Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHODS OF TREATING CANCER USING AND AGENT THAT MODULATES ACTIVITY OF THE CALCITONIN-GENE RELATED PEPTIDE ("CGRP") RECEPTOR
Document Type and Number:
WIPO Patent Application WO/2010/006168
Kind Code:
A2
Abstract:
The present invention is directed to methods of treating cancer and preventing cancer metastasis in a subject by administering a modulator of CGRP receptor signaling. The present invention is further directed to methods of identifying novel compounds that inhibit CGRP receptor signaling.

Inventors:
DICKERSON, Ian, M. (10 Babcock Farms Lane, Pittsford, NY, 14534, US)
BROWN, Edward, B. (380 Quaker Meeting House Road, Honeoye Falls, NY, 14472, US)
Application Number:
US2009/050103
Publication Date:
January 14, 2010
Filing Date:
July 09, 2009
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIVERSITY OF ROCHESTER (601 Elmwood Avenue, Box OttRochester, NY, 14642, US)
DICKERSON, Ian, M. (10 Babcock Farms Lane, Pittsford, NY, 14534, US)
BROWN, Edward, B. (380 Quaker Meeting House Road, Honeoye Falls, NY, 14472, US)
International Classes:
A61K39/395; A61K39/395
Attorney, Agent or Firm:
MERKEL, Edwin, V. (Nixon Peabody Llp - Patent Group, 1100 Clinton SquareRochester, NY, 14604-1792, US)
Download PDF:
Claims:
WHAT IS CLAIMED:

1. A method of treating cancer comprising: administering to a patient having cancer an effective amount of an agent that modulates activity of calcitonin-gene related peptide ("CGRP") receptor, wherein said administering is effective to treat the cancer.

2. The method according to claim 1, wherein the cancer is characterized by the presence of a CGRP receptor on the cancer cells.

3. The method according to claim 2, wherein the cancer is a primary tumor.

4. The method according to claim 3, wherein primary tumor cells exist under normoxic conditions.

5. The method according to claim 3, wherein primary tumor cells exist under hypoxic conditions.

6. The method according to claim 2, wherein the cancer is a secondary tumor.

7. The method according to claim 6, wherein secondary tumor cells exist under hypoxic conditions.

8. The method according to claim 6, wherein secondary tumor cells exist under normoxic conditions.

9. The method according to claim 2, wherein the cancer is metastatic, or has the potential to become metastatic.

10. The method according to claim 1, wherein the cancer is selected from breast, ovarian, prostate, liver, lung, colon, stomach, esophageal, glioma, or melanoma.

11. The method according to claim 1 , wherein said administering is carried out orally, topically, transdermally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, by intranasal instillation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, or by application to mucous membranes.

12. The method according to claim 1, wherein the agent that modulates activity of CGRP receptor is selected from the group consisting of a calcitonin-gene related peptide ("CGRP") antagonist, a calcitonin-like receptor ("CLR") inhibitor, a receptor activity modifying protein 1 ("RAMPl") inhibitor, and a receptor component protein ("RCP") inhibitor.

13. The method according to claim 1, wherein the agent that modulates activity of CGRP receptor is selected from the group consisting of an antibody or fragment thereof or antibody mimic that binds specifically to calcitonin-like receptor ("CLR"), an antibody or fragment thereof or antibody mimic that binds specifically to receptor activity modifying protein 1 ("RAMPl"), an antibody or fragment thereof or antibody mimic that binds specifically to receptor component protein ("RCP"), an antibody or fragment thereof or antibody mimic that binds specifically to CGRP, a RAMPl soluble protein or partial protein, a CLR soluble protein or partial protein, an antisense nucleic acid that disrupts expression of RAMPl, an antisense nucleic acid that disrupts expression of CLR, or an antisense nucleic acid that disrupts expression of RCP.

14. The method according to claim 1, wherein the agent is administered at a dosage rate of about 0.01 to about 10 mg/kg-body weight.

15. The method according to claim 1, wherein said administering is repeated periodically.

16. The method according to claim 1, wherein said administering is carried out in combination with another cancer therapy.

17. The method according to claim 16, wherein the other cancer therapy comprises a chemotherapeutic, radiation, an anti-angiogenic factor, or an immune-enhancing agent.

18. A method of modifying survival of a cancerous cell comprising: contacting a cancer cell with an agent that modulates activity of calcitonin-gene related peptide ("CGRP") receptor, wherein said contacting is effective to modulate CGRP receptor activity and either kill or inhibit growth of the cancer cell.

19. The method according to claim 18, wherein the cancer is selected from breast, ovarian, prostate, liver, lung, colon, stomach, esophageal, glioma, or melanoma.

20. The method according to claim 18, wherein said contacting is carried out in vitro.

21. The method according to claim 18, wherein said contacting is carried out in vivo.

22. The method according to claim 18, wherein the agent that modulates activity of CGRP receptor is selected from the group consisting of a calcitonin-gene related peptide ("CGRP") antagonist, a calcitonin-like receptor ("CLR") inhibitor, a receptor activity modifying protein 1 ("RAMPl") inhibitor, and a receptor component protein ("RCP") inhibitor.

23. The method according to claim 18, wherein the agent that modulates activity of CGRP receptor is selected from the group consisting of, an antibody or fragment thereof or antibody mimic that binds specifically to calcitonin-like receptor ("CLR"), an antibody or fragment thereof or antibody mimic that binds specifically to receptor activity modifying protein 1 ("RAMPl"), an antibody or fragment thereof or antibody mimic that binds specifically to receptor component protein ("RCP"), an antibody or fragment thereof or antibody mimic that binds specifically to CGRP, a RAMPl soluble protein or partial protein, a CLR soluble protein or partial protein, an antisense nucleic acid that disrupts expression of RAMPl, an antisense nucleic acid that disrupts expression of CLR, or an antisense nucleic acid that disrupts expression of RCP.

24. A method of preventing establishment of a cancerous metastasis comprising: contacting a cancer cell with an agent that modulates activity of calcitonin-gene related peptide ("CGRP") receptor, wherein said contacting is effective to prevent its establishment of a cancerous metastasis.

25. The method according to claim 24, wherein the cancer is selected from breast, ovarian, prostate, liver, lung, colon, stomach, esophageal, glioma, or melanoma.

26. The method according to claim 24, wherein the agent that modulates activity of CGRP receptor is selected from the group consisting of a calcitonin-gene related peptide ("CGRP") antagonist, a calcitonin-like receptor ("CLR") inhibitor, a receptor activity modifying protein 1 ("RAMPl") inhibitor, and a receptor component protein ("RCP") inhibitor.

27. The method according to claim 24, wherein the agent that modulates activity of CGRP receptor is selected from the group of a CGRP antagonist, an antibody or fragment thereof or antibody mimic that binds specifically to calcitonin-like receptor ("CLR"), an antibody or fragment thereof or antibody mimic that binds specifically to receptor activity modifying protein 1 ("RAMPl"), an antibody or fragment thereof or antibody mimic that binds specifically to receptor component protein ("RCP"), an antibody or fragment thereof or antibody mimic that binds specifically to CGRP, a RAMPl soluble protein or partial protein, a CLR soluble protein or partial protein, an antisense nucleic acid that disrupts expression of RAMPl, an antisense nucleic acid that disrupts expression of CLR, or an antisense nucleic acid that disrupts expression of RCP.

28. The method according to claim 24, wherein said contacting is carried out by administering the agent to a patient having at least one primary tumor.

29. A non-human mammal comprising tumor cells introduced into the mammal, wherein the tumor cells express CGRP receptor and comprise a transgene expressing a fluorescent marker protein.

30. The non-human mammal according to claim 29, wherein the mammal is a rodent.

31. The non-human mammal according to claim 29, wherein the tumor cells are derived from human tumors.

32. The non-human mammal according to claim 29, wherein the tumor cells further comprise a transgene that expresses a dominant-negative regulator of CGRP receptor function.

33. The non-human mammal according to claim 29, wherein the dominant-negative regulator of CGRP receptor function is inducible.

34. The non-human mammal according to claim 29, wherein the dominant-negative regulator of CGRP receptor function is a fusion protein comprising a second cytoplasmic domain of calcitonin-like receptor ("CLR") fused to a fluorescent protein.

35. A transgenic cell line comprising a transgene that expresses a dominant-negative regulator of CGRP receptor function.

36. The transgenic cell line according to claim 35, wherein the dominant-negative regulator of CGRP receptor function is inducible.

37. The transgenic cell line according to claim 35, wherein the dominant-negative regulator of CGRP receptor function is a fusion protein comprising a cytoplasmic domain of calcitonin-like receptor ("CLR") fused to a fluorescent protein.

38. The transgenic cell line according to claim 35, wherein the cell is of human origin.

39. The transgenic cell line according to claim 35, wherein the cell is derived from a human breast cancer cell line.

40. The transgenic cell line according to claim 35, wherein the tumor cell is derived from a brain metastasizing human breast cancer cell line.

41. The transgenic cell line according to claim 35, wherein the tumor cell is derived from a rat glioma line.

42. A method of screening compounds for inhibition of calcitonin- gene related peptide ("CGRP") receptor function, the method comprising: contacting a eukaryotic cell that expresses the CGRP receptor with a test agent; and determining the effect, if any, of the test agent on CGRP receptor function, or the effect on protein-protein interactions between CLR and RAMPl, CLR and RCP, and RAMPl and RCP.

43. The method according to claim 42, wherein the eukaryotic cell is an NIH3T3 cell.

44. The method according to claim 42, wherein the level of cAMP production is determined using a biochemical assay.

45. The method according to claim 42, wherein protein-protein interactions between CLR and RCP, CLR and RAMP, or RAMP and RCP are analyzed via co-immunoprecipitation.

46. The method according to claim 42, wherein protein-protein interactions between CLR and RCP, CLR and RAMP, or RAMP and RCP are analyzed via fluorescence resonance energy transfer (FRET), bioluminescence resonance energy transfer (BRET), or polarized FRET (pFRET).

47. The method according to claim 42, wherein CGRP receptor function is measured via interaction of receptor component protein ("RCP") with calcitonin-like receptor ("CLR").

48. The method according to claim 42, wherein the cell is a yeast cell, and wherein said determining is by a yeast two-hybrid method.

49. The method according to claim 48, wherein the yeast cell expresses a first transgene that encodes a fusion protein that includes CLR or a fragment thereof fused to a prey polypeptide, and a second transgene that includes RCP or a fragment thereof fused to a bait polypeptide.

50. The method according to claim 48, wherein the yeast cell expresses a first transgene that encodes a fusion protein that includes RCP or a fragment thereof fused to a prey polypeptide, and a second transgene that includes CLR or a fragment thereof fused to a bait polypeptide.

51. The method according to claim 49 or 50, wherein the yeast cell comprises a reporter gene that is expressed only upon binding of RCP or the fragment thereof with CLR or the fragment thereof, and the absence of reporter gene expression indicates that the test agent inhibits CGRP receptor function.

Description:
METHODS OF TREATING CANCER USING

AN AGENT THAT MODULATES ACTIVITY OF THE

CALCITONIN-GENE RELATED PEPTIDE ("CGRP") RECEPTOR

[0001] This application claims the priority benefit of U.S. Provisional Patent Application Serial No. 61/079,204, filed July 9, 2008, which is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0002] The present invention is directed to methods of treating cancer and preventing cancer metastasis by modulating calcitonin-gene related peptide (CGRP) receptor signaling. Methods of identifying compounds that modulate CGRP receptor signaling are also disclosed.

BACKGROUND OF THE INVENTION

[0003] There are currently -2.5 million breast cancer survivors in the United

States. Breast cancer affects -180,000 new Americans annually, and kills -40,000 patients (Ries, "SEER Cancer Statistics Review 1975-2005" (eds.) (National Cancer Institute, Bethesda, 2008). The primary cause of death is due to metastasis to distant organs, including bone, liver, lungs, and brain. Although great strides have been made in the treatment of primary tumors in breast cancer, the incidence of fatal metastatic events is still very high. In particular, it is estimated that 10-15% of patients have symptomatic brain metastases (Patanaphan et al., "Breast Cancer: Metastatic Patterns and Their

Prognosis," South Med J 81(9):1109-12 (1988); and Tsukada et al., "Central Nervous System Metastasis From Breast Carcinoma Autopsy Study," Cancer 52(12):2349-54 (1983)) and in as many as 30% of patients brain metastases are found on autopsy (Cho et al., "Causes of Death and Metastatic Patterns in Patients With Mammary Cancer. Ten- year Autopsy Study," Am J Clin Pathol 73(2):232-4 (1980); and Lee Y.T., "Breast Carcinoma: Pattern of Metastasis At Autopsy," J Surg Oncol 23(3): 175-80 (1983)). Breast cancer is the second leading cause of CNS metastases (Lee Y. T., "Breast Carcinoma: Pattern of Metastasis At Autopsy," J Surg Oncol 23(3): 175-80 (1983); Kesari et al., "Leptomeningeal Metastases," Neurol Clin 21(l):25-66 (2003); Nussbaum et al., "Brain Metastases. Histology, Multiplicity, Surgery, and Survival," Cancer 78(8):1781-8 (1996); and Zimm et al., "Intracerebral Metastases in Solid-Tumor Patients: Natural History and Results of Treatment," Cancer 48(2):384-94 (1981)), and the clinical prognosis for patients with metastases is poor, with one -year survival rates of 20% (DiStefano et al., "The Natural History of Breast Cancer Patients With Brain Metastases," Cancer 44(5): 1913-8 (1979); and Engel et al., "Determinants and Prognoses of Locoregional and Distant Progression in Breast Cancer," Int J Radiat Oncol Biol Phys 55(5): 1186-95 (2003)).

[0004] Treatment includes corticosteroids, radiation therapy, and surgery (Lin et al., "CNS Metastases in Breast Cancer," J Clin Oncol 22(17):3608-17 (2004)). Recent clinical treatment has focused on developing antagonists for the estrogen receptor, progesterone receptor, and human epidermal growth factor. However, approximately 25% of all patients with breast cancer lack these three receptors and do not respond to standard chemotherapy (Bauer et al., "Descriptive Analysis of Estrogen Receptor (ER)- Negative, Progesterone Receptor (PR)-Negative, and HER2 -Negative Invasive Breast Cancer, the So-Called Triple-Negative Phenotype: A Population-Based Study From the California Cancer Registry," Cancer 109(9): 1721-8 (2007); Carey et al., "The Triple Negative Paradox: Primary Tumor Chemosensitivity of Breast Cancer Subtypes," Clin Cancer Res 13(8):2329-34 (2007); Dent et al., "Triple-Negative Breast Cancer: Clinical Features and Patterns of Recurrence," Clin Cancer Res 13(15):4429-34 (2007); and Haffty et al., "Locoregional Relapse and Distant Metastasis in Conservatively Managed Triple Negative Early-Stage Breast Cancer," J Clin Oncol 24(36):5652-7 (2006)). In addition, treatment with trastuzumab, a monoclonal antibody against the human epidermal growth factor-2 receptor, appears to be effective for combating breast cancer in the periphery but not in the central nervous system, and patients treated with trastuzumab show an increased incidence of brain metastases (Bartsch et al., "Trastuzumab Prolongs Overall Survival in Patients With Brain Metastases From Her2 Positive Breast Cancer," J Neurooncol 85(3):311-7 (2007); and Yau et al., "Incidence, Pattern and Timing of Brain Metastases Among Patients With Advanced Breast Cancer Treated With Trastuzumab," Acta Oncol 45(2):196-201 (2006)). [0005] Additionally, aggressive tumors often exhibit regions of hypoxia (low oxygen concentration), and hypoxic tumor cells are often resistant to chemotherapy and radiation therapy (Batchelder et al., "Oxygen Dependence of the Cytotoxicity of the Enediyne Anti-Tumour Antibiotic Esperamicin Al," Br J Cancer Suppl 27:S52-6 (1996); Brizel et al., "Oxygenation of Head and Neck Cancer: Changes During Radiotherapy and Impact on Treatment Outcome," Radiother Oncol 53(2): 113-7 (1999); Comerford et al., "Hypoxia-Inducible Factor- 1 -Dependent Regulation of the Multidrug Resistance

(MDRl) Gene," Cancer Res 62(12):3387-94 (2002); Nordsmark et al., "Pretreatment Oxygenation Predicts Radiation Response in Advanced Squamous Cell Carcinoma of the Head and Neck," Radiother Oncol 41(1):31-9 (1996); and Teicher et al., "Classification of Antineoplastic Agents by Their Selective Toxicities Toward Oxygenated and Hypoxic Tumor Cells," Cancer Res 41(1):73-81 (1981)). Hypoxia-resistant breast cancer tumor cells show increased proliferation, metastasis and poor prognosis (Gruber et al., "Hypoxia-Inducible Factor 1 Alpha in High-Risk Breast Cancer: An Independent Prognostic Parameter?" Breast Cancer Res 6(3):R191-8 (2004); Schindl et al., "Overexpression of Hypoxia-Inducible Factor lα is Associated With an Unfavorable Prognosis in Lymph Node-Positive Breast Cancer," Clin Cancer Res 8(6): 1831-7 (2002); and Zhong et al., "Overexpression of Hypoxia-Inducible Factor lα in Common Human Cancers and Their Metastases," Cancer Res 59(22):5830-5 (1999)). Consequently, inhibition of breast cancer metastasis, including metastasis to the brain, would affect lives of millions of people per year, and in the process would ease a significant economic burden on them, their families, and their caregivers, as well as society as a whole.

[0006] Malignant glioblastomas are highly aggressive tumors characterized by rapid proliferation, invasiveness, high vascularization, and resistance to apoptosis and thus most chemotherapy and radiotherapy (Schmitt C. A., "Senescence, apoptosis and Therapy-Cutting the Lifelines of Cancer," Nat Rev Cancer 3(4): 286-95 (2003). Patients generally survive less than two years from diagnosis (Curran et al., "Recursive

Partitioning Analysis of Prognostic Factors in Three Radiation Therapy Oncology Group Malignant Glioma Trials," J Natl Cancer Inst 85(9): 704-10 (1993); Curran et al., "Survival Comparison of Radiosurgery-Eligible and -Ineligible Malignant Glioma Patients Treated with Hyperfractionated Radiation Therapy and Carmustine: A Report of Radiation Therapy Oncology Group 83-02," J Clin Oncol 11(5): 857-62 (1993); DeAngelis L.M., "Brain Tumors," N Engl J Med 344(2): 114-23 (2001)). Current treatment combines radiotherapy with temozolomide chemotherapy, which results in approximately a two year survival rate of 26% (Stupp et al., "Radiotherapy Plus Concomitant and Adjuvant Temozolomide for Glioblastoma," N EnglJ Med 352(10): 987-96 (2005)). Recent research has focused on identifying cellular factors that promote growth and angiogenesis of gliomas in the hopes of identifying new targets for pharmacologic intervention, but none have yet shown specificity or efficacy required for therapeutic use (Wong et al., "Targeting Malignant Glioma Survival Signalling To Improve Clinical Outcomes," J CHn Neurosci 14(4): 301-8 (2007); and Omuro et al., "What is New in the Treatment of Gliomas?" Curr Opin Neurol 20(6): 704-7 (2007)). [0007] It would be desirable to identify a new target for the treatment of breast cancer malignancies, particularly those that create secondary tumors at sites such as the brain, as well as gliomas. Likewise, identifying compounds that can be used to modulate this target are desirable for the treatment of existing breast cancer tumors and/or gliomas, and the prevention of secondary tumor formation resulting therefrom. Finally, it would be of significant benefit to develop a screening assay that can be used to identify additional compounds that can be used to treat existing breast cancer, gliomas, or secondary tumors resulting therefrom.

[0008] The present invention is directed to overcoming these and other deficiencies in the art. SUMMARY OF THE INVENTION

[0009] A first aspect of the present invention relates to a method of treating cancer that includes administering to a patient having cancer an effective amount of an agent that modulates activity of calcitonin-gene related peptide ("CGRP") receptor, wherein said administering is effective to treat the cancer. [0010] A second aspect of the present invention relates to a method of modifying survival of a cancerous cell that includes contacting a cancer cell with an agent that modulates activity of the CGRP receptor, wherein said contacting is effective to modulate CGRP receptor activity and either kill or inhibit growth of the cancer cell. [0011] A third aspect of the present invention relates to a method of preventing establishment of a cancerous metastasis that includes contacting a cancer cell with an agent that modulates activity of the CGRP receptor, wherein said contacting is effective to prevent establishment of a cancerous metastasis by the cancer cell. [0012] A fourth aspect of the present invention relates to a non-human mammal that includes tumor cells introduced into the mammal, wherein the tumor cells express the CGRP receptor and include a transgene expressing a fluorescent marker protein.

[0013] A fifth aspect of the present invention relates to a transgenic cell line that includes a transgene that expresses a dominant-negative regulator of CGRP receptor function. Preferably, the dominant-negative regulator of CGRP receptor function is under control of an inducible promoter. [0014] A sixth aspect of the present invention relates to a method of screening compounds for inhibition of CGRP receptor function. This method includes the steps of contacting a eukaryotic cell that expresses the CGRP receptor with a test agent; and determining the effect, if any, of the test agent on CGRP receptor function, or the effect on protein-protein interactions between calcitonin-like receptor ("CLR") and receptor activity modifying protein type 1 ("RAMPl"), CLR and receptor component protein ("RCP"), or RAMPl and RCP.

[0015] The present invention relates to the identification of the CGRP receptor

(and its component protein subunits) as a novel target for cancer, particularly breast cancer, and malignant secondary tumors resulting therefrom. The examples of the present application identify RAMPl as the component of the CGRP receptor that is differentially upregulated in MDA-MB-231BR cells under hypoxic conditions, and that these same cells proliferate under conditions of hypoxia and CGRP receptor stimulation whereas MDA-MB-231 cells do not. Rat CNS 1 glioma cells were also shown to proliferate in the presence of CGRP receptor stimulation. These data explain why some breast cancers metastasize to the brain and proliferate, while others do not. The examples also identify the second cytoplasmic domain of CLR as a drug target, because a peptide fragment comprising this second cytoplasmic loop constitutes a dominant-negative regulator that inhibits CGRP signaling and proliferation of cancer cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 is a model of the Calcitonin Gene-Related Peptide Receptor

(CGRPC) showing the transmembrance components RAMP (Receptor Activity Modifying Protein) and CLR (Calcitonin-Like Receptor), as well as the intracellular protein RCP (CGRP-Receptor Component Protein).

[0017] Figure 2 shows western blot results of RCP, CLR, and RAMPl protein expression in MDA-MB-231 and MDA-MB-231BR cells under normoxic ("norm") and hypoxic ("hypo") conditions. RAMPl (~38kDa) expression is differentially regulated in MDA-MB231 cells compared to MDA-MB-231BR cells (right panel). CLR (~55kDa) expression is downregulated by hypoxia in both cell types (middle panel), while RCP (~55kDa, but appearing as its typical -300 kDa molecular weight multimer (Prado et al., "The Role of the CGRP-Receptor Component Protein (RCP) in Adrenomedullin Receptor Signal Transduction," Peptides 22:1773-81 (2001), which is hereby incorporated by reference in its entirety)) expression is upregulated by hypoxia in both cells (left panel).

[0018] Figure 3 is a graph showing MDA-MB-231 and MDA-MB-23 IBR cell proliferation under hypoxic ("hypo") and normoxic ("norm") conditions when treated with CGRP. Under hypoxic conditions, 23 IBR cell proliferation is enhanced by CGRP exposure while 231 cell proliferation is unaffected. Under normoxic conditions, neither cell line is affected by CGRP exposure. Data normalized for growth by dividing the level of growth observed in the presence of CGRP by the level of growth observed in parallel wells grown in the absence of CGRP.

[0019] Figure 4 is a graph showing the interaction between RCP and cpd2 CLR .

NIH3T3 cells were transfected with RCP-cerulean and cpd2 CLR fusion proteins and the interaction was detected by a loss in anisotropy using the method of polarized fluorescence resonance energy transfer (pFRET). NIH3T3 cells transfected with a FRET8 plasmid, in which cerulean and venus fluorophores are separated by 8 amino acids, were used as a positive control and cells co-transfected with cerulean and venus constructs that do not interact were used as negative controls. [0020] Figure 5 is a graph showing inhibition of CLR signaling in NIH3T3 cells transfected with cpd2 CLR plasmid expressing the second cytoplasmic domain of CLR. Data represents experiments conducted in three independent stable cell lines. Non- transfected NIH3T3 cells are shown as a control.

[0021] Figure 6 is a series of western blots showing CLR (left), RAMPl (middle), and RCP (right) expression in NIH3T3 and CNSl glioma cells. [0022] Figure 7 shows CNSl basal proliferation ("control") and enhanced proliferation observed with growth in media containing CGRP and adrenomedullin (AM).

CNSl glioma cells were incubated in 10OnM AM or CGRP and grown for seven days.

[0023] Figure 8 is a fluorescent photomicrograph visualizing the metastasis of

MDA-MB23 lBR/GFP-labeled cells to the brain following intracardiac injection. MDA- MB-23 IBR cells were stably transfected with GFP, and geneticin-resistant colonies were isolated and characterized. Fluorescent breast cancer cells were then injected intracardially and formed a brain metastasis within 21 -days post injection.

[0024] Figure 9 is a fluorescent photomicrograph of glioma cells visualized with multi-photon laser-scanning microscropy (MPLSM) in live animals. U87 glioma cells expressing GFP were implanted into cranial window and imaged 14-days later.

Vasculature is also imaged by injection of tetramethylrhodamine dextran in tail vein.

DETAILED DESCRIPTION OF THE INVETION [0025] The present invention relates to a method of treating cancer, modifying survival of cancer cells, and, importantly, preventing establishment of a cancerous metastasis (i.e., a secondary tumor). As used herein, the treatment of cancer includes, without limitation, slowing tumor growth, halting tumor growth, reversing tumor growth, eliminating a tumor, inhibiting angiogenesis within a tumor, inhibiting lymphangio genesis within a tumor, preventing metastasis, and/or enhancing immune response against a tumor.

[0026] The types of cancer to be treated in accordance with the present invention are those cancers that are characterized by cancer cell expression of the CGRP receptor or any one of the CGRP receptor proteins. In particular, those cancers that may proliferate in response to CGRP, induce angiogenesis in response to CGRP, induce lymphangio genesis in response to CGRP, establish metastases in response to CGRP, and/or suppress immune cells in response to CGRP, are intended to be treated in accordance with the present invention. Exemplary cancers include, without limitation, breast, ovarian, prostate, liver, lung, colon, stomach, esophageal, glioma, and melanoma. [0027] As identified in the examples, applicants have identified a surprising role of CGRP in two different situations, which are relevant to growth of a primary tumor as well as to establishment of metastases. Under normoxic conditions, CGRP is capable of stimulating cell replication and growth in cancer cells, demonstrating that it is relevant to the growth of a primary tumor. Under hypoxic conditions, CGRP is capable of stimulating cell replication and growth in a metastatic variant of a cancer cell line while it does not do so in a less metastatic variant. This demonstrates that CGRP signaling is relevant to the seeding and growth of metastatic, i.e., secondary, tumors.

[0028] Thus, the use of agents that modulate CGRP activity can be used to treat primary tumors as well as secondary tumors, where the tumor cells exist under normoxic or hypoxic conditions. Furthermore, for metastatic cancer cells that are in circulation and await implantation to form a secondary tumor, such agents can be used to prevent the implantation of those metastatic cells.

[0029] These methods are carried out through the use of an agent that modulates the activity of the CGRP receptor, including the prevention of CGRP from activating the receptor as well as agents that modify receptor function. [0030] The CGRP receptor includes three components: calcitonin- like receptor ("CLR"), which is a G-protein coupled receptor; receptor activity modifying protein type 1 ("RAMPl"), which confers pharmacological specificity to the CGRP receptor; and the receptor component protein ("RCP"), which couples the CLR/RAMPl complex to intracellular signaling pathways. Thus, agents that modulates the activity of the CGRP receptor can interfere with the interaction between any of these three components of the receptor, or between CGRP and the receptor.

[0031] Exemplary agents that modulate the CGRP receptor include, without limitation, a CGRP antagonist, a calcitonin-like receptor ("CLR") inhibitor, a receptor activity modifying protein 1 ("RAMPl") inhibitor, and a receptor component protein ("RCP") inhibitor. More specifically the CGRP receptor can be modulated using an antibody or fragment thereof or antibody mimic that binds specifically to CLR, an antibody or fragment thereof or antibody mimic that binds specifically to RAMPl, an antibody or fragment thereof or antibody mimic that binds specifically to RCP, an antibody or fragment thereof or antibody mimic that binds specifically to CGRP, a RAMPl soluble protein or partial protein, a CLR soluble protein or partial protein, an antisense nucleic acid that disrupts expression of RAMPl, an antisense nucleic acid that disrupts expression of CLR, or an antisense nucleic acid that disrupts expression of RCP. [0032] As used herein, the term "CGRP antagonist" means any agent that interferes with CGRP binding and/or activation of the CGRP receptor. [0033] Exemplary CGRP antagonists include small molecule therapeutics that bind to CGRP, interfere with CGRP binding to its receptor, or block receptor activity. These include, without limitation, those described in PCT International Patent

Application Nos. PCT/EP03/11762 to Rudolf et al, PCT/EP03/11763 to Rudolf et al, PCT/EP2004/000087 to Bauer et al., PCT/EP2005/003094 to Mueller et al., PCT/US03/16576 to Chaturvedula et al., PCT/US2004/040721 to Luo et al., PCT/US2003/038799 to Degnan et al., PCT/US2005/010330 to Degnan et al., PCT/GB99/03154 to Hill et al., PCT/US2004/007226 to Bell et al., PCT/US2004/007289 to Bell et al., PCT/US2004/007686 to Bell et al., PCT/US2004/007678 to Bell et al., PCT/US2004/007715 to Bell et al., PCT/US2004/011254 to Burgey et al., PCT/US2004/010851 to Burgey et al., PCT/US2004/011280 to Burgey et al., PCT/US2004/020206 to Burgey et al., PCT/US2004/021888 to Bell et al., PCT/US2004/020209 to Burgey et al., PCT/US2005/002199 to Burgey et al., PCT/US2005/031713 to Bell et al., PCT/US2005/031617 to Bell et al., PCT/US2005/031712 to Bell et al., PCT/US2005/032036 to Williams et al., PCT/US2005/032041 to Bell et al., PCT/US2005/032288 to Bell et al., PCT/US2005/035654 to Burgey et al., and U.S. Patent Application Publ. Nos. 20080139537 to Doods et al., 20080139591 to Doods et al., 20080125413 to Burgey et al. 20080113966 to Burgey et al., 20080096878 to Bell et al., 20080090806 to Paone et al., 20080070899 to Burgey et al., 20080004304 to Bell et al., 20080004261 to Gutierrez et al., 20070293470 to Williams et al., 20070287697 to Paone et al., 20070287696 to Burgey et al., 20070265225 to Wood et al., 2007/0259850 to Mercer et al., 20070225272 to Burgey et al., 20070149503 to Chaturvedula et al., 20070149502 to Chaturvedula et al., 20070111982 to Bell et al., 20070049577 to Han et al., 20060211712 to Bell et al., 20060194783 to Burgey et al, 20060189600 to Bell et al, 20060189593 to Bell et al, 20060183700 to Vater et al., 20060173046 to Bell et al., 20060148790 to Burgey et al., 20060148779 to Bell et al., 20060135511 to Burgey et al., 2006/0094707 to Chaturvedula et al., 20050256098 to Burgey et al., 20050215576 to Degnan et al., 20040229861 to Burgey et al., 20040204397 to Chaturvedula et al., and 20040063735 to Chaturvedula et al., each of which is hereby incorporated by reference in its entirety. Pharmaceutical compositions suitable for administering such agents are also disclosed therein. [0034] There are presently two commercially available CGRP antagonists:

BIBN4096BS (Boehringer Ingelheim), which is also known as olcegepant or N-((lR)-2- (((1 S)-5 -amino- 1 -((4-(pyridin-4-yl)piperazin- 1 -yl)carbonyl)pentyl)amino)- 1 -(3 ,5 - dibromo-4-hydroxybenzyl)-2-oxoethyl)-4-(2-oxo-l,4-dihydroqui nazolin-3(2H)- yl)piperidine-l-carboxamide (Edvinsson, "Clinical Data on the CGRP Antagonist BIBN4096Bs for Treatment of Migraine Attacks," CNS Drug Rev. l l(l):69-76 (2005), which is hereby incorporated by reference in its entirety); and MK-0974 (Merck), which is also known as telcagepant or N-((3R,6S)-6-(2,3-Difluorophenyl)-2-oxo-l-(2,2,2- trifluoroethyl)hexahydro-lH-azepin-3-yl)-4-(2-oxo-2,3-dihydr o-lH-imidazo(4,5- b)pyridin-l-yl)piperidine-l-carboxamide (Salvatore et al., "Pharmacological Characterization of MK-0974, a Potent and Orally Active CGRP Receptor Antagonist for the Treatment of Migraine," J. Pharmacol. Exp. Ther. 324(2) :416-21 (2007), which is hereby incorporated by reference in its entirety). Both of these drugs are currently in stage III clinical trials for treatment of migraine.

[0035] A number of other CGRP antagonists are also known in the art. By way of example, suitable hydroxypyridine carboxamide CGRP antagonists include, without limitation, 4-bromo-N-(3, 5 -difluorobenzyl)-6-( 1,1 -dioxido- l,2-thiazinan-2-yl)-3- hydroxypyridine-2-carboxamide; 4-bromo-N-(3 -fluorobenzyl)-6-( 1 , 1 -dioxido- 1,2- thiazinan-2-yl)-3-hydroxypyridine-2-carboxamide; 4-bromo-N-(£-butyl-acetate)-6-(l , 1 - dioxido- 1 ,2-thiazinan-2-yl)-3 -hydroxypyridine-2-carboxamide; 4-bromo-N- ((cyclobutylcarbamoyl) methyl)-6-(l , 1 -dioxido- 1 ,2-thiazinan-2-yl)-3 -hydroxypyridine -2- carboxamide; 4-bromo-N-((cyclohexylcarbamoyl)methyl)-6-( 1 , 1 -dioxido- 1 ,2-thiazinan- 2-yl)-3-hydroxypyridine-2-carboxamide; 4-bromo-N-((adamantylcarbamoyl)methyl)-6- (1,1 -dioxido- 1 ,2-thiazinan-2-yl)-3 -hydroxypyridine-2-carboxamide; 4-bromo-N-((m- diphenylcarbamoyl)methyl)-6-( 1 , 1 -dioxido- 1 ,2-thiazinan-2-yl)-3 -hydroxypyridine-2- carboxamide; N-(3 ,5 -difluorobenzyl)-6-( 1 , 1 -dioxido- 1 ,2-thiazinan-2-yl)-8- hydroxynaphtyridine-7-carboxamide; N-(3-iodobenzyl)-6-( 1 , 1 -dioxido- 1 ,2-thiazinan-2- yl)-8-hydroxynaphtyridine-7-carboxamide; N-(3 ,5 -dichlorobenzyl)-6-( 1 , 1 -dioxido- 1,2- thiazinan-2-yl)-8-hydroxynaphtyridine-7-carboxamide; methyl 2- {[3,5- difluorobenzyl)amino]carbonyl} -6-(l , 1 -dioxido- 1 , 2-thiazinan-2-yl)-3 - hydroxyisonicotinate; and methyl 2-({[>butoxycarbonyl)methyl] amino }carbonyl)-6-( 1,1- dioxido- 1 ,2-thiazinan-2-yl)-3 -hydroxyisonicotinate. [0036] By way of example, suitable oxepino[3,4-e]indazol-8-one and azepino[3,4-e]indazol-8-one CGRP antagonists include, without limitation, (S)-4-bromo- 7-(2-oxo-2-(4-(2-oxo-l,2-dihydroquinolin-3-yl)piperidin-l-yl )ethyl)-6,7-dihydro-3H- oxepino[3,4-e]indazol-8(10H)-one; (S)-l,4-dibromo-7-(2-oxo-2-(4-(2-oxo-l,2- dihydroquinolin-3-yl)piperidin- 1 -yl)ethyl)-9-(2,2,2-trifluoroethyl)-6,7,9, 10- tetrahydroazepino[3,4-e]indazol-8(3H)-one; and (S)-l,4-dibromo-7-(2-(4-(8-fluoro-2- oxo- 1 ,2-dihydroquinolin-3-yl)piperidin- 1 -yl)-2-oxoethyl)-9-(2,2,2-trifluoroethyl)- 6,7,9, 10-tetrahydroazepino[3,4-e]indazol-8(3H)-one.

[0037] By way of example, suitable azepine CGRP antagonists include, without limitation, N-[(3R,7R)-l-(cyclopropylmethyl)-2-oxo-7-phenylazepan-3-yl]- 4-(2-oxo-l, 4-dihydroquinazolin-3 (2H)-yl) piperidine-1-carboxamide; tert-butyl [(3R,7R)-2-oxo-3- ( { [4-(2-oxo- 1 ,4-dihydroquinazolin-3 (2H)-yl)piperidin- 1 -yllcarbonyl} amino)-7- phenylazepan-1-yl acetate; tert-butyi [(3R,7R)-2-oxo-3-({[4-(2-oxo-l,2,4,5-tetrahydro- 3H- 1 ,3-benzodiazepin-3-yl)piperidin-l -yllcarbonyl} amino)-7-phenylazepan- 1 -yljacetate; N-R (3R, 6S)- 1 -(cyclopropylmethyl)-2-oxo-6-phenylazepan-3-yl]-4-(2-oxo- 1 ,4- dihydroquinazolin-3(2H)-yl) piperidine-1-carboxamide; N-R (3 S, 6R)-I- (cyclopropylmethyl)-2-oxo-6-phenylazepan-3-yl]-4-(2-oxo-l,4- dihydroquinazolin-3(2H)- yl) piperidine- 1 -carboxamide; cis-N- 1 -(cyclopropylmethyl)-2-oxo-6-phenylazepan-3-yl]- 4-(2-oxo- 1 ,4-dihydroquinazolin-3(2H)-yl) piperidine- 1 -carboxamide; N-R(3R,6S)- 1 - (cyclopropylmethyl)-2-oxo-6-phenylazepan-3-yll-4-(2-oxo-l, 2, 4, 5-tetrahydro-3H-13- benzodiazepin-3-yl) piperidine-1-carboxamide; 4-(4-chloro-2-oxo-2, 3-dihydro-lH- benzimidazol- 1 -yl)-N-f (3R, 6S)-l-(2-methoxyethyl)-2-oxo-6-phenylazepan-3- yllpiperidine-1-carboxamide; N-f (3R, 6S)-l-(2-methoxyethyl)-2-oxo-6-phenylazepan-3- yll-4-(4-methyl-2-oxo-2, 3-dihydro-lH-benzimidazol-l-yl) piperidine-1-carboxamide; N- r (2S,6R)-4-(cyclopropylmethyl)-5-oxo-2-phenyl-14-oxazepan-6-y ll-4-(2-oxo-l, 2, 4, 5- tetrahydro-3H-l, 3-benzodiazepin-3-yl) piperidine-1-carboxamide; N-(2S, 6R)-4- (cyclopropylmethyl)-5-oxo-2 -phenyl- 1, 4-oxazepan-6-yll-4-(2-oxo-2,3-dihydro-lH- benzimidazol- 1 -yl) piperidine- 1 -carboxamide; N-r (2S, 6R)-4-(cyclopropylmethyl)-5- oxo-2-phenyl- 1 , 4-oxazepan-6-yll-4-(6-fluoro-2-oxo-2,3-dihydro-lH-benzimidaz ol- 1 -yl) piperidine-1-carboxamide; N-f (2S*6R)-4-(cyclopropylmethyl)-5-oxo-2-phenyl-l,4- oxazepan-6-yll-4-(2-oxo-l,2-dihydroquinolin-3-yl) piperidine-1-carboxamide; N-r (2S, 6R and 2R, 6S)-4-(cyclopropylmethyl)-5-oxo-2 -phenyl- 1 ,4-oxazepan-6-yll-4-(2-oxo- 1,4- dihydroquinazolin-3(2H)-yl) piperidine- 1 -carboxamide; 19-(2R, 6S and 2R, 6R)-4- (cyclopropylmethyl)-5 -oxo-2 -phenyl- 1 ,4-oxazepan-6-yll-4-(2-oxo- 1,4- dihydroquinazolin-3(2H)-yl) piperidine-1-carboxamide; cis N-r (3S, 6S and 3R, 6R)-I- (cyclopropylmethyl)-7-oxo-3-phenyl-l,4-diazepan-6-yll-4-(2-o xo-l,4-dihydroquinazolin- 3 (2H)-yl) piperidine-1-carboxamide; N-[(3R)-l-(cyclopropylmethyl)-2-oxoazepan-3-yll- 4-(2-oxo-l,4-dihydroquinazolin-3 (2H)-yl) piperidine-1-carboxamide; N-r (3R)-l-benzyl- 2-oxoazepan-3-yll-4-(2-oxo- 1 ,4-dihydroquinazolin-3(2H)-yl) piperidine-1-carboxamide; N- (l-benzyl-2-oxoazepan-3-yl)-4- (2-oxo-l, 2, 4,5-tetrahydro-3H-l, 3-benzodiazepin-3- yl) piperidine- 1 -carboxamide; N-f (3R)- 1 -(4-hydroxybenzyl)-2-oxoazepan-3-yll-4-(2- oxo- 1 ,4-dihydroquinazolin-3(2H)-yl) piperidine-1-carboxamide; N-f (3R)- 1 -(3- methoxybenzyl)-2-oxoazepan-3-yll-4-(2-oxo- 1 ,4-dihydroquinazolin-3(2H)-yl) piperidine-1-carboxamide; N-r (3R)-l-(3-Hydroxybenzyl)-2-oxoazepan-3-yll-4-(2-oxo-l 4-dihydroquinazolin-3(2H)-yl) piperidine-1-carboxamide; N-[ 1 -benzyl-3-(4- hydroxybenzyl)-2-oxoazepan-3-yl]-4-(2-oxo- 1 ,4-dihydroquinazolin-3(2H)-yl) piperidine- 1-carboxamide; and N-[3- (4-methoxybenzyl)-2-oxoazepan-3-yll-4-(2-oxo-2,3-dihydro- lH-benzimidazol-1-yl) piperidine-1-carboxamide.

[0038] Peptide CGRP receptor antagonists are also disclosed in U.S. Patent

Application Publ. No. 20020068814 to Smith et al, and U.S. Patent Application Publ. No. 20080020978 to Gegg et al., each of which is hereby incorporated by reference in its entirety. One exemplary peptide CGRP antagonist is CGRP8-37, which consists of residues 8-37 of SEQ ID NO: 2 below (Chiba et al., "Calcitonin Gene-Related Peptide Receptor Antagonist Human CGRP(8-37)," Am J Physiol 256(2 Pt 1):E331-35 (1989), which is hereby incorporated by reference in its entirety).

[0039] Antibodies or fragments thereof, which specifically bind to any one of

CGRP, CLR, RAMPl, RCP, or the CGRP receptor as a whole can also be used. The antibodies may be monoclonal or polyclonal, and can include active fragments thereof. The antibodies may be neutralizing antibodies in that they inhibit the activity of the protein(s) to which they bind. Also suitable are blocking antibodies that block the interaction between two proteins of the CGRP receptor thereby preventing CGRP receptor signaling. [0040] Monoclonal antibody production may be effected by techniques which are well-known in the art {Monoclonal Antibodies - Production, Engineering and Clinical Applications, Ritter et al, Eds. Cambridge University Press, Cambridge, UK (1995), which is hereby incorporated by reference in its entirety). Basically, the process involves first obtaining immune cells (lymphocytes) from the spleen of a mammal (e.g., mouse) which has been previously immunized with the antigen of interest (i.e., CGRP, CLR,

RAMPl, or RCP, or fragments thereof containing an epitope of interest) either in vivo or in vitro. The antibody-secreting lymphocytes are then fused with (mouse) myeloma cells or transformed cells, which are capable of replicating indefinitely in cell culture, thereby producing an immortal, immunoglobulin-secreting cell line. The resulting fused cells, or hybridomas, are cultured, and the resulting colonies screened for the production of the desired monoclonal antibodies. Colonies producing such antibodies are cloned, and grown either in vivo or in vitro to produce large quantities of antibody. A description of the theoretical basis and practical methodology of fusing such cells is set forth in Kohler and Milstein, "Continuous Culture of Fused Cell Secreting Antibody of Predefined Specificity," Nature, 256:495 (1975), which is hereby incorporated by reference in its entirety.

[0041] Mammalian lymphocytes are immunized by in vivo immunization of the animal (e.g., a mouse) with the protein or polypeptide of the present invention. Such immunizations are repeated as necessary at intervals of up to several weeks to obtain a sufficient titer of antibodies. Following the last antigen boost, the animals are sacrificed and spleen cells removed. [0042] Fusion with mammalian myeloma cells or other fusion partners capable of replicating indefinitely in cell culture is effected by standard and well-known techniques, for example, by using polyethylene glycol (PEG) or other fusing agents. Milstein and Kohler, "Fusion Between Immunoglobin- Secreting and Nonsecreting Myeloma Cell Lines," Eur. J. Immunol, 6:511 (1976), which is hereby incorporated by reference in its entirety. This immortal cell line, which is preferably murine, but may also be derived from cells of other mammalian species, including without limitation, rats and humans, is selected to be deficient in enzymes necessary for the utilization of certain nutrients, to be capable of rapid growth, and to have good fusion capability. Many such cell lines are known to those skilled in the art, and others are regularly described.

[0043] Procedures for raising polyclonal antibodies are also well known.

Typically, such antibodies can be raised by administering the polypeptide containing the epitope of interest subcutaneously to New Zealand white rabbits which have first been bled to obtain pre-immune serum. The antigens can be injected at a total volume of 100 μl per site at six different sites. Each injected material will contain synthetic surfactant adjuvant pluronic polyols, or pulverized acrylamide gel containing the protein or polypeptide after SDS-polyacrylamide gel electrophoresis. The rabbits are then bled approximately every two weeks after the first injection and periodically boosted with the same antigen three times every six weeks. A sample of serum is then collected 10 days after each boost. Polyclonal antibodies are then recovered from the serum by affinity chromatography using the corresponding antigen to capture the antibody. This and other procedures for raising polyclonal antibodies are disclosed in Harlow et al., Eds., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988), which is hereby incorporated by reference in its entirety. Mono-specific polyclonal antibodies can also be prepared by selecting those polyclonal antibodies that bind to a specific epitope, and antibodies that do not be are removed. [0044] It is also possible to use the anti-idiotype technology to produce monoclonal antibodies that mimic an epitope. As used in this invention, "epitope" means any antigenic determinant on an antigen to which the paratope of an antibody binds. Epitopic determinants usually consist of chemically active surface groupings of molecules, such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. For example, an anti-idiotype monoclonal antibody made to a first monoclonal antibody will have a binding domain in the hypervariable region that is the image of the epitope bound by the first monoclonal antibody. [0045] Also suitable for use in the present invention are antibody fragments engineered to bind to intracellular proteins, i.e., intrabodies. Particularly useful for carrying out the methods of the present invention are intrabodies directed to RCP or to the second cytoplasmic domain of the CLR that will prevent the RCP-CLR interaction, and thereby prevent CGRP receptor signaling. Intrabodies are generally obtained by selecting a single variable domain from variable regions of an antibody having two variable domains (i.e., a heterodimer of a heavy chain variable domain and a light chain variable domain). Single chain Fv fragments, Fab fragments, ScFv-Ck fusion proteins, single chain diabodies, V H -C H I fragments, and even whole IgG molecules are suitable formats for intrabody development (Kontermann R.E., "Intrabodies as Therapeutic Agents," Methods 34: 163-70 (2004), which is here by incorporated by reference in its entirety).

[0046] Intrabodies having antigen specificity for a CGRP receptor protein epitope can be obtained from phage display, yeast surface display, or ribosome surface display. Methods for producing libraries of intrabodies and isolating intrabodies of interest are further described in U.S. Published Patent Application No. 20030104402 to Zauderer and U.S. Published Patent Application No. 20050276800 to Rabbitts, which are hereby incorporated by reference in their entirety. Methods for improving the stability and affinity binding characteristics of intrabodies are described in WO2008070363 to Zhenping; Contreras-Martinez et al., "Intracellular Ribosome Display via SecM Translation Arrest as a Selection for Antibodies with Enhanced Cytosolic Stability," J MoI Biol 372(2):513-24 (2007), which are hereby incorporated by reference in their entirety.

[0047] In addition to whole antibodies, the present invention encompasses binding portions of such antibodies. Such binding portions include Fab fragments, Fab' fragments, F(ab) 2 fragments, F(ab') 2 fragments, Fd fragments, Fv fragments, dAb fragments, complementarity determining regions, single-chain antibodies (i.e., covalently linked variable heavy (V H ) and light (V L ) domains), single-domain antibodies (i.e., monomeric variable domains) (see, e.g., Holt et al., "Domain Antibodies: Proteins for Therapy," Trends in Biotechnology 21 :484-490 (2003), which is hereby incorporated by reference in its entirety), and minibodies, e.g., 61 -residue subdomains of the antibody heavy-chain variable domain (Pessi et al., "A Designed Metal-binding Protein with a Novel Fold," Nature, 362:367-369 (1993), which is hereby incorporated by reference in its entirety).

[0048] These antibody fragments can be made by conventional procedures, such as proteolytic fragmentation procedures, as described in J. Goding, Monoclonal Antibodies: Principles and Practice, (pp. 98-118) Academic Press: New York (1983), and Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (1988), which are hereby incorporated by reference in their entirety, or other methods known in the art. [0049] Exemplary CGRP neutralizing antibodies include those disclosed in PCT/US2006/062272 to Benschop et al., which is hereby incorporated by reference in its entirety. A number of antibodies directed against CGRP (Santa Cruz sc-8857, sc-28920, sc-8856, and sc-34588; Assay Designs (Enzo) anti-human CGRP monoclonal ABS 026- 04-02), RAMPl (Abnova H00010267-M01), CLR (Abnova H00010203-A01), and RCP (Santa Cruz sc-34588; Abnova H00027297-A01) are commercially available. [0050] Additional antibodies can be raised using purified or recombinantly produced proteins as the antigen in the procedures described above. Purified proteins can be obtained using via recombinant expression followed by standard purification procedures.

[0051] CGRP is a 37 amino acid peptide that is derived from the calcitonin- related polypeptide alpha (Genbank Accession Nos. NM_001033952 and

NM 001033953, each of which is hereby incorporated by reference in its entirety). An exemplary nucleotide sequence encoding the CGRP is shown below as SEQ ID NO: 1 :

gcctgtgaca ctgccacctg tgtgactcat cggctggcgg gcttgctgag cagatcaggg 60 ggtgtggtga agaacaactt tgtgcccacc aatgtgggtt ccaaagcctt c 111 Additional nucleotide sequences encoding the CGRP peptide are described in U.S. Patent No. 4,736,023 to Evan et al., which is hereby incorporated by reference in its entirety. [0052] The amino acid sequence of CGRP is shown as SEQ ID NO:2 below:

Ala Cys Asp Thr Ala Thr Cys VaI Thr His Arg Leu Ala GIy Leu Leu 1 5 10 15

Ser Arg Ser GIy GIy VaI VaI Lys Asn Asn Phe VaI Pro Thr Asn VaI 20 25 30 GIy Ser Lys Ala Phe 35

[0053] Additional details concerning CGRP are disclosed at Genbank Accession

1005250A, which is hereby incorporated by reference in its entirety. Homologous CGRP amino acid sequences that are known in the art and can be used to carry out the methods of the present invention include a CGRP amino acid sequence having at least about 65 percent or 70 percent identity to SEQ ID NO: 2, more preferably at least about 75 percent or 80 percent identity to SEQ ID NO: 2, most preferably at least about 85 percent or 90 percent identity to SEQ ID NO: 2. Homo logs having at least about 95 percent identity to SEQ ID NO: 2 are even more preferred.

[0054] Exemplary homo logs of SEQ ID NO: 2 include, without limitation, the human calcitonin-related polypeptide beta, Genbank Accession NP-000719, having 91% sequence identity to the CGRP peptide derived from the human calcitonin-related polypeptide alpha; rat (Rattus norvegicus) CGRP alpha, Genbank Accession AAU07931, having 89% sequence identity to the human CGRP sequence; mouse (Mus musculus) CGRP alpha, Genbank Accession AAK06841, having 89% sequence identity to the human CGRP sequence; sheep (Ovis aries) CGRP alpha, Genbank Accession AAB23468, having 89% identity to the human CGRP sequence; and dog (Canis familiaris) CGRP alpha, Genbank Accession CAB97487, having 91% identity to the human CGRP sequence. Each of the above referenced Genbank Accession entries and corresponding sequences are hereby incorporated by reference in their entirety.

[0055] An exemplary human RAMPl nucleotide sequence is shown below (SEQ

ID NO:3): atggcccggg ccctgtgccg cctcccgcgg cgcggcctct ggctgctcct ggcccatcac 60 ctcttcatga ccactgcctg ccaggaggct aactacggtg ccctcctccg ggagctctgc 120 ctcacccagt tccaggtaga catggaggcc gtcggggaga cgctgtggtg tgactggggc 180 aggaccatca ggagctacag ggagctggcc gactgcacct ggcacatggc ggagaagctg 240 ggctgcttct ggcccaatgc agaggtggac aggttcttcc tggcagtgca tggccgctac 300 ttcaggagct gccccatctc aggcagggcc gtgcgggacc cgcccggcag catcctctac 360 cccttcatcg tggtccccat cacggtgacc ctgctggtga cggcactggt ggtctggcag 420 agcaagcgca ctgagggcat tgtgtag 447

This nucleotide sequence encodes the following RAMPl protein (SEQ ID NO:4).

Met Ala Arg Ala Leu Cys Arg Leu Pro Arg Arg GIy Leu Trp Leu Leu 1 5 10 15

Leu Ala His His Leu Phe Met Thr Thr Ala Cys GIn GIu Ala Asn Tyr 20 25 30

GIy Ala Leu Leu Arg GIu Leu Cys Leu Thr GIn Phe GIn VaI Asp Met 35 40 45 GIu Ala VaI GIy GIu Thr Leu Trp Cys Asp Trp GIy Arg Thr lie Arg 50 55 60

Ser Tyr Arg GIu Leu Ala Asp Cys Thr Trp His Met Ala GIu Lys Leu 65 70 75 80

GIy Cys Phe Trp Pro Asn Ala GIu VaI Asp Arg Phe Phe Leu Ala VaI 85 90 95

His GIy Arg Tyr Phe Arg Ser Cys Pro lie Ser GIy Arg Ala VaI Arg 100 105 110

Asp Pro Pro GIy Ser lie Leu Tyr Pro Phe lie VaI VaI Pro lie Thr 115 120 125 VaI Thr Leu Leu VaI Thr Ala Leu VaI VaI Trp GIn Ser Lys Arg Thr 130 135 140

GIu GIy lie VaI 145

Additional details concerning RAMPl are disclosed at Genbank Accession NM 005855, which is hereby incorporated by reference in its entirety. Homologous RAMPl amino acid sequences that are known in the art and can be used to carry out the methods of the present invention include RAMPl amino acid sequences having at least about 65 percent or 70 percent identity to SEQ ID NO: 4, more preferably at least about 75 percent or 80 percent identity to SEQ ID NO: 4, most preferably at least about 85 percent or 90 percent identity to SEQ ID NO: 4. Homo logs having at least about 95 percent identity to SEQ ID NO: 4 are even more preferred.

[0056] Exemplary homo logs of SEQ ID NO: 4 include, without limitation, chimpanzee {Pan troglodytes) RAMPl, Genbank Accession XP_516183, having 97% sequence identity to the human RAMPl sequence; rat (Rattus norvegicus) RAMPl, Genbank Accession NP_113833, having 71% sequence identity to the human RAMPl sequence; mouse (Mus musculus) RAMPl, Genbank Accession NP_058590, having 70% sequence identity to the human RAMPl sequence; and guinea pig (Cavia Porcellus) RAMPl, Genbank Accession Q8R4C6, having 71% sequence identity to the human RAMPl sequence. Each of the above referenced Genbank Accession entries and corresponding sequences are hereby incorporated by reference in their entirety. [0057] An exemplary human CLR nucleotide sequence is shown below (SEQ ID

NO:5). atggagaaaa agtgtaccct gtattttctg gttctcttgc ctttttttat gattcttgtt 60 acagcagaat tagaagagag tcctgaggac tcaattcagt tgggagttac tagaaataaa 120 atcatgacag ctcaatatga atgttaccaa aagattatgc aagaccccat tcaacaagca 180 gaaggcgttt actgcaacag aacctgggat ggatggctct gctggaacga tgttgcagca 240 ggaactgaat caatgcagct ctgccctgat tactttcagg actttgatcc atcagaaaaa 300 gttacaaaga tctgtgacca agatggaaac tggtttagac atccagcaag caacagaaca 360 tggacaaatt atacccagtg taatgttaac acccacgaga aagtgaagac tgcactaaat 420 ttgttttacc tgaccataat tggacacgga ttgtctattg catcactgct tatctcgctt 480 ggcatattct tttatttcaa gagcctaagt tgccaaagga ttaccttaca caaaaatctg 540 ttcttctcat ttgtttgtaa ctctgttgta acaatcattc acctcactgc agtggccaac 600 aaccaggcct tagtagccac aaatcctgtt agttgcaaag tgtcccagtt cattcatctt 660 tacctgatgg gctgtaatta cttttggatg ctctgtgaag gcatttacct acacacactc 720 attgtggtgg ccgtgtttgc agagaagcaa catttaatgt ggtattattt tcttggctgg 780 ggatttccac tgattcctgc ttgtatacat gccattgcta gaagcttata ttacaatgac 840 aattgctgga tcagttctga tacccatctc ctctacatta tccatggccc aatttgtgct 900 gctttactgg tgaatctttt tttcttgtta aatattgtac gcgttctcat caccaagtta 960 aaagttacac accaagcgga atccaatctg tacatgaaag ctgtgagagc tactcttatc 1020 ttggtgccat tgcttggcat tgaatttgtg ctgattccat ggcgacctga aggaaagatt 1080 gcagaggagg tatatgacta catcatgcac atccttatgc acttccaggg tcttttggtc 1140 tctaccattt tctgcttctt taatggagag gttcaagcaa ttctgagaag aaactggaat 1200 caatacaaaa tccaatttgg aaacagcttt tccaactcag aagctcttcg tagtgcgtct 1260 tacacagtgt caacaatcag tgatggtcca ggttatagtc atgactgtcc tagtgaacac 1320 ttaaatggaa aaagcatcca tgatattgaa aatgttctct taaaaccaga aaatttatat 1380 aattga 1386

This nucleotide sequence encodes the following CLR protein (SEQ ID NO:6).

Met GIu Lys Lys Cys Thr Leu Tyr Phe Leu VaI Leu Leu Pro Phe Phe 1 5 10 15

Met lie Leu VaI Thr Ala GIu Leu GIu GIu Ser Pro GIu Asp Ser lie 20 25 30

GIn Leu GIy VaI Thr Arg Asn Lys lie Met Thr Ala GIn Tyr GIu Cys 35 40 45

Tyr GIn Lys lie Met GIn Asp Pro lie GIn GIn Ala GIu GIy VaI Tyr 50 55 60 Cys Asn Arg Thr Trp Asp GIy Trp Leu Cys Trp Asn Asp VaI Ala Ala 65 70 75 80

GIy Thr GIu Ser Met GIn Leu Cys Pro Asp Tyr Phe GIn Asp Phe Asp 85 90 95

Pro Ser GIu Lys VaI Thr Lys lie Cys Asp GIn Asp GIy Asn Trp Phe 100 105 110

Arg His Pro Ala Ser Asn Arg Thr Trp Thr Asn Tyr Thr GIn Cys Asn 115 120 125

VaI Asn Thr His GIu Lys VaI Lys Thr Ala Leu Asn Leu Phe Tyr Leu 130 135 140 Thr lie lie GIy His GIy Leu Ser lie Ala Ser Leu Leu lie Ser Leu 145 150 155 160

GIy lie Phe Phe Tyr Phe Lys Ser Leu Ser Cys GIn Arg lie Thr Leu 165 170 175

His Lys Asn Leu Phe Phe Ser Phe VaI Cys Asn Ser VaI VaI Thr lie 180 185 190 lie His Leu Thr Ala VaI Ala Asn Asn GIn Ala Leu VaI Ala Thr Asn 195 200 205 Pro VaI Ser Cys Lys VaI Ser GIn Phe lie His Leu Tyr Leu Met GIy 210 215 220

Cys Asn Tyr Phe Trp Met Leu Cys GIu GIy lie Tyr Leu His Thr Leu 225 230 235 240

He VaI VaI Ala VaI Phe Ala GIu Lys GIn His Leu Met Trp Tyr Tyr 245 250 255

Phe Leu GIy Trp GIy Phe Pro Leu He Pro Ala Cys He His Ala He 260 265 270

Ala Arg Ser Leu Tyr Tyr Asn Asp Asn Cys Trp He Ser Ser Asp Thr 275 280 285

His Leu Leu Tyr He He His GIy Pro He Cys Ala Ala Leu Leu VaI 290 295 300

Asn Leu Phe Phe Leu Leu Asn He VaI Arg VaI Leu He Thr Lys Leu 305 310 315 320

Lys VaI Thr His GIn Ala GIu Ser Asn Leu Tyr Met Lys Ala VaI Arg 325 330 335

Ala Thr Leu He Leu VaI Pro Leu Leu GIy He GIu Phe VaI Leu He 340 345 350

Pro Trp Arg Pro GIu GIy Lys He Ala GIu GIu VaI Tyr Asp Tyr He 355 360 365

Met His He Leu Met His Phe GIn GIy Leu Leu VaI Ser Thr He Phe

370 375 380

Cys Phe Phe Asn GIy GIu VaI GIn Ala He Leu Arg Arg Asn Trp Asn 385 390 395 400

Gin Tyr Lys He GIn Phe GIy Asn Ser Phe Ser Asn Ser GIu Ala Leu

405 410 415

Arg Ser Ala Ser Tyr Thr VaI Ser Thr He Ser Asp GIy Pro GIy Tyr

420 425 430

Ser His Asp Cys Pro Ser GIu His Leu Asn GIy Lys Ser He His Asp 435 440 445

He GIu Asn VaI Leu Leu Lys Pro GIu Asn Leu Tyr Asn 450 455 460

Additional details concerning CLR are disclosed at Genbank Accession NM 005795, which is hereby incorporated by reference in its entirety. Homologous CLR amino acid sequences that are known in the art and can be used to carry out the methods of the present invention include CLR amino acid sequences having at least about 65 percent or 70 percent identity to SEQ ID NO: 6, more preferably at least about 75 percent or 80 percent identity to SEQ ID NO: 6, most preferably at least about 85 percent or 90 percent identity to SEQ ID NO: 6. Homo logs having at least about 95 percent identity to SEQ ID NO: 6 are even more preferred. [0058] Exemplary homo logs of SEQ ID NO: 6 include, without limitation, orangutan (Pongo abelii) CLR, Genbank Accession NP OOl 125204, having 100% sequence identity to the human CLR sequence; chimpanzee {Pan troglodytes) CLR, Genbank Accession XP OOl 161496, having 96% sequence identity to the human CLR sequence; horse (Equus caballus) CLR, Genbank Accession XP 001501718, having 93% sequence identity to the human CLR sequence; dog (Canis familiaris) CLR, Genbank Accession XP 545560, having 93% sequence identity to the human CLR sequence; mouse (Mus musculus) CLR, Genbank Accession NP 061252, having 90% sequence identity to the human CLR sequence; and rat (Rattus norvegicus) CLR, Genbank Accession NP 036849, having 90% sequence identity to the human CLR sequence. Each of the above referenced Genbank Accession entries and corresponding sequences are hereby incorporated by reference in their entirety.

[0059] An exemplary human RCP (also known as RCP9) nucleotide sequence is shown below (SEQ ID NO:7): atggaagtga aggatgccaa ttctgcgctt ctcagtaact acgaggtatt tcagttacta 60 actgatctga aagagcagcg taaagaaagt ggaaagaata aacacagctc tgggcaacag 120 aacttgaaca ctatcaccta tgaaacgtta aaatacatat caaaaacacc atgcaggcac 180 cagagtcctg aaattgtcag agaatttctc acagcattga aaagccacaa gttgaccaaa 240 gctgagaagc tccagctgct gaaccaccgg cctgtgactg ctgtggagat ccagctgatg 300 gtggaagaga gtgaagagcg gctcacggag gagcagattg aagctcttct ccacaccgtc 360 accagcattc tgcctgcaga gccagaggct gagcagaaga agaatacaaa cagcaatgtg 420 gcaatggacg aagaggaccc agcatag 447

This nucleotide sequence encodes the following RCP protein (SEQ ID NO: 8).

Met GIu VaI Lys Asp Ala Asn Ser Ala Leu Leu Ser Asn Tyr GIu VaI 1 5 10 15

Phe GIn Leu Leu Thr Asp Leu Lys GIu GIn Arg Lys GIu Ser GIy Lys 20 25 30 Asn Lys His Ser Ser GIy GIn GIn Asn Leu Asn Thr lie Thr Tyr GIu 35 40 45

Thr Leu Lys Tyr lie Ser Lys Thr Pro Cys Arg His GIn Ser Pro GIu 50 55 60 lie VaI Arg GIu Phe Leu Thr Ala Leu Lys Ser His Lys Leu Thr Lys 65 70 75 80 Ala GIu Lys Leu GIn Leu Leu Asn His Arg Pro VaI Thr Ala VaI GIu

85 90 95 lie GIn Leu Met VaI GIu GIu Ser GIu GIu Arg Leu Thr GIu GIu GIn 100 105 110 lie GIu Ala Leu Leu His Thr VaI Thr Ser lie Leu Pro Ala GIu Pro 115 120 125

GIu Ala GIu GIn Lys Lys Asn Thr Asn Ser Asn VaI Ala Met Asp GIu 130 135 140

GIu Asp Pro Ala 145 Additional details concerning RCP are disclosed at Genbank Accession AK311829, which is hereby incorporated by reference in its entirety. Homologous RCP amino acid sequences that are known in the art and can be used to carry out the methods of the present invention include RCP amino acid sequences having at least about 65 percent or 70 percent identity to SEQ ID NO: 8, more preferably at least about 75 percent or 80 percent identity to SEQ ID NO: 8, most preferably at least about 85 percent or 90 percent identity to SEQ ID NO: 8. Homo logs having at least about 95 percent identity to SEQ ID NO: 8 are even more preferred.

[0060] Exemplary homo logs of SEQ ID NO: 8 include, without limitation, cattle

(Bos taurus) RCP, Genbank Accession NP 001071338, having 90-93% sequence identity to the human RCP sequence; horse (Equus caballus) RCP, Genbank Accession

XP 001493592, having 93% sequence identity to the human RCP sequence; dog (Canis familiaris) RCP, Genbank Accession XP_536833, having 93% sequence identity to the human RCP sequence; mouse (Mus musculus) RCP, Genbank Accession NP 031787, having 88% sequence identity to the human RCP sequence; guinea pig (Cavia porcellus) RCP, Genbank Accession Q60482, having 83% sequence identity to the human RCP sequence; and rat (Rattus norvegicus) RCP, Genbank Accession NP_446122, having 87% sequence identity to the human RCP sequence. Each of the above referenced Genbank Accession entries and corresponding sequences are hereby incorporated by reference in their entirety.

[0061] The recombinant expression of these and other proteins or polypeptides generally involves inserting a DNA molecule of interest (encoding the full length protein or, for example, and extracellular fragment thereof) into an expression system to which the DNA molecule is heterologous, i.e., not normally present. The heterologous DNA molecule is inserted into the expression system or vector in sense orientation and correct reading frame relative to regulatory sequences for the transcription and translation of the inserted protein-coding sequences. [0062] With respect to the recombinant expression systems, an expression vector containing a DNA molecule encoding the recombinant protein or polypeptide can be made using common techniques in the art. The nucleic acid molecules, including those identified above or portions thereof, can be inserted into any of the many available expression vectors using reagents that are well known in the art. In preparing a DNA vector for expression, the various DNA sequences may normally be inserted or substituted into a bacterial plasmid. Any convenient plasmid may be employed, which will be characterized by having a bacterial replication system, a marker which allows for selection in a bacterium, and generally one or more unique, conveniently located restriction sites. The selection of a vector will depend on the preferred transformation technique and target host for transformation. The DNA can also be transferred to other vectors that are specific for use with other systems.

[0063] A variety of host-vector systems may be utilized to express the recombinant proteins or polypeptides. Primarily, the vector system must be compatible with the host cell used. Host- vector systems include but are not limited to the following: bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA; microorganisms such as yeast containing yeast vectors; mammalian cell systems infected with virus (e.g., vaccinia virus, adenovirus, adeno-associated virus, etc.); insect cell systems infected with virus (e.g., baculovirus); and plant cells infected by bacteria (e.g., Agrobacteriuni). The expression elements of these vectors vary in their strength and specificities. Depending upon the host- vector system utilized, any one of a number of suitable transcription and translation elements can be used. [0064] When recombinantly produced, the protein or polypeptide is expressed in a recombinant host cell, which can be either a prokaryote or a eukaryote. [0065] Suitable vectors for practicing the present invention include, but are not limited to, the following viral vectors such as lambda vector system gtl 1, gtWES.tB, Charon 4, and plasmid vectors such as pCMV, pBR322, pBR325, pACYC177, pACYC184, pUC8, pUC9, pUC18, pUC19, pLG339, pR290, pKC37, pKClOl, SV 40, pBluescript II SK +/- or KS +/- (see "Stratagene Cloning Systems" Catalog (1993)), pQE, pIH821, pGEX, pET series (Studier et al, "Use of T7 RNA Polymerase to Direct Expression of Cloned Genes," Methods in Enzymology 185:60-89 (1990), which is hereby incorporated by reference in its entirety), and any derivatives thereof. Any appropriate vectors now known or later described for genetic transformation are suitable for use with the present invention.

[0066] The DNA sequences can cloned into the vector using standard cloning procedures in the art, as described by Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor, N.Y.: Cold Springs Laboratory, (1982), which is hereby incorporated by reference in its entirety. U.S. Patent No. 4,237,224 issued to Cohen and Boyer, which is hereby incorporated by reference in its entirety, describes the production of expression systems in the form of recombinant plasmids using restriction enzyme cleavage and ligation with DNA ligase. These recombinant plasmids are then introduced by means of transformation and replicated in unicellular cultures including prokaryotic organisms and eukaryotic cells grown in tissue culture.

[0067] Different genetic signals and processing events control many levels of gene expression (e.g., DNA transcription and messenger RNA (mRNA) translation). [0068] Transcription of DNA is dependent upon the presence of a promoter, which is a DNA sequence that directs the binding of RNA polymerase and thereby promotes mRNA synthesis. The DNA sequences of eukaryotic promoters differ from those of prokaryotic promoters. Furthermore, eukaryotic promoters and accompanying genetic signals may not be recognized in or may not function in a prokaryotic system, and, further, prokaryotic promoters are not recognized and do not function in eukaryotic cells. [0069] The promoter used for expression of the above-identified proteins or polypeptide fragments thereof can be a constitutive promoter, which directs expression continually, or an inducible promoter, which is capable of directly or indirectly activating transcription of one or more DNA sequences or genes in response to an inducer (whereas, in the absence of an inducer the DNA sequences or genes will not be transcribed). In addition, any enhancer or inducer elements can be included to generate the level and control over expression of the transgene.

[0070] The DNA construct of the present invention can also include an operable

3' regulatory region, selected from among those which are capable of providing correct transcription termination and polyadenylation of mRNA for expression in the host cell of choice, operably linked to a DNA molecule which encodes for a protein of choice. [0071] The vector of choice, promoter, and an appropriate 3 ' regulatory region can be ligated together to produce the DNA construct of the present invention using well known molecular cloning techniques as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Press, NY (1989), and Ausubel, F. M. et al. Current Protocols in Molecular Biology, New York, N.Y: John Wiley & Sons (1989), which are hereby incorporated by reference in their entirety.

[0072] As noted, one alternative to the use of prokaryotic host cells is the use of eukaryotic host cells, such as mammalian cells, which can also be used to recombinantly produce the various proteins or polypeptide fragments thereof as noted above. Mammalian cells suitable for carrying out the present invention include, among others: COS (e.g., ATCC No. CRL 1650 or 1651), BHK (e.g., ATCC No. CRL 6281), CHO (ATCC No. CCL 61), HeLa (e.g., ATCC No. CCL 2), 293 (ATCC No. 1573), CHOP, NS-I, NIH3T3 (ATCC No. CRL 1658), CNSl, and MDA-MB-231 (ATCC No. HTB-26) cells. Suitable expression vectors for directing expression in mammalian cells generally include a promoter, as well as other transcription and translation control sequences known in the art. Common promoters include SV40, MMTV, metallothionein-1, adenovirus EIa, CMV, immediate early, immunoglobulin heavy chain promoter and enhancer, and RSV-LTR.

[0073] Once the DNA construct of the present invention has been prepared, it is ready to be incorporated into a host cell. Recombinant molecules can be introduced into cells via transformation, particularly trans fection, lipofection, transduction, conjugation, mobilization, electroporation, or infection (e.g., with a viral vector). Accordingly, another aspect of the present invention relates to a method of making a recombinant host cell. Basically, this method is carried out by transforming a host cell with a DNA construct of the present invention under conditions effective to yield transcription of the DNA molecule in the host cell. [0074] Once the host cell has been prepared, the protein or polypeptide fragment can be expressed and recovered in a substantially pure form. In a particular embodiment, the substantially pure protein or polypeptide is at least about 80% pure, more preferably at least 90% pure, most preferably at least 95% pure. A substantially protein or polypeptide fragment can be obtained by conventional techniques well known in the art. Typically, the substantially pure protein or polypeptide is secreted into the growth medium of recombinant host cells. Alternatively, the substantially pure protein or polypeptide is produced but not secreted into growth medium. In such cases, to isolate the substantially pure protein or polypeptide, the host cell carrying a recombinant plasmid is propagated, lysed by sonication, heat, or chemical treatment, and then the homogenate is centrifuged to remove cell debris. The supernatant is then subjected to sequential ammonium sulfate precipitation. The fraction containing the substantially pure protein or polypeptide is subjected to gel filtration in an appropriately sized dextran or polyacrylamide column to separate the protein or polypeptide. If necessary, a protein fraction (containing the substantially pure CGRP, RAMPl, CLR or RCP protein or polypeptide) may be further purified by high performance liquid chromatography ("HPLC").

[0075] The CGRP antagonist can also be a soluble or partial protein of one or more of the CGRP receptor proteins. In particular, the soluble or partial protein is preferably a polypeptide fragment of either the RAMPl protein or the CLR protein. Soluble or partial proteins of RAMPl or CLR can be prepared using standard recombinant technology followed by standard protein purification procedures, both of which are described above. The soluble or partial protein can include fragments thereof lacking in cell membrane domains. The cell membrane domains of these proteins are known in the art (Conner, et al., "A Key Role for Transmembrane Pralines in Calcitonin Receptor- like Receptor Agonist Binding and Signalling: Implications for Family B G- Protein-coupled Receptors," MoI. Pharmacol. 67:20-31 (2005), which is hereby incorporated by reference in its entirety), and therefore soluble or partial polypeptides thereof can be produced by using DNA fragments that encode the desired fragment of the RAMPl or CLR proteins. One suitable fragment is the second cytoplasmic loop of the CLR. These fragments can be introduced into expression vectors and then host cells in the manner described above.

[0076] The CGRP antagonist can also be an antibody mimic, a number of which are known in the art including, without limitation, those known as monobodies and those known as affϊbodies. Monobodies are derived from the tenth human fibronectin type III domain ( 10 Fn3) (Koide et al., "The Fibronectin Type III Domain as a Scaffold for Novel Binding Proteins," J. MoI. Biol. 284: 1141-1151 (1998); Koide et al., "Probing Protein Conformational Changes in Living Cells by Using Designer Binding Proteins: Application to the Estrogen Receptor," Proc. Natl Acad. ScL USA 99:1253-1258 (2002), each of which is hereby incorporated by reference in its entirety). Affibodies are derived from the stable alpha-helical bacterial receptor domain Z of staphylococcal protein A (Nord et al., "Binding Proteins Selected from Combinatorial Libraries of an alpha-helical Bacterial Receptor Domain," Nature Biotechnol. 15(8):772-777 (1997), which is hereby incorporated by reference in its entirety). Variations in the antibody mimics can be created by substituting one or more domains of these polypeptides and then screening the modified monobodies or affibodies for selective binding activity (i.e., against one or more of CLR, RAMP 1 , and RCP).

[0077] According to another embodiment, the CGRP antagonist is a nucleic acid molecule known as an aptamer. Aptamers are single-stranded, partially single-stranded, partially double-stranded, or double-stranded nucleotide sequences, advantageously a replicatable nucleotide sequence, capable of specifically recognizing a selected non- oligonucleotide molecule or group of molecules (in this case, one or more of CLR, RAMPl, and RCP) by a mechanism other than Watson-Crick base pairing or triplex formation. Aptamers include, without limitation, defined sequence segments and sequences comprising nucleotides, ribonucleotides, deoxyribonucleotides, nucleotide analogs, modified nucleotides and nucleotides comprising backbone modifications, branchpoints and non-nucleotide residues, groups or bridges. Aptamers include partially and fully single-stranded and double-stranded nucleotide molecules and sequences; synthetic RNA, DNA, and chimeric nucleotides; hybrids; duplexes; heteroduplexes; and any ribonucleotide, deoxyribonucleotide, or chimeric counterpart thereof and/or corresponding complementary sequence, promoter, or primer-annealing sequence needed to amplify, transcribe, or replicate all or part of the aptamer molecule or sequence. [0078] Nucleic acid aptamers include multivalent aptamers and bivalent aptamers.

Methods of making bivalent and multivalent aptamers and their expression in multicellular organisms are described in U.S. Patent No. 6,458,559 to Shi et al., which is hereby incorporated by reference in its entirety. A method for modular design and construction of multivalent nucleic acid aptamers, their expression, and methods of use are described in U.S. Patent Publication No. 2005/0282190, which is hereby incorporated by reference in its entirety. Aptamers may be designed to antagonize CGRP activity, disrupt the CGRP receptor, or disrupt CGRP binding to its receptor. [0079] Identifying suitable nucleic acid aptamers of the present invention that antagonize CGRP basically involves selecting aptamers that bind CGRP or one or more of CLR, RAMP 1 , and RCP with sufficiently high affinity (e.g. , K d = 20-50 nM) and specificity from a pool of nucleic acids containing a random region of varying or predetermined length (see Shi et al., "A Specific RNA Hairpin Loop Structure Binds the RNA Recognition Motifs of the Drosophila SR Protein B52," MoI. Cell Biol. 17:1649- 1657 (1997); Shi, "Perturbing Protein Function with RNA Aptamers" (thesis, Cornell University) microformed on (University Microfilms, Inc. 1997), which are hereby incorporated by reference in their entirety).

[0080] Identifying suitable nucleic acid aptamers can be carried out using an established in vitro selection and amplification scheme known as SELEX. The SELEX scheme is described in detail in U.S. Patent No. 5,270,163 to Gold et al.; Ellington and Szostak, "//? Vitro Selection of RNA Molecules that Bind Specific Ligands," Nature 346:818-822 (1990); and Tuerk & Gold, "Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase," Science 249:505-510 (1990), which are hereby incorporated by reference in their entirety. The SELEX procedure can be modified so that an entire pool of aptamers with binding affinity can be identified by selectively partitioning the pool of aptamers. This procedure is described in U.S. Patent Application Publication No. 2004/0053310 to Shi et al, which is hereby incorporated by reference in its entirety.

[0081] Aptamers that bind to and inhibit activity of CGRP, or one or more of

CLR, RAMPl, and RCP, may be identified using screening assays such as yeast-two hybrid approaches described in U.S. Patent Application Serial No. 20040210040 to Landolfϊ et al., which is hereby incorporated by reference in its entirety. [0082] Alternatively, the CGRP receptor can be effectively blocked in the cancer cells by using an antisense nucleic acid construct that disrupts expression of one or more of RAMPl, CLR, or RCP. Given its specificity for CGRP, RAMPl disruption is particularly preferred.

[0083] A number of suitable antisense techniques can be employed, including full length antisense constructions, e.g., using the RAMPl nucleotide sequence identified above, which is insert in reverse orientation relative to a promoter to form an antisense construct that expresses a full length antisense RAMPl mRNA. [0084] Alternatively, any of a number of interfering RNA (RNAi) processes can also be employed. Numerous reports have been published on critical advances in the understanding of the biochemistry and genetics of both gene silencing and RNAi (Matzke et al., "RNA-Based Silencing Strategies in Plants," Curr. Opin. Genet. Dev. 11(2):221- 227 (2001), which is hereby incorporated by reference in its entirety). In RNAi, the introduction of double stranded RNA (dsRNA, or iRNA, for interfering RNA) into animal or plant cells leads to the destruction of the endogenous, homologous mRNA, phenocopying a null mutant for that specific gene. In both post-transcriptional gene silencing and RNAi, the dsRNA is processed to short interfering molecules of 21-, 22-, or 23-nucleotide RNAs (siRNA) by a putative RNAaselll-like enzyme (Tuschl T., "RNA Interference and Small Interfering RNAs," Chembiochem 2:239-245 (2001); Zamore et al., "RNAi: Double Stranded RNA Directs the ATP-Dependent Cleavage of mRNA at 21 to 23 Nucleotide Intervals," Cell 101 :25-3, (2000), each of which is hereby incorporated by reference in its entirety). The endogenously generated siRNAs mediate and direct the specific degradation of the target mRNA. In the case of RNAi, the cleavage site in the mRNA molecule targeted for degradation is located near the center of the region covered by the siRNA (Elbashir et al., "RNA Interference is Mediated by 21- and 22-Nucleotide RNAs," Gene Dev. 15(2):188-200 (2001), which is hereby incorporated by reference in its entirety).

[0085] The dsRNA for RAMP 1 , CLR, or RCP can be generated by transcription in vivo, which involves modifying the nucleic acid molecule encoding RAMPl, CLR, or RCP for the production of dsRNA (see Evans et al., "CGRP-RCP, a Novel Protein

Required for Signal Transduction at Calcitonin Gene-related Peptide and Adrenomedullin Receptors," J. Biol. Chem. 275(40):31438-43 (2000); Prado et al., "The Role of the CGRP -receptor Component Protein (RCP) in Adrenomedullin Receptor Signal Transduction ," Peptides 22(11): 1773-81 (2001), each of which is hereby incorporated by reference in its entirety), inserting the modified nucleic acid molecule into a suitable expression vector having the appropriate 5' and 3' regulatory nucleotide sequences operably linked for transcription and translation (as described above), and introducing the expression vector having the modified nucleic acid molecule into a suitable host cell or subject. [0086] Alternatively, complementary antisense RNAs derived from a substantial portion of the coding region of the RAMPl, CLR, or RCP nucleic acid molecule are synthesized in vitro (Fire et al., "Specific Interference by Ingested dsRNA," Nature 391 :806-811 (1998); Montgomery et al, "RNA as a Target of Double-Stranded RNA- Mediated Genetic Interference in Caenorhabditis elegans," Proc Natl Acad Sci USA 95:15502-15507; Tabara et al., "RNAi in C. elegans: Soaking in the Genome Sequence," Science 282:430-431 (1998), each of which is hereby incorporated by reference in its entirety), and the resulting antisense RNAs are annealed in an injection buffer, and dsRNA is administered to the subject using any method of administration described herein. [0087] iRNA for CGRP or RCP, RAMP 1 , or CLR can be selected using the online GenScript Corp. online service, Promega Corp. online service, or Ambion Inc. online service. Alternatively, commercially available siRNA and shRNA are available from a number of sources, including without limitation: RCP siRNA (h), sc-45539 (Santa Cruz Biotechnology, Inc.); RCP shRNA (h), TR315681 (Origene); RAMPl shRNA Construct, TR318934 (Origene); RAMPl siRNA, sc-40894 (Santa Cruz Biotechnology, Inc.); CLR siRNA, sc-43705 (Santa Cruz Biotechnology, Inc.); and CLR shRNA Construct, TR314222 (Origene). In addition, the antisense DNA oligonucleotide (TGCTCACTGTGTAAGCCTTAAATCCATCAAG; SEQ ID NO:9) has been shown to inhibit CGRP receptor function in the oocyte-CFTR assay described in Luebke et al., "Identification of a Protein that Confers Calcitonin Gene-related Peptide Responsiveness to Oocytes by Using a Cystic Fibrosis Transmembrane Conductance Regulator Assay," Proc Natl Acad Sci USA 93(8):3455-60 (1996), which is hereby incorporated by reference in its entirety.

[0088] As noted above, the various CGRP antagonists are intended to be introduced into a patient to achieve their therapeutic effect in treating cancer. Administration of the CGRP antagonist can be achieved by any means suitable to achieve delivery of the agent to the desired cells, and such administration can be carried out systemically or via direct or local administration, i.e., to a tumor site. By way of example, suitable modes of systemic administration include, without limitation, orally, topically, transdermally, parenterally, subcutaneously, intravenously, intramuscularly, intraperitoneally, by intranasal instillation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, or by application to mucous membranes. Suitable modes of local administration include, without limitation, catheterization, implantation, direct injection, dermal/transdermal application, stenting, ear/eye drops, or portal vein administration to relevant tissues, or any other local administration technique, method or procedure, as is generally known in the art.

[0089] With respect to the administration of small molecule inhibitors and protein inhibitors, these materials can be administered in the form of a pharmaceutical composition that includes a pharmaceutically acceptable carrier and one or more of the active agents. As noted above, exemplary pharmaceutical carriers are described in the literature, cited herein, describing the various agents per se. Antibodies are generally stable and can be administered in a suitable diluent. Protein inhibitors can also be present in the form of a conjugate that reduces the degradation thereof//? vivo. [0090] iRNA and nucleic acid aptamers are preferably administered alone or as a component of a composition. Suitable compositions include the nucleic acid formulated or complexed with polyethylenimine (e.g., linear or branched PEI) and/or polyethylenimine derivatives, including for example grafted PEIs such as galactose PEI, cholesterol PEI, antibody derivatized PEI, and polyethylene glycol PEI (PEG-PEI) derivatives thereof (see, e.g., Blazek- Welsh & Rhodes, "Maltodextrin-based Proniosomes," AAPS Pharm. Sci. 3(1): 1-11 (2001); Furgeson et al, "Modified Linear Polyethylenimine-cholesterol Conjugates for DNA Complexation," Bioconjug. Chem. 14:840-7 (2003); Kunath et al., "The Structure of PEG-modified Poly(Ethylene Imines) Influences Biodistribution and Pharmacokinetics of Their Complexes with NF-κB Decoy in Mice," Pharm. Res. 19:810-7 (2002); Choi et al., "Effect of Polyethylene Glycol) Grafting on Polyethylenimine as a Gene Transfer Vector in Vitro " Bull. Korean Chem. Soc. 22(l):46-52 (2001); Bettinger et al., "Size Reduction of Galactosylated PEI/DNA Complexes Improves Lectin-mediated Gene Transfer into Hepatocytes," Bioconjug.

Chem. 10:558-61 (1999); Petersen et al., "Polyethylenimine-graft-poly(ethylene glycol) Copolymers: Influence of Copolymer Block Structure on DNA Complexation and Biological Activities as Gene Delivery System," Bioconjug. Chem. 13:845-54 (2002); Erbacher et al., "Transfection and Physical Properties of Various Saccharide, Poly(Ethylene Glycol), and Antibody-derivatized Polyethylenimines (PEI)," J. Gene Med. 1(3):210-22 (1999); Godbey et al., "Tracking the Intracellular Path of Poly(Ethylenimine)/DNA Complexes for Gene Delivery," Proc. Natl Acad. Sci. USA 96:5177-81 (1999); Godbey et al., "Poly(Ethylenimine) and Its Role in Gene Delivery," J. Control. Release 60:149-60 (1999); Diebold et al., "Mannose Polyethylenimine Conjugates for Targeted DNA Delivery into Dendritic Cells," J. Biol. Chem. 274:19087- 94 (1999); Thomas & Klibanov, "Enhancing Polyethylenimine 's Delivery of Plasmid DNA into Mammalian Cells," Proc. Nat'l Acad. Sci. USA 99:14640-5 (2002); and U.S. Patent No. 6,586,524 to Sagara, each of which is hereby incorporated by reference in its entirety. [0091] The iRNA molecule can also be present in the form of a bioconjugate, for example a nucleic acid conjugate as described in U.S. Patent No. 6,528,631, U.S. Patent No. 6,335,434, U.S. Patent No. 6,235,886, U.S. Patent No. 6,153,737, U.S. Patent No. 5,214,136, or U.S. Patent No. 5,138,045, each of which is hereby incorporated by reference in its entirety. [0092] The iRNA, or any composition or bioconjugate containing the same, can also be administered via a liposomal delivery mechanism. Basically, this involves providing a liposome which includes the siRNA to be delivered, and then contacting the target cancer cell with the liposome under conditions effective for delivery of the iRNA into the cancer cell. Again, for administration to a primary tumor site, the liposomal vesicles need not be targeted to the cancer cells per se. However, where the cancer cells to be treated include metastatic cells and possible multiple secondary tumor sites, then it is desirable to administer liposomes that are targeted for delivery to the cancer cells per se. The liposome delivery system can be made to accumulate at a target organ, tissue, or cell via active targeting (e.g., by incorporating an antibody or hormone on the surface of the liposomal vehicle). This can be achieved using antibodies specific for an appropriate cancer cell marker.

[0093] Different types of liposomes can be prepared according to Bangham et al.,

"Diffusion of Univalent Ions across the Lamellae of Swollen Phospholipids," J. MoI. Biol. 13:238-252 (1965); U.S. Patent No. 5,653,996 to Hsu et al.; U.S. Patent No. 5,643,599 to Lee et al.; U.S. Patent No. 5,885,613 to Holland et al.; U.S. Patent No. 5,631,237 to Dzau et al.; and U.S. Patent No. 5,059,421 to Loughrey et al., each of which is hereby incorporated by reference in its entirety.

[0094] These liposomes can be produced such that they contain, in addition to iRNA, other therapeutic agents, such as anti-inflammatory agents, chemotherapeutic agents, or immune-enhancing agents (e.g., IL-2 or interferon alpha or GM-CSF), which would also be released at the target site (e.g., Wolff et al., "The Use of Monoclonal Anti- Thyl-IgGl for the Targeting of Liposomes to AKR-A Cells in vitro and in vivo," Biochem. Biophys. Acta 802:259 (1984), which is hereby incorporated by reference in its entirety). [0095] As an alternative to non-infective delivery of the inhibitory RNA as described above, naked DNA or infective transformation vectors can be used for delivery, whereby the naked DNA or infective transformation vector contains a recombinant gene that encodes the inhibitory RNA capable of inhibiting expression of RAMPl, CLR, or RCP. The inhibitory RNA molecule is then expressed in the transformed cell. [0096] The recombinant gene includes, operatively coupled to one another, an upstream promoter operable in mammalian cells and optionally other suitable regulatory elements (i.e., enhancer or inducer elements), a coding sequence that encodes the therapeutic nucleic acid (described above), and a downstream transcription termination region. Any suitable constitutive promoter or inducible promoter can be used to regulate transcription of the recombinant gene, and one of skill in the art can readily select and utilize such promoters, whether now known or hereafter developed. The promoter can also be made inducible/repressible using, e.g. , a TetO response element. Other inducible elements can also be used. Known recombinant techniques can be utilized to prepare the recombinant gene, transfer it into the expression vector (if used), and administer the vector or naked DNA to a patient. Exemplary procedures are described in SAMBROOK & RUSSELL, MOLECULAR CLONING: A LABORATORY MANUAL (2d ed. 1989), which is hereby incorporated by reference in its entirety. One of skill in the art can readily modify these procedures, as desired, using known variations of the procedures described therein. [0097] Any suitable viral or infective transformation vector can be used.

Exemplary viral vectors include, without limitation, adenovirus, adeno-associated virus, and retroviral vectors (including lenti viral vectors). [0098] Adenovirus gene delivery vehicles can be readily prepared and utilized given the disclosure provided in Berkner, "Development of Adenovirus Vectors for Expression of Heterologous Genes," Biotechniques 6:616-627 (1988); Rosenfeld et al, "Adenovirus-Mediated Transfer of a Recombinant αl -Antitrypsin Gene to the Lung Epithelium in vivo," Science 252:431-434 (1991); PCT Publication No. WO 93/07283; PCT Publication No. WO 93/06223; and PCT Publication No. WO 93/07282, each of which is hereby incorporated by reference in its entirety. Additional types of adenovirus vectors are described in U.S. Patent No. 6,057,155 to Wickham et al.; U.S. Patent No. 6,033,908 to Bout et al.; U.S. Patent No. 6,001,557 to Wilson et al.; U.S. Patent No. 5,994,132 to Chamberlain et al.; U.S. Patent No. 5,981,225 to Kochanek et al.; U.S. Patent No. 5,885,808 to Spooner et al.; and U.S. Patent No. 5,871,727 to Curiel, each of which is hereby incorporated by reference in its entirety.

[0099] Adeno-associated viral gene delivery vehicles can be constructed and used to deliver into cells a recombinant gene encoding a desired nucleic acid. The use of adeno-associated viral gene delivery vehicles in vitro is described in Chatterjee et al., "Dual-Target Inhibition of HIV- 1 in vitro by Means of an Adeno-Associated Virus

Antisense Vector," Science 258:1485-1488 (1992); Walsh et al., "Regulated High Level Expression of a Human Gamma-globin Gene Introduced into Erythroid Cells by an Adeno-associated Virus Vector," Proc. Nat' I Acad. Sci. USA 89:7257-7261 (1992); Walsh et al., "Phenotypic Correction of Fanconi anemia in Human Hematopoietic Cells with a Recombinant Adeno-associated Virus Vector," J. Clin. Invest. 94: 1440-1448 (1994); Flotte et al., "Expression of the Cystic Fibrosis Transmembrane Conductance Regulator from a Novel Adeno-Associated Virus Promoter," J. Biol. Chem. 268:3781— 3790 (1993); Ponnazhagan et al., "Suppression of Human Alpha-globin Gene Expression Mediated by the Recombinant Adeno-associated Virus 2-based Antisense Vectors," J. Exp. Med. 179:733-738 (1994); Miller et al., "Recombinant Adeno-Associated Virus (Raav)-Mediated Expression of a Human Gamma-Globin Gene in Human Progenitor- Derived Erythroid Cells," Proc. Nat' I Acad. Sci. USA 91 :10183-10187 (1994); Einerhand et al., "Regulated High-Level Human Beta-Globin Gene Expression in Erythroid Cells Following Recombinant Adeno-Associated Virus-Mediated Gene Transfer," Gene Ther. 2:336-343 (1995); Luo et al., "Adeno-Associated Virus 2-Mediated Gene Transfer and Functional Expression of the Human Granulocyte-Macrophage Colony-Stimulating

Factor," Exp. Hematol. 23:1261-1267 (1995); and Zhou et al., "Adeno-associated Virus 2-Mediated Transduction and Erythroid Cell-Specific Expression of a Human Beta- Globin Gene," Gene Ther. 3:223-229 (1996), each of which is hereby incorporated by reference in its entirety. In vivo use of these vehicles is described in Flotte et al., "Adeno- associated Virus 2-Mediated Transduction and Erythroid Cell-Specific Expression of a Human Beta-Globin Gene," Proc. Nat'l Acad. Sci. USA 90:10613-10617 (1993); and Kaplitt et al., "Long-term Gene Expression and Phenotypic Correction using Adeno- associated Virus Vectors in the Mammalian Brain," Nature Genet. 8:148-153 (1994), each of which is hereby incorporated by reference in its entirety. [0100] Retroviral vectors which have been modified to form infective transformation systems can also be used to deliver a recombinant gene encoding a desired nucleic acid product into a target cell. One such type of retroviral vector is disclosed in U.S. Patent No. 5,849,586 to Kriegler et al., which is hereby incorporated by reference in its entirety. Lentivirus vectors can also be utilized, including those described in U.S. Patent No. 6,790,657 to Arya, and U.S. Patent Application Nos. 20040170962 to Kafri et al. and 20040147026 to Arya, each of which is hereby incorporated by reference in its entirety.

[0101] The various gene therapy approaches for introducing CGRP antagonists

(peptides or inhibitory nucleic acids) to cancer cells are intended to be introduced into a patient to achieve their therapeutic effect in treating cancer. Administration of these

CGRP antagonists can be achieved by any means suitable to achieve delivery of the agent to the desired cells, and such administration can be carried out systemically or via direct or local administration, i.e., to a tumor site. Suitable modes of systemic and local administration include those identified for administration of small molecule or polypeptide or nucleic acid aptamer CGRP antagonists.

[0102] The amount of the CGRP antagonist to be administered can vary depending upon the mode of administration and the nature of the cancer cells being targeted, but preferably the dosage is between about 0.01 to about 10 mg/kg-body weight, more preferably between about 30 to about 300 μg/kg-body weight. This dosage can optionally be repeated periodically, for instance, up to several times daily or weekly as needed during the course of treatment. Continuous pump dosages can also be used to introduce a steady-state of the CGRP antagonist during a prolonged course of treatment, i.e., over several weeks up to several months or longer as needed. [0103] It is also contemplated that the CGRP antagonists of the present invention can be administered in combination with one or more other therapeutic agents. For example, the CGRP antagonists can be administered in combination or contemporaneously with a chemotherapeutic agent suitable for a particular type of cancer, radiation therapy, an immune-enhancing agent (e.g., IL-2 or interferon alpha or GM- CSF), or an anti-angiogenic factor. [0104] A further aspect of the present invention relates to a method of screening compounds for inhibition of calcitonin-gene related peptide ("CGRP") receptor function. The method includes the steps of contacting a cell (preferably a eukaryotic cell) that expresses the CGRP receptor with a test agent; and determining the effect, if any, of the test agent on CGRP receptor function, or the effect on protein-protein interactions between CLR and RAMP 1 , CLR and RCP, and RAMP 1 and RCP. Compounds identified as inhibitors of CGRP receptor activity, or of the interactions among the CGRP receptor constituent proteins, can also be utilized in the above-identified methods of treating cancer.

[0105] The cell used in the above assay can be any CGRP-expressing eukaryotic cell, one example of which is an NIH3T3 cell. [0106] According to one embodiment, the CGRP receptor activity can be screened by measuring the level of cAMP production, which can be readily determined using a biochemical assay. Diminished cAMP production in the presence of CGRP and the test compound, when compared to cAMP product in the presence of CGRP alone, indicates that the agent is a CGRP antagonist. [0107] According to another embodiment, the interactions among the three continuent CGRP receptor proteins (CLR, RCP, and RAMPl) can be screened. This can be achieved via measurement of co-immunoprecipitation in the presence or absence of a test agent. The absence of co-immunoprecipitation in the presence of the test agent indicates that the test agent interferences with CGRP receptor function via disruption of protein-protein interactions (i.e., between CLR and RCP, between CLR and RAMP, or between RAMP and RCP). Alternatively, this can be achieved by measurement of fluorescence resonance energy transfer (FRET) or bioluminescence resonance energy transfer (BRET) using fusion receptor proteins that contain a bioluminescent label that does not itself interfere with their interaction or signaling. In a preferred embodiment of the present invention, the candidate compounds that disrupt the protein-protein interactions between components of the CGRP receptor are screened using a rapid and sensitive assay based on polarized FRET (pFRET).

[0108] In conventional intensity-based FRET imaging, the wavelength of excitation light is chosen to maximally excite the donor fluorophore and minimally excite the acceptor fluorophore. If the two fluorophores are sufficiently close (50 angstroms or less), energy imparted to the donor by the excitation laser is transferred to the acceptor and subsequently emitted as a fluorescence photon at the typical emission wavelengths of the acceptor. Thus, proximity is measured as a gain of acceptor fluorophore emission. Typical fluorophores used are cyan fluorescent protein (CFP) for the donor and yellow fluorescent protein (YFP) for the acceptor. When two test proteins are expressed as fusion proteins with CFP and YFP, protein interaction can be scored by FRET. These studies are typically carried out on a cell by cell basis using wide-field fluorescence microscopy.

[0109] There are several limitations to this conventional intensity-based method of quantifying FRET efficiency. First, "bleed-through" of donor fluorescence into the acceptor detection channel is difficult to completely eliminate due to the emission spectral overlap of the two fluorophores, and direct excitation of acceptor by the excitation laser is impossible to completely eliminate due to the overlap in excitation spectra. Both of these effects produce a false positive FRET signal. Second, the signal from the donor fluorophore and acceptor fluorophore are sufficient for traditional microscope-based FRET, but lack sufficient intensity for reliable quantification in a plate reader format. Third, microscopy-based FRET is impractical to use for screening large numbers of samples, as each cell must be individually identified, analyzed for FRET, and then background and bleed-through between donor and acceptor data channels must be corrected (Jares-Erijman et al, "FRET Imaging," Nat Biotechnol 21(11): 1387-95 (2003), which is hereby incorporated by reference in its entirety).

[0110] To overcome the above-noted deficiencies of these conventional methods, a rapid and sensitive screening method was developed. This method involves the adaption of polarized fluorescence resonance energy transfer (pFRET) to a plate reader form to overcome the above noted deficiencies and enable high throughput screening analysis of protein-protein interactions. Fluorescence emission of the various fluorescent proteins is highly polarized, i.e. the polarization of the emitted fluorescence is highly correlated with the excitation laser's polarization. In contrast, fluorescence emitted by acceptor fluorophores after FRET energy transfer is much less correlated with the excitation polarization. This degree of correlation can be measured and anisotropy calculated r=(VV-gVH)/(VV+2gVH) (Rizzo et al. , "High-Contrast Imaging of Fluorescent Protein FRET by Fluorescence Polarization Microscopy," Biophys J 88(2):L14-6 (2005), which is hereby incorporated by reference in its entirety), where VV is the signal in the detector polarized parallel to the laser polarization, VH is the signal in the detector polarized perpendicular to the laser polarization and g corrects for polarization bias in the detection system. An increase in FRET efficiency is manifested by a decrease in anisotropy. It is significant to note that "bleed through" of donor emission and direct excitation of acceptor by the excitation laser both cause an increase in anisotropy, and hence are no longer false positives, a key fact for high throughput screens. The pFRET assay of the present invention can be easily adapted to identify and study other protein-protein interactions, and hence provides a rapid method to discover novel compounds that can disrupt, and thus alter function.

[0111] According to a further embodiment, CGRP receptor function can be measured via interaction of receptor component protein ("RCP") with calcitonin- like receptor ("CLR"). [0112] Finally, according to yet another embodiment, disruption between any two CGRP receptor proteins can be measured via the yeast two-hybrid approach. In this approach, the yeast cell expresses a first transgene that encodes a fusion protein that includes CLR or a fragment thereof fused to a prey polypeptide, and a second transgene that includes RCP or a fragment thereof fused to a bait polypeptide, or vice versa (RCP- prey and CLR-bait). Interaction of the CLR and RCP proteins or fragments thereof results in functional interaction of prey-bait, which is measured directly by expression of a reporter gene. Any suitable reporter gene can be used, including a selectable marker or fluorescent reporter genes or a product that is readily detectable by immunoassay, or other detection means. [0113] A further aspect of the present invention relates to a non-human, animal model of cancer. This animal model is preferably a mammal (e.g., rodent) and includes tumor cells introduced into the mammal, wherein the tumor cells express CGRP receptor and include a transgene expressing a fluorescent marker protein. In this animal model of cancer the introduced tumor cells are preferably derived from human tumors or human tumor cell lines, i.e., the mammal is a xenograft model of cancer, although tumor cells derived from rodent cell lines can also be used.

[0114] The tumor cells preferably contain a transgene that expresses a dominant- negative regulator of CGRP receptor function, which can be constitutively expressed or inducibly expressed using appropriate regulatory control sequences in the promoter regions of the transgene. The dominant-negative regulator of CGRP receptor function is preferably a fusion protein that includes a second cytoplasmic domain of the CLR fused to a fluorescent protein (e.g., GFP, YFP, RFP, etc.) [0115] A still further aspect of the present invention relates to a transgenic cell line that expresses a dominant-negative regulator of CGRP receptor function of the type described above. This cell line can be introduced into a rodent to generate the model of disease. [0116] According to one embodiment, the cell line can be of human origin, for example one derived from a human breast cancer cell line or a brain metastasizing human breast cancer cell line.

[0117] According to another embodiment, the cell line can be from the same or a different type of rodent, such as a rat glioma cell line.

EXAMPLES

[0118] The present invention is further described with reference to the following examples, which are not intended to limit the scope of the claimed invention in any way.

Example 1 - Differential Expression of Calcitonin Gene-Related Peptide Receptor in Metastatic Tumor Cells [0119] Tumor metastasis requires the successful completion of a complex series of steps, involving migration of a tumor cell towards a tumor blood vessel, entry into the blood vessel, survival in the bloodstream, lodgment in a distant vessel, and proliferation in the new site. To investigate the molecular pathways involved in influencing tumor cell metastasis, a pair of cell lines derived from breast cancer patients, MDA-MB-231 (231) and MDA-MB-23 IBR (23 IBR) were utilized. The MDA-MB-231 cell line is a human estrogen-independent breast cancer cell line that metastasizes primarily to bone, but also at low frequency to brain, ovary and adrenal gland when injected into the left ventricle of the heart in nude mice (Cailleau et al., "Breast Tumor Cell Lines From Pleural Effusions," J Natl Cancer Inst 53(3):661-74 (1974); Yoneda T., "Cellular and Molecular Mechanisms of Breast and Prostate Cancer Metastasis To Bone," Eur J Cancer

34(2):240-5 (1998); Yoneda et al., "Osteolytic Bone Metastasis in Breast Cancer," Breast Cancer Res Treat 32(l):73-84 (1994), which are hereby incorporated by reference in their entirety). MDA-MB-23 IBR cells were derived from the MDA-MB-231 line by isolating cells of a rare brain-metastases that developed following intracardiac injection of the MDA-MB-231 cells, and by passaging the brain-metastasizing cells through animals six times. The resulting MDA-MB-23 IBR cells preferentially metastasize to the brain when injected into the left ventricle of mice.

[0120] The properties of the 23 IBR cell line that improve its metastatic ability compared to its parent cell line were investigated. Analysis of the metastatic process using principles of biomedical engineering provided key insights. After vascular entry, the 23 IBR cells lodge in the brain vasculature. It is believed that this event is trigged by one or more cells blocking a small capillary and obstructing blood flow to the tissue surrounding that capillary (the Krogh cylinder), which exposes the tumor cells to hypoxia. Because subsequent proliferation occurs under hypoxia, it was believed that the molecular pathways that were differentially regulated in the 231 and 23 IBR cell lines under hypoxia were promising candidates for pathways that play a key role in metastasis. Therefore, a proteomic screen was performed to identify proteins that were differentially expressed in these two cell lines under hypoxia, and the expression levels of several candidate proteins were validated by western blot analysis. This analysis revealed that an element of the Calcitonin Gene-Related Peptide Receptor (CGRPR) was differentially regulated.

[0121] The CGRPR is a unique G-coupled receptor consisting of a core transmembrane calcitonin-like receptor (CLR) protein and two accessory proteins (Figure 1). The first accessory protein is the transmembrane Receptor Activity Modifying Protein (RAMPl), which is responsible for intracellular trafficking of CLR to the cell surface and pharmacologic specificity. There are three forms of RAMP. CLR plus RAMPl generates a high-affinity receptor for the neuropeptide Calcitonin Gene -Related Peptide (CGRP), while CLR plus RAMP2 or RAMP3 forms a high-affinity receptor for the neuropeptide adrenomedullin (McLatchie et al., "RAMPs Regulate the Transport and Ligand Specificity of the Calcitonin- Receptor-Like Receptor," Nature 393(6683):333-9 (1998), which is hereby incorporated by reference in its entirety). The second accessory protein is CGRP -receptor component protein (RCP), which couples the CLR/RAMP complex to the cellular signaling pathway (Evans et al., "CGRP-RCP, A Novel Protein Required for Signal Transduction at Calcitonin Gene-Related Peptide and Adrenomedullin Receptors," J Biol Chem 275(40):31438-43 (2000) and Prado et al., "The Role of the CGRP-Receptor Component Protein (RCP) in Adrenomedullin Receptor Sgnal Transduction," Peptides 22(11):1773-81 (2001), which are hereby incorporated by reference in their entirety).

[0122] RAMPl expression is greatly increased in 23 IBR cells under hypoxia, and decreased in the parent 231 cells (Figure 2, right panel). Hence differential expression of RAMPl under hypoxia is a good candidate for the molecular source of 23 IBR's enhanced metastatic ability. The observed differential regulation was unique to RAMPl . Under hypoxia CLR is reduced in both 231 and 23 IBR, while RCP is increased in both 231 and 23 IBR (Figure 2, left and middle panels). Hence, these are not good candidates for the source of 23 IBR's enhanced metastatic ability. Example 2 - Hypoxia Induced Upregulation of RAMP Increases Metastatic Tumor Cell Proliferation Upon CGRPR Activation

[0123] Elevated expression of RAMPl under hypoxic conditions will increase the number of functional CGRPRs and hence enhance a cell's response to CGRP. Trigeminal nerves innervating the cerebral vasculature express CGRP (Uddman et al., "Innervation of the Feline Cerebral Vasculature by Nerve Fibers Containing Calcitonin Gene-Related Peptide: Trigeminal Origin and Co-existence With Substance," P. Neurosci Lett 62:131-6 (1985), which is hereby incorporated by reference in its entirety), providing a ready source of receptor activation. Therefore, it is possible that upon vessel plugging and resultant hypoxia, subsequent tumor growth is enhanced by CGRPR activation in 23 IBR cells relative to 231 cells.

[0124] To test whether proliferation of these two lines would be differentially affected by CGRP receptor activation under hypoxia, the 231 and 23 IBR cell lines were grown under CGRP stimulation and hypoxia. As shown in Figure 3, CGRP stimulation in combination with hypoxia resulted in the proliferation of 23 IBR cells but not 231 cells. These data provide a model to explain why some breast tumor types metastasize to the brain while others do not. In this model the breast tumor cell types that more readily metastasize to the brain respond to hypoxia induced by their own vascular lodgment, with an upregulation of RAMPl expression, leading to enhanced tumor growth in the presence of CGRP. The importance of this model of vessel plugging and hypoxia, based upon biomedical engineering principles, is illustrated by the fact that these same two cell types, in the presence of normoxia, do not show any alterations in proliferation under CGRP stimulation (Figure 3).

Example 3 - Dominant Negative Inhibition of CLR Disrupts CGRP Receptor Signaling [0125] CGRP appears to be a hypoxic-specifϊc activator of breast cancer cell growth. This is important as there are currently few effective therapies for hypoxic tumors, which are aggressive and lethal. Interestingly, CGRP promotes growth of breast cancer cells destined for metastasis to the brain, and may be diagnostic for brain metastasis. Thus, the receptor for CGRP is an important target for managing breast cancer, and expression of the receptor proteins (i.e., RAMPl and RAMP2) could be used as an early indicator of later metastatic events.

[0126] CLR is a core protein of the CGRPR, and inhibition of CLR will inhibit

CGRP mediated receptor activation as well as activation by other neuropeptides (e.g., adenomedullin), thereby blocking potentially multiple avenues of breast cancer metastasis.

[0127] A method to inhibit CLR was developed based on its unique multi-protein requirements. Because CLR requires RCP for signaling (Evans et al., "CGRP-RCP, A Novel Protein Required for Signal Transduction at Calcitonin Gene-Related Peptide and Adrenomedullin Receptors," J Biol Chem 275(40):31438-43 (2000); and Prado et al., "The Role of the CGRP-Receptor Component Protein (RCP) in Adrenomedullin Receptor Signal Transduction," Peptides 22(11):1773-81 (2001), which are hereby incorporated by reference in their entirety), a yeast two-hybrid screen was carried out and it was discovered that RCP interacts directly with the second cytoplasmic loop of CLR (Figure 4). When this second cytoplasmic domain of CLR (cpd2 CLR ) was expressed in NIH3T3 fibroblast cells as a fusion protein with green fluorescent protein (GFP)

(cpd2 CLR -GFP), CGRP signaling was inhibited as shown in Figure 5. The cpd2 CLR -GFP fusion protein co-immunoprecipitated with RCP, demonstrating a competition between the fusion protein and endogenous CLR for RCP, where loss of RCP-CLR interaction resulted in loss of CGRP receptor signaling. [0128] To determine if the dominant-negative cpd2 CLR -GFP fusion protein could inhibit CLR function in breast cancer cells, four breast cancer lines (human MDA-MB- 231 and MDA-MB-231BR lines and mouse 4Tl and TGl lines) were transfected with cpd2 CLR -GFP or GFP alone. MDA-MB231 and MDA-MB-23 IBR cells that constitutively express GFP were generated as previously described (Evans et al., "CGRP- RCP, a Novel Protein Required for Signal Transduction at Calcitonin Gene -Related Peptide and Adrenomedullin Receptors," J Biol Chem 275(40):31438-43 (2000); Prado et al., "The Role of the CGRP-Receptor Component Protein (RCP) in Adrenomedullin Receptor Signal Transduction," Peptides 22(11):1773-81 (2001); and Rosenblatt et al., "Endoproteolysis at Tetrabasic Amino Acid Sites in Procalcitonin Gene-Related Peptide by Pituitary Cell Lines" Peptides 18(4):567-76 (1997), which are hereby incorporated by reference in their entirety). However, when a constitutive promoter was used to express cpd2 CLR -GFP in these tumor cells, pure fluorescent colonies could not be isolated because, it is believed, the constitutive expression of cpd2 CLR -GFP was too effective at inhibiting tumor growth. When mixed colonies were purified by fluorescence activated cell sorting (FACS), pure populations of cells expressing the dominant-negative inhibitor were obtained, but would not grow, indicating the potency of CLR inhibition in controlling tumor growth. These same results were obtained from multiple replicate experiments, thereby confirming that the dominant-negative inhibitor was responsible for these results. [0129] Therefore, a tetracycline-repressible promoter will be employed to inhibit expression of cpd2 -GFP during cell culturing. cpd2 -GFP will be cloned into the tetracycline-responsive plasmid pTRE -Tight (Clontech), and this plasmid

(pTRE.cpd2 CLR -GFP) will be co-transfected with the plasmid pTet-Off (Clontech) into the four breast cancer tumor lines. The latter plasmid expresses the tetracycline activator protein that upon binding of tetracycline represses the TRE promoter, inhibiting expression of cpd2 CLR -GFP. The pTet-Off plasmid contains the gene for geneticin resistance, while pTRE does not. The presence of pTet-Off will be selected for by growth in the presence of geneticin, and for pTRE.cpd2 CLR -GFP by fluorescence in the absence of doxycycline. Once geneticin-resistant colonies are identified, colonies will be switched into doxycycline (a tetracycline analog)-deficient media, and colonies expressing cpd2 CLR -GFP will be identified by fluorescence. [0130] The inhibitory effect of cpd2 CLR -GFP on CLR signaling will be tested by inducing cpd2 CLR -GFP expression with the removal of doxycycline from the growth media overnight, incubating transfected cells (MDA-MB-231 , MDA-MB-231BR, 4Tl and TGl) with CGRP, and assaying for cAMP response.

Example 4 - CGRP Stimulates Glioma Tumor Cell Proliferation and Growth

[0131] Malignant glioblastomas are highly aggressive tumors characterized by rapid proliferation, invasiveness, high vascularization, and resistance to apoptosis and thus most chemotherapy and radiotherapy (Schmitt C. A., "Senescence, Apoptosis and Therapy-Cutting the Lifelines of Cancer," Nat Rev Cancer 3(4):286-95 (2003), which is hereby incorporated by reference in its entirety). From the above results, it is believed that CGRP receptor signaling may be an important target for controlling or inhibiting glioma tumor cell proliferation.

[0132] Rat CNSl glioma cells, which are characterized by an aggressive invasive phenotype, serve as a model glioma system for which to study the potential role of CGRP -receptor signaling in glioma tumor cell proliferation and growth. Rat CNS 1 cells express CLR, and its accessory proteins RAMPl and RCP as assessed by western blot analysis shown in Figure 6. In addition, when CNSl cells were grown in the presence or absence of CGRP and stained with Calcein-AM as an indicator of cell proliferation, it was determined that CGRP is a potent activator of glioma tumor cell proliferation (Figure 7). CGRP increased CNSl glioma growth by 300% over control, demonstrating that inhibitors of CGRP receptor function should be useful for anti-glioma therapy. [0133] To examine the role of CLR in glioma proliferation, inhibition of CLR via expression of cpd2 CLR -GFP was attempted. Although CNS 1 cells that constitutively express GFP were generated using published techniques (Evans et al., "CGRP-RCP, A Novel Protein Required for Signal Transduction At Calcitonin Gene-Related Peptide and Adrenomedullin Receptors," J Biol Chem 275(40):31438-43 (2000); Prado et al., "The Role of the CGRP-Receptor Component Protein (RCP) in Adrenomedullin Receptor Signal Transduction," Peptides 22(11):1773-81 (2001); Rosenblatt et al., "Endoproteolysis At Tetrabasic Amino Acid Sites in Procalcitonin Gene- Related Peptide by Pituitary Cell Lines," Peptides 18(4):567-76 (1997), which are hereby incorporated by reference in their entirety), upon transfection of the constitutively expressed cpd2 CLR - GFP construct, pure fluorescent colonies could not be isolated. Similar to the observations made in breast cancer cell lines, constitutive expression of cpd2 CLR -GFP was so effective at inhibiting glioma growth that when mixed colonies were purified by fluorescence activated cell sorting (FACS), the pure populations of cells expressing the dominant-negative inhibitor would not grow. This data further supports the potency of CLR inhibition in controlling glioma growth.

Example 5 - The Effect of CGRP Inhibition on Breast Cancer Tumor Growth

[0134] To test the effect of CGRP inhibition on breast cancer tumor growth,

MDA-MB-231 human breast tumor cells will be grown in the mammary fat pad of nude mice. An osmotic pump that will continuously secrete either the peptide inhibitor of CGRPR signaling (CGRPg_ 37 , purchased from California Peptide Research, Inc.) or saline as control will be implanted in each mouse. Tumor size will be measured via calipers every two days for two weeks. After two weeks of growth and treatment, tumors will be excised for histology. It is predicted that CGRP 8-3 7 treatment will significantly retard tumor growth.

Example 6 - The Role of CGRP in Breast Cancer Metastasis to the Brain

[0135] An in vivo model will be employed to determine whether inhibition of

CGRP receptor signaling can prevent breast cancer metastasis. In this model, the MDA- MB231 and MDA-MB-23 IBR cell lines expressing the Tet-repressible dominant negative CLR inhibitor cpd2 CLR -GFP (MDA-MB-23 l/cpd2 CLR -GFP and MDA-MB- 23 lBR/cpd2 CLR -GFP) or GFP alone (MDA-MB-23 lBR/GFP and MDA-MB-231/GFP), as described in Example 3, will be suspended (2x10 5 cells) in 10 μl of Dulbecco's PBS with 0.5% FBS for intracardial injection into 20 nude mice via a stereotactic frame. Three weeks later animals will be perfusion fixed, and brain, lungs, ovaries, femurs and adrenal glands will be dissected. Organs will be paraffin embedded and sectioned (bones will undergo decalcification in 14% EDTA for two weeks) and the number and size of micrometastases will be quantified systemically on an epifluorescence microscope (Yoneda et al., "A Bone-Seeking Clone Exhibits Different Biological Properties From the MDA-MB-231 Parental Human Breast Cancer Cells and A Brain-Seeking Clone In Vivo and In Vitro " J Bone Miner Res 16(8): 1486-95 (2001), which is hereby incorporated by reference in its entirety). This particular intracardiac injection model allows for examining only the later stages of metastasis, after cells have entered the bloodstream. It is these later stages where it is believed that CGRP signaling plays a role in the metastatic process.

[0136] Figure 8 is a fluorescent photomicrograph showing visualization of a MDA-MB-231BR/GFP brain metastases in a nude mouse 21 -days after intracardiac injection of the cells. Seventy-two 50 μm sections of the brain were inspected per animal and twenty-six +/- 6 tumors were observed per animal, with tumors appearing primarily in cortex, cerebellum and brain stem. In contrast, no brain tumors were observed when MDA-MB-231 /GFP cells were similarly injected into mice. This same form of analysis will be performed on the treated mice.

[0137] In addition to CLR-dominant negative inhibition of CGRP mediated signaling, non-peptide CGRP antagonists will also be tested in the intracardiac injection model for their ability to inhibit breast cancer cell brain metastasis. There are currently two non-peptide CGRP antagonists available: BIBN4096BS (Doods et al, "CGRP Antagonists: Unravelling the Role of CGRP in Migraine," Trends Pharmacol Sci 28(11):580-7 (2007); Edvinsson L., "Clinical Data on the CGRP Antagonist BIBN4096BS for Treatment of Migraine Attacks," CNS Drug Rev 1 l(l):69-76 (2005); and Olesen et al., "Calcitonin Gene-Related Peptide Receptor Antagonist BIBN 4096 BS for the Acute Treatment of Migraine," N Engl J Med 350(11):1104-10 (2004), which are hereby incorporated by reference in their entirety), and MK-0974 (Salvatore et al., "Pharmacological Characterization of MK-0974, A Potent and Orally Active CGRP Receptor Antagonist for the Treatment of Migraine," J Pharmacol Exp Ther (2007) and Ho et al., "Randomized Controlled Trial of an Oral CGRP Antagonist, MK-0974, in Acute Treatment of Migraine," Neurology (2007), which are hereby incorporated by reference in their entirety).

[0138] In these studies, MDA-MB-231 BR/GFP cells (brain-metastasizing) and

MDA-MB-231 /GFP cells (non-brain metastasizing) will be injected intracardially into nude mice via a stereotactic frame. For each cell type two therapeutic strategies will be evaluated. In the first strategy, treatment with CGRP antagonist will begin three days before injection with tumor cells, and treatment will continue throughout the subsequent three weeks until animal sacrifice. In the second strategy, treatment with CGRP antagonist will only begin one week after animals are injected with tumor cells, and treatment will continue for the subsequent two weeks until animal sacrifice. The first regimen provides the CGRP antagonists with the greatest opportunity to influence every step of the metastatic process, while the second regimen will evaluate CGRP antagonist efficacy after metastases have already established. BIB4096 has 100-100Ox lower affinity for rodent receptors over human receptors, and are not usually amenable to rodent studies (Mallee et al., "Receptor Activity-Modifying Protein 1 Determines the Species Selectivity of Non-Peptide CGRP Receptor Antagonists," J Biol Chem 277(16): 14294-8 (2002) and Hershey et al., "Investigation of the Species Selectivity of A Nonpeptide CGRP Receptor Antagonist Using A Novel Pharmacodynamic Assay," Regul Pept 127(l-3):71-7 (2005), which are hereby incorporated by reference in their entirety). However, MDA-MB-231 cells are human and, therefore, will allow for monitoring human CGRP receptor pharmacology in the mouse background. Antagonists will be delivered by an Alzet mini-osmotic pump. Antagonists have been used at doses of 30- 300 μg/kg in monkeys (Hershey et al., "Investigation of the Species Selectivity of A

Nonpeptide CGRP Receptor Antagonist Using A Novel Pharmacodynamic Assay," Regul Pept 127(l-3):71-7 (2005), which is hereby incorporated by reference in its entirety). Starting doses of 150 μg/kg will be used, although depending on the initial results doses of 50 μg/kg and 300 μg/kg will also be assessed. [0139] For these experiments, mice will be approximately 20 grams at the time of surgery and the Alzet #2004 pump has the appropriate delivery rate (0.25 μl/hr for up to 4 weeks, 200 μl capacity) for antagonist. Pumps will be implanted subcutaneously in the back, and antagonist delivered to the vasculature via catheter to the external jugular (Menon et al., "Angiotensin-(l-7) Inhibits Growth of Human Lung Adenocarcinoma Xenografts in Nude Mice Through A Reduction in Cyclooxygenase-2," Cancer Res

67(6):2809-15 (2007), which is hereby incorporated by reference in its entirety). After perfusion fixation brain, femurs, ovaries, and adrenal glands will be prepared and analyzed for metastases. If no change in brain metastasis is observed at the 150 μg/kg dose, the dose will be increased. Conversely, if a diminution in fluorescent brain metastasis is observed, the dosing will be decreased to discover the lower limits of antagonist activity. Example 7 - The Effect of CGRP Peptide Inhibition on Glioma Tumor Growth

[0140] CNS-I (rat glioma) tumors will be grown subcutaneously in the flank of nude mice. An osmotic pump that continuously secretes either the peptide inhibitor of CGRPR signaling (CGRP 8 _ 37 ) or saline as control will be implanted in each mouse. Tumor size will be measured via calipers every two days for two weeks. After two weeks of growth and treatment, tumors will be excised for histology. It is predicted that CGRP8-3 7 treatment significantly retards tumor growth.

Example 8 - The Role of CLR in Glioma Proliferation in an In Vivo Model [0141] Because constitutive expression of cpd2 CLR -GFP completely inhibited glioma growth, the use of a tetracycline-repressible promoter will be used to inhibit expression of cpd2 CLR -GFP in CNSl cells during culturing as described in Example 3. [0142] Glioma cells expressing the cpd2 CLR -GFP dominant-negative inhibitor of

CLR signaling or GFP alone will be stereotactically injected into the cortex of severe combined immunodeficiency (SCID) mice approximately 200 μm deep. To image glioma tumor cell proliferation in the cortex, a cranial window (Brown et al., A Practical Guide: In vivo Imaging of Tumors, in Imaging in Neuroscience and Development, Yuste, Eds., Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY. 695-700 (2005), which is hereby incorporated by reference in its entirety) will be surgically implanted in the skull of the animal, allowing repeated optical access to visualize expression of the cpd2 CLR -GFP fusion protein and monitor changes in tumor cell proliferation and angiogenesis by multi-photon laser-scanning microscopy (MPLSM). MPLSM allows non-invasive 3D visualization of the tumor to a depth of 500 μm below the tissue surface (Brown et al., "//? Vivo Measurement of Gene Expression, Angiogenesis and Physiological Function in Tumors Using Multiphoton Laser Scanning Microscopy," Nat Med 7(7):864-8 (2001), which is hereby incorporated by reference in its entirety). Figure 9 shows human U87 glioma cells transfected with GFP alone visualized with MPLSM in live animals 14-days after implantation. Tumor cells will be assessed for proliferation over three weeks, and tumor growth tracked by measuring the volume of the cranial window occupied by fluorescent tumor tissue. It is expected that CNSl glioma cells that express cpd2 CLR -GFP will have decreased proliferation rates compared to control CNSl cells. Example 9 - High-Throughput Screen for Novel Antagonists of CGRP Receptor

[0143] A rapid and sensitive assay for protein-protein interaction has been developed based on polarized fluorescence resonance energy transfer (pFRET). The CGRP receptor components, CLR, RAMPl and RCP, have been tagged with fluorescent donor/acceptor proteins, and small compound libraries will be screened for molecules that disrupt pFRET between CLR-RAMPl . Since these molecules will be selected for their ability to block protein-protein interactions they will not be limited to classical antagonists that bind the extracellular domain of CLR. It is presumed this group will include hydrophobic molecules that can pass through the cell membranes, and thus may also be candidates for compounds that could pass through the blood-brain barrier. [0144] Preliminary studies indicate that it is necessary to tightly control expression of both donor and acceptor fusion protein to avoid false-positive FRET reactions. Therefore, cell lines that express donor and acceptor pairs will be developed for analysis of CLR proteins by pFRET. If one of the FRET pair does not express well, or if the pair expression is too high or too low, then data interpretation becomes problematic. To avoid this difficulty the Tetracycline-responsive system will be used. RAMPl-venus and CLR-cerulean fusion proteins will be cloned into the Tet-responsive bidirectional plasmid pTRE-Tight-BI (Clontech). This plasmid uses a tightly regulated bidirectional tetracycline-responsive promoter that will express both constructs with equal efficiency. The resulting plasmid, pTRE-Tight/cpd2 CLR +RCP, will be co- transfected into COSl cells with pTet-ON plasmid, which constitutively expresses the reverse tetracycline-controlled transactivator. When both plasmids are expressed in a cell, addition of tetracycline will induce expression of RAMPl-venus and CLR-cerulean. COSl cells endogenously express RCP and transfect with high efficiency, thus making an ideal cellular environment for HTS.

[0145] Stable cell lines will be isolated following geneticin selection, and screened for expression of cerulean and venus by fluorescence microscopy in response to doxycycline. By inducing cells with increasing concentrations of tetracycline, a dose- response curve of protein expression will be generated. pFRET analysis will be carried out by MPLSM using both microscopy and plate reader detection. An example of a control pFRET experiment carried out in the plate reader is shown in Figure 4, where the interaction between cpd2 CLR and RCP was detected in transient experiments. Control cell lines that substitute free cerulean for RCP-cerulean will be made and used as an initial negative control. Tetracycline conditions that give sufficient levels of expression and a high z-score will be optimized (MaIo et al., "Statistical Practice in High-Throughput Sreening Data Analysis," Nat Biotechnol 24(2): 167-75 (2006); Zhang et al., "A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays," J Biomol Screen 4(2):67-73 (1999); Zhang X.D., "A New Method With Flexible and Balanced Control of False Negatives and False Positives for Hit Selection in RNA Interference High-Throughput Screening Assays," J Biomol Screen 12(5):645-55 (2007); Zhang et al., "The Use of Strictly Standardized Mean Difference for Hit Selection in Primary RNA Interference High-Throughput Screening Experiments," J Biomol Screen 12(4):497-509 (2007), which are hereby incorporated by reference in their entirety), similar to the 0.8 recorded for preliminary experiments. [0146] Identification of novel compounds that disrupt CLR protein interactions will be carried out using the stable cell lines expressing CLR-cerulean + RAMPl-venus. In these experiments compounds that disrupt the pFRET interaction, resulting in increased anisotropy over control, will be identified. Compounds identified in this screening will be subjected to in vivo testing according to Examples 5-8 for efficacy in treating breast cancer, inhibiting breast cancer metastasis, and treating glioma. [0147] All of the features described herein (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined with any of the above aspects in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.