Methods and uses for quantifying lung overdistension by determining a set of miRNAs

The present invention belongs to the field of clinical diagnosis and prognosis. Specifically, the present invention relates to methods for the lung overdistension diagnosis, the monitoring of the evolution of lung overdistension, and the evaluation of treatments for lung overdistension by determining the levels of specific miRNAs, and to uses for said purposes.

BACKGROUND ART

Patients with severe lung injury require different treatments depending on the severity of their condition. Among them, mechanical ventilation is applied when there is a severe deterioration of gas exchange or an increase in the work of breathing that the patient is unable to handle. In addition to these cases, there are patients with normal lungs who require mechanical ventilation for other reasons.

Mechanical ventilation is performed by means of applying positive pressure to the patient's airway, getting air into the lungs (Pham T. et al., Mayo Clin Proc., 92(9):1382- 1400 (2017)). Although these elevated pressures can help to improve aeration of previously collapsed lung areas, they can also cause lung overdistension, affecting healthy alveoli or the interfaces between healthy and collapsed lung (Gordo Vidal, F., et al., Medicina Intensiva, 31 (1 ), 18-26 (2017).

There is wide experimental evidence which proves that lung overdistension causes damage to the lungs, both as a result of direct and massive tissue damage due to elevated pressures, and as a result of the activation of a biological response associated to overdistension including alveolar activation of inflammation and extracellular matrix remodeling. This damage has been linked to a higher death rate from disease in patients with lung damage. In fact, at present, clinical mechanical ventilation guidelines recommend minimizing damage from overdistension as a therapeutic objective.

Despite its clinical relevance, the identification and quantification of lung overdistension in a patient presents technical difficulties, given the absence of markers with high sensitivity and specificity. In clinical practice, airway pressures are used as an overdistension marker, where it is recommended for said pressures to not exceed certain limits (plateau pressure of 28 cmH2O, boost pressure of 15 cmH2O). However, these limits have not been verified in any clinical trial. On the other hand, It is accepted that lung overdistension is a local phenomenon, limited to certain areas of the lung. In contrast, pressure measurements performed yield a single value for the entire respiratory system, so the existence of areas with overdistension may be concealed despite pressures in the normal range. Therefore, there is currently no marker based on respiratory mechanics that identifies lung overdistension with an acceptable performance for clinical practice.

On the other hand, different molecules have been proposed as markers of lung overdistension, including cytokines IL-6, IL-8, and S100A8 and S100A9 proteins. All of these inflammatory markers are elevated in lung injury of any cause (Kuipers MT, et al. PLOS ONE 18;8(7): e68694 (2013); Voiriot G, et al., Breath Res., 18(1 ):64 (2017)), so they are neither sensitive nor specific for overdistension.

The relationship between the expression levels of certain microRNAs and lung conditions other than lung overdistension, such as acute respiratory distress syndrome (ARDS) and diffuse alveolar damage (described in document EP2977463A1 ) is also known in the state of the art.

Thus, despite the fact that there is experimental evidence which proves that lung overdistension causes lung damage, there is no reliable diagnostic/prognostic method based on specific biomarkers for said condition. Therefore, providing biomarkers and methods based on said biomarkers is of clinical interest, particularly considering their potential application in patients subjected to mechanical ventilation in terms of adjusting the treatment and preventing further associated damage.

Therefore, in view of the state of the art, there is a need to find biomarkers and methods for the diagnosis/prognosis of lung overdistension, with high sensitivity and specificity values.

DESCRIPTION OF THE INVENTION

The inventors have identified a set of lung overdistension specific microRNAs: miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 . By means of determining their levels in biological samples and comparison with reference values, this set of microRNAs allows the lung overdistension diagnosis, the monitoring of the evolution of lung overdistension, and the evaluation lung overdistension treatments, having relevant clinical applications such as the adjustment of mechanical ventilation in subjects suffering from lung overdistension.

The inventors arrived at this conclusion by an analysis of the microRNAs expression in cell culture samples, identifying significant differences in the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 and miR-581 in cell cultures subjected to static conditions compared to stretching (overdistension) conditions, with each of these microRNAs having the capacity to discriminate between samples subjected to both conditions with areas under the ROC Curve between 0.81 1 and 0.923 (Fig. 1 A, Fig. 1 B, and Table 1 ). Furthermore, the results were validated in (1 ) human lung tissue samples from subjects subjected to ventilation under overdistension conditions compared to samples from lungs ventilated in the absence of overdistension; discriminating both groups (Fig. 3A and Fig. 3B); and (2) bronchoalveolar lavage samples from patients subjected to mechanical ventilation for pulmonary edema during a change in tidal volume from 3 to 6 ml/kg of weight (Fig. 4A and Fig. 4B).

Thus, the invention solves problems of the state of the art related to the lung overdistension diagnosis and prognosis, representing an approach with high sensitivity and specificity, which further allows customizing mechanical ventilation in individuals suffering from this condition. Based on the levels of the microRNAs specific for lung overdistension mentioned above, the inventors have developed in vitro methods for the lung overdistension diagnosis, the monitoring of the evolution of lung overdistension, and the evaluation of the response to lung overdistension treatments, as well as kits and uses for said purposes, which will be described in more detail below.

Methods of the invention

Based on the miRNAs levels in isolated biological samples from a subject, the inventors have developed three applications, as are the diagnosis of lung overdistension, the monitoring of lung overdistension, and the evaluation of the response to treatment for lung overdistension, giving rise to the three methods of the invention. In the present invention, “lung overdistension” refers to a condition characterized by excessive stretching of lung areas or structures that can lead to the lungs being damaged either directly or through a biological response associated therewith. Examples of lung areas or structures affected by this stretching include, but are not limited to, the alveoli. Thus, in a preferred embodiment, lung overdistension is alveolar overdistension.

Furthermore, in the present invention, other structures that may be affected by lung overdistension include, but are not limited to, airways. “Airways” are understood to mean the areas, structures or organs of the respiratory system through which air flows towards the lungs. In a preferred embodiment, lung overdistension affects the airways.

Examples of airway structures or organs include, but are not limited to, the pharynx, larynx, trachea, bronchi, and bronchioles. Thus, in another preferred embodiment, overdistension affects the pharynx, larynx, trachea, bronchi, and/or bronchioles. Preferably, it affects the bronchi and/or bronchioles.

Preferably, overdistension affects small airways. As it is used herein, small airways mean those structures, areas or organs of the airways that do not have cartilage. Thus, in another preferred embodiment, overdistension affects airways that do not have cartilage.

Lung overdistension can be caused by elevated pressures in the aforementioned areas or structures, for example, but without limitation to, the application of mechanical ventilation. Thus, in a preferred embodiment of the methods of the invention, the subject has been or is being subjected to mechanical ventilation.

As understood by a person skilled in the art, in addition to lung overdistension, the subject may suffer from other lung injuries or damage. In fact, in many cases, mechanical ventilation is applied when the subject suffers from lung injury. In that sense, in a preferred embodiment of the methods of the invention, the subject suffers from lung injury.

The term “lung injury” refers to an inflammatory disorder which affects lung structures and areas, characterized by damages to them such as disruption of the pulmonary endothelium or epithelial barriers, and which may include the loss of alveolar capillaries, membrane integrity, or the release of proinflammatory and cytotoxic molecules, causing breathing difficulties. As used herein, “mechanical ventilation” refers to therapeutic treatments or procedures which are based on the application of pressure to the airways of a subject through an external mechanical system, and used for the purpose of mechanically assisting the lung ventilation of an individual and/or improving oxygenation. However, applying pressure to the airways may cause certain types of lung injuries or conditions including, among others, lung overdistension.

In a preferred embodiment, mechanical ventilation comprises a tidal volume of 6 to 12 ml/kg of patient weight (including end values). Preferably, mechanical ventilation comprises a tidal volume of 6 to 8 ml/kg of patient weight (including the end values).

Different mechanical ventilation strategies can be followed, depending among other aspects, on the degree of lung overdistension in the subject. As a result, diagnosing or identifying the degree of lung overdistension, monitoring its evolution, and/or evaluating the effectiveness of treatments for lung overdistension, is relevant in clinical practice, given that healthcare professionals can adjust or customize mechanical ventilation in a subject based on same. Thus, the methods of the invention, which have high specificity and sensitivity, are applicable for adjusting mechanical ventilation in a subject.

Likewise, it should be mentioned that the methods of the invention that will be described below are applicable to any subject. The term “subject” or “individual”, as it is used herein, refers to any animal, preferably a mammal, and includes, but is not limited to, domestic and farm animals, primates, and humans. In a preferred embodiment of the methods of the invention, the subject is a human being, of any sex, age, or race. Furthermore, the sample in which the levels of microRNAs are to be measured can be any biological sample from or isolated from the subject. Thus, in the present invention, a "sample" means a small part or amount of something which is considered representative of the whole and taken or separated from said whole in order to be subjected to a study, an analysis, or an experimentation. In particular, in the present invention, the term "sample" encompasses samples of biological origin isolated from the subject which include, but are not limited to, blood samples and other liquid samples of biological origin, solid tissue samples, such as biopsy samples, or tissue cultures or cells derived therefrom and the progeny thereof, such as cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples. Nevertheless, in a preferred embodiment of the methods of the invention, the isolated biological sample is blood, serum, plasma, or bronchial fluid. The term "isolated" means that the biological sample has been separated or extracted from the rest of the components occurring naturally therewith. Techniques for obtaining biological samples from an individual are widely known in the state of the art, and any of said techniques can be used in the practice of the present invention.

Diagnostic method of the invention

Having described the foregoing, an aspect of the present invention relates to an in vitro method for lung overdistension diagnosis in a subject, hereinafter the “diagnostic method of the invention”, which comprises the following steps:

(a) determining the levels of at least one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR- 581 in an isolated biological sample from a subject, and

(b) comparing the levels of microRNA determined in step (a) with control values and detecting a significant deviation from said control values, wherein said comparison and detection of the significant deviation allows the diagnosis of lung overdistension.

The term "diagnose", as it is used herein, refers to the action of identifying a specific disease, nosological entity, syndrome, or any health-disease condition, by means of analyzing a series of clinical parameters or symptoms characteristic of said disease and which distinguish it from other diseases with similar clinical conditions and/or from a subject not suffering from said disease. In the present invention, it relates to the identification of lung overdistension, and the clinical parameter is the levels of microRNA.

In a first step [step (a)], the diagnostic method of the invention comprises determining the levels of, at least, one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 in an isolated biological sample from a subject. The sample can be treated to isolate nucleic acids prior to this step. Techniques for isolating nucleic acids are routine laboratory practice and widely known to one skilled in the art.

In the present invention, the term “levels” refers to the concentration, amount of microRNA in a biological sample, also including the expression levels of microRNA in a biological sample. In the present invention, the term "microRNA (miRNA)" refers to a class of non-coding RNA that plays an important role in the regulation of gene expression. Most miRNAs are transcribed from DNA sequences into primary miRNAs and processed into precursor miRNAs (pre-microRNAs) and, finally, into mature miRNAs. The deregulation of processes involving miRNAs can be the cause of various pathologies, while changes in the levels thereof can be indicators of certain conditions, illness, or pathologies. In the present document, the terms microRNA, miRNA, or miR are used interchangeably.

In the present invention, the microRNAs or miRNAs, the levels of which are determined alone or in combination, miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and/or miR-581 , also being referred to as microRNAs or miRNAs of the invention throughout the present document, may comprise pre-microRNA (pre-miR or mir, terms used interchangeably in the present invention) and/or mature miRNA.

Thus, in a preferred embodiment of the methods of the invention, miR-483 is mir-483 and/or miR-483-3p and/or miR-483-5p.

In another preferred embodiment of the methods of the invention, miR130a is mir-130a and/or miR-130a-3p and/or miR-130a-5p.

In another preferred embodiment of the methods of the invention, miR-146a is mir-146a and/or miR-146a-3p and/or miR-146a-5p.

In another preferred embodiment of the methods of the invention, miR-609 is mir-609 and/or mature miR-609.

In another preferred embodiment of the methods of the invention, miR-375 is mir-375 and/or miR-375-3p and/or miR-375-5p.

In another preferred embodiment of the methods of the invention, miR-658 is mir-658 and/or mature miR-658.

In another preferred embodiment of the methods of the invention, miR-921 is mir-921 and/or mature miR-921 .

In another preferred embodiment of the methods of the invention, miR-581 is mir-581 and/or mature miR-581 .

Thus, in a preferred embodiment, the levels of, at least, one microRNA selected from the list consisting of: mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a- 5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR- 375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 , and miR-581 are determined.

In the diagnostic method of the invention, the levels of microRNAs of the invention can be determined in a combined manner. In particular, the levels of any combination of the microRNAs of the invention can be determined in the present method of the invention, as well as in the following aspects of the invention. Therefore, in the present method of the invention, as well as in the following aspects of the invention, the levels of microRNA may comprise the levels of any combination of the microRNAs of the invention.

Thus, a preferred embodiment of the diagnostic method of the invention comprises determining the microRNA levels, wherein the microRNA levels comprise the levels of at least two, three, four, five, six, seven, or eight microRNAs selected from the list consisting of: miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 , in an isolated biological sample from a subject.

In another preferred embodiment of the diagnostic method of the invention, the microRNA levels comprise the levels of miR-483 and miR130a. In another preferred embodiment, the levels of miR-483 and miR-146a are determined. In another preferred embodiment, the levels of miR-483 and miR-609 are determined. In another preferred embodiment, the levels of miR-483 and miR-375 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR-483 and miR-658. In another preferred embodiment, the levels of miR-483 and miR-921 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR-483 and miR-581. In another preferred embodiment, the levels of miR130a and miR-146a are determined. In another preferred embodiment, the levels of miR130a and miR-609 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR130a and miR-375. In another preferred embodiment, the levels of miR130a and miR-658 are determined. In another preferred embodiment, the levels of miR130a and miR-921 are determined. In another preferred embodiment, the levels of miR130a and miR-581 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR-146a and miR-609. In another preferred embodiment, the levels of miR-146a and miR-375 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR-146a and miR-658. In another preferred embodiment, the levels of miR-146a and miR-921 are determined.

In another preferred embodiment, the microRNA levels comprise the levels of miR-146a and miR-581. In another preferred embodiment, the levels of miR-609 and miR-375 are determined. In another preferred embodiment, the levels of microRNA comprise the levels of miR-609 and miR-658. In another preferred embodiment, the microRNA levels comprise the levels of miR-609 and miR-921. In another preferred embodiment, the levels of miR-609 and miR-581 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR-375 and miR-658. In another preferred embodiment, the microRNA levels comprise the levels of miR-375 and miR-921. In another preferred embodiment, the levels of miR-375 and miR-581 are determined. In another preferred embodiment, the microRNA levels comprise the levels of miR-658 and miR-921 . In another preferred embodiment, the microRNA levels comprise the levels of miR-658 and miR-581 . In another preferred embodiment, the levels of miR-921 and miR- 581 are determined.

In another preferred embodiment of the diagnostic method of the invention, the levels of, at least, 3 microRNAs of the invention are determined. More preferably, the microRNA levels comprise the levels of: miR-483, miR130a and miR-146a; or miR-483, miR130a and miR-609; or miR-483, miR130a and miR-375; or miR-483, miR130a and miR-658; or miR-483, miR130a and miR-921 ; or miR-483, miR130a and miR-581 ; or miR-483, miR-146a and miR-609; or miR-483, miR-146a and miR-375; or miR-483, miR-146a and miR-658; or miR-483, miR- 146a and miR-921 ; or miR-483, miR-146a and miR-581 ; or miR-483, miR-609 and miR- 375; or miR-483, miR-609 and miR-658; or miR-483, miR-609 and miR-921 ; or miR-483, miR-609 and miR-581 ; or miR-483, miR-375 and miR-658; or miR-483, miR-375 and miR-921 ; or miR-483, miR-375 and miR-581 ; or miR-483, miR-658 and miR-921 ; or miR- 483, miR-658 and miR-581 ; or miR-483, miR-921 and miR-581 ; or miR130a, miR-146a and miR-609; or miR130a, miR-146a and miR-375; or miR130a, miR-146a and miR-658; or miR130a, miR-146a and miR-921 ; or miR130a, miR-146a and miR-581 ; or miR130a, miR-609 and miR-375; or miR130a, miR-609 and miR-658; or miR130a, miR-609 and miR-921 ; or miR130a, miR-609 and miR-581 ; or miR130a, miR-375 and miR-658; or miR130a, miR-375 and miR-921 ; or miR130a, miR-375 and miR-581 ; or miR130a, miR- 658 and miR-921 ; or miR130a, miR-658 and miR-581 ; or miR130a, miR-921 and miR- 581 ; or miR-146a, miR-609 and miR-375; or miR-146a, miR-609 and miR-658; or miR- 146a, miR-609 and miR-921 ; or miR-146a, miR-609 and miR-581 ; or miR-146a, miR- 375 and miR-658; or miR-146a, miR-375 and miR-921 ; or miR-146a, miR-375 and miR- 581 ; or miR-146a, miR-658 and miR-921 ; or miR-146a, miR-658 and miR-581 ; or miR- 146a, miR-921 and miR-581 ; or miR-609, miR-375 and miR-658; or miR-609, miR-375 and miR-921 ; or miR-609, miR-375 and miR-581 ; or miR-609, miR-658 and miR-921 ; or miR-609, miR-658 and miR-581 ; or miR-609, miR-921 and miR-581 ; or miR-375, miR- 658 and miR-921 ; or miR-375, miR-658 and miR-581 ; or miR-375, miR-921 and miR- 581 ; or miR-658, miR-921 , and miR-581 .

In another preferred embodiment of the diagnostic method of the invention, the levels of at least 4 microRNAs of the invention are determined. More preferably, the microRNA levels comprise the levels of: miR-483, miR130a, miR-146a and miR-609; or miR-483, miR130a, miR-146a and miR- 375; or miR-483, miR130a, miR-146a and miR-658; or miR-483, miR130a, miR-146a and miR-921 ; or miR-483, miR130a, miR-146a and miR-581 ; or miR-483, miR130a, miR- 609 and miR-375; or miR-483, miR130a, miR-609 and miR-658; or miR-483, miR130a, miR-609 and miR-921 ; or miR-483, miR130a, miR-609 and miR-581 ; or miR-483, miR130a, miR-375 and miR-658; or miR-483, miR130a, miR-375 and miR-921 ; or miR- 483, miR130a, miR-375 and miR-581 ; or miR-483, miR130a, miR-658 and miR-921 ; or miR-483, miR130a, miR-658 and miR-581 ; or miR-483, miR130a, miR-921 and miR- 581 ; or miR-483, miR-146a, miR-609 and miR-375; or miR-483, miR-146a, miR-609 and miR-658; or miR-483, miR-146a, miR-609 and miR-921 ; or miR-483, miR-146a, miR- 609 and miR-581 ; or miR-483, miR-146a, miR-375 and miR-658; or miR-483, miR-146a, miR-375 and miR-921 ; or miR-483, miR-146a, miR-375 and miR-581 ; or miR-483, miR- 146a, miR-658 and miR-921 ; or miR-483, miR-146a, miR-658 and miR-581 ; or miR-483, miR-146a, miR-921 and miR-581 ; or miR-483, miR-609, miR-375 and miR-658; or miR- 483, miR-609, miR-375 and miR-921 ; or miR-483, miR-609, miR-375 and miR-581 ; or miR-483, miR-609, miR-658 and miR-921 ; or miR-483, miR-609, miR-658 and miR-581 ; or miR-483, miR-609, miR-921 and miR-581 ; or miR-483, miR-375, miR-658 and miR- 921 ; or miR-483, miR-375, miR-658 and miR-581 ; or miR-483, miR-375, miR-921 and miR-581 ; or miR-483, miR-658, miR-921 and miR-581 ; or miR130a, miR-146a, miR-609 and miR-375; or miR130a, miR-146a, miR-609 and miR-658; or miR130a, miR-146a, miR-609 and miR-921 ; or miR130a, miR-146a, miR-609 and miR-581 ; or miR130a, miR- 146a, miR-375 and miR-658; or miR130a, miR-146a, miR-375 and miR-921 ; or miR130a, miR-146a, miR-375 and miR-581 ; or miR130a, miR-146a, miR-658 and miR- 921 ; or miR130a, miR-146a, miR-658 and miR-581 ; or miR130a, miR-146a, miR-921 and miR-581 ; or miR130a, miR-609, miR-375 and miR-658; or miR130a, miR-609, miR- 375 and miR-921 ; or miR130a, miR-609, miR-375 and miR-581 ; or miR130a, miR-609, miR-658 and miR-921 ; or miR130a, miR-609, miR-658 and miR-581 ; or miR130a, miR- 609, miR-921 and miR-581 ; or miR130a, miR-375, miR-658 and miR-921 ; or miR130a, miR-375, miR-658 and miR-581 ; or miR130a, miR-375, miR-921 and miR-581 ; or miR130a, miR-658, miR-921 and miR-581 ; or miR-146a, miR-609, miR-375 and miR- 658; or miR-146a, miR-609, miR-375 and miR-921 ; or miR-146a, miR-609, miR-375 and miR-581 ; or miR-146a, miR-609, miR-658 and miR-921 ; or miR-146a, miR-609, miR- 658 and miR-581 ; or miR-146a, miR-609, miR-921 and miR-581 ; or miR-146a, miR-375, miR-658 and miR-921 ; miR-146a, miR-375, miR-658 and miR-581 ; or miR-146a, miR- 375, miR-921 and miR-581 ; or miR-146a, miR-658, miR-921 and miR-581 ; or miR-609, miR-375, miR-658 and miR-921 ; or miR-609, miR-375, miR-658 and miR-581 ; or miR- 609, miR-375, miR-921 and miR-581 ; or miR-609, miR-658, miR-921 and miR-581 ; or miR-375, miR-658, miR-921 , and miR-581.

In another preferred embodiment of the diagnostic method of the invention, the levels of, at least, 5 microRNAs of the invention are determined. More preferably, the microRNA levels comprise the levels of: miR-483, miR130a, miR-146a, miR-609 and miR-375; or miR-483, miR130a, miR-146a, miR-609 and miR-658; or miR-483, miR130a, miR-146a, miR-609 and miR-921 ; or miR- 483, miR130a, miR-146a, miR-609 and miR-581 ; or miR-483, miR130a, miR-146a, miR- 375 and miR-658; or miR-483, miR130a, miR-146a, miR-375 and miR-921 ; or miR-483, miR130a, miR-146a, miR-375 and miR-581 ; or miR-483, miR130a, miR-146a, miR-658 and miR-921 ; or miR-483, miR130a, miR-146a, miR-658 and miR-581 ; or miR-483, miR130a, miR-146a, miR-921 and miR-581 ; or miR-483, miR130a, miR-609, miR-375 and miR-658; or miR-483, miR130a, miR-609, miR-375 and miR-921 ; or miR-483, miR130a, miR-609, miR-375 and miR-581 ; or miR-483, miR130a, miR-609, miR-658 and miR-921 ; or miR-483, miR130a, miR-609, miR-658 and miR-581 ; or miR-483, miR130a, miR-609, miR-921 and miR-581 ; or miR-483, miR130a, miR-375, miR-658 and miR-921 ; or miR-483, miR130a, miR-375, miR-658 and miR-581 ; or miR-483, miR130a, miR-375, miR-921 and miR-581 ; or miR-483, miR130a, miR-658, miR-921 and miR-581 ; or miR-483, miR-146a, miR-609, miR-375 and miR-658; or miR-483, miR- 146a, miR-609, miR-375 and miR-921 ; or miR-483, miR-146a, miR-609, miR-375 and miR-581 ; or miR-483, miR-146a, miR-609, miR-658 and miR-921 ; or miR-483, miR- 146a, miR-609, miR-658 and miR-581 ; or miR-483, miR-146a, miR-609, miR-921 and miR-581 ; or miR-483, miR-146a, miR-375, miR-658 and miR-921 ; or miR-483, miR- 146a, miR-375, miR-658 and miR-581 ; or miR-483, miR-146a, miR-375, miR-921 and miR-581 ; or miR-483, miR-146a, miR-658, miR-921 and miR-581 ; or miR-483, miR-609, miR-375, miR-658 and miR-921 ; or miR-483, miR-609, miR-375, miR-658 and miR-581 ; or miR-483, miR-609, miR-375, miR-921 and miR-581 ; or miR-483, miR-609, miR-658, miR-921 and miR-581 ; or miR-483, miR-375, miR-658, miR-921 and miR-581 ; or miR130a, miR-146a, miR-609, miR-375 and miR-658; or miR130a, miR-146a, miR-609, miR-375 and miR-921 ; or miR130a, miR-146a, miR-609, miR-375 and miR-581 ; or miR130a, miR-146a, miR-609, miR-658 and miR-921 ; or miR130a, miR-146a, miR-609, miR-658 and miR-581 ; or miR130a, miR-146a, miR-609, miR-921 and miR-581 ; or miR130a, miR-146a, miR-375, miR-658 and miR-921 ; or miR130a, miR-146a, miR-375, miR-658 and miR-581 ; or miR130a, miR-146a, miR-375, miR-921 and miR-581 ; or miR130a, miR-146a, miR-658, miR-921 and miR-581 ; or miR130a, miR-609, miR-375, miR-658 and miR-921 ; or miR130a, miR-609, miR-375, miR-658 and miR-581 ; or miR130a, miR-609, miR-375, miR-921 and miR-581 ; or miR130a, miR-609, miR-658, miR-921 and miR-581 ; or miR130a, miR-375, miR-658, miR-921 and miR-581 ; or miR- 146a, miR-609, miR-375, miR-658 and miR-921 ; or miR-146a, miR-609, miR-375, miR- 658 and miR-581 ; or miR-146a, miR-609, miR-375, miR-921 and miR-581 ; or miR-146a, miR-609, miR-658, miR-921 and miR-581 ; or miR-146a, miR-375, miR-658, miR-921 and miR-581 ; or miR-609, miR-375, miR-658, miR-921 , and miR-581 .

In another preferred embodiment of the diagnostic method of the invention, the levels of at least 6 microRNAs of the invention are determined. Preferably, the microRNA levels comprise the levels of: miR-483, miR130a, miR-146a, miR-609, miR-375 and miR-658; or miR-483, miR130a, miR-146a, miR-609, miR-375 and miR-921 ; or miR-483, miR130a, miR-146a, miR-609, miR-375 and miR-581 ; or miR-483, miR130a, miR-146a, miR-609, miR-658 and miR- 921 ; or miR-483, miR130a, miR-146a, miR-609, miR-658 and miR-581 ; or miR-483, miR130a, miR-146a, miR-609, miR-921 and miR-581 ; or miR-483, miR130a, miR-146a, miR-375, miR-658 and miR-921 ; or miR-483, miR130a, miR-146a, miR-375, miR-658 and miR-581 ; or miR-483, miR130a, miR-146a, miR-375, miR-921 and miR-581 ; or miR- 483, miR130a, miR-146a, miR-658, miR-921 and miR-581 ; or miR-483, miR130a, miR- 609, miR-375, miR-658 and miR-921 ; or miR-483, miR130a, miR-609, miR-375, miR- 658 and miR-581 ; or miR-483, miR130a, miR-609, miR-375, miR-921 and miR-581 ; or miR-483, miR130a, miR-609, miR-658, miR-921 and miR-581 ; or miR-483, miR130a, miR-375, miR-658, miR-921 and miR-581 ; or miR-483, miR-146a, miR-609, miR-375, miR-658 and miR-921 ; or miR-483, miR-146a, miR-609, miR-375, miR-658 and miR- 581 ; or miR-483, miR-146a, miR-609, miR-375, miR-921 and miR-581 ; or miR-483, miR- 146a, miR-609, miR-658, miR-921 and miR-581 ; or miR-483, miR-146a, miR-375, miR- 658, miR-921 and miR-581 ; or miR-483, miR-609, miR-375, miR-658, miR-921 and miR- 581 ; or miR130a, miR-146a, miR-609, miR-375, miR-658 and miR-921 ; or miR130a, miR-146a, miR-609, miR-375, miR-658 and miR-581 ; or miR130a, miR-146a, miR-609, miR-375, miR-921 and miR-581 ; or miR130a, miR-146a, miR-609, miR-658, miR-921 and miR-581 ; or miR130a, miR-146a, miR-375, miR-658, miR-921 and miR-581 ; or miR130a, miR-609, miR-375, miR-658, miR-921 and miR-581 ; or miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581.

In another preferred embodiment of the diagnostic method of the invention, the levels of, at least, 7 microRNAs of the invention are determined.

In another preferred embodiment of the diagnostic method of the invention, the microRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR- 375, miR-658, and miR-921. In another preferred embodiment, the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, and miR-581. In another preferred embodiment, the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-921 , and miR-581. In another preferred embodiment, the levels of microRNA comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR-658, miR-921 , and miR-581. In another preferred embodiment, the levels of microRNA comprise the levels of miR-483, miR130a, miR-146a, miR-375, miR-658, miR-921 , and miR-581. In another preferred embodiment, the levels of miR-483, miR130a, miR-609, miR-375, miR-658, miR-921 , miR-581 are determined. In another preferred embodiment, the levels of microRNA comprise the levels of miR-483, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 . In another preferred embodiment, the levels of microRNA comprise the levels of miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 .

Preferably, the levels of the 8 microRNAs of the invention are determined. Thus, in another more preferred embodiment of the diagnostic method of the invention, the levels of microRNA comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581.

In another preferred embodiment of the diagnostic method of the invention, the levels of mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir- 658, miR-658, mir-921 , miR-921 , mir-581 , and miR-581 are determined. miR-483-3p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 1.

SEQ ID NO: 1

UCACUCCUCUCCUCCCGUCUU

Sequence SEQ ID NO: 1 corresponds to the sequence of miR-483-3p in homo sapiens (hsa-miR-483-3p, miRBase version 22, accession number: MIMAT0002173). In a more preferred embodiment, the miR-483-3p comprises, or consists, of sequence SEQ ID NO:

1. miR-483-5p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 2.

SEQ ID NO: 2

AAGACGGGAGGAAAGAAGGGAG

Sequence SEQ ID NO: 2 corresponds to the sequence of miR-483-5p in homo sapiens (hsa-miR-483-5p, miRBase version 22, accession number: MIMAT0004761 ). In a more preferred embodiment, the miR-483-5p comprises, or consists of, sequence SEQ ID NO:

2. miR-130a-3p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 3.

SEQ ID NO: 3 CAGUGCAAUGUIIAAAAGGGCAU

Sequence SEQ ID NO: 3 corresponds to the sequence of miR-130a-3p in homo sapiens (hsa-miR-130a-3p, miRBase version 22, accession number: MIMAT0000425). In a more preferred embodiment, the miR-130a-3p comprises, or consists of, sequence SEQ ID NO: 3. miR-130a-5p is an miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 4.

SEQ ID NO: 4

GCUCUUUUCACAUUGUGCIIACII

Sequence SEQ ID NO: 4 corresponds to the sequence of miR-130a-5p in homo sapiens (hsa-miR-130a-5p, miRBase version 22, accession number: MIMAT0004593). In a more preferred embodiment, the miR-130a-5p comprises, or consists of, sequence SEQ ID NO:4. miR-146a-3p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO: 5.

SEQ ID NO: 5

CCUCUGAAAUUCAGUUCUUCAG

Sequence SEQ ID NO: 5 corresponds to the sequence of miR-146a-3p in homo sapiens (hsa-miR-146a-3p, miRBase version 22, accession number: MIMAT0004608). In a more preferred embodiment, the miR-146a-3p comprises, or consists of, sequence SEQ ID NO:5. miR-146a-5p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence of SEQ ID NO:6.

SEQ ID NO: 6 UGAGAACUGAAUUCCAUGGGUU

Sequence SEQ ID NO: 6 corresponds to the sequence of miR-146a-5p in homo sapiens (hsa-miR-146a-5p, miRBase version 22, accession number: MIMAT0000449). In a more preferred embodiment, the miR-146a-5p comprises, or consists of, sequence SEQ ID NO:6. miR-609 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 7

SEQ ID NO: 7

AGGGUGUUUCUCUCAUCLICll

Sequence SEQ ID NO: 7 corresponds to the sequence of miR-609 in homo sapiens (hsa- miR-609, miRBase version 22, accession number: MIMAT0003277). In a more preferred embodiment, miR-609 comprises, or consists of, sequence SEQ ID NO:7. miR-375-3p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% yo sequence SEQ ID NO:8.

SEQ ID NO: 8

UUUGUUCGUUCGGCUCGCGUGA

Sequence SEQ ID NO: 8 corresponds to the sequence of miR-375-3p in homo sapiens (hsa-miR-375-3p, miRBase version 22, accession number: MIMAT0000728). In a more preferred embodiment, miR-375-3p comprises, or consists of, sequence SEQ ID NO:8. miR-375-5p is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:9

SEQ ID NO: 9

GCGACGAGCCCCUCGCACAAACC Sequence SEQ ID NO: 9 corresponds to the sequence of miR-375-5p in homo sapiens (hsa-miR-375-5p, miRBase version 22, accession number: MIMAT0037313). In a more preferred embodiment, miR-375-5p comprises, or consists of, sequence SEQ ID NO: 9. miR-658 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at leas,t 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:10.

SEQ ID NO: 10

GGCGGAGGGAAGUAGGUCCGIIIIGGII

Sequence SEQ ID NO: 10 corresponds to the sequence of miR-658 in homo sapiens (hsa-miR-658, miRBase version 22, accession number: MIMAT0003336). In a more preferred embodiment, miR-658 comprises, or consists of, sequence SEQ ID NO:10. miR-921 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:11.

SEQ ID NO: 11

CUAGUGAGGGACAGAACCAGGAULIC

Sequence SEQ ID NO: 11 corresponds to the sequence of miR-921 in homo sapiens (hsa-miR-921 , miRBase version 22, accession number: MIMAT0004971 ). In a more preferred embodiment, miR-921 comprises, or consists of, sequence SEQ ID NO:1 1 . miR-581 is a miRNA comprising or consisting of a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:12.

SEQ ID NO: 12

UCUUGUGUUCUCUAGAUCAGU

Sequence SEQ ID NO: 12 corresponds to the sequence of miR-581 in homo sapiens (hsa-miR-581 , miRBase version 22, accession number: MIMAT0003246). In a more preferred embodiment, miR-581 comprises, or consists of, sequence SEQ ID NO: 12. mir-483 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence

SEQ ID NO:13.

SEQ ID NO: 13 GAGGGGGAAGACGGGAGGAAAGAAGGGAGUGGUIICCAUCACGCCIICCIICACUC CUCUCCUCCCGUCUUCUCCUCUC

Sequence SEQ ID NO: 13 corresponds to the sequence of pre-miR-483 or mir-483 in homo sapiens (hsa-mir-483, miRBase version 22, accession number: MI0002467). In a more preferred embodiment, mir-483 comprises, or consists, of sequence SEQ ID NO:13. mir-130a is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:14.

SEQ ID NO: 14 UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCIIACUGIICIIGCACCUGIICACUA GCAGUGCAAUGUUAAAAGGGCAUIIGGCCGIIGIIAGIIG

Sequence SEQ ID NO: 14 corresponds to the sequence of pre-miR-130a or mir-130a in homo sapiens (hsa-mir-130a, miRBase version 22, accession number: MI0000448). In a more preferred embodiment, mir-130a comprises, or consists of, sequence SEQ ID NO: 14. miR-146a is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:15.

SEQ ID NO: 15

CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGIIIIGIIGIICAGIIGI IC AGACCUCUGAAAUUCAGUUCUUCAGCIIGGGAUAUCIICIIGIICAUCGII

Sequence SEQ ID NO: 15 corresponds to the sequence of pre-miR-146a or mir-146a in homo sapiens (hsa-mir-146a, miRBase version 22, accession number: MI0000477). In a more preferred embodiment, mir-146a comprises, or consists of, sequence SEQ ID NO:15. mir-609 is an miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99% to sequence SEQ ID NO:16.

SEQ ID NO: 16

UGCUCGGCUGUUCCUAGGGUGUUUCUCUCAUCUCUGGUCUAIIAAIJGGGIIIIAAA UAGUAGAGAUGAGGGCAACACCCLIAGGAACAGCAGAGGAACC

Sequence SEQ ID NO: 16 corresponds to the sequence of pre-miR-609 or mir-609 in homo sapiens (hsa-mir-609, miRBase version 22, accession number: MI0003622). In a more preferred embodiment, mir-609 comprises, or consists of, sequence SEQ ID NO:

16. mir-375 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 17.

SEQ ID NO: 17

CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGC UCGCGUGAGGC

Sequence SEQ ID NO: 17 corresponds to the sequence of pre-miR-375 or mir-375 in homo sapiens (hsa-mir-375, miRBase version 22, accession number: MI0000783). In a more preferred embodiment, mir-375 comprises, or consists of, sequence SEQ ID NO:

17. mir-658 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 18.

SEQ ID NO: 18

GCUCGGUUGCCGUGGUUGCGGGCCCUGCCCGCCCGCCAGCUCGCUGACAGCA CGACUCAGGGCGGAGGGAAGUAGGUCCGUUGGUCGGUCGGGAACGAGG

Sequence SEQ ID NO: 18 corresponds to the sequence of pre-miR-658 or mir-658 in homo sapiens (hsa-mir-658, miRBase version 22, accession number: MI0003682). In a more preferred embodiment, mir-658 comprises, or consists of, sequence SEQ ID NO:

18. mir-921 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 19.

SEQ ID NO: 19

ACUAGUGAGGGACAGAACCAGGAUIICAGACIICAGGIICCAUGGGCCIIGGAUCAC UGG

Sequence SEQ ID NO: 19 corresponds to the sequence of pre-miR-921 or mir-921 in homo sapiens (hsa-mir-921 , miRBase version 22, accession number: MI0005713). In a more preferred embodiment, mir-921 comprises, or consists of, sequence SEQ ID NO:

19. mir-581 is a miRNA comprising, or consisting of, a nucleotide sequence with a sequence identity of, at least, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% to sequence SEQ ID NO: 20.

SEQ ID NO: 20

GUUAUGUGAAGGUAUUCUUGUGUUCUCUAGAUCAGUGCUUUUAGAAAAUUUGU GUGAUCUAAAGAACACAAAGAAUACCUACACAGAACCACCUGC

Sequence SEQ ID NO: 20 corresponds to the sequence of pre-miR-581 or mir-581 in homo sapiens (hsa-mir-581 , miRBase version 22, accession number: MI0003588). In a more preferred embodiment, mir-581 comprises, or consists of, sequence SEQ ID NO:

20.

In the present invention, "sequence identity" is understood to mean the degree of similarity between two nucleotide (or amino acid) sequences obtained by means of aligning the two sequences. Depending on the number of common residues between the aligned sequences, a degree of identity expressed as a percentage will be obtained. The degree of identity between two nucleotide (or amino acid) sequences can be determined by conventional methods, for example, by means of standard sequence alignment algorithms known in the state of the art such as, for example, BLAST [Altschul S.F. et al. Basic local alignment search tool. J Mol Biol. 5 October 1990). 215(3):403-10]. BLAST programs, for example, BLASTN, BLASTX, and TBLASTX, BLASTP and TBLASTN, are public domain found on the website of The National Center for Biotechnology Information (NCBI).

As understood by a person skilled in the art, the determination of said levels of miRNAs can be carried out by means of conventional methodologies well known in the state of the art. Examples of methods for determining the levels miRNA include, but are not limited to, immunoassays, for example, ELISA (an abbreviation for Enzyme-Linked ImmunoSorbent Assay), molecular biology essays, for example, quantitative PCR (qPCR), sequencing methods (for example, small size RNA sequencing, miRNA-seq, Next-generation sequencing), miRNA arrays or microarrays, detection by NanoString nCounter, in situ miRNA hybridization, or biochemical tests, for example, colorimetric tests or others. In a particular embodiment of the diagnostic method of the invention, the levels of miRNA are determined by miRNA sequencing.

Once the levels of the miRNA(s) of the invention have been determined in step (a), the diagnostic method of the invention comprises comparing said levels with control values [step (b)].

In the diagnostic method of the invention, the term "control values" refers to the miRNA(s levels in a healthy subject, or to the mean levels of miRNA/s in a cohort of healthy subjects. Methods for determining the miRNA levels have been described in the preceding paragraphs.

Finally, from the comparison between the levels of miRNA/s with control values and the detection of a significant deviation from those control values, whether an individual suffers from lung overdistension can be known.

“Significant deviation” is understood to mean that the determined levels are different from the control values. For miR-483, miR-658, and/or miR-921 , this significant deviation may result in an increased levels with respect to the control values, while for miR-130a, miR- 146a, miR-375, miR-581 and/or miR-609, deviation from the control values may result, in contrast, in decreased levels. An increase in the levels of miR-483, miR-658, and/or miR-921 , and/or a decrease in the levels of miR-130a, miR-146a, miR-375, miR-581 , and/or miR-609, with respect to control values, indicates that the subject suffers from lung overdistension.

In a preferred embodiment, the determined levels are different in, at least, 1 .5 times the standard deviation. In another preferred embodiment, the determined levels differ by 1 .5 times, 1 .55 times, 1 .6 times, 1 .65 times, 1 .70 times, 1 .80 times, 1 .90 times, 1 .95 times, 2 times, 2.05 times, 2.10 times, 2.15 times, 2.20 times the standard deviation or more.

Furthermore, based on the levels of the microRNAs of the invention, it is possible to obtain a lung overdistension index that is useful in the diagnostic method of the invention, as well as in the other methods of the invention. The lung overdistension index can be obtained by means of calculating the geometric mean of the levels of miR-921 , miR-483, and miR-658, minus the geometric mean of the levels of miR130a, miR-146a, miR-609, miR-375, and miR-581 .

Thus, a particular embodiment of the diagnostic method of the invention comprises an additional stage (a'), previous to step (b) of the method, of obtaining a lung overdistension index, which comprises:

- calculating the geometric mean of the levels of miR-921 , miR-483 and miR-658 determined in (a),

- calculating the geometric mean of the levels of miR130a, miR-146a, miR-609, miR-375, and miR-581 determined in (a), and

- calculating the difference between both geometric means, obtaining a value for the lung overdistension index.

Comparing the value obtained for the lung overdistension index with control values of the lung overdistension index and detecting a significant deviation, allow the diagnosis of lung overdistension. Specifically, a lung overdistension index significantly elevated with respect to the control value, indicates that the subject suffers from or has lung overdistension.

Control values of the lung overdistension index" are understood to be the geometric mean of the levels of miR-921 , miR-483, and miR-658 minus the geometric mean of the levels of miR130a, miR-146a, miR-609, miR-375 and miR-581 in a healthy subject.

Thus, in a preferred embodiment of the diagnostic method of the invention, control values comprise the control values of the lung overdistension index.

In another preferred embodiment, the step (b) comprises comparing the levels determined in step (a) with control values and/or comparing the value obtained for the lung overdistension index, and detecting a significant deviation from those control values and/or from a control value of the lung overdistension index, wherein said comparison and detection of the significant deviation allows the lung overdistension diagnosis.

Monitoring method of the invention

Another method of the present invention, also based on the miRNA levels, is a method for monitoring the evolution of lung overdistension. Thus, another aspect of the present invention relates to an in vitro method for monitoring the evolution of lung overdistension in a subject, hereinafter the “monitoring method of the invention”, which comprises the following steps:

(a) determining in, at least, two different moments in time, the levels of at least one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR- 609, miR-375, miR-658, miR-921 and miR-581 , in an isolated biological sample from a subject, and

(b) comparing the levels of microRNA determined in said moments with one another and detecting a significant deviation between said levels, wherein said comparison and detection of the significant deviation allows monitoring the evolution of lung overdistension in the subject over time.

The terms used to define the present aspect of the invention have been explained in preceding inventive aspects, applying, as well as their preferred embodiments, to the present aspect of the invention, including the term “miRNA”, as well as the preferred embodiments of the miRNAs of the invention.

In the present invention, the expression "monitoring the evolution of lung overdistension" refers to predicting and/or evaluating the course of lung overdistension in a subject. Monitoring the evolution of lung overdistension can ease clinical decisions, such as customizing the treatment strategy to be followed for said subject, including, without limitation to, adjusting mechanical ventilation in a subject, defining groups of patients according to its degree of progression, or improving the design and analysis of clinical studies and trials by stratifying patients. In the present invention, the evolution or course of the disease can be monitored by determining, comparing and detecting significant deviations between the miRNAs levels at different moments in time.

Step (a) of the monitoring method of the invention comprises determining the levels of miRNA/s in an isolated biological sample from the subject in, at least, two different moments in time. The term "miRNA" has been defined and explained in the diagnostic method of the invention, applying, as well as the preferred embodiments of the miRNAs of the invention to the present method.

In a preferred embodiment, the levels of, at least, one microRNA selected from the list consisting of: mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR- 375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 and miR-581 are determined.

In the monitoring method of the invention, as in the diagnostic method of the invention, the levels of microRNAs can be determined in a combined manner. As in the diagnostic method of the invention, the levels of any of the combinations of the microRNAs of the invention mentioned can be susceptible to be determined in the monitoring method of the invention. Therefore, in the present method of the invention, as well as in the following aspects of the invention, the microRNA levels may comprise the levels of any combination of the microRNAs of the invention.

In a more preferred embodiment of the monitoring method of the invention, the microRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 . Preferably, the microRNA levels comprise the levels of mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a- 3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR- 658, mir-921 , miR-921 , mir-581 and miR-581.

In the present invention, the expression "different moments in time" is understood to mean moments sufficiently separated in time, in other words, the minimum time lapse between two moments, which allows concluding how lung overdistension evolves over time. Preferably, in the present invention, the time lapse between the two moments considered sufficient to conclude how the disease evolves is at least 4 hours. In another preferred embodiment, the time lapse between the two moments sufficient to conclude how the disease evolves is 4, 5, 6, 7, 8, 9 hours or more.

After determining the levels of miRNAs in step (b) of the monitoring method of the invention, these levels are compared to one another, and the possible existence of a significant deviation between the values of the levels compared is detected. Thus, said comparison and detection of the significant deviation allows monitoring the evolution of lung overdistension in the subject over time.

“Significant deviation” is understood to mean that the levels compared are different from one another. In a preferred embodiment, the determined levels are different in, at least, 1 .5 times the standard deviation. In another preferred embodiment, the determined levels differ by 1 .5 times, 1 .55 times, 1 .6 times, 1 .65 times, 1 .70 times, 1 .80 times, 1 .90 times, 1.95 times, 2 times, 2.05 times, 2.10 times, 2.15 times, 2.20 times or more the standard deviation.

In the monitoring method of the invention, an increase in the levels of miR-483, miR-658 and/or miR-921 , and/or a decrease in the levels of miR-130a, miR-146a, miR-375, miR- 581 and/or miR-609, being compared, indicates that the lung overdistension in the subject evolves negatively. The term “evolves negatively" refers to the fact that the subject exhibits a worsening of its health condition related to lung overdistension.

Furthermore, as in the diagnostic method of the invention, it is possible, based on the levels of the microRNAs of the invention, to obtain a lung overdistension index that is useful in the monitoring method of the invention, which is obtained by means of calculating the difference in the geometric mean of the levels of miR-921 , miR-483 and miR-658 with respect to the geometric mean of the levels of miR130a, miR-146a, miR- 609, miR-375 and miR-581 .

Thus, a particular embodiment of the monitoring method of the invention comprises an additional step (a'), previous to step (b) of the method, of obtaining a lung overdistension index, which comprises:

- calculating the geometric mean of the levels of miR-921 , miR-483 and miR-658 determined in (a),

- calculating the geometric mean of the levels of miR130a, miR-146a, miR-609, miR-375 and miR-581 determined in (a), and

- calculating the difference between both geometric means, obtaining a value for the lung overdistension index.

Comparing the value obtained for the lung overdistension index at different moments in time and detecting a significant deviation, allows monitoring the evolution of lung overdistension in the subject over time. Specifically, an increase in the calculated overdistension index over time indicates that the lung overdistension in the subject evolves negatively.

As in the other methods of the invention, the monitoring method of the invention is applicable for adjusting mechanical ventilation in a subject.

Treatment evaluation method of the invention

Another application of the invention, also based on the same concept of determining the levels of the miRNAs of the invention, and comparing and detecting significant deviations with respect to other values, relates to a method for evaluating the response to a lung overdistension treatment. Thus, in another aspect, the present invention relates to an in vitro method for evaluating the response of a subject to a lung overdistension treatment, hereinafter the "treatment evaluation method of the invention", which comprises the following steps:

(a) determining, before and after treatment, the levels of, at least, one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR-609, miR- 375, miR-658, miR-921 , and miR-581 , in an isolated biological sample from a subject, and

(b) comparing the levels of microRNA determined before the treatment with those obtained after the treatment and detecting a significant deviation between said levels, wherein said comparison and detection of the significant deviation allows evaluating the response of a subject to the treatment.

The terms used to define the present aspect of the invention have been explained in previous inventive aspects, and both applying, as well as their preferred embodiments, to the present aspect of the invention, including the term “miRNA”, as well as the preferred embodiments of the miRNAs of the invention.

Thus, in a preferred embodiment of the treatment evaluation method of the invention, the levels of, at least, one microRNA selected from the list consisting of: mir-483, miR- 483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 , and miR-581 are determined.

In the present method, as in the other methods of the invention, microRNAs can be determined in a combined manner. As in the previous methods of the invention, the levels of any of the combinations of the microRNAs of the invention can be susceptible to be determined in the treatment evaluation method of the invention. Therefore, in the present method of the invention, as well as in the following aspects of the invention, the microRNA levels may comprise the levels of any combination of the microRNAs of the invention.

In a more preferred embodiment of the treatment evaluation method of the invention, the microRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR- 375, miR-658, miR-921 , and miR-581. Even more preferably, the microRNA levels comprise the levels of mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR- 130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375- 3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

In the present invention, the expression “evaluation the response to a treatment" refers to analyzing the capacity of a treatment, particularly a treatment for lung overdistension, to cause a desired result or effect in a subject, and/or verifying whether the treatment causes a change in the health condition or lung overdistension pathology in the subject. Preferably, the treatment being evaluated is mechanical ventilation.

“Significant deviation” is understood to mean that the levels compared are different from one another. In a preferred embodiment, the determined levels are different in, at least, 1 .5 times the standard deviation. In another preferred embodiment, the determined levels differ by 1 .5 times, 1 .55 times, 1 .6 times, 1 .65 times, 1 .70 times, 1 .80 times, 1 .90 times, 1 .95 times, 2 times, 2.05 times, 2.10 times, 2.15 times, 2.20 times the standard deviation or more. In the treatment evaluation method of the invention, a decrease in the levels of miR-483, miR-658, and/or miR-921 , and/or an increase in the levels of miR-130a, miR-146a, miR- 375, miR-581 and/or miR-609, being compared, indicates that the treatment is effective and/or the subject responds positively to treatment.

In the present invention, a subject which “responds positively to treatment” is understood to mean that the treatment has had an effect of improving the subject’s health condition and/or lung overdistension condition.

Furthermore, as in the other methods of the invention, it is possible, based on the levels of the microRNAs of the invention, to obtain a lung overdistension index that is useful in the treatment evaluation method of the invention. This index is obtained by means of calculating the difference in the geometric mean of the levels of miR-921 , miR-483, and miR-658 with respect to the geometric mean of the levels of miR130a, miR-146a, miR- 609, miR-375, and miR-581 .

Thus, a particular embodiment of the treatment evaluation method of the invention comprises an additional stage (a'), previous to step (b) of the method, of obtaining a lung overdistension index, which comprises:

- calculating the geometric mean of the levels of miR-921 , miR-483 and miR-658 determined in (a),

- calculating the geometric mean of the levels of miR130a, miR-146a, miR-609, miR-375 and miR-581 determined in (a), and

- calculating the difference between both geometric means, obtaining a value for the lung overdistension index.

Comparing the value obtained for the lung overdistension index before and after treatment, and detecting a significant deviation, allow evaluating the response of a subject to the treatment. Specifically, if the overdistension index calculated after the treatment is less than that before treatment, the treatment is effective and/or the subject responds positively to the treatment.

As in the other methods of the invention, the treatment evaluation method of the invention is applicable for adjusting mechanical ventilation in a subject. Uses of the Invention

As explained above in the present description, the levels of microRNAs, miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and/or miR-581 , are useful for the lung overdistension diagnosis, the monitoring of the evolution of lung overdistension and the evaluation of the response to in vitro treatments for lung overdistension in subjects. Thus, the present invention contemplates the uses of the levels of said miRNAs as inventive aspects.

As explained above in the present description, lung overdistension can be caused when mechanical ventilation is applied. Thus, in a preferred embodiment of the uses of the invention, the subject has been or is being subjected to mechanical ventilation. In another additional preferred embodiment, the subject suffers from a lung injury.

Furthermore, the uses of the invention, being based on the same concept as the methods of the invention, are also applicable in the adjustment of mechanical ventilation in a subject.

Diagnostic use of the invention

Thus, another aspect of the present invention relates to the use of the levels of, at least, one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR- 609, miR-375, miR-658, miR-921 and miR-581 , for the in vitro lung overdistension diagnosis in a subject, hereinafter the “diagnostic use of the invention”.

In the present diagnostic use of the invention, levels different from control values, preferably elevated levels of miR-483, miR-658 and/or miR-921 , and/or lower levels of miR-130a, miR-146a, miR-375, miR-581 and/or miR-609, with respect to control values, indicate that the subject suffers from lung overdistension.

In a more preferred embodiment, the levels are different in, at least, 1.5 times the standard deviation. In other even more preferred embodiment, the levels differ by 1 .5 times, 1 .55 times, 1 .6 times, 1 .65 times, 1 .70 times, 1 .80 times, 1 .90 times, 1 .95 times, 2 times, 2.05 times, 2.10 times, 2.15 times, 2.20 times the standard deviation or more.

The terms used to define the present aspect of the invention have been explained in the previous inventive aspects, applying, as well as their preferred embodiments, to the present use of the invention, including the terms or expressions “subject”, "lung overdistension", “diagnosis”, and “control values”.

The term "miRNA", as well as the preferred embodiments of the miRNAs of the invention, have also been defined in previous inventive aspects and are applicable to the present use of the invention.

Thus, a preferred embodiment of the diagnostic use of the invention comprises the use of the levels of, at least, one microRNA selected from the list consisting of: mir-483, miR- 483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

As in the methods of the invention, for the diagnostic use of the invention, in some preferred embodiments, the levels of each one of the combinations of the microRNAs of the invention are contemplated.

In a more preferred embodiment of the diagnostic use of the invention, the microRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 and miR-581. Even more preferably, the microRNA levels comprise the levels of mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir- 658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

The terms defined and explained for the methods of the invention, as well as preferred embodiments thereof are also applicable to the uses of the invention. Likewise, the terms "subject" and "sample" have been defined in other aspects of the present invention and are applicable to the uses of the invention. Likewise, the preferred embodiments of said terms are also applicable to the uses of the invention. Thus, in a preferred embodiment, the isolated biological sample is blood, serum, plasma or bronchial fluid. In another preferred embodiment, the subject is a human being.

Monitoring use of the invention

Another aspect of the present invention relates to the use of the levels of, at least, one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 and miR-581 for the in vitro monitoring of the evolution of lung overdistension in a subject, hereinafter the "monitoring use of the invention."

In the present monitoring use of the invention, different levels over time, preferably an increase in the levels of miR-483, miR-658 and/or miR-921 , and/or a decrease in the levels of miR-130a, miR-146a, miR-375, miR-581 and/or miR-609, over time, indicate that the lung overdistension in the subject evolves negatively. The term “evolves negatively" refers to the fact that the subject exhibits a worsening of its health condition related to lung overdistension.

In a more preferred embodiment, the levels are different in, at least, 1.5 times the standard deviation. In another even more preferred embodiment, the levels differ by 1.5 times, 1 .55 times, 1 .6 times, 1 .65 times, 1 .70 times, 1 .80 times, 1 .90 times, 1 .95 times, 2 times, 2.05 times, 2.10 times, 2.15 times, 2.20 times the standard deviation or more.

The terms used to define the present aspect of the invention have been explained in previous inventive aspects, applying, as well as their preferred embodiments, to the present aspect of the invention, including the terms or expressions “subject”, “lung overdistension”, and the “evolution of lung overdistension”.

The term "miRNA", as well as the preferred embodiments of the miRNAs of the invention, have also been defined in previous inventive aspects and are applicable to the present use of the invention.

Thus, a preferred embodiment of the monitoring use of the invention comprises the use of the levels of, at least, one microRNA selected from the list consisting of: mir-483, miR- 483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 , and miR-581 .

As in previous aspects of the invention, for the monitoring use of the invention, the levels of each one of the combinations of the microRNAs of the invention are contemplated in some preferred embodiments.

Thus, in another more preferred embodiment of the monitoring use of the invention, the microRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR- 375, miR-658, miR-921 and miR-581. Even more preferably, the microRNA levels comprise the levels of mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR- 130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375- 3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

Treatment evaluation use of the invention

Another aspect of the present invention relates to the use of the levels of, at least, one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 and miR-581 for the in vitro evaluation of the response of a subject to a lung overdistension treatment, hereinafter the “treatment evaluation use of the invention”.

In the present treatment evaluation use of the invention, different levels after the treatment compared to levels before treatment, preferably a decrease in the levels of miR-483, miR-658, and/or miR-921 , and/or an increase in the levels of miR-130a, miR- 146a, miR-375, miR-581 and/or miR-609, after treatment compared to levels before treatment, indicate that the treatment is effective and/or the subject responds positively to the treatment.

In the present invention, a subject “responds positively to the treatment” is understood to mean that the treatment has had an effect of improving the subject’s health condition and/or lung overdistension condition.

In a more preferred embodiment, the levels are different in, at least, 1.5 times the standard deviation. In another preferred embodiment, the determined levels differ by 1 .5 times, 1 .55 times, 1 .6 times, 1 .65 times, 1 .70 times, 1 .80 times, 1 .90 times, 1 .95 times, 2 times, 2.05 times, 2.10 times, 2.15 times, 2.20 times the standard deviation or more.

The terms used to define the present aspect of the invention have been explained in previous inventive aspects, applying, as well as their preferred embodiments, to the present aspect of the invention, including the terms or expressions “subject”, “lung overdistension” and “evaluation of the response to a treatment”.

The term "miRNA", as well as the preferred embodiments of the miRNAs of the invention, have also been defined in previous inventive aspects and are applicable to the present use of the invention.

Thus, a preferred embodiment of the treatment evaluation use of the invention comprises the use of the levels of, at least, one microRNA selected from the list consisting of: mir- 483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR- 146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

As in previous aspects of the invention, for the treatment evaluation use of the invention, the levels of each one of the combinations of the microRNAs of the invention are contemplated in some preferred embodiments.

In a preferred embodiment of the treatment evaluation use of the invention, the microRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR- 375, miR-658, miR-921 , and miR-581. Preferably, the microRNA levels comprise the levels of mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir- 146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

Kit of the invention and uses thereof

The uses and methods of the invention are put into practice based on determining the levels of one or more of the miRNAs of the invention (miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 and miR-581 ) in isolated biological samples from a subject. The means used for this levels determination may be part of a kit.

Thus, another aspect of the present invention relates to a kit, hereinafter the “kit of the invention”, which comprises means for the in vitro determination of the levels of, at least, one microRNA selected from the list consisting of: miR-483, miR130a, miR-146a, miR- 609, miR-375, miR-658, miR-921 and miR-581 in an isolated sample from a subject.

A preferred embodiment of the kit of the invention comprises means for the in vitro determination of the levels of, at least, one microRNA selected from the list consisting of: mir-483, miR-483-3p, miR-483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir- 658, miR-658, mir-921 , miR-921 , mir-581 and miR-581.

As in previous inventive aspects, the miRNAs of the invention can be determined in a combined manner. As in the preceding inventive aspects, the levels of any of the combinations of the microRNAs of the inventioncan be susceptible to be determined using the kit of the invention. Thus, the kit of the invention may comprise media for the in vitro determination of the levels of said microRNAs.

In another preferred embodiment of the kit of the invention, the miRNA levels comprise the levels of miR-483, miR130a, miR-146a, miR-609, miR-375, miR-658, miR-921 , and miR-581 . Preferably, the miRNA levels comprise the levels of mir-483, miR-483-3p, miR- 483-5p, mir-130a, miR-130a-3p, miR-130a-5p, mir-146a, miR-146a-3p, miR-146a-5p, mir-609, miR-609, mir-375, miR-375-3p, miR-375-5p, mir-658, miR-658, mir-921 , miR- 921 , mir-581 and miR-581 .

As explained in previous inventive aspects, the determination of the levels of miRNAs, can be carried out by means of conventional methodologies well known in the state of the art. Examples of methods for determining the miRNA levels include, without limitation to, immunoassays, for example, ELISA (an abbreviation for Enzyme-Linked ImmunoSorbent Assay), molecular biology assays, for example, quantitative PCR (qPCR), sequencing methods (for example, small size RNA sequencing, miRNA-seq, Next-generation sequencing), miRNA arrays or microarrays, detection by NanoString nCounter, in situ miRNA hybridization, or biochemical tests, for example, colorimetric tests or others.

In a preferred embodiment of the kit of the invention, the means for the in vitro determination of the miRNAs levels comprise the reagents required to carry out the microRNAs sequencing.

In a more preferred embodiment, the means of the kit of the invention comprise the reagents required to carry out miRNA whole transcriptomic assay.

Preferably, the means of the kit of the invention also comprise the reagents required to carry out an extraction of miRNA from a previously isolated biological sample.

Furthermore, as understood by a person skilled in the art, the kit may comprise other components useful in putting the present invention into practice, such as buffering solutions, delivery vehicles, material supports, positive and/or negative control components, etc. In addition to the mentioned components, the kits may also include instructions for practicing the object of the invention. These instructions may be present in the mentioned kits in a variety of forms, one or more of which may be present in the kit. One way in which these instructions may be present is as information printed on a suitable medium or substrate, for example, a sheet or sheets of paper on which the information is printed, in the kit packaging, in a package insert, etc. Another medium would be a computer-readable medium, for example, a CD, a USB, etc., in which the information has been recorded. Another medium that may be present is a website address that can be used over the Internet to access information at a remote site. Any suitable means may be present in the kits.

The kit of the invention, which comprises means for determining the levels of the miRNAs of the invention, is useful in the diagnosis of lung overdistension, the monitoring of lung overdistension, and the evaluation of the response to in vitro treatments for lung overdistension, and can be used in any of the methods of the invention that have been described above.

Thus, in another aspect, the invention relates to the use of the kit of the invention in any of the methods of the invention.

In another aspect, the invention relates to the use of the kit of the invention for the in vitro lung overdistension diagnosis in a subject.

In another aspect, the invention relates to the use of the kit of the invention for the in vitro monitoring of the evolution of lung overdistension in a subject.

In another aspect, the invention relates to the use of the kit of the invention to evaluate the response of a subject to a lung overdistension treatment.

The terms used to define the kit and the uses of the kit of the invention have been explained for the uses of the invention, applying, as well as their preferred embodiments, to the different uses of the kit of the invention. Likewise, the terms "subject" and "sample" have been defined in other aspects of the present invention and are applicable to the kit of the invention and uses thereof. Likewise, the preferred embodiments of said terms are also applicable to the kit of the invention and the uses thereof. Thus, in a preferred embodiment, the isolated biological sample is blood, serum, plasma or bronchial fluid. In another preferred embodiment, the subject is a human being.

In another preferred embodiment, the subject has been or is being subjected to mechanical ventilation.

In another preferred embodiment, the subject suffers from a lung injury.

Furthermore, the kit and uses thereof, as explained in preceding inventive aspects, are applicable in the adjustment of mechanical ventilation in a subject.

DESCRIPTION OF THE DRAWINGS

Fig. 1. MicroRNAs expression in cell cultures under static and stretching conditions. A: Heat map showing the expression of each of the mature microRNAs (grouping the -3p and -5p forms) in the 24 samples studied. B: ROC curve of the precision of each of the microRNAs for identifying cell stretching. AUC: Area under the ROC curve.

Fig. 2. Calculation of the overdistension index in both groups. This index perfectly discriminates the two experimental groups.

Fig. 3. A: Quantification of the overdistension index in human lungs ventilated ex v/vo for 4 hours with continuous positive airway pressure (CPAP) or with a tidal volume of 12 ml/kg (VI LI) . B: ROC curve of the overdistension index to determine the capacity thereof to discriminate inclusion in the group of damage due to overdistension. AUC: Area under the ROC curve.

Fig. 4. A: Quantification of the overdistension index in bronchoalveolar lavage samples from patients with pulmonary edema subjected sequentially to ventilation with a tidal volume of 3 and 6 ml/kg. Overdistension was quantified by means of calculating lung strain (defined as the ratio of tidal volume and end-expiratory volume). B: ROC curve of the overdistension index to determine its capacity to discriminate inclusion in the group of damage due to overdistension. AUC: Area under the ROC curve. Examples

Next, the invention will be illustrated by means of assays performed by the inventors which demonstrate the effectiveness of the invention.

1. Materials and methods

The identification of the microRNAs involved in the cellular response to stretching was performed by grouping the results available in the public Gene Expression Omnibus database (https://www.ncbi.nlm.nih.gov/geo/). MicroRNA expression data was identified in cells subjected to mechanical stress, obtaining 3 studies (with access codes GSE131645, GSE75100, and GSE36256) that include a total of 24 samples. The microRNAs expression was grouped by means of joint normalization with the COCONUT software for the R statistical platform. Once normalized, microRNAs expression was compared between cells subjected to cyclic stretching and cells cultured under static conditions by means of the limma software, adjusting the p-value of the comparison by means of the Benjamini-Hochberg method, with a false positive rate of 5%. MicroRNAs with differential expression with an adjusted p-value less than 0.1 were considered significant.

For the ex vivo lung stretching study, human lungs not suitable for transplantation but donated for research were used. Lungs were perfused with a 5% albumin solution in DMEM using a Vivoline LS1 machine without oxygenator or leukocyte filter. Whole blood was added to the perfusion solution up to a total concentration of 10%. Lungs from three donors were kept ventilated with a continuous positive airway pressure of 10 cmH2O, and lungs from three other donors were ventilated with a tidal volume of 12 ml/kg weight, with no positive pressure at the end of expiration, at a rate of 15 breaths/minute. In all cases, the inspired oxygen fraction was 100%. After 4 hours of ventilation, the lungs were deflated, removed from the ventilation/perfusion system, and a portion of tissue was homogenized in Trizol, incubated with isopropanol, and washed with ethanol to extract RNA which was resuspended in RNases-free water. MicroRNAs were extracted by means of separation on a 10% urea-polyacrylamide gel by means of selecting the band of 18-30 nucleotides. The extracted microRNAs were sequenced with unique molecular identifiers to avoid PCR duplicates. Files with the readings were aligned against a reference transcriptome with the sequences of known microRNAs obtained from http://www.mirbase.org/ftp.shtml, and their relative abundances were calculated with the Salmon software, version 1 .4.

Patient validation was performed by means of analyzing bronchoalveolar lavage samples from patients subjected to mechanical ventilation and included in a published clinical trial (Amado-Rodnguez, Annals of Intensive Care, 2021). In 7 patients with mechanical ventilation, two bronchoalveolar lavage samples were obtained after 24 hours of mechanical ventilation with a tidal volume of 3 ml/kg and another 24 hours of mechanical ventilation with a tidal volume of 6 ml/kg. In these patients, before each bronchoalveolar lavage, the end-expiratory lung volume was measured by means of a nitrogen washin-washout technique (General Electric CareStation). Lung strain was calculated as the ratio of tidal volume and end-expiratory volume. The abundance of microRNAs in the bronchoalveolar lavage samples was quantified by means of an EdgeSeq assay for microRNAs (HTG molecular diagnostics).

In both studies, the overdistension index was calculated as the geometric mean of the abundance of microRNAs overexpressed with stretching (hsa-miR-483, hsa-miR-658, hsa-miR-921 ) minus the geometric mean of the abundance of microRNAs underexpressed with stretching (hsa-miR-130a, hsa-miR-146a, hsa-miR-375, hsa-miR- 581 , hsa-miR-609).

MicroRNAs overexpressed with stretching:

- hsa-miR-483, grouping the -3p and -5p forms (SEQ ID NO: 1 and 2);

- hsa-miR-658 (SEQ ID NO: 10); and

- hsa-miR-921 (SEQ ID NO: 11 ).

MicroRNAs underexpressed with stretching:

- hsa-miR-130a, grouping the -3p and -5p forms (SEQ ID NO: 3 and 4);

- hsa-miR-146a, grouping the -3p and -5p forms (SEQ ID NO: 5 and 6);

- hsa-miR-375, grouping the -3p and -5p forms (SEQ ID NO: 8 and 9);

- hsa-miR-581 (SEQ ID NO: 12); and

- hsa-miR-609 (SEQ ID NO: 7).

The indices obtained in each group were compared by means of a variance analysis in the case of independent samples (ex vivo experiment) or a T-test for paired samples (samples from patients). 2. Results

A bioinformatic analysis of the microRNA expression of 24 cell culture samples was carried out under static or stretching conditions. After grouping and renormalizing the expression, 8 microRNAs were identified (hsa-miR-130a, hsa-miR-146a, hsa-miR-375, hsa-miR-483, hsa-miR-581 , hsa-miR-609, hsa-miR-658, hsa-miR-921 ) with significant differences between samples cultured under static conditions and stretching conditions (Table 1 and Fig. 1 A).

Table 1. MicroRNAs expression in cell cultures under static and stretching conditions. The microRNAs with significant differential expression between both groups are shown. hsa-miR-483 (SEQ ID NO: 1 and 2); hsa-miR-658 (SEQ ID NO: 10); hsa-miR-921 (SEQ ID NO: 11 ); hsa-miR-130a (SEQ ID NO: 3 and 4); hsa-miR-146a (SEQ ID NO: 5 and 6); hsa-miR-375 (SEQ ID NO: 8 and 9); hsa-miR-581 (SEQ ID NO: 12); hsa-miR-609 (SEQ ID NO: 7).

Each of these microRNAs discriminated between samples subjected to stretching or static conditions with areas under the ROC curve of between 0.811 and 0.923 (Fig. 1 B).

An overdistension index was calculated as the geometric mean of the expression of microRNAs overexpressed with stretching (hsa-miR-483, hsa-miR-658, hsa-miR-921) minus the geometric mean of the expression of microRNAs underexpressed (hsa-miR- 130a, hsa-miR-146a, hsa-miR-375, hsa-miR-581 , hsa-miR-609). This index discriminated cells cultured under static conditions from those cultured under cyclic mechanical stress with an area under the ROC curve of 1 (Fig. 2).

The findings were validated in two different human models. First, lung tissue samples

SUBSTITUTE SHEET (RULE 26) were obtained from donors whose lungs were not suitable for lung transplantation, and which were ventilated and perfused ex vivo for 4 hours. MicroRNAs expression in this tissue was quantified by means of massive sequencing, and three lungs that were ventilated with a constant airway pressure of 10 cmH2O (i.e., in the absence of overdistension) were compared with another three lungs subjected to cyclic ventilation with a tidal volume of 12 ml/kg (which is equivalent to overdistension conditions). The calculated overdistension index was significantly higher in lung tissue subjected to overdistension (Fig. 3A), and the index discriminated both groups with an area under the ROC curve of 0.889 (Fig. 3B).

Second, bronchoalveolar lavage samples from 7 patients subjected to mechanical ventilation for pulmonary edema were obtained during a change in tidal volume from 3 to 6 ml/kg of weight, and the expression of free microRNAs in the fluid from said lavage was quantified.

For the identification of overdistension in the patients, the change in lung strain (ratio of tidal volume and end-expiratory volume) was used (Garcia-Prieto, Anesthesiology 2016). The lung overdistension index increased when going from 3 to 6 ml/kg of tidal volume in all the patients who exhibited an increased lung strain, while the same was not observed in those patients who did not exhibit an increased lung strain (Fig. 4).