I. GOVERNMENT SUPPORT

This invention was made with government support under Grant No. R35CA197452 awarded by the National Institutes of Health. The government has certain rights in the invention.

II. CROSS REFERENCE TO RELATED APPLICATIONS

This Application claims the benefit of U.S. Provisional Application No. 63/340,311, filed on May 10, 2022, which is incorporated herein by reference in its entirety.

REFERENCE TO SEQUENCE LISTING

The sequence listing submitted on May 9, 2023, as an .XML file entitled “10110- 402WO1.XML” created on May 9, 2023, and having a file size of 4,433 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).

III. BACKGROUND

1. Cancer metastasis is the leading cause of death in cancer patients. Multiple pathways have been found to increase cancer progression and metastasis including the activation of the PI3K/AKT pathway and the gain-of-function mutation of the tumor suppressor TP53, which are the two most frequent driving mutations in a broad variety of human cancers. Therefore, investigating the mechanistic interplay between these pathways is of the utmost importance for the identification of novel therapeutic opportunities against the progression of metastatic cancers.

IV. SUMMARY

2. Disclosed are methods and compositions related to long non-coding RNAs (IncRNAs) for TROLLS in the detection and treatment of breast cancer.

3. In one aspect, disclosed herein are methods of assessing tumor grade and/or progression of a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising obtaining a tissue sample from a subject and measuring the expression level of the long non-coding RNA for TROLL- 8; wherein the higher the level of IncRNA for TROLL-8, the greater the severity and/or invasiveness of the tumor is indicated. In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

4. Also disclosed herein are methods of assessing the efficacy of a cancer treatment regimen administered to a subject comprising obtaining a tissue sample from a subject and measuring the expression level of the long non-coding RNA for TROLL-8 relative to a control.

5. Tn one aspect, disclosed herein are methods of assessing the efficacy of a cancer treatment of any preceding aspect, wherein when the expression level of IncRNA for TROLL-8 is i) higher than a negative control, ii) equivalent to or has not decreased relative to a positive control and/or equivalent to or has not decreased relative to a positive control; indicates that the treatment regimen is not efficacious. Tn one aspect, disclosed herein are methods of assessing the efficacy of a cancer treatment wherein the positive control is a reference gene or pretreatment sample from the subject whose cancer treatment regimen is being assessed.

6. Also disclosed herein are methods of detecting the presence of a cancer (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising obtaining a tissue sample from the subject and assaying the tissue sample for the presence and/or expression level of the long noncoding RNA for TROLL-8; wherein the presence or an increase in IncRNA for TROLL-8, indicates the presence of a cancer in the tissue sample from the subject. In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

7. In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising obtaining a tissue sample from a subject receiving a cancer treatment regimen and measuring the expression level of the long non-coding RNA for TROLL- 8; wherein when the expression level of IncRNA for TROLL- 8 is i) higher than a negative control and/or equivalent to or has not decreased relative to a positive control; indicates that the treatment regimen is not efficacious; and wherein the method further comprises changing the treatment regimen when the treatment regimen is not efficacious. In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

8. Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising i) obtaining a tissue sample from the subject; ii) assaying the tissue sample for the presence and/or expression level of the long non-coding RNA for TROLL- 8; wherein the presence of IncRNA for TROLL-8 indicates the presence of a cancer in the tissue sample from the subject; and hi) administering to a subject an agent that knocks down expression of TROLL-8 or increases expression of carnitine palmitoyltransferase 1A (CPT1A). In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

9. In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) of any preceding aspect, wherein expression of TROLL- 8 is knocked down through the administration of one or more RNA-targeted therapeutics including, but not limited to antisense oligonucleotides, siRNA (such as, for example, SEQ ID NO: 2, SEQ ID NO: 3, and/or SEQ ID NO: 4), shRNA, ribozymes, transcription activator-like effector nucleases (TALEN), zinc finger nucleases (ZFNs) and/or clustered regularly interspaced short palindromic repeats/associated (CRISPR/Cas) nucleases.

10. Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) of any preceding aspect, wherein the treatment comprises administering to the subject carnitine palmitoyltransferase I A (CPT1A) or a vector that overexpresses CPTIA.

11. In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) of any preceding aspect, further comprising the administration of a second anti-cancer agent and/or immunotherapy.

V. BRIEF DESCRIPTION OF THE DRAWINGS

12. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and together with the description illustrate the disclosed compositions and methods.

13. Figures 1A, IB, 1C, ID, IF, and IF show that TROLL-8 expression is positively correlated with human breast cancer progression. Pan-cancer analysis of TROLL-8 expression in the TCGA database in breast cancer molecular subtypes (1A). Data were analyzed with one-way ANOVA. Pairwise comparisons with significant Pvalues are demonstrated. Kaplan-Meier curves showing overall breast cancer survival data based on TROLL- 8 expression in the TCGA database in BRCA patients (IB), TNBC patients (1C), and IDC patients (ID). IDC = invasive ductal carcinoma. Quantification of the 1SH scores of TROLL- 8 expression in the indicated TMA. Data were analyzed with one-way ANOVA (IE) and two-tailed Student’s t test (IF). Asterisk vs. normal breast tissue (NB), P<0.05. The TMA whisker boxplots represent the individual data points and median.

14. Figures 2A and 2B show that TROLL-8 interacts with proteins enriched in metabolism. Figure 2A shows that a protein microarray experiment identifies specific TROLL-8 interacting proteins and Ingenuity pathway analysis (IP A) emphasized the metabolic pathways for TROLL-8 interacting proteins. Figure 2B shows enriched canonical pathways of the proteins interacting with TROLL- 8 defined by IPA.

15. Figures 3A, 3B, 3C, and 3D show that TROLL-8 silencing decreases mitochondrial fuel oxidation for energy production. Agilent Seahorse XF Cell Mito Stress Test Profile showing oxygen consumption rate (OCR) kinetics with key parameters of mitochondrial function (3A). Key parameters of mitochondrial function were compared before and after TROLL- 8 knockdown (3B). OCR in control (siNT, blue bar) cells in basal respiration and ATP production was compared with that in TROLL-8 knockdown (siTROLL-8, red bar) cells. OCR was measured by the Agilent Seahorse XF mitochondrial fuel oxidation stress test to compare the glucose, palmitate and glutamine demands in siNT and siTROLL-8 cells supplemented with the corresponding fuels (3C). OCR measurements of mitochondrial dependency and flexibility for each fuel source upon addition of inhibitor of the corresponding fuel source (3D).

16. Figures 4A, 4B, 4C, 4D, 4E, 4F, and 4G show that TROLL-8 silencing leads to LCFA accumulation and decreases FAO. Figure 4A shows volcano plot comparing the metabolite accumulation patterns from control and TROLL- 8 knockdown groups obtained from LC-MS targeted metabolomics experiments; visualization using GraphPad Prism. Figure 4B shows a table showing metabolites with significant upregulated levels after TROLL- 8 knockdown. Figure 4C shows a brief schematic demonstrates the U- ¹³ C-palmitate tracing workflow to track the accumulation of input U- ¹³ C-Palmitate, the generation of FAO product ¹³ C-citrate, and the de novo synthesized palmitate. Labeling patterns following isotope tracing with U- ¹³ C-palmitate of cellular citrate (4D), U-13C-palmitate (4E) and labeling patterns following isotope with U- ¹³ C-glutamine (4F), and U-13C-glucose (4G) in MCFCA1D cells expressing siNT or siTROLL-8.

17. Figure 5A, 5B, 5C, 5D, and 5E shows that TROLL-8 interacts with the FAO ratelimiting enzyme, CPT1A. Figure 5A shows a schematic of cytosolic fatty acid oxidation in the mitochondria. Figure 5B shows a representative immune blot analysis for the CPT1 A protein pulled down by the indicated in vitro transcribed and biotinlabeled IncRNAs. Targeted LC-MS metabolomics revealed free carnitine (5C) and available long chain fatty acyl carnitine (5D) in MCFCA1D cells expressing siNT or siTROLL-8 and treated with vehicle or lOpM Etomoxir. The relative changes of CPT1 A subcellular protein expression are measured by immune blot in MCFCA1D cells expressing siNT or siTROLL-8 (5E).

18. Figures 6A, 6B, 6C, 6D, 6E, 6F, 6G, and 6H show that TROLL-8 regulated CPT1A post-translational modifications mediate its activity Quantification of cellular acetyl-CoA was performed by LC-MS analysis in MCFCA1D cells (6A). The relative changes of global protein acetylation are represented by immuno blot in MCFCA1D cells (b). Cellular extracts from MCFCA1D cells expressing siNT and siTROLL-8 were resolved by SDS-PAGE. The whole bands demonstrated by immuno blot in (6B) were retrieved and analyzed by mass spectrometry (MS). Bar plots displayed 20 MS detected metabolic proteins with changed acetylation status in MCFCA1D cells expressing siNT (6C) and siTROLL-8 (6D). Quantification of the ratio of the relative abundance of acetylated peptides (6E) and the peptide acetylation modified sequence in CPT1A is shown in a table (6F). Volcano plot of LC-MS detected CPT1A interacting proteins with or without significant affinity change for CPT1A in MCFCA1D cells expressing siTROLL- 8 (6G). The only acetyltransferase, ACAT1 was revealed in the volcano plot. Ingenuity Pathway Analysis (IP A) demonstrated ACAT1 involved metabolic pathways (6H).

19. Figures 7A, 7B, 7C, 7D, 7E, 7F, 7G, and 7H show that Expression of CPT1A and its hypo- acetylated form restore TROLL-8 knockdown induced effects in breast cancer cells. Figure 7A shows representative immuno-blot demonstrated endogenous interaction between ACAT1 and CPT1A. Figure 7B shows Representative immuno-blot displayed enhanced interaction between ACAT1 and CPT1A after TROLL-8 silencing in MCFCA1D cells. Targeted LC-MS - comparison of relative pool size (%) of free cellular carnitine (7C) and fatty acyl-camitine in MCFCA1D cells expressing wild type (WT) CPT1A or CPT1 A acetylation mutants (K148Q or K148R) (7D). Quantification and comparison of key parameters of mitochondrial function after TROLL-8 silencing and/or CPT1A overexpression were analyzed by Agilent Seahorse XF Cell Mito Stress Test (e & f). Bar plots showed the OCR comparison among siNT, siTROLL-8 and/or CPT1A overexpression groups in basal respiration (7E) and ATP production (7F). Quantification (7G) and bright field representative images (7H) of anchorage independent colony formation of MCFCA1D cell line in soft agar assay (per 10X field).

20. Figure 8 shows Schematic of the underlying mechanism of action of TROLL-8. When TROLL-8 is silenced, e.g., the tumor metastasis suppressor and cellular metabolism regulator TAp63 inhibits the expression of TROLL-8, TROLL-8 regulates mitochondrial fuel oxidation, especially FAO, which is indicated by reduced fatty acyl-carnitine and citrate and leads to accumulation of LCFAs. TROLL-8 interacts with proteins enriched in cellular metabolism and regulates cellular availability of acetyl-CoA, and global protein acetylation. TROLL-8 interacts with FAO rate-limiting enzyme, CPT1A, to regulate its activity, acetylation status, and interaction with the acetyltransferase AC ATI.

VI. DETAILED DESCRIPTION

21 . Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

A. Definitions

22. As used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a pharmaceutical carrier” includes mixtures of two or more such carriers, and the like.

23. Ranges can be expressed herein as from “about” one particular value, and/or to “about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10” is also disclosed. It is also understood that when a value is disclosed that “less than or equal to” the value, “greater than or equal to the value” and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value “10” is disclosed the “less than or equal to 10” as well as “greater than or equal to 10” is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point “10” and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15. It is also understood that each unit between two particular units are also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

24. In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings:

25. “Optional” or “optionally” means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

26. An "increase" can refer to any change that results in a greater amount of a symptom, disease, composition, condition or activity. An increase can be any individual, median, or average increase in a condition, symptom, activity, composition in a statistically significant amount. Thus, the increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase so long as the increase is statistically significant.

27. A "decrease" can refer to any change that results in a smaller amount of a symptom, disease, composition, condition, or activity. A substance is also understood to decrease the genetic output of a gene when the genetic output of the gene product with the substance is less relative to the output of the gene product without the substance. Also for example, a decrease can be a change in the symptoms of a disorder such that the symptoms are less than previously observed. A decrease can be any individual, median, or average decrease in a condition, symptom, activity, composition in a statistically significant amount. Thus, the decrease can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% decrease so long as the decrease is statistically significant.

28. "Inhibit," "inhibiting," and "inhibition" mean to decrease an activity, response, condition, disease, or other biological parameter. This can include but is not limited to the complete ablation of the activity, response, condition, or disease. This may also include, for example, a 10% reduction in the activity, response, condition, or disease as compared to the native or control level. Thus, the reduction can be a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to native or control levels.

29. By “reduce” or other forms of the word, such as “reducing” or “reduction,” is meant lowering of an event or characteristic e.g., tumor growth). It is understood that this is typically in relation to some standard or expected value, in other words it is relative, but that it is not always necessary for the standard or relative value to be referred to. For example, “reduces tumor growth” means reducing the rate of growth of a tumor relative to a standard or a control.

30. By “prevent” or other forms of the word, such as “preventing” or “prevention,” is meant to stop a particular event or characteristic, to stabilize or delay the development or progression of a particular event or characteristic, or to minimize the chances that a particular event or characteristic will occur. Prevent does not require comparison to a control as it is typically more absolute than, for example, reduce. As used herein, something could be reduced but not prevented, but something that is reduced could also be prevented. Likewise, something could be prevented but not reduced, but something that is prevented could also be reduced. It is understood that where reduce or prevent are used, unless specifically indicated otherwise, the use of the other word is also expressly disclosed.

31. The term “subject” refers to any individual who is the target of administration or treatment. The subject can be a vertebrate, for example, a mammal. In one aspect, the subject can be human, non-human primate, bovine, equine, porcine, canine, or feline. The subject can also be a guinea pig, rat, hamster, rabbit, mouse, or mole. Thus, the subject can be a human or veterinary patient. The term “patient” refers to a subject under the treatment of a clinician, e.g., physician.

32. The term “therapeutically effective” refers to the amount of the composition used is of sufficient quantity to ameliorate one or more causes or symptoms of a disease or disorder. Such amelioration only requires a reduction or alteration, not necessarily elimination.

33. The term “treatment” refers to the medical management of a patient with the intent to cure, ameliorate, stabilize, or prevent a disease, pathological condition, or disorder. This term includes active treatment, that is, treatment directed specifically toward the improvement of a disease, pathological condition, or disorder, and also includes causal treatment, that is, treatment directed toward removal of the cause of the associated disease, pathological condition, or disorder. In addition, this term includes palliative treatment, that is, treatment designed for the relief of symptoms rather than the curing of the disease, pathological condition, or disorder; preventative treatment, that is, treatment directed to minimizing or partially or completely inhibiting the development of the associated disease, pathological condition, or disorder; and supportive treatment, that is, treatment employed to supplement another specific therapy directed toward the improvement of the associated disease, pathological condition, or disorder.

34. "Biocompatible" generally refers to a material and any metabolites or degradation products thereof that are generally non-toxic to the recipient and do not cause significant adverse effects to the subject.

35. "Comprising" is intended to mean that the compositions, methods, etc. include the recited elements, but do not exclude others. "Consisting essentially of' when used to define compositions and methods, shall mean including the recited elements, but excluding other elements of any essential significance to the combination. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants from the isolation and purification method and pharmaceutically acceptable carriers, such as phosphate buffered saline, preservatives, and the like. "Consisting of' shall mean excluding more than trace elements of other ingredients and substantial method steps for administering the compositions provided and/or claimed in this disclosure. Embodiments defined by each of these transition terms are within the scope of this disclosure.

36. A “control” is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."

37. “Effective amount” of an agent refers to a sufficient amount of an agent to provide a desired effect. The amount of agent that is “effective” will vary from subject to subject, depending on many factors such as the age and general condition of the subject, the particular agent or agents, and the like. Thus, it is not always possible to specify a quantified “effective amount.” However, an appropriate “effective amount” in any subject case may be determined by one of ordinary skill in the art using routine experimentation. Also, as used herein, and unless specifically stated otherwise, an “effective amount” of an agent can also refer to an amount covering both therapeutically effective amounts and prophylactically effective amounts. An “effective amount” of an agent necessary to achieve a therapeutic effect may vary according to factors such as the age, sex, and weight of the subject. Dosage regimens can be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation.

38. A "pharmaceutically acceptable" component can refer to a component that is not biologically or otherwise undesirable, i.e., the component may be incorporated into a pharmaceutical formulation provided by the disclosure and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the formulation in which it is contained. When used in reference to administration to a human, the term generally implies the component has met the required standards of toxicological and manufacturing testing or that it is included on the Inactive Ingredient Guide prepared by the U.S. Food and Drug Administration.

39. "Pharmaceutically acceptable carrier" (sometimes referred to as a “carrier”) means a carrier or excipient that is useful in preparing a pharmaceutical or therapeutic composition that is generally safe and non-toxic and includes a carrier that is acceptable for veterinary and/or human pharmaceutical or therapeutic use. The terms "carrier" or "pharmaceutically acceptable carrier" can include, but are not limited to, phosphate buffered saline solution, water, emulsions (such as an oil/water or water/oil emulsion) and/or various types of wetting agents. As used herein, the term "carrier" encompasses, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as described further herein.

40. “Pharmacologically active” (or simply “active”), as in a “pharmacologically active” derivative or analog, can refer to a derivative or analog (e.g., a salt, ester, amide, conjugate, metabolite, isomer, fragment, etc.) having the same type of pharmacological activity as the parent compound and approximately equivalent in degree.

41. “Therapeutic agent” refers to any composition that has a beneficial biological effect. Beneficial biological effects include both therapeutic effects, e.g., treatment of a disorder or other undesirable physiological condition, and prophylactic effects, e.g., prevention of a disorder or other undesirable physiological condition (e.g., a non-immunogenic cancer). The terms also encompass pharmaceutically acceptable, pharmacologically active derivatives of beneficial agents specifically mentioned herein, including, but not limited to, salts, esters, amides, proagents, active metabolites, isomers, fragments, analogs, and the like. When the terms “therapeutic agent” is used, then, or when a particular agent is specifically identified, it is to be understood that the term includes the agent per se as well as pharmaceutically acceptable, pharmacologically active salts, esters, amides, proagents, conjugates, active metabolites, isomers, fragments, analogs, etc.

42. “Therapeutically effective amount” or “therapeutically effective dose” of a composition (e.g. a composition comprising an agent) refers to an amount that is effective to achieve a desired therapeutic result. In some embodiments, a desired therapeutic result is the control of type I diabetes. In some embodiments, a desired therapeutic result is the control of obesity. Therapeutically effective amounts of a given therapeutic agent will typically vary with respect to factors such as the type and severity of the disorder or disease being treated and the age, gender, and weight of the subject. The term can also refer to an amount of a therapeutic agent, or a rate of delivery of a therapeutic agent (e.g., amount over time), effective to facilitate a desired therapeutic effect, such as pain relief. The precise desired therapeutic effect will vary according to the condition to be treated, the tolerance of the subject, the agent and/or agent formulation to be administered (e.g., the potency of the therapeutic agent, the concentration of agent in the formulation, and the like), and a variety of other factors that are appreciated by those of ordinary skill in the art. In some instances, a desired biological or medical response is achieved following administration of multiple dosages of the composition to the subject over a period of days, weeks, or years.

— lo 43. Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.

B. Method of treating cancer

44. Long non-coding RNAs (IncRNAs) are regulatory RNAs with no or little proteincoding potential. They function as additional regulators of gene transcription either in cis or trans based on their sequence matching or secondary/tertiary structures. They also serve as decoys, scaffolds, or guides to maintain the spatial-temporal architecture of transcriptional and translational programs on either gene expression or cellular events, including cancer metastasis and metabolism.

45. Advanced breast cancer metastasis is the major cause of relapse and death in women. However, no effective treatment exists for the metastatic stage of breast cancer. TAp63, one member of the p53 family, is a tumor suppressor in breast cancer metastasis and regulates lipid and glucose metabolism. RNA-seq analysis identified its IncRNA targets, which also differentially expressed during breast cancer progression using MCF10 model. Among them, expression of the oncogenic IncRNA TROLL-8 is significantly higher in triple negative breast cancer (TNBC) molecular subtypes and is negatively correlated with TNBC patient overall survival rate. TROLL- 8 interacts with proteins that are enriched in metabolic pathways, detected by protein microarray and Ingenuity Pathway Analysis (IPA). Specifically, seahorse assays demonstrated that TROLL-8 increases breast cancer oxidation pathways. Silencing of TROLL-8 leads to compromised fatty acid oxidation (FAO), which contributes to accumulated long-chain fatty acids (LCFAs) in the breast cancer cells. The rate-limiting enzyme of FAO, carnitine palmitoyltransferase 1 (CPT1A) interacts with TROLL-8, and we show herein that CPT1A contributes to TROLL-8 silencing impaired breast cancer migration. TROLL-8 regulates CPT1 A activity and acetylation through blocking its physical interaction with the acetyltransferase AC ATI.

46. Our study emphasized the potential functionalities of the oncogenic IncRNA TROLL-8 in breast cancer metastasis and metabolism through regulating the FAO ratelimiting enzyme CPT1 A activity and post- translational modification. Abnormal expression of TROLL-8 can thus be adopted as diagnostic/prognostic biomarkers, or therapeutic targets for breast cancer control and management. 47. In one aspect, disclosed herein are methods of assessing tumor grade and/or progression of a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising obtaining a tissue sample from a subject and measuring the expression level of the long non-coding RNA for TROLL- 8; wherein the higher the level of IncRNA for TROLL-8, the greater the severity and/or invasiveness of the tumor is indicated. Tn some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

48. Also disclosed herein are methods of assessing the efficacy of a cancer treatment regimen administered to a subject comprising obtaining a tissue sample from a subject and measuring the expression level of the long non-coding RNA for TROLL-8 relative to a control.

49. In one aspect, disclosed herein are methods of assessing the efficacy of a cancer treatment, wherein when the expression level of IncRNA for TROLL- 8 is i) higher than a negative control, ii) equivalent to or has not decreased relative to a positive control and/or equivalent to or has not decreased relative to a positive control; indicates that the treatment regimen is not efficacious. In one aspect, disclosed herein are methods of assessing the efficacy of a cancer treatment wherein the positive control is a reference gene or pretreatment sample from the subject whose cancer treatment regimen is being assessed.

50. Also disclosed herein are methods of detecting the presence of a cancer (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising obtaining a tissue sample from the subject and assaying the tissue sample for the presence and/or expression level of the long noncoding RNA for TROLL-8; wherein the presence or an increase in IncRNA for TROLL-8, indicates the presence of a cancer in the tissue sample from the subject. In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

51. The disclosed compositions can be used to treat any disease where uncontrolled cellular proliferation occurs such as cancers. A representative but non-limiting list of cancers that the disclosed compositions can be used to treat is the following: lymphomas such as B cell lymphoma and T cell lymphoma; mycosis fungoides; Hodgkin’s Disease; myeloid leukemia (including, but not limited to acute myeloid leukemia (AML) and/or chronic myeloid leukemia (CML)); bladder cancer; brain cancer; nervous system cancer; head and neck cancer; squamous cell carcinoma of head and neck; renal cancer; lung cancers such as small cell lung cancer, nonsmall cell lung carcinoma (NSCLC), lung squamous cell carcinoma (LUSC), and Lung Adenocarcinomas (LUAD); neuroblastoma/glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; hepatic cancer; melanoma; squamous cell carcinomas of the mouth, throat, larynx, and lung; cervical cancer; cervical carcinoma; breast cancer (including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)); genitourinary cancer; pulmonary cancer; esophageal carcinoma; head and neck carcinoma; large bowel cancer; hematopoietic cancers; testicular cancer; and colon and rectal cancers.

52. Accordingly, in one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising obtaining a tissue sample from a subject receiving a cancer treatment regimen and measuring the expression level of the long non-coding RNA for TROLL-8; wherein when the expression level of IncRNA for TROLL-8 is i) higher than a negative control and/or equivalent to or has not decreased relative to a positive control; indicates that the treatment regimen is not efficacious; and wherein the method further comprises changing the treatment regimen when the treatment regimen is not efficacious. In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

53. Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)) in a subject comprising i) obtaining a tissue sample from the subject; ii) assaying the tissue sample for the presence and/or expression level of the long non-coding RNA for TROLL- 8; wherein the presence of IncRNA for TROLL-8 indicates the presence of a cancer in the tissue sample from the subject; and iii) administering to a subject an agent that knocks down expression of TROLL-8 or increases expression of carnitine palmitoyltransferase 1A (CPT1A). In some aspects, the cancer comprises a cancer with a KRAS ^G12C mutation or p53 mutation.

54. In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)), wherein expression of TROLL-8 is knocked down through the administration of one or more RNA-targeted therapeutics including, but not limited to antisense oligonucleotides, siRNA (such as, for example, SEQ ID NO: 2, SEQ ID NO: 3, and/or SEQ ID NO: 4), shRNA, ribozymes, transcription activator-like effector nucleases (TALEN), zinc finger nucleases (ZFNs) and/or clustered regularly interspaced short palindromic repeats/associated (CRISPR/Cas) nucleases.

55. Also disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)), wherein the treatment comprises administering to the subject carnitine palrnitoyltransfera.se 1A (CPT1A) or a vector that overexpresses CPTIA.

56. In one aspect, disclosed herein are methods of treating, inhibiting, reducing, decreasing, amelioration, and/or preventing a cancer and/or metastasis (such as, for example, breast cancer, including, but not limited to triple negative breast cancer (TNBC) or invasive ductal carcinoma (IDC)), further comprising the administration of a second anti-cancer agent and/or immunotherapy. It is understood and herein contemplated that the disclosed treatment regimens can used alone or in combination with any anti-cancer therapy known in the art including, but not limited to Abemaciclib, Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE- PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Dimaleate, Afinitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab, Alimta (Pemetrexed Disodium), Aliqopa (Copanlisib Hydrochloride), Alkeran for Injection (Melphalan Hydrochloride), Alkeran Tablets (Melphalan), Aloxi (Palonosetron Hydrochloride), Alunbrig (Brigatinib), Ambochlorin (Chlorambucil), Amboclorin Chlorambucil), Amifostine, Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane),Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Atezolizumab, Avastin (Bevacizumab), Avelumab, Axitinib, Azacitidine, Bavencio (Avelumab), BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, Besponsa (Inotuzumab Ozogamicin) , Bevacizumab, Bexarotene, Bexxar (Tositumomab and Iodine I 131 Tositumomab), Bicalutamide, BiCNU (Carmustine), Bleomycin, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Brigatinib, BuMel, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cabometyx (Cabozantinib-S-Malate), Cabozantinib-S-Malate, CAP, Campath (Alemtuzumab), Camptosar , (Irinotecan Hydrochloride), Capecitabine, CAPOX, Carac (Fluorouracil— Topical), Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmubris (Carmustine), Carmustine, Carmustine Implant, Casodex (Bicalutamide), CEM, Ceritinib, Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, CEV, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Cladribine, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clof arabine), Clolar (Clofarabine), CMF, Cobimetinib, Cometriq (Cabozantinib-S-Malate), Copanlisib Hydrochloride, COPDAC, COPP, COPP-ABV, Cosmegen (Dactinomycin), Cotellic (Cobimetinib), Crizotinib, CVP, Cyclophosphamide, Cyfos (Ifosfamide), Cyramza (Ramucirumab), Cytarabine, Cytarabine Liposome, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dactinomycin, Daratumumab, Darzalex (Daratumumab), Dasatinib, Daunorubicin Hydrochloride, Daunorubicin Hydrochloride and Cytarabine Liposome, Decitabine, Defibrotide Sodium, Defitelio (Defibrotide Sodium), Degarelix, Denileukin Diftitox, Denosumab, DepoCyt (Cytarabine Liposome), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC-Dome (Dacarbazine), Durvalumab, Efudex (Fluorouracil— Topical), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Elotuzumab, Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Empliciti (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride , EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi) , Ethyol (Amifostine), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista , (Raloxifene Hydrochloride), Evomela (Melphalan Hydrochloride), Exemestane, 5-FU (Fluorouracil Injection), 5-FU (Fluorouracil- Topical), Fareston (Toremifene), Farydak (Panobinostat), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil— Topical), Fluorouracil Injection, Fluorouracil— Topical, Flutamide, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRLBEVACIZUMAB, FOLFIRI- CETUXIMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gardasil 9 (Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINECISPLATIN, GEMCITABINE-OXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gleevec (Imatinib Mesylate), Gliadel (Carmustine Implant), Gliadel wafer (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven (Eribulin Mesylate), Hemangeol (Propranolol Hydrochloride), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, Hycamtin (Topotecan Hydrochloride), Hydrea (Hydroxyurea), Hydroxyurea, Hyper-CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Idhifa (Enasidenib Mesylate), Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), LL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica (Ibrutinib), Imfinzi (Durvalumab), Imiquimod, Imlygic (Talimogene Laherparepvec), Inlyta (Axitinib), Inotuzumab Ozogamicin, Interferon Alfa- 2b, Recombinant, Interleukin-2 (Aldesleukin), Intron A (Recombinant Interferon Alfa-2b), Iodine 1 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Irinotecan Hydrochloride Liposome, Istodax (Romidepsin), Ixabepilone, Ixazomib Citrate, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), JEB, Jevtana (Cabazitaxel), Kadcyla (Ado- Trastuzumab Emtansine), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kisqali (Ribociclib), Kymriah (Tisagenlecleucel), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lartruvo (Olaratumab), Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Leustatin (Cladribine), Levulan (Aminolevulinic Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Lomustine, Lonsurf (Trifluridine and Tipiracil Hydrochloride), Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lynparza (Olaparib), Marqibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, Mekinist (Trametinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Methylnaltrexone Bromide, Mexate (Methotrexate), Mexate- AQ (Methotrexate), Midostaurin, Mitomycin C, Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride) , Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Necitumumab, Nelarabine, Neosar (Cyclophosphamide), Neratinib Maleate, Nerlynx (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, Neulasta (Pegfilgrastim), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilandron (Nilutamide), Nilotinib, Nilutamide, Ninlaro (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Obinutuzumab, Odomzo (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ondansetron Hydrochloride, Onivyde (Irinotecan Hydrochloride Liposome), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), OPPA, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel Albumin- stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Palonosetron Hydrochloride and Netupitant, Pamidronate Disodium, Panitumumab, Panobinostat, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, PCV, PEB, Pegaspargase, Pegfilgrastim, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Portrazza (Necitumumab), Pralatrexate, Prednisone, Procarbazine Hydrochloride , Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Propranolol Hydrochloride, Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa- 2b, Regorafenib, Relistor (Methylnaltrexone Bromide), R-EPOCH, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Ribociclib, R-ICE, Rituxan (Rituximab), Rituxan Hycela (Rituximab and Hyaluronidase Human), Rituximab, Rituximab and , Hyaluronidase Human, ,Rolapitant Hydrochloride, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Rubraca (Rucaparib Camsylate), Rucaparib Camsylate, Ruxolitinib Phosphate, Rydapt (Midostaurin), Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sonidegib, Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate), Sylatron (Peginterferon Alfa- 2b), Sylvant (Siltuximab), Synribo (Omacetaxine Mepesuccinate), Tabloid (Thioguanine), TAC, Tafinlar (Dabrafenib), Tagrisso (Osimertinib), Talc, Talimogene Laherparepvec, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel), Taxotere (Docetaxel), Tecentriq , (Atezolizumab), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Thioguanine, Thiotepa, Tisagenlecleucel, Tolak (Fluorouracil-Topical), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and Iodine 1 131 Tositumomab, Totect (Dexrazoxane Hydrochloride), TPF, Trabectedin, Trametinib, Trastuzumab, Treanda (Bendamustine Hydrochloride), Trifluridine and Tipiracil Hydrochloride, Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Unituxin (Dinutuximab), Uridine Triacetate, VAC, Vandetanib, VAMP, Varubi (Rolapitant Hydrochloride), Vectibix (Panitumumab), VelP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, Venclexta (Venetoclax), Venetoclax, Verzenio (Abemaciclib), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Vistogard (Uridine Triacetate), Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Vyxeos (Daunorubicin Hydrochloride and Cytarabine Liposome), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELIRI, XELOX, Xgeva (Denosumab), Xofigo (Radium 223 Dichloride), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Yondelis (Trabectedin), Zaltrap (Ziv-Aflibercept), Zarxio (Filgrastim), Zejula (Niraparib Tosylate Monohydrate), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zofran (Ondansetron Hydrochloride), Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), and/or Zytiga (Abiraterone Acetate). The treatment methods can include or further include checkpoint inhibitors including, but are not limited to antibodies that block PD-1 (such as, for example, Nivolumab (B MS-936558 or MDX1106), pembrolizuntab, CT-011, MK-3475), PD-L1 (such as, for example, atezolizumab, avelumab, durvalumab, MDX-1105 (BMS-936559), MPDL3280A, or MSB0010718C), PD-L2 (such as, for example, rHIgM12B7), CTLA-4 (such as, for example, Ipilimumab (MDX-010), Tremelimumab (CP-675,206)), IDO, B7-H3 (such as, for example, MGA271, MGD009, omburtamab), B7-H4, B7-H3, T cell immunoreceptor with Ig and ITIM domains (TIGIT)(such as, for example BMS-986207, OMP-313M32, MK-7684, AB-154, ASP-8374, MTIG7192A, or PVSRIPO), CD96, B and T-lymphocyte attenuator (BTLA), V -domain 1g suppressor of T cell acti ation (VISTA)(such as, for example, JNJ-61610588, CA-170), TIM3 (such as, for example, TSR-022, MBG453, Sym023, INCAGN2390, LY3321367, BMS-986258, SHR-1702, RO7121661), LAG-3 (such as, for example, BMS-986016, LAG525, MK-4280, REGN3767, TSR-033, BI754111, Sym022, FS118, MGD013, and Immutep).

C. Examples

57. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. 1. Example 1: TAp63 regulated oncogenic long non-coding RNA-8 (TROLL-8) promotes human breast cancer progression through CPT1A mediated fatty acid oxidation

58. Advanced breast cancer metastasis is the major cause of relapse and death in women. However, no effective treatment exists for the metastatic stage of breast cancer. TAp63, one member of the p53 family, is a tumor suppressor in breast cancer metastasis and regulates lipid and glucose metabolism. RNA-seq analysis identified its IncRNA targets, which also differentially expressed during breast cancer progression using MCF10 model. Among them, expression of the oncogenic IncRNA TROLL-8 is significantly higher in triple negative breast cancer (TNBC) molecular subtypes and is negatively correlated with TNBC patient overall survival rate.

59. TROLL-8 interacts with proteins that are enriched in metabolic pathways, detected by protein microarray and Ingenuity Pathway Analysis (IPA). Silencing of TROLL-8 leads to compromised fatty acid oxidation (FAO), which contributes to accumulated long-chain fatty acids (LCFAs) in the breast cancer cells. The rate-limiting enzyme of FAO, CPT1 A interacts with TROLL-8, and CPT1 A contributes to TROLL-8 silencing impaired breast cancer migration. TROLL-8 regulates CPT1 A activity and acetylation through blocking its physical interaction with the acetyltransferase ACAT1.

60. Our study emphasized the potential functionalities of the oncogenic IncRNA TROLL-8 in breast cancer metastasis and metabolism through regulating the FAO ratelimiting enzyme CPT1 A activity and post- translational modification. Abnormal expression of TROLL-8 can thus be adopted as diagnostic/prognostic biomarkers, or therapeutic targets for breast cancer control and management. a) METHODS:

61. We have previously identified TAp63 regulated oncogenic IncRNAs (TROLLs) through RNA-seq analysis and human-mouse cancer cross-species analysis. Through performing multi-omics experiments, including the cross-species genomic approach, proteomics, metabolomics, protein microarray assay, and bioinformatics analysis of the TCGA datasets, we identified an oncogenic IncRNA target of TAp63, TROLL-8, in mediating human breast cancer metabolism. b) RESULTS:

62. As shown in Figures 1A, IB, 1C, ID, IF, and IF, TROLL-8 expression is positively correlated with human breast cancer progression. A pan-cancer analysis of TROLL-8 expression in the TCGA database shows TROLL- expressed in multiple in breast cancer molecular subtypes (Figure 1A). Kaplan-Meier curves showing overall breast cancer survival data based on TROLL-8 expression in the TCGA database in BRCA patients (Figure IB), TNBC patients (Figure 1C), and IDC patients (Figure ID). TROLL-8 is expressed at significantly higher levels in triple negative breast cancer (TNBC) and invasive ductal carcinoma (IDC) and is correlated with poor overall survival.

63. Mechanistically, we found using in vitro transcription of TROLL-8 and hybridization to a human protein microarray with 9483 unique human recombinant proteins, that it interacts with proteins that are enriched in metabolic pathways (Figures 2A and 2B). Specifically, Figures 2 A and 2B show that TROLL- 8 interacts with proteins enriched in metabolism. Figure 2 A shows that a protein microarray experiment identifies specific TROLL-8 interacting proteins and Ingenuity pathway analysis (IP A) emphasized the metabolic pathways for TROLL- 8 interacting proteins. Figure 2B shows enriched canonical pathways of the proteins interacting with TROLL- 8 defined by IPA.

64. Figures 3A, 3B, 3C, and 3D show that TROLL-8 silencing decreases mitochondrial fuel oxidation for energy production. Agilent Seahorse XF Cell Mito Stress Test Profile showing oxygen consumption rate (OCR) kinetics with key parameters of mitochondrial function (Figure 3A). Key parameters of mitochondrial function were compared before and after TROLL- 8 knockdown (Figure 3B).

65. Importantly, as shown in Figures 4A, 4B, 4C, 4D, 4E, 4F, and 4G show that TROLL- 8 silencing leads to long chain fatty acid (LCFA) accumulation and decreases FAO. Specifically, we found that TROLL-8 interacts with CPT1A, the rate-limiting enzyme of FAO (Figures 5A, 5B, 5C, 5D, and 5E). Further, we found that TROLL-8 increases breast cancer mitochondrial respiration and an accumulation of long-chain fatty acids (LCFAs).

66. Moreover, TROLL-8 regulates cytosolic availability of acetyl-CoA, global protein acetylation, including CPT1A acetylation and activity. Through mass spectrometry of extracts from advanced metastatic breast cancer cell lines with depleted TROLL-8, we identified interactions between the acetyltransferase ACAT1 and CPT1A. These data indicate that TROLL-8 regulates CPT1A activity and acetylation through blocking its physical interaction with the acetyltransferase ACAT1. As shown in Figures 6A, 6B, 6C, 6D, 6E, 6F, 6G, and 6H show that TROLL-8 regulated CPT1A post-translational modifications mediate its activity. Quantification of cellular acetyl-CoA was performed by LC-MS analysis in MCFCA1D cells (Figure 6A). The relative changes of global protein acetylation are represented by immuno blot in MCFCA1D cells (Figure 6B). Cellular extracts from MCFCA1D cells expressing siNT and siTROLL-8 were resolved by SDS-PAGE. The whole bands demonstrated by immuno blot in (Figure 6B) were retrieved and analyzed by mass spectrometry (MS). Bar plots displayed 20 MS detected metabolic proteins with changed acetylation status in MCFCA1D cells expressing siNT (Figure 6C) and siTROLL-8 (Figure 6D). Quantification of the ratio of the relative abundance of acetylated peptides (Figure 6E) and the peptide acetylation modified sequence in CPT1A is shown in a table (Figure 6F). Volcano plot of LC-MS detected CPT1 A interacting proteins with or without significant affinity change for CPT1A in MCFCA1D cells expressing siTROLL-8 (Figure 6G). The only acetyltransferase, ACAT1 was revealed in the volcano plot. Ingenuity Pathway Analysis (IP A) demonstrated ACAT1 involved metabolic pathways (Figure 6H).

67. As evidenced by Figures 7A, 7B, 7C, 7D, 7E, 7F, 7G, and 7H, expression of CPT1A and its hypo-acetylated form restore TROLL-8 knockdown induced effects in breast cancer cells. Figure 7A shows representative immuno-blot demonstrated endogenous interaction between ACAT1 and CPT1A. Figure 7B shows Representative immuno-blot displayed enhanced interaction between ACAT1 and CPT1A after TROLL-8 silencing in MCFCA1D cells. Targeted LC-MS - comparison of relative pool size (%) of free cellular carnitine (Figure 7C) and fatty acyl-carnitine in MCFCA1D cells expressing wild type (WT) CPT1A or CPT1A acetylation mutants (K148Q or K148R) (Figure 7D). Quantification and comparison of key parameters of mitochondrial function after TROLL- 8 silencing and/or CPT1A overexpression were analyzed by Agilent Seahorse XF Cell Mito Stress Test (Figures 7E and 7F). Bar plots showed the OCR comparison among siNT, siTROLL-8 and/or CPT1A overexpression groups in basal respiration (7E) and ATP production (7F). Quantification (7G) and bright field representative images (7H) of anchorage independent colony formation of MCFCA1D cell line in soft agar assay (per 10X field).

68. Figure 8 shows a schematic of the underlying mechanism of action of TROLL-8. When TROLL-8 is silenced, e.g., the tumor metastasis suppressor and cellular metabolism regulator TAp63 inhibits the expression of TROLL-8, TROLL-8 regulates mitochondrial fuel oxidation, especially FAO, which is indicated by reduced fatty acyl-carnitine and citrate and leads to accumulation of LCFAs. TROLL- 8 interacts with proteins enriched in cellular metabolism and regulates cellular availability of acetyl-CoA, and global protein acetylation. TROLL-8 interacts with FAO rate-limiting enzyme, CPT1A, to regulate its activity, acetylation status, and interaction with the acetyltransferase AC ATI. c) CONCLUSION:

1. The examples herein demonstrate the mechanistic functionalities of TROLL-8 in breast cancer metabolism through regulating CPT1A activity and post-translation modification. Abnormal expression of TROLL-8 can thus be adopted as a diagnostic/prognostic biomarker or potential therapeutic target for breast cancer. Specifically, TAp63 regulated oncogenic IncRNA- 8, TROLL-8, correlates with poor TNBC and IDC breast cancer patient overall survival. Additionally, TROLL-8 regulates mitochondrial fuel oxidation, especially fatty acid oxidation (FAO) leading to accumulation of long-chain fatty acids (LCFAs). TROLL-8 also interacts with CPT1 A, a FAO rate-limiting enzyme, to regulate its activity, acetylation status, and interaction with the acetyltransferase ACAT1. Lastly, TROLL-8 regulates cellular availability of acetyl- CoA and global protein acetylation. Overexpression of CPT1A rescues impaired mitochondrial oxygen consumption and energy production in cellular metabolism in breast cancer cell lines depleted of TROLL- 8.

D. Sequences

SEQ ID NO: 1 Tap63 Binding site for TROLL-8 IncRNA GAACATGATCGATCCATGTCA

SEQ ID NO: 2 siRNA specific for TROLL-8 (AL161668.12

CATCCATAAAGAAGGCATA

SEQ ID NO: 3 siRNA specific for TROLL-8 (AL161668.12

CCACTTATTGGCCCTCATT

SEQ ID NO: 4 siRNA specific for TROLL-8 (AL161668.12

GACTTGTTCTGTCGCTTCT