Field of the invention

The present invention relates to a method, a device, and the use of the device, for obtaining samples. In particular, the invention relates to sampling of solid biological materials by inserting microscopic needles into the biological material and subsequently removing them from the biological material, thereby obtaining a sample of the biological material attached to the needles.

Background of the invention

Nucleic acid sample preparation begins with the process of sample collection. If samples are not collected and handled properly, it may be impossible to obtain high-quality nucleic acid regardless of the method used for DNA preparation. Therefore, sample collection is critical to obtaining optimal results in downstream applications for nucleic acids.

Collection of samples of biological material for diagnostic or forensic purposes may be performed in various ways, and often includes drawing of blood by venepuncture or finger prick. These methods involve pain to the subject and a significant number of subjects feel discomfort with these methods. Some subjects may also have a severe fear or phobia related to the pain involved and/or the drawing of blood which may entail avoidance of these procedures. This in turn may lead to subjects not seeking medical care when they are in need of such care, and to healthcare providers not having sufficient information to make correct diagnoses. Collection of samples of biological material for forensic purposes are usually done with buccal swabs. However, the number of cells collected with the swab varies and depends on a variety of factors including the technique of the person taking the swab, whether the donor is a high or low shedder, and the type of swab used. Also the efficiency in the transfer of cells from the swab to a storage medium varies. Micro-needle devices for application on the human or animal skin have been suggested for various applications including drug delivery and cosmetics.

Devices for transdermal delivery of various drugs usually comprise hollow micro-needles wherein the drug is delivered into the epidermis or dermis of the patient through the hollow cavity in the microneedle. One example of such a system is the Hollow Microstructured Transdermal System available from 3M (S :t Paul, Minnesota, U.S.). Sullivan and co-workers (Sullivan et al. Nature Medicine 16, 915-920 (2010)) have proposed dissolving micro-needle patches for influenza vaccination using a patch-based system, wherein influenza virus vaccine contained in the micro-needles was delivered during a dissolution of the micro-needle when applied to the patient's skin.

Patches comprising arrays of micro-needles and intended for use as transdermal devices are commercially available from i.a. Innoture Medical Technology, Ltd. (London, U.K.). Cylinders comprising an array of micro-needles on the cylinder surface are sold for cosmetic purposes under the trademark Dermaroller ^® . Fabrication of micro-needles and patches comprising arrays of micro-needles is well-known in the art and described for example in WO2006/018642 and WO2007/080427.

Summary of the invention

There exists a need in the art for an alternative device and method for sample collection that is non- invasive and less painful than venepuncture or finger prick, but neverthelsess can obtain live/viable cells from the epidermis or dermis. There also exists a need for an alternative device and method for sample collection that is consistent in obtaining the sample and transferring it to a storage medium, and preferably also negate the need to put a swab into someone's mouth, which may be

uncomfortable for both the person providing the sample and the person taking the sample. The present invention thus proposes the use of micro-needle technology for sample collection, i.e., the collection of cells from the skin for forensic or diagnostic analyses and the possible collection of cells from the surface of tissue samples (fresh, frozen or Formalin Fixed, Paraffin Embedded (FFPE)) prior to applying to solid media. After removal the micro-needle device could be applied to a solid medium to preserve the biological sample and stabilise the DNA, NA, protein etc. prior to transportation and storage.

Brief description of the drawings

Figure 1 shows a a side view (A) of an exemplary device (10) according to the invention, said device comprising a base plate (20) having an array of micro-needles (30) arranged thereon. The figure also shows a view of the array side (B) of the device, and a side view (C) of the device.

Figure 2 illustrates individual micro-needles (30) having surface modifications (32, 34, 36). (A) a micro-needle (30) with protrusions in the form of bristles (32). (B) a micro-needle (30) with protrusions in the form of barbs (34). (C) a micro-needle with a coating (36).

Figure 3 illustrates a workflow for using a micro-needle device(lO) in obtaining a sample from a biological material (40) and transferring it to a solid medium (50) for further processing.

Figure 4: Endpoint PCR showing 85 bp amplicon amplified from bovine gDNA applied to FTA micro- cards using a foam-tipped swab and commercially available micro-needle roller systems with varying needle length. Upper Left: 0.5 mm micro-needle; Upper Right: 0.2 mm micro-needle; Lower Left: Swab; Lower Right: 1.0 mm micro-needle.

Detailed description of the invention

In one aspect, the present invention relates to a device for obtaining a sample from a biological material in solid form, wherein the device comprises an array of micro-needles arranged on a base plate. This is shown in figure 1, wherein an exemplary device (10) comprising a base plate (20) having an array of micro-needles (30) arranged thereon is shown.

The micro-needles arranged on the base plate may be solid. However, hollow micro-needles of the type used in some types of drug delivery may be used also in the present invention. The micro- needles may also have a rugged or generally uneven surface in order to increase the surface area of the micro-needle in order to increase the amount of biological material that may adhere to the micro-needle. It is also contemplated that the micro-needles may be porous so that biological material may diffuse into the micro-needle to further increase the amount of biological material that adheres to the micro-needle.

The base plate (10) is typically made of a flexible material for ease of application to the surface of a biological material, such as the skin of a human or animal subject. The base plate and the microneedles may be made from the same or different material. Suitable materials for manufacture of the base plate and/or the micro-needles are from silica; polymers, such as epoxy resins, acrylic polymers, polyurethane, polypropylene, and silicone resins; ceramics; metal; or a combination thereof.

The micro-needles are generally of a length in the micrometer range, i.e. from 1-10 micrometers up to a 1 or 2 milimeters. The length of the micro-needles may be adapted to be long enough to penetrate through the strateum corneum and into the epidermis of a subject to which the microneedles are applied when in use. Typical lengths of micro-needles may be 0.1-1.5 mm preferably 0.15-1.0 mm, such as 0.2-0.5 mm. The concentration of micro-needles on the base plate is typically in the range 400-12,000 micro-needles per cm ² , such as 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, or 11,000 micro-needles per cm ² .

The micro-needles may have an average diameter of 0.1-0.3 mm and be in the shape of cones, three- sided or four-sided pyramids, or rods with conical or pyramidal tips, extending from the base plate. The micro-needles may also have a barbed or rugged surface. An embodiment wherein the microneedles are equipped with bristles (32) is shown in Figure 2 A. An embodiment wherein the microneedles are equipped with barbs (34) is shown in Figure 2 B.

The micro-needles may also be coated with a coating (36) enhancing adherence of biological material, such as cells, proteins, and/or nucleic acids including DNA, to the micro-needles. Such coatings may be selected from extracellular matrix attachment proteins, extracellular matrix adhesion proteins, mucopolysaccharides, basic synthetic polymers, or any combination thereof. Examples of coatings that may be suitable for use with the present invention are collagen, laminin, fibronectin, from heparin sulfate, hyaluronidate, chondroitin sulfate, and poly-D-lysine.

In a further aspect, the invention relates to a method for obtaining a sample (50) from a biological material (40) in solid form, comprising pressing the micro-needles (30) of a device (10) according to the above aspect, into said biological material (40), and subsequently removing the device from the biological material (40). Part of the biological material (40), including whole cells, proteins, and/or nucleic acids including DNA, will adhere to the micro-needles (30) and thus constitute the sample (50). This workflow is shown in Figure 3 (A)-(C). The biological material (40) may be the skin from a living or deceased human or animal, or a fresh, frozen, or Formalin Fixed, Paraffin Embedded (FFPE) tissue sample. The sample (50) obtained from the biological material (40) thus typically comprise whole cells, proteins, and/or nucleic acids including DNA, and may originate from the subject from which the biological material originates or from foreign organisms such as microbes. In a preferred embodiment, the sample of biological material is transferred to a solid medium (60) for storage of samples of biological material, by pressing the micro-needles (30) into the solid medium (60). This workflow is shown in Figure 3 (D)-(E).

Such media for storage of samples of biological material are well-known in the art and include 903 Sample Collection Cards, Whatman FTA/FTA Elute Sample Collection Cards, and DMPK Sample

Collection Cards, all available from GE Healthcare, Uppsala, Sweden. Whatman FTA technology is a patented process that incorporates chemically coated matrices to collect, transport, archive and isolate nucleic acids in a single device. The technology, which consists of two distinct chemistries for FTA and FTA Elute, has the ability to lyse cells on contact, denature proteins, and protect DNA from degradation caused by environmental challenges and microbial attack. FTA contains chemical denaturants and a free radical scavenger, while FTA Elute contains a chaotropic salt. The difference in the chemical coatings is what allows the DNA to be eluted from FTA Elute into a solution phase, while purified DNA remains bound to FTA. Purified genomic DNA from FTA and FTA Elute is suitable for use in PC , STR, SN P genotyping, allelic discrimination genotyping, and RFLP analyses. DNA from FTA is also suitable for AFLP; DNA from FTA Elute is also suitable for use in TaqMan™ assays.

Samples may thus be collected onto FTA or FTA Elute cards by pressing the micro-needles into the cards, and cards are dried. Discs of FTA and FTA Elute are removed from sample areas using a coring device, such as a Harris Micro Punch or Uni-Core. These coring devices come in various sizes (i.e., 1.2 mm, 2.0 mm, and 3.0 mm); the choice of size depends on both the downstream application and the initial sample type. For applications that require DNA in solution, multiple discs can be treated at once. Genomic DNA purification from sample applied to FTA cards may be performed according to the manufacturer's instructions.

The invention also relates to the use of a device according to the first aspect in a method according to the second aspect. Sequences

The following sequences are included in the attached sequence listing. Forward primer: CTAAGATCATGGCATCAGGTCC (SEQ ID NO: 1) Reverse primer: CCCCAAAATAAAGTCAGCCAC (SEQ I D NO: 2) FAM TAM probe: [6FAM]TCCACTGTTTCCCCATCTATTTGCCA[TAM] (SEQ ID NO: 3) Example

The invention is further illustrated in the example below. The examples are not intended to limit the invention, which is defined in the appended claims.

The principle of the invention is shown in this example by analysis of samples obtained from bovine meat with the use of a micro-needle device. Materials:

• FTA cards: GEHC WB120055 #9463630 (GE Healthcare, Uppsala, Sweden)

• Indicating FTA cards: GEHC WB120211 #384045 (GE Healthcare, Uppsala, Sweden) • Foam tipped swabs, GEHC WB100032 #3673(GE Healthcare, Uppsala, Sweden)

• Sirloin steak (obtained from the local supermarket)

• Bovine genomic DNA. AMSBIO cat: D1B34999-G01 #B601033

• Primers and probes (obtained from Sigma-Aldrich)

o Forward: CT AAG ATC ATG G CATC AG GTCC (SEQ ID NO: 1)

o Reverse: CCCCAAAATAAAGTCAGCCAC (SEQ ID NO: 2)

o FAM TAM probe: [6FAM]TCCACTGTTTCCCCATCTATTTGCCA[TAM] (SEQ ID NO: 3)

• Applied Biosystems: 2x Taqman Universal PCR Master Mix cat:4324018 #1406029, exp Oct 2015

• Sterile water

• Derma roller 0.2mm: MT roller, Model MT2 (no other details supplied)

• Derma roller 0.5mm: Dermaroller System (DRS), model DRS50 (no other details supplied)

• Derma roller 1.0mm: Micro Needle Roller System, model MR100, RoHS ref JMF-003, lot:

130348, Exp March 2015.

• 2mm Harris micro-punch

• Applied Biosystems real-time 7900 QPCR machine, CL/LE/PE/00293, calibration due Sept 2015.

Method

Real-time detection and quantification of bovine DNA were performed essentially as described in Cai et al., Journal of Food Composition and Analysis, 25 (2012) pp. 83-87.

Samples were obtained from the bovine meat using micro-needles of length 0.2 mm, 0.5 mm or 1.0 mm, or a swab, and transferred to a FTA card, and also using micro-needles of length 0.5 mm or a swab and transferred onto an indicating FTA card. All samples were repeated six times, as set out in the table below.

Table 1

Day 1: For micro-needle application, the dermaroller was placed on the fresh joint of beef (not rolled) and then pressed onto the FTA paper. For swab application, the swab head was rolled back & forth 4 times on the joint of beef, then applied to the FTA paper & rolled back & forth 4 times. Post application samples were left to dry in a laminar flow cabinet for >3 hours, then stored in a desiccator cabinet overnight.

Day 2:

1. Dilute primers to give 250nM in PC reaction (20ul):

Dilute supplied primers to lOOuM as follows:

• Forward primer (supplied at 37.9nmol) - add 379ul sterile water to give lOOuM solution.

• Reverse primer (supplied at 37.2nmol) - add 372ul sterile water to give lOOuM solution. For each primer - dilute to 2.5uM as follows:

• 100uM/2.5uM = 1:40 dilution

• Add 5ul lOOuM solution to 195ul sterile water

2. Dilute probe to give 500nM in PCR reaction (20ul)

Dilute supplied probe to lOOuM as follows:

• Probe (supplied at 13.2nmol) - add 132ul sterile water to give lOOuM solution.

Dilute probe to 5uM as follows:

• 100uM/5uM = 1:20 dilution

· Add lOul lOOuM solution to 190ul sterile water

3. Preparation of standard curve:

Stock = l.lOug/ml (i.e., HOOpg/ul)

Dilute bovine gDNA to 50pg/ul as follows:

· 1100/50 = 1:22 dilution

Add lOul stock to 210ul sterile water to give 50pg/ul = 100pg/2ul

Prepare 1:10 dilutions (lOul +90ul sterile water) to give the following standard curve solutions:

1. 100pg/2ul

2. 10pg/2ul

3. lpg/2ul

4. 0.1pg/2ul

5. 0.01pg/2ul

6. 0.001pg/2ul

4. Preparation of FTA punches:

• 2mm punches (using a Harris punch) were removed from bovine-spotted FTA

punches and transferred to sterile 0.5ml eddpendorf tubes.

• Each punch was washed 3X using 200ul GEHC FTA purification reagent, then 2X using 200ul IX TE buffer (0.01M Tris, 0.001M EDTA, pH 7.4).

· Punches were left to dry for ~30 mins prior to using in direct QPCR reactions as below:-

5. Gel Electrophoresis: Pour a IX TAE, 1% agarose gel:- a) Weigh out lg agarose in a sterile erlenmeyer flask

b) Add 100ml IX TAE buffer (Tris-Acetate/EDTA)

c) Heat in a microwave, heat for 1 minute, mix, then further 30 sec intervals until the

agarose has dissolved

d) Leave to cool for ~2 minutes, then add lOul Gel Red stain

e) Pour into gel tray, avoid air bubble formation, insert gel combs and leave to dry for ~30 mins

To load PCR samples:- a) Fill the gel tank with IX TAE buffer (remove the 'stoppers' used to cast the gel) b) Add 4ul of 6X loading dye to 15ul PCR reactions and load between lOul into each well of the gel

c) Load DNA markers into 1 lane of the gel.

d) Connect the electrophoresis tank to the power & run at ~80 volts for ~30-40 mins e)

A resulting gel is shown in Figure 3. Endpoint PCR showing 85 bp amplicon amplified from bovine gDNA applied to FTA micro-cards using a foam-tipped swab and commercially available micro-needle roller systems with varying needle length. Upper Left: 0.5 mm micro-needle; Upper Right: 0.2 mm micro-needle; Lower Left: Swab; Lower Right: 1.0 mm micro-needle. A lOObp DNA ladder were run in upper and lower leftmot lanes, and the upper rightmost lane. The 83 bp fragment is highlighted in Figure 3. Primer dimers are visible below the 83 bp fragment.

PCR reaction

Table 2

Table 3

Reagent/concentration Volume (ul)

Forward primer @ 2.5uM 2

Reverse primer @ 2.5uM 2

Probe @ 5.0uM 2

2X PCR Master Mix 10

Water 2

Control bovine gDNA @lng/ul 2

Final volume 20

Plate map (Table 5)

Results

The results are summarized in Table 6

Table 6

Well Sample Name Ct Quantitv (οε/ul) Quantity (pg/ml)

4 0.5mm miconeedle 20.601551 1.0145711 1014.571

5 0.5mm miconeedle 26.268627 0.014150693 14.151

6 0.5mm miconeedle 33.313503 6.98E-05 0.070

7 0.5mm miconeedle 35.29981 1.56E-05 0.016

8 0.5mm miconeedle 29.670776 0.001088558 1.089

9 0.5mm miconeedle 26.111387 0.015931653 15.932

16 Swab 26.547935 0.011463758 1 1.464

17 Swab 31.232628 3.35E-04 0.335

18 Swab 27.237637 0.006815631 6.816

19 Swab 27.346052 0.006280713 6.281

20 Swab 24.847023 0.04132729 41.327

21 Swab 25.545555 0.02440758 24.408

28 0.2mm micro-needle 29.195902 0.001557163 1.557

29 0.2mm micro-needle 1.1531498 2366172 2366172000

30 0.2mm micro-needle 27.272406 0.006639297 6.639

31 0.2mm micro-needle 28.55655 0.002521564 2.522

32 0.2mm micro-needle 39.614628 6.04E-07 0.001

33 0.2mm micro-needle 37.7316 2.50E-06 0.002

40 1mm micro-needle 22.972874 0.16977271 169.773

41 1mm micro-needle 28.513432 0.002604879 2.605

42 1mm micro-needle 26.627182 0.010798915 10.799

43 1mm micro-needle 34.065872 3.96E-05 0.040

44 1mm micro-needle Undetermined 0 0.000

45 1mm micro-needle 33.36794 6.70E-05 0.067

52 No template control Undetermined 0 0

53 No template control Undetermined 0 0

54 No template control Undetermined 0 0

13 10pg/ul 17,68969 10 10000,000

14 10pg/ul 17,678354 10 10000,000

15 10pg/ul 17,447315 10 10000,000

73 punch + 10pg/ul 19,21 1739 2,8928947 2892,895

85 punch + 10pg/ul 17,58295 9,877061 9877,061

37 0.1 pg/ul 23,980858 0, 1 100,000

38 0.1 pg/ul 23,688795 0, 1 100,000

39 0.1 pg/ul 23,7168 0, 1 100,000

74 punch + 0.1 pg/ul 23,077671 0,15687558 156,876

86 punch + 0.1 pg/ul 23,667562 0,10055739 100,557

49 0.01 pg/ul 26,331987 0,01 10,000

50 0.01 pg/ul 26,249264 0,01 10,000

51 0.01 pg/ul 26,419891 0,01 10,000

61 0,001 30, 151587 0,001 1 ,000

62 0,001 29,975388 0,001 1 ,000

63 0,001 29,93187 0,001 1 ,000

75 punch + 0.001 pg/ul 29,214556 0,001535418 1 ,535

87 punch + 0.001 pg/ul 30,067472 8,0717E-04 0,807 The average quantity of DNA obtained from the biological material is, with the outliers of wells 4 and 29 removed:

Table 7

These results demonstrate that microneedles can be used to obtain sufficient DNA for QPCR analysis, using a device with micro-needles of a length of 0.2, 0.5, or 1 mm.