TSUJI, Moriya (450 East 63rd Street, Apt. 2FNew York, New York, 10065, US)
TSUJI, Moriya (450 East 63rd Street, Apt. 2FNew York, New York, 10065, US)
| CLAIMS What is claimed is: 1 . A recombinant adenovirus derived from a recombinant adenovirus plasmid vector, wherein the recombinant adenovirus plasmid vector comprises a nucleotide sequence encoding: a Plasmodium circumsporozoite protein gene, or antigenic portion thereof, operably linked to a heterologous promoter sequence; and a modified Hexon hypervariable region (HVR) sequence comprising an immunogenic B cell epitope sequence of a Plasmodium falciparum circumsporozoite protein that is inserted into or replaces at least part of the HVR sequence. 2. The adenovirus of claim 1 , wherein the Plasmodium falciparum circumsporozoite protein gene is a codon-optimized protein gene is encoded by SEQ ID NO:1 . 3. The adenovirus of claim 1 , wherein the HVR sequence further comprises an HVR1 or HVR5 sequence and the B cell epitope: a) is inserted in the HVR1 or HVR5 sequence; or b) replaces a portion of the HVR1 or HVR5 sequence. 4. The adenovirus of claims 1 or 3, wherein the immunogenic B cell epitope sequence is (NANP)n (SEQ ID NO:17). 5. The adenovirus of claim 4, wherein n is less than 40. 6. The adenovirus of claim 4, wherein n is 22 to 34. 7. The adenovirus of claims 1 or 3, wherein the B cell epitope sequence is (NANP)4, (NANP)5, (NANP)6, (NANP)7, (NANP)8, (NANP)9, (NANP)10, (NANP)n , (NANP)12, (NANP)i 3, (NANP)i4, (NANP)15, (NANP)16, (NANP)17, (NANP)18, (NANP)19, (NANP)20, (NANP)2i , (NANP)22, (NANP)23, (NANP)24, (NANP)25, (NANP)26, (NANP)27, (NANP)28, (NANP)29, (NANP)30, (NANP)3i , (NANP)32, (NANP)33 or (NANP)34. 8. The adenovirus of claim 1 , wherein the modified capsid protein gene is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:1 1 and SEQ ID NO:13. 9. The adenovirus of claim 8 wherein the nucleic acid sequence encodes a modified capsid protein sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12 and SEQ ID NO:14. 10. A method of inducing a humoral immune response against a Plasmodium circumsporozoite protein in a subject comprising administering to the subject at least one dose of a recombinant adenovirus, wherein said recombinant adenovirus is derived from a recombinant adenovirus plasmid vector, and wherein the recombinant adenovirus plasmid vector comprises a nucleotide sequence encoding: a Plasmodium circumsporozoite protein, or antigenic portion thereof, operably linked to a heterologous promoter, and a modified Hexon hypervariable region (HVR) sequence comprising an immunogenic B cell epitope sequence of Plasmodium circumsporozoite that is inserted into or replaces at least part of the HVR sequence. 1 1 . The method of claim 10, further comprising administering an adjuvant with the recombinant adenovirus. 12. The adenovirus of claim 10, wherein the HVR sequence further comprises an HVR1 or HVR5 sequence and the B cell epitope: a) is inserted in the HVR1 or HVR5 sequence; or b) replaces a portion of the HVR1 or HVR5 sequence. 13. The adenovirus of claims 10, wherein the immunogenic B cell epitope sequence is (NANP)n (SEQ ID NO:17). 14. The adenovirus of claim 13, wherein n is less than 40. 15. The adenovirus of claim 13, wherein n is 22 to 34. 16. The adenovirus of claims 10, wherein the B cell epitope sequence is (NANP)4, (NANP)5, (NANP)6, (NANP)7, (NANP)8, (NANP)9, (NANP)10, (NANP)n , (NANP)12, (NANP)13, (NANP)14, (NANP)15, (NANP)16, (NANP)17, (NANP)18, (NANP)19, (NANP)20, (NANP)21, (NANP)22, (NANP)23, (NANP)24, (NANP)25, (NANP)26, (NANP)27, (NANP)28, (NANP)29, (NANP)30, (NANP)31 , (NANP)32, (NANP)33 or (NANP)34. 17. The adenovirus of claim 10, wherein the modified capsid protein gene is encoded by a nucleic acid sequence selected from the group consisting of SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:1 1 and SEQ ID NO:13. 18. The adenovirus of claim 17, wherein the nucleic acid sequence encodes a modified capsid protein sequence selected from the group consisting of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12 and SEQ ID NO:14. 19. A method of inducing a cellular and humoral immune response against a Plasmodium circumsporozoite protein in a subject lacking a pre-existing neutralizing antibody to an adenovirus serotype, comprising administering to the subject: a first priming dose of a first recombinant adenovirus, and a subsequent boosting dose of a second recombinant adenovirus, wherein the first recombinant adenovirus is derived from a recombinant adenovirus plasmid vector, and wherein the recombinant adenovirus plasmid vector comprises a nucleotide sequence encoding a Plasmodium circumsporozoite protein, or antigenic portion thereof, operably linked to a heterologous promoter, and wherein the second recombinant adenovirus is derived from a recombinant adenovirus plasmid vector, and wherein the recombinant adenovirus plasmid vector comprises a nucleotide sequence encoding a Plasmodium circumsporozoite protein, or antigenic portion thereof, operably linked to a heterologous promoter, and a modified Hexon hypervariable region (HVR) sequence comprising an immunogenic B cell epitope sequence of Plasmodium circumsporozoite that is inserted into or replaces at least part of the HVR sequence. 20. The method of claim 19, further comprising administering an adjuvant with the recombinant adenovirus. 21 . The adenovirus of claims 19 or 20, wherein the immunogenic B cell epitope sequence is (NANP)n (SEQ ID NO:17) and wherein n is less than 40. 22. The adenovirus of claims 19 or 20, wherein the B cell epitope sequence is (NANP)4, (NANP)6, (NANP)8, (NANP)10, (NANP)12, (NANP)14, (NANP)16, (NANP)18, (NANP)20, (NANP)22, (NANP)28 or (NANP)34. 23. A pharmaceutical composition comprising a recombinant adenovirus, wherein the recombinant adenovirus is produced from an HVR1 -modified adenovirus vector, the HVR1 -modified adenovirus vector comprising a nucleotide sequence encoding a Plasmodium circumsporozoite protein, or antigenic portion thereof, operably linked to a heterologous promoter, and a modified Hexon hypervariable region (HVR) sequence comprising an immunogenic B cell epitope sequence of Plasmodium circumsporozoite that is inserted into or replaces at least part of the HVR sequence. 24. The pharmaceutical composition of claim 23, further comprising an adjuvant. 25. The pharmaceutical composition of claims 23 or 24, wherein the immunogenic B cell epitope sequence is (NANP)n (SEQ ID NO:17) and wherein n is less than 40. 26. The pharmaceutical composition of claims 23 or 24, wherein the B cell epitope sequence is (NANP)4, (NANP)6, (NANP)8, (NANP)10, (NANP)12, (NANP)14, (NANP)16, (NANP)18, (NANP)20, (NANP)22, (NANP)28 or (NANP)34. 27. The pharmaceutical composition of any of claims 23-26, wherein the pharmaceutical composition is part of a vaccine for malaria infection. 28. The pharmaceutical composition of claim 27, wherein the vaccine is administered to a subject intramuscularly, intradermal^ or subcutaneously. |
PRIORITY CLAIM
[0001] This application claims priority to and is a continuation-in-part of
International Application No. PCT/US10/045952, filed on August 18, 2010, and is also a continuation-in-part of International Application No. PCT/US09/054212, filed on August 18, 2009, the subject matter of both which are hereby incorporated by reference in their entirety, as if fully set forth herein. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under Grant No.
1 R01 AI081510-01 A1 awarded by the National Institute of Allergy and Infectious
Diseases (NIAID), an institute that is part of the National Institutes of Health. The government has certain rights in the invention. FIELD OF THE INVENTION
[0003] The invention relates to the field of medicine and biotechnology. More particularly, the invention relates to the use of capsid-modified adenoviral vectors to induce a potent immune response to a malaria parasite antigen such as Plasmodium circumsporozoite protein, which are suitable for vaccines against malaria. BACKGROUND
[0004] Malaria is a severe disease that ranks among the most prevalent infections in tropical areas throughout the world. Approximately 300-500 million people become infected yearly, with relatively high rates of morbidity and mortality. Severe morbidity and mortality occur particularly in young children and in adults migrating to a malaria endemic area without having undergone prior malaria exposure. The World Health Organization (WHO) estimates that 2 - 3 million children die of malaria in Africa alone, every year. The widespread occurrence and the increasing incidence of malaria in many countries, caused by drug-resistant parasites (Plasmodium falciparum, recently also Plasmodium vivax) and insecticide-resistant vectors (Anopheles mosquitoes), underscore the need for developing new methods for the control of this disease
(Nussenzweig and Long 1994).
[0005] Malaria parasites have a complicated life cycle consisting of pre- erythrocytic, erythrocytic and sexual parasitic forms, representing a potential target for the development of a malaria vaccine. The pre-erythrocytic and erythrocytic forms are found in the host, while the sexual forms occur in the vector. Immunization with live- attenuated irradiated sporozoites (IrSp) has been shown to induce sterile protection (i.e., complete resistance against parasite challenge) in mice (Nussenzweig et al. 1967), non-human primates (Gwadz et al. 1979) and human (Clyde et al. 1973, Edelman et al. 1993). Protection conferred by IrSp is mediated by sporozoite neutralization by both humoral (B cell) and cellular (T cell) immune responses (Tsuji et al. 2001 ). Although an IrSp vaccination is an attractive solution, the only way to obtain sporozoites is by dissecting mosquito salivary glands, and there is currently no known technology to grow large numbers of sporozoites in vitro. Therefore, an alternate vaccine vector that can elicit an equally strong protective immunity against malaria is needed.
[0006] One promising target for such a vaccine vector is the circumsporozoite (CS) protein, which is expressed on the surface of the sporozoite. Effective neutralizing antibodies are directed against the immunodominant, species specific, repeat domains of the circumsporozoite (CS) protein. In Plasmodium falciparum (human malaria parasite), the repeats (NANP) n are conserved among isolates from all areas of the world. This central repeat contains multiple repeat of B cell epitopes, and, therefore, the CS protein can induce a strong humoral immune response by triggering B cells (Tsuji et al. 2001 ). At the C-terminal region of the CS protein, there are several T cell epitopes, which can induce a significant cellular immune response (Tsuji et al. 2001 ). The humoral (antibody) response can eliminate parasites by interacting and neutralizing the infectivity of sporozoites (extra-cellular parasite) prior to entering hepatocyte, whereas the cellular (T cell) response can attack EEF (an intra-cellular parasite) by secreting interferon-gamma. These immune responses prevent the EEFs from maturing and dividing rapidly to form thousands of merozoites that reenter the blood and infect erythrocytes causing the disease we recognize as malaria.
[0007] One CS-based malarial vaccine that is currently undergoing human trials is GlaxoSmithKline's RTS, S, fusion protein of the Hepatitis B surface antigen and a portion of Plasmodium falciparum circumsporozoite protein (PfCSP) in a form of viruslike particle (International Patent Application No. PCT/EP1992/002591 to SmithKline Beecham Biologicals S.A., filed November 1 1 , 1992), has been shown to decrease malaria infection in clinical trials (Alonso et al. 2004, Alonso et al. 2005, Bejon et al. 2008). RTS, S induces an anti-PfCSP humoral immune response, but a relatively weak PfCSP-specific cellular (CD8+) response (Kester et al. 2008), which might be the reason for the relatively weak protection by RTS, S. In contrast, adenovirus-based malaria vaccines can induce a protective cellular immune response (International Patent Application No. PCT/EP2003/051019, filed December 16, 2003, Rodrigues et al. 1997). However, there are currently two obstacles that limit the use of an adenovirus-based platform as a malaria vaccine: (1 ) lack of a capability of inducing a potent humoral response against a transgene product, and (2) pre-existing immunity to adenovirus, especially adenovirus serotype 5, which hampers the immunogenicity of adenovirus- based vaccine.
[0008] One approach that has recently been taken in an attempt to augment adenovirus-induced humoral response is to insert a B cell antigenic epitope (e.g., a bacterial or viral epitope) in adenovirus capsid proteins such as Hexon, Fiber, Penton and pIX (Worgall et al. 2005, McConnell et al. 2006, Krause et al. 2006, Worgall et al. 2007, Shiratsuchi et al. 2010, Palma et al. 201 1 ).
[0009] In addition, to circumvent pre-existing immunity to adenovirus serotype 5 (Ad5), other adenovirus serotypes with lower seroprevalence, such as adenovirus serotype 1 1 , 35, 26, 48, 49 and 50, have been evaluated as a vaccine platform and shown to induce immune response to a transgene in spite of the presence of anti-Ad5 immunity (International Patent Application No. PCT/EP2005/055183 to Crucell Holland B.V., filed October 12, 2005, Abbink et al. 2007). Substitution of Ad5 Hexon, which is the target capsid protein of neutralizing antibody, with that of other serotypes has also been constructed in order to escape pre-existing anti-Ad5 immunity (Wu et al. 2002, Roberts et al. 2006).
[0010] Given that seroprevalence to Ad5 is high in malaria endemic areas
(Ophorst et al. 2006.), there is a need for an adenovirus-based malaria vaccine that induces both protective humoral and cellular immune responses even in the presence of pre-existing immunity to adenovirus.
SUMMARY
[0011] The present disclosure relates to various adenovirus protein modifications to augment immune response to a transgene of a recombinant adenoviral vaccine and to circumvent pre-existing anti-adenovirus immunity.
[0012] More specifically, one embodiment is directed to a recombinant
adenovirus derived from a recombinant adenovirus plasmid vector, wherein the recombinant adenovirus plasmid vector comprises a nucleotide sequence encoding (i) a Plasmodium circumsporozoite protein, or antigenic portion thereof, operably linked to a heterologous promoter such as CMV or CMV5 and (ii) a modified capsid or core protein, wherein an immunogenic epitope of Plasmodium circumsporozoite has been inserted into or replaces at least part of a capsid or core protein.
[0013] In some embodiments, the Plasmodium circumsporozoite protein further comprises a Plasmodium falciparum circumsporozoite protein. The circumsporozoite protein may further comprise a codon-optimized Plasmodium falciparum
circumsporozoite protein, and in some aspects, may be encoded by the sequence of SEQ ID NO:1 or SEQ ID NO:2.
[0014] In other embodiments, the immunogenic epitope further comprises a B cell epitope of Plasmodium circumsporozoite protein. The B cell epitope may be
incorporated in a modified capsid protein, and in some aspects, the capsid protein may comprise a Hexon hypervariable region (HVR). The HVR may further comprise HVR1 or HVR5, wherein a portion of HVR1 or HVR5 is replaced with the B cell epitope. In other aspects, the capsid protein may further comprise a capsid Fiber protein wherein the B cell epitope is inserted into the Fiber protein. In some aspects, the B cell epitope is a Plasmodium falciparum circumsporozoite protein B cell epitope, wherein the B cell epitope is a repeat sequence, for example, (NANP) n (SEQ ID NO:17), wherein n is less than 40. In some embodiments, the repeat sequence may be (NANP) 4 , (NANP) 6 , (NANP) 8 , (NANP)io, (NANP) 12 , (NANP) 14 , (NANP) 16 , (NANP) 18 , (NANP) 20 , (NANP) 22 , (NANP) 28 or (NANP) 34 .
[0015] Other embodiments are directed to a pharmaceutical composition or malaria vaccine composition comprising a recombinant adenovirus according to the above embodiments. Further embodiments include a method of treating, preventing, or diagnosing malaria, comprising administering a therapeutic amount of the
pharmaceutical composition or malaria vaccine composition in accordance with the above embodiments.
[0016] In another embodiment, a method for treatment comprising administering a prime-boost vaccination, wherein a subject is given a series of increasing dosages or same dosages at a given time interval. The time interval may be any length sufficient to generate a humoral and/or cellular immune response. For example, as described below, the interval may be, but is not limited to, once every 3 weeks.
[0017] BRIEF DESCRIPTION OF THE DRAWINGS [0018] Fig. 1 is a schematic diagram of a (NANP) n -HVR1 /PfCSP recombinant adenovirus in accordance with embodiments of the disclosure.
[0019] Fig. 2 is a schematic diagram illustrating the preparation of the DNA fragment coding (NANP) 28 and HVR1 -flanking sequences by overlapping PCR in accordance with embodiments of the disclosure. [0020] Fig. 3 is a schematic diagram illustrating the preparation of the DNA fragment coding (NANP) 34 and HVR1 -flanking sequences by overlapping PCR in accordance with embodiments of the disclosure. [0021] Fig. 4 is a schematic diagram illustrating the preparation of the DNA fragment coding (NANP) 40 and HVR1 -flanking sequences by overlapping PCR in accordance with embodiments of the disclosure.
[0022] Fig. 5 is a schematic diagram illustrating the construction of the (NANP) 4> io, i6, 22, or 28-HVR1 /PfCSP and (NANP) 2 2, or 28-HVR1 /CMV5-PfCSP in accordance with embodiments of the disclosure.
[0023] Fig. 6 is a schematic diagram illustrating the construction of the (NANP) 34> or 40 -HVR1 /PfCSP and (NANP) 34 , 0 r 4o-HVR1 /CMV5-PfCSP. using pUC19-Mut plasmid in accordance with embodiments of the disclosure. [0024] Fig. 7 is the nucleic acid sequence of codon-optimized Plasmodium falciparum circumsporozoite protein (PfCSP, SEQ ID NO:1 ) and the corresponding amino acid sequence (SEQ ID NO:2).
[0025] Fig. 8 is the nucleic acid and amino acid sequences of modified Hexon having four repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=4) in HVR1 (SEQ ID NO:3, nucleic acid; SEQ ID NO:4, amino acid). The inserted (NANP) 4 sequence is underlined.
[0026] Fig. 9 is the nucleic acid and amino acid sequences of modified Hexon having ten repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=10) in HVR1 (SEQ ID NO:5, nucleic acid; SEQ ID NO:6, amino acid). The inserted (NANP)-io sequence is underlined.
[0027] Fig. 10 is the nucleic acid and amino acid sequences of modified Hexon having sixteen repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=16) in HVR1 (SEQ ID NO:7, nucleic acid; SEQ ID NO:8, amino acid). The inserted (NANP) 6 sequence is underlined. [0028] Fig. 1 1 is the nucleic acid and amino acid sequences of modified Hexon having twenty-two repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=22) in HVR1 (SEQ ID NO:9, nucleic acid; SEQ ID NO:10, amino acid). The inserted (NANP) 2 2 sequence is underlined.
[0029] Fig. 12 is the nucleic acid and amino acid sequences of modified Hexon having twenty-eight repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=28) in HVR1 (SEQ ID NO:1 1 , nucleic acid; SEQ ID NO:12, amino acid). The inserted (NANP) 2 s sequence is underlined.
[0030] Fig. 13 is the nucleic acid and amino acid sequences of modified Hexon having thirty-four repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=34) in HVR1 (SEQ ID NO:13, nucleic acid; SEQ ID NO:14, amino acid). The inserted (NANP) 34 sequence is underlined.
[0031] Fig. 14 is the nucleic acid and amino acid sequences of modified Hexon having forty repeats of the PfCSP B cell epitope sequence (NANP) n (SEQ ID NO:17; n=40) in HVR1 (SEQ ID NO:15, nucleic acid; SEQ ID NO:16, amino acid). The inserted (NANP) 40 sequence is underlined. [0032] Fig. 15 shows the results of PCR analysis of the region where NANP repeats were inserted in (NANP) n -HVR1 /PfCSP. A 1 kb plus ladder (Invitrogen) was used as a molecular marker.
[0033] Fig. 16 shows HVR1 -modified adenovirus growth after HVR1 -modified adenovirus DNA transfection of AD293 cells. [0034] Fig. 17 illustrates a prime and boost immunization regimen with HVR1 - modified PfCSP adenovirus having (NANP) n repeats (SEQ ID NO:17, n=22)(A), PfCSP- specific humoral responses at week 9 (B), and blood stage parasite infection after PfCSP-transgenic P. berghei sporozoite challenge (C).
[0035] Fig. 18 illustrates a prime and boost immunization regimen with HVR1 - modified PfCSP adenovirus having (NANP) n repeats (SEQ ID NO:17, n=22, 28, 34) (A), and PfCSP-specific humoral responses at day 35 (B). MEANS FOR SOLVING THE PROBLEMS
[0036] The present inventors have found a novel recombinant adenovirus having a novel, capsid-modified structure that is derived from a recombinant adenovirus plasmid vector. The recombinant adenovirus is capable of infecting mammalian cells, causing the cells to express a Plasmodium circumsporozoite protein. The recombinant adenovirus also has a modified Hexon hypervariable region (HRV) sequence
comprising an immunogenic B cell epitope sequence of a Plasmodium falciparum circumsporozoite protein that is inserted into or replaces at least part of the HRV sequence. The recombinant adenovirus is obtained by the method of transfecting cells with the linearized recombinant adenovirus plasmid vector. Using the obtained recombinant adenovirus, the present inventors carried out extensive research on pharmaceuticals containing as an active ingredient a recombinant adenovirus having malaria infection preventive and therapeutic effects. As a result, the inventors found that the obtained recombinant adenovirus has the desired pharmaceutical effects. DETAILED DESCRIPTION
[0037] The following description provides specific details for a thorough understanding of, and enabling description for, embodiments of the disclosure.
However, one skilled in the art will understand that the disclosure may be practiced without these details. In other instances, well-known structures and functions have not been shown or described in detail to avoid unnecessarily obscuring the description of the embodiments of the disclosure.
[0038] The abbreviations used for the amino acids, peptides, base sequences, and nucleic acids in the present disclosure are based on the abbreviations specified in the lUPAC-IUB Communication on Biochemical Nomenclature, Eur. J. Biochem., 138: 9 (1984), "Guideline for Preparing Specifications Including Base Sequences and Amino Acid Sequences" (United States Patent and Trademark Office), and those commonly used in this technical field.
[0039] A "nucleotide sequence," "polynucleotide" or "DNA molecule" as contemplated by the current disclosure, may include double strand DNA or single strand DNA (i.e., a sense chain and an antisense chain constituting the double strand DNA), and is not limited to a full length thereof. Nucleotide sequences encoding an
immunogenic foreign gene, such as those disclosed herein below, encompass double strand DNA containing genomic DNA, single strand DNA (sense chain) containing cDNA, single strand DNA (antisense chain) having a sequence complementary to the sense chain, synthetic DNA, and fragments thereof, unless otherwise mentioned.
[0040] Nucleotide sequences, polynucleotides or DNA molecules as used herein are not limited to the functional region, and may include at least one of an expression suppression region, a coding region, a leader sequence, an exon, and an intron.
Further, examples of nucleotide sequences or polynucleotides may include RNA or DNA. A polypeptide containing a specific amino acid sequence and a polynucleotide containing a specific DNA sequence may include fragments, homologs, derivatives, and mutants of the polynucleotide. Examples of mutants of a nucleotide sequence or polynucleotide (such as mutant DNA), include naturally occurring allelic mutants;
artificial mutants; and mutants having deletion, substitution, addition, and/or insertion. It should be understood that such mutants encode polypeptides having substantially the same function as the polypeptide encoded by the original non-mutated polynucleotide.
[0041] The present disclosure relates to a recombinant adenovirus that can express an antigenic determinant of a Plasmodium parasite, and comprises one or more modified capsid and/or core proteins. The recombinant adenovirus is derived from a recombinant adenovirus plasmid vector, the generation of which is described in the Examples below. The use of adenovirus as a vector is discussed further below. The recombinant adenovirus plasmid vectors described herein may be used as a malaria vaccine or pharmaceutical composition, wherein both humoral and/or cellular immune responses against the Plasmodium parasite are induced.
[0042] The Plasmodium parasite may be selected from any of the known
Plasmodium (P.) species, for example, P. falciparum, P. malariae, P. ovale, P. vivax, P. knowlesi, P. berghei, P. chabaudi and P. yoelii. In some embodiments, the antigenic determinant is derived from the rodent-specific Plasmodium yoelii or the human-specific Plasmodium falciparum
[0043] In one embodiment, a recombinant adenovirus capsid-modified plasmid vector (also described as a recombinant adenovirus plasmid vector herein) is a plasmid that encodes and produces a capsid and/or core-modified recombinant adenovirus (also described as a recombinant adenovirus herein) that has a structure comprising one or more modified capsid and/or core proteins. In accordance with the embodiments of the disclosure, the modification of the capsid and/or core proteins may be accomplished by insertion of at least one immunogenic epitope of a Plasmodium circumsporozoite protein. Alternatively, at least part of the capsid and/or core protein may be deleted and replaced by at least one immunogenic epitope of a Plasmodium circumsporozoite protein. In some embodiments, the immunogenic epitope is a B-cell and/or T-cell epitope of a Plasmodium circumsporozoite protein. The addition of a B cell or T cell epitope may serve to enhance the efficacy of an adenoviral vector used as a malaria vaccine by establishing or enhancing the humoral immune response to the CS protein. The modified capsid and core proteins and their significance with respect to their use in the recombinant adenovirus described herein are discussed further below.
[0044] The one or more modified capsid and/or core proteins may be a modified Hexon protein, a modified Fiber protein, a modified pVII protein or a combination thereof. In one embodiment, a portion of a Hexon hypervariable region (HVR) is replaced by at least one B-cell epitope of a Plasmodium circumsporozoite protein. In another embodiment, one or more B-cell and/or T cell epitope of a Plasmodium circumsporozoite protein may be inserted in the Fiber protein or Hexon HVR. In some aspects, the modified HVR may be HVR1 , HVR2, HVR3, HVR4, HVR5, HVR6 or HVR7. In other aspects, the modified HVR may be HVR1 or HVR5.
[0045] In some embodiments the HVR-modified Hexon includes a B cell epitope repeat sequence, (NANP) n (SEQ ID NO:17; n=4, 10, 16, 22, 28, 34), inserted in the HVR1 region of the Hexon. In some aspects, such an HVR-modified Hexon may have a nucleic acid sequence of SEQ ID NO:3 (Fig. 8), SEQ ID NO:5 (Fig. 9), SEQ ID NO:7 (Fig. 10), SEQ ID NO:9 (Fig. 1 1 ), SEQ ID NO:1 1 (Fig. 12), SEQ ID NO:13 (Fig. 13), or SEQ ID NO:15 (Fig. 14). These nucleic acid sequences encode modified capsid proteins having amino acid sequences of SEQ ID NO:4 (Fig. 8), SEQ ID NO:6 (Fig. 9), SEQ ID NO:8 (Fig. 10), SEQ ID NO:10 (Fig. 1 1 ), SEQ ID NO:12 (Fig. 12), SEQ ID NO:14 (Fig. 13), or SEQ ID NO:16 (Fig. 14), respectively.
[0046] The HVR-modified Hexon may be produced by any suitable method known in the art, for example, a polymerase chain reaction (PCR) method. In some embodiments, the HVR-modified Hexon may be produced by one or more PCR reactions to amplify a region of the hexon gene that contains Age I and Nde I restriction sites using primers that have an (NANP) n sequence (SEQ ID NO:17) instead of an HVR1 sequence. In other embodiments, the HVR-modified Hexon is produced by an "overlapping" (or "overlap extension") PCR method. Overlapping PCR, a method similar to gene splicing for recombination of DNA, involves the use of oligonucleotide primers used in a PCR reaction to generate DNA fragments that have overlapping ends. The overlapping fragments are then combined in a fusion reaction wherein the overlapping ends anneal, allowing the 3' overlap of each strand to serve as a primer for the 3' extension of the complementary strand, resulting in the production of a longer target (Horton et al. 1989).
[0047] In addition to inserting a B cell epitope, a T-cell epitope of a Plasmodium circumsporozoite protein may be inserted into an adenovirus core pVII protein at any of the following sites: the C-terminus, before the first Nuclear Localization Signal (NLS) or between the two NLS. Alternatively, a T-cell epitope of a Plasmodium circumsporozoite protein may replace a portion of the pVII protein.
[0048] The recombinant adenovirus may express a transgenic protein or recombinant transgenic protein. In some embodiments, the transgenic protein or recombinant transgenic protein is a Plasmodium circumsporozoite protein or an antigenic determinant that is encoded by a recombinant adenovirus plasmid vector as described herein, and is expressed by a recombinant adenovirus produced by said recombinant adenovirus plasmid vector after infection of one or more host cells. [0049] Thus, in some embodiments, the recombinant adenovirus plasmid vectors comprise a nucleotide sequence encoding a recombinant transgenic protein. In one embodiment, the recombinant transgenic protein may comprise an antigenic
determinant of P. falciparum, a human-specific parasite, wherein the antigenic determinant comprises a P. falciparum circumsporozoite gene (CS) protein or an antigenic portion thereof. The P. falciparum CS protein has demonstrated prevention of malaria when used as the basis of active immunization in humans against mosquito- borne infection. The antigenic determinant may further comprise an immunogenic epitope, such as a B cell and/or T cell epitope. [0050] In some embodiments, the CS protein is codon-optimized for enhanced expression in a subject. Codon-optimization is based on the required amino acid content, the general optimal codon usage in the subject of interest as well as any aspects that should be avoided to ensure proper expression. Such aspects may be splice donor or acceptor sites, stop codons, polyadenylation (pA) signals, GC- and AT- rich sequences, internal TATA boxes, or any other aspects known in the art. In some embodiments, the DNA sequence of the codon-optimized CS transgene is shown in Fig. 7 (SEQ ID NO:1 , P. falciparum).
[0051] In some embodiments, the recombinant adenovirus plasmid vector may be a modified P. falciparum recombinant adenovirus plasmid vectors, such as an HVR1 - modified adenovirus vector (e.g., (NANP) 4> 0 , 16, 22, 28, 34 or 40 -HVR1 /PfCSP or (NANP) 4> 0 , 16, 22, 28, 34 or 40-H VR1 /CMV5-Pf CSP). Such vectors are discussed further in the
Examples below and may be constructed as shown in Figs. 5 and 6, using a B cell epitope coding sequence of (NANP) n (SEQ ID NO:17).
[0052] In other embodiments, a recombinant adenovirus may be produced by one of the following modified P. falciparum recombinant adenovirus plasmid vectors: (NANP) 4 -HVR1 /PfCSP, (NANP) 10 -HVR1 /PfCSP, (NANP) 16 -HVR1 /PfCSP, (NANP) 22 - HVR1 /PfCSP, (NANP) 28 -HVR1 /PfCSP, (NANP) 4 -HVR1 /CMV5-PfCSP, (NANP) 10 - HVR1 /CMV5-PfCSP, (NANP) 16 -HVR1 /CMV5-PfCSP, (NANP) 22 -HVR1 /CMV5-PfCSP or (NANP) 28 -HVR1 /CMV5-PfCSP (Fig. 5); or (NANP) 34 -HVR1 /PfCSP, (NANP) 40 - HVFM /PfCSP, (NANP) 34 -HVR1 /CMV5-PfCSP or (NANP) 40 -HVR1 /CMV5-PfCSP (Fig. 6). The recombinant adenovirus may be produced in accordance with the methods described herein for producing a recombinant adenovirus plasmid vector with the ability to express a recombinant transgenic protein (e.g., Plasmodium CS protein) in
mammalian host cells.
[0053] Purification of a recombinant adenovirus may be performed by using known virus purification methods. For example, purification of 0.5 to 1 .0 ml_ of a stock virus obtained by the method of producing a recombinant adenovirus protein by inoculating insect cells (1 x 10 7 cells/10 cm dish), such as AD293 cells. The culture supernatant is then collected several days after the infection, and a virus pellet obtained by centrifugation is suspended in a buffer, such as PBS (Phosphate Buffered Saline). The resulting suspension is subjected to a sucrose gradient of 10 to 60% and then centrifuged (25,000 rpm for 60 minutes at 4°C) to collect a virus band. The collected virus is further suspended in PBS, subsequently centrifuged under the same conditions as above, and the resulting purified recombinant virus pellet is stored at 4°C in a buffer, such as PBS.
[0054] Another embodiment is directed to a pharmaceutical composition comprising at least one active ingredient. In one embodiment, an active ingredient of the pharmaceutical composition may comprise a recombinant adenovirus, which may be obtained by the genetic engineering techniques described herein. More specifically, the active ingredient may be a recombinant adenovirus comprising modified capsid and/or core proteins, wherein a portion of a Hexon hypervariable region (HVR), a portion of Fiber protein, a portion of pVII protein or a combination thereof is replaced by at least one immunogenic epitope of Plasmodium circumsporozoite protein.
Alternatively, one or more B-cell and/or T cell epitopes of a Plasmodium
circumsporozoite protein may be inserted in the Fiber protein, Hexon HVR or pVII protein. The recombinant adenovirus plasmid vector further comprises a transgenic protein or recombinant transgenic protein that is expressed by the recombinant adenovirus after infecting one or more host cells. The transgenic protein or
recombinant transgenic protein may be a Plasmodium circumsporozoite protein or a malaria antigen of a Plasmodium circumsporozoite protein, wherein the malaria antigen comprises at least one immunogenic epitope (e.g., a B cell or T cell epitope) of
Plasmodium circumsporozoite protein.
[0055] In some embodiments, the active ingredient of the pharmaceutical composition is a recombinant adenovirus derived from a recombinant adenovirus plasmid vector, wherein the recombinant adenovirus plasmid vector is one of the following modified P. falciparum recombinant adenovirus plasmid vectors: (NANP) 4 - HVFM /PfCSP, (NANP) 10 -HVR1 /PfCSP, (NANP) 16 -HVR1 /PfCSP, (NANP) 22 - HVFM /PfCSP, (NANP) 28 -HVR1 /PfCSP, (NANP) 4 -HVR1 /CMV5-PfCSP, (NANP) 10 - HVR1 /CMV5-PfCSP, (NANP) 16 -HVR1 /CMV5-PfCSP, (NANP) 22 -HVR1 /CMV5-PfCSP or (NANP) 28 -HVR1 /CMV5-PfCSP (Fig. 5); or (NANP) 34 -HVR1 /PfCSP, (NANP) 40 - HVR1 /PfCSP, (NANP) 34 -HVR1 /CMV5-PfCSP or (NANP) 40 -HVR1 /CMV5-PfCSP (Fig. 6). These recombinant adenovirus plasmid vectors are capable of producing recombinant adenoviruses when transfected into cells (e.g., AD293 cells) and wherein the
recombinant transgenic protein may be expressed in mammalian cells, including human cells.
[0056] When given to a subject, a pharmaceutical composition having an active ingredient is a recombinant adenovirus as described herein enhances malaria infection- preventing effects against a malaria infectious antigen and reduces the infectivity titer, as described further in the Examples below. Thus, the recombinant adenovirus may be used for the treatment of malaria infections associated with infection of target cells and tissues. Examples of target cells affected by such malaria infection include blood cells, hepatic cells, renal cells, brain cells, lung cells, epithelial cells, and muscular cells.
Examples of tissues comprising such cells include the lung, liver, kidney, brain, arteries and veins, the stomach, intestines, urethra, skin, and muscle.
[0057] In some aspects, the pharmaceutical composition may enhance malaria infection- preventing effects against infectious antigens, for example, malaria antigens such as sporozoite surface antigens (Circumsporozoite Protein (CSP) and
Thrombospondin Related Adhesive Protein (TRAP)) of malaria parasites, merozoite surface membrane protein (MSPI), malaria S antigen secreted from erythrocytes infected with malaria, and P. falciparum Erythrocyte Membrane Protein-1 (PfEMPI) protein present in the knobs of erythrocytes infected with malaria. The pharmaceutical composition may enhance malaria infection-preventing effects against a Plasmodium parasite, selected from any known Plasmodium (P) species, for example, P. falciparum, P. malariae, P. ovale, P. vivax, P. knowlesi, P. berghei, P. chabaudi and P. yoelii, by reducing the infectivity titer. When administered to a subject, a reduction of the infectivity titer by the pharmaceutical composition may result in an increased survival, disease-free survival, or infection-free survival period and survival, disease-free survival, or infection-free survival rate when compared to subjects not administered the
pharmaceutical composition. Thus, in some aspects, the pharmaceutical composition is useful as a preventive or therapeutic agent for malaria infections caused by pathogens such as Plasmodium. In further aspects, the pharmaceutical composition is useful as a preventive or therapeutic agent for complications resulting from a malaria infection caused by pathogens such as Plasmodium.
[0058] The infection-preventing effect of the recombinant adenovirus of the present invention in a subject can be provided, for example, by administering the pharmaceutical composition containing the capsid-modified recombinant adenovirus of the present invention and additives for pharmaceutical administration to vertebrates, particularly mammals, including humans, by intramuscular (i.m.), subcutaneous (s.c), intracutaneous (i.e.), intradermal (i.d.), intraperitoneal (i.p.), nasal, or respiratory route, and then immunizing the vertebrates with the pharmaceutical composition containing the recombinant adenovirus described herein as an active ingredient several times. To evaluate the infection-preventing effect, the survival rate, disease-free survival, or infection-free survival of subjects immunized with the pharmaceutical composition several times followed by infection by a target pathogen (such as a selected
Plasmodium species) may be compared with the survival rate, disease-free survival, or infection-free survival of subjects not given the pharmaceutical composition.
[0059] In some embodiments, the pharmaceutical composition may additionally comprise a pharmaceutically effective amount of capsid and/or core-modified recombinant adenovirus as described herein and a pharmaceutically acceptable carrier, which is described further below.
[0060] Another embodiment is directed to a vaccine composition essentially comprising at least one active ingredient. In one embodiment, an active ingredient of the vaccine composition may comprise a recombinant adenovirus, derived from a recombinant adenovirus plasmid vector as described herein. More specifically, the active ingredient may be a recombinant adenovirus comprising modified capsid or core proteins, wherein a portion of a Hexon hypervariable region (HVR), a portion of Fiber protein, a portion of pVII protein or a combination thereof are replaced by at least one immunogenic epitope of Plasmodium circumsporozoite protein. Alternatively, at least one immunogenic epitope of a Plasmodium circumsporozoite protein may be inserted in the pVII protein, Fiber protein or Hexon HVR, or a combination thereof. In some embodiments, the active ingredient of the vaccine composition may be derived from a recombinant adenovirus plasmid vector illustrated in Figs. 5-6, for example, (NANP) 4 - HVR1 /PfCSP, (NANP) 10 -HVR1 /PfCSP, (NANP) 16 -HVR1 /PfCSP, (NANP) 22 -
HVR1 /PfCSP, (NANP) 28 -HVR1 /PfCSP, (NANP) 4 -HVR1 /CMV5-PfCSP, (NANP) 10 - HVR1 /CMV5-PfCSP, (NANP) 16 -HVR1 /CMV5-PfCSP, (NANP) 22 -HVR1 /CMV5-PfCSP or (NANP) 28 -HVR1 /CMV5-PfCSP (Fig. 5); or (NANP) 34 -HVR1 /PfCSP, (NANP) 40 - HVR1 /PfCSP, (NANP) 34 -HVR1 /CMV5-PfCSP or (NANP) 40 -HVR1 /CMV5-PfCSP (Fig. 6). [0061] In some aspects, the vaccine composition, when administered to a subject, first comprises a recombinant adenovirus having one or more antigenic portions of a Plasmodium CS protein (i.e., a B cell epitope, T cell epitope or both) inserted into or replacing at least a part of a capsid or core protein. The vaccine composition may then express a recombinant transgenic protein, wherein the recombinant transgenic protein is a Plasmodium CS protein comprising a B cell epitope, T cell epitope or both. The antigenic portions of the Plasmodium CS protein are found in the recombinant transgenic protein and the modified capsid or core proteins promote or enhance acquired humoral immunity, cellular immunity, or both as described in the Examples below. Thus, in some aspects, the recombinant adenovirus as described herein is useful as a vaccine to promote or enhance humoral immunity, cellular immunity, or both. [0062] In further embodiments, the vaccine composition may enhance infection- preventing effects against infectious antigens, for example, malaria antigens such as sporozoite surface antigens (CSP and TRAP) of malaria parasites, merozoite surface membrane protein MSPI, malaria S antigen secreted from erythrocytes infected with malaria, PfEMPI protein present in the knobs of erythrocytes infected with malaria,
Serine-Rich Antigen (SERA) protein, Tyrosine-Rich Acidic Matrix Protein (TRAMP), and Apical Membrane Antigen-1 (AMAI) protein. Further, a reduced infectivity titer resulting from administration of a vaccine composition described herein may result in an increased survival, disease-free survival or infection-free survival period and survival, disease-free survival or infection-free survival rate when compared to subjects not administered the vaccine composition. Thus, in some aspects, the vaccine composition is also useful as a preventive or therapeutic agent for malaria infections caused by pathogens such as Plasmodium. In further aspects, the vaccine composition is also useful as a preventive or therapeutic agent for complications resulting from a malaria infection by pathogens such as Plasmodium.
[0063] A vaccine composition as described herein may comprise a
therapeutically effective amount of a recombinant adenovirus as described herein, and further comprising a pharmaceutically acceptable carrier according to a standard method. Examples of acceptable carriers include physiologically acceptable solutions, such as sterile saline and sterile buffered saline.
[0064] In some embodiments, the vaccine or pharmaceutical composition may be used in combination with a pharmaceutically effective amount of an adjuvant to enhance the anti-malaria effects. Any immunologic adjuvant that may stimulate the immune system and increase the response to a vaccine, without having any specific antigenic effect itself may be used as the adjuvant. Many immunologic adjuvants mimic evolutionarily conserved molecules known as pathogen-associated molecular patterns (PAMPs) and are recognized by a set of immune receptors known as Toll-like
Receptors (TLRs). Examples of adjuvants that may be used in accordance with the embodiments described herein include Freund's complete adjuvant, Freund's
incomplete adjuvant, double stranded RNA (a TLR3 ligand), LPS, LPS analogs such as monophosphoryl lipid A (MPL) (a TLR4 ligand), flagellin (a TLR5 ligand), lipoproteins, lipopeptides, single stranded RNA, single stranded DNA, imidazoquinolin analogs (TLR7 and TLR8 ligands), CpG DNA (a TLR9 ligand), Ribi's adjuvant
(monophosphoryl-lipid A/trehalose dicorynoycolate), glycolipids (a-GalCer analogs), unmethylated CpG islands, oil emulsion, liposomes, virosomes, saponins (active fractions of saponin such as QS21 ), muramyl dipeptide, alum, aluminum hydroxide, squalene, BCG, cytokines such as GM-CSF and IL-12, chemokines such as MIP 1 -a and RANTES, N-acetylmuramine-L-alanyl-D-isoglutamine (MDP), thymosin al and MF59. The amount of adjuvant used can be suitably selected according to the degree of symptoms, such as softening of the skin, pain, erythema, fever, headache, and muscular pain, which might be expressed as part of the immune response in humans or animals after the administration of this type of vaccine.
[0065] In some embodiments, the vaccine or pharmaceutical composition described herein may be used in combination with other known pharmaceutical products, such as immune response-promoting peptides and antibacterial agents
(synthetic antibacterial agents). The vaccine or pharmaceutical composition may further comprise other drugs and additives. Examples of drugs or additives that may be used in conjunction with a vaccine or pharmaceutical composition described herein include drugs that aid intracellular uptake of the recombinant adenovirus or recombinant transgenic protein of the present invention, liposome and other drugs and/or additives that facilitate transfection, (e.g., fluorocarbon emulsifiers, cochleates, tubules, golden particles, biodegradable microspheres, and cationic polymers).
[0066] In some embodiments, the amount of the active ingredient contained in the vaccine or pharmaceutical composition described herein may be selected from a wide range of concentrations, Virus Particle Unit (VPU), Plaque Forming Unit (PFU), weight to volume percent (w/v %) or other quantitative measure of active ingredient amount, as long as it is a therapeutically or pharmaceutically effective amount. The dosage of the vaccine or pharmaceutical composition may be appropriately selected from a wide range according to the desired therapeutic effect, the administration method (administration route), the therapeutic period, the patient's age, gender, and other conditions, etc.
[0067] In some aspects, when a recombinant adenovirus is administered to a human subject as an active ingredient of the vaccine or pharmaceutical composition, the dosage of the recombinant adenovirus may be administered in an amount approximately corresponding to 10 2 to 10 14 PFU, preferably 10 5 to 10 12 PFU, and more preferably 10 6 to 10 10 PFU per patient, calculated as the PFU of the recombinant virus.
[0068] In further aspects, when a recombinant adenovirus is administered to a subject as an active ingredient of the vaccine or pharmaceutical composition, the dosage may be selected from a wide range in terms of the amount of expressible DNA introduced into the vaccine host or the amount of transcribed RNA. The dosage also depends on the strength of the transcription and translation promoters used in any transfer vectors used.
[0069] In some embodiments, the vaccine composition or pharmaceutical composition described herein may be administered by directly injecting a recombinant adenovirus suspension prepared by suspending the recombinant adenovirus in PBS (phosphate buffered saline) or saline into a local site (e.g., into the lung tissue, liver, muscle or brain), by nasal or respiratory inhalation, or by intravascular (i.v.) (e.g., intraarterial, intravenous, and portal venous), subcutaneous (s.c), intracutaneous (i.e.), intradermal (i.d.), or intraperitoneal (i.p.) administration. The vaccine or pharmaceutical composition of the present invention may be administered more than once. More specifically, after the initial administration, one or more additional vaccinations may be given as a booster. One or more booster administrations can enhance the desired effect. After the administration of the vaccine or pharmaceutical composition, booster immunization with a pharmaceutical composition containing the recombinant adenovirus as described herein may be performed.
[0070] In further embodiments, use of various other adjuvants, drugs or additives with the vaccine of the invention, as discussed above, may enhance the therapeutic effect achieved by the administration of the vaccine or pharmaceutical composition. The pharmaceutically acceptable carrier may contain a trace amount of additives, such as substances that enhance the isotonicity and chemical stability. Such additives should be non-toxic to a human or other mammalian subject in the dosage and concentration used, and examples thereof include buffers such as phosphoric acid, citric acid, succinic acid, acetic acid, and other organic acids, and salts thereof;
antioxidants such as ascorbic acid; low molecular weight (e.g., less than about 10 residues) polypeptides (e.g., polyarginine and tripeptide) proteins (e.g., serum albumin, gelatin, and immunoglobulin); amino acids (e.g., glycine, glutamic acid, aspartic acid, and arginine) ; monosaccharides, disaccharides, and other carbohydrates (e.g., cellulose and derivatives thereof, glucose, mannose, and dextrin) , chelating agents (e.g., EDTA); sugar alcohols (e.g., mannitol and sorbitol); counterions (e.g., sodium); nonionic surfactants (e.g., polysorbate and poloxamer) ; and PEG.
[0071] The vaccine or pharmaceutical composition containing a recombinant adenovirus described herein may be stored as an aqueous solution or a lyophilized product in a unit or multiple dose container such as a sealed ampoule or a vial.
[0072] Another embodiment further provides a method of preventing malaria infection, or a method of treating malaria comprising administering an effective amount of the recombinant adenoviral vaccine, formulation, or pharmaceutical composition. The present invention further provides a method of immunostimulation comprising administering an effective amount of a recombinant adenoviral vaccine composition, formulation, pharmaceutical composition or a combination thereof to a subject.
Subjects may include humans, animals (such as mammals, birds, reptiles, fish, and amphibians), or any other subjects that may become infected with a malaria parasite. Malaria parasites may include a Plasmodium parasite, selected from any of known Plasmodium (P) species, for example, P. falciparum, P. malariae, P. ovale, P. vivax, P. knowlesi, P. berghei, P. chabaudi and P. yoelii.
[0073] In some embodiments, a recombinant adenovirus as described herein may be formed alone or may be together with a pharmaceutically acceptable carrier into a vaccine composition, formulation, or pharmaceutical composition, and administered to the subject. The administration route may be, for example, any administration route mentioned above. The pharmaceutically acceptable carrier for use in the present invention can be suitably selected from carriers commonly used in this technical field, according to the form of the pharmaceutical composition to be produced. For example, when the pharmacological composition is formed into an aqueous solution, purified water (sterile water) or a physiological buffer solution can be used as the carrier. When the pharmaceutical composition is formed into other appropriate solutions, organic esters capable of being injected, such as glycol, glycerol and olive oil may be used as the carrier. The composition may contain stabilizers, excipients and other commonly used substances in this technical field, and particularly in the field of vaccine
formulations.
[0074] In further embodiments, the amount of recombinant adenovirus used in a vaccine composition, formulation, or pharmaceutical composition may be suitably selected from a wide range of concentrations, VPU, PFU, weight to volume percent (w/v %) or other quantitative measure of active ingredient amount. In some aspects, a suitable range of recombinant adenovirus in the composition is preferably about 0.0002 to about 0.2 (w/v %), and more preferably 0.001 to 0.1 (w/v %). The method of administration of a recombinant adenovirus vaccine composition, formulation, or pharmaceutical composition according to some embodiments may be suitably selected according to the dosage form, the patient's age, gender and other conditions such as the severity of the disease. A suitable dosage form is a form for parenteral
administration, such as injections, drops, nasal drops, and inhalants. When the composition is formed into an injection or drops, the injection can be intravenously administered and mixed with a replacement fluid such as a glucose solution or an amino acid solution as appropriate, or can be administered intramuscularly (i.m.),
intracutaneously (i.e.), subcutaneously (s.c.) intradermal^ (i.d.), or intraperitoneal^ (i.p.).
[0075] In other embodiments, the daily dosage of a recombinant adenovirus vaccine composition, formulation, or pharmaceutical composition may vary depending on the subject's condition, body weight, age, gender, etc. In some aspects, the dosage of a recombinant adenovirus is administered in an amount of approximately 0.001 to 100 mg per kg of body weight per day. The vaccine, formulation, or composition of the invention may be administered in one or more administrations per day.
[0076] In further embodiments, when a recombinant adenovirus is administered to a human subject as an active ingredient of the vaccine composition, formulation or pharmaceutical composition, the dosage of the recombinant adenovirus is administered in an amount approximately corresponding to 10 2 to 10 14 PFU, preferably 10 5 to 10 12 PFU, and more preferably 10 6 to 10 10 PFU per patient, calculated as the PFU of the recombinant adenovirus particle. The vaccine composition of the present invention should be administered according to Good Medical Practice, considering the clinical condition (for example, the condition to be prevented or treated) of each patient, the delivery site of the vaccine composition containing the recombinant adenovirus, the target tissue, the administration method, the dosage regimen, and other factors known to those skilled in the art. Therefore, the proper dosage of the vaccine composition herein is determined in consideration of the above.
[0077] Yet another embodiment of the disclosure relates to a method of treating or preventing a malaria infection in a subject, the method comprising administering an immunologic or therapeutic amount of a malaria vaccine composition comprising a recombinant adenovirus. The recombinant adenovirus of the malaria vaccine may comprise an antigenic determinant of a Plasmodium parasite, and may further comprise one or more modified capsid or core proteins. An immunologic, pharmacologic or therapeutic amount may be any suitable amount wherein a potent immune response is generated against one or more antigenic portions of the (CS) protein (i.e., the transgene, B cell epitope, or CD4+ T cell epitope) such that malarial infection is prevented or reduced in severity.
[0078] When a subject is first exposed or "primed" to an adenovirus vector, the immune system produces neutralizing antibodies against that specific vector. The immune response to the adenovirus is generally directed against the capsid proteins. Therefore, subsequent exposure to the same adenovirus vector, or "boosts," can reduce the efficacy of transgene expression. Therefore, in some embodiments, the method of treating or preventing a malaria infection described above may comprise a priming step using a first recombinant adenovirus vector followed by one or more boosting steps using one or more different recombinant adenovirus vectors. This method may be used in subjects that have not yet been exposed to a wild-type adenovirus, or in a subject that has been previously exposed to a wild-type adenovirus vector, wherein the priming step recombinant adenovirus vector is used to circumvent existing adenovirus immunity. Further embodiments and examples are described below. Adenovirus as a vector
[0079] Adenoviruses are non-enveloped DNA viruses comprising a set of viral capsid proteins (described below) and a viral genome, that have been widely used to deliver one or more therapeutic or antigenic transgene to a variety of cells in vitro and in vivo. Many adenovirus serotypes exist. Of the known adenovirus serotypes, serotype 5 (Ad5) is preferably used as a vector for foreign gene transduction because of its strong infectivity in vivo (Abbink et al. 2007). Expression of the antigenic transgene may be controlled by any promoter or enhancer element known in the art. Promoters which may be used to control gene expression include, but are not limited to, cytomegalovirus immediate early promoter (CMV), simian virus 40 (SV40) early promoter, cellular polypeptide chain elongation factor 1 alpha (EF1 ) promoter, Rous sarcoma virus (RSV) promoter, and tetracycline- regulated (TR) promoter. A polyadenylation (pA) signal after the coding sequence may also be used for efficient transcription and translation. The recombinant adenovirus vector described herein may be replication-defective, having a deletion at least in the E1 region of the adenoviral genome, since the E1 region is required for replication, transcription, translation and packaging processes. In some aspects, the E2, E3 and/or E4 regions may also be deleted. In further aspects, a Kozak consensus sequence may be used for a more efficient translation (Kozak 1987).
[0080] The adenovirus (Ad) system is an attractive vector for the development of recombinant vaccines for a number of reasons. One reason is that recombinant adenoviral vectors infect most mammalian cell types (both replicative and non- replicative), including, but not limited to, mouse and human cell types. Thus, the same vector may be used successfully in mouse models and human clinical trials alike.
Another reason is that any transferred genetic information remains epichromosomal, avoiding insertional mutagenesis and alteration of the cellular genotype (Crystal 1995). Yet another reason is that the transgene remains unaltered after successive rounds of viral replication. Other advantages of using adenovirus include that recombinant adenovirus: 1 ) has a high virion stability, 2) is well tolerated, 3) may be grown at high titer, 4) can accommodate large transgenes, 5) has a genome that has been extensively studied for many years such that the complete DNA sequence of several serotypes is known, facilitating the manipulation of the Ad genome by recombinant DNA techniques (Graham and Prevec 1992).
[0081] In one embodiment, the adenovirus vaccine platform is used as a viral vector for development of a vaccine that targets a pre-erythrocytic malaria parasite, and provides protection from malaria infection. Among known recombinant viral vectors (Rodrigues et al. 1997, Bruna-Romero et al. 2001 , Anderson et al. 2004, Tao et al.
2005), adenovirus has been shown to be a suitable viral vector for a malaria vaccine because it can induce a strong protective cellular immune response to pre-erythrocytic malaria parasites (Rodrigues et al. 1997). The malaria parasite may be any one of the Plasmodium family. In some embodiments, the targeted parasite may be P. yoelii or P. falciparum.
Adenovirus vectors expressing PyCS as a transgene elicits a malaria- specific CD8+ T cell response
[0082] Adenovirus is an attractive vector for inducing a significant CD8+ T cell- mediated protective immunity against malaria (Rodrigues et al. 1997, Rodrigues et al. 1998). The immunogenicity of a recombinant adenovirus expressing the P. yoelii (a rodent malaria parasite) CS protein, AdPyCS, was determined using a rodent malaria model. The inoculation of mice with AdPyCS induces complete immunity in a significant proportion of mice, preventing the occurrence of parasitemia (Rodrigues et al. 1997). This protective effect is primarily mediated by CD8+ T cells, as evidenced by depletion of the T cell population and is corroborated by the fact that AdPyCS was unable to induce high titers of antibody response against malaria parasites.
[0083] To quantitatively measure the infectivity of capsid-modified adenovirus, the shuttle vector may contain a GFP expression cassette and cloning sites for a transgene. The resulting shuttle vector (GFP/pShuttle-CMV) has dual pCMV promoters and SV40pAs for a transgene and GFP from pmaxGFP (Amaxa, Germany). The optimized PyCS fragment was inserted into Kpnl and Hindi 11 sites of GFP/pShuttle- CMV.
[0084] The immunogenicity of Ad(PyCS+GFP) was determined by measuring the magnitude of the CS-specific CD8+ T cell response and the level of protective immunity against the plasmodial liver stages. Administration of Ad(PyCS+GFP) via different routes, at an optimal dose, 10 10 viral particle (v.p.) elicited the same pattern of antimalarial protective responses that AdPyCS was shown to elicit, with the s.c. and i.m. routes inducing the strongest response resulted in the highest degree of liver stage inhibition in mice challenged with live P. yoelii sporozoites. This illustrates that as a vaccine, Ad(PyCS+GFP) behaves equivalently to AdPyCS (Rodrigues et al 1997), and is a potentially useful tool in determining the in vivo tropism of AdPyCS.
Adenovirus capsid and core proteins
[0085] The studies above confirm that recombinant adenoviral vectors expressing a CS protein elicit a strong cellular immune response by CD8+ T cells, but no
appreciable humoral response. Therefore, because the humoral response to wild-type adenovirus can often be attributed to capsid proteins, recombinant adenoviral vectors with modified capsid and core proteins were constructed to 1 ) enhance humoral immunity via B cell activation, 2) enhance humoral immunity via T helper cell activation, and 3) circumvent existing adenoviral immunity.
[0086] Adenovirus is a non-enveloped naked double stranded DNA virus with an icosahedral shape, having 20 faces of equilateral triangles. The adenovirus capsid consists of 252 capsomers, of which 240 are Hexon trimers and 12 are penton pentamers. A Fiber protein, which projects from each penton base, mediates attachment to host cells by interaction with the cellular receptor. A secondary interaction occurs between the RGD (Asp-Arg-Gly) motif in the penton base with ανβ3, ανβ5 and similar integrins, facilitating subsequent internalization of adenovirus into the cell (Mathias et al. 1994, Wickham et al. 1993). Most of the adenovirus use the coxsackie-adenovirus receptor, CAR, as a cellular receptor (Bergelson et al. 1997). In addition, MHC class I molecules, VCAM, and heparan sulfate, are shown to mediate attachment and entry of Ad5 (Chu et al. 2001 , Hong et al. 1997). Following entry via endocytosis, the Ad5 rapidly escapes from endocytic compartments into the cytosol (Meier and Greber 2003, Leopold and Crystal 2007). The virion then translocates to the nucleus using microtubules. The Fiber protein is shed as the earliest capsid protein in the process (Nakano et al. 2000, Hong et al 2003). Adenoviruses of different serotypes demonstrate different trafficking patterns (Miyazawa et al. 1999, Miyazawa et al. 2001 ). Changing or modifying the Fiber protein can impact trafficking, which may be
particularly important with regard to antigen processing and presentation, following infection of antigen presenting cells (APC).
[0087] The adenovirus Fiber is a trimer divided into Fiber tail, shaft and knob domains (Henry et al. 1994, Rux and Burnett 2004, Chroboczek et al. 1995). The three dimensional structure of the knob domain is known, and together with mutagenesis studies, these studies allow the areas involved in CAR interaction and trimerization to be visualized (Kirby et al. 1999, Xia et al. 1995). The Fiber shaft projects from the virion and the Fiber knob contains the Coxsackie and Adenovirus Receptor (CAR) interaction domain (Roelvink et al. 1999, Bewley et al. 1999). The CAR-binding site of the Fiber knob consists primarily of residues from the AB loop and CD loop and extends secondarily to the FG and HI loop and the B, E and F β sheets (Roelvink et al. 1999, Bewley et al. 1999). The HI loop has been the best studied insertion site on the Fiber knob (Worgall et al. 2004, Mizuguchi and Hayakawa 2004, Koizumi et al. 2003,
Belousova et al. 2002, Noureddini and Curiel 2005, Nicklin et al. 2001 ), and
incorporation of an epitope into the HI loop (residue 543 and 544) resulted in potent anti-epitope immunity (Krause et al. 2006). Therefore, an immunodominant CS-derived B cell epitope was initially inserted into the HI loop of the Fiber protein. [0088] Hexon is the most abundant protein of the adenovirus capsid with 720 copies per virion. In the mature virus, Hexon exists as homotrimeric capsomeres which make up the facets of the icosahedral virion (Rux and Burnett 2004). The crystal structures of adenovirus serotypes 2 and 5 (Ad2 and Ad5) Hexons have been solved, revealing a complex molecular architecture (Athapilly et al. 1994, Roberts et al. 1986, Rux and Burnett 2000). The base of each monomeric subunit consists of two beta- barrel motifs that are present in the capsid proteins of many icosahedral viruses. Three long loops (DE1 , FG1 , and FG2) extend out from the base structure to form the tower region of each molecule (Rux and Burnett 2004). Sequences within these loop domains protrude to the surface of the capsid to form the exterior of the virion. Alignments from different adenovirus serotypes show that the sequences located on the capsid exterior are poorly conserved in both length and amino acid sequence (Crawford-Miksza and Schnurr 1996). Furthermore, it has been shown that the sequences located in these poorly conserved domains, termed hypervariable regions (HVRs), contain the
determinants against which serotype-specific antibodies are produced (Top 1975, Rux and Burnett 2000, Top et al. 1971 ).
[0089] Based on early sequence alignments, seven HVRs were identified throughout the Hexon molecule (Crawford-Miksza and Schnurr 1996, Roberts et al 2006). Because the HVRs are poorly conserved between serotypes and do not appear to be involved in maintaining the structural integrity of Hexon, small changes could be made to these domains without affecting the viability of the virus (Rux and Burnett 2000). For example a hexahistidine tag can be inserted into HVR2, HVR3, HVR5, HVR6, and HVR7 without compromising virus viability (Wu et al. 2005). Thus, Hexon HVRs are often used as targets to efficiently induce an antibody response against peptides located in Hexon HVRs (Worgall et al. 2005, Crompton et al. 1994). Due to its poor conservation in length between serotypes and its position on the outermost surface of the adenovirus capsid (Rux and Burnett 2000, Crawford-Miksza and Schnurr 1996), Hexon HVR5 was initially chosen as a site for epitope insertion. Further, the crystal structure of Hexon indicates that HVR5 is a flexible loop on the capsid surface, suggesting that HVR5 can accommodate relatively large peptides without compromising the structural integrity of the capsid (Roberts et al. 1986). Hexon-specific CD4+ and CD8+ epitopes have recently been identified (Leen et al. 2008), and the CD4+ T cell response to adenovirus is focused against conserved residues within the Hexon protein in humans (Onion et al. 2007, Heemskerk et al. 2006).
[0090] The adenovirus core is composed of the viral genome and four core proteins. The terminal protein (TP) is covalently linked to the 5' end of each linear viral DNA strand at two copies per virion. Noncovalently and nonspecifically bound to the viral DNA through arginine-rich portions are three other core proteins mu (μ), V (pV) and VII (pVII). pVII is the major core protein contributing roughly 700-800 copies per virion, and serves as a histone-like center around which viral DNA is wrapped to form nucleosome structures.
Modification of adenovirus capsid proteins to enhance humoral immunity
[0091] In some embodiments, circumsporozoite (CS) adenoviral vectors that have an immunodominant CS protein B epitope in an adenovirus capsid protein
(inserted in the Hexon or Fiber) are described. The transgene may be under a promoter such as CMV to augment cell-mediated and humoral immune responses to CS protein.
[0092] A central repeat region is the conserved structure of CS protein among Plasmodium species, and antibody against this repeat sequence has been shown to have sporozoite neutralizing activity. Examples of a repeat sequence in Plasmodium CS protein are (NANP) n repeat (P. falciparum; SEQ ID NO:17), ANGAGNQPG repeat (P. v/Vax; SEQ ID NO:18) and NAAG repeat (P. malariae; SEQ ID NO:19), which can be inserted into adenovirus capsid proteins. In some embodiments, the number of
(NANP)n repeats (SEQ ID NO:17) of PfCSP that may be inserted into HVR1 of adenovirus serotype 5 Hexon is more than 4. In some embodiments, the number of (NANP)n repeats (SEQ ID NO:17) of PfCSP that may be inserted into HVR1 of adenovirus serotype 5 Hexon is less than 40. As discussed in the Examples below, adenoviruses with forty repeats (e.g., (NANP) 40 -HVR1 /PfCSP) did not show any growth, thereby indicating that the maximum number or NANP repeats that can be successfully inserted is forty. Thus, according to the embodiments described herein, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, twenty-one, twenty-two, twenty-three, twenty-four, twenty- five, twenty-six, twenty seven, twenty-eight, twenty-nine, thirty, thirty-one, thirty-two, thirty-three, thirty-four, thirty-five, thirty six, thirty-seven, thirty-eight, or thirty-nine
(NANP)n repeats (SEQ ID NO:17; n=2, 3, 4, 5, 6, 7, 8, 9, 1 0, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39) of PfCSP are inserted into HVR1 of adenovirus serotype 5 Hexon.
[0093] In other embodiments, 4 to 39, 4 to 39, 5 to 39, 6 to 39, 7 to 39, 8 to 39, 9 to 39, 10 to 39, 1 1 to 39, 12 to 39, 13 to 39, 14 to 39, 15 to 39, 16 to 39, 17 to 39, 18 to 39, 19 to 39, 20 to 39, 21 to 39, 22 to 39, 23 to 39, 24 to 39, 25 to 39, 26 to 39, 27 to 39, 28 to 39, 29 to 39, 30 to 39, 31 to 39, 32 to 39, 33 to 39, 34 to 39, 35 to 39, 36 to 39, 37 to 39 or 38 to 39 (NANP) n repeats (SEQ ID NO:17) of PfCSP may be inserted into HVR1 of adenovirus serotype 5 Hexon.
[0094] In other embodiments, 22 to 34, 23 to 34, 24 to 34, 25 to 34, 26 to 34, 27 to 34, 28 to 34, 29 to 34, 30 to 34, 31 to 34, 32 to 34, 33 to 34 (NANP) n repeats (SEQ ID NO:17) of PfCSP may be inserted into HVR1 of adenovirus serotype 5 Hexon.
[0095] The (NANP) n repeat sequence may be additionally inserted in the in the HI loop of Fiber.
[0096] In some embodiments, immunodominant neutralizing B cell epitopes to CS were mapped to develop improved CS protein adenovirus vaccines. As described further below, mice immunized with recombinant P. falciparum CS protein (PyCS) generated high titers against the B cell epitope repeat, (NANP) n repeats (SEQ ID
NO:17). Further, administration of a recombinant adenovirus plasmid vector such as those described above (e.g., (NANP) n -HVR1 /PfCSP) shows a protective effect and improved infection-free survival upon challenge with malaria sporozoites (see Example 3, below). The B cell epitope repeat peptide should be presented on the surface of adenovirus virions so that immune system can recognize the epitope efficiently. Such insertion sites could be HVRs of Hexon and Loop structures in Fiber, and different insertion sites can be combined. Modification of adenovirus capsid and core proteins to enhance T helper cell activation
[0097] In addition to modification of capsid proteins with B cell epitopes, a CD4+ epitope specific to the transgene used in an adenoviral vector may be incorporated into adenovirus proteins. The CD4+ epitope may be incorporated into pVII, pV and Hexon to augment immunogenicity of the adenoviral-based vaccine. Professional antigen presenting cells (APC) such as dendritic cells (DC) and B cells can uptake particulated pathogens like virus particles via endocytosis and present CD4+ epitopes in the pathogen to CD4+ T cells which acts as helper cells for humoral and/or cellular immune responses. pVII and Hexon may easily be used as adenovirus target proteins to insert antigenic CD4+ peptides because of high copy number of pVII (700-800 copies) and Hexon (720 copies) in one virion.
Modification of adenovirus capsid proteins to circumvent existing adenovirus immunity
[0098] In some embodiments, adenovirus Fiber and Hexon capsid proteins may be modified to insert a B cell or T helper cell epitope to overcome existing immunity to adenovirus and/or enhance the humoral response to an adenovirus vaccine. An estimated 80% of young adults in human population have circulating neutralizing antibodies to adenovirus (Douglas 2007), especially to serotype 5 (Ad5). In studies utilizing adenovirus as a gene therapy vector, it was found that the presence of neutralizing antibodies in animals limits the expression of transgenes delivered by adenovirus. In addition to neutralizing antibodies, CD8+ T cell responses also contributed to the limitation of recombinant gene expression (Yang et al. 1995, Yang et al 1996). Such pre-existing immunity to adenovirus has previously been reported to inhibit the efficacy of a recombinant adenovirus vaccine (Papp et al. 1999) and also reduces immunogenicity of adenovirus-based vaccines in a clinical trial (Priddy et al. 2008).
[0099] Hexon is a major target for anti-Ad capsid immune responses (Roy et al. 2005, Wohlfart 1988), and is likely responsible for the potent adjuvant effect of adenovirus, including the induction of CD4+ and CD8+ T cell responses. Therefore, one strategy that has been employed to circumvent pre-existing anti-adenovirus immunity is to replace all or part of the Hexon with a different protein, for example, rare serotypes such as adenovirus 1 1 , 24, 26 and 35. Because Hexon is a major target of anti-adenovirus neutralizing antibody (Youil et al. 2002, Sumida et al. 2005), the entire Hexon or HVRs of Hexon may be swapped with the rare serotypes (Wu et al. 2002, Roberts et al. 2006).
[00100] In another strategy as described in some of the embodiments herein, an adenoviral Hexon may be modified by replacement of HVR1 or HVR5 with an antigenic peptide to circumvent pre-existing anti-adenovirus immunity or anti-adenovirus neutralizing antibody induced by previous vaccination with adenoviral vector. In some embodiments, an antigenic peptide may be an immunogenic epitope of Plasmodium CS protein, and in certain aspects, the epitope may comprise a central repeat sequence, CD4+ epitope sequence or CD8+ epitope sequence.
[00101] Repeat administration with an Ad vector of the same serotype is prevented due to anti-Ad immunity following immunization. Therefore, many Ad vaccines impede boosting of the vaccine by preventing expression and presentation of the antigen encoded by the transgene (Yang 1995, Hackett et al. 2000, Harvey et al. 1999, Mastrangeli et al. 1996). The addition of a specific epitope to the Ad capsid, such as those described in the examples below, may reduce or eliminate this impediment according to some embodiments.
[00102] The following examples are provided to better illustrate the embodiments and are not to be interpreted as limiting the scope of any claimed embodiment. The extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention. It will be understood that many variations can be made in the procedures herein described while still remaining within the bounds of the present invention. It is the intention of the inventors that such variations are included within the scope of the invention. Further, all references cited herein are hereby incorporated by reference in their entirety as if fully set forth herein.
Example 1 : Construction of HVR1 -modified Plasmodium falciparum
circumsporozoite protein adenovirus plasmid vectors and recombinant
adenovirus particles.
Construction of adenovirus DNA fragment containing (NANP)n repeats in HVR1 of hexon
[00103] The structures of (NANP) n -HVR1 /PfCSP and (NANP) n -HVR1 /cmv5-PfCSP are shown in Fig. 1 . [00104] The adenovirus genome DNA used in the experiments is an E1 and E3- deleted human adenovirus serotype 5 from Stratagene (pAdEasy-1 ) and an adenovirus shuttle vector, pShuttle-CMV (Stratagene) was used to construct recombinant PfCSP adenovirus genome DNA.
[00105] The pShuttle-CMV was modified to replace the CMV promoter region with the CMV5 promoter from pQBI-AdCMV5 (QBIOgene). The SgrA I- Kpn I fragment of pShuttle-CMV was replaced with the fragment containing the CMV5 promoter sequence and the upstream sequence from CMV promoter in pShuttle-CMV to construct pShuttle- CMV5.
[00106] The PfCSP amino acid sequence of P. falciparum 3D7 strain was used as a template sequence for codon-optimization for protein expression in human with Integrated DNA Technologies' (Coralville, IA USA) optimization software. DNA fragments that encode whole PfCSP except for the GPI-anchored motif at the C- terminus (Fig. 7; SEQ ID NO:1 ) were synthesized by Integrated DNA Technologies.
[00107] The synthesized PfCSP cDNA was cloned into Kpn I and Hind III sites in adenovirus shuttle vectors, pShuttle-CMV and pShuttle -CMV5 to construct PfCSP/ pShuttle-CMV and PfCSP/ pShuttle-CMV5. These recombinant shuttle vectors were linearized by Pme I digestion and used for homologous recombination with pAdEasy-1 vector in E. co// ' BJ5183 cells (Stratagene) to construct PfCSP the recombinant adenoviruses wt/PfCSP and wt/CMV5-PfCSP. [00108] DNA fragments containing (NANP) 4 , 0 , i 6 , 0 r 22-HVR1 were prepared by performing a two-step PCR method, resulting in the amplification of the region of the hexon gene that contains the Age I and Nde I sites using primers which have the (NANP) n sequence instead of HVR1 sequence. This PCR product was digested with Age I and Nde I, and used to replace the native Age l-Nde I region of the Sfi I - Sfi I fragment in a Sfi l/pUC19 vector, which contains the Sfi I - Sfi I fragment (about 6.6 kbp) from pAdEasy-1 in the multi-cloning site of pUC19. The sequence of the amplified region in the constructs was confirmed by sequencing.
[00109] The DNA fragments containing (NANP) n -HVR1 (n = 28, 34 or 40) were prepared by an "overlapping" (or "overlap extension") PCR method as shown in Fig. 2. Primers used to produce (NANP) n -HVR1 fragments during the overlapping PCR methods described herein are shown in Table 1 , below.
Table. 1 Primers used to construct (NANP) n -HVR1 adenoviruses
[00110] To prepare the DNA fragment containing (NANP) 28 -HVR1 three
overlapping fragments were generated to produce the DNA fragment that coded the (NANP) 28 repeat sequence. The first DNA fragment (Fig. 2; (I)), coding HVR1 -NANP repeats, was amplified by PCR with HVR1 F1 and NANPR1 primers using (NANP) 22 - HVR1 /PfCSP as a template. The second DNA fragment (Fig. 2; (II)), coding NANP repeats, was amplified by PCR with NANPF1 and NANPR3 primers using PfCSP/pShuttle-CMV as a template. The third DNA fragment (Fig. 2; (III)), coding NANP repeats-HVFM , was amplified by PCR with NANPF3 and HVR1 R1 primers using (NANP) 2 2-HVR1 /PfCSP as a template. These fragments were purified after agarose gel electrophoresis and used as templates for overlapping PCR with HVR1 F1 and HVR1 R1 primers at an annealing temperature of 58 °C. The overlapping PCR product was purified after agarose gel electrophoresis.
[00111] Next, a second overlapping PCR reaction using the (NANP) 28 repeat sequence generated by the first overlapping PCR reaction (Fig. 2; (IV)) with two additional overlapping fragments was performed to produce the (NANP) 28 -HVR1 DNA fragments. The hexon DNA fragment containing Age I site was amplified by PCR with CD4HexF1 and HVR1 R2 primers (Fig. 2; (V)). The hexon DNA fragment containing Nde I site was amplified by PCR with HVR1 F2and CD4HexR1 primers (Fig. 2; (VI)). The second overlapping PCR was performed using CD4HexF1 and CD4HexR1 primers to connect the DNA fragment containing the Age I site, the fragment coding (NANP) 28 repeats and the fragment containing the Nde I site. The resulting PCR product, the (NANP) 28 -HVR1 DNA fragment, was purified and digested with Age I and Nde I restriction enzymes, and used to replace the Age l-Nde I region of hexon in Sfi l/pUC19 plasmid (Fig. 5). The sequence of the amplified region in the constructs was confirmed by sequencing. [00112] Similarly, the DNA fragments containing (NANP) 34 or 4 o-HVR1 were prepared by overlapping PCR as shown in Figs. 3 and 4 respectively. The first DNA fragments (Figs. 3 and 4; (I)), coding HVR1 -NANP repeats was amplified by PCR with HVR1 F1 and NANPR2 primers using (NANP) 22 -HVR1 /PfCSP as a template. The second DNA fragments (Figs. 3 and 4; (II)), coding NANP repeats was amplified by PCR with NANPF2 and NANPR4 primers using PfCSP/pShuttle-CMV as a template. The third DNA fragments (Figs. 3 and 4; (III)), coding NANP repeats-HVR1 was amplified by PCR with NANPF4 and HVR1 R1 primers using (NANP) 22 -HVR1 /PfCSP as a template. These fragments were purified after agarose gel electrophoresis and used as templates for overlapping PCR with HVR1 F1 and HVR1 R1 primers. For the amplification of DNA fragments containing (NANP) 34 , an annealing temperature of 58 °C was used. For the amplification of DNA fragments containing (NANP) 40 , an annealing temperature of 48 °C was used to amplify a wide range of (NANP) n repeats by miss- annealing. The overlapping PCR products were separated on agarose gel and gel corresponding to the estimated size was cut out for DNA purification. [00113] The second overlapping PCR was done as described above to connect the DNA fragment containing the Age I site (Figs. 3 and 4; (V)), the fragment coding (NANP) 34 or 4 o repeats (Figs. 3 and 4; (IV)) and the fragment containing the Nde I site (Figs. 3 and 4; (VI)). The PCR product was purified and digested with Age I and Nde I restrict enzymes, and used to replace the Age l-Nde I region of hexon in Sfi l/pUC19- Mut plasmid (Fig. 6). Sfi l/pUC19-Mut has a mutation at the Nde I site in pUC19 and used in order to increase ligation efficiency. The sequence of the amplified region in the constructs was confirmed by sequencing.
(NANP)n-HVRI adenovirus production, purification and quantification
[00114] The Sfi I - Sfi I region of wt/PfCSP or wt/CMV5- PfCSP adenovirus genome plasmid was replaced with the Sfi I - Sfi I fragment containing (NANP) n in HVR1 to construct (NANP) n -HVR1 /PfCSP or (NANP) n -HVR1 /CMV5-PfCSP as described in Fig. 5 and 6.
Table. 2 Constructed recombinant PfCSP adenovirus genome DNA plasmids
[00115] (NANP)n insertion in HVR1 region was reconfirmed by PCR using
(NANP)n-HVRI /PfCSP plasmids as templates. The region was amplified with HexF12 (GTGCTGGACATGGCTTCCACGTAC; SEQ ID NO:34) and Hex R1 3
(TTTAGGTGTTTGACCTTCGACACC; SEQ ID NO:35) primers and the PCR products were analyzed on agarose gel. As shown in Fig. 15, the size of PCR products increased in association with the increase in NANP repeats, indicating that constructed adenovirus genome retains the inserted NANP repeats.
[00116] Adenovirus genome DNA plasmid was linearized by Pac I digestion and used for transfection of AD293 cells (Stratagene) in order to produce recombinant adenovirus.
[00117] Adenovirus seed solution was prepared from the transfected AD293 cells showing cytopathic effects (CPE) by several rounds of freeze/thaw and used for further virus amplification. Adenovirus growth was not observed in AD293 cells transfected with (NANP) 40 -HVR1 /PfCSP and (NANP) 40 -HVR1 /cmv5-PfCSP, suggesting that insertion of (NANP) 40 repeats in HVR1 of hexon deteriorated adenovirus fitness.
[00118] After the last virus amplification, adenovirus particles were purified by CsCI gradient centrifugation. The band was then collected and dialyzed against dialysis buffer (10 mM Tris-HCI, 150 mM NaCI, 10 mM MgCI 2 , 3% (w/v) Sucrose, pH7.8) to remove CsCI. Virus particle unit (v.p.) was calculated based on O.D. 2 eo
(1 O.D.260=1 .25x10 12 v.p./ml_).
Example 2: Evaluation of (NANP) n -HVR1/PfCSP adenovirus growth in vitro [00119] To evaluate the effect of the insertion of (NANP) n in the HVR1 of hexon on adenovirus growth , the quantity of adenovirus genomic DNA was measured after transfection of AD293 cells with the adenovirus genome DNA. AD293 cells were seeded into 24 well plates one day before transfection and linearized adenovirus genome DNA was transfected in triplicate using Lipofectamine 2000 (Invitrogen) at day 0. At day 5, 7, 9 and 1 1 , genomic DNA was extracted from transfected AD293 cells using QIAamp DNA Mini kit (QIAGEN). The copy number of adenovirus genomic DNA in the extracted DNA was measured by real time PCR using 7500 Real Time PCR system (Applied Biosystems). The primer set for the real time PCR reaction was 100KF (AACTTCTACCCCGTATTTGCC; SEQ ID NO:36) and 100KR
(GATATCAGGTATGACAGCGCC; SEQ ID NO:37), and the probe is 100KProbe (5'- [FAM]-AAGATACCCCTATCCTGCCGTGC-[BHQ-1 ]-3'; SEQ ID NO:38).
[00120] The adenovirus growth showed a trend that was inversely correlated with number of NANP repeats inserted in HVR1 . A slight delay of adenovirus growth was observed in (NANP) 2 8-HVR1 /PfCSP-transfected wells and a significant delay in
(NANP) 34 -HVR1 /PfCSP-transfected wells (Fig. 16). No increase in the (NANP) 40 - HVR1 /PfCSP-transfected wells was detected, nor was there any increase in the copy number of adenovirus genome DNA (Fig. 16), which is consistent with the fact we could not produce (NANP) 40 -HVR1 /PfCSP or (NANP) 40 -HVR1 /CMV5-PfCSP. These observations suggest that the maximum number of NANP repeats which can be inserted in HVR1 is less than forty.
[00121] Example 3: Protection from blood stage malaria infection by
(NANP) 22 -HVR1/PfCSP adenovirus
[00122] Six to eight-week old female C57BL/C mice were purchased from Taconic (Hudson, NY, USA) and maintained under standard conditions in the Laboratory Animal Research Center of The Rockefeller University. For immunization, adenoviruses were diluted in PBS (-) or diluted and mixed with adjuvant (Sigma Adjuvant System
containing saponin). The adjuvant (AS) was prepared by re-suspending Sigma
Adjuvant System with 1 mL of PBS (-) containing 200 μg/mL saponin. Adenovirus and adenovirus solution was mixed with an equal amount of the adjuvant (AS) before the immunization.
[00123] To evaluate the immunogenicity and protection effect of (NANP) 2 2- HVR1 /PfCSP adenovirus, na ' ive C57BL/6 mice were given "boosts" of recombinant PfCSP adenoviruses with or without the adjuvant (AS) at three doses of 1 x10 10 v.p. at 3 weeks intervals as shown in Fig. 17A. Using this immunization regimen, a (NANP) 2 2- HVR1 /PfCSP adenovirus with the adjuvant (AS) induced much higher anti-NANP antibody titer than wt/PfCSP alone or wt/PfCSP with the adjuvant (AS) at week 9 (Fig. 17B). [00124] The resulting humoral response that was specific to the NANP repeat sequences was determined by ELISA. Briefly, five microliters of blood was collected from tail vein of the immunized mice and diluted in 495 μΙ_ of PBS (-), and then the samples were centrifuged at 5,000 rpm for 5 min to prepare diluted plasma samples (x100). Maxisorp ELISA plates were coated with 1 μg/mL (T1 B) 4 , a PfCSP repeat peptide which contains a NANP repeat sequence (Calvo-Calle et al 2006) in 0.1 M Sodium Carbonate Buffer (pH 9.5) at 4°C for overnight. The plates were washed with PBS (-) containing 0.05% Tween-20 and blocked with 1 x Diluent (eBioscience) for at least 2 hours at room temperature. The plates were washed again and 100 L of serially twofold-dilute plasma in I xDiluent was added to the plates. After one-hour incubation at room temperature, the plates were washed and incubated with 100 L of HRP-labeled goat anti-mouse IgG antibody.
[00125] The immunized mice were intravenously challenged with 2,000 transgenic P. berghei sporozoites that express recombinant P. bergfre/ circumsporozoite protein having the PfCSP central repeat region (NANP repeats) instead of the original central repeat (Persson et al. 2002). Giemsa-stained blood smears were analyzed from 4 to 10 days after challenge to detect blood stage malaria parasite infection. All of the mice in na ' ive, wt/PfCSP and wt/PfCSP with the adjuvant groups were infected by day 7, whereas 50% of mice immunized with (NANP) 2 2-HVR1 /PfCSP with the adjuvant were protected from blood stage malaria parasite infection (Fig. 17C). The difference in protection between the na ' ive and (NAN P) 2 2-HVR1 /PfCSP with the adjuvant groups was statistically significant (p=0.0006, log-rank test). SAS software (SAS Institute Japan, R9.1 ) was used for the statistical analysis.
[00126] Example 4: Protection from blood stage malaria infection by
(NANP)n-HVFM /PfCSP adenovirus
[00127] Six to eight-week old female C57BL/C mice were purchased from Taconic (Hudson, NY, USA) and maintained under standard conditions in the Laboratory Animal Research Center of The Rockefeller University. For immunization, adenoviruses were diluted in PBS (-). [00128] To evaluate the immunogenic and protective effect of (NANP) n - HVFM /PfCSP (n=22, 28 or 34) adenovirus, na ' ive C57BL/6 mice were given "boosts" of recombinant PfCSP adenoviruses without the adjuvant (AS) at three doses of 1 x1 0 10 v.p. as shown in Fig. 18A. [00129] NANP repeat-specific humoral response was determined by ELISA as described above. Using this immunization regimen, all (NANP) n -HVR1 /PfCSP adenoviruses induced a significantly higher anti-NANP antibody titer than wt/PfCSP at day 35 (Fig. 1 8B). The anti-NANP antibody titer in the na ' ive mice was lower than the minimum dilution (200-times dilution) and therefore was depicted as "2" in Figure 1 8B.
REFERENCES
Abbink, P., Lemckert, A.A., Ewald, B.A., Lynch, D.M., Denholtz, M., et al. 2007.
Comparative seroprevalence and immunogenicity of six rare serotype recombinant adenovirus vaccine vectors from subgroups B and D. J Virol. 81 :4654-4663.
Alonso, P.L., Sacarlal, J., Aponte, J.J., Leach, A., Macete, E., et al. 2004. Efficacy of the RTS,S/AS02A vaccine against Plasmodium falciparum infection and disease in young African children : randomised controlled trial. Lancet. 364:141 1 -1420.
Alonso, P.L., Sacarlal, J., Aponte, J.J., Leach, A., Macete, E., et al. 2005. Duration of protection with RTS,S/AS02A malaria vaccine in prevention of Plasmodium falciparum disease in Mozambican children: single-blind extended follow-up of a randomised controlled trial. Lancet. 366:201 2-2018.
Anderson, R.J., Hannan, CM., Gilbert, S.C., Laidlaw, S.M., Sheu, E.G., et al. 2004. Enhanced CD8+ T cell immune responses and protection elicited against Plasmodium berghei malaria by prime boost immunization regimens using a novel attenuated fowlpox virus. J Immunol. 172:3094-31 00.
Athappilly, F.K., Murali, R., Rux, J.J., Cai, Z. & Burnett, R.M. The refined crystal structure of Hexon, the major coat protein of adenovirus type 2, at 2.9 A resolution. Journal of molecular biology 242, 430-455 (1994). Barrat, F.J., Meeker, T,, Gregorio, J,, Chan, J.H., Uematsu, S., et al. Nucleic acids of mammalian origin can act as endogenous ligands for Toll-like receptors and may promote systemic lupus erythematosus. J Exp Med. 202, 1 1 31 -1 1 39 (2005)
Bejon, P., Lusingu, J., Olotu, A., Leach, A., Lievens, M., et al. 2008. Efficacy of
RTS,S/AS01 E vaccine against malaria in children 5 to 1 7 months of age. N Engl J Med. 359:2521 -2532.
Belousova, N., Krendelchtchikova, V., Curiel, D.T. & Krasnykh, V. Modulation of adenovirus vector tropism via incorporation of polypeptide ligands into the Fiber protein. Journal of virology 76, 8621 -8631 (2002).
Bergelson, J.M. et al. Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science (New York, N. V275, 1320-1 323 (1 997). Bewley, M.C., Springer, K., Zhang, Y.B., Freimuth, P. & Flanagan, J.M. Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science (New York, N. Y 286, 1579-1 583 (1 999).
Bruna-Romero, O., Schmieg, J., Del Val, M., Buschle, M. & Tsuji, M. The dendritic cell- specific chemokine, dendritic cell-derived CC chemokine 1 , enhances protective cell- mediated immunity to murine malaria. J Immunol 170, 31 95-3203 (2003). Hong, S.S., Karayan, L, Tournier, J., Curiel, D.T. & Boulanger, P. A. Adenovirus type 5 Fiber knob binds to MHC class I alpha2 domain at the surface of human epithelial and B
lymphoblastoid cells. The EMBO journal 16, 2294-2306 (1997). Bruna-Romero, O., Gonzalez-Aseguinolaza, G., Hafalla, J.C., Tsuji, M., and
Nussenzweig, R.S. 2001 . Complete, long-lasting protection against malaria of mice primed and boosted with two distinct viral vectors expressing the same plasmodial antigen. Proc Natl Acad Sci U S A. 98:1 1491 -1 1496. Bruna-Romero, O., Rocha, CD., Tsuji, M. & Gazzinelli, R.T. Enhanced protective immunity against malaria by vaccination with a recombinant adenovirus encoding the circumsporozoite protein of Plasmodium lacking the GPI-anchoring motif. Vaccine 22, 3575-3584 (2004). Calvo-Calle, J.M., Oliveira, G.A., Watta, CO., Soverow, J., Parra-Lopez, C, et al. 2006. A linear peptide containing minimal T- and B-cell epitopes of Plasmodium falciparum circumsporozoite protein elicits protection against transgenic sporozoite challenge.
Infect Immun. 74:6929-6939. Clyde, D.F., Most, H., McCarthy, V.C, and Vanderberg, J. P. 1973. Immunization of man against sporozite-induced falciparum malaria. Am J Med Sci. 266:169-177.
Chroboczek, J., Ruigrok, R.W. & Cusack, S. Adenovirus Fiber. Current topics in microbiology and immunology 199 ( Pt 1), 163-200 (1995).
Chu, Y., Heistad, D., Cybulsky, M.I. & Davidson, B.L. Vascular cell adhesion molecule-1 augments adenovirus-mediated gene transfer. Arterioscler Thromb Vase Biol 21 , 238- 242 (2001 ). Crawford-Miksza, L. & Schnurr, D.P. Analysis of 15 adenovirus Hexon proteins reveals the location and structure of seven hypervariable regions containing serotype-specific residues. Journal of virology 70, 1836-1844 (1996).
Crompton, J., Toogood, C.I., Wallis, N. & Hay, R.T. Expression of a foreign epitope on the surface of the adenovirus Hexon. The Journal of general virology 75 ( Pt 1), 133- 139 (1994).
Crystal, R.G. Transfer of genes to humans: early lessons and obstacles to success. Science (New York, N. Y 270, 404-410 (1995).
Douglas, J.T. Adenoviral vectors for gene therapy. Molecular biotechnology 36, 71 -80 (2007).
Edelman, R., Hoffman, S.L., Davis, J.R., Beier, M., Sztein, M.B., et al. 1993. Long-term persistence of sterile immunity in a volunteer immunized with X-irradiated Plasmodium falciparum sporozoites. J Infect Dis. 168:1066-1070. Grillot, D., Valmori, D., Lambert, P.H., Corradin, G., and Del Giudice, G. 1993. Presentation of T cell epitopes assembled as multiple-antigen peptides to murine and human T lymphocytes. Infect Immun. 61 :3064-3067.
Graham, F.L. & Prevec, L. Adenovirus-based expression vectors and recombinant vaccines. Biotechnology (Reading, Mass 20, 363-390 (1 992).
Gwadz, R.W., Cochrane, A.H., Nussenzweig, V., and Nussenzweig, R.S. 1 979.
Preliminary studies on vaccination of rhesus monkeys with irradiated sporozoites of Plasmodium knowlesi and characterization of surface antigens of these parasites. Bull World Health Organ.57 Suppl 1 :1 65-1 73.
Hackett, N. R. et al. Use of quantitative TaqMan real-time PCR to track the time- dependent distribution of gene transfer vectors in vivo. Mol Ther l, 649-656 (2000).
Harvey, B.G. et al. Airway epithelial CFTR mRNA expression in cystic fibrosis patients after repetitive administration of a recombinant adenovirus. The Journal of clinical investigation 104, 1 245-1 255 (1 999).
Heemskerk, B. et al. Adenovirus-specific CD4+ T cell clones recognizing endogenous antigen inhibit viral replication in vitro through cognate interaction. J Immunol 177, 8851 - 8859 (2006). Henry, L.J., Xia, D., Wilke, M. E., Deisenhofer, J. & Gerard, R. D. Characterization of the knob domain of the adenovirus type 5 Fiber protein expressed in Escherichia coli.
Journal of virology 68, 5239-5246 (1 994).
Hong, S.S., Habib, N.A., Franqueville, L, Jensen, S. & Boulanger, P. A. Identification of adenovirus (ad) penton base neutralizing epitopes by use of sera from patients who had received conditionally replicative ad (addl1520) for treatment of liver tumors. Journal of virology 77, 10366-1 0375 (2003).
Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K., Pease, L. R. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77, 61 - 68 (1 989).
Kester, K. E., Cummings, J. F., Ockenhouse, C. F., Nielsen, R., Hall, B.T., et al. 2008. Phase 2a trial of 0, 1 , and 3 month and 0, 7, and 28 day immunization schedules of malaria vaccine RTS,S/AS02 in malaria-na ' ive adults at the Walter Reed Army Institute of Research. Vaccine. 26:21 91 -2202.
Kirby, I. et al. Mutations in the DG loop of adenovirus type 5 Fiber knob protein abolish highaffinity binding to its cellular receptor CAR. Journal of virology 73, 9508-9514 (1 999). Koizumi, N., Mizuguchi, H., Utoguchi, N., Watanabe, Y. & Hayakawa, T. Generation of Fiber-modified adenovirus vectors containing heterologous peptides in both the HI loop and C terminus of the Fiber knob. The journal of gene medicine 5, 267-276 (2003). Kozak M. 1 987. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15:81 25-148.
Krause, A., Joh, J.H., Hackett, N. R., Roelvink, P.W., Bruder, J.T., et al. 2006. Epitopes expressed in different adenovirus capsid proteins induce different levels of epitope- specific immunity. J Virol. 80:5523-5530.
Labow, D., Lee, S., Ginsberg, R.J., Crystal, R.G. & Korst, R.J. Adenovirus vector- mediated gene transfer to regional lymph nodes. Human gene therapy 11 , 759-769 (2000).
Leen, A.M. et al. Identification of Hexon-specific CD4 and CD8 T cell epitopes for vaccine and immunotherapy. Journal of virology 82, 546-554 (2008).
Leopold, P.L. & Crystal, R.G. Intracellular trafficking of adenovirus: many means to many ends. Advanced drug delivery reviews 59, 81 0-821 (2007).
Mastrangeli, A. et al. "Sero-switch" adenovirus-mediated in wVo gene transfer:
circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Human gene therapy 7, 79- 87 (1 996).
Mathias, P., Wickham, T., Moore, M. & Nemerow, G. Multiple adenovirus serotypes use alpha v integrins for infection. Journal of virology 68, 681 1 -6814 (1 994). McConnell, M.J., Danthinne, X., and Imperiale, M.J. 2006. Characterization of a permissive epitope insertion site in adenovirus Hexon. J Virol. 80:5361 -5370.
Meier, O. & Greber, U. F. Adenovirus endocytosis. The journal of gene medicine 5, 451 - 462 (2003).
Miyazawa, N. et al. Fiber swap between adenovirus subgroups B and C alters intracellular trafficking of adenovirus gene transfer vectors. Journal of virology 73, 6056- 6065 (1 999). Miyazawa, N., Crystal, R.G. & Leopold, P.L. Adenovirus serotype 7 retention in a late endosomal compartment prior to cytosol escape is modulated by Fiber protein. Journal of virology 75, 1 387-1400 (2001 ).
Mizuguchi, H. & Hayakawa, T. Targeted adenovirus vectors. Human gene therapy 15, 1 034-1 044 (2004). Nakano, M.Y., Boucke, K., Suomalainen, M., Stidwill, R. P. & Greber, U. F. The first step of adenovirus type 2 disassembly occurs at the cell surface, independently of
endocytosis and escape to the cytosol. Journal of virology 74, 7085-7095 (2000). Nicklin, S.A. et al. Ablating adenovirus type 5 Fiber-CAR binding and HI loop insertion of the SIGYPLP peptide generate an endothelial cell-selective adenovirus. Mol Ther 4, 534-542 (2001 ).
Noureddini, S.C. & Curiel, D.T. Genetic targeting strategies for adenovirus. Molecular pharmaceutics 2, 341 -347 (2005).
Nussenzweig, R.S., Vanderberg, J., Most, H., and Orton, C. 1 967. Protective immunity produced by the injection of x-irradiated sporozoites of Plasmodium berghei. Nature. 216:1 60-1 62.
Nussenzweig, R.S. & Long, C.A. Malaria vaccines: multiple targets. Science (New York, N. Y 265, 1 381 -1 383 (1 994).
Onion, D. et al. The CD4+ T cell response to adenovirus is focused against conserved residues within the Hexon protein. The Journal of general virology 88, 241 7-2425 (2007).
Ophorst, O.J., Radosevic, K., Havenga, M.J., Pau, M.G., Holterman, L, et al. 2006. Immunogenicity and protection of a recombinant human adenovirus serotype 35-based malaria vaccine against Plasmodium yoelii in mice. Infect Immun. 74:313-320.
Oualikene, W., Gonin, P. & Eloit, M. Short and long term dissemination of deletion mutants of adenovirus in permissive (cotton rat) and non-permissive (mouse) species. The Journal of general virology 75 ( Pt 10), 2765-2768 (1 994). Palma, C, Overstree,t M.G., Guedon, J.M., Hoiczyk, E., Ward, C, Karen, K.A., Zavala, F., Ketner, G. 201 1 . Adenovirus particles that display the Plasmodium falciparum circumsporozoite protein NANP repeat induce sporozoite-neutralizing antibodies in mice. Vaccine. Jan 1 . [Epub ahead of print] Persson C, Oliveira GA, Sultan AA, Bhanot P, Nussenzweig V, Nardin E. 2002. Cutting edge: a new tool to evaluate human pre-erythrocytic malaria vaccines: rodent parasites bearing a hybrid Plasmodium falciparum circumsporozoite protein. J Immunol.
1 69:6681 -6685. Priddy, F.H., Brown, D., Kublin, J., Monahan, K., Wright, D.P., et al. 2008. Safety and immunogenicity of a replication-incompetent adenovirus type 5 HIV-1 clade B
gag/pol/nef vaccine in healthy adults. Clin Infect Dis. 46:1769-1781 .
Roberts, M.M., White, J.L., Grutter, M.G. & Burnett, R.M. Three-dimensional structure of the adenovirus major coat protein Hexon. Science (New York, N. Y 232, 1 148-1 151 (1 986). Roberts, D.M., Nanda, A., Havenga, M.J., Abbink, P., Lynch, D.M., et al. 2006. Hexon- chimaeric adenovirus serotype 5 vectors circumvent pre-existing anti-vector immunity. Nature. 441 :239-243.
Rodrigues, E.G., Zavala, F., Eichinger, D., Wilson, J.M., and Tsuji, M. 1 997. Single immunizing dose of recombinant adenovirus efficiently induces CD8+ T cell-mediated protective immunity against malaria. J Immunol. 158:1 268-1 274. Rodrigues, E.G., Zavala, F., Nussenzweig, R.S., Wilson, J.M. & Tsuji, M. Efficient induction of protective anti-malaria immunity by recombinant adenovirus. Vaccine 16, 1 812-1 817 (1 998).
Roelvink, P.W., Mi Lee, G., Einfeld, D.A., Kovesdi, I. & Wickham, T.J. Identification of a conserved receptor-binding site on the Fiber proteins of CAR-recognizing adenoviridae. Science (New York, N. Y 286, 1568-1 571 (1 999).
Rux, J.J. & Burnett, R.M. Type-specific epitope locations revealed by X-ray
crystallographic study of adenovirus type 5 Hexon. Mol Ther A , 1 8-30 (2000).
Rux, J.J. & Burnett, R.M. Adenovirus structure. Human gene therapy Λ 5, 1 1 67-1 1 76 (2004).
Roy, S. et al. Use of chimeric adenoviral vectors to assess capsid neutralization determinants. Virology 333, 207-214 (2005).
Shiratsuchi, T., Rai, U., Krause, A., Worgall, S., Tsuji, M. 201 0. Replacing adenoviral vector HVR1 with a malaria B cell epitope improves immunogenicity and circumvents preexisting immunity to adenovirus in mice. J Clin Invest. 120:3688-3701 .
Silvie, O., Greco, C, Franetich, J. F., Dubart-Kupperschmitt, A., Hannoun, L., et al. 2006. Expression of human CD81 differently affects host cell susceptibility to malaria
sporozoites depending on the Plasmodium species. Cell Microbiol. 8:1 134-1 146. Sumida, S.M., Truitt, D.M., Lemckert, A.A., Vogels, R., Custers, J.H., et al. 2005.
Neutralizing antibodies to adenovirus serotype 5 vaccine vectors are directed primarily against the adenovirus Hexon protein. J Immunol. 174:7179-71 85.
Sun, P., Schwenk, R., White, K., Stoute, J.A., Cohen, J., et al. 2003. Protective immunity induced with malaria vaccine, RTS,S, is linked to Plasmodium falciparum circumsporozoite protein-specific CD4+ and CD8+ T cells producing I FN-gamma. J Immunol. 171 :6961 -6967.
Tao, D., Barba-Spaeth, G., Rai, U., Nussenzweig, V., Rice, CM., and Nussenzweig, R.S. 2005. Yellow fever 1 7D as a vaccine vector for microbial CTL epitopes: protection in a rodent malaria model. J Exp Med. 201 :201 -209. Teramoto, S. et al. Investigation of effects of anesthesia and age on aspiration in mice through LacZ gene transfer by recombinant E1 -deleted adenovirus vectors. American journal of respiratory and critical care medicine 158, 1 914-1 91 9 (1998).
Top, F.H., Jr., Dudding, B.A., Russell, P.K. & Buescher, E.L. Control of respiratory disease in recruits with types 4 and 7 adenovirus vaccines. American journal of epidemiology 94, 142-146 (1 971 ). Top, F.H., Jr. Control of adenovirus acute respiratory disease in U.S. Army trainees. Yale J Biol Med 48, 1 85-1 95 (1 975).
Tsuji, M., Romero, P., Nussenzweig, R.S., and Zavala, F. 1 990. CD4+ cytolytic T cell clone confers protection against murine malaria. J Exp Med. 172:1353-1 357.
Tsuji, M., Rodrigues, E.G. & Nussenzweig, S. Progress toward a malaria vaccine:
efficient induction of protective anti-malaria immunity. Biol Chem 382, 553-570 (2001 ).
Wickham, T.J., Mathias, P., Cheresh, D.A. & Nemerow, G. R. Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-31 9 (1 993).
Wohlfart, C. Neutralization of adenoviruses: kinetics, stoichiometry, and mechanisms. Journal of virology 62, 2321 -2328 (1 988).
Worgall, S. et al. Modification to the capsid of the adenovirus vector that enhances dendritic cell infection and transgene-specific cellular immune responses. Journal of virology 78, 2572-2580 (2004). Worgall, S., Krause, A., Rivara, M., Hee, K.K., Vintayen, E.V., et al. 2005. Protection against P. aeruginosa with an adenovirus vector containing an OprF epitope in the capsid. J Clin Invest. 115:1 281 -1 289.
Worgall, S., Krause, A., Qiu, J., Joh, J., Hackett, N. R., and Crystal, R.G. 2007.
Protective immunity to pseudomonas aeruginosa induced with a capsid-modified adenovirus expressing P. aeruginosa OprF. J Virol. 81 :1 3801 -1 3808.
Wu, H., Dmitriev, I., Kashentseva, E., Seki, T., Wang, M., et al. 2002. Construction and characterization of adenovirus serotype 5 packaged by serotype 3 Hexon. J Virol.
76:12775-1 2782.
Wu, H. et al. Identification of sites in adenovirus Hexon for foreign peptide incorporation. Journal of virology 79, 3382-3390 (2005). Xia, D., Henry, L, Gerard, R.D. & Deisenhofer, J. Structure of the receptor binding domain of adenovirus type 5 Fiber protein. Current topics in microbiology and immunology 199 ( Pt 1), 39-46 (1995). Yang, Y., Li, Q., Ertl, H.C. & Wilson, J.M. Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses. Journal of virology 69, 2004-2015 (1995).
Youil, R., Toner, T.J., Su, Q., Chen, M., Tang, A., et al. 2002. Hexon gene switch strategy for the generation of chimeric recombinant adenovirus. Hum Gene The 13: 31 1 -320.
Next Patent: TEXTILE COMPOSITE MATERIAL COMPRISING NANOFIBER NONWOVEN
