Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
MODIFIED ALPHA-GLIADINS
Document Type and Number:
WIPO Patent Application WO/2011/157806
Kind Code:
A1
Abstract:
The present invention relates to modified α-gliadins, comprising the three T cell epitopes DQ2-Glia-α1, DQ2-Glia-α2 and DQ2-Glia-α3, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-α1 epitope P1{ F/Y}2P3Q4P5{Q/E}6L7P8Y9 is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia-α2 epitope { P/F}1Q2P3{Q/E}4L5P6Y7P8Q9 is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-α3 epitope F1R2P3Q4Q5P6Y7P8Q9 is replaced by another amino acid, preferably serine. In addition to this the amino acid in position 7 of all three epitopes may be replaced by another amino acid. The invention further relates to plants that comprise in their genome, a polynucleotide encoding the modified α-gliadins, and to grains and food products that comprise the α-gliadins.

Inventors:
KONING, Frits (Zadelmaker 20, WR Leiderdorp, NL-2353, NL)
DRIJFHOUT, Jan Wouter (Da Costastraat 41, AK Leiden, NL-2321, NL)
SMULDERS, Marinus Johannes Maria (Doddendaal 7, KA Ugchelen, NL-7339, NL)
GILISSEN, Ludovicus Johannes Wilhelmus Joseph (Papyruslaan 4, CB Heelsum, NL-6866, NL)
SALENTIJN, Elisabeth Margaretha Jacomina (Zambesidraaf 7, CA Utrecht, NL-3564, NL)
Application Number:
EP2011/060068
Publication Date:
December 22, 2011
Filing Date:
June 16, 2011
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
ACADEMISCH ZIEKENHUIS LEIDEN H.O.D.N LUMC (Albinusdreef 2, ZA Leiden, NL-2333, NL)
Stichting Dienst Landbouwkundig Onderzoek (Costerweg 50, BH Wageningen, NL-6701, NL)
KONING, Frits (Zadelmaker 20, WR Leiderdorp, NL-2353, NL)
DRIJFHOUT, Jan Wouter (Da Costastraat 41, AK Leiden, NL-2321, NL)
SMULDERS, Marinus Johannes Maria (Doddendaal 7, KA Ugchelen, NL-7339, NL)
GILISSEN, Ludovicus Johannes Wilhelmus Joseph (Papyruslaan 4, CB Heelsum, NL-6866, NL)
SALENTIJN, Elisabeth Margaretha Jacomina (Zambesidraaf 7, CA Utrecht, NL-3564, NL)
International Classes:
C07K14/415; A01H5/10; A23J1/12; C12N15/82
Attorney, Agent or Firm:
VAN SOMEREN, Petronella Francisca Hendrika Maria (Sweelinckplein 1, GK Den Haag, NL-2517, NL)
Download PDF:
Claims:
CLAIMS

1. Modified α-gliadin, comprising the three T cell epitopes DQ2-Glia^al, DQ2-Glia-a2 and DQ2-Glia- 3, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-al epitope Pi{F/Y} 2 3Q4P5{Q/E}6L7P8Y9 is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia- 2 epitope { P/FJ^PsiQ E LsPe vPeQs is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-o(3 epitope FiR2 3Q4Q5PeY7 PaQ9 is replaced by another amino acid,

preferably serine.

2. Modified a-gliadins, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia- l epitope

Pi{F/Y}2P3C P5{Q/E}6L7P8Y9 is replaced by another amino acid, preferably serine, and/o.r the amino acid in position 3 and/or 8 of the DQ2-Glia-a2 epitope { P/F hQz Ps i Q /E LsPeYT PsQs is replaced by another amino acid, preferably serine, and/or the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope F1R2P3Q4Q5P6Y7P8Q9 is replaced by another amino acid, preferably serine, and which modified a-gliadins optionally further comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2- Glia-oil, DQ2-Glia-a2 and DQ2-Glia-a3.

3. Modified a-gliadins as claimed in claim 2, wherein the amino acid in position 3 and/or 8 of the DQ2- Glia-αΐ epitope is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia-a2 epitope

{P/F}iQ2P3{Q/E}4L5P6Y7P8Q9 is replaced by another amino acid, preferably serine, and which modified of-gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia~a2 and DQ2-Glia-a3.

4. Modified -gliadins as claimed in claim 2, wherein the amino, acid in position 3 and/or 8 of the DQ2- Glia-oil epitope Pi{ F/YhPsC^PslQ/E} 6L7P8Y9 is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope

1R2 P3Q4Q5P6Y7 P8Q9 is replaced by another amino acid,

preferably serine, and which modified a-gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3.

5. Modified a-gliadins as claimed in claim 2, wherein the amino acid in position 3 and/or 8 of the DQ2- Glia-a2 epitope {P/F}iQ2P3{Q/E} L5P6Y7P8Q9 is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope

F1R2P3Q Q5 P6Y7P8Q9 is replaced by another amino acid,

preferably serine, and which modified α-gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3.

6. Modified α-gliadins as claimed in claim 2, wherein the amino acid in position 3 and/or 8 of the DQ2- Glia-a3 epitope F1R2P3Q4Q5P6Y7 P8Q9 (SEQ ID NO: 5) is replaced by another amino acid, preferably serine, and which modified a- gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3.

7. Modified a-gliadins as claimed in any one of the claims 1-6, wherein the DQ2-Glia-al epitope of the modified a-gliadin is selected from P1F2 P3Q4P5Q6L-7S8Y9, P1F2 3Q 5E6L7S8Y9, P1Y2 P3Q4 P5Q6L7S8Y9 and PiY2P3Q4P5E6L7S8Y9.

8. Modified α-gliadins as claimed in any one of the claims 1-7, wherein the DQ2-Glia-a2 epitope of the modified -gliadin is selected from P1Q2P3Q4L5P6Y7S8, P1Q2P3E4L5 P6Y7S 8 , F1Q2P3Q4L5P6 7S8 and F1Q2P3E4L5P6Y7S8.

9. Modified -gliadins as claimed in any one of the claims 1-8, wherein the DQ2-Glia-a3 epitope of the modified ci-gliadin is F1R2P3Q4Q5P6Y7S8Q9.

10. Modified a-gliadins as claimed in any one of the claims 1-9, wherein the amino acid in position 7 of the DQ2-Glia-al epitope Px{ F/Y PsS^PsiQ/E} 6L7PeY9 (SEQ ID NO:7) is replaced by another amino acid, and/or the amino acid in position 7 of the DQ2-Glia-a2 epitope {P/F}iQ2 3{Q E}4L5P6Y7P8 (SEQ ID NO: 8) is replaced by another amino acid, and/or the amino acid in position 7 of the DQ2-Glia-a3 epitope

F1R2P3Q4Q5P6Y7P8Q9 (SEQ ID NO: 5) is replaced by another amino acid.

11. Polynucleotide comprising a coding sequence for the modified α-gliadins as claimed in any one of the claims 1-10.

12. Cell comprising a coding sequence for the modified α-gliadins as claimed in any one of the claims 1-10 or the polynucleotide as claimed in claim 11.

13. Cell as claimed in claim 12, wherein the cell is a cell of a cereal that does not contain harmful gluten molecules, in particular a cell from oats, tef, rice or maize or the cell is a cell of a wheat strain from which the harmful a-gliadin genes have been removed.

14. Plant that comprises in its genome a polynucleotide encoding the modified α-gliadins as claimed in any one of the claims 1-10.

15. Plant as claimed in claim 14, wherein the plant is a cereal plant that naturally does not comprise harmful gluten, in particular tef, rice, maize or oats, or a cereal plant, in particular wheat, rye or barley that naturally comprises harmful gluten and from which the harmful gluten has been removed.

16. Grain from a plant as claimed in claim 14 or 15.

17. Food products, comprising the modified cx- gliadins as claimed in any one of the claims 1-10.

18. Microorganism that comprises in its genome a polynucleotide encoding the modified a-gliadins as claimed in any one of the claims 1-10 for the production of recombinant modified a-gliadins.'

Description:
MODIFIED α-GLIADINS

Field of the invention

The present invention relates to modified - gliadins that show a lower toxicity than existing of- gliadins, or no toxicity at all, to individuals suffering from celiac disease or individuals prone to develop the disease. The invention further relates to DNA sequences encoding the modified α-gliadins, to plants producing the modified a-gliadins and to products comprising the modified a-gliadins.

Background of the invention

Gluten is a composite of the gliadin and glutenin groups of proteins. Together with starch, they are found in the endosperms of grains of Triticeae species, in particular " wheat, but also in rye and barley. Gliadin and glutenin comprise about 80% of the protein contained in wheat seed.

Worldwide, gluten is an important source of nutritional protein, both in foods prepared directly from sources containing it, and as an additive to foods. Gluten is an essential component of dough and important for the baking quality.

Celiac Disease (CD) is an intestinal T-cell mediated disease caused by the gluten fraction of wheat. CD has prevalence between 0.5 and 2% in human populations and is characterized by a chronic intestinal inflammation upon ingestion of gluten proteins from wheat or the homologues proteins from the related cereals barley and rye. '

In CD patients CD4+ T cells are present in the lamina propria that secrete interferon-gamma upon

recognition of gluten-derived peptides bound to HLA-DQ2 or HLA-DQ8 molecules present on antigen presenting cells. Strikingly, most of the gluten peptides implicated in CD require modification by the enzyme tissue transglutaminase before they can bind to the disease-predisposing HLA-DQ molecules and trigger T cell responses.

In addition to the adaptive CD4+ T cell response to gluten, CD is characterized by an upregulation of IL-15, an intraepithelial T cell infiltrate expressing the NKG2D receptor, and the overexpression of a ligand for NKG2D

(MICA) .

Many gluten peptides with T cell stimulatory properties have now been identified. Such peptides have been found in the -, γ-, and ω-gliadins as well as in the Low Molecular Weight and High Molecular Weight glutenins.

Several studies, however, have demonstrated that peptides derived from α-gliadins induce strong T cell responses in the large majority of patients, while responses to the other peptides are less frequently found.

An a-gliadin derived 33-mer peptide (sequence

LQLQPFPQPQLPYPQPQLPYPQPQLPYPQPQPF (SEQ ID NO: 1) ) was

identified that encodes 6 partially overlapping T cell epitopes, has very potent T cell stimulatory properties, and harbors the p56-75 peptide (amino acid sequence

LQLQPFPQPQLPYPQPQLPY <SEQ ID NO:2) ) that has been identified as the dominant gluten epitope. Furthermore, -gliadins are the only gluten molecules that harbor the p31-43/49 peptide that has been implicated in the innate immune response induced by gluten.

The a-gliadins are encoded by the Gli-2 loci, Gli- A2 r GH-B2 and GH-D2, located on the 'short arm of t ree homeologous chromosomes (6AS, 6BS and 6DS) of hexaploid bread wheat (Triticu aestivum L.) and on the homeologous chromosomes in other hexaploid, tetraploid, and diploid

Triticum and Aegilops species. These loci are known to be complex and contain many gene copies organized in tandem repeats with estimates for a-gliadin gene copy number ranging from 25-35 to even 150 copies per haploid genome.

The occurrence and frequency of HLA-DQ2+ T cell epitopes (DQ2-Glia-al [sequence PFPQPQLPY (SEQ ID NO:3) ] ,

DQ2-Glia-a2 [sequence PQPQLPYPQ (SEQ ID NO:4)] and DQ2-Glia- «3 [sequence FRPQQPYPQ (SEQ ID NO:5)]; previously designated glia-a9, glia- 2, glia-a20, respectively) and HLA-DQ8+ T- cell epitopes (DQ8-Glia-al [sequence QGSFQPSQQ (SEQ ID

NO:6)], previously designated glia-a) was found to differ between the genomes. In addition, it is well established that due to the large variation in gluten genes and in the related genes in barley and rye multiple variants of T cell stimulatory sequences exist. At present, however, it is only partly known if and how such differences influence the immunogenicity of these gluten derived peptides.

. A first step towards elimination of gluten toxicity for celiac disease patients would be the elimination of toxicity from α-gliadins. It is therefore the object of the present invention to provide modified a-gliadins that have a lower or no toxicity as compared to existing a-gliadins.

Summary of the invention

In the research that led to the present invention, over 3000 o£-gliadin sequences were analyzed to determine whether they encode for peptides potentially involved in CD.

This produced insight in which key amino acid changes are sufficient to abolish T-cell recognition,. All identified peptides variants were synthesized and tested for binding to the disease associated HLA-DQ2 molecules and for recognition by patient-derived a-gliadin specific T cell clones.

The results demonstrate that the α-gliadins derived from the wheat D-genome are the most antigenic, as they can code for several different epitopes and sometimes multiple copies of an epitope exist in a single -gliadin molecule, while those from the B-genome produce the least antigenic proteins. Based upon these results a-gliadin genes were designed that encode proteins that are safe for consumption by celiac disease patients.

In addition, the results showed that it is very unlikely that -gliadin genes exist in nature that encode proteins that would be completely harmless for patients, indicating that conventional breeding strategies can not be used to generate wheat that would be safe for consumption by patients. It is therefore a further object of the present invention to provide plants that produce modified a-gliadins that have a lower or no toxicity as compared to existing a- gliadins.

The invention thus relates to modified a-gliadins, ■' comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia- a2 and DQ2-Glia-a3, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-al epitope Pi{ F/Y} 2P3Q4P5 { Q/E } gl^PgYg (SEQ ID NO: 7) is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2- Glia-a2 epitope { P/Fh^PsiQ E LsPeY?^ (SEQ ID NO: 8) is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope F3.R 2 P3Q4Q 5 P 6 Y 7 P8Q9 (SEQ ID NO:5)is replaced by another amino acid, preferably serine. In the annotation of the epitope amino acids between accolades means that at this position either of the two amino acids between the accolades can be present, i.e. { F/Y } 2 means that in position 2 there is either an F or an Y.

The invention further relates to modified a- gliadins in which the amino acid in position 3 and/or 5 of the DQ8-Glia-al epitope QiG2S 3 F 4 Q5P6S 7 Q8Q9 (SEQ ID NO: 6) is replaced by another amino acid, in particular a

phenylalanine in position 3 and an arginine in position 5.

The invention also relates to modified a-gliadins, wherein the amino acid in position 2 in the DQ2-Glia-a3 epitope is substituted from arginine to proline.

According to a further aspect thereof the invention relates to modified a-gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3, wherein the amino acid in position 7 of the DQ2-Glia-al epitope (SEQ ID NO:7)is replaced by another amino acid, and/or the amino acid in position 7 of the DQ2- Glia-a2 epitope { P/FhO^PaiQ/E LsPe^Ps (SEQ ID NO:8) is replaced by another amino acid, and/or the amino acid in position 7 of the DQ2-Glia- 3 epitope F1R2P3Q4Q5P6Y7 P8Q9 (SEQ ID NO:5)is replaced by another amino acid. The other amino acid for the DQ2-Glia-al epitope is preferably selected from ■' A,. R, K, H, P, G, D and W. The other amino acid for the DQ2- Glia-a2 epitope can be any amino acid. The substitution on position 7 of one or more of the epitopes is preferably combined with one or more of the substitutions on positions 3 and/or 8 of the epitopes.

The invention thus provides new α-gliadins in which three separate DQ2 epitopes have been modified thus leading to novel molecules that have a lower or no toxicity for subjects suffering from celiac disease and those that are prone to develop the disease. The modification can be in any combination of the positions 3, 7 and 8.

Furthermore, the invention relates to modified a- gliadins in. which position 7 of one or more of the three DQ2 epitopes is modified, either alone or in addition to one or more of the positions 3 and 8 of the three DQ2 epitopes.

The invention also relates to new oi-gliadins in which one or two separate DQ2 epitopes have been modified. The one or two modified epitopes can have one or more substitutions in positions 3, 7 and 8.

Different substitutions can be combined within one epitope and within one molecule. For example, a substitution in position 7 of DQ2-Glia-al can be combined with a

substitution in position 3 of DQ2-Glia- 2 or in position 8 of DQ2-Glia~a3. All combinations are possible.

Furthermore, the invention relates to modified a- gliadins in which the DQ8 epitope is modified, either alone or in addition to one or more of the three DQ2 epitopes.

The invention further relates to polynucleotides that encode the modified a~gliadins of the invention and their use for the generation of recombinant gluten proteins that are less or not harmful to patients suffering from celiac disease and/or transforming plants to produce gluten that are less or not harmful to patients suffering from "celiac disease.

According to a further aspect thereof, the

invention relates to food products comprising the modified α-gliadins of the invention.

Detailed description of the invention

It is well established that wheat derived gluten causes CD and patients need to adhere to a strict lifelong gluten-free diet. The availability of wheat that lacks toxicity for CD patients would allow patients to follow a more normal diet. Moreover, such a wheat variety could be employed to prevent CD in children born in at risk families or even in the general population. '

The invention is based on the identification of natural variation existing in wheat genomes that lead to a reduced or no toxicity and can be used to generate gluten molecules that are safe for consumption by celiac disease patients and/or to generate a cereal, in particular wheat that is safe for patients. This task, however, is

complicated by the large number of gluten genes that is encoded by a single wheat genome, and by the fact that commercially attractive wheat varieties contain two (durum or pasta wheat) or three (bread wheat) genomes.

With few exceptions CD only develops in HLA-DQ2 and/or -DQ8 positive individuals. Together with the

observation that IFNY-secreting, HLA-DQ2/8 restricted gluten-specific T cells are typically found in the inflamed intestine of CD patients, this indicates that such T cells play a crucial role in disease development. Although T cell responses to peptides derived from -and γ-gliadins as well as from HMW- and L W-glutenins have been described, various studies have indicated that the a-gliadins are most

immunogenic.

The inventors thus contemplated that a crucial first step towards the elimination of gluten toxicity would thus be the elimination of T cell stimulatory a-gliadin sequences. In order to define the full extent of potential toxicity of the a-gliadins for CD patients an extensive analysis of all known a-gliadin genes available was carried out. From these, all potential α-gliadin derived T cell epitopes for binding to HLA-DQ2 and T cell recognition were synthesized and tested and it was determined which naturally occurring amino acid substitutions and/or deletions

eliminate the T cell stimulatory properties of a-gliadin peptides. Finally, it was determined to which extent these results correlate with the expression Of toxic epitopes by diploid wheat species.

The genetic analysis of the gliadin transcripts from different bread wheat accessions showed a high

heterogeneity of the gliadin genes and the encoded T cell epitopes. It was observed that the canonical DQ2-glia-al and DQ2-glia-a3 epitopes are encoded by both the gliadins from the locus on chromosome 6A and those from 6D, while the canonical DQ2-glia-a2 epitope is only encoded by gliadin genes from 6D. Importantly, the extensive analysis of over 3000 sequences indicates that no single α-gliadin protein exists that lacks all T cell stimulatory epitopes.

The 33-mer sequence that contains 6 T cell

stimulatory sequences is only found in a minority of the a- gliadins analyzed, all of which are expressed from 6D. Other a-gliadin genes, including the remainder from 6D and all those from 6h and 6B encode much shorter versions of the 33- mer peptides that may contain between zero and four of the T cell stimulatory sequences.

Many amino acid substitutions affecting the antigenicity of the canonical α-gliadin peptides were identified. Typical examples are the P to S substitution at p8 in the DQ2-Glia-a2 epitope, the P to S substitution at p3 and p8 in the DQ2-Glia-al epitope, the R to P substitution at p2 in the DQ2-Glia-a3 epitope and the L/Y to A

substitution at p7 of all three epitopes, that completely eliminate the T cell stimulatory properties of these

peptides. In addition, several other amino acid

substitutions were found to diminish but not abolish the T cell stimulatory properties of homologs of the canonical a- gliadin peptides.

To systematically determine the impact of amino acid substitutions at the p3 and p8 position in the DQ2- Glia-αΐ epitope, substitution analogs ' of the DQ2-Glia-al epitope were synthesized in which the P at p3 or the P at p8 were systematically replaced by all naturally occurring amino acids. Subsequently these substitutions analogs were tested for T cell stimulatory capacity using two T cell clones derived from children with celiac disease.

With the exception of a P to G substitution at p8, all other substitutions were found to completely eliminate the T cell stimulatory properties of the DQ2-Glia-orl epitope (Figure 6A) . Further testing with two additional T cell clones from children with celiac disease (L6 and S2 in

Figure 6B) underscored the importance of the P at p3 and p8 in the DQ2-Glia-al epitope for T cell recognition but a few additional substitutions were found to be tolerated as well, in particular substitutions with- small amino acids like G, V, or A.

As this indicates that single substitutions can still trigger T cell responses we also tested all possible single, double and triple P to S substitutions in the DQ2- Glia-ofl epitope. The results of this analysis (Figure 7) a-gain underscore the impact of the P to S substitutions at p3 and p8 but also indicate that some single substitutions can give rise to (reduced) T cell responses in one of the four T cell clones tested.

It was furthermore observed that some Glia-al specific T cell clones did not or hardly tolerate any replacement of the leucine at position 7 while others are less specific (Figure 13) . In particular it was found that that the replacement with R, K, H, P, G, D, and W completely eliminated recognition of the peptide by all Glia-al

specific T cell clones while several conservative

substitutions, like M, I, F, Y, Q and V, were accepted by some of the T cell clones. In contrast, the Glia-a2 specific T cell clones were more restricted and with few exceptions, none of the amino acid substitutions were tolerated at position 7 (Figure 13) . The invention thus relates to all modified a- gliadins that comprise single, double and triple amino acid substitutions in one, two or three of the epitopes Glia- l Glia-a2 and Glia-a3 provided that the T cell response of that modified -gliadin is substantially or completely abolished.

However, for all T cell clones many combinations of substitutions, including the combined substitution of the P at p3 and p8 to S leads to complete elimination of T cell stimulatory properties. The invention thus also relates to modified a-gliadins comprising single substitutions in position 3 or 8 of the DQ2-Glia-al, DQ2-Glia-a2 and/or DQ2- Glia-a3 epitope.

Amino acid deletions in the canonical a-gliadin peptides also prohibit binding to HLA-DQ2 and hence T cell recognition. A typical example is the deletion of the Q at ' p4 in the DQ2-Glia-al epitope which generates a peptide that no longer binds to HLA-DQ2, presumably caused by defective docking of the anchor residues into their respective pockets in the HLA-DQ2 molecule.

All a-gliadins of 6A encode an altered version of the DQ2-Glia-a2 epitope with an S at the p8 position, which fails to induce T cell responses. Moreover, it was found according to the invention that a similar substitution affects the T cell stimulatory properties of the DQ2-Glia-al and DQ2-Glia-a3 epitopes. While the 6D a-gliadins generally encode several copies of both the DQ2-Glia-al and DQ2-Glia- a2 epitopes in addition to the DQ2-Glia-a3 and DQ8-Glia-al epitopes, 6A genes usually encode only the DQ2-Glia-al and DQ2-Glia-a3 epitopes while the 6B genes encode no or at most one DQ2-Glia-al, next to the DQ8-Glia-al epitopes.

The present results thus indicate that the a- gliadin locus on 6D encodes the most toxic α-gliadins while substantially less toxicity is associated with those from 6A and 6B .

Based on these findings, the invention thus provides modified α-gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-al epitope (SEQ ID NO:7) is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia- 2 epitope

{P/FhQsPsiQ/E LsPeYvPs (SEQ ID NO:8) is replaced by another amino acid, preferably serine, and the amino acid in

position 3 and/or 8 of the DQ2-Glia-a3 epitope

1R2 3Q4Q5P6Y7P8Q9 (SEQ ID NO: 5) is replaced by another amino acid, preferably serine.

In one embodiment the invention relates to modified a-gliadins, wherein the amino acid in position 3 and/or 8 of ■' the DQ2-Glia-al epitope P x { F/Y} 2 3Q4 5{Q/E}6L 7 P 8 Y9 (SEQ ID

NO: 7) is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia-a2 epitope { P/F}iQ 2 P3{Q/E} L 5 P 6 Y 7 P 8 (SEQ ID NO: 8) is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia- 3 epitope

F1R2P3Q4Q5 P6Y7P8Q9 (SEQ ID NO: 5) is replaced by another amino acid, preferably serine, and wherein the amino acid in position 6 of the DQ2-Glia- 2 epitope is replaced by another amino acid, preferably serine.

In one embodiment, the invention relates to

modified α-gliadins, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-al epitope Pi ' {F Y} 2 P3Q4P5{Q E¾ 6 L 7 PeY9 (SEQ ID NO: 7) is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2- Glia-a2 epitope { P/F}iQ 2 P3{Q/E}4L 5 P 6 Y 7 P 8 (SEQ ID NO: 8) is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope F1R2 P3Q Q5 P6Y7 P8Q9 (SEQ ID NO: 5) is replaced by another amino acid, preferably serine, and which modified a-gliadins further comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2- Glia-cil, DQ2-Glia- 2 and DQ2-Glia-a3.

In one embodiment, the invention relates to modified -gliadins, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-al epitope Pi{

(SEQ ID NO: 7) is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2- Glia- 2 epitope { P/F}iQ 2 P3{Q/E} 4 L 5 P 6 Y 7 P 8 (SEQ ID NO: 8) is replaced by another amino acid, preferably serine, and which modified a-gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia~a2 and DQ ' 2-Glia- ¾3,.

In one embodiment, the invention relates to modified α-gliadins, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-al epitope Pi{F/Y} 2 P3Q4P5{Q E} 6 L 7 P 8 Y9 (SEQ ID NO: 7) is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2- Glia-a3 epitope F1R2P3Q4Q5P6Y7 P8Q9 (SEQ ID NO: 5) is replaced by another amino acid, preferably serine, and which modified ct- gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3.

In one embodiment, the invention relates to modified α-gliadins, wherein the amines acid in position 3 and/or 8 of the DQ2-Glia-a2 epitope { P/FhQ2P3{Q E}4L 5 P 6 Y7p8

(SEQ ID NO: 8) is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope F1R2P3Q4Q5 6Y7P8Q9 (SEQ ID NO: 5) is replaced by another amino acid, preferably serine, and which modified a-gliadins optionally comprise an amino acid substitution in one or more of the nine positions of one or more of the epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia- a3.

In one embodiment, the invention relates to modified a-gliadins, wherein the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope F1R2 P3Q4Q5P6Y7 P8Q9 (SEQ ID NO: 5) is replaced by another amino acid.

In one embodiment, the invention relates to modified α-gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3 with one or more of the above described amino acid substitutions in position 3 and/or 8, and wherein the amino acid in position 7 of the DQ2-Glia-al epitope Pi{ F/Y} 2 P 3 Q 4 P5{Q/E}6L 7 P 8 9 (SEQ ID NO: 7) is replaced by another amino acid, the amino acid in position 7 Of the DQ2-Glia-a2 epitope { P/F}iQ 2 P3{Q E}4L 5 P 6 Y 7 P8 (SEQ ID NO: 8) is replaced by another amino acid, and the amino acid in position 7 of the DQ2-Glia-a3 epitope F^PsQ^Qs eYv eQs (SEQ ID NO: 5) is replaced by another amino acid.

In one embodiment, the invention relates to modified α-gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3 with one or more of the above described amino acid substitutions in position 3 and/or 8, and wherein the amino acid in position 7 of the

DQ2-Glia-al epitope Pi{F/Y} 2 P3Q P5{Q/E} 6 L 7 P 8 Y9 (SEQ ID NO:7) is replaced by another amino acid and the amino acid in

position 7 of the DQ2-Glia-a2 epitope {P/F}iQ 2 P3{Q/E}4L 5 P6Y7P8 (SEQ ID NO: 8) is replaced by another a'mino acid. '

In one embodiment, the invention relates to modified α-gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3 with one or more of the above described amino acid substitutions in position 3 and/or 8, and wherein the amino acid in position 7 of the DQ2-Glia-al epitope Pi{ F/Y } 2P3Q4P5 { Q/E } 6 L 7 P 8 Yg (SEQ ID NO: 7) is replaced by another amino acid and the amino acid in

position 7 of the DQ2-Glia-a3 epitope F1R2P3Q4Q5P6Y7 PBQ9 (SEQ ID NO: 5) is replaced by another amino acid.

In one embodiment, the invention relates to modified α-gliadins, comprising the three T cell epitopes DQ2-Glia- l, DQ2-Glia-a2 and DQ2-Glia-a3 with one or more of the above described amino acid substitutions in position 3 and/or 8, and, wherein the amino acid in position 7 of the DQ2-Glia-a2 epitope { P/FhC^PsiQ/E Ls e^Ps < SE Q 10 NO: 8) is replaced by another amino acid and the amino acid in

position 7 of the DQ2-Glia-a3 epitope F1R2P3Q4Q5P6Y7P8Q9 (SEQ ID NO: 5) is replaced by another amino acid.

In one embodiment, the invention relates to modified -gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3 with one or more of the above described amino acid substitutions in position 3 and/or 8, and wherein the amino acid in position 7 of one of epitopes is replaced by another amino acid.

In one embodiment, the invention relates to modified a-gliadins, comprising the three T cell epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3, wherein the amino acid in position 3 and/or 7 and/or 8 of the DQ2-Glia-al epitope Pi{ (SEQ ID NO:7) is replaced by another amino acid, and/or the amino acid in position 3 and/or 7 and/or 8 of the DQ2-Glia-a2 epitope

{P/F}iQ2P3{Q/E} 4 L 5 P 6 YP 8 (SEQ ID NO: 8) is replaced by another amino acid and/or the amino acid in position 3 and/or 7 and/or 8 of the DQ2-Glia-a3 epitope F1R2P3Q4Q5P6Y7P8Q9 (SEQ ID NO: 5) is replaced by another amino acid.

In one embodiment the DQ2-Glia-al epitope of the modified a-gliadin is selected from P1F2P3Q4P5Q6L7S8 9 (SEQ ID NO: 9), PiF 2 P3Q 4 P 5 E 6 L 7 S 8 Y9 (SEQ ID NO: 10), PiY 2 P 3 Q 4 P 5 Q 6 L 7 S 8 Y 9 (SEQ ID NO:ll), P 1 Y 2 P 3 Q 4 P 5 E6L 7 S 8 Y9 (SEQ ID NO:12), P I F 2 S3Q 4 P 5 Q 6 L 7 SBY9 (SEQ ID NO:13), P 1 F 2 S 3 Q i P 5 E 6 L',S B Y 5 (SEQ ID NO:14), P 1 Y 2 S 3 Q i P 5 Q 6 L 1 S Y 9 (SEQ ID NO: 15), PiY 2 S3Q4P5E6L 7 S 8 Y9 (SEQ ID NO: 16),

PiF 2 S 3 Q4p5Q6L 7 P 8 Y9 (SEQ ID NO: 17), PiFaSsQ^PsEe^PsYg (SEQ ID NO: 18), PiY 2 S3Q4P5Q6L 7 P 8 Y9 (SEQ ID NO:19) and (SEQ ID NO:20).

In one embodiment the DQ2-Glia-a2 epitope of the modified a-gliadin is selected from P 1 Q2P3Q4L 5 P6Y 7 S 8 (SEQ ID NO:21), P 1 Q 2 P 3 E4L 5 P 6 Y7S8 (SEQ ID NO:22), FiQ 2 P3Q4L 5 PeY7Sa (SEQ ID

NO:23), F 1 Q 2 P 3 E 4 L 5 P 6 Y 7 S 8 (SEQ ID NO:24), PiQ 2 S 3 Q 4 L 5 P 6 Y 7 S 8 Q9 (SEQ ID NO:25), PiQ 2 S3E 4 L 5 P 6 Y 7 S 8 Q9 (SEQ ID NO:26), FiQ 2 S 3 Q 4 L 5 P6Y 7 S 8 Q9 (SEQ ID NO:27), FiQ 2 S 3 E 4 L 5 P 6 Y 7 S 8 Q9 (SEQ ID NO:28), P1Q2S3Q4L5P6Y7P8Q9 (SEQ ID NO:29), P1Q2S3E4L 5 P6Y7P8Q9 (SEQ ID NO:30),

FiQ 2 S 3 Q 4 L 5 P6Y7P8Q9 (SEQ ID NO: 31) and F1Q2S3E4L5P6Y7P8Q9 (SEQ ID NO: 32) .

In one embodiment the DQ2-Glia-a3 epitope of the modified a-gliadin is selected from F1R2 P3Q4Q5 P6Y7S 8Q9 (SEQ ID NO:33), F 1 R 2 S 3 Q4Q5 6Y7S 8 Q9 (SEQ ID NO:34) and FiR 2 S 3 Q4Q 5 P6Y7P8Q9 (SEQ ID NO: 35) .

In one embodiment the DQ2-Glia-al epitope of the modified a-gliadin is selected from P1F2P3Q4P5Q6L7S8Y9 (SEQ ID NO:9), PiF 2 P 3 Q4P5E6L 7 S 8 Y9 (SEQ ID NO:10), PiY 2 P 3 Q 4 5Q6L7S 8 Y9 (SEQ ID NO:ll), PiY 2 3 Q4p5E 6 L 7 S 8 Y9 (SEQ ID NO:12), PiF 2 S 3 Q 4 5 Q6L 7 S 8 Y 9 (SEQ ID NO:13), PiFzSsQiPsEeLvSeYa (SEQ ID NO:14), PiY 2 S 3 Q4P5Q6L 7 S 8 Y9 (SEQ ID NO: 15), PiY 2 S 3 Q 4 P 5 E 6 L 7 S8Y9 (SEQ ID NO: 16),

Pi 2 S 3 Q4p5Q6L P 8 Y9 (SEQ ID NO:17), PiF 2 S 3 Q4 5E 6 L 7 P 8 Y9 (SEQ ID NO:18), PiY2S3Q 4 P5Q6L 7 P 8 Y9 (SEQ ID NO: 19) and (SEQ ID NO:20) and/or the DQ2-Glia-a2 epitope 6f the modified* a- gliadin is selected from PiQ 2 P 3 Q 4 L 5 P6Y 7 S8 (SEQ ID NO:21),

PiQ 2 P 3 E 4 L 5 P 6 Y 7 S8 (SEQ ID NO:22), FiQ 2 P 3 Q 4 L 5 P 6 Y 7 S 8 (SEQ ID NO:23), FiQ 2 P 3 E4L 5 P6Y7S 8 (SEQ ID NO:24), P 1 Q 2 S 3 Q4L 5 P6Y7S 8 Q9 (SEQ ID NO:25), PXQ2S3E4L5P6Y7SSQ9 (SEQ ID NO:26), FiQ 2 S 3 Q4L 5 P6Y7S8Q9 (SEQ ID NO:27), F i Q 2 S 3 E 4 L 5 P6 7S8Q9 (SEQ ID NO:28), PiQ 2 S 3 Q 4 L 5 P 6 Y7P8Q9 (SEQ ID NO:29), PiQ 2 S 3 E 4 L 5 P 6 Y7 8Q9 (SEQ ID NO:30), FiQ 2 S3Q4L 5 P 6 Y7P8Q9 (SEQ ID NO: 31) and FiQ 2 S3E4L 5 P 6 Y7P8Q9 (SEQ ID NO: 32) and/or the DQ2-Glia-a3 epitope of the modified a-gliadin is selected from FiR 2 P 3 Q 4 Q 5 P 6 Y 7 S8Q9 (SEQ ID NO:33), FiR 2 S 3 Q 4 Q 5 P6Y7S 8 Q 9 (SEQ ID NO:34) and (SEQ ID NO:35).

In one embodiment any one of the above described epitopes according to SEQ ID NOs:9-35 further comprises an amino acid substitution in position 7.

In one embodiment, the amino acid in position 3 and/or 8 is not substituted with- serine but with another amino acid selected from isoleucine, leucine, valine, phenylalanine, methionine, cysteine, alanine, glycine, proline, threonine, tyrosine, tryptophan, glutamine, asparagines, histidine, glutamic acid, aspartic acid, lysine and arginine.

In one embodiment, in addition to the substitution in position 3 and/or 8 in one or more of the DQ2-Glia-ctl, DQ2-Glia-a2 and DQ2-Glia- 3, one or more of the amino acids in position 1, 2, 4 to 7 and 9 in the DQ2-Glia-al, DQ2-Glia- 2 and DQ2-Glia-cf3 epitopes are replaced by another amino acid selected from isoleucine, leucine, valine,

phenylalanine, methionine, cysteine, alanine, glycine, proline, threonine, tyrosine, tryptophan, glutamine, asparagines, histidine, glutamic acid, aspartic acid, lysine, serine and arginine without negatively affecting or abolishing the functional properties of the a-gliadin.

The substitutions in position 3, 7 and 8 of epitopes DQ2-Glia-al, DQ2-Glia-a2 and ' DQ2-Glia-a3 can exist in all possible combinations, in particular the combinations according to the following schemes . α1 3 8 3 8 8 3 8 3 α2 3 8 8 3 8 3 3 8 a3 3 8 8 8 3 8 3 3

al 3+8+7 3+7 3+7 3+8+7 8+7 8+7

a2 3+7 3+8+7 3+7 8+7 3+8+7 8+7

a3 3+7 3+7 3+8+7 8+7 8+7 3+8+7 al 3+8+7 3+8+7 3+7 8+7 3+7 8+7

a2 8+7 3+7 3+8+7 3+8+7 8+7 3+7

a3 3+7 8+7 8+7 3+7 3+8+7 3+8+7 αΐ 3 3 7 7 3 7 3

0ί2 3 7 3 7 3 3 7 3 3 7 7 3 7 3 3

0£l 3+7 3 3+7 3+7 7 3+7 3+7 2 3+7 3+7 3 3+7 3+7 7 3+7 α3 3+7 3+7 3+7 3 3+7 3+7 7

αΐ 7+8 7 7 7+8 8 8

α2 7 7+8 7 8 7+8 8

α3 7 7 7+8 8 8 7+8 ΐ 7 + 8 7 + 8 7 8 7 8

2 8 7 7+8 7 + 8 8 7

οτ3 7 8 8 7 7 + 8 8+8 oil 3 3 7 8 7 8

2 7 8 3 3 8 7

οί3 8 7 8 7 3 3

The amino acid at each of the positions 3 and/or 8 in each of the three DQ2 epitopes can be substituted with each of the following amino acids: alanine (A), cysteine

(C) , aspartic acid (D) , glutamic acid (E), phenylalanine (F), histidine (H) , isoleucine (I), lysine (K) , leucine (L) , methionine (M) , asparagine (N) , glutamine (Q) , arginine (R) , serine (S) , threonine (T) , valine (V) , tryptophan (W) and tyrosine (Y) .

For position 3, the amino acid after substitution is preferably cysteine (C) , aspartic acid (D) , glutamic acid (E) , phenylalanine (F), histidine (H) , isoleucine (I), lysine (K) , leucine (L) , methionine (M) , asparagine (N) , glutamine (Q) , arginine (R) , valine (V) , tryptophan ( ) and tyrosine (Y) , and most preferably serine.

For position 8, the amino acid after substitution is preferably alanine (A) , cysteine (C) , aspartic acid (D) , glutamic acid (E) , phenylalanine (F) , histidine (H) , lysine (K) , leucine (L) , methionine (M) , asparagine (N) , glutamine CQ) , arginine (R) , tryptophan (W) and tyrosine (Y) , and most preferably serine.

The amino acid at each of the positions 7 in each of the three DQ2 epitopes can be substituted with each of the following amino acids: alanine (A), arginine (R) , lysine ( ) , histidine (H) , proline (P) , glycine (G) , aspartic acid

(D) , and tryptophan (W) .

According to the invention, also other

substitutions and deletions were identified that are capable of eliminating or reducing the T cell stimulatory properties of DQ2 epitopes.

In one embodiment, the invention relates to modified α-gliadins, comprising the DQ2-Glia- 3 epitope wherein the amino acid in position 2 is substituted, in particular with a proline.

In one embodiment, the invention relates to modified α-gliadins, comprising the DQ2-Glia~al epitope wherein the amino acid Q in position 4 is substituted, in particular with a histidine.

In one embodiment, the invention relates to modified -gliadins, comprising the DQ2-Glia-al epitope wherein the amino acid in position 3 or 4 is deleted.

Furthermore, it was found according to the invention that amino acid substitutions in the DQ8-Glia-orl epitope QiG 2 S3F 4 Q 5 P 6 S 7 Q s Q9 are also capable of eliminating or lowering the toxicity of this epitope.

In one embodiment, the invention relates to modified a-gliadins, comprising the DQ8-Glia-al epitope

QiG2S 3 F4Q5P 6 S 7 Q8Q9 wherein the amino acid in position 3 and/or 5 is replaced by another amino acid, in particular a

phenylalanine in position 3 and an arginine in position 5.

In one embodiment, the substitution in the DQ8- Glia-αΐ epitope is combined with the substitutions in one or more of the DQ2 epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2- Glia- 3.

In one embodiment, the modified a-gliadins comprise solely amino acid substitutions in positions 3 and/or 5 of the DQ8~Glia-al epitope QiG 2 S 3 F4Q5 6S 7 Q B Q9.

In one embodiment, the modified α-gliadins comprise a modified DQ8 epitope selected from QiG2F3F a Q 5 P 6 S 7 Q 8 Q9,

Q1G2S3F4R5P6S7Q8Q9 and Q1G2F3F4R5P6S7Q8Q9. All amino acid substitutions or deletions as described herein or in the examples may be comprised in any combination in the modified α-gliadins of the invention. In particular the invention relates to modified a-gliadins in which all of the three DQ2 epitopes DQ2-Glia-al, DQ2-Glia-a2 and DQ2-Glia-a3 comprise one or more substitutions or deletions as described herein.

As no single α-gliadin gene was identified that is completely safe, it will be impossible to generate wheat that is entirely safe for consumption by CD patients by conventional breeding strategies-. According to the present invention the knowledge on the crucial amino acids in the DQ2-Glia-0£l, DQ2-Glia~a2 and DQ2-Glia-a3 epitopes and the DQ8-glia-al epitope is used to modify existing wheat genes or is used to generate safe a-gliadin genes. Such modified genes can subsequently be introduced into safe crops, to

' Optimize bread making quality of such crops. Alternatively, existing harmful crops such as wheat can be modified by specifically modifying the α-gliadin encoding genes therein. Such modification of the genes encoding a-gliadins can be achieved by well known techniques, such a homologous

recombination, site directed mutation or cisgenesis.

According to a further aspect thereof, the

invention relates to a polynucleotide that comprises a coding sequence for the modified α-gliadins of the

invention.

In one embodiment, the polynucleotide further comprises one or more regulatory sequences that are operably linked to the coding sequence for expressing the coding sequence in a cell.

In one embodiment, the coding sequence and optional regulatory sequences form a vector or are part of a vector suitable for being transformed into a cell. According to a further aspect thereof, the

invention relates to a cell comprising a coding sequence for the modified a-gliadins of the invention.

In one embodiment, the cell is a cell of a cereal that does not contain harmful gluten molecules, in

particular a cell from oats, tef, rice or maize.

In one embodiment, the cell is a cell of a wheat variety, landrace, gene bank accession, or progeny thereof from which the harmful a-gliadin genes have been removed.

In one embodiment, the cell is a cell of a diploid, tetraploid, or hexaploid wheat variety, landrace, gene bank accession, or progeny or a synthetic polyploid thereof that has a low level of CD toxicity.

According to a further aspect thereof, the invention relates to plants that comprise a polynucleotide encoding the modified a-gliadins of the invention. The skilled person is very well capable of designing a

polynucleotide on the basis of the amino acid sequence it must encode without undue burden. The general amino acid sequence of a-gliadins is known and can for example be found in Kasarda et al. (1984) Nucleic acid (cDNA) and amino acid sequences of alpha-type gliadins from wheat [Triticum

aestivum) . Proc Natl Acad Sci U S A. 81: 4712-4716. The sequence of one α-gliadin is also presented in Figure 8 (SEQ ID NO: 36) .

In one embodiment, the plant receiving the polynucleotide encoding the modified a-gliadins of the invention is not a wheat plant and the plant is thus a

ί

transgenic plant. The plant is in particular a cereal, more in particular a cereal that does not naturally produce gluten. In one embodiment the cereal is selected from tef (Eragrostis tef), rice, maize, oats, sorghum (Sorghum

bicolor) , pearl millet {Pennisetum glaucum) , Finger millet (Eleusine coracana) , Fonio (Digitaria exilis and Digitaria iburua) , or another cereal crop.

In one embodiment, the plant receiving the

polynucleotide encoding the modified α-gliadins of the invention is not a wheat plant and the plant is thus a transgenic plant. The plant is in particular not a cereal, but another crop such as Amaranthus (amaranth) , Chenopodium spec, (in particular grain chenopod, quinoa) , or buckwheat.

In one embodiment the plant receiving the polynucleotide encoding the modified a-gliadins of the invention is also a wheat ( Triticum) plant and the plant is thus a cisgenic plant.

Both transgenic and cisgenic plants that carry one or more polynucleotides encoding the modified a-gliadins of the invention are part of this invention.

In one embodiment, the invention relates to xecombinant gluten proteins, in particular recombinant modified -gliadins in which one or more of the epitopes described above have been altered, both as part of an organism or as such in isolated form. To a person skilled in the art it is clear that recombinant gluten proteins can be produced in either micro-organisms or in plants. Suitable micro-organisms include but are not restricted to

Escherichia coli and Aspergillus niger. Suitable plants would include but are not restricted to Oryza sativa species (rice) and Zea mays species (maize) . By the transgenic introduction of (modified) gluten genes into such organisms under the right promoters to drive expression, efficient transcription of the introduced genes can be achieved leading to the production of the (modified) gluten proteins of interest.

The plants of the invention produce grain as a crop. The grain can be further used to produce food products, in particular baked products such as bread. The grain and all products, such as flour, that can be obtained therefrom, such as through milling, are also part of this invention. Grain derived products comprise any product that contains gluten or gluten-like molecules such as flour, bran, sperm, etc.

The invention furthermore relates to food products, comprising the modified a-gliadins of the invention. More in particular the invention relates to baked food products, in particular bread, that can be made with or from grain that comprises the modified a-gliadins of the invention. Besides food products that are well-known to contain gluten, like bread, crackers, croutons, cookies, cake etc. other food products may also contain gluten. Examples of such food products are bulgur, couscous, pasta, sauce, soup and

certain snacks. Gluten is also used as a meat substitute and a-s an additive in food products. The invention relates to all food products that in some form contain the modified a- gliadins as claimed.

As used herein "modified a-gliadin" is intended to refer to an a-gliadin that is not found in nature and that comprises one or more amino acid substitutions in one or more of the DQ2-Glia- l, DQ2-Glia-a2 and DQ2-Glia-a3

epitopes. The term refers in particular to α-gliadins from wheat, comprising an amino acid substitution in position 8 in two or more, in particular three of the DQ2-Glia-al, DQ2- Glia-a2 and DQ2-Glia-a3 epitopes. The substitutions are in particular proline to serine substitutions.

The invention will be further illustrated in the Examples that follow and that are given for illustration purposes only but which are not intended to limit the

invention in any way. The invention further relates to the following embodiments .

1) Modified α-gliadins as defined in claim 1, wherein the amino , acid in position 3 and/or 8 of the DQ2- Glia-αΐ epitope Pi{F/Y} 2 P 3 Q P 5 {Q/E} 6 L 7 P 8 Y9 is replaced by another amino acid, preferably serine, the amino acid in position 3 and/or 8 of the DQ2-Glia- 2 epitope

{P/F}iQ2P3{Q/E}4L 5 P 6 Y 7 P8Q9 is replaced by another amino acid, preferably serine, and the amino acid in position 3 and/or 8 of the DQ2-Glia-a3 epitope F3R2P3Q4Q5P6Y7P8Q9 is replaced by another amino acid, preferably serine, and wherein the amino acid in position 6 of the DQ2-Glia- 2 epitope is replaced by another amino acid, preferably serine.

2) Modified a-gliadins as defined in the claims or this specification, wherein the DQ2-Glia-oil, DQ2-Glia-a2 and

DQ2-Glia-a3 have one of the amino acid sequences as listed in SEQ ID Nos: 9-20, 21-32 and 33-35, respectively.

3) Modified -gliadins, comprising the DQ8-Glia-al epitope QiG 2 S 3 F Q 5 P 6 S 7 Q 8 Q 9 wherein the amino acid in position 3 and/or 5 is replaced by another amino acid, in particular a phenylalanine in position 3 and an argxnine in position 5.

4) Modified α-gliadins as defined above, comprising a modified DQ8 epitope selected from Q I G 2 F 3 F 4 Q 5 S S Q B Q 9 ,

Q 1 G 2 S 3 F 4 R5P6S 7 Q8Q9 and Q1G2F3F4R5P6S7Q8Q9.

5) Modified α-gliadins comprising one or more amino acid substitutions as defined in the claims or this

specification .

6) Modified α-gliadins, comprising one or more amino acid modifications selected from:

- a substitution of the amino acid in position 2 of the DQ2-Glia-a3 epitope, in particular with a proline,

- a substitution of the amino acid in position 5 of the DQ2-Glia-al epitope, in particular with alanine, - a substitution of the amino acid in position 6 or 8 of the DQ2-Glia- 2 epitope, in particular with serine,

- a replacement of the N-terminal sequence of the epitope core, P1Q2P3, of the DQ2-Glia-a2 epitope with

Fi{P/L} 2 P 3 or PiH 2 P 3 , and

_ a deletion of the Q at position 4 in the DQ2- Glia- ΐ epitope.

7) Modified -gliadins as defined above, further comprising one or more amino acid modifications selected from:

- a substitution of the amino acid in position 2 of the DQ2-Glia-a3 epitope, in particular with a proline,

- a substitution of the amino acid in position 5 of the DQ2-Glia- l epitope, in particular with alanine,

- a substitution of the amino acid in position 6 or 8 of the DQ2-Glia- 2 epitope, in particular with serine,

- a replacement of the N-terminal sequence of the epitope core, P1Q2P3, of the DQ2-Glia-a2 epitope with

Fi{P/L} 2 P 3 or P1H2P3, and

_ a deletion of the Q at position 4 in the DQ2- Glia-cxl epitope .

8) Polynucleotide comprising a coding sequence for the modified a-gliadins as claimed in the claims or this specification, further comprising one or more regulatory sequences that are operably linked to the coding sequence for expressing the coding sequence in a cell.

9) Polynucleotide as defined above, wherein the coding sequence and optional regulatory sequences form a vector or are part of a vector suitable for being

transformed into a cell.

10) Processed grain product, in particular flour, produced from grain from a plant that comprises in its genome a polynucleotide encoding the modified a-gliadins as claimed in the claims or this specification.

11) Food product, comprising the modified a- gliadins as claimed as claimed in the claims or this

specification, wherein the food product is a baked food product, in particular bread.

FIGURES

In the Example reference is made to the following figures and tables:

Figure 1 shows the Neighbor-Joining relationship of -gliadin transcripts (EST-contigs) of bread wheat (T.

aestivum) and genomic a-gliadin sequences derived from diploid wheat species, Γ. monococcum (AA/green (hatched) circles in GH-A2/AA square) , Ae. speltoides (SS/blue (open) (circles in GH-B2/SS square), Ae. tauschii (DD/red (filled) - circles in G11-D2/DD square) . In all cases, a nucleic acid region of the α-gliadin gene, shared by all transcripts sequences and genomic sequences were used. The a-gliadin sequences of the diploid Aegilops/Triticum species are representative for ancestral sequences of the three

respective homoeologous genomes, AA, BB and DD, of hexaploid bread wheat (Γ. aestivum) . The tree is drawn to scale, with branch lengths in the same units as those of the distances used to infer the tree. The distances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. Codon

positions included were lst+2nd+3rd+Noncoding. All positions containing alignment gaps and missing -data were eliminated only in pairwise sequence comparisons (Pairwise deletion option) . There were a total of 750 positions in the final dataset. Phylogenetic analyses were conducted in MEGA 4

(Tamura et al., MEGA4 : Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-1599 (2007). Software at

http: //www.megasoftware.net/index. html) .

Figure 2 shows the natural sequence variation in celiac disease epitope containing regions of expressed - gliadins of T. aestivum. The deduced amino acid sequence of -gliadin transcript contigs (EST contigs >5 ESTs) assigned to the respective loci Gli-A2 r Gli-B2 or Gli-D2 were aligned to study the natural occurring sequence variation. A total of 24 a-gliadin variants were discriminated in the N- terminal region (72 to 45 amino acids) that is harboring the innate responsive epitope (p31-43) and the adaptive HLA-DQ2+ T cell epitopes (DQ2-Glia-al/DQ2-Glia-a2 and DQ2-Glia-a3) . The corresponding C-terminal region (20 amino acids)

harboring the HLA-DQ8+ restricted Glia-αΐ epitope (alignment shown after the | | ) was deduced from the transcript contigs and showed 26 variants (more variation present in this region in variant no. 2 and variant no. 5) N= number of transcripts covering the regions analyzed. In grey: amino acid variation in the sequence. In black: chymotrypsin or trypsin sites (>72% affinity) ; cleavage occurs at the right side (C-terminal direction) of the marked amino acid.

Figure 3 shows the T cell stimulatory capacity of DQ2-glia-al variants. Variants of the DQ2-Glia-al epitope detected in the a-gliadin transcriptome were synthesized as 15- or 16-mer peptides in a deamidated form and tested for their capacity to induce in vitro proliferation of a DQ2- Glia-αΐ specific T cell clone. IL-2: proliferation of the T cell clone under the influence of interleukin-2. Background: proliferation of the T cells in the presence of antigen presenting cells but no peptide. Positive control:

proliferation of the T cell clone in the presence of a synthetic peptide encoding the DQ2-Glia-al epitope, cpm:

counts per minute.

Figure 4 shows the presence of DQ2-Glia- l and DQ2- Glia-a2 epitopes in diploid wheat. Pepsin-trypsin digests of 29 diploid wheat accessions were prepared and tested in a competition ELISA with a mAb specific for a sequence

partially overlapping with the DQ2-Glia- l and DQ2-Glia- 2 epitopes and after deamidation with T cell clones specific for the DQ2-Glia-al and DQ2-Glia- 2 epitopes. A: results of the competiton ELISA. B: T cell proliferation assay with a DQ2-Glia-al specific T cell clone. C: T cell proliferation assay with a DQ2-Glia-a2 specific T cell clone. IL-2:

proliferation of the T cell clone under the influence of interleukin-2. Background: proliferation of the T cells and the antigen presenting cells. Positive control:

proliferation of the T cell clone in the presence of a synthetic peptide encoding the specific gliadin epitope, cpm: counts per minute. AA: diploid accessions from species having the AA genome. SS: diploid accessions from species with the SS genome. DD: diploid accessions from species with the DD genome.

Figure 5 shows that amino acid substitution eliminates toxicity of known gliadin epitopes. The DQ2-Glia- 3 epitope and the known 33-mer were synthesized in

deamidated form either as the original sequence or after substitution in each epitope of the prolines at position 8 with serine. These peptides were tested in T cell

proliferation assays.

A: T cell proliferation assay using a DQ2-Glia- 3 specific T cell clone.

B: T cell proliferation assay using a DQ2-Glia- l specific T cell clone. Positive control: synthetic peptide encoding the specific T cell epitope.

S im. index: stimulation index defined as the specific proliferation of .a sample divided by the background.

Figure 6 shows that systematic replacement of the P at p3 and p8 in the DQ2-Glia-al epitope by natural occurring amino acids impacts on the T cell stimulatory capacity of the DQ2-Glia-al epitope. For T cell clone N10 (Figure 6A) no substitutions are allowed. For T cell clone L10 (Figure 6A) only a glycine substitution is allowed. For the two other clones L6 and S2 (Figure 6B) the majority of substitutions eliminate T cell stimulatory properties of the DQ2-Glia- l epitope .

Figure 7 shows double en triple substitutions in the DQ2-Glia-al epitope (glia- α9) that were tested with 4 T cell clones L10: black s.quares; S3: red triangles bottom down; L6 green triangles bottom up; N10: bleu diamonds).

Figure 8 shows the amino acid sequence 31-H01 obtained from CGN0851 (a T.aestivum occasion), an a-gliadin of the D genome of wheat (SEQ ID NO: 36) containing the 33- mer of SEQ ID NO:l.The position of the epitopes is shown in the table below.

* The position of DQ8-Glia- l is variable and depends on the lengths of the Q repeats (Q110-Q120 and Q123-Q129) . Variation length of these Q-repeats exists among a-gliadin genes .

Figure 9A shows the recognition of alanine substituted peptides by the al specific T cell clone N12.

Figure 9B shows an overview of the recognition of alanine substituted peptides by the oil specific T cell clones .

Figure 10A shows the recognition of alanine substituted peptides by the 2 specific T cell clone S16.

Figure 10B shows an overview of the recognition of alanine substituted peptides by the a2 specific T cell clones .

Figure 11 shows the mean of the alanine scan peptides recognition by al and a2 specific T cell clones.

Figure 12 shows Y7A recognition by a3 specifc T cell clones.

" Figure 13 shows the effect of single amino acid substitutions of the position 7 leucine residue on the reactivity of al and cx2 specific T cell clones

Figure 14 shows the modified (CD-safe) gliadin gene sequence which is expressed in transformed potato tubers.

Figure 15 is the restriction map of the expression vector containing the modified gliadin sequence driven by the tuber-specific GBSS promoter, used for transformation of potato.

Figure 16 shows a spot blot of extracted protein from potatoes of two non-transgenic control lines (CI and C3) and of six independent transformed lines (T2, 3, 5, 9, 13, 24) . Three different amounts of protein extract were spotted on the filter (1, 2 and 4 microliter) . At the bottom of each filter different amounts of crude wheat gluten protein and Toronto gluten extract were spotted as positive control. The blots to the left were stained for total protein using emCode staining kit. The blots to the right were incubated with different antibodies (upper right blot with mAb glia-alpha-9; middle right blot with mAb glia- alpha-20; lower right blot with R5 antibody) .

Figure 17 shows translated amino acid sequence of a natural gliadin gene containing CD-iramunogenic epitopes used for expression in E.coli and tobacco.

Figure 18 shows expression of the gene depicted in Figure 17 in E.coli (panel A) and in leaves of transformed tobacco plants (panel B) . Spot blot of extracted proteins from transgenic plants was incubated with R5 antibody as described above. Darker spots show the presence of expressed CD-toxic gliadin. Two left hand upper spots are from non- transgenic control lines.

Table 1 shows α-gliadin transcripts of T. monococcum accessions. The transcripts are derived from developing seeds of T. monococcum accessions. The amino acid sequence in the DQ2-Glia-al/-a2/-a3 region (underlined) , as deduced from contigs with five or more a-gliadin

transcripts. The P8→S8 substitution specific for a-gliadins from the Gli-A2 locus is depicted in bold italic. N ota i = total amount of transcript clones analyzed.

Table 2 shows the amino acid sequences of canonical a-gliadin derived peptides with T cell stimulatory

properties and the "innate peptide" p31-43. A list is presented with 4 known glia-a known epitopes and the innate peptide. For each of the epitopes is specified the name, which immune response it evokes, the restriction element and the amino acid sequence.

Table 3 shows epitope variants expressed in bread wheat. Expressed variants of the epitopes DQ2-Glia-al, DQ2- Glia-2, DQ2-Glia-a3, DQ8-Glia-al and the innate responsive element p31-43, represented by ≥5 ESTs [≤2 differences for HLA-DQ epitopes and ≤3 differences for p31-43) and the number of ESTs per epitope variants per chromosomal locus {GH-A2, GH-B2 ox GH-D2) . In italic: DQ2-Glia-a3 variants located on the position of the innate responsive element, p31-43. NEST = total EST count per variant.

Table 4 shows T cell proliferation and binding capacity to HLA-DQ2 of DQ2-glia-a epitope variants. Variants of the DQ2-Glia- l and DQ2-Glia-a2 epitopes found in the a- gliadin transcriptome were synthesized as deamidated 15- or 16-mers (column 1: Peptides) and " tested for binding to HLA- DQ2 in a cell free in vitro peptide binding assay and stimulation of DQ2-Glia-al and DQ2-Glia-a2 specific T cell clones in a proliferation assay. IC 50 DQ2-Glia-al: mean value of the results of binding assays of the DQ2-Glia- l epitope variants. Glia-αΐ T cell: response of the DQ2-Glia-al specific T cell clone after stimulation with the peptides indicated. IC50 DQ2-Glia- 2: mean value of the results of binding assays of the DQ2~Glia-a2 epitope variants. Glia-a2 T cell: response of the DQ2-Glia-a2 specific T cell clone after stimulation with the peptides indicated. A high IC 50 value is correlated with a low binding capacity of the peptide to HLA-DQ2. In bold: DQ2-Glia-al epitope region.

Underlined: DQ2-Glia-a2 epitope region. * data for peptide QLQPFPQPELSYPQPH; **data for QLQPFPQPELSYPHPQ; + = 100 times reduced T cell stimulation compared to the Canonical' epitope; - = 1000 times reduced T cell stimulation compared to the ^canonical' epitope. EXAMPLES

EXAMPLE 1

MATERIAL AND METHODS

Analysis of a gliadin transcripts from diploid wheat varieties

T. monococcum accessions CGN10500, CGN12035 and CGN10555 used for cloning and sequencing of a-gliadin transcripts were obtained from Centre for Genetic Resources, the Netherlands. Plants were grown in pots under greenhouse conditions. Developing green kernels of single lines were harvested and used for RNA isolation followed by cDNA synthesis. RNA was isolated according to the method

described by Doyle and Doyle (Phytochem Bull 19: 11- 15(1987)) but with 1% (w/v) poly- (vinylpyrrolidone) -10 in the extraction buffer. For the production of first strand cDNA 1 μg of total RNA was treated with DNAse I (Invitrogen, Amplification grade; 18068-015) followed by RT PCR

(Invitrogen Superscript™ III First-Strand Synthesis System for RT -PCR; 18080-051) using random hexamer primers in a final reaction volume of 20 μΐ. Samples without Superscript™ III reverse transcriptase (minus RT PCR) were included as controls for the DNAse I treatment.

Primers specific for α-gliadin genes, located on the conserved sequences at the 5' and 3' end of the coding region of the a-gliadin, were used to amplify a-gliadin transcripts from the cDNA samples (aFl: 5'-atg aaR aCm ttt cYc ate and a5R: 5'-gtt agt acc gaN gat gec) . The PCR amplification utilized 5 min at 94 °C followed by 30 cycles consisting of 94 °C for 1 min, 49°C for 1 min and 72 °C for 2 min with a final extension at 72 °C for 10 min. Amplification was performed in a 25 μΐ reaction volume, containing 0.2 μΜ reverse and 0.2 μΜ forward primer, dNTP mix (0.25 mM each), 1 x Pfu buffer (Stratagene) , 20 ng chromosomal DNA and a mixture of (1/4 v/v) Pfu DNA polymerase (Stratagene) (2.5 ϋ/μΐ) and Goldstar DNA polymerase (Eurogentec) (5 U/μΙ) .

The PCR products were ligated into the pGEM-T Easy Vector Systems (Rromega) and subsequently used for the transformation of E. coli-XLl-blue cells (Stratagene) .

Recombinants were identified using blue-white color

selection. Positive colonies were picked and grown overnight at 37 °C in freeze media (36mM K 2 HP0 4/ 13.2 mM KH2P04, 1.7 mM trisodium citrate, 0.4 mM MgS0 4 , 6.8 mM (NH 4 ) 2 S0 4 , 4.4 % v/v glycerol, 100 μg/ml ampiciline, 10 g/l tryptone, 5 g/1 yeast extract and 5 g/l NaCl) .

The cloned insert was amplified directly from the culture in a PCR reaction using the M13 forward primer (5 1 - CGC CAG GGT TTT CCC AGT CAC GAC-3') and the Ml3 reverse primer (5'-AGC GGA TAA CAA TTT CAC ACA GGA-3 ' ) in 20 μΐ reaction volume containing 2 μΐ of culture. The reaction mixture consisted of the same components as well as

concentrations, and utilized the same PCR program as

described before. The amplified product was used in a sequencing reactions using respectively M13 forward and reverse primers .

Characterization of expressed a gliadin sequences

Over 3200 Triticum aestivum expressed sequence tags (ESTs) and mRNAs designated as οί-gliadin or α/β gliadin were downloaded from the NCBI UniGene library (Ta.15268,

Ta.23792, Ta.24084, Ta.25210, Ta.27702, Ta.28482)

(http://www.ncbi.nml.nih.gov/UniGene) on 13 April 2007. The UniGene' s were composed of mRNAs and EST sequences derived from T. aestivum libraries of various tissues, treatments and cultivars (Chinese Spring 34.2%; Glenlea 20.8%; Cheyenne 10.4%; Recital 7.8%; Mercia 7.2%; unknown cultivar 8.9%; Wyuna 3.2%; HiLine 2.9%; Butte 86, 2.4%; Hartog 1.5%; Soleil 0.6%; Nostar 0.1%; Novobirskaya 67, 0.1%).

The DNA sequences were aligned using the Seq an™ II Software (DNAS.TAR) and first assembled at a minimum match percentage of 60% to reduce complexity. To bridge the large gaps associated with aligning the large glutamine (Q) repeats which vary considerably in length, the maximum added gap lengths in sequences and contigs were set at a maximum of 3200 and a maximum match size of 50 bp was used, the latter to prevent that contigs containing ESTs derived from respectively the 5-prime and 3-prime ends of a gliadins falsely match together.

BLAST analysis of the contigs was performed to verify the gliadin identity of the contigs and short

(<100bp) and bad sequences were discarded. This yielded a set of 3022 sequences arranged in transcript contigs of 60% or more homologous sequences, which were subsequently trimmed up to the start and stop codons.

Next, the sequences were reassembled at 90%

homology resulting in 55 a~gliadin transcript contigs containing 1 to 475 sequences. Not all contigs covered the complete gene; the 3' end was covered by 50 contigs (2911 transcripts) whereas the 5' end was present in 30 contigs (2753 transcripts) . The consensus sequence of these contigs were saved in separate files and used for phylogenetic studies to deduce the genome of origin of the sequences in each contig.

Phylogenic analysis

With the aim to deduce the locus of origin, Gli-A2,

GH-B2 or 6DS Gli-D2 where the transcripts are expressed from, the 55 a-gliadin EST consensus nucleotide sequences obtained from clustering, were aligned using Clustal W, MEGA version 4 (Tamura K et al. (2007), supra) , together with 56 genomic DNA sequences of known origin, including sequences derived from the diploid wheat species T. monococcum (A- genome) , T. speltoides (S-genome) and T. tauschii (D-genome) {Molberg 0 et al., Gastroenterology 128:393-401(2005)) and DNA sequences that were previously assigned to a chromosome (Kawaura, K et al., Plant Physiology 139:1870-1880 (2005)).

The sequences that covered the 5' region of the - gliadin sequences were trimmed up to the start and up to nucleotides coding for the conserved amino acid motif PIS, located just in front of the first Q repeat, to cover the same region and subsequently used to generate a Neighbor- Joining tree (bootstrap test of 1000 replicates, pairwise deletion of gaps and missing data, Kimura 2-parameter,

Substitutions to Include Transitions + Transversions;

Pattern among Lineages Homogeneous, Uniform rates among sites, number of sites= 750, in MEGA 4) .

Sequence variation in epitope regions

The 5 r region of the 0£-gliadins harbors the DQ2-

Glia- ΐ, DQ2-Glia-a2, and DQ2-Glia-Ci3 epitopes and the peptide involved in the innate immune response (p31-p43) whereas the 3 r region harbors the DQ8-Glia-al epitope (Table 2) . To analyze all sequence variation, the 55 a-gliadin EST contigs, now assigned to a specific chromosome, were

reassembled one by one at a minimum match percentage of 99% to 100%; SeqManTM II Software (DNASTAR) . This yielded 717 different allelic variants.

The obtained contigs were truncated to be "in frame" -gliadins, and subsequently the consensus nucleotide sequences of all 717 contigs were exported as a single fasta file, which was translated by MEGA 4 into amino acids. These amino acid sequences were explored for epitopes and surrounding sequence regions using a text explorer program (PatternResearch, in house developed) after which the output file was analysed in Excel.

In addition, the 5-prime region (101-115 AA) of the deduced amino acid sequences of a-gliadin EST consensus nucleotide sequences (those represented by > 5 ESTs) was aligned ( egAlign) to detect sequence variation and to reconstruct the genomic organization in the N-terminus of oc- gliadins expressed from the respective chromosomes.

T cell clones and T cell lines

Gluten specific T cell lines and clones were generated from small intestinal biopsies of celiac disease patients as described before (van de Wal Y et al., Proc.

Natl. Acad. Sci . USA 95: 10050-10054(1998), Vader W et al., Gastroenterology 122:1729-1737 (2002)). All patients signed an informed consent form which was approved by the hospital ethics committee. T cell proliferation assay

Proliferation assays were performed in triplicate in 150 μΐ Iscove's Modified Dulbecco's Medium (Bio

Whittaker, Verviers, Belgium) with 10% pooled normal human serum in 96 well flat-bottom plates using 2xl0 4 gluten specific T cells stimulated with 10 5 irradiated HLA-DQ2- matched allogeneic peripheral blood mononuclear cells (3000 rad) in the presence or absence of antigen (1-10 μg/ml) (van de Wal Y et al., Proc. Natl. Acad. Sci. USA 95: 10050-10054 (1998), Vader W et al., Gastroenterology 122:1729-1737

(2002)).

After 2 days 3H-thymidine (0.5 ]iCi/well) was added to the cultures, and 18-20 hours thereafter the cells were harvested. 3H-thymidine incorporation in the T cell DNA was determined with a liquid scintillation counter (1205

Betaplate Liquid Scintillation Counter, LKB Instruments, Gaithersburg, D) . Binding assays to HLA-DQ2

A binding assay was performed as described previously (Stepniak, D et al., J. Immunol. 180, 3268-3278 (2008)). Briefly, 96-well FluoroNunc™ plates were incubated with 10 g/ml SPV-L3 in 0.1 M sodium carbonate/bicarbonate buffer pH 9.6 for 2 h at 37°C. Plates were washed with

PBS/0.05% Tween, residual binding sites blocked with 1% BSA in PBS and the plates incubated subsequently overnight with lysates from HLA-DR3/DQ2 positive EBV-transformed B-cells. Different concentration ranges of the peptides to be tested and a fixed amount of biotin-labeled indicator peptide was prepared in binding buffer (5% DMSO, 0.05% NP-40, 0.05% Tween, 16.8 mM citric acid, 36 mM Na 2 HP0 4 , pH 5.5 and

Complete™ protease inhibitor mix) .

The mixture was incubated on the plates for 48 hours at 37 °C. Next, the plates were washed and incubated for 45 min with streptavidine conjugated europium in assay buffer (Wallac) . After extensive washing, enhancement solution (Wallac) was applied and the plates were read in a time resolved fluorimeter (1234, Wallac) 15-30 minutes thereafter. IC50 values were calculated based on the observed competition between the test peptides and biotin-labeled indicator peptides and indicate the concentration of the tested peptide required for half maximal inhibition of the

ί

binding of the indicator peptide. RESULTS

Genome of origin of a-gliadin (Gli-2) transcripts

The -gliadins are encoded by the complex Gli-2 loci Gli-A2, Gli-B2 and GH-D2 on the short arms of three respective homologous chromosomes 6AS, 6BS and 6DS of hexaploid bread wheat {Triticum aestivum L.). The a-gliadins harbor several peptides that are immunodominant in CD (Table 2) . To analyze the complexity and immunogenic potential of the α-gliadin transcriptome, 3022 expressed a-gliadin sequences (ESTs and mRNA sequences from NCBI and Unigene) originating from 11 different T. aestivum L. cultivars were grouped into 55 clusters that contain genes with at least 90% homology. The DNA consensus sequences of these 55 clusters were used to deduce the locus, G11-A2, Gli-B2 and Gli-D2, from where they originated by clustering with sequences of known origin into distinct groups (clades) of 'sequences (Figure 1) . Forty per cent of the a-gliadins originated from the 6AS chromosome, almost as many (35%) from the 6DS chromosome, whereas considerably less a- gliadins (25%) came from the 6BS chromosome.

After tracing all non-synonymous DNA polymorphisms in the 3022 expressed sequences, 116 transcript contigs were obtained that contained more than three sequence

equivalents. Of these contigs 83 covered the 3-prime region of the gene. This high sequence diversity among expressed of- gliadin sequences reflects the high number of transcribed alleles at the a-gliadin loci.

Variants of T cell stimulatory and innate stimulatory sequences

The N-terminal region of α-gliadins contains the p31-43 epitope implicated in the innate immune response, and the immunodominant DQ2-Glia-al, DQ2-Glia-a2, and DQ2-Glia-a3 T cell epitopes. In addition, the carboxyl-terminal part of the protein encodes the immunodominant DQ8~Glia-al T cell epitope (Table 2) . To obtain information on the immunogenic potential of the various cf-gliadins proteins the amino acid sequences as deduced from contigs of -gliadin transcripts, sorted according to chromosomal location, were checked for the presence of the known canonical T cell epitopes and variants thereof. Table 3 presents the most frequently expressed epitope variants (>5 transcripts).

It was observed that the canonical DQ2-Glia-al and

DQ2-Glia-a3 epitopes were only found in Gli-A2 and Gli-D2 transcripts and that the canonical DQ2-Glia-a2 motif was unique for Gli-D2 transcripts (72% of all Gli-D2

transcripts) . DQ8-Glia-al canonical epitopes were found in Gli-D2 and Gli-B2 transcripts whereas in all Gli-A2

transcripts sequence variants of this epitope were found ' ( ' GGSFRP(S/F)QQN) .

The canonical p31-43 motif was not restricted to transcripts from a specific locus and was found in

transcripts from all a-gliadin loci.

In addition to the canonical epitope motifs, sequence variants of all epitopes with one or two amino acid substitutions were present (Table 3) . For instance, the large majority of the Gli-B2 gliadins contained sequence variants of the DQ2-Glia-al, DQ2-Glia-a2, and DQ2-Glia- 3 epitopes with two amino acid substitutions such as the DQ2- Glia-a2 variants FPPQLPYPQ, FLPQLPYPQ and PQPQPQYPQ

(respectively 91.2%, 7.4% and 1.4% of all Gli-B2 sequences; amino acid substitutions in bold) .

Also, in α-gliadin sequences derived from Gli-B2 clearly more sequence variation was present in the p31-43 epitope: 84.5% of the variants contain amino acid changes. Furthermore, in all GH-A2 transcripts the DQ2-Glia-a2 epitope variants, (P/L/S) QPQL (P/S) YSQ, are found.

Importantly, the results also indicate that only a subset of the a-gliadin genes analyzed encode the 33-mer peptide that has been described as a major epitope in CD. This peptide is highly resistant to degradation in the gastrointestinal tract and contains 6 overlapping DQ2-Glia- otl and DQ2-Glia-a2 epitopes which confer superior T cell stimulatory properties. This 33-mer sequence was only observed in a subset of the a-gliadins assigned to the Gli- D2 locus and never in the a-gliadins from the Gli-A2 and Gli-B2 loci. These latter loci encoded substantially

truncated versions of the 33-mer

(LQLQPFPQPQLPYPQPQLPYPQPQLPYPQPQPF) that contain between zero and four overlapping DQ2-Glia-al and DQ2-Glia-a2 epitopes (Figure 2) .

T cell stimulatory capacity of α-gliadin derived peptides

Several of the amino acid variants that were now detected in the α-gliadin transcriptome have never been described before while some have been described but were never tested for their T cell stimulatory capacity.

Therefore, in order to determine which variants are capable of inducing T cell responses, variants of the DQ2- Glia-αΐ, DQ2-Glia-a2, DQ2-Glia-a3, and DQ8-Glia-al epitopes were synthesized as 15- or 16-mer peptides and tested for their capacity to bind to HLA-DQ2 and induce in-vitro proliferation of HLA DQ2- or DQ8-restricted T cell clones.

DQ2-Glia-al variants: all peptides that carry the 9-mer epitope core sequence Ρχ { (in which the E is introduced by deamidation of the original Q at the Pe position) stimulated DQ2-Glia-al T cells, irrespective of amino acid changes flanking the core sequence (Figure 3, Table 4) . Several amino acid substitutions in the core sequence were found to diminish or abolish T cell

stimulatory capacity, such as a Q to H substitution at position p4, a P .to Ξ substitution at either p3 or p8 , and a P to A substitution at p5. No T cell stimulatory activity was observed for peptides in which an amino acid was deleted at p3 or p4 and the PFPQPELPY sequence was replaced by

PF (P/L/Q) -PELPY (Figure 3, Table 4). Strikingly, such peptides, that lack T cell stimulatory capacity, are all derived from locus G11-B2.

DQ2-Glia-a2 variants: T cell responses were only observed against peptides that carry the core

PiQ2P3E 4 L 5 6Y7PsQ9 or F1Q2P3E4L5P6Y P8Q9 (Table 4) . Various amino acid substitution were found to completely destroy T cell stimulatory capacity such as the replacement of the N- terminal sequence of the epitope core, P1Q2P3, with

F1P/L2P3, or P1H2P3, and the single substitution of the P for a S at either p6 or p8 . The latter is a substitution that is found in gliadins from locus Gli-A2.

DQ2-Glia-a3 variants: also for this epitope several amino acid substitutions were found to destroy T cell stimulatory properties of the identified peptide variants, including an R to P substitution at p2, which is found in ot- gliadins from Gli-B2 (not shown) .

DQ8-Glia-ofl variants: while several amino acid substitutions were found to influence T cell recognition of the canonical sequence QiG2S3F 4 Q 5 P6S 7 Q8Q9, a single Q to R substitution at p5 and a single S to F substitution at p3 were found to completely destroy T cell stimulatory

properties (not shown) . While the T cell stimulatory

variants were derived from the Gli-D2 and Gli-B2

chromosomes, the Q to R variants are derived from Gli-A2

(Figure 2, Table 3) . Thus, naturally occurring amino acid substitution have been identified in all four epitope containing regions of oi-gliadins that eliminate T cell stimulatory properties. The genes encoding variant peptides in which single amino acid substitution or deletions are present that affect T cell stimulatory properties are almost exclusively expressed from Gli-A2 and Gli-B2 loci present on the 6ΑΞ and 6BS chromosomes . T cell stimulatory capacity of diploid wheat accessions

Diploid wheat species " carrying respectively the A, D or S genome, express gliadins from close relatives of the ancestral genomes of hexaploid bread wheat. Hence, a set of accessions from diploid species can be used as a proxy for the differential composition of gliadins from the

homeologous loci in bread wheat.

The reactivity of -gliadin specific mAb and T cells was tested against a panel of diploid wheat accessions expressing either the A-, Ξ- or D-genome. The S-genome is closely related to the ancestor of the B-genome present in the hexaploid bread wheat genome. Pepsin-trypsin digests of 29 diploid accessions were prepared and tested in a

competition ELISA with mAb specific for a sequence partially overlapping with the DQ2-glia-al and DQ2-glia-a2 epitopes (Figure 4A) and, after treatment with TG2, with T cell clones specific for either the DQ2-glia- l and DQ2-glia-a2 epitope (Figure 4B and C) .

The results indicate that the mAb reacts strongly with all extracts except three derived from diploids

expressing the S-genome (Figure 4A) . Similarly, all extracts were capable of stimulating the DQ2-glia-al specific T cell clone (Figure 4B) while the extracts of the diploids

expressing the A genome and the extracts of most of the diploids expressing the S-genome failed to stimulate the DQ2-glia-a2 specific T cell clone (Figure 4C) .

Based on the present observation that the cf- gliadins expressed from locus Gli-A2 of the T. aestivum A- genome carry a variant DQ2-glia-a2 epitope in which the proline at position 8 has been replaced by a serine (Figure 2) , and experimental results described herein that

introducing this substitution in a peptide leads to loss of DQ2-glia-a2 T cell stimulatory properties (Figure 3, Table 4) , it was determined if this amino acid substitution was indeed the cause of loss of immuhogenicity.

For this purpose the a-gliadin locus of diploid wheat (T. monococcum) accessions CGN10500, CGN10555 and CGN12035 was sequenced. In agreement with the results from hexaploid wheat transcripts shown in Figure 2 it was

observed that these oi-gliadin genes transcripts from T.

monococcum contain only a single form copy of the DQ2-glia- oil and DQ2-glia-a2 epitopes (Table 1) . Moreover, in the DQ2- glia-a2 epitopes the proline at position 8 was consistently replaced by a serine (results not shown) . Together these results establish that this naturally occurring single amino acid substitution is sufficient to completely eliminate the T cell stimulatory properties of the DQ2-glia- 2 epitope in gluten.

In addition, differential reactivity of DQ2-glia-a3 specific mAb and T cells towards the extracts of the

diploids was observed which correlated with an arginine to proline replacement at position 2 in a-gliadins derived from the S-genome, FRPQQPYPQ→ FPPQQPYPQ (results not shown) . Elimination of cx-gliadin toxicity by a naturally occurring single amino acid substitution

The large majority of known antigenic peptides derived from gluten, as well as homologous peptides derived from the hordeins from barley and the secalins from rye, contain a proline at position 8. Based on the present observation that the a-gliadins from A genome diploid wheat species and from locus Gli-A2 of hexaploid bread wheat lacked the antigenic DQ2-glia-a2 epitope as a result of a single proline to serine substitution at position 8, and the observation that a similar substitution in the DQ2-glia-al epitope induced T cell unresponsiveness (Figure 3, Table 4), it was investigated if a similar substitution would also eliminate the antigenic properties of the DQ2-glia-a3 epitope. Wild type versions of the DQ2-glia-al, -0i2 and -α3 epitopes as well as versions in which the proline was substituted by a serine were synthesized and tested in T cell proliferation studies. As expected neither the

substituted DQ2-glia-al nor DQ2~glia- 2 epitope induced T cell proliferation (not shown) .

Likewise, the substituted DQ2-glia-ct3 epitope failed to induce T cell activation (Figure 5A) . Previously a 33-mer cx-gliadin derived peptide has been identified that encodes 6 partially overlapping antigenic DQ2-glia-al and - a2 sequences and which has been shown to possess superior T cell stimulatory activity. Therefore the effects of the proline to serine substitutions of the invention were also analysed in the 33-mer peptide as well as in an elongated version of the 33-mer which also encodes the DQ2-glia- 3 epitope. In all cases, the proline to serine substitutions completely abrogated the response of DQ2-glia-al, DQ2-Glia- a2 epitope and DQ2-glia-a3 specific T cell clones (Figure 5B) . Thus, it was established that the proline to serine substitution of the invention is a universal approach to remove the antigenic properties of HLA-DQ2 restricted a- gliadin peptides . EXAMPLE 2

Fine specificity of T cell clones specific for

immunodominant a-gliadin peptides

Many a~gliadin genes encode proteins that contain several immunogenic peptides in their N-terminal region. Of those, the DQ2-Glia-al (Glia-al, sequence PFPQPELPY) and DQ2-Glia- 2 (Glia-a2, sequence PQPELPYPQ) peptides are considered immunodominant as prominent T cell responses to these peptides and homologous sequences in the ω-gliadins and hordeins of barley are usually found in adult Celiac Disease (CD) patients. In order to gain insight into the molecular basis for the .immunodominance of these peptides it was investigated which residues in the peptides are most critical for T cell recognition. For this purpose 11 T-cell clones isolated from intestinal biopsies of 6 CD patients specific for Glia-al and 6 T-cell clones isolated from 4 patients specific for Glia-a2 were analyzed. To verify that these T-cells are independent cDNA' s encoding their T cell receptor a- and β-chains were sequenced. This demonstrated that each T cell clone expressed unique T cell receptor - and β-chains with distinct CDR3 regions (not shown) .

First the proliferative response was tested of the T cell clones to substitution analogs of their cognate antigen in which all amino acids were systematically

replaced by alanine. In all cases the effect of alanine substitutions was tested both in the nine amino acid core as well as in two flanking amino acids at the N- and C-terminus of the peptide. For the Glia-al specific T cell clone N12 (Figure 9A) it was observed that the alanine substitutions at position 3, 7 and 8 dramatically affected T cell

recognition whereas substitutions at the remaining positions had less (positions 5, 9, 10) or no (positions -2, -1, 1, 2, 4, 6, 11) effect- An overview of the results obtained with all Glia- l specific T cell clones is shown in Figure 9B. These results indicate that the effect of the alanine

substitutions is T cell clone dependent. The impact of alanine substitutions at position 1 and 2, for example, varies between enhanced T cell responses to almost complete abrogation of the T cell response. Similarly large variation is observed with substitutions at positions 4, 5, 6 and 8 in the nine amino acid core of the peptide.

It is particularly striking that the replacement of the glutamic acid at position 6 with an alanine is tolerated by the majority of T cell clones as the conversion of the glutamine at this position in native gluten sequences into the negatively charged glutemic acid is thought to be crucial for T cell recognition.

Also, it was observed that alanine substitutions outside the nine amino acid core can have a dramatic impact on the T cell recognition of the peptide by individual T cell clones (Figure 9B) . Despite the differences between the T cell clones it was observed that the substitution of the leucine at position 7 by an alanine abolished antigen

recognition by all T cell clones (Figure 9B) ,

Next, the impact of alanine substitutions on the reactivity of the 6 Glia-a2 specific T cell clones (Figure t

10) was analyzed. For the Glia- 2 specific T cell clone S16 it was found that alanine substitutions at position 3

through 8 largely abolished T cell reactivity while no or little effect was observed at other positions (Figure 10A) . The overview of the results obtained with all 6 T cell clones (Figure 10B) demonstrates that, like the Glia-al specific T cell clones, the effect of alanine substitutions is T cell clone dependent and varies greatly. Moreover, it was observed that the substitution at positions 5 and 7 both abrogated the response of all T cell clones, again pointing to a critical role of the amino acid at position 7.

Although the impact of the alanine substitutions is T cell clone dependent, the overall impact is remarkably similar for the Glia-oil and Glia- 2 specific T cell clones (Figure 11) with similar effects both inside and outside the nine amino acid core of the peptide. As this indicates that the peptides may adopt an overall similar conformation in HLA-DQ2 and the Glia-al and Glia-a2 peptides are largely overlapping peptides it was determined if the uniform effect of the alanine substitution at position 7 is unique for these immunodominant peptides or can be found with unrelated if " cells as well. For this purpose 2 T cell clones specific for the non-immunodominant DQ2-Glia-a3 (Glia-a3) peptide (sequence FRPEQPYPQ) were tested. Again, an alanine

substitution at position 7 abrogated the T cell response to the Glia-a3 peptide (Figure 12) .

Together these results indicate that the nature of the amino acid at position 7 is critical for T cell

recognition of a-gliadin derived peptides.

Promiscuous versus restricted acceptance of amino acids at position 7

To gain further insight into the role of the amino acid at position 7 in T cell recognition of the Glia-al and Glia-a2 peptides the impact of the replacement of this amino acid with all other naturally occurring amino acids (except cysteine) was tested. It was observed that some Glia-al specific T cell clones did not or hardly tolerate any replacement of the leucine at position 7 while others are less specific (Not shown and Figure 13) . In particular it was found that that the replacement with R, K, H, P, G, D, and W completely eliminated recognition of the peptide by all Glia-αΐ specific T cell clones while several

conservative substitutions, like M, I, F, Y, Q and V, were accepted by some of the T cell clones. In contrast, the Glia-a2 specific T cell clones were more restricted and with few exceptions, none of the amino acid substitutions were tolerated at position 7 (Not shown and Figure 13) .

EXAMPLE 3

Expression of safe gliadins in plants

1. Construction of binary vector pModGlia-GBSS

The modified ot-gliadin, including modifications for potato codon usage (Figure 14) , was synthesized (GENEART, Germany) with addition of attB cloning sites to allow cloning into a Gateway vector system, using Gateway® technology (Invitrogen®) . The resulting plasmid was used in a

recombination reaction (Gateway ® ) into pDonR207 using

Gateway® BP Clonase® enzyme mix (Invitrogen) .

The resulting entry vector was used for

transformation of E.coli Dh5 (T. Maniatis, E.P. Fritsch and J. Sambrook, Editors, (second edition ed.) , Molecular

Cloning: A Laboratory Manual, Cold Spring Harbor

Laboratories, Cold Spring Harbor, New York (1982) .

The resulting plasmid was again used in a recombination reaction with binary vector plasmid pHy G2.0- GBSS containing the granule-bound starch synthase (GBSS) promoter and the CaMV 35S terminator and including the hygromycin selection marker (Figure 15) . The binary plasmid was transferred to Agrobacterium tumefaciens strain AglO. 2. Transformation of potato and tobacco, and selection of transformants

Explants of potato cv. Kardal were grown under controlled conditions of 21°C under 16 of light on MS medium (Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobacco cultures.

Physiol. Plant 15:473-497), supplemented with 30 g/L sucrose (MS30) . One day before potato transformation, internodal stem segments of about 5 mm long were cut from 4-6 weeks old in vitro grown potato plants. The stem segments were

collected in liquid PACM medium and transferred onto filter paper that was soaked in 2 ml of liquid PACM and put on solid PACM medium. The plates were closed with parafilm and incubated overnight at 21°C under long day conditions (16 hours light) .

For the plant -transformation, freshly grown

Agrobacterium tumefaciens cultures that were grown for 16h at 28 °C were pelleted using centrifugation at 3500 rpm for 5 minutes. The pellet was resuspended in liquid PACM (10 times more than the culture volume) . The explants were transferred from the plate into the AgrOjbacteriuin suspension containing the gene construct of interest. The explants were incubated in the Agrobacterium suspension (slowly shaking) during 10 min. Then the explants were dried on filter paper and put back on the plates. For the co-cultivation the plates were closed with parafilm and incubated at 21°C under long day conditions (16 hours light) for two days.

After two days the explants were transferred to ZCVH selection medium. Plates were taped with parafilm and incubated at 21°C under 16 h of light. The formed shoots were collected and put on solid MS30 in order to root. Control lines were made by using an empty vector Agrobacterium AGL0 strain for inoculation of potato explants. These explants were not subjected to hygromycin selection during regeneration.

The following media were used in the potato transformation protocol: PACM, containing per liter 4,4 g MS medium {Murashige and Skoog, Duchefa), 30g sucrose, 1 mg

2,4D, 0,5 mg kinetin and 8 g micro agar, pH 5,8 with KOH.

ZCV, containing per liter 4,4 g MS, 20 g sucrose and 8 g micro agar, pH 5,8 with KOH, with 1 mg zeatine, 200 mg cefotaxim, 50 mg vancomycin, (15 mg hygromycin). MS30 (4,4 g MS, 30 g sucrose, pH 5.8, 8 g micro agar per liter).

Antibiotic stocks were prepared as follows: 50 mg 2, D

(or 50 mg kinetin, or 50 mg zeatin) was dissolved in 1 ml

KOH (IN), heated and filled up to 50 ml with milliQ.

Cefotaxim 200 mg/ml in milliQ, filter sterilized. Vancomycin 100 mg/ml in milliQ, filter sterilized. Kanamycin 100 mg/ml in milliQ, filter sterilized. Rifampicin 100 mg/ml in methanol. Hygromycin 50 mg/ml in milliQ, filter sterilized.

Rooted hygromycin resistant transgenic plants were transferred to the greenhouse and grown under normal

greenhouse conditions (16 h light, 21°C; 8 h dark, 18°C) .

The same transformation method was used for introduction of a toxic (non-modified) gliadin sequence into (Nicotiana tabacc m) (Figures 17 and 18) . 3. PCR analysis

DNA was extracted from 0.5-0.7 cm leave tissue using an Extract-N-Amp™ Plant PCR kit from Sigma. The presence of the a-gliadin was tested by PCR using specific primers according to described protocol at 58°C for 35 cycles.

Forward primer: 5' CTCAGCCTCAGCCTCAATACTC3'

Reversed primer: 5' CAAGAAAAGCTGGGTGTCAAT3' Successful transformation resulted in a fragment of 600 bp. Positive (plasmid) and negative (water) controls were included. Out of 30 putative transformants, 22

individual plants, turned out to be transgenic and showed the 600 bp fragment. The control plants and the water control did not show a 600 bp PCR fragment.

4. Potato tuber analysis

Tubers from mature transgenic and control potato plants were analyzed for the presence of a-gliadin protein. Tubers were harvested and ground in liquid nitrogen and lyophilized. One gram of lyqphilized material was extracted with 10 ml 60% ethanol for one hour at room temperature. The supernatants collected after centrifugation for 10 min. at 10,000 rpm were precipitated with 4 volumes of acetone, overnight at -20°C. The pellets obtained after centrifugation for 10 min. at 10,000 rpm were resuspended in buffer

containing 2% SDS, 100 itiM DTT, 62.5 mM Tris-HCl pH 6.8 and 10% glycerol. One, two and four μΐ was spotted on

nitrocellulose membranes, together with 250 ng and ^g of Toronto gluten protein and 0.1, 0.25, 0.5, 1 and 2 μg of crude gliadin protein from wheat ( Sigma-Aldrich) . Membranes were stained for protein by using MemCode™ Reversible

Protein Stain Kit for Nitrocellulose Membrane (Thermo

Scientific) and incubated with antibodies recognizing Glia- ot9, Glia-a20 and R5. (Spaenij-Dekking EHA et al., A novel and sensitive method for the detection of T cell stimulatory epitopes of α/β- and γ-gliadin. Gut 53 ' : 1267-1273 (2004);

Mitea C et al. r Fine specificity of monoclonal antibodies against celiac disease-inducing peptides in the gluteome. Am J Clin Nutr 88:1057-1066 (2008)) and R5 (Sorell et al., An innovative sandwich ELISA system based on an antibody cocktail for gluten analysis. FEBS Lett 439:46-50 (1998)). These monoclonal antibody recognition sites are altered in the modified gliadin protein and are no longer recognized by the antibodies. Images obtained are shown in Figure 16.

TABLES

Table 1

Table 2

Immune Restriction

Sequence

response element

DQ2-Glia-al Adaptive HLA-DQ2 P{F/Y}PQPQLPY

DQ2-Glia-a2 Adaptive HL -DQ2 PQPQLPYPQ

DQ2-Glia- «3 Adaptive HLA-DQ2 FRPQQPYPQ

DQ8-Glia-al Adaptive HLA-DQ8 QGSFQPSQQ

not

P31-43 Innate PGQQQPFPPQQPY applicable Table 3

Table 4

SEQUENCE LISTING INFORMA ION

SEQ ID NO corresponding product

1 a-gliadin derived 33-mer peptide having 6

partially overlapping T cell epitopes

2 p56-75 peptide

3 HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-a9)

4 HLA-DQ2+ T cell epitope DQ2-Glia-a2 (gli-a2)

5 HLA-DQ2+ T cell epitope DQ2-Glia-a3 (glia-a20)

6 HLA-DQ8+ T cell epitope DQ8-Glia-al

7 HLA-DQ2+ T cell epitope DQ2-Glia- l (glia- 9) with variations in position 2 and 6 HLA-DQ2+ T cell epitope DQ2-Glia- l (glia- 9) with variations in positions 1 and 4

HLA-DQ2+ T cell epitope DQ2~Glia-al (glia-a9) with F2, Q6- and S8

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-a9) with F2, E6 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-a9) with Y2, Q6 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia- 9) with Y2, E6 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-a9) with F2, S3, Q6 and S8 .

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-a9) with F2, S3, E6 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia- 9) with Y2, S3, Q6 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-a9) with Y2, S3, E6 and S8

HLA-DQ2+ T cell epitope DQ2-Glia- l (glia-a9) with F2, S3 and Q6

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-x9) with F2, S3 and E6

HLA-DQ2+ T cell epitope DQ2-Glia-al (glia-cx9) with Y2, S3 and Q6

HLA-DQ2+ T cell epitope DQ2-Glia- l (glia- 9) with Y2, S3 and E6

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia-a2) with PI, Q4 and S8 ,

HLA-DQ2+ T cell epitope DQ2-Glia- 2 (glia-a2) with PI, E4 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia-o.2) with Fl, Q4 and S8 HLA-DQ2+ T cell epitope DQ2-Glia-oc2 (glia-ot2) with Fl, E4 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia-a2) with PI, S3,· Q4 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia-a2) with PI, S3, E4 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia-a2) with Fl, S3, Q4 and S8

HLA-DQ2+ T cell epitope DQ2-Glia- 2 (glia- 2) with Fl, S3, E4 and S8

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia-a2) with PI, S3 and Q4

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia- 2) with PI, S3 and E4

HLA-DQ2+ T cell epitope DQ2-Glia-a2 (glia- 2) with Fl, S3 and Q4-

HLA-DQ2+ T cell epitope DQ2-Glia-0i2 (glia-a2) with Fl, S3 and E4

HLA-DQ2+ T cell epitope DQ2-Glia-a3 (glia-a20) with S8

HLA-DQ2+ T cell epitope DQ2-Glia- 3 (glia-a20) with S3 and Ξ8

HLA-DQ2+ T cell epitope DQ2-Glia-a3 (glia- 20) with S3

a-gliadin of the D genome