FIELD OF THE INVENTION

The present invention relates to the field of bioalcohol production by engineering native pathways to enhance production of bioalcohols in bacteria. More particularly the present invention provides modified bacteria which are able to ferment both hexose and pentose sugar, method of obtaining such modified bacteria and method fermenting lignocellulosic biomass having hexose and pentose sugar. BACKGROUND OF THE INVENTION

People are largely dependent upon fossil fuels for fulfilling our energy requirement. Bioalcohol, in particular ethanol is an attractive alternate transportation fuel to replace at least a part of petroleum. Fuels from renewable sources like agricultural and forest residues hold promise in reducing their dependence on fossil fuel without competing with food. The agricultural and forestry waste mostly consist of lignocellulose, which is made-up of highly structured cellulose surrounded by hemicellulose and lignin. In principle, it is possible to breakdown lignocellulose into the monosaccharides and ferment them into ethanol. However, cost associated with this process is a major hurdle in terms of commercial application. One of the key advancement in the economy of ethanol production from lignocellulosic biomass will be to efficiently ferment both hexose and pentose sugars released after hydrolysis of lignocellulose into ethanol.

Unfortunately, the conventional microorganisms used for ethanol fermentation, e.g., Saccharomyces cerevisiae and Zymomonas mobilis, do not have the capability to utilize pentose sugars. Attempts have been made to transfer genes for pentose degradation pathway from other organisms into S. cerevisiae and Z. mobilis. However, the disadvantages associated with foreign gene expression at large scale like instability, toxicity, containment, etc., prevent its wide usage. Escherichia coli, on the other hand, has the ability to ferment both hexose and pentose sugars and is being used to produce ethanol by various genetic manipulation The genetic manipulation of E. coli that does not involve introduction of foreign gene has been attempted with some successes and these technologies have advantages in the long- term genetic stability of the engineered strain.

Under anaerobic condition, E. coli produces ethanol through a pathway that involves pyruvate formate lyase (PFL), which converts pyruvate into acetyl CoA and formate (Figure 1). However, this pathway is not redox balanced because in the process of metabolizing one mole of glucose into ethanol, four moles of NADH are consumed while only two moles of NADH are produced. This redox imbalance would negatively impact the yield of ethanol. However, there is an alternate pathway exists where converting glucose into ethanol or butanol is a redox balance process. Here pyruvate in converted into acetyl CoA and C0 ₂ via pyruvate dehydrogenase complex (PDH) and in the process one molecule of NADH is produced. However, expression of PDH is repressed under anaerobic condition and remains active in the aerobically growing cells. To activate the expression of PDH under anaerobic condition, the promoter of PDH should be replaced with the one that is highly active under anaerobic condition. Attempts of replacing the PDH promoter with the PFL promoter have not been found to be very successful, as despite showing the enhanced expression of PDH under anaerobic condition and increased the yield of ethanol, the net ethanol productivity was low.

Thus, there js a need for a modified bacterial strain with genetic alterations that can ferment both hexose and pentose sugars in order to produce bioalcohol such as ethanol with high productivity. SUMMARY OF THE INVENTION

Accordingly, in general aspect the present invention provides engineering of native pathways in bacteria to enhance production of bioalcohols by fermentation of hexose and pentose sugar. In one of the aspect the present invention provides a modified bacterial strain capable of fermenting both hexose and pentose sugars for production of bioalcohol. In one embodiment the present invention provides a modified bacterial strain capable of fermenting both hexose and pentose sugars for production of bioethanol from lignocellulosic biomass. In one embodiment the present invention provides a modified bacterial strain wherein a promoter of one gene may be replaced with a promoter of another gene for expression under anaerobic conditions.

In one embodiment the present invention provides a modified E. coli strain wherein the E. coli is modified by replacing a promoter of one gene with a promoter of another gene for expression under anaerobic conditions.

In one embodiment the present invention provides a modified E. coli strain wherein the promoter of pyruvate dehydrogenase operon (PDH) is replaced with a promoter of a gene that is expressed under anaerobic conditions.

In one embodiment the present invention provides a modified E. coli strain wherein the promoter of pyruvate dehydrogenase operon (PDH) is replaced with a promoter of a gene selected from frdA, IdhA, pfIB, adhE and gapA.

In one embodiment the present invention provides a modified bacterial strain wherein the promoter of pyruvate dehydrogenase operon (PDH) is replaced with a gapA promoter. In one embodiment the present invention provides a modified E. coli strain wherein the genes responsible for competing products consisting of lactate, succinate, acetate and formate are deleted.

In one embodiment the present invention provides a modified bacterial strain wherein basal level expression of one or more genes of the competing product may be reintroduced. In one aspect the present invention provides a method of obtaining the modified bacterial strain capable of fermenting both hexose and pentose sugars for production of bioalcohol. In one embodiment the present invention provides a method of obtaining a modified Escherichia coli strain wherein the method comprises the steps of:

a. replacing the promoter of pyruvate dehydrogenase operon (PDH) with a promoter of a gene that is expressed at high level under anaerobic conditions;

b. introducing mutations by deleting genes responsible for competing products that is lactate, succinate, acetate and formate and

c. reintroducing basal level expression of gene encoding acetate kinase.

In one embodiment the present invention provides a method of obtaining the modified bacterial strain wherein the promoter of pyruvate dehydrogenase operon (PDH) is replaced with a promoter of a gene selected from frdA, IdhA, pfIB, adhE and gap A.

In one embodiment the present invention provides a method of obtaining the modified bacterial strain wherein the promoter of PDH is replaced with a promoter of a gapA gene.

In one embodiment the present invention provides a method of fermenting hexose and/or pentose sugars utilizing the modified E. coli strain for the production of bioalcohol.

In one embodiment the present inventions provides a method of fermenting lignocellulosic biomass comprising hexose and pentose sugars by using the modified bacterial strain.

In some embodiments of the invention, the method of fermenting hexose and pentose sugars comprised in lignocellulosic biomass by using the modified bacterial strain for the production of bioalcohol under aerobic, microaerobic and/or anaerobic conditions.

In one embodiment the present invention provides a method of fermenting lignocellulosic biomass with a modified Escherichia coli strain wherein the method comprises the steps of:

hydrolyzing the lignocellulosic biomass comprising hexose and pentose sugars;

- mixing the modified Escherichia coli strain with hydrolyzed lignocellulosic biomass comprising hexose and pentose sugars;

- allowing fermentation of the mixture to be carried out in microaerobic conditions.

BRIEF DESCRIPTION OF DRAWINGS

Figure 1 is a graph showing metabolic pathways of E. coli functional under anaerobic conditions during glucose and xylose fermentation.

Figure 2A is a graph showing the functional characterization of promoter engineered E. coli B strains (SSY01-05) and the effect of PDH operon promoter replacement on pyruvate dehydrogenase activity

Figure 2B is a graph showing the functional characterization of promoter engineered E. coli B strains (SSY01-05) and the effect of PDH operon promoter replacement on ethanol production

Figure 3 is a graph showing comparison of product yields of deletion mutants of SSY05.

Figure 4A is a graph showing improvement in cell growth upon basal level expression of ack gene in the engineered SSY09 strain. SSY09 strain was transformed with pZSack was grown in LB media + 2.5g/l glucose Figure 4B is a graph showing improvement in cell growth upon basal level expression of ack gene in the engineered SSY09 strain. SSY09 strain was transformed with pZSack was grown in LB media + 2.5g/l xylose Figure 5A is a graph showing the fermentation profile of E. coli B grown in the bioreactor in defined medium with glucose as carbon source.

Figure 5B is a graph showing the fermentation profile of E. coli B grown in the bioreactor in defined medium with xylose as carbon source.

Figure 6A is a graph showing fermentation profile of SSY10 (SSY09+pZSack) grown in the bioreactor in defined medium with glucose as carbon source. Strain description: SSY10 - Pgap _A PDH LldhA hfrdA Lack hpflB (pZSack). Figure 6B is a graph showing fermentation profile of SSY10 (SSY09+pZSack) grown in the bioreactor in defined medium with xylose as carbon source. Strain description: SSY10 - gapAPDH LldhA hfrdA Lack LpflB (pZSack).

Figure 7A is a graph showing the fermentation profile of E. coli B grown in the bioreactor in complex medium with glucose as carbon source.

Figure 7B is a graph showing the fermentation profile of E. coli B grown in the bioreactor in complex medium with xylose as carbon source. Figure 8A is a graph showing the fermentation profile of SSY10 (SSY09+pZSack) grown in the bioreactor in complex medium with glucose as carbon source. Strain description: SSY10 - P _g ap _A PDH MdhA hfrdA Lack LpflB (pZSack).

Figure- 8B is a graph showing the fermentation profile of SSY10 (SSY09+pZSack) grown in the bioreactor in complex medium with xylose as carbon source. Strain description: SSY10 - P _g a _pA PDH LldhA LfrdA Lack LpflB (pZSack). Figure 9A is a graph showing the fermentation profile of SSY10 (SSY09+pZSack) strain grown under microaerobic condition in the bioreactor in complex medium with xylose as carbon source. Strain description: SSY10- Ρ _83Ρ ΑΡΟΗ Δ/dhA frdA Lack LpflB (pZSack).

Figure 9B is a graph showing the fermentation profile of SSY10 (SSY09+pZSack) strain grown under microaerobic condition in the bioreactor in complex medium with mixture of glucose and xylose as carbon source. Strain description: SSY10- P _gapA PDH LldhA LfrdA Lack ApfIB (pZSack).

Figure 10 is a graph showing the validation of expression of PDH operon in promoter replaced SSY05 strain by quantitative real-time PCR.

Figure 11 is a graph showing the fermentation profile of SSY10 with ammonia treated hydrolysate at pH 7.0 in LB media with microaerobic conditions.

DETAILED DESCRIPTION OF THE INVENTION

Although the present invention has been explained in relation to its embodiments, it is to be understood that many other possible modifications and variations can be made without departing from the spirit and scope of the invention as hereinafter disclosed. Furthermore, the description is for the purpose of illustration only and it is to be understood that the terminology used is intended to be in the nature of description rather than of limitation and hence, the invention may be practiced otherwise than as specifically described.

The present invention is directed to engineering of the native pathways in bacteria to enhance production of bioalcohol.

The present invention provides a modified bacterial strain capable of fermenting both hexose and pentose sugars for production of bioalcohol. The present invention in additional aspect provides method of obtaining modified bacterial strain capable of fermenting both hexose and pentose sugar for production of bioalcohol. The ( _.

present invention further provides a method of fermenting lignocellulosic biomass having hexose and pentose sugar using the modified bacteria for production of bioalcohol. In one embodiment the present invention provides a modified bacterial strain capable of fermenting both hexose and pentose sugars for production of bioethanol from lignocellulosic biomass.

In some embodiments the present invention provides a modified bacterial strain wherein a promoter of one gene is replaced with a promoter of another gene for expression under anaerobic conditions. In some embodiments the invention provides the modified bacterial strain that does not involve the introduction of foreign genes. In one embodiment, the modified bacterial strain is Escherichia coli.

In one embodiment, the modified bacterial strain is Escherichia coli MTCC 5852.

In one embodiment, the bioalcohol that is produced by the modified E. coli strain is ethanol.

In some embodiments, the hexose sugar that the modified E. coli strain can ferment can be selected from glucose, galactose, allose, altrose, mannose, gulose, idose and talose. In one embodiment, the hexose sugar that the modified E. coli strain can ferment can be glucose and/or galactose. In one embodiment, the hexose sugar that the modified f. coli strain can ferment is glucose.

In some embodiments, the pentose sugar that the modified E. coli strain can ferment can be selected from xylose, arabinose, ribose, lyxose, ribulose and xylulose. In one embodiment, the pentose sugar that the modified E. coli strain can ferment can be xylose and/or arabinose. In one embodiment, the pentose sugar that the modified E. coli strain can ferment can be xylose. In some embodiments, the promoter of an operon in the modified E. coli strain is replaced with a promoter of a gene that can be expressed at high level under anaerobic conditions.

In one embodiment, the promoter of a gene that can be replaced in the modified E. coli strain may be pyruvate dehydrogenase operon (PDH).

In one embodiment of the invention, the promoter of pyruvate dehydrogenase operon (PDH) in the modified f. coli strain can be replaced with a promoter of a gene that can be expressed at high level under anaerobic conditions.

In some embodiments a promoter of a gene that can replace the promoter of native gene in the E. coli and that be expressed at high level under anaerobic conditions can be selected from at least one selected from but not limiting to frdA, IdhA, pflB, adhE and gapA.

In one embodiment, the promoter of an operon in the modified E. coli strain that replaces the promoter of native gene and such replaced promoter which can be expressed at high levels under anaerobic conditions is gapA.

In one embodiment of the invention, the promoter of pyruvate dehydrogenase operon (PDH) in the modified E. coli strain is replaced with the promoter of the gapA gene.

In some embodiments, the modified E. coli strain includes delete mutations in the gene of competing products.

In one embodiment the present invention the modified E. coli comprises deletion of genes responsible for competing products that is lactate, succinate, acetate and formate. In one embodiment, the modified E. coli comprises deletion of the gene of competing product lactate that is Lactate dehydrogenase (IdhA).

In some embodiments, the modified E. coli comprises deletion of the genes of competing product acetate that may be selected from Phosphotransacetylase (pta), Acetate kinase (ack).

In one embodiment, the modified E. coli comprises deletion of the gene of competing product acetate that is Acetate kinase (ack). The acetate Acetate kinase (ack) gene may be Acetate kinase A(ack A) or Acetate kinase B (ackB).

In one embodiment, the modified E. coli comprises deletion of the genes of competing product succinate that can be selected from Fumarate Reductase A (frdA), Fumarate Reductase B (frdB), Fumarate Reductase C (frdC), Fumarate Reductase D (frdD), Succinyl coA synthetase and Isocitrate lyase.

In one embodiment, the modified f. coli comprises deletion of the gene of competing product succinate that is Fumarate Reductase A (frdA). In one embodiment, the modified E. coli comprises deletion of the gene of competing product formate that can be selected from Pyruvate formate lyase A (pflA), Pyruvate formate lyase B (pfIB), Pyruvate formate lyase C (pflC) and Pyruvate formate lyase D (pflD). In one embodiment, the modified E. coli comprises deletion of the gene of competing product formate that is Pyruvate formate lyase B (pfIB).

In some embodiments in the modified E. coli the basal level expression of one or more genes of the competing product may be reintroduced.

In one embodiment in the modified E. coli strain the basal level expression of acetate kinase (ack) is reintroduced. In one embodiment of the present invention provides the modified E. coli strain comprising of the promoter of pyruvate dehydrogenase operon (PDH) replaced with a promoter of the gapA gene, delete mutations of genes responsible for competing products that is lactate, succinate, acetate and formate and reintroduction of basal level expression of acetate kinase.

In some embodiments the present invention provides a method of obtaining the modified bacterial strain that can ferment both hexose and pentose sugars for enhanced production of bioalcohol.

In one embodiment, the present invention provides a method of obtaining the modified E. coli strain wherein the modified E. coli strain is capable of fermenting hexose and pentose sugars comprised in lignocellulosic biomass for enhanced production of bioalcohol.

In some embodiments of the invention, the method for obtaining the modified f . coli strain comprises of replacing the promoter of an operon in the modified E. coli strain with a promoter of a gene that can be expressed at high level under anaerobic conditions.

In some embodiments, the method for obtaining the modified E. coli strain comprises replacing the promoter of an operon with a promoter of a gene that can be expressed at high level under anaerobic conditions. In one embodiment, the method for obtaining the modified E. coli strain comprises replacing of the promoter of pyruvate dehydrogenase operon (PDH).

In some embodiments, the method for obtaining the modified £ coli strain comprises replacing a promoter of PDH in the E. coli and with a promoter that can be expressed at high level under anaerobic conditions, wherein the promoter replacing the PDH promoter can be at least one selected from but not limiting to frdA, IdhA, pfIB, adhE and gapA. In one embodiment, the method for obtaining the modified E. coli strain comprises replacing the promoter of PDH with gapA promoter.

In some embodiments, the method for obtaining the modified E. coli strain comprises deleting genes responsible for competing products that is lactate, succinate, acetate and formate.

In one embodiment, the method for obtaining the modified E. coli strain comprises deletion of the gene of competing product lactate that is Lactate dehydrogenase (IdhA).

In some embodiments, the method for obtaining the modified E. coli strain comprises deletion of gene of competing product acetate that may be selected from Phosphotransacetylase (pta) and Acetate kinase (ack).

In one embodiment, the method for obtaining the modified E. coli strain comprises deletion of gene competing product acetate that is Acetate kinase (ack). The acetate Acetate kinase (ack) gene may be Acetate kinase A(ack A) or Acetate kinase B (ackB). In one embodiment, the method for obtaining the modified E. coli strain comprises deletion of gene of competing product succinate that can be selected from Fumarate Reductase A (frdA), Fumarate Reductase B (frdB), Fumarate Reductase C (frdC), Fumarate Reductase D (frdD), Succinyl coA synthetase and Isocitrate lyase. In one embodiment, the method for obtaining the modified E. coli strain comprises deletion of gene of competing product succinate that is Fumarate Reductase A (frdA).

In one embodiment, the method for obtaining the modified E. coli strain comprises deletion of gene of competing product formate that can be selected from Pyruvate formate lyase A (pfIA), Pyruvate formate lyase B (pfIB), Pyruvate formate lyase C (pfIC) and Pyruvate formate lyase D (pflD). In one embodiment, the method for obtaining the modified E. coli strain comprises deletion of gene of competing product formate that is Pyruvate formate lyase B (pfIB).

In some embodiments, the method for obtaining the modified E. coli strain comprises reintroducing the basal level expression of one or more genes of the competing product. In one embodiment the method for obtaining the modified f. coli strain comprises reintroducing the basal level expression of acetate kinase (ack).

In one embodiment the present invention provides a method of obtaining a modified Escherichia coli strain wherein the method comprises the steps of:

a. replacing the promoter of pyruvate dehydrogenase operon (PDH) with a promoter of a gene that is expressed at high level under anaerobic conditions;

b. introducing mutations by deleting genes responsible for competing products that is lactate, succinate, acetate and formate;

c. reintroducing basal level expression of gene encoding acetate kinase.

In one embodiment ^' the present invention provides a method of obtaining a modified Escherichia coli strain wherein the method comprises the steps of:

a. replacing the promoter of pyruvate dehydrogenase operon (PDH) with a promoter of a gene selected from frdA, IdhA, pfIB, adhE and gapA;

b. introducing mutations by deleting genes responsible for competing products that is lactate, succinate, acetate and formate;

c. reintroducing basal level expression of gene encoding acetate kinase.

In preferred embodiment the present invention provides a method of obtaining a modified Escherichia coli strain wherein the method comprises the steps of: a. replacing the promoter of pyruvate dehydrogenase operon (PDH) with a promoter of a gapA gene;

b. introducing mutations by deleting genes responsible for competing products that is lactate, succinate, acetate and formate;

c. reintroducing basal level expression of gene encoding acetate kinase.

In one embodiment the present invention provides a method of fermenting hexose and/or pentose sugars utilizing the modified E. coli strain for the production of bioalcohol.

In one embodiment the present invention provides a method of fermenting hexose sugar wherein the hexose sugar can be selected from glucose, galactose, allose, altrose, mannose, gulose, idose and talose. In one embodiment the present invention provides a method of fermenting hexose sugar wherein the hexose sugar can be glucose and/or galactose. In one embodiment the present invention provides a method of fermenting hexose sugar wherein the hexose sugar is glucose.

In one embodiment the present invention provides a method of fermenting pentose sugar wherein the pentose sugar is selected from xylose, arabinose, ribose, lyxose, ribulose and xylulose. In one embodiment the present invention provides a method of fermenting pentose sugar wherein the pentose sugar can be xylose and/or arabinose. In one embodiment the present invention provides a method of fermenting pentose sugar wherein the pentose sugar is xylose. In one embodiment the present inventions provides a method of fermenting lignocellulosic biomass comprising hexose and pentose sugars by using the modified bacterial strain.

In some embodiments of the invention, the method of fermenting hexose and pentose sugars comprised in lignocellulosic biomass by using the modified bacterial strain for the production of bioalcohol under aerobic, microaerobic and/or anaerobic conditions. In one embodiment of the invention, the method of fermenting hexose and pentose sugars comprised in lignocellulosic biomass by using the modified bacterial strain is carried out under microaerobic and/or anaerobic condition. In one embodiment of the invention, the method of fermenting hexose and pentose sugars comprised in lignocellulosic biomass by using the modified bacterial strain is carried out under microaerobic condition.

In one embodiment the present invention provides a method of fermenting lignocellulosic biomass with a modified Escherichia coli strain wherein the method comprises the steps of:

- hydrolyzing the lignocellulosic biomass comprising hexose and pentose sugars;

- mixing the modified Escherichia coli strain with hydrolyzed lignocellulosic biomass comprising hexose and pentose sugars;

- allowing fermentation of the mixture to be carried out in microaerobic conditions to produce ethanol.

In one embodiment, the lignocellulosic biomass is pretreated to obtain a hydrolyzed lignocellulosic biomass.

The present method of obtaining the modified E. coli strain is redox balanced. The modified E. coli strain with promoter of pyruvate dehydrogenase operon (PDH) replaced with promoters of various genes expressed under anaerobic condition showed enhanced ethanol yield particularly when its promoter was replaced with gapA promoter. Deletion of genes of competing products further increased the ethanol yield. Expression of acetate kinase at basal level helped restoring the cell growth rate and improved ethanol productivity significantly. Microaerobic condition further improved the growth rate of the cells on both glucose and xylose. Further, the modified bacterial strain of the present invention process is without introduction of foreign gene, is genetically more stable and capable of fermenting lignocellulosic biomass with enhanced production of ethanol. The present invention is illustrated by following non-limiting examples. EXAMPLES:

MATERIALS AND METHODS:

Bacterial strains, plasmids, primers, enzymes and methods:

List of bacterial strains, plasmids and primers used in the study has been provided in Table 1. E. coli DH5a strain (Invitrogen) was used for performing all the cloning work and f. coli B (Coli Genetic Stock Centre (CGSC), Yale University, USA) was used as parent strain for all the genomic manipulations. Restriction endonuclease and T4 DNA ligase were procured from New England Biolabs. Custom oligonucleotides (primers) were synthesized from Sigma-Aldrich for PCR amplifications. Taq DNA polymerase (Bangalore Genei) was used for performing verification PCR of the engineered strains. Plasmids pKD4, pKD46 and pCP20 (CGSC, USA) were used as the source of FRT-kan-FRT fragment, lambda Red recombinase and flippase, respectively, for performing genetic manipulation. Recombinant DNA techniques were performed according to standard procedures (Sambrook et al., 1989). DNA purification was performed using Qiagen kit. DNA fragments were amplified by Phusion High Fidelity polymerase (Finnzymes) for cloning and template preparation for homologous recombination.

TABLE 1:

Table 1. Strains, plasmids and primers used in the study

Name Description Reference or Source

Strains

E. coll i F- CGSC #2507

SSY01 E. coli B, PD -promoter.:FRT-kan-FRT-ldhA gene promoter; promoter of pdh gene

replaced with promoter of IdhA gene This study

SSY02 E. coli B, H D -promoter::FRT-kan-FRT-frdA gene promoter This study 10/03 E. coli B, APDH-promoter::f ?f-ton-f ?r-p//8 gene promoter This study

SSY04 E. coli B, APDH-promoter^ffiT-fcan-fflr-oc gene promoter This study SSY05 E. coli B, &PDH-promoter.:FRT-kan-FRT-gapA gene promoter This study SSY06 SSY05 ldhA: FRT-kan-FRT; deletion mutant for IdhA gene in SSY05 host This study SSY07 SSY06 bfrdA-.-.FRT-kan-FRT; deletion mutant for frdA gene in SSY06 host This study fcsvoe SSY07 ackA::FRT-kan-FRT; deletion mutant for ackA gene in SSY07 host This study

SSY09 SSY08 bpflB: FRT-kan-FRT; deletion mutant for pfIB gene in SSY08 host This study

SSY10 SSY09 transformed with pZSack plasmid This study SSY11 SSY09 transformed with pZS*mcs plasmid This study

2Gksmids

pUC19 bla, cloning vector

pKD4 bla, FRT-kan-FRT CGSC #7632 pKD46 bla, y 6 exo (red recombinase), temperature-conditional replicon CGSC #7739 pCP20 bla,flp, temperature-conditional replicon CGSC #7629 js¾Y01 FRT-kan-FRT sequence from pKD4 was cloned into pUC19 at EcoRI and BamHI sites This study

pSSY02 IdhA gene promoter from E . coli B was cloned into pSSYOl at BamHI and Hindlll sites This study

pSSY03 frdA gene promoter from E. coli B was cloned into pSSYOl at BamHI and Hindlll sites This study

pSSY04 pfIB gene promoter from. E. coli B was cloned into pSSYOl at BamHI and Hindlll sites This study

pSSYOS adhE gene promoter from E. coli B was cloned into pSSYOl at BamHI and Hindlll sites This study

j&Y06 gapA gene promoter from E. coli B was cloned into pSSYOl at BamHI and Hindlll sites This study

pZSblank Puetoi expression vector, pSC101*origin, Cm" Yazdani et al 2008 pZS*mcs multiple cloning site derived from pET28a(+) cloned in pZSblank This study pZSack ack gene cloned in pZS*mcs vector This study

£8mers

FRT-kan-FRT-F GGAGAGAATTCGTGTAGGCTGGAGCTGCTTC This study

FRT-kan-FRT-R GGAGAGGAJC£ATATGAATATCCTCCTTAG This study

IdhA promoter-F TCGGGATCCGCAAGCTGACAATCTCCC This study

IdhA promoter-R ACTCAAGCTTAAGACTTTCTCCAGTGATGTTG This study

£θΑ promoter-F TGCGGATCCATCAAACAGCGGTGGGCAG This study frdA promoter-R CCCAAGCTTGACATTCCTCCAGATTGTTT This study p//B promoter-F TCGGJ3ATCCAACCATGCGAGTTACGGGCCTATAA S. Zhou et al 2008 p//B promoter-R CCCAAGCTTGTGCCTGTGCCAGTGGTTGCTGTGA This study

adhE promoter-F CGCGGATCCCCGGATAATGTTAGCCATAA This study

48hE promoter-R CCCAAGCJTAATGCTCTCCTGATAATGTTA This study

gopA promoter-F CGCGGATCCG ATTCTAACAAAACATTAACAC This study

aaoA promoter-RCCCAAGCTTATATTCCACCAGCTATTTGT This study

HI CTCCmCCTACGTAMGTC Aa\TnGTGCATAGTTACAAaTrGTGJAGGCT^ Zhou et al 2008

H2_ldhA GCGAGTTTCGATCGGATCOlCGTCATnGGGAMCGUCTGACATAAGACVrrCrCCAGTGAl GTTG This study

SlQ_adhE GCGAGTTJCGATCGGATCCACGTCATn ^' GGGAAACGTTCTGACATAATGCJC^CCTGAJAATGJT This study

H2_gapA GCGAGTTTCGATCGGATCCACGTCATTTGGGAAACGTTCTGAO^TATATTC J^CCAGCYATTtGT This study

H2_frdA GCGAGTTTCGATCGGATCCACGTCATTTGGGAAACGTTCTGACATGACATTC rCCAGAT\ ^' GTT ^' This study

H2_pflB GCGAGTnCGATCGGATCCACGTCATnGGGAMCGUCTGAMTGJAAO C^ACCX CTGTrG Zhou et al 2008

CTGTGATATAGAAGAC

5-5>DH-F TGC ATG GTTG AAG ATG AGTTG This study

v-PDH-R TGATGTAGTTGCTGATACCTG This study pZS-ack-F GATCGGATCCATGTCGAGTAAGTTAGTACTGGT This study

pZS-ack-R TCGAGTCGACTCAGGCAGTCAGGCGGCTC This study

6)Qte: Homologous region for recombination is in italics and the enzyme sites are underlined Replacing the PDH operon in the E. coli B genome:

FRT-kan-FRT sequence from pKD4 was amplified using FRT-kan-FRT-F and FRT-kan- FRT-R primers (Table 1), digested with fcoRI and Ba W\ and ligated to the corresponding restriction endonuclease sites of p ⁽ JC19 plasmid to generate the plasmid pSSYOl. ( at the 3' end of FRT-kan-FRT in pSSYOl to produce plasmids pSSY02-06 (Table 1). A 45 bases homologous sequence for -202 to -157 bp upstream of pdhR coding region of PDH operon was added to the 20 bases of 5' end of FRT- kan-FRT sequence to design primer HI and a 45 bases homologous sequence corresponding to +1 to +45 coding region of oceE of PDH operon was added to 20- 22 bases of 3' end of each promoter to obtain primer H2 (Table 1). PCR was performed with the HI and H2 primers and corresponding plasmid pSSY02-06 as template under following conditions: 98°C for 2 min, followed by 30 cycles of denaturation at 98°C for 15 sec, annealing at 59°C for 15 sec, extension at 72°C for 2 min and a final extension at 72°C for 10 min. The PCR product was gel eluted, digested with Dpnl, re-purified and electroporated (2.5 KV, 25 μϊ and 200 Ω) into E. coli B carrying pKD46 (grown in LB broth with 1 mM L-arabinose at 30"C till ODeoonm reaches ~ 0.3 - 0.4) to replace the promoter, RBS and pdhR gene of pyruvate dehydrogenase (PDH) operon with the heterologous promoter (Datsenko and Wanner, 2000). Transformants were selected on kanamycin LB-agar plates. The engineered strains (SSY01-05) (Table 1) were verified for the PDH promoter replacement by performing two sets of colony PCR, one set using v-PDH-F (-372 bp upstream of pdhR) and v-PDH-R (+163 bp downstream of start of coding region of aceF) primers to verify native promoter deletion, and second set using forward primer of the heterologous promoter and v-PDH-R to verify introduction of heterologous promoter (data not shown). Before further manipulation, the kanamycin resistance marker gene was removed from the chromosome of the selected strain with the help of FLP recombinase by using the temperature sensitive helper plasmid, pCP20 (Datsenko and Wanner, 2000).

Host gene deletions were achieved through PI transduction method (Miller, 1972) using the single gene knockout Keio strains from CGSC, Yale University, USA (Baba et al., 2006). The kanamycin resistant marker gene was removed as described above and the resultant strain was used for sequential rounds of gene knockout ¹ Construction of pZSack plasmid:

MCS of pET28a(+) (Novagen) was amplified and cloned in pZSblank plasmid (Yazdani and Gonzalez, 2008) to obtain pZS*mcs. The ackA gene encoding acetate kinase was amplified from E. coli B genome using pZS-ack-F and pZS-ack-R primers, digested with SomHI and So/I and the resultant fragment was ligated into the SomHI-So/l sites of pZS*mcs to produce pZSack. The pZSack plasmid was then electroporated into SSY09 for enhancement of growth rate. Media and culture conditions:

Bacterial strains were grown in either LB medium or Morpholino-propanesulfonic (MOPS) defined medium. Antibiotics were added as appropriate with ampicillin at 50 g/ml, kanamycin at 30 μg/ml and chloramphenicol at 34 g/ml. For checking production of metabolites by the engineered strains in the tube, the strains were grown overnight at 37°C on LB agar plates containing relevant antibiotic and an isolated colony was inoculated in Hungate tube filled until brim (17.5 ml) with IX MOPS or LB medium supplemented with antibiotics and desired sugar (glucose, xylose, galactose or arabinose) as carbon source. In the study where engineered strains were transformed with pZSack or pZS*mcs plasmid, the cells were grown in the Hungate tube filled with media containing 0, 0.1 or 100 ng/ml of anhydrotetracycline as inducer and 34 g/ml of chloramphenicol as antibiotic. The tubes were incubated at 37°C under rotating condition and harvested at different intervals. The optical density of the grown culture was recorded at 600 nm and supernatant was saved for metabolite analysis via HPLC.

The engineered strains were cultivated in the bioreactor to evaluate their performance under controlled environment at various stages of manipulation. Primary culture was prepared by incubating an isolated colony from agar plate into 17.5 ml MOPS medium containing 2.5 g/l glucose in Hungate tube for 24 hr at 37 °C. In case of the engineered cells where ack and pflB genes were deleted (i.e., SSY09 and SSY10), primary culture was adapted to anaerobic condition in 100 ml LB medium in a 250 ml flask containing 2.5 g/l glucose or xylose for 48 hr at 37°C in anaerobic chamber (Bactron II, Shel lab). Appropriate volume of the culture to achieve initial OD ₆ oonm of 0.05 in the bioreactor was centrifuged at 4000 rpm for 4 min and re-suspended in fresh medium. The culture was inoculated in one of the six 0.5 L vessels of Biostat Q plus fermentor (Sartorius) containing 350 ml of MOPS or LB medium having appropriate amount of sugar. The vessels were controlled independently at 37 °C, 300 rpm and pH 6.8. High purity Argon gas was purged in the medium to create anaerobic environment at a rate of 0.02 L/min. In case of fermentation under microaerobic condition, compressed air was passed in the headspace of the vessel at the rate of 0.02L/min at which dissolved oxygen probe demonstrated zero reading throughout the fermentation. Samples collected from fermentor vessels at various time intervals were used to calculate cell growth, substrate utilization and product synthesis.

Enzyme assay:

To check the activity of PDH enzyme under anaerobic conditions, engineered E. coli B strains with heterologous PDH promoter along with wild type strain as control were grown in Hungate tubes filled with LB medium + 2% glucose for 12 hr at 37°C. Cells were harvested by centrifugation (5 min, 5000 rpm), washed twice with 9 g/l NaCI and stored as cell pellets at -20 °C. Cell pellets were resuspended in 0.1 M potassium phosphate buffer (pH 8.0) to obtain OD ₆ oo of 10 and were permeabilized with chloroform. The reaction was set-up in 1 ml in the cuvette containing 50 mM potassium phosphate buffer (pH 8.0), 2.0 mM sodium pyruvate, 2.5 mM NAD ⁺ , 0.2 mM thiamine pyrophosphate, 1.0 mM MgCI ₂ , 0.13 mM CoA, 2.6 mM cysteine hydrochloride. Permeabilized cells (25 μΙ) were added to start the reaction and the pyruvate dehydrogenase activity was measured by detecting change in absorbance at 340 nm (Ultrospec 3100 pro, Amersham Biosciences) (Danson et al., 1978). Substrate blank where no sodium pyruvate was added served as control. Enzyme activity was calculated as nmol NADH formed/min/mg of cell protein. A protein content of 50% (wt/wt) with respect to dry cell mass was assumed in these calculations. Significance of differences between enzyme activities of test and control cells was determined using one-tailed unpaired Student's t-test. P value of 0.05 and less was considered statistically significant. Analytical methods:

Extracellular metabolites of the grown culture were determined as follows. Culture of the grown cells was centrifuged at 13200 rpm for 5 min. The aqueous supernatant was filtered and used for HPLC analysis. The metabolite separation was achieved using the HPLC system (Agilent technologies) attached with Aminex HPX-87 H anion exchange column (Bio-Rad). The filtered and degassed mobile phase (4 mM H ₂ S0 ₄ ) was used at a constant rate of 0.3 ml/min with column and Rl detector temperatures maintained at 40 °C and 35 °C, respectively. Standards of the metabolites (Absolute Standards, USA) at 1 g/l were separated on HPLC column and areas obtained were used to calculate metabolite concentration in the text samples. Cell density was measured at an optical density 600 nm (OD ₆ oo) in a spectrophotometer (BioRad). Dry cell mass was calculated by drying cell pellets of defined OD ₆₀ o at 75°C in oven for 20 hr. The OD ₆ oo of 1.0 corresponded to 0.56 mg dry mass per ml of culture.

The values obtained for cell biomass, substrate utilization and product synthesis were used for calculation of biomass and product yields (mmol/mmol substrate), specific productivity (mmol/gcell/h) and volumetric productivity (mmol/L/h). For calculating biomass yield we used a molecular formula of cells as CHi. ₉ O ₀ .5N ₀ . ₂ with an average molecular weight of 24.7.

Supplementary Methods:

Quantitative real-time RCR:

E. coli B and SSY05 strains were grown as described above. Total RNA was isolated and 2 g RNA from each was reverse-transcribed using Superscript RT III (Invitrogen). 2 μΙ of this reaction mix was added in a final volume of 20 μΙ and amplified using the QuantiMix Easy HRM kit (Biotools) with gene specific primers. After an initial activation at 50°C for 2 min and a preincubation step at 95°C for 10 min, reaction mixtures were subjected to 40 cycles of denaturation at 95°C for 15 sec, annealing at 56°C for 30 sec and extension at 72°C for 35 sec (Bio-Rad iCycler). This was followed by a dissociation curve analysis at 95°C for 15 sec, 60°C for 20 sec and 95°C for 15 sec. Data analysis was done as described by Pfaffl method (Pfaffl, 2001). and dnaA gene was taken as the internal control. Reaction mixtures without the reverse transcriptase and without the RNA template were taken as the negative controls for the experiment. All experiments were done in triplicate.

Table 2. Fermentation parameters for cell growth, sugar utilization and Product synthesis at the bioreactor level

Product Yield (mmol per mmol sugar) % Max ethanol

Theor productivity ⁰ etical

Medium+Sugar

Sugar Strain yield

Cone. ³

For1 of Specific

SuccLacmat Acet- Ethethan (mmol/g/h Volumetric

Cells inate tate e ate anol ol ^b ) (mmol/l/h)

Defined medium+20 0.4 1.1 0.5 0.6

Glucose E. coli B 0.36

g/l 0.11 2 9 1 5 32 4.82 4.72

Defined medium+20 0.1 0.9 0.4 0.8

SSY05

g/l 0.40 0.14 3 8 2 4 42 5.76 6.19

Defined medium+20 0.0 1.1 0.5 0.9

SSY06

g l 0.42 0.14 2 5 3 6 48 6.42 6.91

Defined medium+20 0.0 1.1 0.4 1.0

SSY07

g/l 0.46 0.01 3 6 6 8 54 4.85 5.97

Defined medium+20 0.0 0.0 0.1 1.6

SSY10

g/l 0.25 0:00 0 0 2 7 83 4.00 1.62

0.7 0.5 0.3 0.3

£ coli B LB medium+50 g/l

0.23 0.07 8 7 7 1 16 6.15 3.06

0.0 0.0 0.0 1.8

SSY10 LB medium+50 g/l 0.16 0.01 95 20.03 12.34

1 3 7 9

Defined medium+20 0.0 1.2 0.8 0.6

Xylose E. coli B

g/l 0.34 0.17 0 1 0 1 36 2.46 1.54

Defined medium+20 0.0 0.0 0.1 1.0

SSY10

g/l 0.24 0.01 2 0 4 9 68 6.15 1.96

0.0 0.3 0.7 0.7

£ coli B LB medium+50 g/l

0.20 0.10 5 0 0 9 47 3.13 1.90

0.0 0.0 0.2 0.9

SSY10 LB medium+50 g/l 0.18 0.02 55 1.57 1.67

1 3 6 1

LB medium+50 g/l 0.0 0.0 0.1 1.6

SSY10 0.40 0.01 97 5.72 6.84 (Microaerobic, pH 6.3) 1 1 7 3

Glucose+X LB medium+50 g/l 0.0 0.0 0.0 1.6

SSY10 0.64 0.01 85 5.43 14.94 ylose (Microaerobic, pH 6.3) 0 0 4 1 a Growth condition in the fermentor is described herein above. ^b % Theoretical yield of ethanol was calculated by considering theoretical maximum yield of 2 mmol of ethanol per mmol of glucose and 1.67 mmol of ethanol per mmol of xylose as 100%.

c Maximum specific (mmol ethanol per gram of cells per hour) and volumetric (mmol per liter of culture per hour) productivity of ethanol were calculated by accounting the interval at which maximum substrates were consumed and maximum products and cell biomass were formed.

Promoter replacement of pyruvate dehydrogenase (PDH) operon enhances its activity and ethanol yield under anaerobic condition

Ethanol production in E. coli through pyruvate formate lyase (PFL) pathway is short of reducing equivalent to achieve a theoretical maximum yield via fermentation of pentose and hexose sugars (Figure 1). Figure 1 shows the metabolic pathways of E.

coli functional under anaerobic conditions during glucose and xylose fermentation.

Relevant genes and corresponding enzymes are shown. Pyruvate dehydrogenase

(PDH) operon was expressed under anaerobic condition via promoter replacement and is represented as thick line. The competing pathways to ethanol were blocked as shown by two parallel bars. Broken arrows represent multiple reactions of a pathway. Extracellular metabolites are placed in boxes. Abbreviations are as follows:

ADH, acetaldehyde/alcohol dehydrogenase; ACK, acetate kinase; FHL, formate hydrogen-lyase; FRD, fumarate reductase; LDH, actate dehydrogenase; PDH, pyruvate dehydrogenase; PFL, pyruvate formate-lyase; PTA, phosphate acetyltransferase; PYK, pyruvate kinase. Therefore, wild type E. coli typically produces mixed acids under fermentative condition with only fraction of carbon goes towards ethanol. The redox balance for homoethanol production may be achieved upon optimal activation of pyruvate dehydrogenase (PDH) pathway under anaerobic condition (Figure 1). The operon encoding PDH complex is usually repressed under anaerobic condition through global repressor binding to its promoter. To prevent this repression, it was decided to replace the promoter of PDH operon with the promoter of the gene known to express under anaerobic condition.

In the absence of information in the literature regarding relative strength of promoters of the genes expressed under anaerobic condition, promoters of five genes, frdA, IdhA, pflB, adhE and gapA, were selected and native promoter of PDH operon is replaced. The resultant transformants were verified by internal template based and external host chromosomes based primers and were designated as SSY01 to SSY05 for Pidh _A PDH, P _frdA PDH P _a dh _E PDH, P _pf i _B PDH and P _ga p _A PDH promoters, resepectively (Table 1).

The engineered cells were grown under anaerobic condition and used for measuring pyruvate dehydrogenase (PDH) activity. The results indicated 0.6-2.2 fold change in PDH activity between various promoter-engineered strains (Figure 2A). Figure 2A is a graph showing the functional characterization of promoter engineered E. coli B strains (SSY01-05, Table 1) and shows the effect of PDH operon promoter replacement on pyruvate dehydrogenase activity. Cells were grown anaerobically in completely filled hungate tubes and were harvested and permeabilized to measure PDH activity. E. coli B grown under aerobic condition was used as positive control. The supernatant of the culture was used to analyze metabolite concentration via HPLC. Percentage improvement in ethanol yield was calculated by comparing ethanol yield (mol of ethanol per mol of sugar) of each strain with respect to E. coli B.

PDH activities in SSY03 (P=0.045) and SSY05 (P=0.033) strains were significantly higher than the wild type. Transcript levels of aceE, aceF and Ipd genes of PDH operon also showed 2-7 fold higher expression in SSY05 strain as compared to wild type (Supplementary Figure 10). Figure 10 is a graph showing the validation of expression of PDH operon in promoter replaced SSY05 strain by quantitative realtime PCR. E. coli B and SSY05 strain was grown anaerobically in Hungate tubes filled with LB+2% glucose for 12 hr and RNA was isolated for performing Real Time PCR with gene specific primers corresponding to aceE, aceF and IpdA of PDH operon. Values of each gene were normalized to dnaA gene and are plotted with respect to the control, E. coli B, that has arbitrarily been taken as 1.

Higher PDH activity of promoter-engineered strains under anaerobic condition may account for higher NADH availability and greater carbon flux towards ethanol. Concentration of metabolic products of SSY01 to SSY05 strains was measured after growing them in Hungate tubes filled with defined media containing one of the four sugars commonly present in lignocellulosic biomass, i.e., glucose, xylose, arabinose or galactose. All the promoter-engineered strains, except SSY01 (PidhAPDH), showed improvement in ethanol yield when hexose sugars glucose and galactose were used as carbon source (Figure 2B, Table 1). Figure 2B is a graph showing the functional characterization of promoter engineered E. coli B strains (SSY01-05, Table 1) and shows the effect of PDH operon promoter replacement on ethanol production. Cells were grown anaerobically in completely filled hungate tubes and were harvested and permeabilized to measure PDH activity. E. coli B grown under aerobic condition was used as positive control. The supernatant of the culture was used to analyze metabolite concentration via HPLC. Percentage improvement in ethanol yield was calculated by comparing ethanol yield (mol of ethanol per mol of sugar) of each strain with respect to E. coli B. The results were, however, variable in the case of pentose sugars xylose and arabinose. Nevertheless, SSY05 strain showed highest increase in ethanol yield against all the four sugars and therefore was considered for further study.

Deletion of competing pathways improves ethanol yield in the engineered SSY05 strain:

Though the PDH promoter engineered SSY05 strain exhibited significant enhancement in the ethanol level as compared to the wilde type strain, it still produced considerable amount of competing co-products such as lactate, succinate, acetate and formate (Table 1). To further improve ethanol yield, deletion in the genes was introduced for lactate dehydrogenase {IdhA), fumarate reductase (frdA), acetate kinase (ack) and pyruvate formate lyase (pfIB) responsible for the formation of lactate, succinate, acetate and formate, respectively, to obtain SSY06 (P _gaP A PDH AldhA), SSY07 (P _gapA PDH AldhA AfrdA), SSY08 (P _gapA PDH AldhA AfrdA Aack) and SSY09 (Ρ ₈₃ ρΑ PDH AldhA AfrdA Aack ApflB) strains (Table 1). When grown in the Hungate tube containing defined medium under anaerobic condition, SSY06 and SSY07 grew normally and produced ethanol with the yield of 0.87 and 1.11 mmol per mmol glucose, respectively (Figure 3). Figure 3 is a graph showing comparison of product yields of deletion mutants of SSY05. Cells were grown in Hungate tube filled with LB medium and 2.5g/L glucose at 37°C for 24hr were harvested and supernatant was used for detection and analysis of product yield. Data represents average and standard deviation from three independent experiments and indicates successive improvement in ethanol yield upon deletions of competing pathways. However, SSY08 grew very slowly and SSY09 did not grow at all. This observation indicated that deletion of ack had deleterious impact on cell growth, possibly due to corresponding depletion of ATP pool. To regain the cell growth, ack gene is introduced through a very low copy plasmid in SSY09 strain to obtain SSY10 strain Significant improvement is found in cell growth upon transformation with the plasmid containing ack gene (SSY10) as compared to the strain transformed with the control plasmid (SSY11) even without addition of the inducer, indicating minor leaky expression of ack gene (Figure 4A and 4B). Figure 4 is a graph showing improvement in cell growth upon basal level expression of ack gene in the engineered SSY09 strain. SSY09 strain was transformed with pZSack was grown in Hungate tube completely filled with LB media + 2.5g/l glucose (A) or 2.5g/l xylose (B) at 37°C for 36 hr. Acetate kinase expression was induced with 0, 0.1, 100 ng/ml of anhydrotetracycline. E. coli B and SSY09 transformed with pZS*mcs plasmid were used as positive and negative control, respectively. Results indicate improvement in growth of PZSack transformed cells as compared to control plasmid and less acetate production as compared to wild type strain. Acetate level in uninduced SSY10 strain was less than 50% of the wild type strain and this strain demonstrated ethanol yield of 1.9 mmol per mmol glucose (Figure 3). ethanol-producing capability of all the engineered strains is further tested at the bioreactor level under controlled environmental condition.

Comparison of engineered strains for ethanol production at the bioreactor level in defined medium:

When grown in a bioreactor, wild type E. coli B produced ethanol at the yield of 0.65 and 0.61 mmol per mmol of glucose and xylose, respectively, in defined medium under anaerobic condition as against the theoretical maximum yield of 2 and 1.67 mmol per mmol of these sugars due to generation of competing co-products (Figure 5A and 5B, Table 2). Figure 5 is a graph showing the fermentation profile of E. coli B grown in the bioreactor in defined medium with glucose (A) and xylose (B) as carbon source. Competing products of ethanol are produced at significant level during fermentation of both glucose and xylose in E. coli B. The promoter engineered SSY05 strain showed 10% higher ethanol yield as compared to wild type strain, indicating favourable redox balance towards ethanol production (Table 2). As in the case of Hugate tube data, successive deletion made in the competing pathways to generate SSY06, SSY07 and SSY10 strains resulted in corresponding increase in ethanol and decrease in co-product yield (Table 2). SSYIO strain grown in defined medium with 20 g/l glucose or xylose at the bioreactor level produced ethanol at 83% or 68% of theoretical maximum yield, respectively (Figure 6A and 6B, Table 2). Figure 6 is a graph showing fermentation profile of SSYIO (SSY09+pZSack) grown in the bioreactor in defined medium with glucose (A) and xylose (B) as carbon source. SSYIO primarily produced ethanol. Strain description: SSYIO - P _gap A DH ldhA frdA Lack pflB (pZSack). However, ~25% of substrate remained unutilized at ~200 hrs of fermentation and ethanol was produced at the low volumetric productivity of 1.6- 1.9 mmol/l/h.

Comparison of engineered strains for ethanol production at the bioreactor level in complex medium:

To improve the growth, substrate utilization and ethanol production rate, the engineered cells are grown in LB medium with 50 g/l substrate. The wild type strain produced lactate and acetate as major metabolic products with ethanol produced at the yield of 0.31 and 0.79 mmol per mmol glucose and xylose, respectively (Figure 7A and 7B, Table 2). Figure 7 is a graph showing the fermentation profile of E. coli B grown in the bioreactor in complex medium with glucose (A) and xylose (B) as carbon source. Only small fraction of carbon has been used by the E. coli B cells to produce ethanol. Remarkable improvement in growth rate was observed in the case of SSY10 strain, which produced ethanol at the rate of 12.34 mmol/l/h with 95% of the theoretical yield when glucose was used as carbon source (Table 2). The final ethanol concentration achieved was 21 g/l (457 mM) from 44 g/l (242 mM) glucose in 80 h (Figure 8A). Figure 8A is a graph showing the fermentation profile of SSY10 (SSY09+pZSack) grown in the bioreactor in complex medium with glucose as carbon source. SSY10 strain utilized glucose and produced ethanol at a significantly high rate. Strain description: SSY10 - P _ga p _A PDH MdhA AfrdA back ApfIB (pZSack).

The xylose utilization rate, however, was still slow in the SSY10 strain with 25% xylose remained unutilized after 260 h of fermentation and ethanol produced only at the rate of 1.67 mmol/l/h (Figure 8B, Table 2). Figure 8B is a graph showing the fermentation profile of SSY10 (SSY09+pZSack) grown in the bioreactor in complex medium with xylose as carbon source. Xylose utilization rate of SSYIO strain however, was still slow. Strain description: SSYIO - _gap A DH LldhA hfrdA Lack LpfIB (pZSack). There was a slight increase in xylose utilization rate when pH of the cultivation was maintained at 6.3 (data not shown), possibly due to higher activity of a xylose/proton symporter. To enhance the growth rate of the cells, a microaerobic condition was introduced by passing compressed air in the headspace of bioreactor at a very slow flow rate. Cell growth and xylose utilization rate improved significantly with 50 g/l xylose utilized in 115 h and 25 g/l ethanol produced at the rate of 6.84 mmol/l/h with 97% of the maximum theoretical yield (Figure 9A). Figure 9A is a graph showing the fermentation profile of SSYIO (SSY09+pZSack) strain grown under microaerobic condition in the bioreactor in complex medium with xylose as carbon source. The profile indicated efficient utilization of xylose under microaerobic conditions and production of ethanol with high yield and productivity. Strain description: SSYIO- P _gapA PDH LldhA hfrdA Lack LpfIB (pZSack). This yield of ethanol from xylose was higher than those reported in the literature from the engineered E. coli without the foreign genes. Utilization of mixture of glucose and xylose is further tested at 25 g/l each under micro-aerobic condition and it is found that there is complete utilization of sugars in 55 hrs with ethanol produced at the rate of 14.94 mmol/l/h (~0.7 g/l/h) with 85% of the maximum theoretical yield (Figure 9B). Figure 9B is a graph showing the fermentation profile of SSYIO (SSY09+pZSack) strain grown under microaerobic condition in the bioreactor in complex medium with mixture of glucose and xylose as carbon source. The profile indicated efficient utilization of mixture of glucose and xylose under microaerobic condition and production of ethanol with high yield and productivity. Strain description: SSY10- P _gap APDH LldhA LfrdA Lack LpfIB (pZSack). This rate of ethanol production was close to the co- fermenting recombinant E. coli KOll strain at 0.8-0.9 g/l/h. None of the reports published before for the engineered E. coli without the foreign genes demonstrated co-utilization of glucose and xylose. The engineered E. coli SSY10 strain certainly has advantage over the other engineered E. coli strains such as KOll for not having any foreign genes responsible for ethanol production, f. coli KOll has been found to lose its ethanologenicity progressively when cultivated on hemicellulosic sugars in the chemostat culture, possibly due to the genetic instability. Since E. coli SSYIO did not have any foreign genes, its ethanologenic property is expected to be stable for much longer generation and therefore this strain was considered for further studies to evaluate ethanol production from lignocellulosic hydrolysates.

The present invention shows that promoter of pyruvate dehydrogenase operon (PDH) in E. coli was replaced with promoters of various genes expressed under anaerobic condition and that PDH expression and ethanol yield was maximum under anaerobic condition when its promoter was replaced with gapA promoter. Deletion of pathways for competing products further increased the ethanol yield. However, there was significant drop in cell growth rate. Expression of acetate kinase at basal level helped restoring the cell growth rate and improved ethanol productivity significantly. Microaerobic condition further improved the growth rate of the cells on both glucose and xylose.

Fermentation of sugars in biomass hydrolyzate using SSYIO strain:

Alkali (ammonia) treated biomass was prepared. Size reduced rice straw (average 5mm length; 3.5 g) was mixed with 100ml of 30% v/v liquid ammonia in water, at 15°C. The resultant rice straw-ammonia slurry was charged into a high pressure reactor. The reaction was carried out in the reactor vessel at 125°C for 30 minutes to obtain first slurry. Temperature of the first slurry was reduced to at least 95 °C and subsequently the slurry was filtered to obtain a first filtrate comprising lignin and a first residue comprising cellulose and hemicellulose. The first residue comprising cellulose and hemicellulose was subjected to enzyme hydrolysis for recovery of C5 and C6 sugars. The biomass was further hydrolysed using the cellulolytic enzymes according to 100 pfu/g of dry weight for 4 hours at 50°C by slow addition of biomass and was kept overnight at the same conditions. Once the sugars were extracted, the solution was pelleted at 5000 rpm for 20 min. The supernatant was transferred to a fresh bottle and was heat inactivated at 100°C for 20 min and chilled immediately by placing it on ice. This helped to denature and precipitate the cellulase enzyme which was then separated by centrifugation at 8000 rpm for 20 min. The pH of the supernatant was set to 7.0, filter sterilized and stored at 4°C. SSY10 was used for fermenting ammonia treated biomass hydrolysate in LB broth at pH 6.8 under microaerobic conditions. A total of 50 g/l sugars were added in the fermentor with glucose being 34 g/l and xylose being 16 g/l. The engineered strain consumed all of the sugars, 34 g/l glucose and 16 g/l xylose, in 63 hours and produced 19.46 g/l of ethanol with maximum ethanol productivity of 0.85 g/l/h and yield of 0.4 g/g (Figure 11). The acetate levels were marginally increased towards the end of fermentation. Thus it was shown that the engineered strain SSY10 could ferment the sugars in the hydrolysate very efficiently with excellent ethanol yield.

The modified E. coli strain SSY10 as per the present invention shows 68-83% theoretical ethanol yield. The modified E. coli strain SSY10 as per the present invention shows 95% theoretical ethanol yield when glucose was used as carbon . source and shows 85 - 97% of the maximum theoretical ethanol yield when introduced in a microaerobic condition.

Although preferred embodiments of the invention are described herein in detail, it will be understood by those skilled in the art that variations may be made thereto without departing from the spirit of the invention or the scope of the appended claims.