MODIFIED ESTERASE AND ITS APPLICATIONS

The following specification describes the nature of the invention and the manner in which it has to be performed: Field of invention

The present invention relates a modified esterase from Bacillus subtilis MTCC 121, having increased deacetylation activity when expressed in Escherichia coli towards substrates like cephalosporin C and 7-aminocephalosporanic acid (7-ACA) or its acyl amino derivatives. The modified esterase from Bacillus subtilis is found useful in the bioprocess for the preparation of 7- amino-3-hydroxymethyl cephalosporanic acid (HACA) or its acyl amino derivative and 3-deacetyl cephalosporin C.

Background of the invention

7-ACA serves as a starting material for a large number of semi-synthetic cephalosporins like Cefalotin, Cefazolin, Cefotaxime, Cefcapene pivoxil, Cefuroxime etc., by modification of C7 and C3 positions (as shown in the scheme- 1). Deacetylation of C3 position is required for the attachment of appropriate side chain. Chemical hydrolysis of acetate group at C3 position from cephalosporins under acidic conditions lead to poor yield (Kukolja, S., J. Med, Chem. 11 : 1067-1069, 1968), while hydrolysis at alkaline pH imposes significant strain on utilities and reduce productivity. Hence, enzymatic hydrolysis at neutral pH offprs a cost-effective route for the manufacture of deacetyl derivatives of cephalosporins such as 7-ACA in good quality.

Scheme-1

(C)

wherein R is hydrogen or acyl group; Rl is hydrogen or alkoxy; R' is standard cephalosporin substituent like carbamoyl group.

Numerous organisms such as Streptomyces viridochromogene, S. fradiae, S. grisens, Cephalosporium, Asperigillus and Bacillus subtihs have been shown to produce enzymes (US 3,304,236) that can deacetylate 7-aminocephalosporanic acid and is identified as Cephalosporin-C deacetylase or esterase (CAH; systematic name, cephalosporin-C acetylhydrolase [EC 3.1.1.41] (Hinnen, A., and Nuesch, J., Antimicrobial Agents and Chemotherapy, 9, 824-830, 1976; Kenji Mitsushima et al, Applied and Environmental Microbiology, 61 : 2224-2229, 1995). Several processes have been described for enzymatic cephalsporin deacetylation using native enzyme (US 3,304,236, Konecny, J. and Voser, W., Biochimica et Biophysica Acta. 485:367-378, 1977) and poor expression level in their hosts has limited the industrial applications. It is evident from literature that esterase from different organisms differ significantly in their substrate specificity and such differences have been noticed within sub species of Bacillus subtil is as well.

CAH has been cloned, sequenced and expressed, like from, Rhodosporidium toruloids (US 5,869,309), Aureobasidium (US , 4,517,299), Bacillus subtilis (US 6,465,233, WO 99/55881), etc. Several processes have been described for enzymatic cephalosporin deacetylation (US 5,869,309, US 4,517,299, US 6,465,233, WO 99/55881, US 5,338,676, EP 0454478) using esterase from Bacillus subtilis, expressed in Escherichia coli with varying level of hydrolysis. The genome of Bacillus subtilis (MTCC 121) has been sequenced and is known to encode esterase of 318 amino acids. Comparison of nucleotide and amino acid sequences has revealed significant sequence homology among esterase produced by several species of Bacillus subtilis such as ATCC 6633 , SHS 103 and DS 1152 (KCCM- 10143).

Our attempt to express esterase from Bacillus subtilis MTCC 121 , one of the widely used laboratory strains, led to barely detectable level of activity in E. coli. As a result, an object of the current invention is to provide a modified CAH from B. subtilis having increased activity when expressed in E. co.li with substrates such as 7-ACA, cephalosporin C when compared with the wild-type esterase.

Description of the Figure

Figure 1: Wild-type nucleotide and amino acid sequence of esterase from B. subtilis MTCC 121 is given as SEQ ID No: 1.

Objective of the invention:

An object of this invention is to provide a modified esterase from B. subtilis MTCC 121 with improved capability for deacetylation than that occurs in the wild type esterase.

Another object of this invention is to provide a modified esterase having increased deacetylation activity on substrates like 7-ACA or its acyl amino derivative and cephalosporin C. Summary of the invention:

Accordingly, the present invention provides a mutated CAH from B. subtilis

MTCC 121, which consists of amino acid substitution at one or more amino acid residues corresponding to the wild type esterase for the following group of residues consisting of Aspartic acid at position 43, Methionine at position 138, Tyrosine at position 222 and Arginine at position 231.

Specifically, the invention provides esterase mutants with amino acid substitutions at one or more positions of amino acid residues of Ml 38V, R231G and D43G; Y222H, wherein the residue positions of the amino acid substitutions corresponds to those of a wild-type esterase.

The process of invention is to provide a modified CAH gene encoding the mutated cephalosporin esterase.

Another embodiment of the invention is to provide an esterase protein with modified deacetylation activity for substrates such as cephalosporin C and 7-ACA.

In yet another aspect, the invention provides a recombinant vector specifically an expression vector, which comprises the modified esterase gene.

The present invention further relates to a host strain that contains the expression vector with the modified CAH gene.

Another embodiment of the invention is to provide a method of expression of esterase in a host strain that contains the expression vector with the modified CAH gene;

Another embodiment of the invention is to provide a method of isolation of the expressed enzyme.

Another embodiment of the current invention is for a method of deacetylation of cephalosporins using such isolated esterase either as soluble or immobilised form.

Detailed Description of the invention:

The primary embodiment of the present invention is to provide a mutant esterase having increased specificity (deacetylation activity at the 3 ^rd position) for substrates such as 7-ACA, (7-aminocephalosporanic acid) or (7-acyl aminocephalosporanic acid) and cephalosporin C than the wild type esterase, such that the mutant esterase is from the bacteria B. subtilis MTCC 121 , expressed in E. coli. The wild type gene (CAH gene) has been cloned and characterized (Kunst, F., et al, Nature, 390, 249-256, 1997). The wild-type nucleotide and amino acid sequence of esterase from B. subtilis is given in SEQ ID No: 1 (Figure 1).

According to the present invention, a mutated esterase having enhanced deacetylation activity, with amino acid substitutions at one or more amino acid residues corresponding to the wild type esterase for the group of residues consisting of Aspartic acid at position 43, Methionine at position 138, Tyrosine at position 222 and Arginine at position 231. Specifically, the invention provides mutants with amino acid substitutions at one or more amino acid residues of Ml 38V, R231G and D43G; Y222A, wherein the residue positions of the amino acid substitutions corresponds to those of a wild type esterase from B. subtilis MTCC 121.

The following are the variations in the amino acid residues from the sequence in Seq. ID. NO. 1 :

- Methionine at position 138 is substituted by Valine;

- Arginine at position 231 is substituted by Glycine; - Aspartic acid at position 43 is substituted by Glycine; and

- Tyrosine at position 222 is substituted by Alanine.

Another embodiment of the invention is to provide an isolated nucleic acid molecule those codes for the mutated esterase. According to the invention, this isolated nucleic acid molecule is obtained by mutating the wild type esterase. The mutagenesis technique could be by chemical, error-prone PCR or site-directed approach. The suitable mutagenesis technique can be selected and used for introducing mutations. The mutated nucleic acid molecule can be cloned, expressed and the property of the polypeptide can be studied.

In another aspect of the invention, the mutated nucleic acid molecule may be incorporated into a recombinant vector, which is capable of expression or replication when transferred into a host cell. Expression of the polypeptide can be controlled by a regulatory sequence probably a promoter.

The recombinant vector can be introduced into a host strain to produce the mutated esterase.

The mutated esterase when expressed in the host strain is capable of converting the substrate 7-ACA or its acyl amino derivative to HACA (7- amino-3-hydroxymethyl cephalosporanic acid) and cephalosporin C to deacetyl-cephalosporin C by deacetylation. ' ^{■ ■} . ^■

According to the present invention, the modified peptide has amino acid sequence different from that of SEQ ID NO: 1. This polypeptide is one, which has deacetylation activity i.e. catalyze the deacetylation of C3-acetyl side chain of 7-ACA or its acyl amino derivative to HACA or its acyl amino derivative. The deacetylation activity of the polypeptide is modified or increased. The invention provides a modified

CAH protein, having an enhanced catalytic activity or increased specificity for substrates such as 7-ACA when compared with the wild-type esterase.

The polypeptides thus produced from the mutated nucleotide sequence can be used to produce chimeras from portions of other esterase polypeptides.

Polypeptides from the present invention can be purified with varying level of homogeneity and can be used for other purposes.

The invention can be used for the manufacture of modified cephalosporins either as enzymatic or in vivo fermentation based technologies. The detailed procedures, such as transformation and fermentation of such cells, purification and isolation can be found in the literature.

Escherichia coli BL21 (DE3) strains with modified esterase genes deposited in

Microbial Type Culture Collection (MTCC) center Chandigarh, India under Budapest treaty were designated with the following accession numbers: MTCC 5351, MTCC 5352, and MTCC 5353, deposited on 09.05.2007.

Materials:

All the chemicals and reagents were purchased either from Sigma-Aldrich or USB,

USA. Oligonucleotides were synthesized and supplied by Microsynth Gmbh, Switzerland or Sigma, India. Restriction enzymes, pUC19 vector for cloning were obtained from New England Biolabs Inc, USA. dNTPs were purchased from ABgene, England. pET24a vector, Escherichia coli BL21 (DE3) strain and Bugbuster reagent were purchased from Novagen, USA. Bacillus subtilis MTCC 121 was obtained from the Microbial Type Culture Collection, Chandigarh, India (MTCC). Bradford reagent was purchased from Biorad, USA. Cis columns (150 x 4.6mm, 5μ, ODS3) were obtained from GL science, Japan. GeneElute Bacterial genomic DNA isolation Kit Mini was supplied by Sigma, India and growth media components were obtained from Becton Dickinson, USA.

Bacillus subtilis Genomic DNA isolation;

The B. subtilis strain (MTCC No.121) was grown on LB media containing Tryptone 10 gm, Yeast extract 5 gm and sodium chloride 10 gm made up to 1 liter with distilled

water at pH 7.0. The culture was incubated at 30 ⁰ C and 220 rpm for 24 hours. Cells were harvested from 1.5 ml culture and used for'genomic DNA isolation.

Isolation of esterase gene by Polymerase chain reaction: Genomic DNA was isolated from the cell pellet using the GeneElute Bacterial genomic

DNA kit Mini as per protocol recommended by the supplier (SIGMA). The gene coding for cephalosporin acetylesterase (Accession number: Z99105) was amplified using 20 pmole of primers 5' CATATGCAACTATTCGATCTGCCGCTCGAC 3' and 5' TCAGCCTTTAAGATGCTGCTTAAAGAAAGC 3', 200 μM dNTPs, deep vent DNA polymerase buffer, 2.5U deep vent DNA polymerase enzyme, and water in a final reaction volume of 100 μl. PCR condition consists of an initial denaturation for 5 min at 95 ⁰ C followed by 30 cycles consisting of denaturation at 95 ⁰ C for 40 sec, annealing at 50 ⁰ C for 30 sec, extension at 72 ⁰ C for 2 min with a final extension at 72 ⁰ C for 10 min. An amplified product of length of about l kb of the CAH gene fragment was verified by agarose gel electrophoresis.

Cloning in pUC19 and pET24a:

The putative esterase gene fragment observed after amplification was purified by

Geneelute PCR Clean up kit, SIGMA and cloned into pUC19 vector through blunt-end ligation using Smal restriction site to provide pOBTES. Subsequently, the esterase gene fragment was released by digestion with MM/BamHI and ligated into similarly digested pET24a (+) to give pOCPLES vector and transformed into competent Escherichia coli BL21 (DE3) strain for further expression.

Random Mutagenesis:

The pOBTES vector served as template for error-prone PCR mutagenesis. The amplification _x was carried out with 20 pmole of

5αTCGGTGCGGGCCTCTTCGCTATT3' and 5'

CTCACTCATTAGGCACCCCAGGCT 3' primers in a reaction mix containing 10% DMSO, Taq DNA polymerase buffer, 3.0 U Taq DNA polymerase enzyme, dNTPs and water in a final volume of 100 μl and amplified as described earlier. Alternately, pOCPLES templete was used for mutagenesis using hydroxylamine.

Restriction enzymes Nde\ and Sac/ were used to release the mutated gene fragment and ligated to similarly digested pET24a and transformed. E. coli BL21 (DE3)

recombinants were screened for inserts by colony PCR using 20 pmole of 5' CATATGCAACTATTCGATCTGCCGCTCGAC 3' and 5'

GCTAGTTATTGCTCAGCGG 3' primers in a reaction mix containing 10% DMSO, 1Ox Taq DNA polymerase buffer, I U Taq DNA polymerase enzyme and 100 μM dNTPs in a total reaction volume of 50 μl.

Esterase Expression for screening:

Glycerol stocks containing the putative mutant CAH genes in pET24a (+) vector in

E.coli BL21 (DE3) strain was inoculated in 96-well plate containing LB medium with Kanamycin (75 μg/ml) for overnight growth at 37 °C at 220 rpm. Overnight culture was subcultured again in 96-well deep well plates and grown till OD ₆ oo reached 0.6 and induced with 0.1 mM isopropyl-β-D-thiogaϊactopyranoside (IPTG). After induction, the culture was allowed to grow for 3 hours at 25 ⁰ C and pellets were harvested by centrifugation in a micro plate centrifuge at 4,000 rpm for 10 min at 4 ⁰ C. The pellets were resuspended in a buffer containing 50 mM Tris. HCl (pH 7.5), 0.1 mM DTT, 0.01 mM EDTA, 10% Glycerol, 50 mM Glucose and stored at -8O ⁰ C. ^"

When larger quantities of esterase was desired, E. coli BL21 (DE3) harbouring pOCPLES or modified esterase gene was cultivated in a medium containing 2 g of (NH ₄ ) ₂ HPO ₄ , 6.75 g Of KH ₂ PO ₄ , 0.85 g of citric acid, 0.7 g of MgSO ₄ .7H ₂ O, and 5 ml of a trace metal solution that contains (1O g of FeSO ₄ JH ₂ O, 2.25 g of ZnSO ₄ .7H ₂ O, 1 g of CuSO ₄ .5H ₂ O, 0.5 g of MnSO ₄ .5H ₂ O, 0.23 g Of Na ₂ B ₄ O ₇ .10H ₂ O, 2 g of CaCl ₂ .2H ₂ O, and 0.1 g Of (NH ₄ ) ₆ MO ₇ O ₂₄ ) per litre) and glucose (20 gm/litre) at 37 ⁰ C at 220 rpm in a shake flask (KI J. J. AND SANG Y. L., Applied and Environmental Microbiology, 65:3027-3032, 1999).' When the CLD ₆₀ O reaches 0.6, IPTG was added for induction and cultivated further , for 3 hours at 25 ⁰ C. Subsequently, cells were harvested by centrifugation and subjected to sonication for release of esterase. Alternately, large-scale expression was also carried out in fermentors (Lab Pilot Fermentor Type LP351 , 5OL, Bioengineering AG, Switzerland) under fed batch conditions, wherein 80Og of glucose per liter and 2Og of MgSO ₄ JH ₂ O served as the feed solution and pH was maintained by ammonia water (16%).

Sonication:

33.6gm pellet was suspended in 500ml of 5OmM phosphate buffer (pH 7.5) and 5ml of

0.5mM EDTA pH 8.0, 500μl of IM DTT, 200 μl of I M PMSF and 200μl of I M benzamidin HCl was added. The resulting cell suspension was separated into 250ml aliquots and sonicated for 8 minutes using 50% amplitude, 0.5 cycle time, probe dia 10mm, approx. 80mm long (Cat. -No. 8535671 ) in LABSONIC M sonicator. Subsequently, 125 ml of lOOmg/ml lysozyme was added to the suspension and sonication was repeated twice under same conditions with an interval of 5 minutes. After sonication of the second aliquot under identical conditions, the suspensions were pooled together and 5 ml of 200mg/ml streptomycin sulphate was added and left in ice for 30 minutes. The samples were centrifuged for 30 minutes at 12500 rpm and 4 ⁰ C in a Beckman coulter centrifuge and the supernatant was stored at 4C until further use. Protein concentration was estimated using the BIORAD dye concentrate as recommended by the supplier. Larger pellets were disrupted using dynomill (Multilab, Willy A. Bachofen AG, Switzerland) as recommended by the supplier.

Enzyme Immobilization:

250 ml of enzyme solution containing 4.8 mg/ml of protein was made up to 300 ml with an addition of 50 mL of 4M potassium phosphate buffer (pH 7.5) and added to 50gm of Eupergit CM matrix for immobilization and left at 25 ⁰ C. After 36 hours, the suspension was filtered through cloth and stored at 4 ⁰ C after washing thoroughly with

Millipore water. The immobilized matrix is used in the deacetylation of cephalosporins, which is covered in our co-pending application (479/CHE/2007). For example, 7-

Amino cephalosporanic acid was dissolved in water using bases such as sodium hydroxide, sodium bicarbonate, ammonia or sodium carbonate. To the reaction mass enzyme esterase described herein was added and the pH was maintained 7.2- 7.8 till completion of reaction, after completion of reaction the reaction mass optionally diluted with oraganic solvent like acetone, THF, iso-propyl alcohol and pH was adjusted using acid like formic acid, acetic acid, dil HCl and the like to yield deacetylated 7-ACA (HACA).

Assay for activity screening:

The pellets were thawed and enzyme from expressed clones was released using bugbuster reagent. The deacetylation reaction was assayed with 40 μl of 10% 7-ACA

solubilized using aqueous ammonia, in 80 μl of 100 mM k-PO ₄ buffer at pH 8.0. The progression of reaction was analyzed colorimetrically and short-listed isolates were reconfirmed using HPLC.

Colorimetric analysis:

For colorimetric analysis, 2 μl of pH indicator dye neutral red was added to the assay reaction and the progression of reaction was monitored by change in color at 560 nm.

HPLC analysis; All HPLC data was collected on Shimadzu 2010C. Ci ₈ Inertsil ODS-3V column was equilibrated with isocratic buffer containing 1.44 g of ammonium dihydrogen orthophosphate in 500 ml water, 2g of tetraheptylammonium bromide in 250 ml acetonitrile and 250 ml methanol. 20 μl of sample was injected and the components were monitored using 254 nm. The assay components were eluted using buffer B containing 100% acetonitrile, to buffer A at a ratio of 20:80. The retention times of the compounds at a flow rate of 1.5 ml/min are 4.0 mini and 5.5 min for HACA and 7-ACA respectively.

Table-1: Deacetylation of 7-ACA by esterase from Bacillus subtilis strains - Activity comparison

Mutation ID HACA Protein Concentration Units μmol/min (μg) μmol/mg/min MTCC 121 /wild 0.12 5.3 23.1

ATCC 6633/wild 0.20 , 6.5 31 .0

MTCC 121 /R231G 0.58 7.7 76.3

MTCC 121 /Y222H/D43G 0.44 5.2 83.7

MTCC 121 /M138V ^■ 0.40 5.5 73.1

From the above two table it is evident that the modified esterases are having enhanced deacetylation activity when compared to the native strain.