Related Applications

This application is related to and claims priority from Australian provisional patent application no. 2013903557, filed on 16 September 2013, the entire contents of which is incorporated herein by reference.

Field of the Disclosure

The present disclosure relates generall to methods for transcriptional interference. More specifically the disclosure relates to methods and agents for modulating (increasing or decreasing) transcription of a gen or a set of genes with -transcriptional interactions, wherein the modulation is mediated by the inhibition of transcription of a target gene within the same set of interacting transcription units (SITRUS).

Background

Gene transcription requires multiple and complex interactions between nucleic acids and various proteins. Much has been elucidated regarding the initiation and process of transcription, yet by comparison our understanding of the mechamsms that can mediate changes in transcri ption of genes remains rel atively poor .

The elucidation of gene interactions and mechanisms by which transcription is mediated would provide opportunities to develop novel means of modulating transcription, improving our understanding of gene function and ultimately manipulating transcription in order to treat disease.

Summary

Broadly speaking, described herein are methods for identifying sets of interacting transcription units (SITRUS) in which the transcription of one gene (transcription unit) interferes with the transcription of another gene (transcription unit) within the set. Described herein are methods based on interfering with t nscription within the SITRUS, termed SITRUS interference (SITRUSi). One application of the described methods is the transient transcriptional interference (ΤΤΪ) of the SITRUS using siRNA.

A first aspect of the present disclosure provides a method for selectively modulating the transcription of one or more genes in a set of interacting transcription units, wherein the set of interacting transcription units also comprises a target gene, the method comprising interfering with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene, whereby inhibiting transcription of the target gene results in modulation, of transcription of said one or more genes in the set of interacting transcription units.

In one embodiment, interfering with a portion of the transcribed region of the target gene comprises using an agent capable of interacting vvith a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene.

In one embodiment, modulating transcription of said one or more genes in the set of interacting transcription units comprises increasing transcription of said genes compared to transcription levels in the absence of said agent.

In an alternate embodiment, modulating transcription of said one or more genes in the set of interacting transcription units comprises decreasing transcription of said genes compared to transcription levels in the absence of said agent.

In a particular embodiment, at least one of the genes in the set of interacting transcription units, the transcription of which is to be modulated, is a non-coding RNA gene. The non- coding RNA gene may be a long non-coding RN A (incRNA) gene.

The porti on of the transcribed region of the target gene with which the agent interacts to effect inhibition of tra scription of the target gene may compris sequence from an intron or a exon or from an exon-exo boundary. In a particular embodiment the portion comprises sequence from an ex on.

In an embodiment, a sequence of at least one of the genes, the transcription of which is to be modulated, overlaps a portion of the transcribed region of the target gene. The sequence of the at least one gene that overlaps a portion of the transcribed region of the target gene may be a transcribed sequence.

In an embodiment, a regulatory sequence of at least one of the genes, the transcription of which is to be modulated, i s overlapped by a portion of the transcribed region of the target gene or one of the other genes (or transcription units) within the set of interacting transcription units. The regulatory sequence may comprise, for example, a long-range or short-range regulatory element such as an enhancer or promoter.

In a particular embodiment, the overlap comprises the portion of the transcribed region of the target gene with which said agent interacts to inhibit transcription of the target gene. This sequence overlap may be naturally -occurring or may be engineered.

I an alternative embodiment, the non-overlap region comprises the portio of the transcribed region of the target gene with which said agent interacts to inhibit transcription of the target gene.

In a particular embodiment, the agent capable of interacting with a portion of the transcribed region of the target gene is an anti sense oligonucleotide complementary to said portion of the transcribed region of the target gene. The antisense oligonucleotide may be a short interfering RN A (siRN A).

A. second aspect of the disclosure provides a method for determining if one or more genes belongs to a set of interacting transcription units, the method comprising interfering with a portio of the transcribed region of the target gene to effect inhibition of transcription of the target gene, whereby modulation of transcriptio of said one or more genes resulting from inhibitio of transcription of the target gene is indicative of the one or more genes belonging to a set of interacting transcription uni ts. In. one embodiment, interfering with a portion of the transcribed region of the target gene comprises using an agent capable of interacting with, a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene.

A third aspect of the discl osure provides a method for evaluating the function of a gene in a set of interacti g transcription units, wherein the set of interacting transcripti on units also comprises a target gene, the method comprising interfering with a portion of the transcribed region of the target gene to effect inhibition of transcriptio of the target gene, whereby inhibiting transcription of the target gene results in modulation of transcription of said one or more genes in the set of interacting transcription units, whereby modulation of transcription of the gene results in an observable or measurable effect indicative of the functi o of the gene.

In one embodiment, interfering with a portio of the transcribed region of the target gene comprises using an agent capable of interacting with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene,

A fourth aspect of the disclosure provides a method for selectively increasing expression of a first gene or gene product, wherein the first gene resides in a set of interacting transcription units that also comprises a second, target gene, the method comprising interfering with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene, whereby Inhibiting transcription of the target gene results in an increase in transcription of the first gene.

In one embodiment, interfering with a portion of the transcribed regio of the target gene comprises using a agent capable of interacting with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene.

A fifth aspect of the disclosure provides a method for selectively decreasing expression of a first gene or gene product, wherein the first gene resides in a set of interacting transcription units that also comprises a second, target gene, the method comprising interfering with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene, whereby inhibiting transcriptio of the target gene results in a decrease in transcription of the first gene.

In one embodiment, interfering with a portio of the transcribed region of the target gene comprises using an agent capable of interacting with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene.

A sixth aspect of the disclosure provides a method for treating or preventing a disease or condition associated with expression of a first gene in a subject, the method comprising interfering with a portion of the transcribed region of a second, target gene in the subject, or in a ceil or tissue sample derived from the subject, to effect inhibition of transcription of the target, gene, whereby inhibiting transcriptio of the target gene results in modulation of transcription of the first gene, wherein the first gene and the target gene form part of a set of interacting transcription units, and wherein modulation of transcription of the first gene results in a change in expression such that the disease or condition in the subject is treated.

I one embodi ment, interfering with a porti on of the transcribed region of the target gene comprises administering to the subject, or to a cell or tissue sample derived therefrom, an agent capable of interacting wit a portion of the transcribed region of the target gene to effect inhibi tion of transcription of the target gene.

The disease or condition may be associated with aberrant expression of the first gene. Modulation of transcription of the first gene may comprise an increase in transcription of the first gene. Alternatively, modulation of transcription of the first gene may comprise a decrease in transcription of the first gene.

Brief Description of the Drawings

Aspects and embodiments disclosed and exemplified herei n are illustrated, by way of non- limiting example only with reference to the following drawings. Figufe 1. Genomic organisation of the TO SPEAK locus, A. Schematic of the genomic region spanning inversion inv(8)(q22.2q.23.3) breakpoints in family KF2-01 (Tassabehji el al., 20G8). Horizontal arrows represent genes. Vertical arrows represent GDF6 enhancers. B. TOSPEAK gene structure with familial breakpoint, i 4 ^th intron.

Figure 2. Genomic configuration of the overlap region between the TOSPEAK and SMALL TALK genes.

Figure 3. Gene expression in KF2-01 family fibroblast eel! cultures compared with five age and gender matched unaffected controls.

Figure 4. Comparative QPCR expression analysis following siRNA knockdown of TOSPEAK.

Figure 5. SMALLTALK -expression analysis in normal fibroblasts over 72 hours exposure to siRNA-Sl using QPCR.

Figure 6. Expression analysis of SMALLTA LK, TOSPEAK and GL F6 in normal human fibroblasts over 72 hours exposure to siRNA-SI using QPCR.

Figure 7. SMALLTALK expression analysis in normal human fibroblasts over 72 hours exposure to siRMA-Sl, siRNA-S2 and siRNA-S , respectively, using QPCR.

Figure 8. SMALLTALK, TOSPEAK and GDF6 expression in normal human fibroblasts over 72 hours exposure to slRNA-S l, siRNA-S2 and siKNA-.S3, respectivel from separate experiments expressed as the mean .

Figure 9. SMALLTALK, TOSPEAK and GDF6 expression in patient (KF2-01 family) fibroblasts over 48 hours exposure to different concentrations of siR A-S2.

Figure 10. Genomic configurati on of the TTNNA3 and . LRRTM3 genes. Figure 11. CTNNA3 and LMJUM3 expression in H4 cells over 24 hours exposure to stKNA-Cl or siRNA-Ll .

Figure 12. CTNNA3 and I RRIM3 expression in H4 cells over 24 hours exposure to siRNA-Cl, siRNA-C2, siRNA-C3, si.RNA-C4, siRNA-C5, siRNA-Ll, siRNA- or siRNA-L2.

Figure 13. Genomic configuration of the IMMP2L and LRRN3 genes.

Figure 14. IMMP2 and LR N3 expression in an astrocyte cells in culture 24 hours following exposure to iMV/P2L-specifIc siRNAs (siRNA-lMl & siRNA-IM2).

Detailed Description

The reference in this specificatio to an prio publication (or information derived from it), or to any matter which is known;, is not, and should not be taken as an. acknowledgment or admission or any form of suggestion that that prior publication (or information derived from it) or know matter forms part of the common general knowledge in the field of endeavour to which this specification relates.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the ineiusion of a stated element or integer or method step or group of elements or integers or method steps but not the exclusion of any other element or integer or method step or group of elements or integers or method steps.

As used in the subject specification, the singular forms "a", "an" and "the" include plural aspects unless the context clearly dictates otherwise. Thus, for example, reference to "a agent" includes a single agent, as well as two or more agents; reference to "the disclosure" includes a single and multipie aspects described in the disclosure; and so forth. All aspects disclosed, described and/or claimed herein are encompassed by the term "invention". Such aspects are enabled across the width of the present invention. Tire term "inhibiting" and variations thereof as used herein do not necessaril imply the complete inhibitio of transcription. Rather, the inhibition may be to an extent, and/or for a time, suffi cient to produce the desired effect. For example, an inhibition of transcription may compri se interference of transcription resulting in a reduction in the normal level of transcription for a short period of time.

The term "transcription unit" as used herein refers to any region of DNA or RNA comprising sequence that is transcribed or capable of being transcribed. Without limitation, transcriptio units include protein coding genes, non-coding genes, IncR A genes, IncRNAs, mlRNAs, and other small R As, A transcription unit may include non- transcribed sequences such as regulatory sequences, for example promoters and enhancers.

The phrase "set of interacting transcriptio units" as used herein means a group of two or more transcription units, wherein the interaction is by virtue of the transcription of one member of the set bei ng able to modulate, di rectly or indirectl the transcription of one or more other members of the set. The coding sequences or regulatory sequences of two or more members of the set may overlap. The phrase "set of interacting transcription units ¹ ' may be used interchangeably herein with "transcriptional complex".

The term "gene" refers to any transcription unit within the genome, whether encoding an RNA molecule or a peptide or polypeptide.

The terms "transcription" and "expression" may, in some circumstances that will be readily apparent to the person skilled in the art, be used interchangeably. For example, this di scl osure relates to agents and methods that modulate transcription of genes in the nucleus which can be evidenced by changes in expression of their mRNA transcripts in the cytoplasm.

The term "interfering", and variations thereof such as "interfere" and "interferes" as used herein is to be gi ven its broadest interpretation, referring to any means of interfering with a portion of the transcribed portion of a target gene to effect inhibitio of transcription {transcriptional interference) of the target gene. "Interfering" may include direct or indirect interference, including direct or indirect interaction with, deletion of a portion of, insertion of sequence into, or other manipulatio of alteration of a sequence within, a transcribed region,

The term "interacting", and variations thereof such as "interact" and "interacts" as used herein with reference to an agent capable of "interacting" with a portion of the transcribed region of target gene, is to be given its broadest interpretation. The agent may be capable of interacting directly or indirectly with the portion of the transcribed region. Moreover "interact" in this context includes not only an agent capable of binding, directly or indirectly, with a portion of the transcribed region, but also an agent capable of inserting into, or deleting, a portion of the transcribed region, or otherwise interfering with a portion of the transcribed region in order to effect transcriptional interference.

The term "modulating", and variations thereof such as "modulation" and "modulates" as used herein refer to an alteration in the transcription of a gene within a set of interacting transcription units resulting, directly or indirectly, from the inhibition of transcription of the target gene, when compared to transcription in the absence of inhibition of transcription of the target gene. The alteration in transcription of the gene may result in an increase or a decrease in expression of any degree.

The term "inhibiting" and variations thereof such as "inhibition" and "inhibits" as used herein do not necessarily imply the complete inhibition of the speci fied event. Rather, the inhibition may be to an extent, and/or for a time, sufficient to produce the desired effect. Inhibition may be any prevention, retardation, interference, reduction or other disruption or hindrance. Thus, inhibition of transcription of a target gene in a set of interacting transcription units need not necessarily completely inhibit transcription, but rather prevent, retard, interfere with or disrupt transcription sufficiently to effect a modulation of transcription of one or more other genes within the set of interacting transcription units,

The term "transcribed region" as used herei with reference to a target gene refers to a. transcribed region of the target gene within the nucleus, being either a region of a nascent RNA transcript (spliced or unspliced), or a region of a primaty RN A transcript, or a region of D A within the gene being transcribed.

As used herein the term "associated with" when used in the context of a gene "associated with" a disease or condition means that the disease or condition may result from, result in, be characterised by, or otherwise associated with, directly or indirectly, expression of the gene.

The term "subject" as used herein refers to mammals and includes humans, primates, livestock animals (eg. sheep, pigs, cattle, horses, donkeys), laboratory test animals (eg. mice, rabbits, rats, guinea pigs), companion animals (eg. dogs, cats) and captive wild animals (eg. foxes, kangaroos, deer). Typically, the mammal is human or a laboratory test animal. Eve more typically, the mammal is a human.

As used herein the terms "treating", "treatment", "preventing" and "prevention" refer to any and all uses which remedy a disease or condition or at least one symptom thereof, prevent the establishment of a disease or condition, or otherwise prevent, hinder, retard, or reverse the progression of a disease or condition or other undesirable symptom (s) in any way whatsoever. Thus the terms "treating" and "preventing ¹¹ and the like are to be considered in their broadest context. For example, treatment does not necessarily imply that a patient is treated until total recovery. In diseases or conditions which displa or a characterized by multiple symptoms, the treatment or prevention need not necessarily remedy, prevent, hinder, retard, or reverse all of said symptoms, but may prevent, hinder, retard, or reverse one or more of said symptoms, in the context of some diseases and conditions, methods of the present disclosure involve "treating" the disease or condition in terms of reducing or ameliorating the occurrence of a highly undesirable event associated with the disease or condition or an irreversible outcome of the progression of the disease or condition but may not of itself prevent the initial occurrence of the event or outcome. Accordingly, treatment includes not only amelioration of the symptoms of a particula disease or condition, but also preventing or otherwise reducing the risk o developing a particular disorder. The inventors describe and exemplify herein the existence of sets of interacting transcription units in which genes are able to mediate transcriptional interference of other genes within the same set of interacting transcription units ( termed herein 'SITRUS '). For the first time it is show herein that short exogenous anti sense RNA molecules complementary to transcribed regions (in particular exons) of a target gene can not only cause RNA interference (RNAi) of the target mRNA. within the cytoplasm, more commonly termed post transcriptional gene silencing, but that they can also directl interfere with transcription of the target gene and indirectly modulate transcription of surrounding genes within a give SITRUS, whether transcribed from the same or the opposite DNA strand as the target gene.

Described and exemplified herein is a previously unknown affect and function for small siRNAs in the biology of the cell and for the modulation of gene transcription and gene expression. The affect and function of siRNAs described herein is separate and distinct from those previously described such as post-transcriptional gene silencing (PTGS) or RNA interference (RNAi), transcriptional gene silencing (TGS) and transcriptional gene acti ation (TGA).

Exogenous siRNAs have most commonly been used in methods for direct interference of a target mRNA (RNAi) withi the cytoplas of the cell, with the aim of reducing the level of the target mRNA within the cytoplasm (also commonly referred to as reducing gene expression or down-regulating target gen expression). siRNA methods of RNAi involve the design of exogenous siRNA complementary to the target mRNA sequence so as to induce siRNA recognition mediated degradation of the target mRNA molecules within the cytoplasm. Such methods of siRNA mediated RNAi. (commonly referred to as reducing or down-regulating gene expression) are more appropriately referred to as post transcriptional gene silencing (PTGS). PTGS using exogenous siRNAs is transient in its affect.

Exogenous siRNAs have also been used for indirect interference (silencing) of transcription of a gene (referred here as the first gene) within the nucleus in a: method known as transcriptional gene silencing (TGS). For TGS, siRNAs are designed complementary to a target non-coding R A sequence that overlaps the promoter or 3 ' terminus of the first gene, so that siRNAs recognise and bind the non-coding RNA sequence at the site of overlap with the promoter or 3' terminal sequence of the first gene, thereby silencin transcription of the first gene. This mode of TGS using exogenous siRNAs is associated with chromatin modifications and/or .epigenetic modifications of the DNA. causing an enduring or permanent (not a transient) form of TGS .

Exogenous siRNAs have also been used for indirect interference (activation) of transcription of a gene (referred here as the first gene) within the nucleus in a method known as transcriptional gene activation (TGA). For TGA, siRNAs are designed complementary to a target non-coding RNA sequence that overlaps the promoter or 3 " terminus of the first gene, so that siRNAs recognise and bind the non-coding RNA sequence at the site of overlap with the promoter or 3' terminal sequence of the first gene, thereby activating transcription of the first gene. This mode of TGA using exogenous siRNAs is associated with chromatin modifications and/or epigenetic modifications of the DNA causing an enduring or permanent (not a transient) form of TGA.

In contrast to these previousl described affects and functions^ the inventors describe herei for the first time that exogenous siRNAs directly recognise target gene sequences within the nucleus and thereby inhibit functions (eg, transcriptional interference) of these target gene sequences within the nucleus. The inventors describe and exemplify herein that exogenous siRNAs can directly interfere with transcription and interfere with transcriptional interference functions of a target gene, siRNAs composed of sequence complementar to a target gene or its nascent (or primary) transcript interfere with transcript overlap interactions and/or cause direct transcriptional interference of the target gene. Thus, administration of an agent capable of interacting with a portion of the transcribed region of a target gene, such as an si RNA, may cause both post-transeriptional gene silencing (RNAi) of the target gene and direct transcri tional nterference, of the target gene. Where the target gene is part of a larger set of interacting transcription units (SITRUS) it is possible to monitor the agent-mediated direct transcriptional interference of the target gene based on changes (increases or decreases) in the transcription and expressio of other tra scription units within the same SITRUS. Accordingly, disclosed herein is a novel approach to modulating transcription of genes, referred to here as Transient Transcriptional interference, or TTi, wherein inhibition Of transcription of a target gene can be used to modulate (increase or decrease) the transcription and expression of one or more other genes within the same SITRUS as the target gene.

In one aspect the present disclosure provides a method for selectively modulating the transcription of one or more genes in a SITRUS, wherein the set of interacting transcription units also comprises a target gene, the method comprising interfering with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene, whereby inhibiting transcription of the target gene results in direct modulation of transcription of said one or more genes in the same SITRUS as the target gene. In particular embodiments, interfering with a portion of the transcribed region of the target gene comprises using an agent capable of interacting with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene.

In further aspects the present disclosure provides methods for selectively increasing (or decreasing) the transcription and expression of a first gene or gene product, wherein the first gene resides in a SITRUS that al o comprises a second, target gene, the method comprising interfering with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene, whereby inhibiting transcription of the target gene results in a direct increase (or decrease) in transcription of the first gene. In particular embodiments, interfering with a portion of the transcribed region of the target gene comprises using an agent capable of interacting with a portion of the transcribed region of the target gene to effect inhibition of transcription of the target gene.

As disclosed and exemplified herein, by exploiting a hitherto unappreciated endogenous mechanism for regulation of gene transcription, the methods of the present disclosure are generally applicable across a wide variety of genes, cell types, organisms, and conditions, and offer a raft of opportunities to be exploited. Broadly speaking, the present disclosure has significant implications for defining and interpreting gene function within larger sets of interacting transcription units and significant implications for the design and interpretation of gene knockout protocols, small RNA mediated knockdown protocols and their associated applications in understanding gene function, advancing gene therapy as well as in their use for the targeted investigation and manipulation of transcription units in the treatment of disease and/or the production of proteins in vitro. Embodiments of the present disclosure also have application in interpreting genome-wide association studies and genome linkage studies as they relate to diseases, predispositions and traits more generally, and in interpreting nucleotide sequence conservation and function and genomic structural conservation as they relate to gene expression, molecular evolution, development, disease and production.

Accordingly, an aspect of the present disclosure provides a method for treating or preventing a disease or condition associated with expression of a first gene, the method comprising interfering with a portion of the transcribed region of a second, target gene in the subject, or in a cell or tissue sample derived from the subject, to effect inhibition of transcription of the target gene, whereby inhibiting transcription of the target gene results in the direct or indirect modulation of transcription of the first gene, wherein the first gene and the target gene form part of a SITRUS, and wherein modulation of transcription of the first gene results in a change in expression such that the disease or condition is treated. In a particular embodiment, interfering with a portion of the transcribed region of the target gene comprises administering to the subject, or to a cell or tissue sample derived therefrom, an agent capable of interacting with a portion of the transcribed region of the target gene to effect inhibiti on of transcription of the target gene.

The present disclosure also offers novel opportunities for examining and evaluating gene function. Accordingly, another aspect of the disclosure provides a method for evaluating the function of a gene in a set of interacting transcription units, wherei th set of interacting transcription units also comprises a target gene, the method comprisi g interfering with a portion of the transcribed region of the target gene to effect i nhibition of transcription of the target ge e, whereby inhibiting transcription of the target gene results in the direct or indirect modulation of transcription of said one or more genes in the set of interacting transcripti on units, whereby modulation of transcription of the gene(s) results in an observable or measurable effect indicative of the function of the gene(s). In a particular embodiment, interfering with a portio of the transcribed region of the target gene compri ses using an agent capable of interacting with a portio of the transcribed region of the target gene to effect inhibiti on of transcripti on of the target gene.

Typically the inhibition of the target gene is transient in nature, with transcription of the target gene inhibited for a time and or degree sufficient to effect a modulation of transcription of one or more other genes within the set of interacting transcription units. Exemplary agents suitable for achieving such transient inhibition of transcription are described herei below. The agent may inhibit transcription of the target gene by interacting directly with a portion of the transcribed region of the target gene, for example as with the application of exogenous siRNAs as exemplified herein.

SIT US ca also be evaluated and modulated using permanent approaches to transcri ptional interference that alter, rather than interact with, regions of the transcription uni t thereby inhibiting transcription of the target gene.

SITRUS can also be evaluated using more enduring or permanent inhibition of transcription of the target gene which ca t be achieved by, for example, transgenic integration within a host genome of an expression vector that expresses the agent of transcriptional interference, transposon insertion into a transcribed portion of the target gene, or the deletion or 'knock-out ^* of essential transcriptional sequences from a transcribed portion of the target gene, for example, by deleting a portion of the promoter or start site or a portion of the transcribed region within an intron or an exon, or a region that spans an intron-exon boundary.

Exogenous siRNA mediated direct transcriptional interference and post-transcriptional gene silencing (RNAi) are both direct and transient in nature and dependent on siRNA concentration. In the example provided herein, siRNA mediated direct transcriptional interference peaks prior to and is inversely correlated with peak post-transcriptional gene silencing presumably as a function of decreasing siRNA concentration during the post- transcriptional gene silencing process. To achieve more enduring direct transcriptional interference (and post-transcriptioiial gene silencing) of a target gene a variety of approaches may be employed, including permanently transfeeted vectors expressing an siRNA (or other suitable agent) complementary to the target gene or its nascent transcript (spliced or unspliced) or primary transcript.

The agent may inhibit transcription of the target gene by disrupting the transcription process, for example, by introducing an early termination signal. The portion of the transcribed region of the target gene with which the agent interacts may, for example, comprise sequences from an mtroft or an exon, or may span an intron-exon boundary. However in particular embodiments the agent targets sequences within an exon. Where the agent is an antisense oligonucleotide, such as a siRNA. for example, the oligonucleotide may be complementary to a sequence derived from withi an exon or derived from a sequence from across an exon-exon boundary.

Typically within a SITRUS the transcribed region of the target gene overlaps (either on the same or opposing strands) with the transcribed sequences or regulatory' sequences of at l east one of the genes of the SITRUS, the transcription of which is to be modul ated. The agent that inhibits transcription of the target gene may be designed to interact with transcribed sequences of the target gene residing within or outside this overlap region. Where no such overlap exists, overlapping sequences between the target gene and a gene, the transcription of which is to be modulated, may be engineered using a method known to those skilled in the art so that an agent may then be generated and used to interact with the engineered overlap region.

Those skilled in the art will appreciate that a range of suitable methods exist for transiently or permanently inhibiting transcription of a target gene may be employed in accordance with embodiments of the present disclosure, and the scope of the present disclosure is not limited by the selection of -any one particular method. Suitable agents capable of directly or indi rectly interacting with a portion of the transcribed region o a. gene and thereby effecting transcriptional interference include antisense oligonucleotides. Antisense oligonucleotides may be prepared by methods well known to those of skill in the art. Typically oligonucleotides will be chemically synthesized on automated synthesizers. Those skilled in the art will readily appreciate that antisense oligonucleotides need not display 100% sequence complementarity to the target sequence. One or more base changes may be made such that less than 100% complementarity exists whilst the oligonucleotide retains specificity for its target and retains inhibitory activity against this target,

Antisense oligonucleotide sequences may have a length of about 20 to 40 nucleotides, but may range in length from about 20 to about 200 nucleotides. The skilled person ca select an appropriate target sequence and an appropriate length of antisense nucleic acid in order to have the desired effect by standard procedures known to the art, and as described, for example, in Methods in Enzymology, Antisense Technology, Parts A and B (Volumes 313 and 314) (M, Phillips, ed.. Academic Press, 1999). The oligonucleotides for use in accordance with aspects and embodiments disclosed herein may comprise a variety of sequence and structural modifications as will be well understood to those skilled in the art. For example, particular modifications of interest include those that increase the affinit of the oligonucleotide for complementary sequences, i.e. increases the melting temperature of the oligonucleotide base paired to a complementary sequence, or increase the biostabi!ity of the oligonucleotide. Such modifications include 2'-0-flouro, 2'-0-methyl, 2 -0- methoxyethyl groups. The use of LNA, UNA, PTSfA and IMA monomers may also be employed in the oligonucleotides.

Particularly suitable antisense nucleic acids for use in accordance with the present disclosure are small interfering RNAs (siRNAs), which induce RNA. interference (RNAi). siR As are typically generated by cleavage of double stranded RNA, where one strand is identical to the message to be inactivated. Double-stranded RNA molecules may be synthesised in which one strand is identical to a specific region of the target sequence and introduced directly. siRNA molecules suitable for use in accordance with embodiments of the disclosure may be designed by any method known in the art. For example, suitable siRNA may be designed in accordance with the so-called Tuschi's Rules (see Tuschl in RNAi, guide to gene silencing, Harmon, G.J. (ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 265-295 (2003:)) and principles of rational siRN A design such as those set down in Reynolds et al., (2004) Nalwe Bi tee ml. 22: 326-330. A variety of algorithms and web-based tools are also available and well known to those skilled in the art for designing siRNAs. Examples include the application provided by the Whitehead Institute based on methods described in Bingbing et al (2004) Nucleic. Acids. Res. 32. W130-W134. siRNAs may be manufactured by methods known in the art including oligonucleotide synthesis. In some embodiments synthesized RNAi agents incorporate chemical modifications to increase half life and/or efficacy of the agent and/or allow a more robust delivery formulation. The modifications can include incorporation of a polycyclic sugar surrogate; such as a cyclobutyl nucleoside, cyciopentyl nucleoside, proline nucleoside, eyclohexene nucleoside, hexose nucleoside or a eyclohexane nucleoside; inclusion of a non-phosphorous-containing intemucleoside linkage; modification of a 2' substituent group on a sugar moiety that is not H or OH; a modified base for binding to a cytosine, uracil, or thymine base in the opposite strand comprising a boronated C and II or T modified binding base having a boron-containing substituent selected from the group consisting of— BH 2 CNj— BH3, and— BH 2 C.OOR, wherein R is CI to CI 8 alkyl; phosphorami ate intemucleoside linkages such as a 3'aminophosphoramidate, aminoalkylphosphoramidate, or aminoalkylphosphorthioamidate intemucleoside linkage; modified sugar and/or backbone modifications such as a peptide nucleic acid, a peptide nucleic acid mimic, a morpholino nucleic acid, hexose sugar with an amide linkage, cyclohexenyl nucleic acid (CeNA), or an acyclic backbone moiety; or a 3' terminal cap group.

Other agents useful in the present disclosure include DNA-directed RNAi (ddRNAi) agents. ddRNAi agents comprise an expression cassette or ddRNAi expression cassette typically comprising at least one promoter, at least one ddRNAi sequence and at least one terminator in a viral or non-viral vector.

Agents useful in the present disclosure can he synthetically or enzymatically produced and purified by any protocol known to those skilled in the art using standard techniques as described in. for example, Sambrook, et al. Molecular Cloning; A Laboratory Manual, 2 ^tld Ed., Cold Spring Harbour Press, Cold Spring Harbour, N.Y, (1989), Alternatively eorresponding dsDNA can be employed, which, once presented intracelluiarly is converted into dsRNA.

A variety of methods may be used to deliver nucleic acid-based agents into cells, including transfection or direct injection into cells, optionally enhanced using hydrophobic or cationic carriers. Cells can be perraeabilized before being contacted with the agent. As will also be known to those skilled in the art, cationic lipids such as lipofectamine and polymers such as polyethylenimine may be used to facilitate delivery. In one embodiment agents may be delivered directly to cells for example by transfection or may be delivered by use of viral or non-viral vectors capable of infecting or otherwise transfeeting target cell. The vectors can thus deliver and express agents in situ. The agents may, for example, be transcribed as short hairpin RNA (shRNA) precursors from a viral or non-viral vector. After transcriptio the shRNA are processed by the enzyme Dicer into the appropriate active agents, such as siRNA. Viral vectors typically exploit the tissue specific targeting properties of viruses and once appropriately targeted rely upon the endogenous cellular machinery to generate sufficient level s of the agent.

Agents may typically be administered in accordance with the present disclosure in the form of pharmaceutical compositions, which compositions typically comprise one or more pharmaceutically acceptable carriers, excipients or diluents. Such compositions may be administered in any convenient or suitable route such as by parenteral, oral, nasal or topical routes. The skilled addressee will appreciate that any suitable dosage form and route of admini stration may be employed in accordance with the present disclosure.

Examples of pharmaceutically acceptable carriers or diluents are demineralised or distilled water; saline solution; vegetable based oils such as peanut oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oil, arachis oil or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and methyl phenyl polysoipoxane; volatile silicones; mineral oils such as liquid paraffin, soft paraffin or squaiane; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxymethylcellulose, sodium carboxymethyl cellulose or hydiOxypropylmethylcellulose; lower aikanols, for example ethanol or iso-propano!; lower aralkan ^' ols; lower poly alkyl en e glycols or lower alkyiene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1 ,3-butylerie glycol or glycerin; fatty acid esters such as isopropyl palmifate, isopropyl myristate or ethyl oleate; polyvinyl ymdone; agar; earrageenan; gum iragacanth or gum acacia, and petroleum jelly. Typically, the carrier or carriers will form from 10% to 99,9% by weight of the compositions.

Those skilled in the art will appreciate that aspects and embodiments of the present di sclosure described herein have a large number of potential applications, including but not limited to: methods for defining and interpreting gene function within (and without) larger sets of interacting transcription units; methods for improved design and interpretation of gene knockout protocols, small RNA mediated knockdown protocols and their associated applications in understanding gene function and advancing gene therapy and in their use for the targeted investigation and manipulation of transcription units in the treatment of disease and/or the production of proteins in vitro; methods for improved interpretation of genome-wide association studies and linkage studies as the relate to diseases, predispositions and traits more generally; methods for disease gene discovery; methods for establishing the existence of a SITRUS; methods fo evaluating and modulating transcription within a SITRUS; methods for evaluating and modulating the function of a SITRUS; methods for decreasing or increasing the levels of specific proteins;

methods for evaluating transcriptional interference; methods for desig and evaluation of small direct transcriptional interfering RNAs fdtiR As); methods for evaluating transcriptional interference from small RNAs; methods for testing, proving and validating micro-R A function and target specificity; methods for testing, preying and validating endogenous small RNA function; methods for testing, proving and validating endogenous small RNA target specificity; methods for characterisation of the function of non-coding genes; methods for characterisation of function of DNA long-range regulatory elements; method to modulate the function of DNA long-range regulatory' elements; methods for switching on or off gene enhancers; methods for experimental design to evaluate/modulate the activity/specificity of DNA/RNA regulatory elements; methods to evaluate and modulate the biological response to transcriptional i terference; methods for experimental desig for interrogation and modulation of genome function; methods to interrogate and modulate function of intervening sequences; methods of diagnosis, detection & treatment of genetic deficiencies; methods to evaluate and modulate the transcriptional interrelationship between overlapping transcription units; methods for SNP functional analysis; methods for mutation analysis; methods for translocation analysis; methods for IncRNA function analysis; and methods for improved understanding of genetic sequence conservation and genomic structural conservation as they relate to molecular evolution, development, disease, traits and production.

Those skilled in the art will appreciate that aspects described herein are susceptible to variations and modifications other than those specifically described. It is to be understood that these aspect include all such variations and modifications. The disclosure also includes all of the steps features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.

Aspects taught herein are now described with reference to the following specific examples, which should not be construed as in any way limiting the scope of the invention .

Examples

Table 1. Oligonucleotide primer and siRNA sequences used in the studies described herei (synthesised by Invitrogen Australia Pty Lid)

Description Sequence (5' - 3*) SEQ ID

No

Primers

GDF6 - forward CCTGTTGCTTGTTTGGTTCA

GDF6 - reverse GCTGTCCATTTCCTCTTTGC

SMAIJ ALK - forward AGTAGGGAGCGGAACCAAG

SMALLTALK - rever TTGTCCAAGTTGGGCTCTTC

TOSPEAK (exon 6)- reverse GCAGGTCCTTGAATCCCTCATGGCCAT

TOSPEAK (exon 9j- forward TATGCTTCACAGGTGTTTCT

TOSPEAK! (exon 8}~ TG ^' GCAGTTCCATCATTTGAA

forward

TOSPEAK! (exon 9)- reverse AGGAOAAACACCTGTGAAGCA 8

T0SPEAK2 (exon 9)~ AGCTCTC CTGGC ATACTCTG A 9

forward

TOSPEAK2 (exon 9)- reverse CCCAGATCGGATGAGACATA 10

I8S r NA - forward GTAACCCGTTGAACCCCATT 11

18S rRNA - reverse CCATCCAATCGGTAGTAGC 12

GAPDH - forward CCACCCATGGCAAATTCCATGGCA

GAPDH - reverse TCTAGACGGCAGGTCAGGTCCACC 14

LRR7M3-fom∞d G A ATACGC AG ACTC A A A GAG 31

LRRTM' B- reverse TTCCGTAAATTTGTCACAGG 52

CWNA3- forward AAAT GTCAAATTGCAGCC 53

CTNNA3- reverse CTTGTAATGTCATCTACGGC 54

LI IN3 -fonvwd GGCAACATTTATTTAACATGCTCCACAGC 55

LKRN3- reverse TCCATGCTTCTTCAGTATTTGCAGGA 56

7A£liP2£ -forward GCCTrCTTTGAATCCTGGG 49

./ JP2£ -reverse CCTATGGTTCTGACAATATCTCC 50 siRNAs

siRNA-S 1 (SMALLTALK CAAGCCAAGGCGAAAGAGACGCUCA I S exon 1) - sense

siRNA-S.1 (SMALLTALK UGAGCGUCUCUUUCGCCUUGGCU UG 16 exon 1) - antisense

siRNA-S2 (SMALLTALK last CCAGUGUAGCUGGAGAACUAUUGAA 17 exon) - sense

siR A-82 {SMALLTALK last UUCAAUAGUUCUCCAGCUACACIJGG 18 exon) - antisense

siRNA-S3 (.SMALLTALK last UCGCUGGGU UUGUGGUAAACAUUAA 1 exon) - sense

siRNA-S3 (SMALLTALK last UUAAUGUUUACCACAAACCCAGCGA 20 exon) - antisense

siRNA-Tl (TOSPE4K intron AUCACUGCCAGUUUCUACACCUCUG 21

I ) - sense

siKNA-Tl (TOSPEAK intron CAGAGGUGUAGAAACUGGCAGUGAU 22

./) - antisense

siRNA-T2 (TOSPEAK CCAGGCCUUGUAAAGGGCAUUUGAU 23 intron!) - sense

siRNA-T (TOSPEAK intron AUCAAAUGCCCUU UACAAGGCCUGG 24

2) - antisense

Stealth control - sense CAAGAACAGCGAGAAGCAGCCGUCA 25

Stealth control - antisens UGACGGCUGCUUCUCGCUGU UCU UG 26

Scrambled siRMA Control - GGGAAGAGGUCACAlJACCAUUCCCA 27 sense

Scrambled siRNA. Control - UGGGAAUCGUAUGUGACCUCUUCCC 28 antisense

siRNA-C l (Cl? i3 GGCACCUAACCAGGCAGAAAUGUAU 29 terminal exon) - sense

siRNA-C l (CTNNA3 AUACAUUUCUGCCUGGUUAGGUGCC 30 terminal exon) - antisense

sf NA- 2 (c ms GGUUUCCAAUGUGU UAGAGAGUUCU 31 terminal exon) - sen.se· siR A-C2 (CTNNA3 AGAACUCUCUAACACAU UGGAAACC 32 te rminal exori) ~ antisense

siRNA-C3 (CTNNA.3 UAACUGCAUGAACUG-UACCAUUGAA 33 terminal exori) - sense

S.RNA-C3 (CTNNA3 UUCAAUGGUACAGUUCAUGCAGUUA 34 terminal exori) - antisense

SJRNA-C4 (CTNNA.3 mm 8- CAGACAGCUCCGCAAGGCUAUUAUA 35

9 splice site) ~ sense

siRNA-C4 (CTNNA3 exan 8~ UAUAAUAGCCUUGCGGAGCUGUCUG 36

9 splice site) - antisense

si A-C5 (CimS exan 9- CAGGCUUGDAGAGGUGGCAAAUCUU 37

10 splice site) - - sense

siRNA-C6 (C7NNA3 exan 9- AAGAUUUGCCACCUCUACAAGCCUG 38

10. splice site) - - antisense

siRNA-L l (LRRTM CAUAAUGGGAUUCACCUCCAAAUUA 39 terminal exon) - sense

siR A-Ll (LRi fS UAAUU UGGAGGUGAAUCCCAUUAUG 40 t rminal exori) - antisense

si NA-L2 (LRRTM3 CAUGU UC AACACU UUGUCAACUGA 41 terminal exori) - sense

siRNA-L2 (LRRTM3 UUCAGUUGACAAAGUGUUGAACAUG 42 terminal exori) - antisense

SiRNA-L3 (LRRTM3 GAGCUAAUUGGGAAGAC U ACAU AA 43 terminal exoii) - sense

siRNA-L4 (LRRTM3 UUAUGUAAGUCUUCCCAAUUAGCUC 44 terminal exori) - antisense

siRNA-IMl (IMMP2L GAAGUACACCGUGGUGACAUUGUAU 45 terminal exori) ~ sense

siRNA- I {1MMP2.L AUACAAUGUCACCACGGUGUAC U UC 46 terminal exori) - antisense

SLRNA-1M2 (IMMP2L UGGUCACAUCUGGGU UGAAGGUGAU 47 terminal exori) - sense

siRNA-IM2 (IMMP2L AUCACCUUCAACCCAGAUGUGACCA 48 terminal exori) - antisense Example 1 ~ Transcriptional interference within th SMALLTALK-TOSPEAK-GDF6 transcriptional complex

Growth differentiation factor 6 (GDF6) is a bone morphogenetic protein gene that regulates cartilage and joint development in the axial and appendicular skeleton. Loss of function mutations in GDF6 result in loss of cartilage and joint fusions. Comparable cartilage and joint anomalies in the speech impaired KF2-01 family, including malformed larynx, wrist, ankle and spine joints, segregate with a translocation breakpoint 623 kb 3 ' of GDF6 indicating the likely long-range .dy singulation of GDF6 (8q22.2 breakpoint; see Fi g.

1 ).

Identification of TOSPEAK long non-coding RNA gene

RT-PCR and RACE analysis of three short expressed sequence tags (ESTs) located near the 8q22.2 breakpoint (BU570390, AIS32412 and AV713874) was carried out on a PG thermocycler (MS research) with gene specific primers. Each reaction contained 5 ul of the diluted cDNA template, 2.5 ul of lOx PGR buffer, 0, 2 ul of 25 mM dNTPs, 1 ul of each of the forward and reverse primer stocks (10 mM), 1.5 ui of 25 mM MgCl2 and 0.25 ul of AmpliTaq Gold polymerase (Applied Biosystems), The following PGR conditions were applied: initial denaturation of 94°C for 10 minutes followed by 40 cycles of 94°C for 30 seconds,. 58°C for 30 seconds and 72°C for 40 seconds and a final extension of 72°C for 15 minutes. This analysis identified a. hitherto unknown IncRNA gene, TOSPEAK, disrupted by the breakpoint (Fig. IB).

TOSPEAK is 542 kb in length with nine exons (Fig. IB) and 12 different polyadenylated transcripts. The shortest transcript (180 nucleotides) contains sequence from the first and last exons only. Stop codons are prevalent in all reading frames which are poorly conserved (GenBank Accession numbers GU295153-64) and lack homology with any recognisable protein structure suggestive of a long non-coding transcription unit. However, TOSPEAK does not display the more common characteristics of functional IncRNAs such as conserved sequence, structure, promoter and/or tissue and cell- specific expression patterns (Mattick, 2009, PLoS Genet, 5(4): p, el000459). Northern analysis of adult and neonatal tissues using a labelled cDNA probe overlapping exons 8 and 9 of TOSPFAK found low-level expression of TOSPEAK across a range of tissues (data not shown). A polyclonal antibody was generated in rabbits against a synthetic peptide (CESFLR SVALPGEVI SLLA) designed from the most abundant transcript of TOSPEAK. Using this antibody, lymphocyte cell lines were screened- by Western analysis and paraffin embedded human tissues screened using .immunohistochemistry, with both providing no evidence for an expressed protein (data not shown).

TOSPEAK is located -350 kb 3' of GDF6 (Fig. I A), A long-range enhancer (ECR5 for GDF6 (Reed and Mortlock, 2010, Dev Dyn. 239(4): p. 1047-60) can now be located within intron 6 of the TOSPEAK gem. ECR5 is a highly conserved 440 bp pharyngeal arch tissue specific enhancer that regulates GDF6 transcription in midline and laryngeal cartilage homologs during development. Using a BAC transgenic approach the present inventors identified two additional GDFfi enhancers (DJEI and DJE2), one o either side of ECR5, withi the region spanned by TOSPEAK in humans. DJEI and DJE2 regulate GDF6 transcription within the developing distal joints of the wrist and ankle (data not shown). The tissue specificities of the three GDF6 enhancers within TOSPEAK correspond precisely to the joints and cartilages affected in the KF2-01 family.

GDF6 expression

Comparative quantitative PCR (QPCR) was used to examine expression of GI1F6 in speech-impaired F2-01 family members. First-Strand cD A synthesis was performed using the SuperScriptTM.m First-Strand synthesis qRT-PC Kit (Invitrogen Cat# 11752- 050) according to manufacturer's instructions. QPCR was performed on the Rotor Gene RG-300 (Corbeit Research). For multiple reactions, a master mix was prepared including all common components, Volumes for a single 25 μ| reaction were 12.5 μΐ of Platinum® SYBR® Gree qPCR SuperMtx-UDG (Tnvitrogen Cat# 1 1733-046), 1 μΐ each of 10 μΜ primer working stocks (see Table 1), 2.5 μΐ of cD ^' NA from Step 1 (above) and DEPC- treated water added to a final volume of 25 μΐ. Reactions were incubated at 50°C for 2 min. PCR was performed using a initial denaturat on step at 94°C for 2 min and then 40 cycles: denaturation at 94°C for 15 sec, annealing at 55°C for 30 sec, and extension at 72°C for 20 sec. Identical reactions prepared from a -single master mi were prepared using primer sets specific for the gene of interest (See Table 1). Real time PCR praties for each gene of interest were normalised for variations in. the expression level of i SS ribosomal RNA. and GAPDH, and analysed using RT ^" Profiler PGR Array Data Analysis software (Versio 3.5). As shown in Fig. 3, expression of GDF6 is downregulated in affected KF2-01 family members.

The 8q22.2 breakpoint in TOSPEAK does not disturb DJE1, ECR5 or DIE2 nor was there evidence for GDF6 enhancers beyond the breakpoint. Yet the breakpoint does halt TOSPEAK transcription across DJE1, ECR5 and JE2 raising the spectre that TOSPEAK transcription may modulate GDFi) enhancer function.

SMALLTALK.

The transcribed region of the TOSPEAK gene also overlaps the transcribed region of the SMALLTALKICH()rf37 gene located on the opposing DNA strand in a head-to-bead configuration (Fig. 2), As determined by QPCR (as described above, using primers shown in Table 1), SMALLTALK expression is downregulated in the speech-impaired KF2-01 famil members (Fig. 3), suggesting that TOSPEAK transcription may also modulate the transcription of SMALLTALK.

Lramcriptional interference

The inventors then examined transcriptional interactions between TOSPEAK, SMALLTALK and GDF6 using a novel approach to transcriptional interference, Transient Transcriptional interference (TTi), which utilises direct siRNA targeting of the coding gene, SMALLTALK. siRNAs targeting exonic sequences of SMALLTALK were used (see Table 1) and the affect of these siRNAs on gene expression in primary human fibroblasts was examined.

Cell cultures

Primary fibroblasts from patients and normal control individuals were cultured in DMEM media with 10% fetal calf serum (FCS) at 37°C. At sub-confluence, cells were washed with cold PBS and then harvested using 0.5% trypsin in PBS at 37°Ό for 5min. This was then deactivated by suspension of cells in DMEM containing 10% FCS. Cells were then centrifuged at 1000 rpm for 7 rain and resuspended in DMEM without FCS before replating in preparation for treatment with siRNAs. Cells were plated into 6 well culture plates ~ 10° celts/well i 2 raL volume. Cells were incubated for 24 hrs prior to treatment with siRNAs as described below.

STEALTH siRNAs (Life Sciences Corp) were prepared at 1/10 dilution in ddH2G and stored at - 80°C. Working stocks of siRNAs were prepared at a 1/20 dilution of storage stocks in ddH2Q and stored at -8Q°C. Then 2 ,5 μΐ of the siRNA working Stock was added to media (no FCS) and incubated at RT for 10 rains. At the same time 5 ul Lipofectamine 2000 (Invitrogen Pty Ltd) was added to media (no FCS) and incubated according to manufacturer's instructions. After 20 mins siRNA mix and Lipofectamine mix were combined and added to 'treatment' welts containing fibroblasts (1 ml FCS free media + 2.5 μΐ siRN + 5μ1 Lipofectamine Reagent 2000) and incubated at 37°C for 6 hrs before the addition of 1 mL of DMEM containing 20% FCS,

After 18 hrs the cell culture medi was replaced with fresh DMEM containing 10 FCS (referred to as time zero). Ceils were then incubated for 24 hrs (Time 1), 48 hrs (Time 2) or 72 hrs (Time 3) before harvesting. Cells were harvested for real time PCR analysis and for Western analysis. To harvest celts for RNA extraction and real time PCR analysis the cell culture media was removed and adherent cells washed twice with PBS at room temperature before adding 350 μί of cell lysis buffer (2.4 ml Buffer RLT and 20 μΐ of β~ Mercaptoethanol) to each well (as per RNeasy Mini Kit, Qiagen). To harvest cells for Western analysis the cell culture media was removed and adherent cells washed twice with PBS at room temperature before adding 100 μΐ of cell lysis buffer (300 mM NaCl, ImM EDTA, 30 mM TrisCl, I proteinas inhibitor) and storing on ice for 30 minutes. siRNA knockdown of TOSPEAK also caused a decrease in GDF6 expression suggesting a regulatory relationship between, he expression of WSPEAK and GDF6 (Fig. 4). siRNA- S l, which targets coding sequences derived from exon 1 of SMAIXTALK in the overlap region with TOSPEAK, achieved effective knockdown of SMALLTALK expression in. normal primary fibroblast cultures within 72 hours (Fig. 5). By comparison, the mean expression level of TOSPEAK at 72 hours was unchanged, while GDF6 expression had increased -2.6 fold (Fig, 6). Analyses were refocussed at earlier time points on the premise that any upregulation in. GDF6 expression resulting from siRNA-Sl interference of SMALLTALK should reflect a prior change in the level of TOSPEAK transcription. At 48 hours TOSPEAK .expression had increased -2.3 fold compared -with a greater -10 fold increase in GDF6 expression levels (Fig, 6). At 24 hours, TOSPEAK and GDF6 expression had both increased dramatically -18 fold and -312 fold, respectively (Fig. 6), compared with no significant change for siRNA controls. To corroborate this result, and to help elucidate the mechanism of transcriptional interference, SMALLTALK was again targeted for knockdown using two different siRNAs (Fig. 7), siR.NA.-S2 and siRNA-S3 were designed to target sites nearer the centre of the SMALLTALK gene (coding sequences within the last exon) over 20 kb distant from TOSPEAK. siRNA-S2 and siRNA-S3 achieved comparable results to siRNA-Sl with both rapid and dramatic increases in the transcription of TOSPEAK and GDF6, respectively, withi 24 hours (Fig, 8). These results confirm that siRN A targeting of SMALLTALK affects the rapid inducti on of TOSPEAK and GDF6 transcription, independent of the stRNA-S target site within SMALL/TALK. Furthermore, the rapid induction of TOSPEAK and GDF6 transcription occurs prior to, independent o and in inverse correlation with the post-transcriptional gene silencing of SMALLTAIJC within the cytopl asm.

In addition, siRNA-S2 targeting of SMALLTALK in. primary fibroblasts from affected members of the KF2-01 family essentially reversed the downreguiated levels of TOSPEAK and GDF6, with increases of -2.6 fold and -6 fold, respectively, observed (Fig, 9) indicating the therapeutic potential of this novel approach to transcriptional ^' interference. Doubling the concentration of siRNA-S2 in these cell cultures resulted in a further rapid reductio in SMALLTALK expression together with a greater coordinate induction of TOSPEAK and GDF6 transcription (Fig. 9), consistent with a rapid yet transient phase of siRNA mediated interference of SMALLTALK transcription.

Summary

The Sq23.3 breakpoint in the speech impaired KF2-0I family disrupts the primate IncRNA gene TOSPEAK. TOSPEAK plays a central role within a comple web of transcri tional interference with two coding genes SMALLTALK and GDF6. The novel approach to siRNA mediated transcriptional interference used in this study helps to distinguish between two different yet interconnected mechanisms of transcriptional interference involving TOSPEAK. siRNA targeting of SMALLTALK results in the induction of TOSPEAK and GDF6 transcription prior to and independent of the cytoplasmic post-transcriptional gene silencing of SMAI TALK. The transcription of the SMALLTALK and TOSPEAK genes overlap and converge on opposing DNA strands yet the processed transcripts of the two genes are not anti sense which effectively rules out any transcript overlap/anti sense interference mechanism within the cytoplasm. Moreover, the rapid induction of LOSPEAK transcription (24 hrs) prior to and inversely correlated with the post-transcriptional gene silencing of SMALLTALK (72 hrs) indicates a nuclear transcriptional mechanism of interference operating between SMALLTALK, and TOSPEAK. Interestingly, siRNA-S2 dose escalation studies demonstrate a more rapid reduction in SMALLTALK expression at 24 hrs simultaneous with increased induction of TOSPEAK and GDF6 transcription suggestive of an early phase of siRNA interference with SMALLTALK transcription. Moreover, siRNA-S2 and siRNA-S3 target SMALLTALK outside the overla region with TOSPEAK thereby ruling out siRNA interference to interactions between the primary or nascent transcripts of the two overlapping genes SMALLTALK and TOSPEAK. Furthermore, the transient nature of the TOSPEAK induction indicates no pemianent epigenetic silencing of the chromatin as reported elsewhere for transcript overlap-based mechanisms of post-transcriptional gene silencing. Together these findings suggest that SMAILTALX transcription per se, not the SMALLTALK tmnscript, interferes directly with TOSPEAK transcription.. As such, without wishing to be bound by theory, the inventors propose a novel mechanism of siRNA mediated transcriptional interference wherein siRNAs directly repress SMALL/TALK transcription, possibly through transient interaction with the nascent transcript of SMALLTALK. The evidence further suggests that reduced SMALLTALK transcription per se has a direct and immediate derepression effect on TOSPEAK transcription, possibly by reducing RNA II polymerase collision events as a consequence of their convergent transcription. The consequent rapid spike in TOSPEAK transcription is accompanied by a simultaneous spike in GDF6 transcription again indicative that no permanent epigenetic silencing of the chromatin is involved. Moreover, TOSPEAK transcription in primates appears conserved despite rapid evolution of the sequence and structure of TOSPEAK transcripts and promoter. Together these findings indicate that TOSPEAK transcription per se, not the TOSPEAK transcripts), as the more likely regulator of GDF6 transcription. As such, without wishing to be bound by theory, the inventors propose a novel long-range mechanism of positive transcriptional interference between TOSPEAK and GDF6 in which TOSPEAK transcription across, and secondment of GDF6 long-range enhancers DJEl, ECR5 and DJE2 into, the transcription factory increases the incidence of enhancer coupling with the GDF6 promoter coincident with the Tooping-out' of the intervening DNA. The short transient nature of TOSPEAK and GDF6 induction in response to siRNA may be due to the titratio of siRN As in the cytopl asm resulting from progression of the post-transcriptional gene silencing of SMALLTALK after 24 hrs.

Example 2 — Tramcriptiomtl interference within the CTNNA3-LRRTM3 transcriptional complex

The LRJUM (leucine rich repeat transmembrane) protein gene family comprises 4 highly conserved members, LRRTM1-4, which encode synaptic cell adhesion molecules initiating excitatory presynaptic differentiation aid mediating post-synaptie specializations. Three of the LRRTM genes (LRRTMF3) are nested within the introns of different -catemn (CWNA) genes. LRRl&iiS, located within intron 9 of the -TNNA3 gene (Fig, 10) is associated with autism spectrum disorder (ASD). Moreover, the CTNNA3 gene is recurrently disrupted in Tourette Syndrome (TS) suggesting a role for LRRTM3 i the etiology of TS.

CTNNA3 and LRR1M3 are overlapping genes transcribed in opposite directions from the same DNA, and appear vulnerable to transcriptional interference arising from RNA Pol Π collision events. In this study, the inventors aimed to interrogate the transcriptional relationship between CTNNA3 and LRRIM3 using the novel TTi approach described herein to identify hitherto unrecognized SITRUS. Cell cultures and assays

To assess transcriptional interference between CTNNAS and LRRIMS, C.7}V/¾4-specifie and LRRJMS -specific siRNAs (Table 1 ) were used to target- the CTNNAS and LRRIMS genes in transient transfection assays using the neuroglioma cell lin H4 (ATCC HTB- 148). Briefly, H4 cells were cultured to 80% confluence in RPMI cell culture medium with 10% FCS. Cell s were trypsi.ni.sed, washed and replated at a density of 50,000 cells per well in a 12 well plate format and cultured for 24 hrs prior to siRNA transfection in FCS free medium. siRNA transfection was performed essentially as described in Example 1 with modifications described below. After 6 hrs FCS was restored to 10% and cells were incubated another 18 hrs before replacing the medium and culturing a further 24 hrs before harvesting cells at 24, 48 and 72hr time points. Assays were performed in triplicate.

RNA was prepared using the PureLink RNA minikit (Ambion by Life Technologies) according to manufacturer's instructions with 18 gauge needles and syringe to fragment DMA. cDNA was synthesized using SSIH 1st Strand QPCR Supermix according manufacturer's instructions. Comparative QPCR was performed using SYBR select Mater Mix (Life Technologies) in a 384 well MicroAmp plate format using the Vii ATM 7 Real- Time PCR system (Life Technologies) using a 384 well MicroAmp plate format for 40 cycles with 57° C annealing, essentially a described above. All assays were performed in triplicate and analysed using RT Profiler PCR Array Data Analysis software (Version 3.5).

.Remits

Transcriptional interference between CTNNAS and LRRIMS was first assessed using siRNA-Cl and siRNA-Ll. The siRNA-Cl targeting of CTNNAS caused a significant decrease in the level of CTNNAS expression after 24 hrs. This decrease was associated with a significant concurrent increase in LRRIMS expression when compared to control H4 cells (treated and untreated) (Fig. 11). In comparison, siRNA -LI targeting of LRRIMS had no significant effect on the expression level of either LRRIMS or CTNNAS compared to untreated control H4 cells (Fig. 1 1), - -

Assays were repeated, using siRNA-C2, siRNA-C3, siRNA -C4 and siRNA-CS, which target regions of CTNNA3 well clear of its nested gene LRRIM3, and siRNA-L2 and siRNA-L3, which target LRRJM3 which is located within an intron of CTNNA3, Each of siRNA-Cl, S.RNA-C2, siRNA-C3, siRNA-C4 and siRNA-C5 caused a decrease in CTNNA3 expression levels within 24 hrs concurrent wit significant rapid increases in IJIRJM3 expression levels when compared to control cells (treated and untreated) (Fig. 12). By compariso siRNA-L2 and siRNA-L3 had no significant effect on the expression level of either LRR1M3 or CTNNA3 when compared to untreated control cells. This result confirmed the specificity of siRNA targeting CTNNA3 and the associated rapid increase in expression of its nested gene L.RRTM3,

The rapidity of the LRRTM3 upregulation and the fact that the processed transcripts of these two genes are not anti sense suggested that the siRNA. targeting CTNNA3 was repressive of the transcription of CTA ^r MA3, which in turn derepressive transcriptional effect on its nested gene LRRTM3. Together these results suggest transcriptional interference between CTNNA3 and LRRTM3.

Summary

Results from this study indicate that the CWNA3 and LRRJM3 genes form a SITRUS wherein transcription of the CTNNA3 gene interferes with the transcription of the nested LRRTM3 gene transcribed in the opposite direction, TNNA.3 and its overlapping nested gene LRRTM3 are both processed coding genes transcribed in the opposite orientatio from the same DMA. LRRJM3 is transcribed from within an intron of CINNA3 wherein no antisense transcripts are generated. As such, the changes observed here in LRR1M3 expression levels occur independent of post-transcriptional antisense effects. Furthermore, the discordant expressio profiles of C1NMA3. and LRRTM3 over the time of the assays indicate their independence from all post-transcriptional affects and are thereby indicative of the direct transient transcriptional interference of LRRIM3 by CTNNA 3 transcription.

Example 3 - Transcriptional interference within the IMMP2L-LRRN3 transcriptional complex The inner mitochondrial membrane peptidase-like (IMMP2L) gene is recurrently disrupted in TS. IMMP2L contains a nested gene, LRRNS, in intron 3 (Fig. 13), and LRRNS has itself been associated with ASD. The transcriptional relationship between IMh4P2L and LRRNS was investigated using the novel TTi approach described herein.

Transection assays and comparative QPCR was performed essentially as described above, using an astrocyte cell line (gift from Dr Nadi Braidy).

IMMP2L-si RNA-IMl caused a significant decrease in the target IMMP2L expression level concurrent with a significant increase in the expressi on level of LRRNS. These changes in expression diminished within 48 hrs (Fig, 14). In contrast, siRNA-IM2 caused a comparable decrease in the target lAL\iP2L expression level compared to siRNA-IMl but no significant change was observed in the expression level of LRRNS over the same time.

These results suggest that the TS-associated gene IMMP2L and its nested gene LRRNS may also form a SITRUS.