Modulators of cell adhesion molecules and use thereof

Field of the Invention The present invention relates to new molecules capable of decreasing or altering cell adhesion and especially cell aggregation induced by Necl (Nectin-like)/SynCAM (Synaptic cell adhesion) molecules and their ligands such as other members of the Necl protein family. In particular, the invention provides proteins useful in the treatment of CNS (central nervous system) disorders, including neuro-infiammatory and neurodegenerative conditions. More particularly, the present invention provides novel proteins and antibodies, DNA encoding thereof, processes for production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the treatment of neuroinflammatory and neurodegenerative conditions.

Background of the Invention Neurodegenerative conditions are characterized by a deterioration or loss of function of nerve cells and other cells of the central nervous system (CNS), which may include injuries or damages at the level of the axons and of synaptic connections. The deterioration of nerve cell function through the progressive destruction of the myelin sheath that protects the nerves and allows uninterrupted transmission of nerve impulses is also called demyelination.

Multiple sclerosis (MS) is the most known chronic inflammatory demyelinating disease of the central nervous system in humans. The onset of the disease typically occurs during ages 20 to 40. Women are affected approximately twice as often as men. It is estimated to affect about 2.5 million people worldwide and its economic impact is considerable.

This chronic disease is typically characterised by episodes of neurological deficit followed by periods of remission. MS is manifested in physical symptoms (relapses and disability progression), Central Nervous System (CNS) inflammation, brain atrophy and cognitive impairment. Presenting symptoms include focal sensory deficits, focal weakness, visual problems, imbalance and fatigue. Sexual impairment and sphincter dysfunction may occur.

Approximately half of the patients with MS may experience cognitive impairment or depression. MS is now considered to be a multi-phasic disease where periods of clinical quiescence (remissions) occur between exacerbations of the disease. Remissions vary in length (typical frequency of 0.8 - 1.2/year) and may last several years but are infrequently permanent. Four courses of the disease are individualized: relapsing-remitting (RR), secondary progressive (SP), primary progressive (PP) and progressive relapsing (PR) multiple sclerosis. A total of 85 - 90% of patients experience a relapsing/remitting course, which over time becomes secondary progressive in the majority of patients; 10 - 15% have a progressive course from the onset (primary progressive MS). Over time, the relapse frequency declines.

MS is considered to be an autoimmune disorder pathologically characterized by inflammation, demyelination and variable degrees of axonal degeneration and gliosis. Demyelination of the axons, which can be partial, interferes with the conduction of action potentials along axons, which results in tissue atrophy resulting by the symptoms and neurological deficits and clinical disability experienced by patients.

The diagnosis of MS requires demonstration of dissemination of the disease process in both time and space, and exclusion of other causes. The diagnosis is made clinically with the use of paraclinical tools. The introduction of the McDonald criteria allows a diagnosis of MS to be made after a single clinical event (Mc Donald et al., 2001, Ann. Neurol, 50:121-127). MS onset is defined by the occurrence of the first neurological symptoms of CNS dysfunction. Advances in cerebrospinal fluid (CSF) analysis and magnetic resonance imaging (MRI) have simplified the diagnostic process and facilitated early diagnostic of multiple sclerosis (Noseworthy et al., 2000, The New England Journal of Medicine, , 343, 13, 938-952). The International Panel on the Diagnosis of MS published revised criteria facilitating the diagnosis of MS and including MRI together with clinical and para-clinical diagnostic methods (Mc Donald et al., 2001, above).

Cell adhesion molecules (CAMs) are plasma membrane proteins specialized in cell-cell recognition and adhesion. Nectins are a group of immunoglobulin (Ig) superfamily proteins

that mediate Ca2+-independent cell-cell adhesion through both homophilic as well as heterophilic interactions. The nectin family is comprised of nectin -1, -2, -3 and -4. In addition, five nectin-like proteins, also called SynCAMs (synaptic CAM), have been identified and named Necl-1 (for nectin-like 1) through Necl-5 (Ikeda et al, 2003, The Journal of Biological Chemistry, 278, 30, 28167-28172; Fuchs et al., 2006, Seminars in Cancer Biology, 16, 359-366). Two SynCAMs (SynCAMl, alternatively named Necl-2 and SynCAM3, alternatively named Necl-1) have been shown to serve as synaptic adhesion molecule in the CNS. SynCAMl has been found to be expressed in the brain and various organs (Biederer et al., 2006, Genomics, 87, 139-150), while SynCAM3/ Necl-1 is mainly expressed in the nervous system (Kakunaga et al., 2005, J Cell Sci. 118:1267-77). Biederer et al, 2006, above mentions Necl-3 and Necl-4 only in the context of the family of Necls proteins and genome ninming, without any functional reference or therapeutic perspective. Genomic analysis has predicted that SynCAM proteins belong to a set of four proteins: SynCAM 1, 2, 3 and 4 (Biederer et al., 2006; above) for which different nomenclatures have been proposed, in particular nectin-like 1 to 4 (Necl-1 to -4). Necl-3 has not been characterized, Necl-4 poorly so (Fukami et al., 2003, Gene 323:11-18), and Necl-5 is only distantly related to Necl-1 to -4. Arase Noriko et al., 2005, International Immunology, 17(9), 1227-1237 disclose Necl-2 as a ligand of Class I-restricted T-cell associated molecule. Furuno Tadahide et al., 2005, The Journal of Immunulogy, 174(11), 6934-6942 and Ito Akihiko et al., 2006, J. Pharmacol. Sci., 102(1), 1-5 disclose the interaction between cells expressing Spermatogenic Immunoglobulin Superfamily (SgIGSF or Necl-2) at their surface (masts cells) and neurites. Koma-Yu Ichiro et al., 2004, Oncogene, 23(33), 5687- 5692 disclose the use of fusion proteins of Necl-2 and their use in aggregation assays.

Multiple sclerosis pathogenesis is described as a succession of immunological events. Although the exact course is not fully understood yet, it is believed that the following events are essential. T-cell activation occurs first when the receptor of the T-cells sees an antigen in the context of major histocompatibility complex (MHC) class II on the antigen- presenting cell (APC), then the activated T-cells which are initially in the periphery enter the CNS through complex mechanisms involving among other adhesion molecules. After

the entry of the activated T cells into the CNS, recruitment of other immune cells occurs, a variety of cytokines are secreted, and ultimately the immune-mediated destruction of the brain parenchyma takes place. In the central nervous system, activated T cells continue to release pro-inflammatory cytokines locally, and the process repeats itself. Simultaneously, other immune system cells, including B cells and macrophages, also enter the CNS through the blood-brain barrier, which further enhances the local immune response against myelin. Therefore the interaction of T-cells with adhesion molecules has been shown to be a crucial step in the pathogenesis development of multiple sclerosis.

Current medications for MS which are disease modifying treatments, i.e. modifying the course of MS, modulate or suppress the immune system. There are four immunomodulating agents approved by the Food and Drug Administration (FDA) for

RRMS: three beta interferons (Betaseron®, Berlex; Avonex®, Biogen; Rebif®, Serono) and Glatiramer Acetate (Copaxone®, Amgen). There is also one FDA approved immunosuppressing drug for worsening MS, Mitoxantrone (Novantrone®, Amgen) and a humanized monoclonal antibody directed against the human α4 integrin chain, Natalizumab

(Tysabri®, Biogen and Elan). Currently, the most effective MS treatment is Natalizumab but its clinical use is somewhat limited by its potential side effects. The fact that

Natalizumab targets an adhesion molecule (the α4 integrin chain) exemplifies that the interaction of T-cells with adhesion molecules is crucial in the pathogenesis development of multiple sclerosis.

Due to the severity of the disease, the limited efficacy of the known treatments and the chronic character of the neurodegenerative diseases, it would be highly desirable to have a new method for treating neurodegenerative disorders, such as multiple sclerosis.

Summary of the Invention The present invention is directed towards new molecules capable of decreasing or altering cell adhesion and especially cell-cell contacts induced by Necl-3 and Necl-4 and their ligands, including the other members of the Necl family. More particularly, the present invention provides novel proteins and antibodies, DNA encoding thereof, processes for

production thereof, pharmaceutical compositions, kits containing thereof and use of these in the preparation of pharmaceutical compositions for the treatment of CNS disorders such as neuroinfiammatory and neurodegenerative conditions.

A first aspect of the invention provides a polypeptide having at least 80% identity or homology with a sequence of amino acids selected from an amino acid sequence of Necl-3 and an amino acid sequence selected from an amino acid sequence of Necl-4 or fragments thereof.

A second aspect of the invention relates to nucleic acid molecules encoding a polypeptide as defined above or fusion proteins as described below. Such nucleic acids also include vectors containing said molecules, in particular expression vectors.

A third aspect of the invention resides in a fusion protein having inhibitory activity to a

Necl protein such as Necl-1 orNecl-2 or Necl-3 or Necl-4 or a ligand thereof.

A fourth aspect of the invention relates to antibodies that selectively bind the polypeptides according to the invention, as well as to antibodies that bind Necl-3 (Necl-4) and/or block the binding of Necl-3 (Necl-4) to other binding partners such as Necl-1, Necl-2, Necl-3 and/or Necl-4 and to a use of an antibody according to the invention in an assay.

A fifth aspect of the invention relates to host cells expressing a polypeptide as defined above, as well as methods of producing such cells.

A sixth aspect of the invention is a process for preparing a polypeptide or a fusion protein as defined above, typically using recombinant technologies.

A seventh aspect of the invention relates to a pharmaceutical composition comprising a polypeptide or a nucleic acid as defined above and a pharmaceutically acceptable carrier or vehicle.

An eighth aspect of the invention is a use of a Necl-3 antagonist and/or Necl-4 antagonist for the preparation of a medicament for the treatment of CNS disorders.

A ninth aspect of the invention is a Necl-3 antagonist or a Necl-4 antagonist for use as a medicament.

A tenth aspect of the invention provides a kit comprising at least one Necl-3 antagonist and/or Necl-4 antagonist according to the invention.

An eleventh aspect of the invention relates to a method of treating of a disease comprising the administration of a therapeutically effective amount of a Necl-3 antagonist or a Necl-4 antagonist according to the invention in a mammal in need thereof and wherein the disease is a CNS disorders as well as methods of promoting remyelination of nerve cells in a mammal comprising administering to the mammal a Necl-3 and/or Necl-4 antagonist according to the invention.

A twelfth aspect of the invention is a method of antagonizing the aggregation of Necl-3 and/or of Necl-4 with itself of with at least one protein of the Necl/SynCAM family.

A thirteenth aspect is a method for in vitro detection of the level of a Necl-3 and of Necl-4 protein in a biological sample.

A fourteenth aspect is a method for screening for a Necl-3 and/or Necl-4 antagonist.

Other features and advantages of the invention will be apparent from the following detailed description.

Description of the figures Figure 1 shows the nucleic acid sequence (SEQ ID NO: 1) and the amino acid sequence of human Necl-3 (SEQ ID NO: 2).

Figure 2: Figure 2a shows the nucleic acid sequence (SEQ ID NO: 3) and Figure 2b shows the amino acid sequence of the extracellular fragment aa 1-365 of human Necl-3 (SEQ ID

NO: 4). Figure 3 shows the nucleic acid sequence (SEQ ID NO: 5) and the amino acid sequence of human Necl-4 (SEQ ID NO: 6).

Figure 4: Figure 4a shows the nucleic acid sequence (SEQ ID NO: 7) and Figure 4b shows the amino acid sequence of the extracellular fragment aa 1-323 of human Necl-4 (SEQ ID

NO: 8). Figure 5: Figure 5a shows the nucleic acid sequence (SEQ ID NO: 14) and Figure 4b shows the amino acid sequence of the extracellular fragment aa 169-367 of human Necl-3 (SEQ

ID NO: 15).

Figure 6: Figure 6a shows the nucleic acid sequence (SEQ ID NO: 25) and Figure 6b shows the amino acid sequence of the extracellular fragment aa 126-322 of human Necl-4 (SEQ ID NO: 26).

Figure 7: Figure 7a shows the amino acid sequence (SEQ ID NO: 35) of IgGl and Figure 7b shows the amino acid sequence of IgG4 (SEQ ID NO: 36) of the fusion proteins according to the invention.

Detailed Description of the invention

The term "neurodegenerative" comprises a disease or a state characterized by a CNS degeneration or alteration, especially at the level of the neurons. It comprises neuro- inflammatory and demyelinating states or diseases such as leukoencephalopathies, and leukodystrophies.

The term "demyelinating" is referring to a state or a disease of the CNS comprising the degradation of the myelin around the axons. In the context of the invention, the term demyelinating disease is intended to comprise conditions which comprise a process that demyelinate cells such as multiple sclerosis, progressive multifocal leukoencephalopathy (PML), myelopathies, any neuroinflammatory condition involving autoreactive leukocyte within the CNS, congenital metabolic disorder, a neuropathy with abnormal myelination, drug induced demyelination, radiation induced demyelination, a hereditary demyelinating condition, a prion induced demyelinating condition, encephalitis induced demyelination or a spinal cord injury. Preferably, the condition is multiple sclerosis.

The term "multiple sclerosis" includes relapsing remitting MS (RRMS), Secondary Progressive MS (SPMS), primary progressive MS (PPMS). Patients suffering from MS can be defined for example as having clinically definite or laboratory-definite MS according to Schumacher or Poser criteria (Schumacher et al., 1965, Ann. NY Acad. Sd. 1965; 122:552- 568; Poser et al, 1983, Ann. Neurol. 13(3): 227-31).

The term "Efficacy" of a treatment according to the invention can be measured based on changes in the course of disease in response to a use according to the invention. For example, the efficacy of a treatment of MS can be measured by the frequency of relapses in RRMS and the presence or absence of new lesions in the CNS as detected using methods

such as MRI technique (Miller et al, 1996, Neurology, 47(Suppl 4): S217; Evans et al, 1997, Ann. Neurology, 41:125-132). The observation of the reduction and/or suppression of MRI Ti gadolinium-enhanced lesions (thought to represent areas of active inflammation) gives a primary efficacy variable. Secondary efficacy variables include MRI Ti enhanced brain lesion volume, MRI Ti enhanced lesion number, MRI T ₂ lesion volume (thought to represent total disease burden, i.e. demyelination, gliosis, inflammation and axon loss), MRI Ti enhanced hypointense lesion volume (thought to represent primarily demyelination and axon loss), time-to-progression of MS, frequency and severity of exacerbations and time-to-exacerbation, Expanded Disability Status Scale score and Scripps Neurologic Rating Scale (SNRS) score (Sipe et al, 1984, Neurology, 34, 1368-1372). Methods of early and accurate diagnosis of multiple sclerosis and of following the disease progression are described in Mattson, 2002, Expert Rev. Neurotherapeutics, 319-328. Degree of disability of MS patients can be for example measured by Kurtzke Expanded Disability Status Scale (EDSS) score (Kurtzke, 1983, Neurology, 33, 1444-1452). Typically a decrease in EDSS score corresponds to an improvement in the disease and conversely, an increase in EDSS score corresponds to a worsening of the disease. Any other clinical assessment of the disease known is available to the skilled person to measure the efficacy of the treatment according to the invention. "Relapses" involve neurological problems that occur over a short period, typically days but sometimes as short as hours or even minutes. These attacks most often involve motor, sensory, visual or coordination problems early in the disease. Later, bladder, bowel, sexual and cognitive problems may be shown. Sometimes the attack onset occurs over several weeks. Typical MS relapse involves a period of worsening, with development of neurological deficits, then a plateau, in which the patient is not getting any better but also not getting any worse followed by a recovery period. Recovery usually begins within a few weeks.

As used herein, "treatment" and "treating" and the like generally mean obtaining a desired pharmacological and physiological effect. The effect may be prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof and/or may be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or

adverse effect attributed to the disease. The term "treatment" as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or relieving the disease, i.e., causing regression of the disease and/or its symptoms or conditions.

The term "subject" as used herein refers to mammals. For examples, mammals contemplated by the present invention include human, primates, domesticated animals such as cattle, sheep, pigs, horses and the like. The term "Fc domain" encompasses native Fc, including the various subtypes, and Fc variant molecules and sequences as defined below. It includes molecules in monomeric or multimeric form, whether digested from whole antibody or produced by other means. The term "native Fc" refers to a molecule or sequence comprising the sequence of a non- antigen binding fragment resulting from the digestion of whole antibody, or by means of recombinant DNA techniques, whether in monomeric or multimeric form. The original immunoglobulin source of native Fc is preferably of human origin and may be any of the immunoglobulins. Native Fc's are made up of monomeric polypeptides that may be linked into dimeric or multimeric forms by covalent (i.e. disulfide bonds) and non-covalent association. The number of intermolecular disulfide bonds between monomeric subunits of native Fc molecules ranges from 1 to 4 depending on class (e. g. IgG, IgA, IgE, IgM, IgD) or subclass (e.g. IgGl, IgG2, IgG3, IgG4, IgAl, IgA2). Examples of native Fc domains are human IgGl and IgG4, having respectively the amino acid sequence of SEQ ID NO: 35 and of SEQ ID NO: 36. The term "native Fc" as used in the context of the invention is generic to the monomeric, dimeric, and multimeric forms. The term "Fc variant" refers to a molecule or sequence that is modified from a native Fc, for example a molecule or sequence that is humanized from a non-human native Fc. A native Fc comprises sites that may be removed or changed because they provide structural features or biological activities that are not required, or alternatively enhanced, for the fusion molecules of the present invention. Thus, the term "Fc variant" comprises a molecule or sequence that lacks one or more native Fc sites or residues that affect or are

involved in (i) disulfide bond formation, (ii) incompatibility with a selected host cell (iii) N-terminal heterogeneity upon expression in a selected host cell, (iv) glycosylation, (v) interaction with complement, (vi) binding to an Fc receptor other than a salvage receptor, or (vii) antibody-dependent cellular cytotoxicity (ADCC). The term "Fc fusion proteins" in general refers to molecules comprising at least part of an immunoglobulin Fc domain and at least one peptide. Such fusion proteins may be multimers or dimers or fragment thereof and may be derivatized. Suitable fusion proteins of the invention include a Necl-3 polypeptide e.g. an extracellular domain of Necl-3, a fragment thereof or a mutein thereof, linked to an immunoglobulin Fc region. Suitable fusion proteins of the invention include a Necl-4 polypeptide e.g. an extracellular domain of Necl-4, a fragment thereof or a mutein thereof, linked to an immunoglobulin Fc region. The extracellular domain, the fragment or the mutein thereof may be fused directly or through linker sequences to the Fc portion of an immunoglobulin. The preparation of fusion proteins comprising certain heterologous polypeptides fused to an Fc domain is known in the art WO 91/08298, WO 96/08570, WO 93/22332, WO 04/085478, WO 01/03737 and WO 02/66514 incorporated by reference in their entirety. The term "isolated" is used to indicate that the molecule is free of association with other proteins or polypeptides, for example as a purification product of recombinant host cell culture or as a purified extract. The term "antibody" comprises antibodies binding to Necl-3 or Necl-4 protein or fragment thereof, chimeric antibodies recognizing and/or binding selectively to Necl-3 or Necl-4 protein or fragment thereof, fully human, humanized, genetically engineered or bispecific or multispecific antibodies as well as fragments thereof such as single chain antibodies (scFv) or domain antibodies against Necl-3 and/or Necl-4 protein or fragment thereof and the like. Antibodies of this invention may be monoclonal or polyclonal antibodies, or fragments or derivative thereof having substantially the same antigen specificity. The term "selectively" indicates that the antibodies preferentially recognize and/or bind the target polypeptide or epitope, i.e., with a higher affinity than any binding to any other antigen or epitope, i.e. the binding to the target polypeptide can be discriminated from non-specific binding to other antigens. The binding affinity of an antibody can be readily determined by

one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard et ah, 1949, Ann NY Acad. ScL, 51, 660-672).

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific, being directed against a single antigenic site. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.

The term "antagonists" is defined as a molecule that antagonizes completely or partially the activity of biological molecule.

The term "peptidomimetic" is defined as a peptide analog containing non-peptidic structural elements, which peptide is capable of mimicking or antagonizing the biological action(s) of a natural parent peptide. A peptidomimetic does no longer have classical peptide characteristics such as enzymatically scissile peptide bonds.

Necl-3 and Necl-4

The nucleotide sequence encoding human Necl-3, isolated as described in Examples 1 and 2, is presented in SEQ ID NO: 1 and the amino acid sequence of human Necl-3 is described in SEQ ID NO: 2. The human Necl-3 amino acid sequence described in SEQ ID NO: 2 has a predicted extracellular domain spanning from amino acids 1 to 367. As used herein, the term Necl-3 encompasses polypeptides having an amino acid sequence of SEQ ID NO: 2 and fragments thereof such as the corresponding full length extracelullar domain (aal-365) of SEQ ID NO: 4 or a fragment thereof (aal 69-367) having an amino acid sequence of SEQ ID NO: 15. In addition, Necl-3 encompasses polypeptides that have a high degree of similarity or a high degree of identity with the amino acid sequence of SEQ ID NO: 2, or with the amino acid sequence of SEQ ID NO: 4 or the amino acid sequence of SEQ ID NO: 15 and which polypeptides are biologically active. The term Necl-3 encompasses Necl-3 secreted peptide where the signal peptide is cleaved. Typically,

the signal peptide is cleaved between position 24 and 25 of the SEQ ID NO: 4 as determined by Signal P 3.0 software.

The nucleotide sequence encoding human Necl-4, isolated as described in Examples 6 and

7, is presented in SEQ ID NO: 5 and the amino acid sequence of human Necl-4 is described in SEQ ID NO: 6. The human Necl-4 amino acid sequence described in SEQ ID NO: 6 has a predicted extracellular domain of from amino acids 1 to 323.

As used herein, the term Necl-4 encompasses polypeptides having an amino acid sequence of SEQ ID NO: 6 and fragments thereof such as the full length extracelullar domain (aal-

323) of SEQ ID NO: 8 or a fragment thereof (aal 26-322) having an amino acid sequence of SEQ ID NO: 26. In addition, Necl-4 encompasses polypeptides that have a high degree of similarity or a high degree of identity with the amino acid sequence of SEQ ID NO: 6 or with the amino acid sequence of SEQ ID NO: 8 or with the amino acid sequence of SEQ ID

NO: 26 and which polypeptides are biologically active.

The term Necl-4 encompasses Necl-4 secreted peptide where the signal peptide is cleaved. Typically, the signal peptide is cleaved between position 24 and 25 of the SEQ ID NO: 8 as determined by Signal P 3.0 software.

A "Necl-3 variant" or a "Necl-4 variant" as referred to herein, means a polypeptide substantially homologous to native Necl-3 or native Nelc-4, respectively, but which has an amino acid sequence different from that of native Necl-3 or Necl-4 respectively (human, murine or other mammalian species) because of one or more deletions, insertions or substitutions. Substantially homologous means a variant amino acid sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the native amino acid sequences, as disclosed above. The percent identity of two amino acid or two nucleic acid sequences can be determined by visual inspection and/or mathematical calculation, or more easily by comparing sequence information using a computer program such as Clustal package version 1.83. Necl-3 variants or Necl-4 variants may comprise a sequence having at least one conservatively substituted amino acid, meaning that a given amino acid residue is replaced by a residue having similar physiochemical characteristics. Generally, substitutions for one or more

amino acids present in the native polypeptide should be made conservatively. Examples of conservative substitutions include substitution of amino acids outside of the active domain(s), and substitution of amino acids that do not alter the secondary and/or tertiary structure of Necl-3 or Necl-4 respectively. Examples of conservative substitutions include substitution of one aliphatic residue for another, such as He, VaI, Leu, or Ala for one another, or substitutions of one polar residue for another, such as between Lys and Arg; GIu and Asp; or GIn and Asn. Other such conservative substitutions, for example, substitutions of entire regions having similar hydrophobicity characteristics, are well known (Kyte, et al, 1982, J. MoI. Biol., 157: 105- 131). Naturally occurring variants are also encompassed by the invention. Examples of such variants are proteins that result from alternate mRNA splicing events or from proteolytic cleavage of the native protein, wherein the native biological property is retained. For example, a "conservative amino acid substitution" may involve a substitution of a native amino acid residue with a non native residue such that there is little or no effect on the polarity or charge of the amino acid residue at that position. Desired amino acid substitutions (whether conservative or non-conservative) can be determined by those skilled in the art at the time such substitutions are desired. Exemplary amino acid substitutions are presented in Table 1 below:

Table 1

Further examples of Necl-3 or Necl-4 are provided herein and include but is not limited to variants, biologically active fragments, fragments and fragments of variants. Necl-3 variants or Necl-4 variants may be used as antagonists of Necl-3 activity or Necl-4 activity or be used to develop Necl-3 antagonists or Necl-4 antagonists, such as antibodies, chimaeric proteins or fusion proteins according to the invention.

The term "Necl-3 antagonist" comprises all antagonists of all suitable forms of Necl-3 described herein that antagonize one or more biological activity of Necl-3 and of Necl-3 variants or fragment thereof. For example, the Necl-3 antagonists of the invention are able to antagonize the ability of Necl-3 to participate to homophilic interactions (interactions between Necl-3 proteins) and/or heterophilic interactions (interactions with other protein(s) from the Necl or synCAM family such as Necl-1, Necl-2 and Necl-4, or with other membrane protein ligands). The term "Necl-3 antagonist" includes but is not limited to: Necl-3 specific antibodies of any sort (polyclonal, monoclonal, antibody fragments, antibody variants), chimaeric proteins, natural or unnatural proteins with Necl-3 antagonizing activities, small molecules, nucleic acid derived polymers (such as DNA and RNA aptamers, PNAs, or LNAs), peptidomimetics, fusion proteins, or gene therapy vectors driving the expression of such Necl-3 antagonists. Further embodiments include as Necl-3 antagonists, soluble Necl-3 fusion proteins such as but not limited to an extracellular

domain of Necl-3 or a fragment thereof linked to an Fc domain. Typically, Necl-3 antagonists are able to bind Necl-3 and/or to block the binding of Necl-3 and other binding partners such as Necl-1, Necl-2, Necl-3 and/or Necl-4.

The term "Necl-4 antagonist" comprises all antagonists of all suitable forms of Necl-4 described herein that antagonize one or more biological activity of Necl-4 and of Necl-4 variants. For example, the Necl-4 antagonists of the invention are able to antagonize the ability of Necl-4 to participate to homophilic interactions (interactions between Necl-4 proteins) and/or heterophilic interactions (interactions with other protein(s) from the SynCAM family such as Necl-1 , Necl-2 and Necl-3, or with other membrane protein ligands). The term Necl-4 antagonist includes but is not limited to: Necl-4 specific antibodies, chimeric proteins, small molecules, peptidomimetics and fusion proteins. Further embodiments include as Necl-4 antagonists, soluble Necl-4 fusion proteins such as but not limited to an extracellular domain of Necl-4 or a fragment thereof linked to an Fc domain. Typically, Necl-4 antagonists are able to bind Necl-3 and/or to block the binding of Necl-4 and other binding partners such as Necl-1 , Necl-2, Necl-3 and/or Necl-4.

The biological consequences of the homophilic and heterophilic interactions referred in the context of the invention for instance lead to cell-cell contact, to cell movement, to cell aggregation or to cellular activation. An antibody that is immunoreactive with Necl-3 and/or especially to an extracellular fragment of Necl-3 or a fragment thereof e.g. to an amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 15 may be used as a Necl-3 antagonist.

An antibody that is immunoreactive with Necl-4 and/or especially to an extracellular fragment of Necl-4 or a fragment thereof e.g. to an amino acid sequence of SEQ ID NO: 8 or SEQ ID NO: 26 may be used as a Necl-4 antagonist. A Necl-3 or a Necl-4 protein, a Necl-3 antagonist or a Necl-4 antagonist, as an isolated, purified or homogeneous protein according to the invention, may be produced by recombinant expression systems as described herein or purified from naturally occurring cells. Suitable expression of Necl-3, Necl-3 variants or fragments, Necl-3 antagonists, Necl-4, Necl-4 variants or fragments and Necl-4 include prokaryotes, yeast or higher eukaryotic

cells. Appropriate cloning and expression vectors for use with bacterial, fungal, yeast and mammalian cellular hosts are described for example in Pouwels et ah, 1985, Cloning Vectors: A laboratory manual, Elsevier, New York.

Prokaryotes include gram negative and gram positive organism such as E. CoIi or Bacilli. Suitable prokaryotic host cells include for example E. CoIi BL21 strain. In prokaryotic host cells, such as E. coli, a Necl-3, Necl-3 fragment or variant, Necl-3 antagonist, Necl-4, Necl- 4 fragment or variant or Necl-4 antagonist may include a N-terminal methionine residue to facilitate the expression of recombinant polypeptide in the prokaryotic host cell. The N- terminal Met may be cleaved from the expressed peptide.

Compositions

The invention provides pharmaceutical or therapeutic agents as compositions and methods for treating a patient, preferably a mammalian patient, and most preferably a human patient who is suffering from a medical disorder, and in particular a disorder mediated by Necl-3 and/or Necl-4, such as neuro inflammatory disorders and/or neurodegenerative disorders. Pharmaceutical compositions of the invention can contain one or more Necl-3 antagonist and/or Necl-4 antagonist (including from recombinant and non-recombinant sources) in any form described herein. Compositions of this invention may further comprise one or more pharmaceutically acceptable additional ingredient(s) such as alum, stabilizers, antimicrobial agents, buffers, coloring agents, flavoring agents, adjuvants, and the like. The compounds of the invention, together with a conventionally employed adjuvant, carrier, diluent or excipient may be placed into the form of pharmaceutical compositions and unit dosages thereof, and in such form may be employed as solids, such as tablets or filled capsules, or liquids such as solutions, suspensions, emulsions, elixirs, or capsules filled with the same, all for oral use, or in the form of sterile injectable solutions for parenteral (including subcutaneous) use. Such pharmaceutical compositions and unit dosage forms thereof may comprise ingredients in conventional proportions, with or without additional active compounds or principles, and such unit dosage forms may contain any suitable effective amount of the active ingredient commensurate with the intended daily

dosage range to be employed. Compositions according to the invention are preferably injectable.

Compositions of this invention may also be liquid formulations including, but not limited to, aqueous or oily suspensions, solutions, emulsions, syrups, and elixirs. Liquid forms suitable for oral administration may include a suitable aqueous or non-aqueous vehicle with buffers, suspending and dispensing agents, colorants, flavors and the like. The compositions may also be formulated as a dry product for reconstitution with water or other suitable vehicle before use. Such liquid preparations may contain additives including, but not limited to, suspending agents, emulsifying agents, non-aqueous vehicles and preservatives. Suspending agent include, but are not limited to, sorbitol syrup, methyl cellulose, glucose/sugar syrup, gelatin, hydroxyethylcellulose, carboxymethyl cellulose, aluminum stearate gel, and hydrogenated edible fats. Emulsifying agents include, but are not limited to, lecithin, sorbitan monooleate, and acacia. Nonaqueous vehicles include, but are not limited to, edible oils, almond oil, fractionated coconut oil, oily esters, propylene glycol, and ethyl alcohol. Preservatives include, but are not limited to, methyl or propyl p- hydroxybenzoate and sorbic acid. Further materials as well as processing techniques and the like are set out in Part 5 of Remington 's Pharmaceutical Sciences, 20 Edition, 2000, Marck Publishing Company, Easton, Pennsylvania, which is incorporated herein by reference. Solid compositions of this invention may be in the form of tablets or lozenges formulated in a conventional manner. For example, tablets and capsules for oral administration may contain conventional excipients including, but not limited to, binding agents, fillers, lubricants, disintegrants and wetting agents. Binding agents include, but are not limited to, syrup, accacia, gelatin, sorbitol, tragacanth, mucilage of starch and polyvinylpyrrolidone. Fillers include, but are not limited to, lactose, sugar, microcrystalline cellulose, maizestarch, calcium phosphate, and sorbitol. Lubricants include, but are not limited to, magnesium stearate, stearic acid, talc, polyethylene glycol, and silica. Disintegrants include, but are not limited to, potato starch and sodium starch glycollate. Wetting agents include, but are not limited to, sodium lauryl sulfate. Tablets may be coated according to methods well known in the art.

Injectable compositions are typically based upon injectable sterile saline or phosphate- buffered saline or other injectable carriers known in the art.

Compositions of this invention may also be formulated as suppositories, which may contain suppository bases including, but not limited to, cocoa butter or glycerides. Compositions of this invention may also be formulated for inhalation, which may be in a form including, but not limited to, a solution, suspension, or emulsion that may be administered as a dry powder or in the form of an aerosol using a propellant, such as dichlorodifiuoromethane or trichlorofluoromethane. Compositions of this invention may also be formulated transdermal formulations comprising aqueous or non-aqueous vehicles including, but not limited to, creams, ointments, lotions, pastes, medicated plaster, patch, or membrane.

Compositions of this invention may also be formulated for parenteral administration including, but not limited to, by injection or continuous infusion. Formulations for injection may be in the form of suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulation agents including, but not limited to, suspending, stabilizing, and dispersing agents. The composition may also be provided in a powder form for reconstitution with a suitable vehicle including, but not limited to, sterile, pyrogen-free water.

Compositions of this invention may also be formulated as a depot preparation, which may be administered by implantation or by intramuscular injection. The compositions may be formulated with suitable polymeric or hydrophobic materials (as an emulsion in an acceptable oil, for example), ion exchange resins, or as sparingly soluble derivatives (as a sparingly soluble salt, for example).

Compositions of this invention may also be formulated as a liposome preparation. The liposome preparation can comprise liposomes which penetrate the cells of interest or the stratum corneum, and fuse with the cell membrane, resulting in delivery of the contents of the liposome into the cell. Other suitable formulations can employ niosomes. Niosomes are lipid vesicles similar to liposomes, with membranes consisting largely of non-ionic lipids, some forms of which are effective for transporting compounds across the stratum corneum. The compounds of this invention can also be administered in sustained release forms or from sustained release drug delivery systems. A description of representative sustained

release materials can also be found in the incorporated materials in Remington 's Pharmaceutical Sciences.

Mode of administration

Compositions of this invention may be administered in any manner including, but not limited to, orally, parenterally, sublingually, transdermally, rectally, transmucosally, topically, via inhalation, via buccal or intranasal administration, or combinations thereof. Parenteral administration includes, but is not limited to, intravenous, intra-arterial, intraperitoneal, subcutaneous, intramuscular, intra-thecal, and intra-articular. The compositions of this invention may also be administered in the form of an implant, which allows slow release of the compositions as well as a slow controlled i.v. infusion. In a preferred embodiment, a Necl-3, or a Necl-3 antagonist, or a necl-4 or a Necl-4 antagonist according to the invention are administered intravenously or subcutaneously.

This invention is further illustrated by the following examples that are not intended to limit the scope of the invention in any way. The dosage administered, as single or multiple doses, to an individual will vary depending upon a variety of factors, including pharmacokinetic properties, patient conditions and characteristics (sex, age, body weight, health, size), extent of symptoms, concurrent treatments, frequency of treatment and the effect desired.

Combination According to the invention, a Necl-3 antagonist and/or a Necl-4 antagonist according to the invention can be administered alone or in combination with a co-agent useful in the treatment of CNS disorders including neuro inflammation and/or neurodegeneration, such as substances useful in the treatment of demyelinating diseases e.g. for example a co-agent selected from IFN-beta, Glatiramer acetate, Corticosteroids, immunusuppressants such as Mitoxantrone, Azathioprine, Cyclophosphamide, Methotrexate, Natalizumab (Tysabri®), metalloproteinases inhibitors, especially MMP- 12 and/or MMP-9 inhibitors such as Minocycline.

The invention encompasses the administration of a Necl-3 antagonist or Necl-4 antagonist of the invention wherein the Necl-3 antagonist or the Necl-4 antagonist is administered to

an individual prior to, simultaneously or sequentially with other therapeutic regimens or co- agents useful in the treatment of neuroinflammation and/or neurodegeneration (e.g. multiple drug regimens), in a therapeutically effective amount. The Necl-3 antagonist and/or a Necl-4 antagonist according to the invention that are administered simultaneously with said co-agents can be administered in the same or different compositions and in the same or different routes of administration.

The term "interferon-beta (IFN-β)", as used herein, is intended to include fibroblast interferon in particular of human origin, as obtained by isolation from biological fluids or as obtained by DNA recombinant techniques from prokaryotic or eukaryotic host cells, as well as its salts, functional derivatives, variants, analogs and active fragments.

IFN-β suitable in accordance with the present invention is commercially available e.g. as Rebif® (Serono), Avonex® (Biogen) or Betaferon® (Schering). The use of interferons of human origin is also preferred in accordance with the present invention. The term interferon, as used herein, is intended to encompass salts, functional derivatives, variants, analogs and active fragments thereof.

Patients

In an embodiment, patients according to the invention are patients suffering from CNS disorders such as neuro inflammatory and neurodegenerative disorders or states. In another embodiment, patients according to the invention are patients suffering from demyelinating states or disorders.

In a further embodiment, patients according to the invention are patients suffering from multiple sclerosis.

Use according to the invention

The nucleic acids encoding Necl-3, Necl-3 antagonists, Necl-4, Necl-4 antagonists and fragments thereof may be used to express recombinant polypeptides for analysis, characterization and therapeutic use.

Necl-3 antagonists and Necl-4 antagonists according to the invention are useful in the treatment of CNS disorders, including neuroinflammatory and/or neurodegenerative disorders or conditions such as demyelinating diseases or conditions.

Necl-3 antagonists according to the invention are useful to antagonize one or more biological activity of Necl-3 such as adhesion properties, including Necl-3 induced cell adhesion processes, for example adhesion process between Necl-3 on myelinated axons and cells of the immune system expressing Necl-3 or Necl-3 heterophilic ligands. Necl-4 antagonists according to the invention are useful to antagonize one or more biological activity of Necl-4 such as adhesion properties, including Necl-4 induced cell adhesion processes, for example adhesion process between Necl-4 on astrocytes and cells of the immune system expressing Necl-4 or Necl-4 heterophilic ligands The disclosed Necl-3 nucleic acid sequences or Necl-4 nucleic acid sequences, or fragments thereof and combinations of fragment thereof may be used as probes or primers. The disclosed Necl-3 or Necl-4 amino acid sequences, variants thereof, fragments thereof and combinations thereof may be used in a process for the preparation of Necl-3 antagonists and/or Necl-4 antagonists according to the invention. The disclosed Necl-3 antibodies and/or Necl-4 antibodies may be used in assays relating for example to the analysis of Necl-3 and/or Necl-4 expression such as western blots, immunohistochemistry, ELISA or FACS assays.

Within the context of this invention, the beneficial effect includes but is not limited to an attenuation, reduction, decrease or diminishing of the pathological development after onset of the disease. Table 2 below presents the Sequence identity numbers and associated molecules:

Table 2

One process for producing Necl-3 antagonists or Necl-4 antagonists according to the invention comprises culturing a host cell transformed with an expression vector comprising a DNA sequence that encodes a Necl-3 antagonist or a Necl-4 antagonist under conditions sufficient to promote expression of Necl-3 antagonists or Necl-4 antagonists, respectively. A Necl-3 antagonist or a Necl-4 antagonist according to the invention is then recovered from culture medium or cell extracts, depending upon the expression system employed. As known to the skilled artisan, procedures for purifying a recombinant protein will vary according to such factors as the type of host cells employed and whether or not the recombinant protein is secreted into the culture medium.

For example, when expression systems that secrete the recombinant protein are employed, the culture medium first may be concentrated using a commercially available protein concentration filter, for example, an Amicon or Millipore Pellicon ultrafiltration unit. Following the concentration step, the concentrate can be applied to a purification matrix such as a gel filtration medium. Alternatively, an anion exchange and/or an affinity resin can be employed. The matrices can be acrylamide, agarose, dextran, cellulose or other types commonly employed in protein purification. Alternatively, a cation exchange step can be employed. Finally, one or more reversed-phase high performance liquid chromatography (RP-HPLC) steps employing hydrophobic RP-HPLC media can be employed to further purify Necl-3, Necl-3 variants and Necl-3 antagonists and/or Necl-4, Necl-4 variants and Necl-4 antagonists. Some or all of the foregoing purification steps, in various combinations,

are well known and can be employed to provide a substantially homogeneous recombinant protein.

Recombinant protein produced in bacterial culture can be isolated by initial disruption of the host cells, centrifugation, extraction from cell pellets if an insoluble polypeptide, or from the supernatant fluid if a soluble polypeptide, followed by one or more concentration, salting-out, ion exchange, affinity purification or size exclusion chromatography steps. Microbial cells can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents. A desired DNA sequence may be chemically synthesized using techniques known per se. DNA fragments also may be produced by restriction endonuclease digestion of a full length cloned DNA sequence, and isolated by electrophoresis on agarose gels. Linkers containing restriction endonuclease cleavage site(s) may be employed to insert the desired DNA fragment into an expression vector, or the fragment may be digested at cleavage sites naturally present therein. The well known polymerase chain reaction procedure also may be employed to amplify a DNA sequence encoding a desired protein fragment. As a further alternative, known mutagenesis techniques may be employed to insert a stop codon at a desired point, e. g. immediately downstream of the codon for the last amino acid of the receptor-binding domain.

Typically, when the Necl-3 and/or Necl-4 antagonists are fusion proteins (Fc-Necl-3 and Fc-Necl-4 fusion protein) according to the invention, they may be prepared according to known processes: for example, the nucleic acid sequence encoding the extracellular domain of Necl-3 or Necl-4 or a fragment thereof can be cloned in an expression vector fused to a nucleic acid sequence encoding the original extracellular domain of Necl-3 or Necl-4 or a fragment thereof signal sequence (or any other appropriate signal/export sequence) at its 5' end, and the nucleic acid sequence encoding the constant region of human immunoglobulin lambda heavy chain IgG (e.g. IgGl or IgG4) at its 3'end. The resulting vector can be used to transform a mammalian (e.g. CHO or HEK293) or an insect (e.g. Schneider S2 cells) host cell line and the clones stably expressing and secreting the recombinant fusion protein having extracellular domain of Necl-3 or Necl-4 or a fragment thereof at the N-terminus

and the IgG sequence at the C-terminus can be selected. This clone then can be used for scaling up the production and for purifying the recombinant fusion protein from the culture medium. Alternatively, the position of the nucleic acid encoding the constant region of human immunoglobulin lambda heavy chain IgG and extracellular domain of Necl-3 or Necl-4 or a fragment thereof can be inversed, and the resulting protein can be expressed and secreted using still the original signal sequence of extracellular domain of Necl-3 or Necl-4 or a fragment thereof, or any other appropriate signal/export sequence. Using these technologies it can be also possible to generate heterodimers if two different constructs expressing one Necl-3 -Fc or Necl-4-Fc fusion protein and the other a different Fc-based fusion protein (for example another antagonist) are coexpressed in the same host cell (WO 00/18932).

Typically, preparation of the fusion protein according to the invention in insect cells is carried out by the co-transfection of the corresponding insect cell expression vector expressing Fc-Necl-3 extra-cellular domain or Fc-Necl-4 extra-cellular domain (such as illustrated in Examples 6 and 12) along with the plasmid pCoBlast that carries a blasticidin S resistance gene and stable clones are selected with blasticidin S according to methods commonly known in the art. Of these, high expressers of the fusion proteins are selected. Alternatively, the preparation in mammalian cells (CHO, BHK, COS, HEK-293 or other cell line) is carried out by the transfected of the corresponding mammalian cell expression vector expressing Fc-Necl-3 extra-cellular domain or Fc-Necl-4 (such as illustrated in Examples 6 and 12) and stable clones are selected with Zeocin according to methods commonly known in the art. Of these, high expressers of the fusion proteins are selected. Once selected, high expresser clones obtained from one of these methods are expanded and grown (e.g. in a 150 mL flat bottom flask). For instance, S2 insect cells are induced with CuSθ4 (e.g. 0.5 mM). After several days (e.g. 4 days), the conditioned culture medium is loaded onto a Protein A Sepharose column and the Fc-Necl-3 or Fc-Necl-4 fusion protein is recovered according to general methods.

Typically, when the Necl-3 and/or Necl-4 antagonists are antibodies to Necl-3/Necl-4 according to the invention, they may be prepared according to known processes.

Methods of preparing polyclonal antibodies from various species have been described for instance in Vaitukaitis et ah, 1971, J. Clin. Endocrinol. Metab., 33, 988. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections. The immunizing agent may include Necl-3 or Necl-4 or the extracellular fragment or a fragment thereof or a variant as described here above or a fusion protein thereof, or a synthetic peptide encoding a region of Necl-3 or Necl-4. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). Repeated injections may be performed. Blood samples are collected and immunoglobulins or serum are separated.

Methods of producing monoclonal antibodies may be found, for instance, in Kohler et ah, 1975, Nature, 256, 495 incorporated therein by reference in its entirety. The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in US 4,816,567. Typically, the preparation of the polyclonal antibodies according to the invention is performed by using a fragment of the extracellular domain of Necl-3 or Necl-4 (e.g. the Necl-3 ₍ aai69-367) fragment of SEQ ID NO: 15 or Necl-4 _(aa i26-322) of SEQ ID NO: 26) produced in E. coli to immunize rabbits. The same fragment is coupled to NHS activated Sepharose 4 Fast Flow and used for affinity purification of the antibodies from the rabbit sera. The antibody-containing fractions are then loaded onto a Protein A Sepharose CL-4B column and the IgGs are eluted.

Typically, the efficacy of the Necl-3/Necl-4 antagonists according to the invention may be assayed in various cell adhesion assays such as described in Biederer et ah, 2002, Science, 297:1525-31 or according to the following general process: S2 Drosophila cells are

maintained in appropriate medium such as Schneider's Drosophila Medium (Gibco) supplemented with 10% FCS and transfected with an appropriate transfection agent (e.g. Lipofectamine 2000 (Invitrogen), Fugene HD (Roche), or other). After transfection (e.g. about 24 hours) the medium is changed and CuSθ4 is added (e.g. to 0.5 mM) for another period of time (e.g. 24 hours). For aggregation assays, the cells to be tested are mixed after the medium change, induced with CuSθ4 and gently shaken for several hours to allow for plasmid transcription, protein accumulation and aggregate formation. The Necl-3/Necl-4 antagonists and appropriate controls such as unrelated Fc fusion proteins or immunoglobulins are added prior to induction with CuSθ ₄ and their inhibitory effect on aggregate formation is assessed by microscopy.

In one embodiment, the invention provides an isolated polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of: (a) amino acids 1 to 435 of SEQ ID NO: 2; (b) amino acids 1 to 365 SEQ ID NO: 4;

(c) amino acids 1 to 388 of SEQ ID NO: 6;

(d) amino acids 1 to 323 of SEQ ID NO: 8;

(e) amino acids 1 to 198 of SEQ ID NO: 15; and

(f) amino acids 1 to 197 of SEQ ID NO: 26.

In a further embodiment, the invention provides an isolated polypeptide according to the invention having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acids 1 to 435 of SEQ ID NO: 2; amino acids 1 to 365 SEQ ID NO: 4; and amino acids 1 to 198 of SEQ ID NO: 15.

In another further embodiment, the invention provides an isolated polypeptide according to the invention having at least 90% (such as at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acids 1 to 435

of SEQ ID NO: 2; amino acids 1 to 365 SEQ ID NO: 4; and amino acids 1 to 198 of SEQ ID NO: 15.

In a further embodiment, the invention provides an isolated polypeptide according to the invention wherein the isolated polypeptide binds to at least one Necl protein or one of its ligand such as Necl-1, Necl-2, Necl-3 or Nec-4 or fragment thereof. In a particular embodiment, the isolated polypeptide according to the invention binds to the extracellular fragment or a fragment thereof of at least one Necl protein, such as Necl-1 , Necl-2, Necl-3 or Nec-4.

In a further embodiment, the invention provides an isolated polypeptide according to any one of claims 1 to 3 comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 2; SEQ ID NO: 4; SEQ ID NO: 6; SEQ ID NO: 8; SEQ ID NO: 15 and SEQ ID NO: 26.

In a further embodiment, the invention provides an isolated polypeptide according to the invention comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 2; SEQ ID NO: 4 and SEQ ID NO: 15. In a further embodiment, the isolated peptide comprises an amino acid sequence of SEQ ID NO: 4.

In a further embodiment, the invention provides an isolated peptide according to the invention wherein the amino acid sequence is of SEQ ID NO: 2.

In a further embodiment, the invention provides an isolated peptide according to the invention wherein the amino acid sequence is of SEQ ID NO: 4.

In a further embodiment, the invention provides an isolated peptide according to the invention wherein the an amino acid sequence is of SEQ ID NO: 15.

In another further embodiment, the invention provides an isolated polypeptide according to the invention comprising an amino acid sequence selected from the group consisting of: SEQ ID NO: 6; SEQ ID NO: 8 and SEQ ID NO: 26. In a further embodiment, the isolated peptide comprises an amino acid sequence of SEQ ID NO: 8.

In a further embodiment, the invention provides an isolated peptide according to the invention wherein the amino acid sequence is of SEQ ID NO: 8.

In a further embodiment, the invention provides an isolated peptide according to the invention wherein the amino acid sequence is of SEQ ID NO: 26.

In another embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of: (a) amino acids 1 to 435 of SEQ ID NO: 2; (b) amino acids 1 to 365 SEQ ID NO: 4;

(c) amino acids 1 to 388 of SEQ ID NO: 6;

(d) amino acids 1 to 323 of SEQ ID NO: 8;

(e) amino acids 1 to 198 of SEQ ID NO: 15; and

(f) amino acids 1 to 197 of SEQ ID NO: 26.

In another embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 80% (such as at least 85%, at least 90%, at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acids 1 to 435 of SEQ ID NO: 2; amino acids 1 to 365 SEQ ID NO: 4; and amino acids 1 to 198 of SEQ ID NO: 15.

In another embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having at least 90% (such as at least 95%, at least 98%) identity or homology with a sequence of amino acids selected from the group consisting of amino acids 1 to 435 of SEQ ID NO: 2; amino acids 1 to 365 SEQ ID NO: 4; and amino acids 1 to 198 of SEQ ID NO: 15.

In a further embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having a sequence of amino acids selected from the group consisting of:

(a) amino acids 1 to 435 of SEQ ID NO: 2;

(b) amino acids 1 to 365 of SEQ ID NO: 4;

(c) amino acids 1 to 388 of SEQ ID NO: 6;

(d) amino acids 1 to 323 of SEQ ID NO: 8; (e) amino acids 1 to 198 of SEQ ID NO: 15; and (f) amino acids 1 to 197 of SEQ ID NO: 26.

In a further embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having a sequence of amino acids selected from the group consisting of: SEQ ID NO: 2; SEQ ID NO: 4 and SEQ ID NO: 15.

In a further embodiment, the invention provides an isolated nucleic acid according to the invention wherein the amino acid sequence is of SEQ ID NO: 2.

In a further embodiment, the invention provides an isolated nucleic acid according to the invention wherein the amino acid sequence is of SEQ ID NO: 4.

In a further embodiment, the invention provides an isolated nucleic acid according to the invention wherein the amino acid sequence is of SEQ ID NO: 15.

In a further embodiment, the invention provides an isolated nucleic acid consisting of a nucleotide sequence encoding a polypeptide having a sequence of amino acids selected from the group consisting of: SEQ ID NO: 6; SEQ ID NO: 8 and SEQ ID NO: 26.

In a further embodiment, the invention provides an isolated peptide or an isolated nucleic acid according to the invention wherein the amino acid sequence consists in SEQ ID NO: 2.

In a further embodiment, the invention provides an isolated peptide or an isolated nucleic acid according to the invention wherein the amino acid sequence consists in SEQ ID NO: 4.

In a further embodiment, the invention provides an isolated peptide or an isolated nucleic acid according to the invention wherein the amino acid sequence consists in SEQ ID NO: 15.

In a further embodiment, the invention provides an isolated peptide or an isolated nucleic acid according to the invention wherein the amino acid sequence consists in SEQ ID NO: 8.

In a further embodiment, the invention provides an isolated peptide or an isolated nucleic acid according to the invention wherein the amino acid sequence consists in SEQ ID NO: 26.

In another embodiment, the invention provides a fusion protein comprising the following sequences:

-an effector region having at least 80% identity or homology (such as at least 85%, at least 90%, at least 95%, at least 98%) with a sequence of amino acids selected from the group consisting of an extracellular domain of said Necl-3 or Necl-4 or a fragment thereof and -an immunoglobulin constant region (Fc domain or an Fc variants thereof).

In another embodiment, the invention provides a fusion protein comprising the following sequences:

-an effector region having at least 80% identity or homology (such as at least 85%, at least 90%, at least 95%, at least 98%) with a sequence of amino acids selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 15; and

- an immunoglobulin constant region (Fc domain or an Fc variants thereof).

In another embodiment, the invention provides a fusion comprising the following sequences: -an effector region having at least 80% identity or homology (such as at least 85%, at least 90%, at least 95%, at least 98%) with a sequence of amino acids of SEQ ID NO: 8 and SEQ ID NO: 26; and

- an immunoglobulin constant region (Fc domain or an Fc variants thereof).

In another further embodiment, the invention provides a fusion protein according to the invention wherein the effector region is a protein with a sequence of amino acid of SEQ ID NO: 4.

In another further embodiment, the invention provides a fusion protein according to the invention wherein the effector region is a protein with a sequence of amino acid of SEQ ID NO: 8.

In a further embodiment, the invention provides a fusion protein according to the invention wherein the immunoglobulin constant region is the Fc domain of an IgG.

In another further embodiment, the invention provides a fusion protein according to the invention wherein the Fc domain is the Fc domain of an IgGl or an IgG4.

In another further embodiment, the invention provides a fusion protein according to the invention wherein the fusion protein is selected from the following group: The fusion protein formed by the human Necl-3 extracellular domain (aa 1 -365) of SEQ ID NO: 4 fused to the human Fc domain of an IgGl of SEQ ID NO: 35;

The fusion protein formed by the human Necl-3 extracellular domain (aa 169-367) of SEQ ID NO: 15 fused to the human Fc domain of an IgGl of SEQ ID NO: 35; The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36;

The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the mouse Fc domain of an IgG2a of SEQ ID NO: 37; The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the mouse Fc domain of an IgG3 of SEQ ID NO: 38; The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgGl of SEQ ID NO: 35;

The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36; The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the mouse Fc domain of an IgG2a of SEQ ID NO: 37; and

The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the mouse Fc domain of an IgG3 of SEQ ID NO: 38.

In another further embodiment, the invention provides a fusion protein according to the invention wherein the fusion protein is selected from the following group: The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgGl of SEQ ID NO: 35; The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36;

The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgGl of SEQ ID NO: 35; and The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36.

In another further embodiment, the invention provides a fusion protein according to the invention wherein the fusion protein is selected from the following group: The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgGl of SEQ ID NO: 35; and the fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36.

In another further embodiment, the invention provides a fusion protein according to the invention wherein the fusion protein is selected from the following group: The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgGl of SEQ ID NO: 35; and the fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36.

In a particular embodiment, the fusion protein according to the invention of the invention has an inhibitory activity to a Necl protein such as Necl-1 or Necl-2 or Necl-3 or Necl-4 or a ligand thereof.

In another embodiment, the invention provides an isolated DNA sequence that encodes a fusion protein according to the invention.

In a further embodiment, the invention provides an isolated antibody or an immunologically active fragment of a monoclonal antibody that binds to at least one Necl protein selected fromNecl-3 andNecl-4.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids selected from the group consisting of:

(a) amino acids 1 to 435 of SEQ ID NO: 2;

(b) amino acids 1 to 365 of SEQ ID NO: 4;

(c) amino acids 1 to 388 of SEQ ID NO: 6; (d) amino acids 1 to 323 of SEQ ID NO: 8;

(e) amino acids 1 to 198 of SEQ ID NO: 15; and

(f) amino acids 1 to 197 of SEQ ID NO: 26.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids of amino acids 1 to 435 of SEQ ID NO: 2.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids of amino acids 1 to 435 of SEQ ID NO: 4.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids of amino acids 1 to 435 of SEQ ID NO: 6.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids of amino acids 1 to 435 of SEQ ID NO: 8.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids of amino acids 1 to 435 of SEQ ID NO: 15.

In another further embodiment, the invention provides an isolated antibody specifically directed against a polypeptide having a sequence of amino acids of amino acids 1 to 435 of SEQ ID NO: 26.

In another embodiment, the invention provides a use of an antibody according to the invention for the analysis of Necl-3 or Necl-4 expression such as in a western blot, an immunohistochemistry, an ELISA or a FACS assay.

In another embodiment, the invention provides a kit comprising at least one Necl-3 antagonist and/or Necl-4 antagonist according to the invention. More especially, the invention provides a kit comprising at least one Necl-3 antagonist and/or Necl-4 antagonist according to the invention wherein the Necl-3 antagonist and/or Necl-4 antagonist is a fusion protein according to the invention. The kit according to the invention may be used for measuring the activity/or the presence of at least one Necl protein such as Necl-1 , Necl- 2, Necl-3 or Necl-4 or its ligand. In a particular embodiment, the kit is used for measuring the activity/or the presence of Necl-3 and/or Necl-4.

In another embodiment, the invention provides a recombinant expression vector comprising a nucleic acid molecule according to the invention, wherein the vector optionally comprises an expression control sequence, allowing expression in prokaryotic or eukaryotic host cells of the encoded polypeptide, operably linked to the nucleic acid molecule.

In another embodiment, the invention provides a host cell (e.g. prokaryotic or eukaryotic) transfected or transformed with a recombinant expression vector or a nucleic acid according to the invention.

In another embodiment, the invention provides a process for producing cells capable of expressing a polypeptide according to the invention, comprising genetically engineering cells with a vector or a nucleic acid according to the invention

In another embodiment, the invention provides a process for producing a polypeptide according to the invention, comprising transfecting an expression vector according to the invention into a host cell according to the invention under conditions allowing the expression of said polypeptide according to the invention and recovering the said polypeptide.

In another embodiment, the invention provides a process for producing a fusion protein according to the invention, comprising culturing a host cell transformed with an expression vector according to the invention under conditions that promotes expression of said fusion protein and recovering said fusion protein.

In another embodiment, the invention provides a pharmaceutical composition comprising a Necl-3 antagonist or a Necl-4 antagonist according to the invention, and a physiologically acceptable carrier, diluent or excipient.

In particular, the invention provides a pharmaceutical composition wherein the Necl-3 antagonist or the Necl-4 antagonist is selected from a fusion protein according to the invention and a Necl-3 or a Necl-4 specific binding agent of the invention and a physiologically acceptable carrier, diluent or excipient. More especially, the invention provides a pharmaceutical composition comprising a Necl-3 antagonist or a Necl-4 antagonist according to the invention, wherein the Necl-3 antagonist or Necl-4 antagonist is a fusion protein according to the invention, and a physiologically acceptable carrier, diluent or excipient.

In another embodiment, the invention provides a Necl-3 antagonist or a Necl-4 antagonist for use as a medicament. In particular, the Necl-3 antagonist or the Necl-4 antagonist according to the invention for use as a medicament is selected from a fusion protein

according to the invention, an isolated Necl-3 specific binding agent or a Necl-4 specific binding agent according to the invention, and an antibody according to the invention.

In another embodiment, the invention provides a use of a Necl-3 antagonist or a Necl-4 antagonist according to the invention for the manufacture of a medicament for the treatment of CNS disorders comprising neuro inflammatory and neurodegenerative conditions or diseases such as demyelinating disorders or diseases. In particular, the Necl-3 antagonist or the Necl-4 antagonist according to the invention is selected from a fusion protein according to the invention, an isolated Necl-3 specific binding agent or a Necl-4 specific binding agent according to the invention, and an antibody according to the invention.

In a further embodiment, the Necl-3 antagonist or the Necl-4 antagonist according to the invention is a fusion protein according to the invention.

In a further embodiment, the Necl-3 antagonist or the Necl-4 antagonist according to the invention is an antibody or an immunologically active fragment of a monoclonal antibody that binds Necl-3 (Necl-4) and/or blocks the binding of Necl-3 (Necl-4) to other binding partners such as Necl-1 , Necl-2, Necl-3 and/or Necl-4

In another embodiment, the invention provides a use of a Necl-3 antagonist or a Necl-4 antagonist according to the invention for the manufacture of a medicament for the treatment of CNS disorders comprising neuroinfiammatory and neurodegenerative conditions or diseases such as demyelinating disorders or diseases wherein the Necl-3 antagonist or the Necl-4 antagonist is to be administered in combination with a co-agent that useful in the treatment of CNS disorders, including neuroinflammation and/or neurodegeneration such as a co-agent useful in the treatment of demyelination. In a particular embodiment, the Necl-3 antagonist or a Necl-4 antagonist according to the invention and the co-agent are used simultaneously or sequentially.

In a further embodiment, the invention provides a use of a Necl-3 antagonist or a Necl-4 antagonist according to the invention for the manufacture of a medicament for the treatment of multiple sclerosis.

In a further embodiment, the invention provides a use of a Necl-3 antagonist or a Necl-4 antagonist according to the invention for the manufacture of a medicament for the treatment of CNS disorders comprising neuroinfiammatory and neurodegenerative conditions or diseases such as demyelinating disorders or diseases, wherein the Necl-3 antagonist or Necl-4 antagonist is a fusion protein according to the invention.

In another embodiment, the invention provides a method of treating of a disease comprising the administration of a therapeutically effective amount of a Necl-3 antagonist or a Necl-4 antagonist according to the invention in a mammal in need thereof and wherein the disease is a CNS disorders comprising neuroinfiammatory and neurodegenerative conditions or diseases such as demyelinating disorders or diseases. In a further embodiment, the mammal is human. In another further embodiment, the human suffers from multiple sclerosis.

The invention relates to methods of promoting remyelination of nerve cells in a mammal comprising administering to the mammal a Necl-3 and/or Necl-4 antagonist according to the invention in a remyelination effective amount. In a particular embodiment, the mammal in the methods of the present invention is a human and the human suffers from a condition that demyelinates cells.

In another embodiment, the invention provides a method of antagonizing the aggregation of Necl-3 and/or of Necl-4 with itself of with at least one protein of the Necl/SynCAM family, comprising exposing cells that express Necl-3 or Necl-4, respectively to a Necl-3 antagonist and/or Necl-4 antagonist according to the invention, such that the Necl-3 antagonist or the Necl-4 antagonist blocks the aggregation of Necl-3 or of Necl-4 with itself or with at least one protein of the Necl/SynCAM family. More particularly, the Necl-3 antagonist or Necl-4 antagonist used in this method is a fusion protein according to the invention.

In another embodiment, the invention provides a method for in vitro detection of the level of a Necl-3 and of Necl-4 protein in a biological sample comprising contacting said biological sample with an antibody according to the invention.

In another embodiment, the invention provides a method for screening for a Necl-3 and/or a Necl-4 antagonist, comprising the following steps:

(i) Combining cells that do not aggregate spontaneously but in presence of a Necl-3 and/or a Necl-4 protein with at least one peptide according to the invention, in presence/in absence of a compound to be screened;

(ii) Determining the ability of the compound to inhibit the Necl-3 and/or Necl-4 induced cell aggregation.

References cited herein are hereby incorporated by reference in their entirety. The present invention is not to be limited in scope by the specific embodiments described herein, which are intended as single illustrations of individual aspects of the invention, and functionally equivalent methods and components are within the scope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

The invention having been described, the following examples are presented by way of illustration, and not limitation.

Examples

The following abbreviations refer respectively to the definitions below: aa (amino acid); Da (Dalton), Kb (Kilobase), μl (microliter), mL (milliliter), mM (millimolar), min (minute), mW (MilliWatt), nm (nanometer), APC (Antigen Presenting Cell), BSA (Bovine Serum Albumin), CAM (Cell Adhesion Molecule), CHO (Chinese Hamster Ovary), CNS (Central nervous system), CSF (Cerebrospinal fluid), DMEM (Dulbecco's Modified Eagle Medium), DsRed2 (Discosoma Red), EDSS (Expanded Disability Status Scale), FACS (Fluorescence Activated Cell Sorte); FCS (Fetal calf serum), GADPH (Glyseraldehyde-3 -phosphate dehydrogenase), GFP (Green Fluorescent Protein), IFN (interferon), Ig (Immunoglobulin), IPTG (isopropyl-beta-D- thiogalactopyranoside), i.v. (intra- venous), MBP (myelin basic protein), MHC (Major Histocompatibility Complex), MRI (Magnetic resonance imaging), MS (multiple

sclerosis), NHS (N-hydroxysuccinimide), PCR (Polymerase Chain Reaction), PML (progressive multifocal leukoencephalopathy), PPMS (Primary progressive multiple sclerosis), PRMS (Progressive relapsing multiple sclerosis), RIPA (Radioimmunoprecipitation assay), RRMS (Relapsing-remitting multiple sclerosis), SDS (Sodium Dodecyl Sulfate), SNRS (Scripps Neurologic Rating Scale), SPMS (Secondary progressive multiple sclerosis), SynCAM (Synaptic CAM), s.c. (subcutaneous).

Example 1: Necl-3 expression vectors

Amplifications were performed by PCR reaction with Pfu Turbo polymerase (Stratagene) according to the supplier's instructions (IX cloned Pfu buffer, 200 μM each dNTP, 0.1 -0.5 μM each primer, 2.5 units cloned enzyme, 1 -100 ng plasmid template DNA, or 100-250 ng genomic template DNA).

Mammalian expression vectors pNecl-3-GFP and pNecl3-DsRed2 were constructed as follows:

- the cDNA DKFZp761G128 (accession AL834270) of SEQ ID NO: 9 was used as a template for PCR amplification with the primers 5'-

GGAATTCATGATTTGGAAACGC-S' of SEQ ID NO: 10 and 5'- CCCCAATT GCAATGAAAT ACTCTTT-3 of SEQ ID NO: 1 1 , respectively.

- the resulting amplicon was digested with EcoRl and Mfe l and ligated into the EcoRl site ofpEGFP-Nl and pDsRed2-Nl (BD Biosciences Clonetech).

Another mammalian expression vector pNecl-3-myc was constructed as follows:

- the cDNA DKFZp761 G128 of SEQ ID NO: 9 was used as a template for PCR amplification with the primers 5 '-GGAATTCATGATTTGGAAACGC-S ' of SEQ ID NO: 10 and 5 '-CCCCAATTGCAATGAAATACTCTTT-S of SEQ ID NO: 1 1.

- the resulting amplicon was digested with EcoRl and Mfe l and ligated into the EcoRl site ofpcDNA3.1/myc-His (Invitrogen).

- The insect cell expression vector pMT-Necl-3-GFP and pMT-Necl-3-DsRed2 were constructed as follows: the pNecl-3-GFP and pNecl-3-DsRed2 vectors were digested

with EcoRl and Notl and the resulting inserts were ligated into the plasmid pMT (Invitrogen), digested with the same enzymes.

The resulting expression vectors were transfected into S2 Drosophila cells that were maintained in Schneider's Drosophila Medium (Gibco) supplemented with 10% FCS. The transfection was performed with Lipofactamine 2000 (Invitrogen) in 6-well culture plates: 2 μg of DNA were diluted in 50 μl of medium without serum. Lipofectamine 2000 was mixed gently before use, then diluted in 50 μl of medium, and incubated for 5 minutes at room temperature. After 5 minutes of incubation the diluted DNA was diluted in Lipofectamine 2000 (total volume = 100 μl), mixed and incubated for 20 minutes at room temperature. The 100 μl of complexes were added to each well containing cells and medium. 24 hours after transfection the medium was changed and 0.5 mM CuSθ ₄ was added for another 24 hours.

For aggregation assays, cells to be tested were mixed after the medium change, then induced with CuSO ₄ and gently shaken several hours to allow for plasmid transcription, protein accumulation and aggregate formation. HeIa cells were maintained in DMEM 10% FCS and transfected with Fugene (Roche): Fugene was mixed gently before use, then diluted in 100 μl of medium without serum, and incubated for 5 minutes at room temperature. After 5 minutes of incubation 2 μg of DNA were added to the diluted Fugene, mixed and incubated for 20 minutes at room temperature. The 100 μl of complexes were added to each well containing cells and medium.

Example 2: Necl-1 and Necl-2 expression vectors

The amino acid sequence encoding human Necl-1 and -2, are presented in SEQ ID NO: 39 and SEQ ID NO: 40, respectively.

The expression vectors of the Necl-1 and Necl-2 protein fused with GFP or with DsRed2 (respectively pMT-Necl-l-GFP/pMT-Necl-l-DsRed2 and pNecl-2-GFP which were used in the aggregation assay described in Example 6 were constructed as follows: The cDNA IMAGE: 5199627 (accession BC033819) of SEQ ID NO: 29 was used as a template for PCR amplification with the primers 5'-

CCCCAATTGATGGGGGCCCCAGCCGC -3' of SEQ ID NO: 30 and 5'-

CCCCAGATCTAAGATGAAATATTCCTTCTTGTCGTCCCC -3 of SEQ ID NO: 31. The resulting amplicon was digested with Bgl2 and Mfel and ligated into the EcoRl and BamHl sites of pMT-Necl-3-GFP resulting in the pMT-Necl-1-GFP. The same digested amplicon was ligated into the EcoRl and BamHl sites of pMT-Necl-3-DsRed2 resulting in the pMT-Necl-l-DsRed2.

The cDNA IMAGE: 4701395 (accession BC035930) of SEQ ID NO: 32 was used as a template for PCR amplification with the primers 5'- GGAATTCATGGCGAGTGTAGTG - 3' of SEQ ID NO: 33 and 5'- CCCC AATTGCGATGAAGT ACT CTTT -3 of SEQ ID NO: 34. The resulting amplicon was digested with EcoRl and Mfel and ligated into the EcoRl site of pEGFP-Nl (BD Biosciences Clonetech) resulting in pNecl-2-GFP. The insect vector pMT-Necl-2-GFP was constructed as follows: the pNecl-2-GFP vector was digested with EcoRl and Notl and the resulting inserts were ligated into the plasmid pMT (Invitrogen), digested with the same enzymes.

Example 3: Expression of an extracellular domain of Necl-3 (SEQ ID NO: 14) A bacterial expression vector pQE-Necl-3( _aa i69-367) was constructed as follows:

-the plasmid pNecl-3-myc obtained under Example 1 was used as a template for PCR amplification with the primers 5'-AGGTCTATATAAGC-S ' of SEQ ID NO: 12 and 5'- GGGGTACCAGGGCCATTCTGGCC-3 ofSEQ ID NO: 13 -the resulting amplicon was digested with Dral and Kpnl and ligated into the blunted BamHl and Kpnl sites of the plasmid pQE-30 (Qiagen).

The E. coli strain Ml 5 was transformed with the bacterial expression vector pQE-Necl- 3(aai69-367) and used to express the corresponding Necl-3 fragment. Bacteria were grown exponentially, IPTG was added to 1 mM, and the cells were allowed to grow for another 4 h at 37°C. Cells were then harvested and lysed. The cleared supernatants were loaded under denaturing conditions onto Ni -nitrilotriacetic acid agarose columns (Qiagen, 1 mL resin per 200 mL of bacteria culture), and eluted under standard conditions. The eluted proteins were then extensively dialyzed against PBS and used for immunization. The obtained Necl-3(aai69-367) fragment has an amino acid sequence of SEQ ID NO: 15.

Example 4: Raising of antibodies against an extracellular domain of Necl-3 (SEQ ID NO: 15)

The Necl-3(aai69-367) fragment produced in E. coli as described under Example 3 and having the sequence SEQ ID NO: 15 was used to immunize two rabbits according to Harlow et al, 1988, "Antibodies: A Laboratory Manual, " Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 349.

This fragment was coupled to NHS activated Sepharose 4 Fast Flow (Amersham Biosciences) and used for affinity purification of the anti Necl-3 antibodies from the rabbit sera: 10 mg of protein was used for 2 mL of resin. Coupling was performed at 4 ⁰ C overnight. After the coupling, non-reacted groups on the medium were blocked with 0.5 M ethanolamine, 0.5 M NaCl, pH 8.3 for a one hour. The medium was washed after coupling with 50 mL of two buffers (0.1 M Tris-HCl buffer pH 8-9 and 0.1 M acetate buffer, 0.5 M NaCl). The antibody-containing fractions were then loaded onto a Protein A Sepharose CL- 4B column (Amersham Biosciences) and the IgGs were eluted with 0.1 M glycine buffer pH 3.0).

The antibody specificity was tested using Drosophila S2 cells transfected with either GFP alone or with Necl-1, Necl-2 (obtained as described in Example 2), Necl-3 (as described in Example 1) and Necl-4 (as described in Example 7) fused to GFP at their carboxy-termini where crude S2 lysates were separated by SDS gel electrophoresis and probed with either the anti Necl-3 (obtained as described in Example 4) or an anti GFP antibody (anti-green fluorescent protein, Roche Applied Science) serving as a loading control. The anti Necl-3 antibody reveals a single species of the expected size exclusively in cells transfected with Necl-3 -GFP which proves that highly specific anti Necl-3 antibodies have been prepared which do not cross-react with other Necl/SynCAM family members, i.e. Necl-1, Necl-2, or Necl-4.

Example 5: Localization of Necl-3 adhesion molecules

Necl-3 mRNA expression in eighteen various rat tissues was assessed by real time PCR using a primer pair spanning two exons. The primers used for amplifying Necl-3 were SEQ ID NO: 16 (5 '-TGACCATGCTCTCATAGG-S ') and SEQ ID NO: 17 (5'-

TGCCAGATATCGACCAAG-3'), those for GAPDH were SEQ ID NO: 18 (5'- TGATTCT ACCCACGGC-3') and SEQ ID NO: 19 (5'-

TGATGGGTTTCCCATTGATGA-3 ')•

The results confirmed northern blot data showing a Necl-3 mRNA greater than 5 Kb in various structures of the central nervous system (midbrain, cerebellum, and hippocampus), whereas it was either undetectable or poorly expressed in all other organs tested except for testis. Real time PCR analysis were performed with SYBR green (Molecular Probes) on an iCycler iQ Bio-Rad station, with quantitation, melt curve, and PCR efficiency analysis derived by the station's software as described in Pellissier et ah, 2006, Anal. Biochem, 350:310-2 incorporated by reference in its entirety.

RNA purification and cDNA synthesis were prepared as described in (Ossipow et ah, 2004, MoI Cell Neurosci. 27: 70-83 ) .

Necl-3 protein accumulation was examined by using Necl-3 antibodies obtained as described in Example 4. Western blot analysis with extracts from a series of different organs was carried out where rat tissues were heated and sonicated in Laemmli sample buffer. Proteins were separated on a 12% SDS-polyacrylamide gels, and transferred to nitrocellulose membranes. These were probed with the appropriate antibodies and revealed by chemiluminescence (ECL, Amersham) (equal amounts of the ECL substrates were mixed and incubated with the blot for 5 min). Necl-3 protein was detected in brain structures, but also in kidney, heart and liver. Necl-3 migrates with an apparent mass of approximately 52 kDa (calculated molecular weight of 48 kDa), due to N-linked glycosylation.

The brain distribution of Necl-3 was investigated by immunohistochemistry and confocal microscopy. 2 month-old rats were anaesthetized, their brains were rapidly excised and immersed for 5 min in isopentane pre-cooled to -20 ⁰ C. Brains were then embedded in OCT medium (Miles Inc., Elkhart, IN) and cryo-sectioned at 12-μm.

Brain sections were exposed for 10 min to -20 ⁰ C absolute ethanol, rinsed in PBS and incubated for 30 min in PBS containing 2% BSA. Sections were then incubated for 2 h at 37°C in PBS, 0.5% BSA, containing the affinity-purified anti-Necl-3 antibody (diluted

1 :100) obtained as described under Example 4 and the appropriate mouse monoclonal antibody. After washes in PBS, Alexa Fluor highly cross-adsorbed secondary antibodies (Molecular Probes) were used to detect the mouse and rabbit primary antibodies (with Alexa 488 and Alexa 594, respectively). The brain sections were then rinsed again in PBS and stained with Hoechst. Confocal laser scanning was performed on a Leica SP2 microscope (Leica, Germany) using 20 mW blue diode (405 nm), 30 mW ArKr (488 nm), 1 mW HeNe (594 nm) lasers and a 63X plan Apo oil immersion objective. Section planes were collected in steps throughout the entire cell thickness. Images of each field were merged using the Leica Confocal software. Z-section analysis was done with the Imaris software (Bitplane AG, Switzerland) using the "Section" function with the stacks series of confocal acquisitions.

Intense labeling was observed in structures resembling axon bundles in several brain areas including cerebellar white matter and ventral reticular nucleus. The axonal localization of Necl-3 was confirmed by a near-perfect overlap with the axonal neurofilament marker. Monoclonal antibodies directed against the MBP (Calbiochem) were used in combination with anti Necl-3 antibodies obtained as described under Example 4 to confirm that Necl-3 is found in the axoplasm of myelinated axons and that Necl-3 immunoreactivity is stronger in the myelinated areas.

Example 6: Aggregation of Necl-3 molecules- Fusion protein preparation S2 cells do not aggregate spontaneously and the ability of Necl-3 to induce their aggregation was assayed. S2 cells were transfected separately with plasmids expressing GFP (the insect cell expression vector pMT-GFP was constructed as follows: pEGFP-Nl (BD Biosciences Clonetech) was digested with EcoRl and Notl, and the resulting insert was ligated into the plasmid pMT (Invitrogen), digested with the same enzymes) or Necl-3- GFP obtained under Example 1 under the control of the drosophila inducible metallothionein promoter. After transfection, the cells were washed free from plasmid, and mixed together. They were then induced with CuSCU, gently shaken to favor aggregation and visualized without further fixation. Unlike cells transfected with GFP, those transfected

with Necl-3 -GFP formed large aggregates. Non-transfected cells serving as internal control did not aggregate.

S2 cells were separately transfected with plasmids coding for Necl-3-GFP (Example 1),

Necl-l-DsRed2 (Example 2), and Necl-4-DsRed2 (Example 7). After transfection, they were mixed together in different combinations and induced to express their transfected

Necl. After gentle shaking, aggregates formed between Necl-3-GFP and Necl-l-DsRed2 or

Necl-4-DsRed2 were observed by fluorescence microscopy. A similar S2 cells aggregation assay using a myc-tagged version of Necl-3 (pNecl-3-myc) along with Necl-2-GFP. Using a rhodamine-conjugated anti myc secondary antibody, aggregates of red and green cells were again observed.

Thus, Necl-3 unambiguously interacts with itself, Necl-1 , Necl-2, and Necl-4.

An Fc-Necl-3 fusion protein between the Fc domain of a human IgGl of SEQ ID NO: 35 and the extra-cellular domain of Necl-3 (aa 1-365) of SEQ ID NO: 2 was prepared as follows: First, a mammalian expression vector pFc-Necl-3 was constructed by using the plasmid pNecl-3-myc (Example 1) as a template for PCR amplification with the primers 5'- AGGTCT AT AT AAGC-3' of SEQ ID NO: 12 and 5'-

GGGGTACCAGGGCCATTCTGGCC-3 of SEQ ID NO: 13. The resulting amplicon was digested with Nhel and Kpnl and ligated into the plasmid plgplus (R&D Systems, Abingdon, United Kingdom) digested with the same enzymes, resulting in pFc-Necl-3. An insect cell expression vector pMT -Fc-Necl-3 was then constructed wherein the pFc-Necl-3 vector obtained above was digested with Nhel and Apal and the resulting insert was ligated into the plasmid pMT (Invitrogen) digested with Spel and Apal resulting in pMT- Fc-Necl-3. The obtained insect cell expression vector pMT -Fc-Necl-3 was then co -transfected in S2 cells along with the plasmid pCoBlast that carries a blasticidin S resistance gene (Invitrogen). Stable clones were selected with blasticidin S at 25 μg/mL. Of these, high expressers of the Fc-Necl-3 fusion were selected. One such clone was expanded and grown in a 150 mL fiat bottom flask and induced with 0.5 mM CUSO ₄ . After 4 days, the conditioned culture medium was loaded onto a Protein A Sepharose CL-4B column

(Amersham Biosciences). The Fc-Necl-3 fusion protein which was bond to the resin directly from the culture medium was recovered by washing the column (10 volumes of Tris-HCl: 50 mM, pH 7.4) and eluting (0.1 M glycine buffer pH 3.0), and was then characterised by western blotting. This fusion protein or a control full-length human IgGs (Sigma) were adsorbed on protein A resin. lOOμl of lysates of mock-transfected and pMT-Necl-2-GFP transfected S2 cells (Example 2) were pre-cleared for 30 min at 4°C with 25 μl of Protein A Sepharose CL-4B resin and used as the inputs for the following pull-down experiments: After pre-clearing, the lysates were rocked 45 min at 4°C with the Fc-Necl-3 fusion protein immobilized on Protein A Sepharose CL-4B resin. After incubation, the proteins retained on the beads were washed 3 times with 500 μl RIPA buffer, and boiled in IX Laemmli sample buffer for western blot analysis. After incubation and washings, the proteins retained on the beads were analyzed by western blot. Control IgG beads were unable to bring down Necl-2-GFP, whereas the Fc-Necl-3 beads efficiently did so. This shows that Necl-3 is able to make heterophilic interactions with Necl-2, and the fact that human IgGs beads do not interact with Necl-2 confirms that even though the Necl proteins are capable of multiple heterophilic interactions, they retain specificity.

Example 7: Necl-4 expression vector

Necl-4 amplification was performed by PCR reaction with Pfu Turbo polymerase (Stratagene): IX cloned Pfu buffer, 200 μM each dNTP, 0.1-0.5 μM each primer, 2.5 units cloned enzyme, 1-100 ng plasmid template DNA, or 100-250 ng genomic template DNA)

Insect expression vectors pMT-Necl-4-GFP and pMT-Necl-4-DsRed2 were constructed as follows:

- the modified cDNA clone IMAGE 4375136 (accession BC068457) mutated in position 563 wherein A is mutated in G as shown on SEQ ID NO: 20 was used as a template for

PCR amplification with the primers 5 '-CCCCAATTGATGGGCCGGGCCCGG-S ' of

SEQ ID NO: 21 and 5 '-CCCCAGATCTAAGATGAAGAATTCCTCTTTCCTCTTGT-S of SEQ ID NO: 22.

- the resulting amplicon was digested with Mfel and Bgl2 and ligated into either a pMT- GFP or a pMT-DsRed2 digested by EcoRl and BamHl .

A mammalian expression vector pNecl-4-GFP was constructed as follows:

- pMT-Necl-4-GFP obtained above was digested with Xbal and the fragment Necl-4-GFP was ligated into the pcDNA3.1/myc-His (Invitrogen) digested with the same enzyme.

A bacterial expression vector pQE-Necl-4( _aa i26-322) was constructed as follows:

- the plasmid pNecl-4-GFP above was used as a template for PCR amplification with the primers 5 '-CCCGCATGCAATCCTGTGGTGGAGGTC-S' of SEQ ID NO: 23 and 5'- CCCCT GC AGGGGAACCG ACGTCTGA-3 of SEQ ID NO: 24. -the resulting amplicon was digested with Sphl and Pstl and ligated into the pQE-30 (Qiagen), digested with the same enzymes.

The insect vectors were transfected into S2 Drosophila cells under the same conditions as described for the transfection conditions described in Example 1.

Example 8: Expression of Necl-4 an extracellular domain (SEQ ID NO: 26) A Ml 5 E. coli strain was transformed with the bacterial expression vector pQE-Necl-4( _aa i26- 322) obtained above and used to express the corresponding Necl-4 fragment The bacteria were grown exponentially, 1 mM IPTG was added, and the cells were allowed to grow for another 4 h at 37°C. Cells were then harvested and lysed. The cleared supernatants were loaded under denaturing conditions onto Ni ²⁺ -nitrilotriacetic acid agarose columns (Qiagen), i.e. 1 mL resin per 200 mL of bacteria culture, and eluted under standard conditions. The eluted proteins were then extensively dialyzed against PBS and used for immunization. The obtained Necl-4( _aa i26-322) fragment has an amino sequence of SEQ ID NO: 26.

Example 9: Raising of antibodies against an extracellular domain of Necl-4 (SEQ ID NO: 26)

The Necl-4( _aa i26-322) fragment produced in E. coli as described under Example 7 and having the amino acid sequence of SEQ ID NO: 26 was used by to immunize two rabbits on the same manner as described under Example 4.

Example 10: Localization of Necl-4 adhesion molecules

Necl-4 expression was examined in various tissues by real-time PCR in the way as described under Example 5 and wherein the primers used for amplifying Necl-4 were 5'- GAGGGCGCTCT ACGT ACTTG-3' of SEQ ID NO: 27 and 5'- AACCGACGTCTGAGCCTCT A-3' of SEQ ID NO: 28, those for GAPDH were of SEQ ID NO: 18 and SEQ ID NO: 19. The Necl-4 expression was shown to be the highest in brain and spinal cord.

Example 11: Aggregation of Necl-4 molecules

The ability of Necl-4 to form homophilic interaction was demonstrated as described under Example 6 wherein the S2 cells were transfected with the plasmid expressing Necl-4-GFP obtained under Example 7.

The ability of Necl-4 to form heterophilic interaction was demonstrated as described under

Example 6 wherein the S2 cells were separately transfected with the plasmid expressing

Necl-4-GFP obtained under Example 7, the plasmid coding for Necl-3-GFP obtained under Example 1, the plasmids coding for Necl-4-DsRed2 obtained under Example 7, Necl-1-

GFP and Necl-2-GFP obtained under Example 2.

Necl-4 showed to unambiguously interact with itself, Necl-1 , Necl-2, and Necl-3.

Example 12: Fusion proteins

The following fusion proteins for modulating the Necl-3 and/or Necl-4 induced cell aggregation are prepared as described in Example 6.

The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgGl of SEQ ID NO: 35;

The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36;

The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the mouse Fc domain of an IgG2a of SEQ ID NO: 37; The fusion protein formed by the human Necl-3 extracellular domain (aa 1-365) of SEQ ID NO: 4 fused to the mouse Fc domain of an IgG3 of SEQ ID NO: 38;

The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgGl of SEQ ID NO: 35;

The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the human Fc domain of an IgG4 of SEQ ID NO: 36;

The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the mouse Fc domain of an IgG2a of SEQ ID NO: 37; and The fusion protein formed by the human Necl-4 extracellular domain (aa 1-323) of SEQ ID NO: 8 fused to the mouse Fc domain of an IgG3 of SEQ ID NO: 38.

Example 13: Models for demylinating diseases

The efficiency of the Necl-3 antagonists or Necl-4 antagonists and in particular of fusion proteins according to the invention in the treatment of CNS disorders may be assayed in different models such as Experimental Autoimmune Encephalomyelitis (EAE) model such as described in Loo et al, 2006, Nature Immunology 7(9): 954-961. In particular, Necl-3 antagonists or Necl-4 antagonists according to the invention may be subjected to i.v. injection with various doses and dosing regimens in mice primed to develop (EAE). Specifically, a MOG peptide (SEQ ID NO: 41) (Sigma-Aldrich Co.) is injected into mice of 10-15 weeks of age by subcutaneous injection of 200 μg peptide in 200 μl sterile PBS emulsified with an equal volume of complete Freund's adjuvant (Sigma) containing 5 mg/mL of Mycobacterium tuberculosis H37Ra (BD). The effect of Necl-3 antagonists or Necl-4 antagonists according to the invention on the disease course are assigned with scores on a scale of 0-6, with 0.5 points for immediate clinical findings, as follows: 0, normal; 1, weakness of the tail; 2, complete loss of tail tonicity; 3, partial hind limb paralysis; 4, complete hind limb paralysis; 5, forelimb paralysis or moribund; and 6, death.