MODULATORS OF COMPLEMENT FACTOR B

Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0183WOSEQ_ST25.txt created September 11, 2014, which is 225 kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

The present embodiments provide methods, compounds, and compositions for treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway by administering a Complement Factor B (CFB) specific inhibitor to a subject.

Background The complement system is part of the host innate immune system involved in lysing foreign cells, enhancing phagocytosis of antigens, clumping antigen-bearing agents, and attracting macrophages and neutrophils. The complement system is divided into three initiation pathways— the classical, lectin, and alternative pathways— that converge at component C3 to generate an enzyme complex known as C3 convertase, which cleaves C3 into C3a and C3b. C3b associates with C3 convertase mediated by CFB and results in generation of C5 convertase, which cleaves C5 into C5a and C5b, which initiates the membrane attack pathway resulting in the formation of the membrane attack complex (MAC) comprising components C5b, C6, C7, C8, and C9. The membrane-attack complex (MAC) forms transmembrane channels and disrupts the phospholipid bilayer of target cells, leading to cell lysis.

In the homeostatic state, the alternative pathway is continuously activated at a low "tickover" level as a result of activation of the alternative pathway by spontaneous hydrolysis of C3 and the production of C3b, which generates C5 convertase.

Summary

The complement system mediates innate immunity and plays an important role in normal inflammatory response to injury, but its dysregulation may cause severe injury. Activation of the alternative complement pathway beyond its constitutive "tickover" level can lead to unrestrained hyperactivity and manifest as diseases of complement dysregulation. Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway in a subject by administration of a Complement Factor B (CFB) specific inhibitor. Several embodiments provided herein are drawn to a method of inhibiting expression of CFB in a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway by administering a CFB specific inhibitor to the subject. In certain embodiments, a method of reducing or inhibiting accumulation of C3 deposits in the eye of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a CFB specific inhibitor to the subject. In several embodiments, a method of reducing or inhibiting accumulation of C3 deposits in the kidney of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a CFB specific inhibitor to the subject.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

Unless otherwise indicated, the following terms have the following meanings:

"2'-0-methoxyethyl" (also 2'-MOE and 2'-0(CH ₂ )2-OCH ₃ ) refers to an O-methoxy-ethyl modification at the 2' position of a furanose ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.

"2'-MOE nucleoside" (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a 2'- MOE modified sugar moiety.

"2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2 '-position of the furanosyl ring other than H or OH. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications. "3' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular antisense compound.

"5' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 5 '-most nucleotide of a particular antisense compound.

"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5- methylcytosine is a modified nucleobase.

"About" means within ±10% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of CFB", it is implied that CFB levels are inhibited within a range of 60%> and 80%.

"Administration" or "administering" refers to routes of introducing an antisense compound provided herein to a subject to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.

"Amelioration" refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression of one or more indicators of a condition or disease. The severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.

"Antisense activity" means any detectable or measurable activity attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid.

"Antisense compound" means an oligomeric compound that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, siRNAs, shRNAs, ssRNAs, and occupancy-based compounds.

"Antisense inhibition" means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

"Antisense mechanisms" are all those mechanisms involving hybridization of a compound with target nucleic acid, wherein the outcome or effect of the hybridization is either target degradation or target occupancy with concomitant stalling of the cellular machinery involving, for example, transcription or splicing. "Antisense oligonucleotide" means a single-stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid.

"Base complementarity" refers to the capacity for the precise base pairing of nucleobases of an antisense oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.

"Bicyclic sugar moiety" means a modified sugar moiety comprising a 4 to 7 membered ring

(including but not limited to a furanosyl) comprising a bridge connecting two atoms of the 4 to 7 membered ring to form a second ring, resulting in a bicyclic structure. In certain embodiments, the 4 to 7 membered ring is a sugar ring. In certain embodiments the 4 to 7 membered ring is a furanosyl. In certain such embodiments, the bridge connects the 2 '-carbon and the 4 '-carbon of the furanosyl.

"Bicyclic nucleic acid" or " BNA" or "BNA nucleosides" means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) a-L- Methyleneoxy (4'-CH ₂ -0-2') LNA , (B) β-D-Methyleneoxy (4'-CH ₂ -0-2') LNA , (C) Ethyleneoxy (4'- (CH ₂ ) ₂ -0-2') LNA , (D) Aminooxy (4'-CH ₂ -0-N(R)-2') LNA and (E) Oxyamino (4'-CH ₂ -N(R)-0-2') LNA, as depicted below.

As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ri)(R ₂ )] _n -, -C(Ri)=N- , -C(=NR -, -C(=0)-, -C(=S)-, -0-, -Si(Ri) ₂ -, -S(=0) _x - and -N(Ri)-; wherein: x is 0, 1, or 2; n is

1, 2, 3, or 4; each Ri and R ₂ is, independently, H, a protecting group, hydroxyl, C ₁ -C ₁₂ alkyl, substituted d- C ₁₂ alkyl, C ₂ -C ₁₂ alkenyl, substituted C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, substituted C ₂ -C ₁₂ alkynyl, C ₅ -C ₂₀ aryl, substituted C ₅ -C ₂₀ aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C ₅ -C ₇ alicyclic radical, substituted C ₅ -C ₇ alicyclic radical, halogen, OJi, NJiJ ₂ , SJi, N ₃ , COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl or sulfoxyl and each J _t and J ₂ is, independently, H, C _r Ci ₂ alkyl, substituted C _r Ci ₂ alkyl, C ₂ -C ₁₂ alkenyl, substituted C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, substituted C ₂ -C ₁₂ alkynyl, C ₅ -C ₂₀ aryl, substituted C ₅ -C ₂₀ aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C _r Ci ₂ aminoalkyl, substituted C _r Ci ₂ aminoalkyl or a protecting group.

Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(R (R ₂ )] _n -, -[C(R (R ₂ )] _n -O-, -C(R ₁ R ₂ )-N(R ₁ )-0- or -C(R ₁ R ₂ )-0-N(R ₁ )-. Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH ₂ -2', 4'-(CH ₂ ) ₂ -2', 4'- (CH ₂ ) ₃ -2', 4'-CH ₂ -0-2', 4'-(CH ₂ ) ₂ -0-2', 4'-CH ₂ -0-N(R ₁ )-2' and 4'-CH ₂ -N(R -O-2'- bridges, wherein each Ri and R ₂ is, independently, H, a protecting group or C _r Ci ₂ alkyl.

Also included within the definition of LNA according to the invention are LNAs in which the 2'- hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH ₂ -0-2') bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (-CH ₂ -) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'- CH ₂ -0-2') LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4'-CH ₂ CH ₂ -0-2') LNA is used, a -L- methyleneoxy (4'-CH ₂ - 0-2'), an isomer of methyleneoxy (4'-CH ₂ -0-2') LNA is also encompassed within the definition of LNA, as used herein.

"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of an antisense compound.

"cEt" or "constrained ethyl" means a bicyclic sugar moiety comprising a bridge connecting the 4'- carbon and the 2'-carbon, wherein the bridge has the formula: 4'-CH(CH ₃ )-0-2'.

"Constrained ethyl nucleoside" (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4'-CH(CH ₃ )-0-2' bridge.

"Complement Factor B (CFB)" means any nucleic acid or protein of CFB. "CFB nucleic acid" means any nucleic acid encoding CFB. For example, in certain embodiments, a CFB nucleic acid includes a DNA sequence encoding CFB, an RNA sequence transcribed from DNA encoding CFB (including genomic DNA comprising introns and exons), including a non-protein encoding (i.e. non-coding) RNA sequence, and an mRNA sequence encoding CFB. "CFB mRNA" means an mRNA encoding a CFB protein.

"CFB specific inhibitor" refers to any agent capable of specifically inhibiting CFB RNA and/or CFB protein expression or activity at the molecular level. For example, CFB specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of CFB RNA and/or CFB protein.

"Chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'- O-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2'-0- methoxyethyl modifications. "Chimeric antisense compounds" means antisense compounds that have at least 2 chemically distinct regions, each position having a plurality of subunits.

"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

"Comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.

"Contiguous nucleobases" means nucleobases immediately adjacent to each other.

"Deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.

"Designing" or "Designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.

"Effective amount" means the amount of active pharmaceutical agent sufficient to effectuate a desired physiological outcome in an individual in need of the agent. The effective amount may vary among individuals depending on the health and physical condition of the individual to be treated, the taxonomic group of the individuals to be treated, the formulation of the composition, assessment of the individual's medical condition, and other relevant factors.

"Efficacy" means the ability to produce a desired effect.

"Expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.

"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is an antisense compound and a target nucleic acid is a second nucleic acid.

"Gapmer" means a chimeric antisense compound in which an internal region having a plurality of nucleosides that support RNase H cleavage is positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the "gap" and the external regions may be referred to as the "wings."

"Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense oligonucleotide and a nucleic acid target.

"Identifying an animal having, or at risk for having, a disease, disorder and/or condition" means identifying an animal having been diagnosed with the disease, disorder and/or condition or identifying an animal predisposed to develop the disease, disorder and/or condition. Such identification may be accomplished by any method including evaluating an individual's medical history and standard clinical tests or assessments.

"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.

"Individual" means a human or non-human animal selected for treatment or therapy.

"Inhibiting the expression or activity" refers to a reduction, blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.

"Internucleoside linkage" refers to the chemical bond between nucleosides.

"Lengthened" antisense oligonucleotides are those that have one or more additional nucleosides relative to an antisense oligonucleotide disclosed herein.

"Linked deoxynucleoside" means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.

"Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.

"Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.

"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond).

"Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.

"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.

"Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase. "Modified sugar" means substitution and/or any change from a natural sugar moiety.

"Modulating" refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating CFB mRNA can mean to increase or decrease the level of CFB mRNA and/or CFB protein in a cell, tissue, organ or organism. A "modulator" effects the change in the cell, tissue, organ or organism. For example, a CFB antisense compound can be a modulator that decreases the amount of CFB mRNA and/or CFB protein in a cell, tissue, organ or organism.

"Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.

"Motif means the pattern of unmodified and modified nucleosides in an antisense compound.

"Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

"Naturally occurring internucleoside linkage" means a 3' to 5' phosphodiester linkage.

"Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

"Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids.

"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

"Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

"Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.

"Nucleoside" means a nucleobase linked to a sugar.

"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=0)-0- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/ or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

"Oligomeric compound" means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.

"Oligonucleoside" means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.

"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.

"Parenteral administration" means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular

administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

"Pharmaceutical composition" means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more active pharmaceutical agents and a sterile aqueous solution.

"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

"Portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an antisense compound "Prevent" refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely. Prevent also means reducing the risk of developing a disease, disorder, or condition.

"Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.

"Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

"Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.

"Segments" are defined as smaller or sub-portions of regions within a target nucleic acid.

"Side effects" means physiological disease and/or conditions attributable to a treatment other than the desired effects. In certain embodiments, side effects include injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system

abnormalities, myopathies, and malaise. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.

"Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid. "Slows progression" means decrease in the development of the said disease.

"Specifically hybridizable" refers to an antisense compound having a sufficient degree of complementarity between an antisense oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.

"Subject" means a human or non-human animal selected for treatment or therapy.

"Target" refers to a protein, the modulation of which is desired.

"Target gene" refers to a gene encoding a target.

"Targeting" means the process of design and selection of an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect. "Target nucleic acid," "target RNA," "target RNA transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by antisense compounds.

"Target region" means a portion of a target nucleic acid to which one or more antisense compounds is targeted.

"Target segment" means the sequence of nucleotides of a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.

"Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual. "Treat" refers to administering a pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. In certain embodiments, one or more pharmaceutical compositions can be administered to the animal.

"Unmodified" nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

"Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside).

Certain Embodiments

Certain embodiments provide methods, compounds and compositions for inhibiting Complement

Factor B (CFB) expression.

Certain embodiments provide antisense compounds targeted to a CFB nucleic acid. In certain embodiments, the CFB nucleic acid has the sequence set forth in GENBANK Accession No. NM 001710.5 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No NW 001116486.1 truncated from nucleotides 536000 to 545000 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. XM 001113553.2 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. NM 008198.2 (incorporated herein as SEQ ID NO: 5).

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 9 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 11 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to

30 linked nucleosides and having a nucleobase sequence comprising at least 12 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 6-808.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of the nucleobase sequence of any one of SEQ ID NOs: 6-808.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleobases 30-49, 48-63, 150-169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1 178, 1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1 196, 1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341, 1328-1347, 1349-1368, 1355-1374, 1393-1412, 1396-1415, 1399-1418, 1405-1424, 1421 -1440, 1621-1640, 1646-1665, 1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782, 1912-1931, 2073-2092, 2085-2104, 2166-2185, 2172-2191, 2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197-2212, 2197-2216, 2202-2221, 2223-2238, 2223-2242, 2225-2240, 2226-2245, 2227-2242, 2227-2246, 2238-2257, 2241-2260, 2267-2286, 2361-2380, 2388-2407, 2397-2416, 2448-2467, 2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2532-2551, 2550-2569, 2551 -2566, 2551-2570, 2552-2568, 2552-2570, 2552-2571, 2553-2568, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554-2573, 2555-2570, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2573, 2557-2574, 2557-2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2576, 2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582, 2567-2584, 2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2585, 2570-2587, 2570-2589, 2571-2586, 2571-2588, 2571-2590, 2572-2589, 2572-2590, 2572-2591, 2573-2590, 2573-2592, 2574-2590, 2574-2591, 2574-2593, 2575-2590, 2575-2591, 2575-2592, 2575-2594, 2576-2593, 2576-2595, 2577-2594, 2577-2595, 2577-2596, 2578-2594, 2578-2596, 2578-2597, 2579-2598, 2580-2596, 2580-2597, 2580-2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600, 2582-2598, 2582-2599, 2582-2600, 2582-2601, 2583-2599, 2583-2600, 2583-2601, 2583-2602, 2584-2600, 2584-2601, 2584-2602, 2584-2603, 2585-2601, 2585-2603, 2585-2604, 2586-2601, 2586-2602, 2586-2604, 2586-2605, 2587-2602, 2587-2603, 2587-2605, 2587-2606, 2588-2603, 2588-2604, 2588-2605, 2588-2606, 2588-2607, 2589-2604, 2589-2605, 2589-2606, 2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607, 2590-2608, 2590-2609, 2590-2609, 2591-2607, 2591-2608, 2591-2609, 2591-2610, 2592-2607, 2592-2608, 2592-2609, 2592-2610, 2592-2611, 2593-2608, 2593-2609, 2593-2610, 2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-2613, 2595-2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-2614, 2596-2615, 2597-2612, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600-2615, 2600-2616, 2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601-2617, 2601-2618, 2601 -2619, 2601-2620, 2602-2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626, 2608-2623, 2608-2624, 2608-2625, 2608-2626, 2608-2627, 2609-2624, 2609-2625, 2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629, 2611-2626, 2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629, 2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615-2631, or 2616- 2631 of SEQ ID NO: 1, wherein said modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO : 1.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 30-49, 48-63, 150-169, 151-170, 152- 171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1178, 1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1 194, 1177-1196, 1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341, 1328-1347, 1349-1368, 1355-1374, 1393-1412, 1396-1415, 1399-1418, 1405-1424, 1421-1440, 1621-1640, 1646-1665, 1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782, 1912-1931, 2073-2092, 2085-2104, 2166-2185, 2172-2191, 2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197-2212, 2197-2216, 2202- -2221, 2223- -2238, 2223- -2242, 2225- -2240, 2226- -2245, 2227- -2242, 2227- -2246, 2238- -2257, 2241- -2260,

2267- -2286, 2361 -2380, 2388- -2407, 2397- -2416, 2448- -2467, 2453- -2472, 2455- -2474, 2457- -2472, 2457- -2476,

2459- -2474, 2459- -2478, 2461- -2476, 2461- -2480, 2532- -2551, 2550- -2569, 2551 -2566, 2551 -2570, 2552- -2568,

2552- -2570, 2552- -2571, 2553- -2568, 2553- -2570, 2553- -2571, 2553- -2572, 2554- -2571, 2554- -2572, 2554- -2573,

2555- -2570, 2555- -2572, 2555- -2574, 2556- -2573, 2556- -2574, 2556- -2575, 2557- -2573, 2557- -2574, 2557- -2575,

2557- -2576, 2558- -2575, 2558- -2576, 2558- -2577, 2559- -2576, 2559- -2577, 2559- -2578, 2560- -2577, 2560- -2578,

2560- -2579, 2561 -2576, 2561 -2578, 2561 -2579, 2561 -2580, 2562- -2577, 2562- -2579, 2562- -2581, 2563- -2578,

2563- -2580, 2563- -2582, 2564- -2581, 2564- -2583, 2565- -2584, 2566- -2583, 2566- -2585, 2567- -2582, 2567- -2584,

2567- -2586, 2568- -2583, 2568- -2585, 2568- -2587, 2569- -2586, 2569- -2588, 2570- -2585, 2570- -2587, 2570- -2589,

2571- -2586, 2571- -2588, 2571- -2590, 2572- -2589, 2572- -2590, 2572- -2591, 2573- -2590, 2573- -2592, 2574- -2590,

2574- -2591, 2574- -2593, 2575- -2590, 2575- -2591, 2575- -2592, 2575- -2594, 2576- -2593, 2576- -2595, 2577- -2594,

2577- -2595, 2577- -2596, 2578- -2594, 2578- -2596, 2578- -2597, 2579- -2598, 2580- -2596, 2580- -2597, 2580- -2598,

2580- -2599, 2581- -2597, 2581- -2598, 2581- -2599, 2581- -2600, 2582- -2598, 2582- -2599, 2582- -2600, 2582- -2601,

2583- -2599, 2583- -2600, 2583- -2601, 2583- -2602, 2584- -2600, 2584- -2601, 2584- -2602, 2584- -2603, 2585- -2601,

2585- -2603, 2585- -2604, 2586- -2601, 2586- -2602, 2586- -2604, 2586- -2605, 2587- -2602, 2587- -2603, 2587- -2605,

2587- -2606, 2588- -2603, 2588- -2604, 2588- -2605, 2588- -2606, 2588- -2607, 2589- -2604, 2589- -2605, 2589- -2606,

2589- -2607, 2589- -2608, 2590- -2605, 2590- -2606, 2590- -2607, 2590- -2608, 2590- -2609, 2590- -2609, 2591 -2607,

2591- -2608, 2591 -2609, 2591 -2610, 2592- -2607, 2592- -2608, 2592- -2609, 2592- -2610, 2592- -2611, 2593- -2608,

2593- -2609, 2593- -2610, 2593- -2612, 2594- -2609, 2594- -2610, 2594- -2611, 2594- -2612, 2594- -2613, 2595- -2610,

2595- -2611, 2595- -2612, 2595- -2613, 2595- -2614, 2596- -2611, 2596- -2612, 2596- -2613, 2596- -2614, 2596- -2615,

2597- -2612, 2597- -2612, 2597- -2613, 2597- -2614, 2597- -2615, 2597- -2616, 2598- -2613, 2598- -2614, 2598- -2615,

2598- -2616, 2598- -2617, 2599- -2614, 2599- -2615, 2599- -2616, 2599- -2617, 2599- -2618, 2600- -2615, 2600- -2616,

2600- -2617, 2600- -2618, 2600- -2619, 2601- -2616, 2601- -2617, 2601 - -2618, 2601- -2619, 2601- -2620, 2602- -2617,

2602- -2618, 2602- -2619, 2602- -2620, 2602- -2621, 2603- -2618, 2603- -2619, 2603- -2620, 2603- -2621, 2603- -2622,

2604- -2619, 2604- -2620, 2604- -2621, 2604- -2622, 2604- -2623, 2605- -2620, 2605- -2621, 2605- -2622, 2605- -2623,

2605- -2624, 2606- -2621, 2606- -2622, 2606- -2623, 2606- -2624, 2606- -2625, 2607- -2622, 2607- -2623, 2607- -2624,

2607- -2625, 2607- -2626, 2608- -2623, 2608- -2624, 2608- -2625, 2608- -2626, 2608- -2627, 2609- -2624, 2609- -2625,

2609- -2626, 2609- -2627, 2609- -2628, 2610- -2625, 2610- -2626, 2610- -2627, 2610- -2628, 2610- -2629, 2611 -2626,

2611 -2627, 2611 -2628, 2611 -2629, 2611 -2630, 2612- -2627, 2612- -2628, 2612- -2629, 2612- -2630, 2612- -2631,

2613- -2628, 2613 -2629, 2613 -2630, 2613 -2631, 2614- -2629, 2614- -2630, 2614- -2631, 2615 -2630, 2615 -2631, or 2616-2631 of SEQ ID NO: l, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 1.

Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleobases 1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151 -4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621 -4640, 4642-4661, 4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733, 5270-5289, 5295-5314, 5296-5315, 5830-5849, 5890-5909, 5904-5923, 6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000, 6985-7004, 6990-7009, 7122-7141, 7125-7144, 7151-7170, 7353-7372, 7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692-7711, 7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804, 7786-7801, 7787-7803, 7787-7805, 7787-7806, 7788-7803, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7805, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808, 7792-7809, 7792-7810, 7792-7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820, 7805-7822, 7805-7824, 7806-7821, 7806-7823, 7806-7825, 7807-7824, 7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809-7826, 7809-7828, 7810-7825, 7810-7826, 7810-7827, 7810-7829, 7811-7828, 7811-7830, 7812-7829, 7812-7830, 7812-7831, 7813-7829, 7813-7831, 7813-7832, 7814-7833, 7815-7831, 7815-7832, 7815-7833, 7815-7834, 7816-7832, 7816-7833, 7816-7834, 7816-7835, 7817-7833, 7817-7834, 7817-7835, 7817-7836, 7818-7834, 7818-7835, 7818-7836, 7818-7837, 7819-7835, 7819-7836, 7819-7837, 7819-7838, 7820-7836, 7820-7838, 7820-7839, 7821-7836, 7821-7837, 7821-7839, 7821-7840, 7822-7837, 7822-7838, 7822-7840, 7822-7841, 7823-7838, 7823-7839,

7823- 7839, 7823-7840, 7823-7841, 7823-7842, 7824-7839, 7824-7840, 7824-7840, 7824-7841, 7824-7842,

7824- 7843, 7825-7840, 7825-7841, 7825-7842, 7825-7843, 7825-7844, 7826-7842, 7826-7843, 7826-7844, 7826-7845, 7827-7842, 7827-7843, 7827-7844, 7827-7845, 7827-7846, 7828-7843, 7828-7844, 7828-7845, 7828-7847, 7829-7844, 7829-7845, 7829-7846, 7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7847, 7831-7848, 7831 -7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851, 7833-7852, 7834-7849, 7834-7850, 7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852, 7835-7853, 7835-7854,

7836- 7851, 7836-7852, 7836-7853, 7836-7854, 7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855,

7837- 7856, 7838-7853, 7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854, 7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856, 7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857,

7841-7858, 7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860, 7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862, 7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862, 7846-7861, or 7846-7862 of SEQ ID NO: 2, wherein said modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to SEQ ID NO: 2. Certain embodiments provide a compound comprising a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising a portion of at least 8 contiguous nucleobases complementary to an equal length portion of nucleobases 1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642-4661, 4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733, 5270-5289, 5295-5314, 5296-5315, 5830-5849, 5890-5909, 5904-5923, 6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000, 6985-7004, 6990-7009, 7122-7141, 7125-7144, 7151-7170, 7353-7372, 7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692-7711, 7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804, 7786-7801, 7787-7803, 7787-7805, 7787-7806, 7788-7803, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7805, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808, 7792-7809, 7792-7810, 7792-7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820, 7805-7822, 7805-7824, 7806-7821, 7806-7823, 7806-7825, 7807-7824, 7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809-7826, 7809-7828, 7810-7825, 7810-7826, 7810-7827, 7810-7829, 7811-7828, 7811 -7830, 7812-7829, 7812-7830, 7812-7831, 7813-7829, 7813-7831, 7813-7832, 7814-7833, 7815-7831, 7815-7832, 7815-7833, 7815-7834, 7816-7832, 7816-7833, 7816-7834, 7816-7835, 7817-7833, 7817-7834, 7817-7835, 7817-7836, 7818-7834, 7818-7835, 7818-7836, 7818-7837, 7819-7835, 7819-7836, 7819-7837, 7819-7838, 7820-7836, 7820-7838, 7820-7839, 7821-7836, 7821-7837, 7821-7839, 7821-7840, 7822-7837, 7822-7838, 7822-7840, 7822-7841, 7823-7838, 7823-7839, 7823-7839, 7823-7840, 7823-7841, 7823-7842, 7824-7839, 7824-7840, 7824-7840, 7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842, 7825-7843, 7825-7844, 7826-7842, 7826-7843, 7826-7844, 7826-7845, 7827-7842, 7827-7843, 7827-7844, 7827-7845, 7827-7846, 7828-7843, 7828-7844, 7828-7845, 7828-7847, 7829-7844, 7829-7845, 7829-7846, 7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7847, 7831 -7848, 7831-7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851, 7833-7852,

7834- 7849, 7834-7850, 7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852, 7835-7853,

7835- 7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854, 7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856, 7838-7853, 7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854, 7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856, 7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858, 7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860, 7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862, 7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862, 7846-7861, and 7846-7862 of SEQ ID NO: 2, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%>, at least 95%, or 100% complementary to SEQ ID NO: 2.

In certain embodiments, antisense compounds or oligonucleotides target a region of a CFB nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a CFB nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 1 : 30-49, 48-63, 150- 169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644-663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159- 1178, 1162-1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177- 1196, 1183-1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322- 1341, 1328-1347, 1349-1368, 1355-1374, 1393-1412, 1396-1415, 1399-1418, 1405-1424, 1421-1440, 1621- 1640, 1646-1665, 1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782, 1912-1931, 2073-2092, 2085- 2104, 2166-2185, 2172-2191, 2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197- 2212, 2197-2216, 2202-2221, 2223-2238, 2223-2242, 2225-2240, 2226-2245, 2227-2242, 2227-2246, 2238- 2257, 2241-2260, 2267-2286, 2361-2380, 2388-2407, 2397-2416, 2448-2467, 2453-2472, 2455-2474, 2457- 2472, 2457-2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2532-2551, 2550-2569, 2551-2566, 2551- 2570, 2552-2568, 2552-2570, 2552-2571, 2553-2568, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554- 2572, 2554-2573, 2555-2570, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2573, 2557- 2574, 2557-2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560- 2577, 2560-2578, 2560-2579, 2561-2576, 2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562- 2581, 2563-2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567- 2582, 2567-2584, 2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2585, 2570- 2587, 2570-2589, 2571-2586, 2571-2588, 2571-2590, 2572-2589, 2572-2590, 2572-2591, 2573-2590, 2573- 2592, 2574-2590, 2574-2591, 2574-2593, 2575-2590, 2575-2591, 2575-2592, 2575-2594, 2576-2593, 2576- 2595, 2577-2594, 2577-2595, 2577-2596, 2578-2594, 2578-2596, 2578-2597, 2579-2598, 2580-2596, 2580- 2597, 2580-2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600, 2582-2598, 2582-2599, 2582- 2600, 2582-2601, 2583-2599, 2583-2600, 2583-2601, 2583-2602, 2584-2600, 2584-2601, 2584-2602, 2584- 2603, 2585-2601, 2585-2603, 2585-2604, 2586-2601, 2586-2602, 2586-2604, 2586-2605, 2587-2602, 2587- 2603, 2587-2605, 2587-2606, 2588-2603, 2588-2604, 2588-2605, 2588-2606, 2588-2607, 2589-2604, 2589- 2605, 2589-2606, 2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607, 2590-2608, 2590-2609, 2590- 2609, 2591-2607, 2591-2608, 2591-2609, 2591-2610, 2592-2607, 2592-2608, 2592-2609, 2592-2610, 2592- 2611, 2593-2608, 2593-2609, 2593-2610, 2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-

2613, 2595-2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-

2614, 2596-2615, 2597-2612, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598- 2614, 2598-2615, 2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600- 2615, 2600-2616, 2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-

2620, 2602-2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-

2621, 2603-2622, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-

2622, 2605-2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-

2623, 2607-2624, 2607-2625, 2607-2626, 2608-2623, 2608-2624, 2608-2625, 2608-2626, 2608-2627, 2609- 2624, 2609-2625, 2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-

2629, 2611-2626, 2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629, 2612-

2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615- 2630, 2615-2631 , and 2616-2631.

In certain embodiments, antisense compounds or oligonucleotides target a region of a CFB nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a CFB nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotide target the following nucleotide regions of SEQ ID NO: 2: 1608-1627, 1685- 1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877- 1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946- 2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151- 4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642- 4661, 4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733, 5270-5289, 5295-5314, 5296- 5315, 5830-5849, 5890-5909, 5904-5923, 6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977- 6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000, 6985-7004, 6990-7009, 7122- 7141, 7125-7144, 7151-7170, 7353-7372, 7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692- 7711, 7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804, 7786-7801, 7787-7803, 7787- 7805, 7787-7806, 7788-7803, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790- 7805, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808, 7792-7809, 7792-7810, 7792- 7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-

7814, 7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7813, 7798-

7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802- 7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820, 7805-7822, 7805-7824, 7806- 7821, 7806-7823, 7806-7825, 7807-7824, 7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809- 7826, 7809- -7828, 7810- -7825, 7810- -7826, 7810- -7827, 7810- -7829, 7811 -7828, 7811- -7830, 7812- -7829, 7812-

7830, 7812- -7831, 7813- -7829, 7813- -7831, 7813- -7832, 7814- -7833, 7815- -7831, 7815- -7832, 7815- -7833, 7815-

7834, 7816- -7832, 7816- -7833, 7816- -7834, 7816- -7835, 7817- -7833, 7817- -7834, 7817- -7835, 7817- -7836, 7818-

7834, 7818- -7835, 7818- -7836, 7818- -7837, 7819- -7835, 7819- -7836, 7819- -7837, 7819- -7838, 7820- -7836, 7820-

7838, 7820- -7839, 7821- -7836, 7821- -7837, 7821- -7839, 7821- -7840, 7822- -7837, 7822- -7838, 7822- -7840, 7822-

7841, 7823- -7838, 7823- -7839, 7823- -7839, 7823- -7840, 7823- -7841, 7823- -7842, 7824- -7839, 7824- -7840, 7824-

7840, 7824- -7841, 7824- -7842, 7824- -7843, 7825- -7840, 7825- -7841, 7825- -7842, 7825- -7843, 7825- -7844, 7826-

7842, 7826- -7843, 7826- -7844, 7826- -7845, 7827- -7842, 7827- -7843, 7827- -7844, 7827- -7845, 7827- -7846, 7828-

7843, 7828- -7844, 7828- -7845, 7828- -7847, 7829- -7844, 7829- -7845, 7829- -7846, 7829- -7847, 7829- -7848, 7830-

7845, 7830- -7846, 7830- -7847, 7830- -7848, 7830- -7849, 7831- -7846, 7831- -7847, 7831- -7848, 7831- -7849, 7831-

7850, 7832- -7847, 7832- -7848, 7832- -7849, 7832- -7850, 7832- -7851, 7833- -7848, 7833- -7849, 7833- -7850, 7833-

7851, 7833- -7852, 7834- -7849, 7834- -7850, 7834- -7851, 7834- -7852, 7834- -7853, 7835- -7850, 7835- -7851, 7835-

7852, 7835- -7853, 7835- -7854, 7836- -7851, 7836- -7852, 7836- -7853, 7836- -7854, 7836- -7855, 7837- -7852, 7837-

7853, 7837- -7854, 7837- -7855, 7837- -7856, 7838- -7853, 7838- -7854, 7838- -7855, 7838- -7856, 7838- -7857, 7839-

7854, 7839- -7855, 7839- -7856, 7839- -7857, 7839- -7858, 7840- -7855, 7840- -7856, 7840- -7857, 7840- -7858, 7840-

7859, 7841- -7856, 7841- -7857, 7841- -7858, 7841- -7859, 7841- -7860, 7842- -7857, 7842- -7858, 7842- -7859, 7842-

7860, 7842- -7861, 7843- -7858, 7843- -7859, 7843- -7860, 7843- -7861, 7843- -7862, 7844- -7859, 7844- -7860, 7844-

7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862, 7846-7861, and 7846-7862.

In certain embodiments, antisense compounds or oligonucleotides target the 3 'UTR of a CFB nucleic acid. In certain embodiments, antisense compounds or oligonucleotides target within nucleotides 2574-2626 of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO: 1. In certain embodiments, antisense compounds or oligonucleotides have at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobase portion complementary to an equal length portion within nucleotides 2574-2626 of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO: 1.

In certain embodiments, antisense compounds or oligonucleotides target a region of a CFB nucleic acid having the nucleobase sequence of SEQ ID NO: 1 within nucleobases 2457-2631, 2457-2472, 2457- 2474, 2457-2476, 2457-2566, 2457-2570, 2457-2571, 2457-2572, 2457-2573, 2457-2574, 2457-2575, 2457- 2576, 2457-2577, 2457-2578, 2457-2579, 2457-2580, 2457-2581, 2457-2582, 2457-2583, 2457-2584, 2457- 2585, 2457-2586, 2457-2587, 2457-2588, 2457-2589, 2457-2590, 2457-2591, 2457-2592, 2457-2593, 2457- 2594, 2457-2595, 2457-2596, 2457-2597, 2457-2598, 2457-2599, 2457-2600, 2457-2601, 2457-2602, 2457- 2603, 2457-2604, 2457-2605, 2457-2606, 2457-2607, 2457-2608, 2457-2609, 2457-2610, 2457-2611, 2457- 2612, 2457-2613, 2457-2614, 2457-2615, 2457-2616, 2457-2617, 2457-2618, 2457-2619, 2457-2620, 2457- 2621, 2457-2622, 2457-2623, 2457-2624, 2457-2625, 2457-2626, 2457-2627, 2457-2628, 2457-2629, 2457- 2630, 2457-2631, 2459-2474, 2459-2476, 2459-2566, 2459-2570, 2459-2571, 2459-2572, 2459-2573, 2459- 2574, 2459-2575, 2459-2576, 2459-2577, 2459-2578, 2459-2579, 2459-2580, 2459-2581, 2459-2582, 2459- 2583, 2459-2584, 2459-2585, 2459-2586, 2459-2587, 2459-2588, 2459-2589, 2459-2590, 2459-2591, 2459- 2592, 2459-2593, 2459-2594, 2459-2595, 2459-2596, 2459-2597, 2459-2598, 2459-2599, 2459-2600, 2459- 2601, 2459-2602, 2459-2603, 2459-2604, 2459-2605, 2459-2606, 2459-2607, 2459-2608, 2459-2609, 2459- 2610, 2459-2611, 2459-2612, 2459-2613, 2459-2614, 2459-2615, 2459-2616, 2459-2617, 2459-2618, 2459- 2619, 2459-2620, 2459-2621, 2459-2622, 2459-2623, 2459-2624, 2459-2625, 2459-2626, 2459-2627, 2459- 2628, 2459-2629, 2459-2630, 2459-2631, 2461-2476, 2461-2566, 2461-2570, 2461-2571, 2461-2572, 2461- 2573, 2461-2574, 2461-2575, 2461-2576, 2461-2577, 2461-2578, 2461-2579, 2461-2580, 2461-2581, 2461-

2582, 2461-2583, 2461-2584, 2461-2585, 2461-2586, 2461-2587, 2461-2588, 2461-2589, 2461-2590, 2461- 2591, 2461-2592, 2461-2593, 2461-2594, 2461-2595, 2461-2596, 2461-2597, 2461-2598, 2461-2599, 2461- 2600, 2461-2601, 2461-2602, 2461-2603, 2461-2604, 2461-2605, 2461-2606, 2461-2607, 2461-2608, 2461- 2609, 2461-2610, 2461-2611, 2461-2612, 2461-2613, 2461-2614, 2461-2615, 2461-2616, 2461-2617, 2461- 2618, 2461-2619, 2461-2620, 2461-2621, 2461-2622, 2461-2623, 2461-2624, 2461-2625, 2461-2626, 2461-

2627, 2461-2628, 2461-2629, 2461-2630, 2461-2631, 2551-2566, 2551-2570, 2551-2571, 2551-2572, 2551-

2573, 2551-2574, 2551-2575, 2551-2576, 2551-2577, 2551-2578, 2551-2579, 2551-2580, 2551-2581, 2551- 2582, 2551-2583, 2551-2584, 2551-2585, 2551-2586, 2551-2587, 2551-2588, 2551-2589, 2551-2590, 2551-

2591, 2551-2592, 2551-2593, 2551-2594, 2551-2595, 2551-2596, 2551-2597, 2551-2598, 2551-2599, 2551-

2600, 2551-2601, 2551-2602, 2551-2603, 2551-2604, 2551-2605, 2551-2606, 2551-2607, 2551-2608, 2551- 2609, 2551-2610, 2551-2611, 2551-2612, 2551-2613, 2551-2614, 2551-2615, 2551-2616, 2551-2617, 2551-

2618, 2551-2619, 2551-2620, 2551-2621, 2551-2622, 2551-2623, 2551-2624, 2551-2625, 2551-2626, 2551- 2627, 2551-2628, 2551-2629, 2551-2630, 2551-2631, 2553-2570, 2553-2571, 2553-2572, 2553-2573, 2553-

2574, 2553-2575, 2553-2576, 2553-2577, 2553-2578, 2553-2579, 2553-2580, 2553-2581, 2553-2582, 2553-

2583, 2553-2584, 2553-2585, 2553-2586, 2553-2587, 2553-2588, 2553-2589, 2553-2590, 2553-2591, 2553-

2592, 2553-2593, 2553-2594, 2553-2595, 2553-2596, 2553-2597, 2553-2598, 2553-2599, 2553-2600, 2553-

2601, 2553-2602, 2553-2603, 2553-2604, 2553-2605, 2553-2606, 2553-2607, 2553-2608, 2553-2609, 2553- 2610, 2553-2611, 2553-2612, 2553-2613, 2553-2614, 2553-2615, 2553-2616, 2553-2617, 2553-2618, 2553-

2619, 2553-2620, 2553-2621, 2553-2622, 2553-2623, 2553-2624, 2553-2625, 2553-2626, 2553-2627, 2553-

2628, 2553-2629, 2553-2630, 2553-2631, 2554-2573, 2554-2574, 2554-2575, 2554-2576, 2554-2577, 2554- 2578, 2554-2579, 2554-2580, 2554-2581, 2554-2582, 2554-2583, 2554-2584, 2554-2585, 2554-2586, 2554- 2587, 2554-2588, 2554-2589, 2554-2590, 2554-2591, 2554-2592, 2554-2593, 2554-2594, 2554-2595, 2554- 2596, 2554-2597, 2554-2598, 2554-2599, 2554-2600, 2554-2601, 2554-2602, 2554-2603, 2554-2604, 2554- 2605, 2554-2606, 2554-2607, 2554-2608, 2554-2609, 2554-2610, 2554-2611, 2554-2612, 2554-2613, 2554- 2614, 2554-2615, 2554-2616, 2554-2617, 2554-2618, 2554-2619, 2554-2620, 2554-2621, 2554-2622, 2554- 2623, 2554-2624, 2554-2625, 2554-2626, 2554-2627, 2554-2628, 2554-2629, 2554-2630, 2554-2631, 2555- 2572, 2555-2573, 2555-2574, 2555-2575, 2555-2576, 2555-2577, 2555-2578, 2555-2579, 2555-2580, 2555- 2581, 2555-2582, 2555-2583, 2555-2584, 2555-2585, 2555-2586, 2555-2587, 2555-2588, 2555-2589, 2555- 2590, 2555- -2591, 2555- -2592, 2555- -2593, 2555- -2594, 2555- -2595, 2555- -2596, 2555- -2597, 2555- -2598, 2555-

2599, 2555- -2600, 2555- -2601, 2555- -2602, 2555- -2603, 2555- -2604, 2555- -2605, 2555- -2606, 2555- -2607, 2555-

2608, 2555- -2609, 2555- -2610, 2555- -2611, 2555- -2612, 2555- -2613, 2555- -2614, 2555- -2615, 2555- -2616, 2555-

2617, 2555- -2618, 2555- -2619, 2555- -2620, 2555- -2621, 2555- -2622, 2555- -2623, 2555- -2624, 2555- -2625, 2555-

2626, 2555- -2627, 2555- -2628, 2555- -2629, 2555- -2630, 2555- -2631, 2556- -2573, 2556- -2574, 2556- -2575, 2556-

2576, 2556- -2577, 2556- -2578, 2556- -2579, 2556- -2580, 2556- -2581, 2556- -2582, 2556- -2583, 2556- -2584, 2556-

2585, 2556- -2586, 2556- -2587, 2556- -2588, 2556- -2589, 2556- -2590, 2556- -2591, 2556- -2592, 2556- -2593, 2556-

2594, 2556- -2595, 2556- -2596, 2556- -2597, 2556- -2598, 2556- -2599, 2556- -2600, 2556- -2601, 2556- -2602, 2556-

2603, 2556- -2604, 2556- -2605, 2556- -2606, 2556- -2607, 2556- -2608, 2556- -2609, 2556- -2610, 2556- -2611, 2556-

2612, 2556- -2613, 2556- -2614, 2556- -2615, 2556- -2616, 2556- -2617, 2556- -2618, 2556- -2619, 2556- -2620, 2556-

2621, 2556- -2622, 2556- -2623, 2556- -2624, 2556- -2625, 2556- -2626, 2556- -2627, 2556- -2628, 2556- -2629, 2556-

2630, 2556- -2631, 2557- -2574, 2557- -2575, 2557- -2576, 2557- -2577, 2557- -2578, 2557- -2579, 2557- -2580, 2557-

2581, 2557- -2582, 2557- -2583, 2557- -2584, 2557- -2585, 2557- -2586, 2557- -2587, 2557- -2588, 2557- -2589, 2557-

2590, 2557- -2591, 2557- -2592, 2557- -2593, 2557- -2594, 2557- -2595, 2557- -2596, 2557- -2597, 2557- -2598, 2557-

2599, 2557- -2600, 2557- -2601, 2557- -2602, 2557- -2603, 2557- -2604, 2557- -2605, 2557- -2606, 2557- -2607, 2557-

2608, 2557- -2609, 2557- -2610, 2557- -2611, 2557- -2612, 2557- -2613, 2557- -2614, 2557- -2615, 2557- -2616, 2557-

2617, 2557- -2618, 2557- -2619, 2557- -2620, 2557- -2621, 2557- -2622, 2557- -2623, 2557- -2624, 2557- -2625, 2557-

2626, 2557- -2627, 2557- -2628, 2557- -2629, 2557- -2630, 2557- -2631, 2558- -2575, 2558- -2576, 2558- -2577, 2558-

2578, 2558- -2579, 2558- -2580, 2558- -2581, 2558- -2582, 2558- -2583, 2558- -2584, 2558- -2585, 2558- -2586, 2558-

2587, 2558- -2588, 2558- -2589, 2558- -2590, 2558- -2591, 2558- -2592, 2558- -2593, 2558- -2594, 2558- -2595, 2558-

2596, 2558- -2597, 2558- -2598, 2558- -2599, 2558- -2600, 2558- -2601, 2558- -2602, 2558- -2603, 2558- -2604, 2558-

2605, 2558- -2606, 2558- -2607, 2558- -2608, 2558- -2609, 2558- -2610, 2558- -2611, 2558- -2612, 2558- -2613, 2558-

2614, 2558- -2615, 2558- -2616, 2558- -2617, 2558- -2618, 2558- -2619, 2558- -2620, 2558- -2621, 2558- -2622, 2558-

2623, 2558- -2624, 2558- -2625, 2558- -2626, 2558- -2627, 2558- -2628, 2558- -2629, 2558- -2630, 2558- -2631, 2559-

2576, 2559- -2577, 2559- -2578, 2559- -2579, 2559- -2580, 2559- -2581, 2559- -2582, 2559- -2583, 2559- -2584, 2559-

2585, 2559- -2586, 2559- -2587, 2559- -2588, 2559- -2589, 2559- -2590, 2559- -2591, 2559- -2592, 2559- -2593, 2559-

2594, 2559- -2595, 2559- -2596, 2559- -2597, 2559- -2598, 2559- -2599, 2559- -2600, 2559- -2601, 2559- -2602, 2559-

2603, 2559- -2604, 2559- -2605, 2559- -2606, 2559- -2607, 2559- -2608, 2559- -2609, 2559- -2610, 2559- -2611, 2559-

2612, 2559- -2613, 2559- -2614, 2559- -2615, 2559- -2616, 2559- -2617, 2559- -2618, 2559- -2619, 2559- -2620, 2559-

2621, 2559- -2622, 2559- -2623, 2559- -2624, 2559- -2625, 2559- -2626, 2559- -2627, 2559- -2628, 2559- -2629, 2559-

2630, 2559- -2631, 2560- -2577, 2560- -2578, 2560- -2579, 2560- -2580, 2560- -2581, 2560- -2582, 2560- -2583, 2560-

2584, 2560- -2585, 2560- -2586, 2560- -2587, 2560- -2588, 2560- -2589, 2560- -2590, 2560- -2591, 2560- -2592, 2560-

2593, 2560- -2594, 2560- -2595, 2560- -2596, 2560- -2597, 2560- -2598, 2560- -2599, 2560- -2600, 2560- -2601, 2560-

2602, 2560- -2603, 2560- -2604, 2560- -2605, 2560- -2606, 2560- -2607, 2560- -2608, 2560- -2609, 2560- -2610, 2560-

2611, 2560- -2612, 2560- -2613, 2560- -2614, 2560- -2615, 2560- -2616, 2560- -2617, 2560- -2618, 2560- -2619, 2560- 2620, 2560- -2621, 2560- -2622, 2560- -2623, 2560- -2624, 2560- -2625, 2560- -2626, 2560- -2627, 2560- -2628, 2560-

2629, 2560- -2630, 2560- -2631, 2561 -2578, 2561 -2579, 2561 -2580, 2561- -2581, 2561- -2582, 2561- -2583, 2561-

2584, 2561 -2585, 2561 -2586, 2561 -2587, 2561 -2588, 2561 -2589, 2561- -2590, 2561- -2591, 2561- -2592, 2561-

2593, 2561 -2594, 2561 -2595, 2561 -2596, 2561 -2597, 2561 -2598, 2561- -2599, 2561- -2600, 2561- -2601, 2561-

2602, 2561 -2603, 2561 -2604, 2561 -2605, 2561 -2606, 2561 -2607, 2561- -2608, 2561- -2609, 2561- -2610, 2561-

2611, 2561 -2612, 2561 -2613, 2561 -2614, 2561 -2615, 2561 -2616, 2561- -2617, 2561- -2618, 2561- -2619, 2561-

2620, 2561 -2621, 2561 -2622, 2561 -2623, 2561 -2624, 2561 -2625, 2561- -2626, 2561- -2627, 2561- -2628, 2561-

2629, 2561 -2630, 2561 -2631, 2562- -2577, 2562- -2578, 2562- -2579, 2562- -2580, 2562- -2581, 2562- -2582, 2562-

2583, 2562- -2584, 2562- -2585, 2562- -2586, 2562- -2587, 2562- -2588, 2562- -2589, 2562- -2590, 2562- -2591, 2562-

2592, 2562- -2593, 2562- -2594, 2562- -2595, 2562- -2596, 2562- -2597, 2562- -2598, 2562- -2599, 2562- -2600, 2562-

2601, 2562- -2602, 2562- -2603, 2562- -2604, 2562- -2605, 2562- -2606, 2562- -2607, 2562- -2608, 2562- -2609, 2562-

2610, 2562- -2611, 2562- -2612, 2562- -2613, 2562- -2614, 2562- -2615, 2562- -2616, 2562- -2617, 2562- -2618, 2562-

2619, 2562- -2620, 2562- -2621, 2562- -2622, 2562- -2623, 2562- -2624, 2562- -2625, 2562- -2626, 2562- -2627, 2562-

2628, 2562- -2629, 2562- -2630, 2562- -2631, 2563- -2580, 2563- -2581, 2563- -2582, 2563- -2583, 2563- -2584, 2563-

2585, 2563- -2586, 2563- -2587, 2563- -2588, 2563- -2589, 2563- -2590, 2563- -2591, 2563- -2592, 2563- -2593, 2563-

2594, 2563- -2595, 2563- -2596, 2563- -2597, 2563- -2598, 2563- -2599, 2563- -2600, 2563- -2601, 2563- -2602, 2563-

2603, 2563- -2604, 2563- -2605, 2563- -2606, 2563- -2607, 2563- -2608, 2563- -2609, 2563- -2610, 2563- -2611, 2563-

2612, 2563- -2613, 2563- -2614, 2563- -2615, 2563- -2616, 2563- -2617, 2563- -2618, 2563- -2619, 2563- -2620, 2563-

2621, 2563- -2622, 2563- -2623, 2563- -2624, 2563- -2625, 2563- -2626, 2563- -2627, 2563- -2628, 2563- -2629, 2563-

2630, 2563- -2631, 2564- -2581, 2564- -2582, 2564- -2583, 2564- -2584, 2564- -2585, 2564- -2586, 2564- -2587, 2564-

2588, 2564- -2589, 2564- -2590, 2564- -2591, 2564- -2592, 2564- -2593, 2564- -2594, 2564- -2595, 2564- -2596, 2564-

2597, 2564- -2598, 2564- -2599, 2564- -2600, 2564- -2601, 2564- -2602, 2564- -2603, 2564- -2604, 2564- -2605, 2564-

2606, 2564- -2607, 2564- -2608, 2564- -2609, 2564- -2610, 2564- -2611, 2564- -2612, 2564- -2613, 2564- -2614, 2564-

2615, 2564- -2616, 2564- -2617, 2564- -2618, 2564- -2619, 2564- -2620, 2564- -2621, 2564- -2622, 2564- -2623, 2564-

2624, 2564- -2625, 2564- -2626, 2564- -2627, 2564- -2628, 2564- -2629, 2564- -2630, 2564- -2631, 2565- -2584, 2565-

2585, 2565- -2586, 2565- -2587, 2565- -2588, 2565- -2589, 2565- -2590, 2565- -2591, 2565- -2592, 2565- -2593, 2565-

2594, 2565- -2595, 2565- -2596, 2565- -2597, 2565- -2598, 2565- -2599, 2565- -2600, 2565- -2601, 2565- -2602, 2565-

2603, 2565- -2604, 2565- -2605, 2565- -2606, 2565- -2607, 2565- -2608, 2565- -2609, 2565- -2610, 2565- -2611, 2565-

2612, 2565- -2613, 2565- -2614, 2565- -2615, 2565- -2616, 2565- -2617, 2565- -2618, 2565- -2619, 2565- -2620, 2565-

2621, 2565- -2622, 2565- -2623, 2565- -2624, 2565- -2625, 2565- -2626, 2565- -2627, 2565- -2628, 2565- -2629, 2565-

2630, 2565- -2631, 2566- -2583, 2566- -2584, 2566- -2585, 2566- -2586, 2566- -2587, 2566- -2588, 2566- -2589, 2566-

2590, 2566- -2591, 2566- -2592, 2566- -2593, 2566- -2594, 2566- -2595, 2566- -2596, 2566- -2597, 2566- -2598, 2566-

2599, 2566- -2600, 2566- -2601, 2566- -2602, 2566- -2603, 2566- -2604, 2566- -2605, 2566- -2606, 2566- -2607, 2566-

2608, 2566- -2609, 2566- -2610, 2566- -2611, 2566- -2612, 2566- -2613, 2566- -2614, 2566- -2615, 2566- -2616, 2566-

2617, 2566- -2618, 2566- -2619, 2566- -2620, 2566- -2621, 2566- -2622, 2566- -2623, 2566- -2624, 2566- -2625, 2566- 2626, 2566-2627, 2566-2628, 2566-2629, 2566-2630, 2566-2631, 2567-2584, 2567-2585, 2567-2586, 2567- 2587, 2567-2588, 2567-2589, 2567-2590, 2567-2591, 2567-2592, 2567-2593, 2567-2594, 2567-2595, 2567- 2596, 2567-2597, 2567-2598, 2567-2599, 2567-2600, 2567-2601, 2567-2602, 2567-2603, 2567-2604, 2567- 2605, 2567-2606, 2567-2607, 2567-2608, 2567-2609, 2567-2610, 2567-2611, 2567-2612, 2567-2613, 2567- 2614, 2567-2615, 2567-2616, 2567-2617, 2567-2618, 2567-2619, 2567-2620, 2567-2621, 2567-2622, 2567- 2623, 2567-2624, 2567-2625, 2567-2626, 2567-2627, 2567-2628, 2567-2629, 2567-2630, 2567-2631, 2568- 2585, 2568-2586, 2568-2587, 2568-2588, 2568-2589, 2568-2590, 2568-2591, 2568-2592, 2568-2593, 2568-

2594, 2568-2595, 2568-2596, 2568-2597, 2568-2598, 2568-2599, 2568-2600, 2568-2601, 2568-2602, 2568-

2603, 2568-2604, 2568-2605, 2568-2606, 2568-2607, 2568-2608, 2568-2609, 2568-2610, 2568-2611, 2568- 2612, 2568-2613, 2568-2614, 2568-2615, 2568-2616, 2568-2617, 2568-2618, 2568-2619, 2568-2620, 2568-

2621, 2568-2622, 2568-2623, 2568-2624, 2568-2625, 2568-2626, 2568-2627, 2568-2628, 2568-2629, 2568-

2630, 2568-2631, 2569-2586, 2569-2587, 2569-2588, 2569-2589, 2569-2590, 2569-2591, 2569-2592, 2569- 2593, 2569-2594, 2569-2595, 2569-2596, 2569-2597, 2569-2598, 2569-2599, 2569-2600, 2569-2601, 2569- 2602, 2569-2603, 2569-2604, 2569-2605, 2569-2606, 2569-2607, 2569-2608, 2569-2609, 2569-2610, 2569- 2611, 2569-2612, 2569-2613, 2569-2614, 2569-2615, 2569-2616, 2569-2617, 2569-2618, 2569-2619, 2569- 2620, 2569-2621, 2569-2622, 2569-2623, 2569-2624, 2569-2625, 2569-2626, 2569-2627, 2569-2628, 2569- 2629, 2569-2630, 2569-2631, 2569-2586, 2569-2587, 2569-2588, 2569-2589, 2569-2590, 2569-2591, 2569-

2592, 2569-2593, 2569-2594, 2569-2595, 2569-2596, 2569-2597, 2569-2598, 2569-2599, 2569-2600, 2569-

2601, 2569-2602, 2569-2603, 2569-2604, 2569-2605, 2569-2606, 2569-2607, 2569-2608, 2569-2609, 2569- 2610, 2569-2611, 2569-2612, 2569-2613, 2569-2614, 2569-2615, 2569-2616, 2569-2617, 2569-2618, 2569-

2619, 2569-2620, 2569-2621, 2569-2622, 2569-2623, 2569-2624, 2569-2625, 2569-2626, 2569-2627, 2569-

2628, 2569-2629, 2569-2630, 2569-2631, 2571-2588, 2571-2589, 2571-2590, 2571-2591, 2571-2592, 2571-

2593, 2571-2594, 2571-2595, 2571-2596, 2571-2597, 2571-2598, 2571-2599, 2571-2600, 2571-2601, 2571-

2602, 2571-2603, 2571-2604, 2571-2605, 2571-2606, 2571-2607, 2571-2608, 2571-2609, 2571-2610, 2571- 2611, 2571-2612, 2571-2613, 2571-2614, 2571-2615, 2571-2616, 2571-2617, 2571-2618, 2571-2619, 2571-

2620, 2571-2621, 2571-2622, 2571-2623, 2571-2624, 2571-2625, 2571-2626, 2571-2627, 2571-2628, 2571-

2629, 2571-2630, 2571-2631, 2572-2589, 2572-2590, 2572-2591, 2572-2592, 2572-2593, 2572-2594, 2572-

2595, 2572-2596, 2572-2597, 2572-2598, 2572-2599, 2572-2600, 2572-2601, 2572-2602, 2572-2603, 2572-

2604, 2572-2605, 2572-2606, 2572-2607, 2572-2608, 2572-2609, 2572-2610, 2572-2611, 2572-2612, 2572- 2613, 2572-2614, 2572-2615, 2572-2616, 2572-2617, 2572-2618, 2572-2619, 2572-2620, 2572-2621, 2572-

2622, 2572-2623, 2572-2624, 2572-2625, 2572-2626, 2572-2627, 2572-2628, 2572-2629, 2572-2630, 2572-

2631, 2573-2590, 2573-2591, 2573-2592, 2573-2593, 2573-2594, 2573-2595, 2573-2596, 2573-2597, 2573- 2598, 2573-2599, 2573-2600, 2573-2601, 2573-2602, 2573-2603, 2573-2604, 2573-2605, 2573-2606, 2573- 2607, 2573-2608, 2573-2609, 2573-2610, 2573-2611, 2573-2612, 2573-2613, 2573-2614, 2573-2615, 2573- 2616, 2573-2617, 2573-2618, 2573-2619, 2573-2620, 2573-2621, 2573-2622, 2573-2623, 2573-2624, 2573- 2625, 2573-2626, 2573-2627, 2573-2628, 2573-2629, 2573-2630, 2573-2631, 2574-2591, 2574-2592, 2574- 2593, 2574-2594, 2574-2595, 2574-2596, 2574-2597, 2574-2598, 2574-2599, 2574-2600, 2574-2601, 2574- 2602, 2574-2603, 2574-2604, 2574-2605, 2574-2606, 2574-2607, 2574-2608, 2574-2609, 2574-2610, 2574- 2611, 2574-2612, 2574-2613, 2574-2614, 2574-2615, 2574-2616, 2574-2617, 2574-2618, 2574-2619, 2574- 2620, 2574-2621, 2574-2622, 2574-2623, 2574-2624, 2574-2625, 2574-2626, 2574-2627, 2574-2628, 2574- 2629, 2574-2630, 2574-2631, 2575-2592, 2575-2593, 2575-2594, 2575-2595, 2575-2596, 2575-2597, 2575- 2598, 2575-2599, 2575-2600, 2575-2601, 2575-2602, 2575-2603, 2575-2604, 2575-2605, 2575-2606, 2575- 2607, 2575-2608, 2575-2609, 2575-2610, 2575-2611, 2575-2612, 2575-2613, 2575-2614, 2575-2615, 2575- 2616, 2575-2617, 2575-2618, 2575-2619, 2575-2620, 2575-2621, 2575-2622, 2575-2623, 2575-2624, 2575- 2625, 2575-2626, 2575-2627, 2575-2628, 2575-2629, 2575-2630, 2575-2631, 2576-2593, 2576-2594, 2576- 2595, 2576-2596, 2576-2597, 2576-2598, 2576-2599, 2576-2600, 2576-2601, 2576-2602, 2576-2603, 2576-

2604, 2576-2605, 2576-2606, 2576-2607, 2576-2608, 2576-2609, 2576-2610, 2576-2611, 2576-2612, 2576- 2613, 2576-2614, 2576-2615, 2576-2616, 2576-2617, 2576-2618, 2576-2619, 2576-2620, 2576-2621, 2576-

2622, 2576-2623, 2576-2624, 2576-2625, 2576-2626, 2576-2627, 2576-2628, 2576-2629, 2576-2630, 2576- 2631, 2577-2594, 2577-2595, 2577-2596, 2577-2597, 2577-2598, 2577-2599, 2577-2600, 2577-2601, 2577-

2602, 2577-2603, 2577-2604, 2577-2605, 2577-2606, 2577-2607, 2577-2608, 2577-2609, 2577-2610, 2577-

2611, 2577-2612, 2577-2613, 2577-2614, 2577-2615, 2577-2616, 2577-2617, 2577-2618, 2577-2619, 2577-

2620, 2577-2621, 2577-2622, 2577-2623, 2577-2624, 2577-2625, 2577-2626, 2577-2627, 2577-2628, 2577-

2629, 2577-2630, 2577-2631, 2578-2597, 2578-2598, 2578-2599, 2578-2600, 2578-2601, 2578-2602, 2578- 2603, 2578-2604, 2578-2605, 2578-2606, 2578-2607, 2578-2608, 2578-2609, 2578-2610, 2578-2611, 2578-

2612, 2578-2613, 2578-2614, 2578-2615, 2578-2616, 2578-2617, 2578-2618, 2578-2619, 2578-2620, 2578-

2621, 2578-2622, 2578-2623, 2578-2624, 2578-2625, 2578-2626, 2578-2627, 2578-2628, 2578-2629, 2578-

2630, 2578-2631, 2579-2598, 2579-2599, 2579-2600, 2579-2601, 2579-2602, 2579-2603, 2579-2604, 2579-

2605, 2579-2606, 2579-2607, 2579-2608, 2579-2609, 2579-2610, 2579-2611, 2579-2612, 2579-2613, 2579- 2614, 2579-2615, 2579-2616, 2579-2617, 2579-2618, 2579-2619, 2579-2620, 2579-2621, 2579-2622, 2579-

2623, 2579-2624, 2579-2625, 2579-2626, 2579-2627, 2579-2628, 2579-2629, 2579-2630, 2579-2631, 2580-

2598, 2580-2599, 2580-2600, 2580-2601, 2580-2602, 2580-2603, 2580-2604, 2580-2605, 2580-2606, 2580-

2607, 2580-2608, 2580-2609, 2580-2610, 2580-2611, 2580-2612, 2580-2613, 2580-2614, 2580-2615, 2580-

2616, 2580-2617, 2580-2618, 2580-2619, 2580-2620, 2580-2621, 2580-2622, 2580-2623, 2580-2624, 2580- 2625, 2580-2626, 2580-2627, 2580-2628, 2580-2629, 2580-2630, 2580-2631, 2581-2597, 2581-2598, 2581-

2599, 2581-2600, 2581-2601, 2581-2602, 2581-2603, 2581-2604, 2581-2605, 2581-2606, 2581-2607, 2581-

2608, 2581-2609, 2581-2610, 2581-2611, 2581-2612, 2581-2613, 2581-2614, 2581-2615, 2581-2616, 2581-

2617, 2581-2618, 2581-2619, 2581-2620, 2581-2621, 2581-2622, 2581-2623, 2581-2624, 2581-2625, 2581-

2626, 2581-2627, 2581-2628, 2581-2629, 2581-2630, 2581-2631, 2582-2600, 2582-2601, 2582-2602, 2582- 2603, 2582-2604, 2582-2605, 2582-2606, 2582-2607, 2582-2608, 2582-2609, 2582-2610, 2582-2611, 2582- 2612, 2582- -2613, 2582- -2614, 2582- -2615, 2582- -2616, 2582- -2617, 2582- -2618, 2582- -2619, 2582- -2620, 2582-

2621, 2582- -2622, 2582- -2623, 2582- -2624, 2582- -2625, 2582- -2626, 2582- -2627, 2582- -2628, 2582- -2629, 2582-

2630, 2582- -2631, 2583- -2601, 2583- -2602, 2583- -2603, 2583- -2604, 2583- -2605, 2583- -2606, 2583- -2607, 2583-

2608, 2583- -2609, 2583- -2610, 2583- -2611, 2583- -2612, 2583- -2613, 2583- -2614, 2583- -2615, 2583- -2616, 2583-

2617, 2583- -2618, 2583- -2619, 2583- -2620, 2583- -2621, 2583- -2622, 2583- -2623, 2583- -2624, 2583- -2625, 2583-

2626, 2583- -2627, 2583- -2628, 2583- -2629, 2583- -2630, 2583- -2631, 2585- -2603, 2585- -2604, 2585- -2605, 2585-

2606, 2585- -2607, 2585- -2608, 2585- -2609, 2585- -2610, 2585- -2611, 2585- -2612, 2585- -2613, 2585- -2614, 2585-

2615, 2585- -2616, 2585- -2617, 2585- -2618, 2585- -2619, 2585- -2620, 2585- -2621, 2585- -2622, 2585- -2623, 2585-

2624, 2585- -2625, 2585- -2626, 2585- -2627, 2585- -2628, 2585- -2629, 2585- -2630, 2585- -2631, 2586- -2604, 2586-

2605, 2586- -2606, 2586- -2607, 2586- -2608, 2586- -2609, 2586- -2610, 2586- -2611, 2586- -2612, 2586- -2613, 2586-

2614, 2586- -2615, 2586- -2616, 2586- -2617, 2586- -2618, 2586- -2619, 2586- -2620, 2586- -2621, 2586- -2622, 2586-

2623, 2586- -2624, 2586- -2625, 2586- -2626, 2586- -2627, 2586- -2628, 2586- -2629, 2586- -2630, 2586- -2631, 2587-

2605, 2587- -2606, 2587- -2607, 2587- -2608, 2587- -2609, 2587- -2610, 2587- -2611, 2587- -2612, 2587- -2613, 2587-

2614, 2587- -2615, 2587- -2616, 2587- -2617, 2587- -2618, 2587- -2619, 2587- -2620, 2587- -2621, 2587- -2622, 2587-

2623, 2587- -2624, 2587- -2625, 2587- -2626, 2587- -2627, 2587- -2628, 2587- -2629, 2587- -2630, 2587- -2631, 2588-

2606, 2588- -2607, 2588- -2608, 2588- -2609, 2588- -2610, 2588- -2611, 2588- -2612, 2588- -2613, 2588- -2614, 2588-

2615, 2588- -2616, 2588- -2617, 2588- -2618, 2588- -2619, 2588- -2620, 2588- -2621, 2588- -2622, 2588- -2623, 2588-

2624, 2588- -2625, 2588- -2626, 2588- -2627, 2588- -2628, 2588- -2629, 2588- -2630, 2588- -2631, 2589- -2607, 2589-

2608, 2589- -2609, 2589- -2610, 2589- -2611, 2589- -2612, 2589- -2613, 2589- -2614, 2589- -2615, 2589- -2616, 2589-

2617, 2589- -2618, 2589- -2619, 2589- -2620, 2589- -2621, 2589- -2622, 2589- -2623, 2589- -2624, 2589- -2625, 2589-

2626, 2589- -2627, 2589- -2628, 2589- -2629, 2589- -2630, 2589- -2631, 2590- -2606, 2590- -2607, 2590- -2608, 2590-

2609, 2590- -2610, 2590- -2611, 2590- -2612, 2590- -2613, 2590- -2614, 2590- -2615, 2590- -2616, 2590- -2617, 2590-

2618, 2590- -2619, 2590- -2620, 2590- -2621, 2590- -2622, 2590- -2623, 2590- -2624, 2590- -2625, 2590- -2626, 2590-

2627, 2590- -2628, 2590- -2629, 2590- -2630, 2590- -2631, 2591 -2610, 2591- -2611, 2591- -2612, 2591- -2613, 2591-

2614, 2591 -2615, 2591 -2616, 2591 -2617, 2591 -2618, 2591 -2619, 2591- -2620, 2591- -2621, 2591- -2622, 2591-

2623, 2591 -2624, 2591 -2625, 2591 -2626, 2591 -2627, 2591 -2628, 2591- -2629, 2591- -2630, 2591- -2631, 2592-

2611, 2592- -2612, 2592- -2613, 2592- -2614, 2592- -2615, 2592- -2616, 2592- -2617, 2592- -2618, 2592- -2619, 2592-

2620, 2592- -2621, 2592- -2622, 2592- -2623, 2592- -2624, 2592- -2625, 2592- -2626, 2592- -2627, 2592- -2628, 2592-

2629, 2592- -2630, 2592- -2631, 2593- -2608, 2593- -2612, 2593- -2613, 2593- -2614, 2593- -2615, 2593- -2616, 2593-

2617, 2593- -2618, 2593- -2619, 2593- -2620, 2593- -2621, 2593- -2622, 2593- -2623, 2593- -2624, 2593- -2625, 2593-

2626, 2593- -2627, 2593- -2628, 2593- -2629, 2593- -2630, 2593- -2631, 2594- -2612, 2594- -2613, 2594- -2614, 2594-

2615, 2594- -2616, 2594- -2617, 2594- -2618, 2594- -2619, 2594- -2620, 2594- -2621, 2594- -2622, 2594- -2623, 2594-

2624, 2594- -2625, 2594- -2626, 2594- -2627, 2594- -2628, 2594- -2629, 2594- -2630, 2594- -2631, 2595- -2611, 2595-

2612, 2595- -2613, 2595- -2614, 2595- -2615, 2595- -2616, 2595- -2617, 2595- -2618, 2595- -2619, 2595- -2620, 2595-

2621, 2595- -2622, 2595- -2623, 2595- -2624, 2595- -2625, 2595- -2626, 2595- -2627, 2595- -2628, 2595- -2629, 2595- 2630, 2595-2631, 2596-2614, 2596-2615, 2596-2616, 2596-2617, 2596-2618, 2596-2619, 2596-2620, 2596- 2621, 2596-2622, 2596-2623, 2596-2624, 2596-2625, 2596-2626, 2596-2627, 2596-2628, 2596-2629, 2596- 2630, 2596-2631, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616, 2597-2617, 2597-2618, 2597- 2619, 2597-2620, 2597-2621, 2597-2622, 2597-2623, 2597-2624, 2597-2625, 2597-2626, 2597-2627, 2597- 2628, 2597-2629, 2597-2630, 2597-2631, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617, 2598- 2618, 2598-2619, 2598-2620, 2598-2621, 2598-2622, 2598-2623, 2598-2624, 2598-2625, 2598-2626, 2598- 2627, 2598-2628, 2598-2629, 2598-2630, 2598-2631, 2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599- 2618, 2599-2619, 2599-2620, 2599-2621, 2599-2622, 2599-2623, 2599-2624, 2599-2625, 2599-2626, 2599-

2627, 2599-2628, 2599-2629, 2599-2630, 2599-2631, 2600-2615, 2600-2616, 2600-2617, 2600-2618, 2600- 2619, 2600-2620, 2600-2621, 2600-2622, 2600-2623, 2600-2624, 2600-2625, 2600-2626, 2600-2627, 2600-

2628, 2600-2629, 2600-2630, 2600-2631, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-2620, 2601-

2621, 2601-2622, 2601-2623, 2601-2624, 2601-2625, 2601-2626, 2601-2627, 2601-2628, 2601-2629, 2601-

2630, 2601-2631, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2602-2622, 2602-2623, 2602-2624, 2602- 2625, 2602-2626, 2602-2627, 2602-2628, 2602-2629, 2602-2630, 2602-2631, 2603-2620, 2603-2621, 2603- 2622, 2603-2623, 2603-2624, 2603-2625, 2603-2626, 2603-2627, 2603-2628, 2603-2629, 2603-2630, 2603-

2631, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623, 2604-2624, 2604-2625, 2604-2626, 2604- 2627, 2604-2628, 2604-2629, 2604-2630, 2604-2631, 2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605- 2624, 2605-2625, 2605-2626, 2605-2627, 2605-2628, 2605-2629, 2605-2630, 2605-2631, 2606-2621, 2606-

2622, 2606-2623, 2606-2624, 2606-2625, 2606-2626, 2606-2627, 2606-2628, 2606-2629, 2606-2630, 2606- 2631, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626, 2607-2627, 2607-2628, 2607-2629, 2607-

2630, 2607-2631, 2608-2623, 2608-2624, 2608-2625, 2608-2626, 2608-2627, 2608-2628, 2608-2629, 2608-

2630, 2608-2631, 2609-2624, 2609-2625, 2609-2626, 2609-2627, 2609-2628, 2609-2629, 2609-2630, 2609-

2631, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629, 2610-2630, 2610-2631, 2611-2626, 2611- 2627, 2611-2628, 2611-2629, 2611-2630, 2611-2631, 2612-2627, 2612-2628, 2612-2629, 2612-2630, 2612- 2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615- 2631, or 2616-2631. In certain embodiments, antisense compounds or oligonucleotides target at least an 8, 9, 10, 11, 12, 13, 14, 15, or 16 contiguous nucleobases within the aforementioned nucleobase regions.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 50% inhibition: 30-49, 48-63, 150-169, 151-170, 152-171, 154-169, 154-173, 156-171, 156-175, 157-176, 158-173, 158-177, 480-499, 600-619, 638-657, 644- 663, 738-757, 1089-1108, 1135-1154, 1141-1160, 1147-1166, 1150-1169, 1153-1172, 1159-1178, 1162- 1181, 1165-1184, 1171-1186, 1171-1190, 1173-1188, 1173-1192, 1175-1190, 1175-1194, 1177-1196, 1183- 1202, 1208-1227, 1235-1254, 1298-1317, 1304-1323, 1310-1329, 1316-1335, 1319-1338, 1322-1341, 1328- 1347, 1349-1368, 1355-1374, 1393-1412, 1396-1415, 1399-1418, 1405-1424, 1421-1440, 1621-1640, 1646- 1665, 1646-1665, 1647-1666, 1689-1708, 1749-1768, 1763-1782, 1912-1931, 2073-2092, 2085-2104, 2166- 2185, 2172-2191, 2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2196-2215, 2197-2212, 2197- 2216, 2202-2221, 2223-2238, 2223-2242, 2225-2240, 2226-2245, 2227-2242, 2227-2246, 2238-2257, 2241- 2260, 2267-2286, 2361-2380, 2388-2407, 2397-2416, 2448-2467, 2453-2472, 2455-2474, 2457-2472, 2457- 2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2532-2551, 2550-2569, 2551-2566, 2551-2570, 2552- 2568, 2552-2570, 2552-2571, 2553-2568, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554- 2573, 2555-2570, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2573, 2557-2574, 2557- 2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577, 2560- 2578, 2560-2579, 2561-2576, 2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581, 2563- 2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582, 2567- 2584, 2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2585, 2570-2587, 2570-

2589, 2571-2586, 2571-2588, 2571-2590, 2572-2589, 2572-2590, 2572-2591, 2573-2590, 2573-2592, 2574-

2590, 2574-2591, 2574-2593, 2575-2590, 2575-2591, 2575-2592, 2575-2594, 2576-2593, 2576-2595, 2577- 2594, 2577-2595, 2577-2596, 2578-2594, 2578-2596, 2578-2597, 2579-2598, 2580-2596, 2580-2597, 2580- 2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600, 2582-2598, 2582-2599, 2582-2600, 2582- 2601, 2583-2599, 2583-2600, 2583-2601, 2583-2602, 2584-2600, 2584-2601, 2584-2602, 2584-2603, 2585- 2601, 2585-2603, 2585-2604, 2586-2601, 2586-2602, 2586-2604, 2586-2605, 2587-2602, 2587-2603, 2587-

2605, 2587-2606, 2588-2603, 2588-2604, 2588-2605, 2588-2606, 2588-2607, 2589-2604, 2589-2605, 2589-

2606, 2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607, 2590-2608, 2590-2609, 2590-2609, 2591-

2607, 2591-2608, 2591-2609, 2591-2610, 2592-2607, 2592-2608, 2592-2609, 2592-2610, 2592-2611, 2593- 2608, 2593-2609, 2593-2610, 2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-2613, 2595-

2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-2614, 2596- 2615, 2597-2612, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614, 2598-

2615, 2598-2616, 2598-2617, 2599-2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600-2615, 2600-

2616, 2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601-2620, 2602- 2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-2621, 2603-

2622, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622, 2605-

2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623, 2607-

2624, 2607-2625, 2607-2626, 2608-2623, 2608-2624, 2608-2625, 2608-2626, 2608-2627, 2609-2624, 2609-

2625, 2609-2626, 2609-2627, 2609-2628, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629, 2611- 2626, 2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629, 2612-2630, 2612-

2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615- 2631, and 2616-2631.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 2, when targeted by antisense compounds or oligonucleotides, display at least 50% inhibition: 1608-1627, 1685-1704, 1686-1705, 1751-1770, 1769-1784, 1871-1890, 1872-1891, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1878-1897, 1879-1894, 1879-1898, 2288-2307, 2808-2827, 2846-2865, 2852-2871, 2946-2965, 3773-3792, 3819-3838, 3825-3844, 3831-3850, 3834-3853, 3837-3856, 3843-3862, 4151-4166, 4151-4170, 4153-4172, 4159-4178, 4184-4203, 4211-4230, 4609-4628, 4612-4631, 4615-4634, 4621-4640, 4642-4661, 4648-4667, 4686-4705, 4689-4708, 4692-4711, 4698-4717, 4714-4733, 5270-5289, 5295-5314, 5296-5315, 5830-5849, 5890-5909, 5904-5923, 6406-6425, 6662-6681, 6674-6693, 6954-6973, 6960-6979, 6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6984-7003, 6985-7000, 6985-7004, 6990-7009, 7122-7141, 7125-7144, 7151-7170, 7353-7372, 7362-7381, 7683-7702, 7688-7707, 7690-7709, 7692-7707, 7692-7711, 7694-7709, 7694-7713, 7696-7711, 7696-7715, 7767-7786, 7785-7804, 7786-7801, 7787-7803, 7787-7805, 7787-7806, 7788-7803, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7805, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7808, 7792-7809, 7792-7810, 7792-7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7811, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821, 7803-7818, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7820, 7805-7822, 7805-7824, 7806-7821, 7806-7823, 7806-7825, 7807-7824, 7807-7825, 7807-7826, 7808-7825, 7808-7827, 7809-7825, 7809-7826, 7809-7828, 7810-7825, 7810-7826, 7810-7827, 7810-7829, 7811-7828, 7811 -7830, 7812-7829, 7812-7830, 7812-7831, 7813-7829, 7813-7831, 7813-7832, 7814-7833, 7815-7831, 7815-7832, 7815-7833, 7815-7834, 7816-7832, 7816-7833, 7816-7834, 7816-7835, 7817-7833, 7817-7834, 7817-7835, 7817-7836, 7818-7834, 7818-7835, 7818-7836, 7818-7837, 7819-7835, 7819-7836, 7819-7837, 7819-7838, 7820-7836, 7820-7838, 7820-7839, 7821-7836, 7821-7837, 7821-7839, 7821-7840, 7822-7837, 7822-7838, 7822-7840, 7822-7841, 7823-7838,

7823- 7839, 7823-7839, 7823-7840, 7823-7841, 7823-7842, 7824-7839, 7824-7840, 7824-7840, 7824-7841,

7824- 7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842, 7825-7843, 7825-7844, 7826-7842, 7826-7843, 7826-7844, 7826-7845, 7827-7842, 7827-7843, 7827-7844, 7827-7845, 7827-7846, 7828-7843, 7828-7844, 7828-7845, 7828-7847, 7829-7844, 7829-7845, 7829-7846, 7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7847, 7831 -7848, 7831-7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851, 7833-7852,

7834- 7849, 7834-7850, 7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852, 7835-7853,

7835- 7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854, 7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856, 7838-7853, 7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854, 7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856, 7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858, 7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860, 7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862, 7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862, 7846-7861, and 7846-7862.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 60% inhibition: 48-63, 150-169, 152-171, 154-169, 154-173, 156-171, 156-175, 158-173, 158-177, 600-619, 1135-1154, 1141-1160, 1147-1166, 1153-1172, 1171-1186, 1173-1188, 1175-1190, 1749-1768, 1763-1782, 1763-1782, 1912-1931, 2189-2208, 2191-2210, 2193-2212, 2195-2210, 2195-2214, 2197-2212, 2197-2216, 2223-2238, 2225-2240, 2227-2242, 2238-2257, 2448-2467, 2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2459-2478, 2461-2476, 2461-2480, 2550-2569, 2551-2566, 2552-2571, 2553-2568, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554-2573, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2574, 2557-2575, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582, 2567-2584, 2567-2586, 2568-2583, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2587, 2570-2589, 2571-2588, 2572-2590, 2572-2591, 2573-2590, 2573-2592, 2574-2591, 2574-2593, 2575-2590, 2575-2592, 2575-2594, 2576-2593, 2576-2595, 2577-2594, 2577-2595, 2577-2596, 2578-2594, 2578-2597, 2579-2598, 2580-2596, 2580-2597, 2580-2598, 2580-2599, 2581-2597, 2581-2598, 2581-2599, 2581-2600, 2582-2598, 2582-2599, 2582-2600, 2582-2601, 2583-2599, 2583-2600, 2583-2601, 2583-2602, 2584-2600, 2584-2602, 2584-2603, 2585-2601, 2585-2603, 2585-2604, 2586-2602, 2586-2604, 2586-2605, 2587-2603, 2587-2605, 2587-2606, 2588-2603, 2588-2604, 2588-2606, 2588-2607, 2589-2605, 2589-2606, 2589-2607, 2589-2608, 2590-2605, 2590-2606, 2590-2607, 2590-2608, 2590-2609, 2591-2607, 2591-2609, 2591-2610, 2592-2608, 2592-2609, 2592-2611, 2593-2608, 2593-2609, 2593-2612, 2594-2609, 2594-2610, 2594-2611, 2594-2612, 2594-2613, 2595-2610, 2595-2611, 2595-2612, 2595-2613, 2595-2614, 2596-2611, 2596-2612, 2596-2613, 2596-2614, 2596-2615, 2597-2612, 2597-2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598-2617,

2599- 2614, 2599-2615, 2599-2616, 2599-2617, 2599-2618, 2600-2615, 2600-2616, 2600-2617, 2600-2618,

2600- 2619, 2601-2616, 2601-2617, 2601-2618, 2601-2619, 2601 -2620, 2602-2617, 2602-2618, 2602-2619, 2602-2620, 2602-2621, 2603-2618, 2603-2619, 2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-2620, 2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2606-2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607-2626,

2608- 2623, 2608-2624, 2608-2625, 2608-2625, 2608-2626, 2608-2627, 2609-2624, 2609-2625, 2609-2626,

2609- 2627, 2609-2628, 2610-2625, 2610-2626, 2610-2627, 2610-2628, 2610-2629, 2611-2626, 2611-2626, 2611-2627, 2611-2628, 2611-2629, 2611-2630, 2612-2627, 2612-2628, 2612-2629, 2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2630, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615-2630, 2615-2630, 2615-2631, 2615-2631, and 2616-2631.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 2, when targeted by antisense compounds or oligonucleotides, display at least 60% inhibition: 1685-1704, 1686-1705, 1769-1784, 1871-1890, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1879-1894, 1879-1898, 2808-2827, 3819-3838, 3825-3844, 3831-3850, 3837-3856, 4151-4166, 5890-5909, 5904-5923, 5904-5923, 6406-6425, 6977-6996, 6979-6998, 6981-7000, 6983-6998, 6983-7002, 6985-7000, 6985-7004, 7122-7141, 7683-7702, 7688- -7707, 7690- -7709, 7692- -7707, 7692- -7711, 7694- -7709, 7696- -7711, 7696- -7715, 7786- -7801, 7787- -7806,

7788- -7803, 7788- -7805, 7788- -7806, 7788- -7807, 7789- -7806, 7789- -7807, 7789- -7808, 7790- -7807, 7790- -7809,

7791- -7808, 7791- -7809, 7791- -7810, 7792- -7809, 7792- -7810, 7792- -7811, 7793- -7810, 7793- -7811, 7793- -7812,

7794- -7811, 7794- -7812, 7794- -7813, 7795- -7812, 7795- -7813, 7795- -7814, 7796- -7813, 7796- -7814, 7796- -7815,

7797- -7812, 7797- -7814, 7797- -7816, 7798- -7813, 7798- -7815, 7798- -7817, 7799- -7816, 7799- -7818, 7800- -7819,

7801- -7818, 7801- -7820, 7802- -7817, 7802- -7819, 7802- -7821, 7803- -7818, 7803- -7820, 7803- -7822, 7804- -7821,

7804- -7823, 7805- -7822, 7805- -7824, 7806- -7823, 7806- -7825, 7807- -7824, 7807- -7825, 7807- -7826, 7808- -7825,

7808- -7827, 7809- -7826, 7809- -7828, 7810- -7825, 7810- -7827, 7810- -7829, 7811- -7828, 7811 -7830, 7812- -7829,

7812- -7830, 7812- -7831, 7813- -7829, 7813- -7832, 7814- -7833, 7815- -7831, 7815- -7832, 7815- -7833, 7815- -7834,

7816- -7832, 7816- -7833, 7816- -7834, 7816- -7835, 7817- -7833, 7817- -7834, 7817- -7835, 7817- -7836, 7818- -7834,

7818- -7835, 7818- -7836, 7818- -7837, 7819- -7835, 7819- -7837, 7819- -7838, 7820- -7836, 7820- -7838, 7820- -7839,

7821- -7837, 7821- -7839, 7821- -7840, 7822- -7838, 7822- -7840, 7822- -7841, 7823- -7838, 7823- -7839, 7823- -7841,

7823- -7842, 7824- -7840, 7824- -7841, 7824- -7842, 7824- -7843, 7825- -7840, 7825- -7841, 7825- -7842, 7825- -7843,

7825- -7844, 7826- -7842, 7826- -7844, 7826- -7845, 7827- -7843, 7827- -7844, 7827- -7846, 7828- -7843, 7828- -7844,

7828- -7847, 7829- -7844, 7829- -7845, 7829- -7846, 7829- -7847, 7829- -7848, 7830- -7845, 7830- -7846, 7830- -7847,

7830- -7848, 7830- -7849, 7831- -7846, 7831- -7847, 7831- -7848, 7831 - -7849, 7831- -7850, 7832- -7847, 7832- -7848,

7832- -7849, 7832- -7850, 7832- -7851, 7833- -7848, 7833- -7849, 7833- -7850, 7833- -7851, 7833- -7852, 7834- -7849,

7834- -7850, 7834- -7851, 7834- -7852, 7834- -7853, 7835- -7850, 7835- -7851, 7835- -7852, 7835- -7853, 7835- -7854,

7836- -7851, 7836- -7852, 7836- -7853, 7836- -7854, 7836- -7855, 7837- -7852, 7837- -7853, 7837- -7854, 7837- -7855,

7837- -7856, 7838- -7853, 7838- -7854, 7838- -7855, 7838- -7856, 7838- -7857, 7839- -7854, 7839- -7855, 7839- -7856,

7839- -7857, 7839- -7858, 7840- -7855, 7840- -7856, 7840- -7857, 7840- -7858, 7840- -7859, 7841- -7856, 7841- -7857,

7841- -7858, 7841- -7859, 7841- -7860, 7842- -7857, 7842- -7858, 7842- -7859, 7842- -7860, 7842- -7861, 7843- -7858,

7843- -7859, 7843- -7860, 7843- -7861, 7843- -7862, 7844- -7859, 7844- -7860, 7844- -7861, 7844- -7862, 7845- -7860,

7845- -7861, 7845-7862, 7846-7861, ^' 7846-7862, and 7847-7862.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 70% inhibition: 48-63, 150-169, 152-171, 154-169, 154-173, 156-171, 156-175, 158-173, 158-177, 1135-1154, 1141-1160, 1147-1 166, 1171-1186, 1173-1188, 1175-1190, 1749-1768, 1763-1782, 1912-1931, 2193-2212, 2195-2210, 2195-2214, 2197-2212, 2197-2216, 2223-2238, 2225-2240, 2227-2242, 2453-2472, 2455-2474, 2457-2472, 2457-2476, 2459-2474, 2461-2476, 2461-2480, 2550-2569, 2551-2566, 2552-2571, 2553-2570, 2553-2571, 2553-2572, 2554-2571, 2554-2572, 2554-2573, 2554-2573, 2555-2572, 2555-2574, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2574, 2557-2576, 2558-2575, 2558-2576, 2558-2577, 2559-2576, 2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2578, 2561-2579, 2561-2580, 2562-2577, 2562-2579, 2562-2581, 2563-2578, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2566-2585, 2567-2582, 2567-2584, 2567-2586, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2587, 2570-2589, 2571-2588, 2571-2590, 2572-2589, 2572- -2591, 2573- -2590, 2573- -2592, 2574-2591, 2574- -2593, 2575- -2592, 2575- -2594, 2576- -2593, 2576- -2595,

2577- -2594, 2577- -2596, 2578- -2597, 2579-2598, 2580- -2596, 2580- -2598, 2580- -2599, 2581- -2597, 2581- -2600,

2582- -2598, 2582- -2600, 2582- -2601, 2583-2599, 2583- -2601, 2583- -2602, 2584- -2600, 2584- -2602, 2584- -2603,

2585- -2601, 2585- -2603, 2585- -2604, 2586-2605, 2587- -2606, 2588- -2604, 2588- -2606, 2588- -2607, 2589- -2605,

2589- -2606, 2589- -2607, 2589- -2608, 2590-2605, 2590- -2606, 2590- -2607, 2590- -2609, 2591 -2607, 2591 -2610,

2592- -2611, 2593- -2608, 2593- -2612, 2594-2609, 2594- -2610, 2594- -2612, 2594- -2613, 2595- -2610, 2595- -2611,

2595- -2612, 2595- -2613, 2595- -2614, 2596-2611, 2596- -2614, 2596- -2615, 2597- -2612, 2597- -2613, 2597- -2614,

2597- -2615, 2597- -2616, 2598- -2613, 2598-2614, 2598- -2615, 2598- -2616, 2598- -2617, 2599- -2614, 2599- -2615,

2599- -2616, 2599- -2617, 2599- -2618, 2600-2615, 2600- -2616, 2600- -2617, 2600- -2618, 2600- -2619, 2601- -2616,

2601- -2617, 2601- -2618, 2601- -2619, 2601-2620, 2602- -2617, 2602- -2618, 2602- -2619, 2602- -2620, 2602- -2621,

2603- -2619, 2603- -2620, 2603- -2621, 2603-2622, 2604- -2619, 2604- -2620, 2604- -2621, 2604- -2622, 2604- -2623,

2605- -2620, 2605- -2621, 2605- -2622, 2605-2623, 2605- -2624, 2606- -2621, 2606- -2622, 2606- -2623, 2606- -2624,

2606- -2625, 2607- -2622, 2607- -2623, 2607-2624, 2607- -2625, 2607- -2626, 2608- -2623, 2608- -2624, 2608- -2625,

2608- -2626, 2608- -2627, 2609- -2624, 2609-2625, 2609- -2626, 2609- -2627, 2609- -2628, 2610- -2625, 2610- -2626,

2610- -2627, 2610- -2628, 2610- -2629, 2611-2626, 2611 -2627, 2611 -2629, 2611 -2630, 2612- -2627, 2612- -2628,

2612- -2629, 2612- -2630, 2612- -2631, 2613-2628, 2613 -2629, 2613 -2630, 2613 -2631, 2614- -2629, 2614- -2630,

2614- -2631, 2615-2630, 2615-2630, 2615-2631, and 2616-2631.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 2, when targeted by antisense compounds or oligonucleotides, display at least 70% inhibition: 1685-1704, 1686-1705, 1769-1784, 1871-1890, 1873-1892, 1875-1890, 1875-1894, 1877-1892, 1877-1896, 1879-1894, 1879-1898, 3819-3838, 3825-3844, 3831-3850, 4151-4166, 5890-5909, 5904-5923, 5904-5923, 6406-6425, 6983-6998, 6983-7002, 6985-7000, 6985-7004, 7688-7707, 7690-7709, 7692-7707, 7692-7711, 7694-7709, 7696-7711, 7696-7715, 7786-7801, 7787-7806, 7788-7805, 7788-7806, 7788-7807, 7789-7806, 7789-7807, 7789-7808, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7809, 7792-7811, 7793-7810, 7793-7811, 7793-7812, 7794-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7813, 7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801-7818, 7801-7820, 7802-7817, 7802-7819, 7802-7821, 7803-7820, 7803-7822, 7804-7821, 7804-7823, 7805-7822, 7805-7824, 7806-7823, 7806-7825, 7807-7824, 7807-7826, 7808-7825, 7808-7827, 7809-7826, 7809-7828, 7810-7827, 7811-7828, 7811-7830, 7812-7829, 7812-7831, 7813-7832, 7814-7833, 7815-7831, 7815-7833, 7815-7834, 7816-7832, 7816-7835, 7817-7833, 7817-7835, 7817-7836, 7818-7834, 7818-7836, 7818-7837, 7819-7835, 7819-7837, 7819-7838, 7820-7836, 7820-7838, 7820-7839, 7821-7840, 7822-7841, 7823-7839, 7823-7841, 7823-7842, 7824-7840, 7824-7841, 7824-7842, 7824-7843, 7825-7840, 7825-7841, 7825-7842, 7825-7844, 7826-7842, 7826-7845, 7827-7846, 7828-7843, 7828-7847, 7829-7844, 7829-7845, 7829-7847, 7829-7848, 7830-7845, 7830-7846, 7830-7847, 7830-7848, 7830-7849, 7831-7846, 7831-7849, 7831-7850, 7832-7847, 7832-7848, 7832-7849, 7832-7850, 7832-7851, 7833-7848, 7833-7849, 7833-7850, 7833-7851, 7833-7852, 7834-7849, 7834-7850, 7834-7851, 7834-7852, 7834-7853, 7835-7850, 7835-7851, 7835-7852, 7835-7853, 7835-7854, 7836-7851, 7836-7852, 7836-7853, 7836-7854, 7836-7855, 7837-7852, 7837-7853, 7837-7854, 7837-7855, 7837-7856, 7838-7854, 7838-7855, 7838-7856, 7838-7857, 7839-7854, 7839-7855, 7839-7856, 7839-7857, 7839-7858, 7840-7855, 7840-7856, 7840-7857, 7840-7858, 7840-7859, 7841-7856, 7841-7857, 7841-7858, 7841-7859, 7841-7860, 7842-7857, 7842-7858, 7842-7859, 7842-7860, 7842-7861, 7843-7858, 7843-7859, 7843-7860, 7843-7861, 7843-7862, 7844-7859, 7844-7860, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7845-7862, 7846-7861, 7846-7862, and 7847-7862.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 80% inhibition: 152-171, 154-169, 156-171, 158- 173, 1135-1154, 1171-1186, 1173-1188, 1175-1190, 1763-1782, 1912-1931, 2197-2212, 2223-2238, 2225- 2240, 2227-2242, 2457-2472, 2459-2474, 2461-2476, 2551-2566, 2553-2570, 2553-2571, 2553-2572, 2554- 2573, 2555-2572, 2555-2574, 2556-2573, 2556-2574, 2556-2575, 2557-2574, 2557-2576, 2558-2575, 2558-

2576, 2559-2577, 2559-2578, 2560-2577, 2560-2578, 2560-2579, 2561-2578, 2561-2579, 2561-2580, 2562-

2577, 2562-2579, 2562-2581, 2563-2580, 2563-2582, 2564-2581, 2564-2583, 2565-2584, 2566-2583, 2567- 2584, 2567-2586, 2568-2585, 2568-2587, 2569-2586, 2569-2588, 2570-2587, 2571-2588, 2571-2590, 2572-

2589, 2572-2591, 2573-2590, 2573-2592, 2574-2591, 2574-2593, 2575-2592, 2576-2593, 2576-2595, 2577- 2594, 2577-2596, 2578-2597, 2580-2598, 2580-2599, 2581-2597, 2581-2600, 2582-2601, 2583-2602, 2584- 2603, 2585-2604, 2586-2605, 2587-2606, 2588-2607, 2589-2608, 2590-2606, 2590-2607, 2590-2609, 2591- 2610, 2592-2611, 2593-2608, 2593-2612, 2594-2613, 2595-2611, 2595-2614, 2596-2615, 2597-2612, 2597- 2613, 2597-2614, 2597-2615, 2597-2616, 2598-2613, 2598-2613, 2598-2614, 2598-2615, 2598-2616, 2598- 2617, 2599-2614, 2599-2617, 2599-2618, 2600-2615, 2600-2617, 2600-2618, 2600-2619, 2601-2616, 2601- 2617, 2601-2619, 2601-2620, 2602-2618, 2602-2621, 2603-2620, 2603-2621, 2603-2622, 2604-2619, 2604-

2620, 2604-2621, 2604-2622, 2604-2623, 2605-2620, 2605-2621, 2605-2622, 2605-2623, 2605-2624, 2606-

2621, 2606-2622, 2606-2623, 2606-2624, 2606-2625, 2607-2622, 2607-2623, 2607-2624, 2607-2625, 2607- 2626, 2608-2623, 2608-2624, 2608-2625, 2608-2627, 2609-2624, 2609-2626, 2609-2627, 2609-2628, 2610-

2625, 2610-2626, 2610-2628, 2610-2629, 2611-2626, 2611-2627, 2611-2629, 2611-2630, 2612-2627, 2612- 2628, 2612-2630, 2612-2631, 2613-2628, 2613-2629, 2613-2631, 2614-2629, 2614-2630, 2614-2631, 2615- 2630, and 2616-2631.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 2, when targeted by antisense compounds or oligonucleotides, display at least 80% inhibition: 1685-1704, 1686-1705, 1873-1892, 1875-1890, 1877-1892, 1879-1894, 3819-3838, 4151-4166, 5904-5923, 6406-6425, 6985-7000, 7692-7707, 7694-7709, 7696-7711, 7786-7801, 7788-7805, 7788-7806, 7788-7807, 7789-7808, 7790-7807, 7790-7809, 7791-7808, 7791-7809, 7791-7810, 7792-7809, 7792-7811, 7793-7810, 7793-7811, 7794-7812, 7794-7813, 7795-7812, 7795-7813, 7795-7814, 7796-7813, 7796-7814, 7796-7815, 7797-7812, 7797-7814, 7797-7816, 7798-7815, 7798-7817, 7799-7816, 7799-7818, 7800-7819, 7801 -7818, 7802-7819, 7802-7821, 7803-7820, 7803- -7822, 7804- -7821, 7804- -7823, 7805-7822, 7806- -7823, 7806- -7825, 7807- -7824, 7807- -7826, 7808- -7825,

7808- -7827, 7809- -7826, 7809- -7828, 7810-7827, 7811- -7828, 7812- -7829, 7812- -7831, 7813- -7832, 7814- -7833,

7815- -7834, 7816- -7832, 7816- -7835, 7817-7836, 7818- -7837, 7819- -7838, 7820- -7839, 7821- -7840, 7822- -7841,

7823- -7842, 7824- -7843, 7825- -7841, 7825-7842, 7825- -7844, 7826- -7845, 7827- -7846, 7828- -7843, 7828- -7847,

7829- -7848, 7830- -7846, 7830- -7849, 7831-7850, 7832- -7847, 7832- -7848, 7832- -7849, 7832- -7850, 7832- -7851,

7833- -7848, 7833- -7849, 7833- -7850, 7833-7851, 7833- -7852, 7834- -7849, 7834- -7852, 7834- -7853, 7835- -7850,

7835- -7852, 7835- -7853, 7835- -7854, 7836-7851, 7836- -7852, 7836- -7854, 7836- -7855, 7837- -7853, 7837- -7856,

7838- -7855, 7838- -7856, 7838- -7857, 7839-7854, 7839- -7855, 7839- -7856, 7839- -7857, 7839- -7858, 7840- -7855,

7840- -7856, 7840- -7857, 7840- -7858, 7840-7859, 7841- -7856, 7841 - -7857, 7841- -7858, 7841- -7859, 7841- -7860,

7842- -7857, 7842- -7858, 7842- -7859, 7842-7860, 7842- -7861, 7843- -7858, 7843- -7859, 7843- -7860, 7843- -7862,

7844-7859, 7844-7861, 7844-7862, 7845-7860, 7845-7861, 7846-7862, and 7847-7862.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 1, when targeted by antisense compounds or oligonucleotides, display at least 90% inhibition: 154-169, 156-171, 158-173, 1135- 1154, 1171-1186, 1173-1188, 1763-1782, 1912-1931, 2223-2238, 2227-2242, 2459-2474, 2461-2476, 2554- 2573, 2555-2574, 2560-2577, 2561-2578, 2561-2579, 2562-2581, 2563-2580, 2563-2582, 2564-2581, 2566- 2583, 2567-2584, 2568-2585, 2568-2587, 2569-2586, 2570-2587, 2576-2593, 2577-2594, 2577-2596, 2578- 2597, 2580-2599, 2581-2600, 2582-2601, 2583-2602, 2584-2603, 2586-2605, 2587-2605, 2587-2606, 2588- 2607, 2589-2608, 2590-2607, 2590-2609, 2592-2611, 2595-2614, 2596-2615, 2597-2612, 2597-2613, 2597- 2615, 2597-2616, 2598-2613, 2598-2613, 2598-2617, 2599-2614, 2599-2618, 2600-2615, 2600-2619, 2601- 2617, 2601-2620, 2602-2621, 2603-2622, 2604-2623, 2605-2621, 2605-2622, 2605-2624, 2606-2625, 2607- 2626, 2608-2623, 2608-2625, 2609-2628, 2611-2627, 2611-2630, 2612-2628, 2612-2631, 2613-2629, 2614- 2629, 2615-2630, and 2616-2631.

In certain embodiments, the following nucleotide regions of SEQ ID NO: 2, when targeted by antisense compounds or oligonucleotides, display at least 90%> inhibition: 1685-1704, 1686-1705, 1875-1890, 1877-1892, 1879-1894, 3819-3838, 5904-5923, 6406-6425, 7694-7709, 7696-7711, 7789-7808, 7790-7809, 7795-7812, 7795-7813, 7796-7813, 7796-7814, 7797-7814, 7797-7816, 7798-7815, 7798-7817, 7799-7816, 7801-7818, 7802-7819, 7803-7820, 7803-7822, 7804-7821, 7805-7822, 7811-7828, 7812-7829, 7812-7831, 7813-7832, 7815-7834, 7818-7837, 7819-7838, 7821-7840, 7822-7840, 7822-7841, 7825-7842, 7832-7847, 7832-7848, 7832-7850, 7833-7848, 7833-7852, 7834-7849, 7834-7853, 7835-7850, 7836-7852, 7836-7855, 7837-7856, 7838-7856, 7839-7857, 7839-7858, 7840-7856, 7840-7857, 7840-7859, 7843-7858, 7843-7860, and 7846-7862.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 50% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614, 532632, 532635, 532638, 532639, 532686, 532687, 532688, 532689, 532690, 532691, 532692, 532692, 532693, 532694, 532695, 532696, 532697, 532698, 532699, 532700, 532701, 532702, 532703, 532704, 532705, 532706, 532707, 532770, 532775, 532778, 532780, 532791, 532800, 532809, 532810, 532811, 532917,

532952, 588509, 588510, 588511, 588512, 588513, 588514, 588515, 588516, 588517, 588518, 588519,

588520, 588522, 588523, 588524, 588525, 588527, 588528, 588529, 588530, 588531, 588532, 588533,

588534, 588535, 588536, 588537, 588538, 588539, 588540, 588541, 588542, 588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550, 588551, 588552, 588553, 588554, 588555, 588556, 588557,

588558, 588559, 588560, 588561, 588562, 588563, 588564, 588565, 588566, 588567, 588568, 588569,

588570, 588571, 588572, 588573, 588574, 588575, 588576, 588577, 588580, 588581, 588585, 588586,

588589, 588590, 588599, 588603, 588606, 588608, 588610, 588614, 588616, 588628, 588631, 588632,

588634, 588636, 588638, 588640, 588645, 588646, 588654, 588656, 588658, 588660, 588662, 588664, 588670, 588672, 588676, 588682, 588688, 588696, 588698, 588807, 588808, 588809, 588813, 588814,

588815, 588819, 588820, 588822, 588823, 588838, 588839, 588840, 588841, 588842, 588846, 588847,

588848, 588849, 588850, 588851, 588852, 588853, 588854, 588855, 588856, 588857, 588858, 588859,

588860, 588861, 588862, 588863, 588864, 588865, 588866, 588867, 588868, 588870, 588871, 588872,

588873, 588874, 588875, 588876, 588877, 588878, 588879, 588880, 588881, 588882, 588883, 588884, 598999, 599000, 599001, 599002, 599003, 599004, 599005, 599006, 599007, 599008, 599009, 599010,

599011, 599012, 599013, 599014, 599015, 599018, 599019, 599023, 599024, 599025, 599026, 599027,

599028, 599029, 599030, 599031, 599032, 599033, 599034, 599035, 599058, 599062, 599063, 599064,

599065, 599070, 599071, 599072, 599073, 599074, 599076, 599077, 599078, 599079, 599080, 599081,

599082, 599083, 599084, 599085, 599086, 599087, 599088, 599089, 599090, 599091, 599092, 599093, 599094, 599095, 599096, 599097, 599098, 599102, 599119, 599123, 599124, 599125, 599126, 599127,

599128, 599132, 599133, 599134, 599135, 599136, 599137, 599138, 599139, 599140, 599141, 599142,

599143, 599144, 599145, 599147, 599148, 599149, 599150, 599151, 599152, 599153, 599154, 599155,

599156, 599157, 599158, 599159, 599178, 599179, 599180, 599181, 599182, 599186, 599187, 599188,

599189, 599190, 599191, 599192, 599193, 599194, 599195, 599196, 599197, 599198, 599199, 599200, 599201, 599202, 599203, 599204, 599205, 599206, 599207, 599208, 599209, 599210, 599211, 599212,

599213, 599214, 599215, 599216, 599217, 599218, 599219, 599220, 599221, 599221, 599222, 599223,

599224, 599225, 599226, 599227, 599228, 599229, 599230, 599231, 599232, 599233, 599234, 599235,

599236, 599241, 599247, 599248, 599249, 599255, 599256, 599257, 599258, 599260, 599261, 599262,

599263, 599264, 599265, 599266, 599267, 599268, 599269, 599270, 599271, 599272, 599273, 599274, 599275, 599276, 599277, 599278, 599279, 599280, 599297, 599299, 599306, 599307, 599308, 599309,

599311, 599312, 599313, 599314, 599315, 599316, 599317, 599318, 599319, 599320, 599321, 599322,

599323, 599324, 599325, 599326, 599327, 599328, 599329, 599330, 599338, 599349, 599353, 599354,

599355, 599356, 599357, 599358, 599359, 599360, 599361, 599362, 599363, 599364, 599369, 599371,

599372, 599373, 599376, 599378, 599379, 599382, 599383, 599384, 599385, 599386, 599387, 599388, 599389, 599390, 599391, 599392, 599393, 599394, 599395, 599396, 599397, 599398, 599399, 599400, 599401, 599402, 599403, 599404, 599405, 599406, 599407, 599408, 599409, 599410, 599412, 599413,

599414, 599415, 599416, 599417, 599418, 599419, 599420, 599421, 599422, 599423, 599424, 599425,

599426, 599433, 599434, 599435, 599436, 599437, 599438, 599439, 599440, 599441, 599442, 599443,

599444, 599445, 599446, 599447, 599448, 599450, 599454, 599455, 599456, 599467, 599468, 599469,

599471, 599472, 599473, 599474, 599475, 599476, 599477, 599478, 599479, 599480, 599481, 599482,

599483, 599484, 599485, 599486, 599487, 599488, 599489, 599490, 599491, 599492, 599493, 599494,

599495, 599496, 599497, 599498, 599499, 599500, 599501, 599502, 599503, 599504, 599505, 599506,

599507, 599508, 599509, 599512, 599515, 599518, 599531, 599541, 599541, 599546, 599547, 599548,

599549, 599550, 599552, 599553, 599554, 599555, 599557, 599558, 599561, 599562, 599563, 599564,

599565, 599566, 599567, 599568, 599569, 599570, 599577, 599578, 599579, 599580, 599581, 599581,

599582, 599584, 599585, 599586, 599587, 599588, 599589, 599590, 599591, 599592, 599593, 599594,

599595, 601321, 601322, 601323, 601325, 601327, 601328, 601329, 601330, 601332, 601333, 601334,

601335, 601336, 601337, 601338, 601339, 601341, 601342, 601343, 601344, 601345, 601346, 601347,

601348, 601349, 601362, 601367, 601368, 601369, 601371, 601372, 601373, 601374, 601375, 601377, 601378, 601380, 601381, 601382, 601383, 601384, 601385, 601386, 601387, and 601388.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 50% inhibition of a CFB m NA, SEQ ID NOs: 12, 30, 33, 36, 37, 84, 85, 86, 87, 88, 89, 90, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 198, 203, 206, 208, 219, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 468, 472, 473, 475, 478, 479, 488, 492, 494, 495, 498, 499, 500, 502, 503, 509, 510, 511, 512, 513, 514, 515, 517, 518, 522, 523, 524, 525, 529, 530, 531, 534, 535, 537, 540, 541, 542, 543, 544, 545, 546, 547, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 563, 564, 565, 569, 570, 572, 573, 577, 588, 589, 590, 591, 592, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 623, 640, 641, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688, 689, 700, 704, 705, 706, 707, 708, 709, 711, 712, 713, 714, 715, 716, 717, 718, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 758, 759, 760, 761, 762, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 813, 833, 834, 841, 846, 849, 850, 867, and 873.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 60% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614, 532635, 532686, 532687, 532688, 532689, 532770, 532800, 532809, 532810, 532811, 532917, 532952, 588512,

588513, 588514, 588515, 588516, 588517, 588518, 588519, 588522, 588523, 588524, 588525, 588527,

588528, 588529, 588530, 588531, 588532, 588533, 588534, 588535, 588536, 588537, 588538, 588539,

588540, 588541, 588542, 588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550, 588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560, 588561, 588562, 588563,

588564, 588565, 588566, 588567, 588568, 588569, 588570, 588571, 588572, 588573, 588574, 588575,

588576, 588577, 588636, 588638, 588640, 588664, 588676, 588696, 588698, 588807, 588808, 588814,

588815, 588819, 588820, 588840, 588842, 588846, 588847, 588848, 588849, 588850, 588851, 588852,

588853, 588854, 588855, 588856, 588857, 588858, 588859, 588860, 588861, 588862, 588863, 588864, 588866, 588867, 588868, 588870, 588871, 588872, 588873, 588874, 588875, 588876, 588877, 588878,

588879, 588880, 588881, 588882, 588883, 588884, 598999, 599000, 599001, 599002, 599003, 599004,

599005, 599006, 599007, 599008, 599009, 599010, 599011, 599012, 599013, 599014, 599015, 599019,

599024, 599025, 599026, 599027, 599028, 599029, 599030, 599031, 599032, 599033, 599034, 599035,

599064, 599065, 599071, 599072, 599077, 599078, 599079, 599080, 599083, 599084, 599085, 599086, 599087, 599088, 599089, 599090, 599091, 599092, 599093, 599094, 599095, 599096, 599097, 599125,

599126, 599127, 599133, 599134, 599135, 599136, 599138, 599139, 599140, 599141, 599142, 599148,

599149, 599150, 599151, 599152, 599154, 599155, 599156, 599157, 599158, 599159, 599178, 599179,

599180, 599181, 599187, 599188, 599190, 599192, 599193, 599194, 599195, 599196, 599197, 599198,

599199, 599200, 599201, 599202, 599203, 599204, 599205, 599206, 599207, 599208, 599209, 599210, 599211, 599212, 599213, 599214, 599215, 599216, 599217, 599218, 599219, 599220, 599221, 599222,

599223, 599224, 599225, 599226, 599227, 599228, 599229, 599230, 599231, 599232, 599233, 599234,

599235, 599236, 599247, 599255, 599256, 599257, 599263, 599264, 599265, 599266, 599270, 599271,

599272, 599273, 599274, 599275, 599276, 599277, 599278, 599279, 599280, 599306, 599307, 599308,

599311, 599312, 599313, 599314, 599315, 599316, 599317, 599318, 599319, 599320, 599321, 599322, 599323, 599324, 599325, 599327, 599328, 599329, 599330, 599349, 599353, 599355, 599356, 599357,

599358, 599359, 599360, 599361, 599362, 599363, 599364, 599369, 599371, 599372, 599373, 599376,

599378, 599379, 599382, 599384, 599386, 599387, 599388, 599389, 599390, 599391, 599392, 599393,

599394, 599395, 599396, 599397, 599398, 599399, 599400, 599401, 599402, 599403, 599404, 599405,

599406, 599407, 599408, 599409, 599410, 599412, 599413, 599414, 599415, 599416, 599417, 599418, 599419, 599420, 599421, 599422, 599423, 599424, 599425, 599433, 599434, 599435, 599436, 599437,

599438, 599439, 599440, 599441, 599442, 599443, 599444, 599445, 599446, 599447, 599448, 599456,

599467, 599468, 599471, 599472, 599473, 599474, 599475, 599476, 599477, 599478, 599479, 599480,

599481, 599482, 599483, 599484, 599485, 599486, 599487, 599488, 599489, 599490, 599491, 599492,

599493, 599494, 599495, 599496, 599497, 599498, 599499, 599500, 599501, 599502, 599503, 599504, 599505, 599506, 599507, 599508, 599512, 599531, 599547, 599548, 599549, 599552, 599553, 599554, 599555, 599557, 599558, 599562, 599563, 599564, 599565, 599566, 599567, 599568, 599569, 599570, 599577, 599578, 599579, 599580, 599581, 599582, 599584, 599585, 599586, 599587, 599588, 599589, 599590, 599591, 599592, 599593, 599594, 599595, 601323, 601327, 601329, 601332, 601333, 601333, 601334, 601335, 601336, 601338, 601339, 601341, 601342, 601343, 601344, 601345, 601346, 601347, 601348, 601349, 601368, 601369, 601371, 601372, 601374, 601375, 601377, 601378, 601380, 601381, 601382, 601383, 601384, 601385, 601386, 601387, and 601388.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 60% inhibition of a CFB m NA, SEQ ID NOs: 12, 33, 84, 85, 86, 87, 198, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 472, 473, 513, 514, 515, 531, 537, 541, 542, 543, 544, 545, 546, 547, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 564, 565, 569, 570, 577, 590, 592, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 682, 683, 684, 685, 686, 687, 688, 689, 700, 704, 706, 707, 708, 709, 711, 712, 713, 714, 715, 716, 717, 720, 721, 722, 723, 724, 725, 726, 727, 727, 728, 729, 730, 731, 732, 733, 734, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 758, 759, 760, 761, 767, 768, 770, 772, 773, 774, 775, 775, 776, 776, 777, 777, 778, 779, 780, 781, 782, 783, 783, 784, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 813, 833, 834, 841, 846, 849, and 850.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 70% inhibition of a CFB mRNA, ISIS NOs: 516350, 532614, 532686, 532687, 532688, 532770, 532800, 532809, 532810, 532811, 532917, 532952, 588512, 588513, 588514, 588515, 588516, 588517, 588518, 588524, 588529, 588530, 588531, 588532, 588533, 588534, 588535, 588536, 588537, 588538, 588539, 588540, 588541, 588542, 588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550, 588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560, 588561, 588562, 588563, 588564, 588565, 588568, 588569, 588570, 588571, 588572, 588573, 588574, 588575, 588577, 588636, 588638, 588640, 588696, 588698, 588807, 588814, 588815, 588819, 588842, 588847, 588848, 588849, 588850, 588851, 588852, 588853, 588856, 588857, 588858, 588859, 588860, 588861, 588862, 588863, 588866, 588867, 588870, 588871, 588872, 588873, 588874, 588875, 588876, 588877, 588878, 588879, 588880, 588881, 588882, 588883, 588884, 599000, 599001, 599003, 599004, 599005, 599008, 599009, 599010, 599011, 599014, 599015, 599024, 599025, 599027, 599028, 599029, 599030, 599031, 599032, 599033, 599034, 599072, 599077, 599080, 599085, 599086, 599087, 599088, 599089, 599090, 599091, 599093, 599094, 599095, 599096, 599097, 599125, 599126, 599134, 599138, 599139, 599148, 599149, 599150, 599151, 599152, 599154, 599155, 599156, 599157, 599158, 599187, 599188, 599193, 599195, 599196, 599197, 599198, 599199, 599200, 599201, 599202, 599203, 599204, 599205, 599206, 599207, 599208, 599210, 599211, 599212, 599213, 599214, 599215, 599216, 599217, 599218, 599219, 599220, 599221, 599222, 599223, 599224, 599225, 599226, 599227, 599228, 599229, 599230, 599231, 599232, 599233, 599234, 599235, 599236, 599266, 599272, 599272, 599273, 599274, 599275, 599277, 599278, 599279, 599280, 599280, 599306, 599311, 599312, 599313, 599314, 599315, 599316, 599317, 599318, 599319, 599320, 599321, 599322, 599323, 599325, 599327, 599328, 599329, 599330, 599355, 599357, 599358, 599359, 599360, 599361, 599362, 599363, 599364, 599369, 599371, 599372, 599373, 599378, 599379, 599382, 599384, 599386, 599387, 599388, 599389, 599390, 599391, 599392, 599393, 599394, 599395, 599396, 599397, 599398, 599399, 599400, 599401, 599402, 599403, 599404, 599405, 599406, 599407, 599408, 599409, 599410, 599413, 599414, 599415, 599416, 599417, 599418, 599419, 599420, 599421, 599422, 599423, 599424, 599433, 599434, 599435, 599436, 599437, 599438, 599439, 599440, 599441, 599442, 599443, 599445, 599446, 599447, 599448, 599472, 599473, 599474, 599475, 599476, 599477, 599478, 599479, 599480, 599481, 599482, 599483, 599484, 599485, 599486, 599487, 599488, 599489, 599490, 599491, 599492, 599493, 599494, 599495, 599496, 599497, 599498, 599499, 599500, 599501, 599502, 599503, 599504, 599505, 599506, 599507, 599508, 599512, 599547, 599548, 599552, 599553, 599554, 599555, 599558, 599562, 599563, 599564, 599566, 599567, 599568, 599569, 599570, 599577, 599578, 599579, 599580, 599581, 599582, 599585, 599586, 599587, 599588, 599589, 599590, 599591, 599592, 599593, 599594, 599595, 601332, 601335, 601341, 601343, 601344, 601345, 601346, 601347, 601348, 601349, 601371, 601372, 601380, 601382, 601383, 601384, 601385, 601386, and 601387.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 70% inhibition of a CFB mRNA, SEQ ID NOs: 12, 84, 85, 86, 198, 228, 237, 238, 239, 317, 395, 396, 397, 398, 399, 402, 403, 404, 405, 407, 408, 410, 411, 412, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 464, 465, 472, 473, 513, 514, 515, 541, 542, 543, 544, 545, 546, 547, 549, 550, 551, 552, 553, 554, 555, 556, 557, 564, 565, 569, 592, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 645, 646, 647, 648, 649, 650, 653, 654, 655, 656, 659, 660, 662, 663, 664, 665, 666, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 677, 678, 679, 680, 682, 683, 684, 686, 687, 688, 689, 706, 708, 709, 711, 712, 713, 714, 715, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 767, 768, 773, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 793, 794, 795, 797, 798, 799, 813, 833, 834, 841, 846, 849, 867, and 873. In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least an 80% inhibition of a CFB mRNA, ISIS NOs: 532686, 532809, 532810, 532811, 532917, 532952, 588512, 588517, 588518, 588533, 588534, 588535, 588536, 588537, 588538, 588539, 588540, 588542, 588543, 588544, 588545, 588546, 588547, 588548, 588549, 588550, 588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560, 588561, 588562, 588563, 588564, 588565, 588571, 588638, 588640, 588696, 588698, 588807, 588814, 588849, 588850, 588851, 588853, 588857, 588858, 588859, 588860, 588861, 588862, 588863, 588866, 588867, 588871, 588872, 588873, 588874, 588875, 588876, 588877, 588878, 588879, 588880, 588881, 588882, 588883, 599001, 599024, 599025, 599033, 599086, 599087, 599088, 599089, 599093, 599094, 599095, 599096, 599134, 599139, 599148, 599149, 599151, 599154, 599155, 599156, 599158, 599188, 599195, 599196, 599198, 599201, 599202, 599203, 599204, 599205, 599206, 599207, 599212, 599213, 599215, 599216, 599217, 599218, 599219, 599220, 599221, 599222, 599223, 599224, 599225, 599226, 599227, 599228, 599229, 599230, 599231, 599232, 599233, 599234, 599235, 599236, 599272, 599273, 599275, 599277, 599278, 599279, 599280, 599311, 599313, 599314, 599316, 599317, 599318, 599320, 599321, 599322, 599323, 599327, 599328, 599329, 599330, 599355, 599357, 599358, 599359, 599360, 599361, 599362, 599363, 599364, 599371, 599372, 599373, 599378, 599379, 599382, 599384, 599386, 599387, 599388, 599389, 599390, 599391, 599392, 599393, 599397, 599398, 599399, 599400, 599401, 599403, 599404, 599405, 599407, 599408, 599409, 599410, 599413, 599414, 599415, 599416, 599417, 599418, 599419, 599420, 599421, 599422, 599423, 599424, 599433, 599434, 599435, 599436, 599437, 599438, 599439, 599440, 599441, 599445, 599446, 599447, 599448, 599474, 599476, 599477, 599479, 599481, 599482, 599483, 599485, 599486, 599487, 599488, 599489, 599490, 599491, 599492, 599494, 599495, 599496, 599497, 599498, 599499, 599500, 599502, 599503, 599504, 599505, 599506, 599507, 599508, 599547, 599552, 599553, 599554, 599558, 599563, 599567, 599568, 599569, 599570, 599577, 599578, 599581, 599582, 599585, 599587, 599588, 599590, 599591, 599592, 599593, 599594, 601332, 601344, 601345, 601382, 601383, and 601385.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 80% inhibition of a CFB mRNA, SEQ ID NOs: 84, 237, 238, 239, 317, 395, 397, 411, 412, 413, 414, 415, 417, 418, 419, 420, 421, 422, 423, 425, 426, 427, 429, 430, 431, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 472, 473, 514, 515, 542, 543, 544, 545, 546, 547, 550, 551, 552, 553, 554, 555, 556, 557, 564, 595, 599, 600, 601, 602, 603, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 646, 655, 660, 662, 663, 666, 669, 670, 671, 672, 673, 675, 676, 677, 678, 679, 682, 684, 686, 687, 688, 689, 706, 708, 709, 711, 712, 713, 714, 715, 720, 722, 723, 724, 725, 726, 727, 729, 730, 731, 732, 733, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 768, 775, 776, 778, 781, 782, 783, 784, 785, 787, 788, 789, 790, 791, 792, 793, 794, 799, 813, 833, 834, 841, 849, 867, and 873.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 90% inhibition of a CFB mRNA, ISIS NOs: 532686, 532811, 532917, 588536, 588537, 588538, 588539, 588544, 588545, 588546, 588548, 588551, 588552, 588553, 588554, 588555, 588556, 588557, 588558, 588559, 588560, 588561, 588562, 588564, 588638, 588640, 588696, 588698, 588849, 588850, 588851, 588860, 588866, 588867, 588872, 588873, 588874, 588876, 588877, 588878, 588879, 588881, 588883, 599149, 599188, 599203, 599206, 599220, 599221, 599222, 599223, 599224, 599225, 599226, 599227, 599228, 599229, 599235, 599236, 599279, 599280, 599314, 599321, 599362, 599378, 599390, 599391, 599398, 599399, 599404, 599413, 599414, 599416, 599419, 599420, 599422, 599435, 599437, 599438, 599441, 599483, 599494, 599508, 599552, 599553, 599554, 599568, 599570, 599577, 599581, 599591, 599592, and 599593.

In certain embodiments, the following antisense compounds or oligonucleotides target a region of a CFB nucleic acid and effect at least a 90% inhibition of a CFB mRNA, SEQ ID NOs: 84, 238, 239, 317, 412, 413, 420, 421, 426, 434, 436, 437, 438, 439, 440, 442, 443, 444, 445, 446, 448, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 464, 465, 472, 473, 514, 515, 542, 543, 544, 545, 546, 551, 553, 555, 556, 599, 600, 601, 602, 610, 616, 617, 618, 662, 666, 670, 676, 677, 678, 688, 689, 713, 723, 729, 730, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 755, 756, 768, 783, 793, 833, and 867.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides complementary within nucleotides 2193-2212, 2195-2210, 2457-2476, 2571 -2590, 2584- 2603, 2588-2607, 2592-2611, 2594-2613, 2597-2616, 2600-2619, or 2596-2611 of SEQ ID NO: 1.

In certain embodiments, a compound comprises a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.

In certain embodiments, a compound comprises a modified oligonucleotide having a nucleobase sequence consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598.

In certain embodiments, any of the foregoing compounds or oligonucleotides comprises at least one modified internucleoside linkage, at least one modified sugar, and/or at least one modified nucleobase.

In certain embodiments, any of the foregoing compounds or oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2'-0-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4'-CH(CH ₃ )-0-2' group, a 4'-CH ₂ -0-2' group, or a 4'-(CH ₂ ) ₂ -0-2'group.

In certain embodiments, the modified oligonucleotide comprises at least one modified internucleoside linkage, such as a phosphorothioate internucleoside linkage. In certain embodiments, any of the foregoing compounds or oligonucleotides comprises at least one modified nucleobase, such as 5-methylcytosine.

In certain embodiments, any of the foregoing compounds or oligonucleotides comprises:

a gap segment consisting of linked deoxynucleosides;

a 5' wing segment consisting of linked nucleosides; and

a 3' wing segment consisting of linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the oligonucleotide consists of 10 to 30 linked nucleosides having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, or 598.

In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising the sequence recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, or 455, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of five linked nucleosides; and

a 3' wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a single-stranded modified oligonucleotide consisting of 20 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 198, 228, 237, 440, 444, 448, 450, 453, or 455, wherein the oligonucleotide comprises: a gap segment consisting of ten linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; and a 3' wing segment consisting of five linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, wherein each nucleoside of each wing segment comprises a 2'-0-methoxyethyl sugar; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence consisting of the sequence recited in SEQ ID NO: 549, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein each nucleoside of each wing segment comprises a cEt sugar; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

In certain embodiments, a compound comprises or consists of a single-stranded modified oligonucleotide consisting of 16 linked nucleosides having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 598, wherein the modified oligonucleotide comprises

a gap segment consisting of ten linked deoxynucleosides;

a 5' wing segment consisting of three linked nucleosides; and

a 3' wing segment consisting of three linked nucleosides;

wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; wherein the 5' wing segment comprises a 2'-0-methoxyethyl sugar, 2'-0-methoxyethyl sugar, and cEt sugar in the 5' to 3' direction; wherein the 3' wing segment comprises a cEt sugar, cEt sugar, and 2'-0- methoxyethyl sugar in the 5' to 3' direction; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.

In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least

90%, at least 95%, at least 98%, at least 99%, or 100% complementary to a nucleic acid encoding CFB.

In any of the foregoing embodiments, the compound or oligonucleotide can be single-stranded.

In certain embodiments, the compounds or compositions as described herein are efficacious by virtue of having at least one of an in vitro IC ₅₀ of less than 250 nM, less than 200 nM, less than 150 nM, less than 100 nM, less than 90 nM, less than 80 nM, less than 70 nM, less than 65 nM, less than 60 nM, less than 55 nM, less than 50 nM, less than 45 nM, less than 40 nM, less than 35 nM, less than 30 nM, less than 25 nM, or less than 20 nM.

In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having at least one of an increase an ALT or AST value of no more than 4 fold, 3 fold, or 2 fold over saline treated animals or an increase in liver, spleen, or kidney weight of no more than 30%, 20%, 15%), 12%), 10%), 5%), or 2%. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase of ALT or AST over saline treated animals. In certain embodiments, the compounds or compositions as described herein are highly tolerable as demonstrated by having no increase in liver, spleen, or kidney weight over saline treated animals.

Certain embodiments provide a composition comprising the compound of any of the aforementioned embodiments or salt thereof and at least one of a pharmaceutically acceptable carrier or diluent. In certain embodiments, the composition has a viscosity less than about 40 centipoise (cP), less than about 30 centipose (cP), less than about 20 centipose (cP), less than about 15 centipose (cP), or less than about 10 centipose (cP). In certain embodiments, the composition having any of the aforementioned viscosities comprises a compound provided herein at a concentration of about 100 mg/mL, about 125 mg/mL, about 150 mg/mL, about 175 mg/mL, about 200 mg/mL, about 225 mg/mL, about 250 mg/mL, about 275 mg/mL, or about 300 mg/mL. In certain embodiments, the composition having any of the aforementioned viscosities and/or compound concentrations has a temperature of room temperature or about 20°C, about 21°C, about 22°C, about 23 °C, about 24°C, about 25°C, about 26°C, about 27°C, about 28°C, about 29°C, or about 30°C.

In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway in a subject comprises administering to the subject a specific inhibitor of Complement Factor B (CFB), thereby treating, preventing, or ameliorating the disease. In certain embodiments, the complement alternative pathway is activated greater than normal. In certain embodiments, the CFB specific inhibitor is an antisense compound targeted to CFB, such as an antisense oligonucleotide targeted to CFB. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 588540, which has the following chemical structure:

In certain embodiments, the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.

In certain embodiments, a method of treating, preventing, or ameliorating macular degeneration, such as age-related macular degeneration (AMD) in a subject comprises administering to the subject a CFB specific inhibitor, thereby treating, preventing, or ameliorating AMD, such as wet AMD and dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. Geographic Atrophy is considered an advanced form of dry AMD involving degeneration of the retina. In certain embodiments, the subject has a complement alternative pathway that is activated greater than normal. In certain embodiments, administering the antisense compound reduces or inhibits accumulation of ocular C3 levels, such as C3 protein levels. In certain embodiments, administering the antisense compound reduces the level of ocular C3 deposits or inhibits accumulation of ocular C3 deposits. In certain embodiments, the CFB specific inhibitor is an antisense compound targeted to CFB, such as an antisense oligonucleotide targeted to CFB. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6- 808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430. In certain embodiments, the compound is administered to the subject parenterally.

In certain embodiments, a method of treating, preventing, or ameliorating a kidney disease associated with dysregulation of the complement alternative pathway in a subject comprises administering to the subject a specific inhibitor of Complement Factor B (CFB), thereby treating, preventing, or ameliorating the kidney disease. In certain embodiments, the complement alternative pathway is activated greater than normal. In certain embodiments, the CFB specific inhibitor is an antisense compound targeted to CFB, such as an antisense oligonucleotide targeted to CFB. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430. In certain embodiments, the compound is administered to the subject parenterally. In certain embodiments, the kidney disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof. In certain embodiments, the kidney disease is associated with C3 deposits, such as C3 deposits in the glomerulus. In certain embodiments, the kidney disease is associated with lower than normal circulating C3 levels, such as serum or plasma C3 levels. In certain embodiments, administering the compound reduces or inhibits accumulation of C3 levels in the kidney, such as C3 protein levels. In certain embodiments, administering the compound reduces the level of kidney C3 deposits or inhibits accumulation of kidney C3 deposits, such as C3 levels in the glomerulus. In certain embodiments, the subject is identified as having or at risk of having a disease associated with dysregulation of the complement alternative pathway, for example by detecting complement levels or membrane-attack complex levels in the subject's blood and/or performing a genetic test for gene mutations of complement factors associated with the disease.

In certain embodiments, a method of inhibiting expression of Complement Factor B (CFB) in a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a Complement Factor B (CFB) specific inhibitor to the subject, thereby inhibiting expression of CFB in the subject. In certain embodiments, administering the inhibitor inhibits expression of CFB in the eye. In certain embodiments, the subject has, or is at risk of having, age related macular degeneration (AMD), such as wet AMD and dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, administering the inhibitor inhibits expression of CFB in the kidney, such as in the glomerulus. In certain embodiments, the subject has, or is at risk of having, lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430. In certain embodiments, the compound is administered to the subject parenterally.

In certain embodiments, a method of reducing or inhibiting accumulation of C3 deposits in the eye of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a Complement Factor B (CFB) specific inhibitor to the subject, thereby reducing or inhibiting accumulation of C3 deposits in the eye of the subject. In certain embodiments, the subject has, or is at risk of having, age related macular degeneration (AMD), such as wet AMD and dry

AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, the inhibitor is an antisense compound targeted to CFB. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430. In certain embodiments, the compound is administered to the subject parenterally.

In certain embodiments, a method of reducing or inhibiting accumulation of C3 deposits in the kidney of a subject having, or at risk of having, a disease associated with dysregulation of the complement alternative pathway comprises administering a Complement Factor B (CFB) specific inhibitor to the subject, thereby reducing or inhibiting accumulation of C3 deposits in the kidney of the subject. In certain embodiments, the subject has, or is at risk of having, lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof. In certain embodiments, the inhibitor is an antisense compound targeted to CFB. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598. In certain embodiments, the CFB specific inhibitor is a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430. In certain embodiments, the compound is administered to the subject parenterally.

Certain embodiments are drawn to a compound or composition described herein for use in therapy.

Certain embodiments are drawn to a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808 for use in therapy. Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808 for use in therapy. Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for use in therapy. Certain embodiments are drawn to a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430 for use in therapy.

Certain embodiments are drawn to a compound or composition described herein for use in treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808 for use in treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808 for use in treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for use in treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430 for use in treating a disease associated with dysregulation of the complement alternative pathway. In certain embodiments, the complement alternative pathway is activated greater than normal. In certain embodiments, the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.

Certain embodiments are drawn to a compound comprising or consisting of ISIS 588540, which has the following chemical structure:

, for use in treating a disease associated with dysregulation of the complement alternative pathway. In certain embodiments, the complement alternative pathway is activated greater than normal. In certain embodiments, the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.

Certain embodiments are drawn to use of a compound or composition described herein for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to use of a compound comprising or consisting of modified oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 6-808 for the manufacture of a medicament for treating disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to use of a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 6-808 for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to use of a compound comprising or consisting of a modified oligonucleotide consisting of 10 to 30 linked nucleosides having a nucleobase sequence comprising or consisting of any one of SEQ ID NOs: 198, 228, 237, 440, 444, 448, 450, 453, 455, 549, and 598, for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway. Certain embodiments are drawn to use of a compound comprising or consisting of ISIS 532770, 532800, 532809, 588540, 588544, 588548, 588550, 588553, 588555, 588848, or 594430 for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway. In certain embodiments, the complement alternative pathway is activated greater than normal. In certain embodiments, the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.

Certain embodiments are drawn to use of a compound comprising or consisting of ISIS 588540, which has the following chemical structure:

, for the manufacture of a medicament for treating a disease associated with dysregulation of the complement alternative pathway. In certain embodiments, the complement alternative pathway is activated greater than normal. In certain embodiments, the disease is macular degeneration, such as age related macular degeneration (AMD), which can be wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. In certain embodiments, the disease is a kidney disease such as lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.

In any of the foregoing embodiments, the CFB specific inhibitor can be an antisense compound targeted to CFB. In certain embodiments, the antisense compound comprises an antisense oligonucleotide, for example an antisense oligonucleotide consisting of 8 to 80 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the antisense oligonucleotide is at least 80%, 85%, 90%>, 95% or 100%) complementary to any of the nucleobase sequences recited in SEQ ID NOs: 1 -5. In certain embodiments, the antisense oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage, the modified sugar is a bicyclic sugar or a 2'-0-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5' wing segment consisting of linked nucleosides; and a 3' wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5' wing segment and the 3' wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the antisense oligonucleotide is administered parenterally. For example, in certain embodiments the antisense oligonucleotide can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

Antisense compounds

Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNAs. An oligomeric compound may be "antisense" to a target nucleic acid, meaning that is is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding.

In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense compound is 10 to 30 subunits in length. In certain embodiments, an antisense compound is 12 to 30 subunits in length. In certain embodiments, an antisense compound is 12 to 22 subunits in length. In certain embodiments, an antisense compound is 14 to 30 subunits in length. In certain embodiments, an antisense compound is 14 to 20 subunits in length. In certain embodiments, an antisense compoun is 15 to 30 subunits in length. In certain embodiments, an antisense compound is 15 to 20 subunits in length. In certain embodiments, an antisense compound is 16 to 30 subunits in length. In certain embodiments, an antisense compound is 16 to 20 subunits in length. In certain embodiments, an antisense compound is 17 to 30 subunits in length. In certain embodiments, an antisense compound is 17 to 20 subunits in length. In certain embodiments, an antisense compound is 18 to 30 subunits in length. In certain embodiments, an antisense compound is 18 to 21 subunits in length. In certain embodiments, an antisense compound is 18 to 20 subunits in length. In certain embodiments, an antisense compound is 20 to 30 subunits in length. In other words, such antisense compounds are from 12 to 30 linked subunits, 14 to 30 linked subunits, 14 to 20 subunits, 15 to 30 subunits, 15 to 20 subunits, 16 to 30 subunits, 16 to 20 subunits, 17 to 30 subunits, 17 to 20 subunits, 18 to 30 subunits, 18 to 20 subunits, 18 to 21 subunits, 20 to 30 subunits, or 12 to 22 linked subunits, respectively. In certain embodiments, an antisense compound is 14 subunits in length. In certain embodiments, an antisense compound is 16 subunits in length. In certain embodiments, an antisense compound is 17 subunits in length. In certain embodiments, an antisense compound is 18 subunits in length. In certain embodiments, an antisense compound is 19 subunits in length. In certain embodiments, an antisense compound is 20 subunits in length. In other embodiments, the antisense compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the antisense compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleotides.

In certain embodiments antisense oligonucleotides may be shortened or truncated. For example, a single subunit may be deleted from the 5' end (5' truncation), or alternatively from the 3' end (3' truncation). A shortened or truncated antisense compound targeted to an CFB nucleic acid may have two subunits deleted from the 5' end, or alternatively may have two subunits deleted from the 3' end, of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.

When a single additional subunit is present in a lengthened antisense compound, the additional subunit may be located at the 5' or 3' end of the antisense compound. When two or more additional subunits are present, the added subunits may be adjacent to each other, for example, in an antisense compound having two subunits added to the 5' end (5' addition), or alternatively to the 3' end (3' addition), of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added to the 5' end and one subunit added to the 3' end.

It is possible to increase or decrease the length of an antisense compound, such as an antisense oligonucleotide, and/or introduce mismatch bases without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992), a series of antisense oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Antisense oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the antisense oligonucleotides were able to direct specific cleavage of the target mRNA, albeit to a lesser extent than the antisense oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase antisense oligonucleotides, including those with 1 or 3 mismatches. Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 m NA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo.

Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358,1988) tested a series of tandem 14 nucleobase antisense oligonucleotides, and a 28 and 42 nucleobase antisense oligonucleotides comprised of the sequence of two or three of the tandem antisense oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase antisense oligonucleotides.

Certain Antisense Compound Motifs and Mechanisms

In certain embodiments, antisense compounds have chemically modified subunits arranged in patterns, or motifs, to confer to the antisense compounds properties such as enhanced inhibitory activity, increased binding affinity for a target nucleic acid, or resistance to degradation by in vivo nucleases.

Chimeric antisense compounds typically contain at least one region modified so as to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and/or increased inhibitory activity. A second region of a chimeric antisense compound may confer another desired property e.g., serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

Antisense activity may result from any mechanism involving the hybridization of the antisense compound (e.g., oligonucleotide) with a target nucleic acid, wherein the hybridization ultimately results in a biological effect. In certain embodiments, the amount and/or activity of the target nucleic acid is modulated. In certain embodiments, the amount and/or activity of the target nucleic acid is reduced. In certain embodiments, hybridization of the antisense compound to the target nucleic acid ultimately results in target nucleic acid degradation. In certain embodiments, hybridization of the antisense compound to the target nucleic acid does not result in target nucleic acid degradation. In certain such embodiments, the presence of the antisense compound hybridized with the target nucleic acid (occupancy) results in a modulation of antisense activity. In certain embodiments, antisense compounds having a particular chemical motif or pattern of chemical modifications are particularly suited to exploit one or more mechanisms. In certain embodiments, antisense compounds function through more than one mechanism and/or through mechanisms that have not been elucidated. Accordingly, the antisense compounds described herein are not limited by particular mechanism.

Antisense mechanisms include, without limitation, RNase H mediated antisense; RNAi mechanisms, which utilize the RISC pathway and include, without limitation, siRNA, ssRNA and microRNA mechanisms; and occupancy based mechanisms. Certain antisense compounds may act through more than one such mechanism and/or through additional mechanisms.

RNase H-Mediated Antisense

In certain embodiments, antisense activity results at least in part from degradation of target RNA by

RNase H. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. It is known in the art that single-stranded antisense compounds which are "DNA-like" elicit RNase H activity in mammalian cells. Accordingly, antisense compounds comprising at least a portion of DNA or DNA-like nucleosides may activate RNase H, resulting in cleavage of the target nucleic acid. In certain embodiments, antisense compounds that utilize RNase H comprise one or more modified nucleosides. In certain embodiments, such antisense compounds comprise at least one block of 1-8 modified nucleosides. In certain such embodiments, the modified nucleosides do not support RNase H activity. In certain embodiments, such antisense compounds are gapmers, as described herein. In certain such embodiments, the gap of the gapmer comprises DNA nucleosides. In certain such embodiments, the gap of the gapmer comprises DNA-like nucleosides. In certain such embodiments, the gap of the gapmer comprises DNA nucleosides and DNA-like nucleosides.

Certain antisense compounds having a gapmer motif are considered chimeric antisense compounds. In a gapmer an internal region having a plurality of nucleotides that supports RNaseH cleavage is positioned between external regions having a plurality of nucleotides that are chemically distinct from the nucleosides of the internal region. In the case of an antisense oligonucleotide having a gapmer motif, the gap segment generally serves as the substrate for endonuclease cleavage, while the wing segments comprise modified nucleosides. In certain embodiments, the regions of a gapmer are differentiated by the types of sugar moieties comprising each distinct region. The types of sugar moieties that are used to differentiate the regions of a gapmer may in some embodiments include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'- modified nucleosides (such 2'-modified nucleosides may include 2'-MOE and 2'-0-CH ₃ , among others), and bicyclic sugar modified nucleosides (such bicyclic sugar modified nucleosides may include those having a constrained ethyl). In certain embodiments, nucleosides in the wings may include several modified sugar moieties, including, for example 2'-MOE and bicyclic sugar moieties such as constrained ethyl or LNA. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2'-MOE nucleosides, bicyclic sugar moieties such as constrained ethyl nucleosides or LNA nucleosides, and 2'-deoxynucleosides.

Each distinct region may comprise uniform sugar moieties, variant, or alternating sugar moieties. The wing-gap-wing motif is frequently described as "X-Y-Z", where "X" represents the length of the 5'- wing, "Y" represents the length of the gap, and "Z" represents the length of the 3 '-wing. "X" and "Z" may comprise uniform, variant, or alternating sugar moieties. In certain embodiments, "X" and "Y" may include one or more 2'-deoxynucleosides."Y" may comprise 2'-deoxynucleosides. As used herein, a gapmer described as "X-Y-Z" has a configuration such that the gap is positioned immediately adjacent to each of the 5 '-wing and the 3' wing. Thus, no intervening nucleotides exist between the 5 '-wing and gap, or the gap and the 3 '-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, "X" and "Z" are the same; in other embodiments they are different. In certain embodiments, "Y" is between 8 and 15 nucleosides. X, Y, or Z can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30 or more nucleosides.

In certain embodiments, the antisense compound targeted to a CFB nucleic acid has a gapmer motif in which the gap consists of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 linked nucleosides.

In certain embodiments, the antisense oligonucleotide has a sugar motif described by Formula A as follows: (J) _m -(B) _n -(J) _p -(B) _r -(A) _t -(D) _g -(A) _v -(B) _w -(J) _x -(B) _y -(J) _z

wherein:

each A is independently a 2'-substituted nucleoside;

each B is independently a bicyclic nucleoside;

each J is independently either a 2' -substituted nucleoside or a 2'-deoxynucleoside;

each D is a 2'-deoxynucleoside;

m is 0-4; n is 0-2; p is 0-2; r is 0-2; t is 0-2; v is 0-2; w is 0-4; x is 0-2; y is 0-2; z is 0-4; g is 6-14; provided that:

at least one of m, n, and r is other than 0;

at least one of w and y is other than 0;

the sum of m, n, p, r, and t is from 2 to 5; and

the sum of v, w, x, y, and z is from 2 to 5. RNAi Compounds

In certain embodiments, antisense compounds are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single- stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). In certain embodiments, antisense compounds comprise modifications that make them particularly suited for such mechanisms.

i. ssRNA compounds

In certain embodiments, antisense compounds including those particularly suited for use as single- stranded RNAi compounds (ssRNA) comprise a modified 5 '-terminal end. In certain such embodiments, the 5 '-terminal end comprises a modified phosphate moiety. In certain embodiments, such modified phosphate is stabilized (e.g., resistant to degradation/cleavage compared to unmodified 5 '-phosphate). In certain embodiments, such 5 '-terminal nucleosides stabilize the 5 '-phosphorous moiety. Certain modified 5'- terminal nucleosides may be found in the art, for example in WO/201 1/139702.

In c 5 '-nucleoside of an ssRNA compound has Formula lie:

lie

wherein:

Ti is an optionally protected phosphorus moiety;

T ₂ is an internucleoside linking group linking the compound of Formula lie to the olig

compound;

A has o

Qi and (¾ are each, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy, substituted Ci-Ce alkoxy, C ₂ -C6 alkenyl, substituted C ₂ -C6 alkenyl, C ₂ -C6 alkynyl, substituted C ₂ -C6 alkynyl or N(R ₃ )(R4);

Q ₃ is O, S, N(R ₅ ) or C(R ₆ )(R ₇ );

each R ₃ , R4 R ₅ , R ₆ and R ₇ is, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl or Ci-Ce alkoxy; M ₃ is O, S, NR ₁₄ , C(R ₁₅ )(Ri ₆ ), C(R ₁₅ )(Ri6)C(R ₁₇ )(R ₁₈ ), C(R ₁₅ )=C(R ₁₇ ), OC(R ₁₅ )(Ri ₆ ) or

OC(R ₁₅ )(Bx ₂ );

Ri ₄ is H, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkoxy, substituted Ci-C ₆ alkoxy, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl;

Ri5, Ri ₆ , Ri7 and R _i8 are each, independently, H, halogen, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkoxy, substituted Ci-C ₆ alkoxy, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl;

Bx _! is a heterocyclic base moiety;

or if Bx ₂ is present then Bx ₂ is a heterocyclic base moiety and Bx _! is H, halogen, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkoxy, substituted Ci-C ₆ alkoxy, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ - Ce alkynyl or substituted C ₂ -C6 alkynyl; J4, J ₅ , ίβ and J ₇ are each, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy, substituted Ci-C ₆ alkoxy, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl;

or J ₄ forms a bridge with one of J ₅ or J ₇ wherein said bridge comprises from 1 to 3 linked biradical groups selected from O, S, NR ₁₉ , C(R ₂₀ )(R ₂ i), C(R ₂₀ )=C(R ₂₁ ), and C(=0) and the other two of J ₅ , J ₆ and J ₇ are each, independently, H, halogen, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkoxy, substituted Ci-C ₆ alkoxy, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl;

each R ₁₉ , R ₂₀ and R _2i is, independently, H, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, Ci-C ₆ alkoxy, substituted Ci-Ce alkoxy, C ₂ -C6 alkenyl, substituted C ₂ -C6 alkenyl, C ₂ -C6 alkynyl or substituted C ₂ -C6 alkynyl;

G is H, OH, halogen or 0-[C(R ₈ )(R ₉ )] _n -[(C=0) _m -Xi] _j -Z;

each R ₈ and R9 is, independently, H, halogen, Ci-Ce alkyl or substituted Ci-Ce alkyl;

Xi is O, S or N(Ei);

Z is H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C ₂ -C6 alkenyl, substituted C ₂ -C6 alkenyl, C ₂ -C6 alkynyl, substituted C ₂ -C6 alkynyl or N(E ₂ )(E ₃ );

Ei, E ₂ and E ₃ are each, independently, H, Ci-Ce alkyl or substituted Ci-Ce alkyl;

n is from 1 to about 6;

m is 0 or 1 ;

j is 0 or 1 ;

each substituted group comprises one or more optionally protected substituent groups independently selected from halogen, OJ _b N(Ji)(J ₂ ), =NJ _b SJ _b N ₃ , CN, OC(=X ₂ )Ji, OC(=X ₂ )N(Ji)(J ₂ ) and C(=X ₂ )N(Ji)(J ₂ );

X ₂ is O, S or NJ ₃ ;

each Ji, J ₂ and J ₃ is, independently, H or Ci-C ₆ alkyl;

when j is 1 then Z is other than halogen or N(E ₂ )(E ₃ ); and

wherein said oligomeric compound comprises from 8 to 40 monomelic subunits and is hybridizable to at least a portion of a target nucleic acid.

In certain embodiments, M ₃ is O, CH=CH, OCH ₂ or OC(H)(Bx ₂ ). In certain embodiments, M ₃ is O.

In certain embodiments, J4, J ₅ , J and J ₇ are each H. In certain embodiments, J4 forms a bridge with one of J ₅ or J ₇ .

In cert the formulas:

wherein: Qi and Q ₂ are each, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy or substituted Ci-C ₆ alkoxy. In certain embodiments, Qi and Q ₂ are each H. In certain embodiments, Qi and Q ₂ are each, independently, H or halogen. In certain embodiments, Qi and Q ₂ is H and the other of Qi and Q ₂ is F, CH ₃ or OCH ₃ .

In certain embodiments, Ti has the formula:

wherein:

R _a and R _c are each, independently, protected hydroxyl, protected thiol, Ci-Ce alkyl, substituted Ci-Ce alkyl, Ci-Ce alkoxy, substituted Ci-Ce alkoxy, protected amino or substituted amino; and

R _b is O or S. In certain embodiments, R _b is O and R _a and R _c are each, independently, OCH ₃ ,

OCH ₂ CH ₃ or CH(CH ₃ ) ₂ .

In certain embodiments, G is halogen, OCH ₃ , OCH ₂ F, OCHF ₂ , OCF ₃ , OCH ₂ CH ₃ , 0(CH ₂ ) ₂ F, OCH ₂ CHF ₂ , OCH ₂ CF ₃ , OCH ₂ -CH=CH ₂ , 0(CH ₂ ) ₂ -OCH ₃ , 0(CH ₂ ) ₂ -SCH ₃ , 0(CH ₂ ) ₂ -OCF ₃ , 0(CH ₂ ) ₃ - N(R ₁₀ )(R _U ), O(CH ₂ ) ₂ -ON(R ₁₀ )(R _u ), O(CH ₂ ) ₂ -O(CH ₂ ) ₂ -N(R ₁₀ )(R _u ), OCH ₂ C(=O)-N(R ₁₀ )(R _u ), OCH ₂ C(=0)- N(R ₁₂ )-(CH ₂ ) ₂ -N(R ₁₀ )(R _U ) or O(CH ₂ ) ₂ -N(R ₁₂ )-C(=NR ₁₃ )[N(R ₁₀ )(R _u )] wherein R ₁₀ , R _u , R ₁₂ and R ₁₃ are each, independently, H or C _r C ₆ alkyl. In certain embodiments, G is halogen, OCH ₃ , OCF ₃ , OCH ₂ CH ₃ , OCH ₂ CF ₃ , OCH ₂ -CH=CH ₂ , 0(CH ₂ ) ₂ -OCH ₃ , 0(CH ₂ ) ₂ -0(CH ₂ ) ₂ -N(CH ₃ ) ₂ , OCH ₂ C(=0)-N(H)CH ₃ , OCH ₂ C(=0)-N(H)- (CH ₂ ) ₂ -N(CH ₃ ) ₂ or OCH ₂ -N(H)-C(=NH)NH ₂ . In certain embodiments, G is F, OCH ₃ or 0(CH ₂ ) ₂ -OCH ₃ . In certain embodiments, G is 0(CH ₂ ) ₂ -OCH ₃ .

In c rminal nucleoside has Formula He:

He

In certain embodiments, antisense compounds, including those particularly suitable for ssRNA comprise one or more type of modified sugar moieties and/or naturally occurring sugar moieties arranged along an oligonucleotide or region thereof in a defined pattern or sugar modification motif. Such motifs may include any of the sugar modifications discussed herein and/or other known sugar modifications.

In certain embodiments, the oligonucleotides comprise or consist of a region having uniform sugar modifications. In certain such embodiments, each nucleoside of the region comprises the same RNA-like sugar modification. In certain embodiments, each nucleoside of the region is a 2'-F nucleoside. In certain embodiments, each nucleoside of the region is a 2'-OMe nucleoside. In certain embodiments, each nucleoside of the region is a 2'-MOE nucleoside. In certain embodiments, each nucleoside of the region is a cEt nucleoside. In certain embodiments, each nucleoside of the region is an LNA nucleoside. In certain embodiments, the uniform region constitutes all or essentially all of the oligonucleotide. In certain embodiments, the region constitutes the entire oligonucleotide except for 1-4 terminal nucleosides.

In certain embodiments, oligonucleotides comprise one or more regions of alternating sugar modifications, wherein the nucleosides alternate between nucleotides having a sugar modification of a first type and nucleotides having a sugar modification of a second type. In certain embodiments, nucleosides of both types are RNA-like nucleosides. In certain embodiments the alternating nucleosides are selected from: 2'-OMe, 2'-F, 2'-MOE, LNA, and cEt. In certain embodiments, the alternating modificatios are 2'-F and 2'- OMe. Such regions may be contiguous or may be interupted by differently modified nucleosides or conjugated nucleosides.

In certain embodiments, the alternating region of alternating modifications each consist of a single nucleoside (i.e., the patern is (AB) _x A _y wheren A is a nucleoside having a sugar modification of a first type and B is a nucleoside having a sugar modification of a second type; x is 1-20 and y is 0 or 1). In certan embodiments, one or more alternating regions in an alternating motif includes more than a single nucleoside of a type. For example, oligonucleotides may include one or more regions of any of the following nucleoside motifs:

AABBAA;

ABBABB;

AABAAB;

ABBABAABB;

ABABAA;

AABABAB;

ABABAA;

ABBAABBABABAA;

BABBAABBABABAA; or

AB ABBAABBABABAA;

wherein A is a nucleoside of a first type and B is a nucleoside of a second type. In certain embodiments, A and B are each selected from 2'-F, 2'-OMe, BNA, and MOE.

In certain embodiments, oligonucleotides having such an alternating motif also comprise a modified

5' terminal nucleoside, such as those of formula lie or He.

In certain embodiments, oligonucleotides comprise a region having a 2-2-3 motif. Such regions comprises the following motif:

-(A) ₂ -(B) _x -(A) ₂ -(C) _y -(A) ₃ - wherein: A is a first type of modifed nucleosde;

B and C, are nucleosides that are differently modified than A, however, B and C may have the same or different modifications as one another;

x and y are from 1 to 15.

In certain embodiments, A is a 2'-OMe modified nucleoside. In certain embodiments, B and C are both 2'-F modified nucleosides. In certain embodiments, A is a 2'-OMe modified nucleoside and B and C are both 2'-F modified nucleosides.

In certain embodiments, oligonucleosides have the following sugar motif:

5'- (Q)- (AB) _x A _y -(D) _z

wherein:

Q is a nucleoside comprising a stabilized phosphate moiety. In certain embodiments, Q is a nucleoside having Formula lie or He;

A is a first type of modifed nucleoside;

B is a second type of modified nucleoside;

D is a modified nucleoside comprising a modification different from the nucleoside adjacent to it. Thus, if y is 0, then D must be differently modified than B and if y is 1 , then D must be differently modified than A. In certain embodiments, D differs from both A and B.

X is 5-15;

Y is O or 1 ;

Z is 0-4.

In certain embodiments, oligonucleosides have the following sugar motif:

5'- (Q)- (A) _X -(D) _Z

wherein:

Q is a nucleoside comprising a stabilized phosphate moiety. In certain embodiments, Q is a nucleoside having Formula lie or He;

A is a first type of modifed nucleoside;

D is a modified nucleoside comprising a modification different from A.

X is 11-30;

Z is 0-4.

In certain embodiments A, B, C, and D in the above motifs are selected from: 2'-OMe, 2'-F, 2'- MOE, LNA, and cEt. In certain embodiments, D represents terminal nucleosides. In certain embodiments, such terminal nucleosides are not designed to hybridize to the target nucleic acid (though one or more might hybridize by chance). In certiain embodiments, the nucleobase of each D nucleoside is adenine, regardless of the identity of the nucleobase at the corresponding position of the target nucleic acid. In certain embodiments the nucleobase of each D nucleoside is thymine. In certain embodiments, antisense compounds, including those particularly suited for use as ssRNA comprise modified internucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or modified internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region having an alternating internucleoside linkage motif. In certain embodiments, oligonucleotides comprise a region of uniformly modified internucleoside linkages. In certain such embodiments, the oligonucleotide comprises a region that is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide is uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of the oligonucleotide is selected from phosphodiester and phosphorothioate and at least one internucleoside linkage is phosphorothioate.

In certain embodiments, the oligonucleotide comprises at least 6 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 8 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least 10 phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 6 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least one 12 consecutive phosphorothioate internucleoside linkages. In certain such embodiments, at least one such block is located at the 3 ' end of the oligonucleotide. In certain such embodiments, at least one such block is located within 3 nucleosides of the 3' end of the oligonucleotide.

Oligonucleotides having any of the various sugar motifs described herein, may have any linkage motif. For example, the oligonucleotides, including but not limited to those described above, may have a linkage motif selected from non-limiting the table below:

ii. siRNA compounds

In certain embodiments, antisense compounds are double-stranded RNAi compounds (siRNA). In such embodiments, one or both strands may comprise any modification motif described above for ssRNA. In certain embodiments, ssRNA compounds may be unmodified RNA. In certain embodiments, siRNA compounds may comprise unmodified RNA nucleosides, but modified internucleoside linkages.

Several embodiments relate to double-stranded compositions wherein each strand comprises a motif defined by the location of one or more modified or unmodified nucleosides. In certain embodiments, compositions are provided comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.

The compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function. In certain embodiments, the degradation of the targeted CFB is facilitated by an activated RISC complex that is formed with compositions of the invention.

Several embodiments are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In some embodiments, the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.

Certain embodiments are drawn to double-stranded compositions wherein both the strands comprises a hemimer motif, a fully modified motif, a positionally modified motif or an alternating motif. Each strand of the compositions of the present invention can be modified to fulfil a particular role in for example the siRNA pathway. Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand. Within this model, each strand can be independently modified such that it is enhanced for its particular role. The antisense strand can be modified at the 5'-end to enhance its role in one region of the RISC while the 3'-end can be modified differentially to enhance its role in a different region of the RISC.

The double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double-stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof). Alternatively, the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self- complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non- nucleic acid-based linker(s).

The double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.

In certain embodiments, the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions. In certain embodiments, the double-stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.

As used herein, double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides. In certain embodiments, the short interfering nucleic acid molecules lack 2'-hydroxy (2'-OH) containing nucleotides. In certain embodiments short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group). Such double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups. Optionally, double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics. For example, double-stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre -transcriptional level. In a non- limiting example, epigenetic regulation of gene expression by siRNA molecules of the invention can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).

It is contemplated that compounds and compositions of several embodiments provided herein can target CFB by a dsRNA-mediated gene silencing or RNAi mechanism, including, e.g., "hairpin" or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA. In various embodiments, the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. The dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule. In various embodiments, a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides. Alternatively, the dsRNA may include two different strands that have a region of complementarity to each other.

In various embodiments, both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides. In certain embodiments, the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence. In certain embodiments, the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75,100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA. In some embodiments, the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin. In other embodiments, the dsRNA has one or more single stranded regions or overhangs. In certain embodiments, RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.

In various embodiments, the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. In other embodiments, a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell. In yet other embodiments, the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.) Exemplary circular nucleic acids include lariat structures in which the free 5' phosphoryl group of a nucleotide becomes linked to the 2' hydroxyl group of another nucleotide in a loop back fashion.

In other embodiments, the dsRNA includes one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2' position contains a hydrogen or an hydroxyl group. In yet other embodiments, the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally- occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The dsRNAs may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.

In other embodiments, the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U.S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.

Occupancy

In certain embodiments, antisense compounds are not expected to result in cleavage or the target nucleic acid via RNase H or to result in cleavage or sequestration through the RISC pathway. In certain such embodiments, antisense activity may result from occupancy, wherein the presence of the hybridized antisense compound disrupts the activity of the target nucleic acid. In certain such embodiments, the antisense compound may be uniformly modified or may comprise a mix of modifications and/or modified and unmodified nucleosides.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

Nucleotide sequences that encode Complement Factor B (CFB) include, without limitation, the following: GENBANK Accession No. NM 001710.5 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No NW 001116486.1 truncated from nucleotides 536000 to 545000 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. XM 001113553.2 (incorporated herein as SEQ ID NO: 4), or GENBANK Accession No. NM 008198.2 (incorporated herein as SEQ ID NO: 5).

Hybridization

In some embodiments, hybridization occurs between an antisense compound disclosed herein and a CFB nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson- Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable with a CFB nucleic acid.

Complementarity

An antisense compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the antisense compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., antisense inhibition of a target nucleic acid, such as a CFB nucleic acid).

Non-complementary nucleobases between an antisense compound and a CFB nucleic acid may be tolerated provided that the antisense compound remains able to specifically hybridize to a target nucleic acid. Moreover, an antisense compound may hybridize over one or more segments of a CFB nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, the antisense compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a CFB nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an antisense compound with a target nucleic acid can be determined using routine methods.

For example, an antisense compound in which 18 of 20 nucleobases of the antisense compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an antisense compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of an antisense compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).

In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an antisense compound may be fully complementary to a CFB nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of an antisense compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the antisense compound. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the antisense compound. At the same time, the entire 30 nucleobase antisense compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

The location of a non-complementary nucleobase may be at the 5' end or 3' end of the antisense compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CFB nucleic acid, or specified portion thereof.

In certain embodiments, antisense compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a CFB nucleic acid, or specified portion thereof.

The antisense compounds provided also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of an antisense compound. In certain embodiments, the antisense compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the antisense compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are antisense compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The antisense compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, an antisense compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the antisense compounds described herein as well as compounds having non-identical bases relative to the antisense compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the antisense compound. Percent identity of an antisense compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

In certain embodiments, the antisense compounds, or portions thereof, are, or are at least 70%, 75%,

80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the antisense compounds or SEQ ID NOs, or a portion thereof, disclosed herein.

In certain embodiments, a portion of the antisense compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.

In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. Modifications

A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3' or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides.

Modified Internucleoside Linkages

The naturally occuring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, antisense compounds targeted to a CFB nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage.

Modified Sugar Moieties

Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substitutent groups (including 5' and 2' substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R), or C(Ri)(R ₂ ) (R, Ri and R ₂ are each independently H, C _r Ci ₂ alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on 8/21/08 for other disclosed 5',2'-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5'-substitution of a BNA (see PCT International Application WO 2007/134181 Published on 11/22/07 wherein LNA is substituted with for example a 5'-methyl or a 5'-vinyl group).

Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH ₃ , 2'-OCH ₂ CH ₃ , 2'-OCH ₂ CH ₂ F and - 0(CH ₂ ) ₂ OCH ₃ substituent groups. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-C _r Ci ₀ alkyl, OCF ₃ , OCH ₂ F, 0(CH ₂ ) ₂ SCH ₃ , 0(CH ₂ ) ₂ -0-N(R _m )(R _n ), 0-CH ₂ -C(=0)- N(R _m )(R _n ), and 0-CH ₂ -C(=0)-N(Ri)-(CH ₂ ) ₂ -N(R _m )(R _n ), where each ¾, R _m and R _n is, independently, H or substituted or unsubstituted Ci-Cio alkyl.

As used herein, "bicyclic nucleosides" refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4' to 2' bridge. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4'-(CH ₂ )-0-2' (LNA); 4'-(CH ₂ )-S-2'; 4'-(CH ₂ ) ₂ -0-2' (ENA); 4'-CH(CH ₃ )-0-2' (also referred to as constrained ethyl or cEt) and 4'-CH(CH ₂ OCH ₃ )- 0-2' (and analogs thereof see U.S. Patent 7,399,845, issued on July 15, 2008); 4'-C(CH ₃ )(CH ₃ )-0-2' (and analogs thereof see published International Application WO/2009/006478, published January 8, 2009); 4'- CH ₂ -N(OCH ₃ )-2' (and analogs thereof see published International Application WO/2008/150729, published December 11, 2008); 4'-CH ₂ -0-N(CH ₃ )-2' (see published U.S. Patent Application US2004-0171570, published September 2, 2004 ); 4'-CH ₂ -N(R)-0-2', wherein R is H, C _r Ci ₂ alkyl, or a protecting group (see U.S. Patent 7,427,672, issued on September 23, 2008); 4'-CH ₂ -C(H)(CH ₃ )-2' (see Chattopadhyaya et al, J. Org. Chem., 2009, 74, 118-134); and 4'-CH ₂ -C(=CH ₂ )-2' (and analogs thereof see published International Application WO 2008/154401, published on December 8, 2008).

Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al, Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al, Curr. Opinion Invest. Drugs, 2001, 2, 558-561 ; Braasch et al, Chem. Biol, 2001, 8, 1-7; and Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Patent Nos. 6,268,490; 6,525,191 ; 6,670,461 ; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281 ; U.S. Patent Serial Nos. 60/989,574; 61/026,995; 61/026,998; 61/056,564; 61/086,231 ; 61/097,787; and 61/099,844; Published PCT International applications WO 1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401 ; and WO 2009/006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example a-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on March 25, 1999 as WO 99/14226).

In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from - [C(R _a )(R _b )] _n -, -C(R _a )=C(R _b )-, -C(R _a )=N-, -C(=0)-, -C(=NR _a )-, -C(=S)-, -0-, -Si(R _a ) ₂ -, -S(=0) _x -, and -N(R _a )-; wherein:

x is 0, 1, or 2;

n is 1, 2, 3, or 4;

each R _a and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C ₂ -Ci ₂ alkenyl, substituted C ₂ -Ci ₂ alkenyl, C ₂ -Ci ₂ alkynyl, substituted C ₂ -Ci ₂ alkynyl, C ₅ -C ₂ o aryl, substituted C ₅ -C ₂₀ aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJiJ ₂ , SJi, N ₃ , COOJi, acyl (C(=0)- H), substituted acyl, CN, sulfonyl or sulfoxyl and

each J i and J ₂ is, independently, H, C ₁ -C ₁₂ alkyl, substituted C _r Ci ₂ alkyl, C ₂ -Ci ₂ alkenyl, substituted C ₂ -C ₁₂ alkenyl, C ₂ -C ₁₂ alkynyl, substituted C ₂ -C ₁₂ alkynyl, C ₅ -C ₂₀ aryl, substituted C ₅ -C ₂₀ aryl, acyl (C(=0)- H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C _r Ci ₂ aminoalkyl, substituted C ₁ -C ₁₂ aminoalkyl or a protecting group.

In certain embodiments, the bridge of a bicyclic sugar moiety is -[C(R _a )(R _b )] _n -, -[C(R _a )(R _b )] _n -0- , -C(R _a R _b )-N(R)-0- or -C(R _a R _b )-0-N(R)-. In certain embodiments, the bridge is 4'-CH ₂ -2', 4'-(CH ₂ ) ₂ -2', 4'- (CH ₂ ) ₃ -2', 4'-CH ₂ -0-2', 4'-(CH ₂ ) ₂ -0-2', 4'-CH ₂ -0-N(R)-2' and 4'-CH ₂ -N(R)-0-2'- wherein each R is, independently, H, a protecting group or C ₁ -C ₁₂ alkyl.

In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4 '-2' methylene-oxy bridge, may be in the a-L configuration or in the β- D configuration. Previously, a-L-methyleneoxy (4'-CH ₂ -0-2') BNA's have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al, Nucleic Acids Research, 2003, 21, 6365- 6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, (A) a-L-methyleneoxy (4'-CH ₂ -0-2') BNA , (B) β-D-methyleneoxy (4'-CH ₂ -0-2') BNA , (C) ethyleneoxy (4'-(CH ₂ ) ₂ -0-2') BNA , (D) aminooxy (4'-CH ₂ -0-N(R)-2') BNA, (E) oxyamino (4'-CH ₂ -N(R)-0-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH ₃ )-0-2') BNA, (G) methylene-thio (4'-CH ₂ -S-2') BNA, (H) methylene- amino (4'-CH ₂ -N(R)-2') BNA, (I) methyl carbocyclic (4'-CH ₂ -CH(CH ₃ )-2') BNA, (J) propylene carbocyclic (4'-(CH ₂ ) ₃ -2') BNA and (K) vinyl BNA as depicted below:

wherein Bx is the base moiety and R is independently H, a protecting group, C ₁ -C ₁₂ alkyl or C ₁ -C ₁₂ alkoxy.

odiments, bicyclic nucleosides are provided having Formula I:

wherein:

Bx is a heterocyclic base moiety;

-Q _a -Q _b -Q _c - is -CH ₂ -N(R _C )-CH ₂ -, -C(=0)-N(R _c )-CH ₂ -, -CH ₂ -0-N(R _c )-, -CH ₂ -N(R _c )-0- or -N(R _c )-0-

CH ₂ ;

R _c is C ₁ -C ₁₂ alkyl or an amino protecting group; and

T _a and T _b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium.

In certain embodiments, bicyclic nucleosides are provided having Formula II:

wherein:

Bx is a heterocyclic base moiety;

T _a and T _b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Z _a is Ci-C ₆ alkyl, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, substituted Ci-C ₆ alkyl, substituted C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio.

In one embodiment, each of the substituted groups is, independently, mono or poly substituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ _c , NJ _c J _d , SJ _C , N ₃ , OC(=X)J _c , and NJ _e C(=X)NJJ _d , wherein each J _c , J _d and J _e is, independently, H, Ci-C ₆ alkyl, or substituted Ci-C ₆ alkyl and X is O or NJ _C .

In certain embodiments, bicyclic nucleosides are provided having Formula III: wherein:

Bx is a heterocyclic base moiety;

T _a and T _b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

Z _b is Ci-Ce alkyl, C ₂ -C6 alkenyl, C ₂ -C6 alkynyl, substituted Ci-Ce alkyl, substituted C ₂ -C6 alkenyl, substituted C ₂ -C ₆ alkynyl or substituted acyl (C(=0)-).

In cert leosides are provided having Formula IV:

wherein:

Bx is a heterocyclic base moiety;

T _a and T _b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

¾ is Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl;

each q _a , q _b , q _c and q is, independently, H, halogen, Ci-Ce alkyl, substituted Ci-Ce alkyl, C ₂ -C6 alkenyl, substituted C ₂ -C6 alkenyl, C ₂ -C6 alkynyl or substituted C ₂ -C6 alkynyl, Ci-Ce alkoxyl, substituted Cp Ce alkoxyl, acyl, substituted acyl, Ci-Ce aminoalkyl or substituted Ci-Ce aminoalkyl;

In certain embodiments, bicyclic nucleosides are provided having Formula V: wherein:

Bx is a heterocyclic base moiety;

T _a and T _b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

q _a , ¾b, q _e and q _f are each, independently, hydrogen, halogen, C1-C12 alkyl, substituted alkyl, C ₂ - C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C1-C12 alkoxy, substituted C1-C12 alkoxy, OJ _j , SJ _j , SOJ _j , S0 ₂ J _j , NJ _j J _k , N ₃ , CN, C(=0)OJ _j , C(=0)NJ _j J _k , C(=0)J _j , 0-C(=0)NJ _j J _k , N(H)C(=NH)NJ _j J _k , N(H)C(=0)NJ _j J _k or N(H)C(=S)NJ _j J _k ;

or q _e and q _f together are =C(q _g )(q _h );

q _g and q _h are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

The synthesis and preparation of the methyleneoxy (4'-CH ₂ -0-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, along with their oligomerization, and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). BNAs and preparation thereof are also described in WO 98/39352 and WO 99/14226.

Analogs of methyleneoxy (4'-CH ₂ -0-2') BNA and 2'-thio-BNAs, have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). Preparation of locked nucleoside analogs comprising oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99/14226 ). Furthermore, synthesis of 2'-amino-BNA, a novel comformationally restricted high-affinity oligonucleotide analog has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA's have been prepared and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

lic nucleosides are provided having Formula VI:

wherein:

Bx is a heterocyclic base moiety;

T _a and T _b are each, independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety or a covalent attachment to a support medium;

each q _; , q,-, q _k and qi is, independently, H, halogen, C1-C12 alkyl, substituted C1-C12 alkyl, C ₂ -Ci ₂ alkenyl, substituted C ₂ -Ci ₂ alkenyl, C ₂ -C ₁₂ alkynyl, substituted C ₂ -C ₁₂ alkynyl, C _r Ci ₂ alkoxyl, substituted C _r C ₁₂ alkoxyl, OJ _j , SJ _j , SOJ _j , S0 ₂ J _j , NJ _j J _k , N ₃ , CN, C(=0)OJ _j , C(=0)NJ _j J _k , C(=0)J _j , 0-C(=0)NJ _j J _k , N(H)C(=NH)NJ _j J _k , N(H)C(=0)NJ _j J _k orN(H)C(=S)NJ _j J _k ; and

q _; and q,- or q _! and q _k together are =C(q _g )(q _h ), wherein q _g and q _h are each, independently, H, halogen, C1-C12 alkyl or substituted C1-C12 alkyl.

One carbocyclic bicyclic nucleoside having a 4'-(CH ₂ )3-2' bridge and the alkenyl analog bridge 4'- CH=CH-CH ₂ -2' have been described (Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al, J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described (Srivastava et al, J. Am. Chem. Soc, 2007, 129(26), 8362-8379).

As used herein, "4'-2' bicyclic nucleoside" or "4' to 2' bicyclic nucleoside" refers to a bicyclic nucleoside comprising a furanose ring comprising a bridge connecting two carbon atoms of the furanose ring connects the 2' carbon atom and the 4' carbon atom of the sugar ring.

As used herein, "monocytic nucleosides" refer to nucleosides comprising modified sugar moieties that are not bicyclic sugar moieties. In certain embodiments, the sugar moiety, or sugar moiety analogue, of a nucleoside may be modified or substituted at any position.

As used herein, "2 '-modified sugar" means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include substituents selected from: a halide, including, but not limited to substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted amino alkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2' modifications are selected from substituents including, but not limited to: 0[(CH ₂ ) _n O] _m CH ₃ , 0(CH ₂ ) _n NH ₂ , 0(CH ₂ ) _n CH ₃ , 0(CH ₂ ) _n F, 0(CH ₂ ) _n ONH ₂ , OCH ₂ C(=0)N(H)CH _3, and 0(CH ₂ ) _n ON[(CH ₂ ) _n CH ₃ ] ₂ , where n and m are from 1 to about 10. Other - substituent groups can also be selected from: C1-C12 alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH ₃ , OCN, CI, Br, CN, F, CF ₃ , OCF ₃ , SOCH ₃ , S0 ₂ CH ₃ , ON0 ₂ , N0 ₂ , N ₃ , NH ₂ , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, or a group for improving the pharmacodynamic properties of an antisense compound, and other substituents having similar properties. In certain embodiments, modifed nucleosides comprise a 2'-MOE side chain (Baker et al, J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitution have been described as having improved binding affinity compared to unmodified nucleosides and to other modified nucleosides, such as 2'- O- methyl, O-propyl, and 0-aminopropyl. Oligonucleotides having the 2'-MOE substituent also have been shown to be antisense inhibitors of gene expression with promising features for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

As used herein, a "modified tetrahydropyran nucleoside" or "modified THP nucleoside" means a nucleoside having a six-membered tetrahydropyran "sugar" substituted in for the pentofuranosyl residue in normal nucleosides (a sugar surrogate). Modified THP nucleosides include, but are not limited to, what is referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), manitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854) or fluoro HNA (F-HNA) having a tetrahydropyran ring system as illustrated below:

In certain embo es are selected having Formula VII:

VII

wherein independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII:

Bx is a heterocyclic base moiety;

T _a and T _b are each, independently, an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound or one of T _a and T _b is an internucleoside linking group linking the tetrahydropyran nucleoside analog to the antisense compound and the other of T _a and T _b is H, a hydroxyl protecting group, a linked conjugate group or a 5' or 3'-terminal group;

qi, ¾2, ¾3, ¾4, ¾5, ¾6 and q ₇ are each independently, H, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, C ₂ -C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl or substituted C ₂ -C ₆ alkynyl; and each of Ri and R ₂ is selected from hydrogen, hydroxyl, halogen, subsitituted or unsubstituted alkoxy, NJiJ ₂ , SJi, N ₃ ,

OC(=X)NJ _! J ₂ , NJ ₃ C(=X)NJ _! J ₂ and CN, wherein X is O, S or NJi and each J _b J ₂ and J ₃ is, independently, H or

C _r C ₆ alkyl.

In certain embodiments, the modified THP nucleosides of Formula VII are provided wherein q _b q ₂ , q ₃ , q ₄ , q ₅ , q ₆ and q ₇ are each H. In certain embodiments, at least one of qi, q ₂ , q ₃ , q ₄ , q ₅ , q ₆ and q ₇ is other than H. In certain embodiments, at least one of qi, q ₂ , q ₃ , q ₄ , q ₅ , q ₆ and q ₇ is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of Ri and R ₂ is fluoro. In certain embodiments, Ri is fluoro and R ₂ is H; R _t is methoxy and R ₂ is H, and Ri is methoxyethoxy and R ₂ is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example nucleosides comprising morpholino sugar moieties and their use in oligomeric compounds has been reported (see for example: Braasch et al, Biochemistry, 2002, 41, 4503-4510; and U.S. Patents 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used here, the term "morpholino" means a sugar llowing formula:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as "modifed morpholinos."

Combinations of modifications are also provided without limitation, such as 2'-F-5 '-methyl substituted nucleosides (see PCT International Application WO 2008/101157 published on 8/21/08 for other disclosed 5', 2'-bis substituted nucleosides) and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2'-position (see published U.S. Patent Application US2005-0130923, published on June 16, 2005) or alternatively 5 '-substitution of a bicyclic nucleic acid (see PCT International Application WO 2007/134181, published on 11/22/07 wherein a 4'-CH ₂ -0-2' bicyclic nucleoside is further substituted at the 5' position with a 5'-methyl or a 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides along with their oligomerization and biochemical studies have also been described {see, e.g., Srivastava et al, J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

In certain embodiments, antisense compounds comprise one or more modified cyclohexenyl nucleosides, which is a nucleoside having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to those described in the art (see for example commonly owned, published PCT Application WO 2010/036696, published on April 10, 2010, Robeyns et al, J. Am. Chem. Soc, 2008, 130(6), 1979-1984; Horvath et al, Tetrahedron Letters, 2007, 48, 3621-3623; Nauwelaerts et al, J. Am. Chem. Soc, 2007, 129(30), 9340-9348; Gu et al.,, Nucleosides, Nucleotides & Nucleic Acids, 2005, 24(5-7), 993-998; Nauwelaerts et al, Nucleic Acids Research, 2005, 33(8), 2452-2463; Robeyns et al., Acta Crystallographica, Section F: Structural Biology and Crystallization Communications, 2005, F61(6), 585-586; Gu et al, Tetrahedron, 2004, 60(9), 2111-2123; Gu et al, Oligonucleotides, 2003, 13(6), 479-489; Wang et al, J. Org. Chem., 2003, 68, 4499- 4505; Verbeure et al, Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al, J. Org. Chem., 2001, 66, 8478-82; Wang et al, Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al, J. Am. Chem., 2000, 122, 8595-8602; Published PCT application, WO 06/047842; and Published PCT Application WO 01/049687; the text of each is incorporated by reference herein, in their entirety). Certain modified cyclo e Formula X.

X

wherein independently for each of said at least one cyclohexenyl nucleoside analog of Formula X: Bx is a heterocyclic base moiety;

T ₃ and T ₄ are each, independently, an internucleoside linking group linking the cyclohexenyl nucleoside analog to an antisense compound or one of T ₃ and T ₄ is an internucleoside linking group linking the tetrahydropyran nucleoside analog to an antisense compound and the other of T ₃ and T ₄ is H, a hydroxyl protecting group, a linked conjugate group, or a 5'-or 3'-terminal group; and

qi, ¾2, ¾3, ¾4, ¾5, ¾6, ¾7, ¾8 and q ₉ are each, independently, H, Ci-C ₆ alkyl, substituted Ci-C ₆ alkyl, C ₂ - C ₆ alkenyl, substituted C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, substituted C ₂ -C ₆ alkynyl or other sugar substituent group.

As used herein, "2'-modified" or "2 '-substituted" refers to a nucleoside comprising a sugar comprising a substituent at the 2' position other than H or OH. 2 '-modified nucleosides, include, but are not limited to, bicyclic nucleosides wherein the bridge connecting two carbon atoms of the sugar ring connects the 2' carbon and another carbon of the sugar ring; and nucleosides with non-bridging 2'substituents, such as allyl, amino, azido, thio, O-allyl, O-C Ci ₀ alkyl, -OCF ₃ , 0-(CH ₂ ) ₂ -0-CH ₃ , 2'-0(CH ₂ ) ₂ SCH ₃ , 0-(CH ₂ ) ₂ -0- N(R _m )(R _n ), or where each R _m and R _n is, independently, H or substituted or unsubstituted Ci-Cio alkyl. 2'-modifed nucleosides may further comprise other modifications, for example at other positions of the sugar and/or at the nucleobase.

As used herein, "2'-F" refers to a nucleoside comprising a sugar comprising a fluoro group at the 2' position of the sugar ring.

As used herein, "2'-OMe" or "2'-OCH ₃ " or "2'-0-methyl" each refers to a nucleoside comprising a sugar comprising an -OCH ₃ group at the 2' position of the sugar ring.

As used herein, "MOE" or "2'-MOE" or "2'-OCH ₂ CH ₂ OCH ₃ " or "2'-0-methoxyethyl" each refers to a nucleoside comprising a sugar comprising a -OCH ₂ CH ₂ OCH ₃ group at the 2' position of the sugar ring.

As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides is modified. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and/or deoxyribonucleosides (DNA). Many other bicyclo and tricyclo sugar surrogate ring systems are also known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see for example review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various additional substitutions to enhance activity.

Methods for the preparations of modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include without limitation, U.S.: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,670,633; 5,700,920; 5,792,847 and 6,600,032 and International Application PCT/US2005/019219, filed June 2, 2005 and published as WO 2005/121371 on December 22, 2005, and each of which is herein incorporated by reference in its entirety.

In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

In certain embodiments, antisense compounds comprise one or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2' -MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH ₃ )-0-2') bridging group. In certain embodiments, the (4'- CH(CH ₃ )-0-2') modified nucleosides are arranged throughout the wings of a gapmer motif. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds. Modified nucleobases include synthetic and natural nucleobases such as, for example, 5- methylcytosine (5-me-C). Certain nucleobase substitutions, including 5-methylcytosine substitutions, are particularly useful for increasing the binding affinity of an antisense compound for a target nucleic acid. For example, 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

Additional modified nucleobases include 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8- azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.

Heterocyclic base moieties can also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Nucleobases that are particularly useful for increasing the binding affinity of antisense compounds include 5- substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2 aminopropyladenine, 5-propynyluracil and 5-propynylcytosine.

In certain embodiments, antisense compounds targeted to a CFB nucleic acid comprise one or more modified nucleobases. In certain embodiments, shortened or gap-widened antisense oligonucleotides targeted to a CFB nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

Conjugated Antisense compounds

Antisense compounds may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides. Typical conjugate groups include cholesterol moieties and lipid moieties. Additional conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.

Antisense compounds can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of antisense compounds to enhance properties such as, for example, nuclease stability. Included in stabilizing groups are cap structures. These terminal modifications protect the antisense compound having terminal nucleic acid from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5'-cap), or at the 3'-terminus (3'- cap), or can be present on both termini. Cap structures are well known in the art and include, for example, inverted deoxy abasic caps. Further 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an antisense compound to impart nuclease stability include those disclosed in WO 03/004602 published on January 16, 2003.

In certain embodiments, antisense compounds, including, but not limited to those particularly suited for use as ssRNA, are modified by attachment of one or more conjugate groups. In general, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, cellular distribution, cellular uptake, charge and clearance. Conjugate groups are routinely used in the chemical arts and are linked directly or via an optional conjugate linking moiety or conjugate linking group to a parent compound such as an oligonucleotide. Conjugate groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins and dyes. Certain conjugate groups have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium l,2-di-0-hexadecyl-rac-glycero-3-H- phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

For additional conjugates including those useful for ssRNA and their placement within antisense compounds, see e.g., US Application No.; 61/583,963.

In vitro testing of antisense oligonucleotides

Described herein are methods for treatment of cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

Cells may be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluency in culture.

One reagent commonly used to introduce antisense oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides may be mixed with LIPOFECTIN in OPTI-MEM 1 (Invitrogen, Carlsbad, CA) to achieve the desired final concentration of antisense oligonucleotide and a LIPOFECTIN concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another reagent used to introduce antisense oligonucleotides into cultured cells includes LIPOFECTAMINE (Invitrogen, Carlsbad, CA). Antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM 1 reduced serum medium (Invitrogen, Carlsbad, CA) to achieve the desired concentration of antisense oligonucleotide and a LIPOFECTAMINE concentration that may range from 2 to 12 ug/mL per 100 nM antisense oligonucleotide.

Another technique used to introduce antisense oligonucleotides into cultured cells includes electroporation. Yet another technique used to introduce antisense oligonucleotides into cultured cells includes free uptake of the oligonucleotides by the cells.

Cells are treated with antisense oligonucleotides by routine methods. Cells may be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of target nucleic acids are measured by methods known in the art and described herein. In general, when treatments are performed in multiple replicates, the data are presented as the average of the replicate treatments.

The concentration of antisense oligonucleotide used varies from cell line to cell line. Methods to determine the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. Antisense oligonucleotides are used at higher concentrations ranging from 625 to 20,000 nM when transfected using electroporation.

RNA Isolation

RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.

Certain Indications

Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a disease associated with dysregulation of the complement alternative pathway in a subject by administration of a CFB specific inhibitor, such as an antisense compound targeted to CFB.

Examples of renal diseases associated with dysregulation of the complement alternative pathway treatable, preventable, and/or ameliorable with the methods provided herein include C3 glomerulopathy, atypical hemolytic uremic syndrome (aHUS), dense deposit disease (DDD; also known as MPGN Type II or C3Neph), and CFHR5 nephropathy.

Additional renal diseases associated with dysregulation of the complement alternative pathway treatable, preventable, and/or ameliorable with the methods provided herein include IgA nephropathy; mesangiocapillary (membranoproliferative) glomerulonephritis (MPGN); autoimmune disorders including lupus nephritis and systemic lupus erythematosus (SLE); infection-induced glomerulonephritis (also known as Postinfectious glomerulonephritis); and renal ischemia-reperfusion injury, for example post-transplant renal ischemia-reperfusion injury. Examples of non-renal disorders associated with dysregulation of the complement alternative pathway treatable and/or preventable with the methods provided herein include ocular diseases such as macular degeneration, for example age-related macular degeneration (AMD), including wet AMD and dry AMD, such as Geographic Atrophy; neuromyelitis optica; corneal disease, such as corneal inflammation; autoimmune uveitis; and diabetic retinopathy. It has been reported that complement system is involved in ocular diseases. Jha P, et al., Mol Immunol (2007) 44(16): 3901-3908. Additional examples of non-renal disorders associated with dysregulation of the complement alternative pathway treatable and/or preventable with the methods provided herein include ANCA-assocaited vasculitis, antiphospholipid syndrome (also known as antiphospholipid antibody syndrome (APS)), asthma, rheumatoid arthritis, Myasthenia Gravis, and multiple sclerosis.

Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating a renal disease associated with dysregulation of the complement alternative pathway in a subject by administration of a CFB specific inhibitor, such as an antisense compound targeted to CFB. In certain embodiments, the renal disease is lupus nephritis, systemic lupus erythematosus (SLE), dense deposit disease (DDD), C3 glomerulonephritis (C3GN), CFHR5 nephropathy, or atypical hemolytic uremic syndrome (aHUS), or any combination thereof.

Certain embodiments provided herein relate to methods of treating, preventing, or ameliorating macular degeneration, such as age-related macular degeneration (AMD), in a subject by administration of a CFB specific inhibitor, such as an antisense compound targeted to CFB. In certain embodiments, the AMD is wet AMD or dry AMD. In certain embodiments, dry AMD can be Geographic Atrophy. Studies have demonstrated the association of complement alternative pathway dysregulation and AMD. Complement components are common constituents of ocular drusen, the extracellular material that accumulates in the macula of AMD patients. Furthermore, it has been reported that CFH and CFB variants account for nearly 75% of AMD cases in northern Europe and North America. It has also been found that a specific CFB polymorphism confers protection against AMD. Patel, N. et al., Eye (2008) 22(6):768-76. Additionally, CFB homozygous null mice have lower complement pathway activity, exhibit smaller ocular lesions, and choroidal neovascularization (CNV) after laser photocoagulation. Rohrer, B. et al., Invest Ophthalmol Vis Sci. (2009) 50(7):3056-64. Furthermore, CFB siRNA treatment protects mice from laser induced CNV. Bora, NS et al., J Immunol. (2006) 177(3): 1872-8. Studies have also shown that the kidney and eye share developmental pathways and structural features including basement membrane collagen IV protomer composition and vascularity. Savige et al., J Am Soc Nephrol. (2011) 22(8): 1403-15. There is evidence that the complement pathway is involved in renal and ocular diseases. For instance, inherited complement regulatory protein deficiency causes predisposition to atypical hemolytic uremic syndrome and AMD. Richards A et al., Adv Immunol. (2007) 96: 141-77. Additionally, chronic kidney disease has been associated with AMD. Nitsch, D. et al., Ophthalmic Epidemiol. (2009) 16(3): 181-6; Choi, J. et al, Ophthalmic Epidemiol. (2011) 18(6):259-63. Dense deposit disease (DDD), a kidney disease associated with dysregulated complement alternative pathway, is characterized by acute nephritic syndrome and ocular drusen. Cruz and Smith, GeneReviews (2007) Jul 20. Moreover, mice harboring genetic deletion of a component of the complement alternative pathway have coexisting renal and ocular disease phenotypes. It has been reported that CFH homozygous null mice develop DDD and present retinal abnormalities and visual dysfunction. Pickering et al., Nat Genet. (2002) 31(4):424-8. Mouse models of renal diseases associated with dysregulation of the complement alternative pathway are also accepted as models of AMD. Pennesi ME et al., Mol Apects Med (2012) 33:487-509. CFH null mice, for example, are an accepted model for renal diseases, such as DDD, and AMD. Furthermore, it has been reported that AMD is associated with the systemic source of complement factors, which accumulate locally in the eye to drive alternative pathway complement activation. Loyet et al., Invest Ophthalmol Vis Sci. (2012) 53(10):6628-37.

EXAMPLES Non-limiting disclosure and incorporation by reference

While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, antisense compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Antisense compounds described by Isis Number (Isis No) indicate a combination of nucleobase sequence and motif.

Example 1 : Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells by MOE gapmers

Antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB m NA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 (forward sequence AGTCTCTGTGGCATGGTTTGG, designated herein as SEQ ID NO: 810; reverse sequence GGGCGAATGACTGAGATCTTG, designated herein as SEQ ID NO: 811 ; probe sequence TACCGATTACCACAAGCAACCATGGCA, designated herein as SEQ ID NO: 812) was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 1

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and 2

SEQ SEQ SEQ SEQ ID ID ID ID

SEQ

ISIS NO: NO: Target % NO: NO:

Sequence ID NO 1 1 Region inhibition 2 2

NO: start stop start stop site site site site

532608 20 39 Exon 1 GCTGAGCTGCCAGTCAAGGA 36 1741 1760 6

532609 26 45 Exon 1 GGCCCCGCTGAGCTGCCAGT 16 1747 1766 7

532610 45 64 Exon 1 CGGAACATCCAAGCGGGAGG 11 1766 1785 8

532611 51 70 Exon 1 CTTTCCCGGAACATCCAAGC 26 1772 1791 9

532612 100 119 Exon 1 ATCTGTGTTCTGGCACCTGC 25 1821 1840 10

532613 148 167 Exon 1 GTCACATTCCCTTCCCCTGC 39 1869 1888 11

532614 154 173 Exon 1 GACCTGGTCACATTCCCTTC 71 1875 1894 12

532615 160 179 Exon 1 GACCTAGACCTGGTCACATT 35 1881 1900 13

532616 166 185 Exon 1 ACTCCAGACCTAGACCTGGT 39 1887 1906 14

532617 172 191 Exon 1 GCTGAAACTCCAGACCTAGA 27 1893 1912 15

532618 178 197 Exon 1 GTCCAAGCTGAAACTCCAGA 29 1899 1918 16

532619 184 203 Exon 1 CTCAGTGTCCAAGCTGAAAC 21 1905 1924 17

532620 246 265 Exon 1 AGGAGAGAAGCTGGGCCTGG 31 1967 1986 18 532621 252 271 Exon 1 GAAGGCAGGAGAGAAGCTGG 25 1973 1992 19

Exon 1-

532622 336 355 2 GTGGTGGTCACACCTCCAGA 28 n/a n/a 20

Junction

532623 381 400 Exon 2 CCCTCCAGAGAGCAGGATCC 22 2189 2208 21

532624 387 406 Exon 2 TCTACCCCCTCCAGAGAGCA 37 2195 2214 22

532625 393 412 Exon 2 TTGATCTCTACCCCCTCCAG 30 2201 2220 23

532626 417 436 Exon 2 TGGAGAAGTCGGAAGGAGCC 35 2225 2244 24

532627 423 442 Exon 2 CCCTCTTGGAGAAGTCGGAA 37 2231 2250 25

532628 429 448 Exon 2 GCCTGGCCCTCTTGGAGAAG 0 2237 2256 26

532629 435 454 Exon 2 TCCAGTGCCTGGCCCTCTTG 26 2243 2262 27

532630 458 477 Exon 2 AGAAGCCAGAAGGACACACG 30 2266 2285 28

532631 464 483 Exon 2 ACGGGTAGAAGCCAGAAGGA 43 2272 2291 29

532632 480 499 Exon 2 CGTGTCTGCACAGGGTACGG 57 2288 2307 30

532633 513 532 Exon 2 AGGGTGCTCCAGGACCCCGT 27 2321 2340 31

Exon 2-

532634 560 579 3 TTGCTCTGCACTCTGCCTTC 41 n/a n/a 32

Junction

532635 600 619 Exon 3 TATTCCCCGTTCTCGAAGTC 67 2808 2827 33

532636 626 645 Exon 3 CATTGTAGTAGGGAGACCGG 24 2834 2853 34

532637 632 651 Exon 3 CACTCACATTGTAGTAGGGA 49 2840 2859 35

532638 638 657 Exon 3 TCTCATCACTCACATTGTAG 50 2846 2865 36

532639 644 663 Exon 3 AAGAGATCTCATCACTCACA 52 2852 2871 37

532640 650 669 Exon 3 AGTGGAAAGAGATCTCATCA 34 2858 2877 38

532641 656 675 Exon 3 CATAGCAGTGGAAAGAGATC 32 2864 2883 39

532642 662 681 Exon 3 AACCGTCATAGCAGTGGAAA 45 2870 2889 40

532643 668 687 Exon 3 GAGTGTAACCGTCATAGCAG 36 2876 2895 41

532644 674 693 Exon 3 CCCGGAGAGTGTAACCGTCA 30 2882 2901 42

532645 680 699 Exon 3 CAGAGCCCCGGAGAGTGTAA 27 2888 2907 43

532646 686 705 Exon 3 GATTGGCAGAGCCCCGGAGA 20 2894 2913 44

532647 692 711 Exon 3 AGGTGCGATTGGCAGAGCCC 28 2900 2919 45

532648 698 717 Exon 3 CTTGGCAGGTGCGATTGGCA 24 2906 2925 46

532649 704 723 Exon 3 CATTCACTTGGCAGGTGCGA 28 2912 2931 47

532650 729 748 Exon 3 ATCGCTGTCTGCCCACTCCA 44 2937 2956 48

532651 735 754 Exon 3 TCACAGATCGCTGTCTGCCC 44 2943 2962 49

532652 741 760 Exon 3 CCGTTGTCACAGATCGCTGT 27 2949 2968 50

Exon 3-

532653 747 766 4 CCCGCTCCGTTGTCACAGAT 28 n/a n/a 51

Junction

Exon 3-

532654 753 772 4 CAGTACCCCGCTCCGTTGTC 13 n/a n/a 52

Junction

Exon 3-

532655 759 778 4 TTGGAGCAGTACCCCGCTCC 8 n/a n/a 53

Junction 532656 789 808 Exon 4 ACCTTCCTTGTGCCAATGGG 40 3152 3171 54

532657 795 814 Exon 4 CTGCCCACCTTCCTTGTGCC 41 3158 3177 55

532658 818 837 Exon 4 CGCTGTCTTCAAGGCGGTAC 33 3181 3200 56

532659 835 854 Exon 4 GCTGCAGTGGTAGGTGACGC 32 3198 3217 57

532660 841 860 Exon 4 CCCCCGGCTGCAGTGGTAGG 17 3204 3223 58

532661 847 866 Exon 4 GGTAAGCCCCCGGCTGCAGT 28 3210 3229 59

532662 853 872 Exon 4 ACGCAGGGTAAGCCCCCGGC 13 3216 3235 60

532663 859 878 Exon 4 GGAGCCACGCAGGGTAAGCC 33 3222 3241 61

532664 866 885 Exon 4 GCCGCTGGGAGCCACGCAGG 10 3229 3248 62

532665 891 910 Exon 4 CAAGAGCCACCTTCCTGACA 17 3254 3273 63

532666 897 916 Exon 4 CCGCTCCAAGAGCCACCTTC 25 3260 3279 64

532667 903 922 Exon 4 TCCGTCCCGCTCCAAGAGCC 29 3266 3285 65

532668 909 928 Exon 4 GAAGGCTCCGTCCCGCTCCA 14 3272 3291 66

532669 915 934 Exon 4 TGGCAGGAAGGCTCCGTCCC 18 3278 3297 67

Exon 4-

532670 921 940 5 GAGTCTTGGCAGGAAGGCTC 20 n/a n/a 68

Junction

Exon 4-

532671 927 946 5 ATGAAGGAGTCTTGGCAGGA 14 n/a n/a 69

Junction

532672 956 975 Exon 5 CTTCGGCCACCTCTTGAGGG 45 3539 3558 70

532673 962 981 Exon 5 GGAAAGCTTCGGCCACCTCT 37 3545 3564 71

532674 968 987 Exon 5 AAGACAGGAAAGCTTCGGCC 28 3551 3570 72

532675 974 993 Exon 5 TCAGGGAAGACAGGAAAGCT 16 3557 3576 73

532676 996 1015 Exon 5 TCGACTCCTTCTATGGTCTC 31 3579 3598 74

Exon 5-

532677 1033 1052 6 CTTCTGTTGTTCCCCTGGGC 36 n/a n/a 75

Junction

532678 1068 1087 Exon 6 TTCATGGAGCCTGAAGGGTC 19 3752 3771 76

532679 1074 1093 Exon 6 TAGATGTTCATGGAGCCTGA 24 3758 3777 77

532680 1080 1099 Exon 6 ACCAGGTAGATGTTCATGGA 13 3764 3783 78

532681 1086 1105 Exon 6 TCTAGCACCAGGTAGATGTT 20 3770 3789 79

532682 1092 1111 Exon 6 GATCCATCTAGCACCAGGTA 33 3776 3795 80

532683 1098 1117 Exon 6 CTGTCTGATCCATCTAGCAC 44 3782 3801 81

532684 1104 1123 Exon 6 CCAATGCTGTCTGATCCATC 29 3788 3807 82

532685 1129 1148 Exon 6 TTTGGCTCCTGTGAAGTTGC 40 3813 3832 83

Table 2

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and 2

SEQ SEQ SEQ SEQ

ID ID ID ID

ISIS NO: NO: Target % NO: NO: SEQ

Sequence

No 1 1 region inhibition 2 2 ID NO: start stop start stop site site site site

532686 1135 1154 Exon 6 ACACTTTTTGGCTCCTGTGA 91 3819 3838 84 532687 1141 1160 Exon 6 GACTAGACACTTTTTGGCTC 77 3825 3844 85

532688 1147 1166 Exon 6 TAAGTTGACTAGACACTTTT 70 3831 3850 86

532689 1153 1172 Exon 6 CTCAATTAAGTTGACTAGAC 61 3837 3856 87

Exon 6-7

532690 1159 1178 CACCTTCTCAATTAAGTTGA 57 3843 3862 88

Junction

Exon 6-7

532691 1165 1184 ACTTGCCACCTTCTCAATTA 56 n/a n/a 89

Junction

Exon 6-7

532692 1171 1190 ACCATAACTTGCCACCTTCT 56 n/a n/a 90

Junction

532693 1177 1196 Exon 7 CTTCACACCATAACTTGCCA 56 4153 4172 91

532694 1183 1202 Exon 7 TCTTGGCTTCACACCATAAC 55 4159 4178 92

532695 1208 1227 Exon 7 ATGTGGCATATGTCACTAGA 55 4184 4203 93

532696 1235 1254 Exon 7 CAGACACTTTGACCCAAATT 55 4211 4230 94

Exon 7-8

532697 1298 1317 GGTCTTCATAATTGATTTCA 53 n/a n/a 95

Junction

Exon 7-8

532698 1304 1323 ACTTGTGGTCTTCATAATTG 53 n/a n/a 96

Junction

Exon 7-8

532699 1310 1329 ACTTCAACTTGTGGTCTTCA 52 n/a n/a 97

Junction

532700 1316 1335 Exon 8 TCCCTGACTTCAACTTGTGG 52 4609 4628 98

532701 1322 1341 Exon 8 TGTTAGTCCCTGACTTCAAC 52 4615 4634 99

532702 1328 1347 Exon 8 TCTTGGTGTTAGTCCCTGAC 51 4621 4640 100

532703 1349 1368 Exon 8 TGTACACTGCCTGGAGGGCC 51 4642 4661 101

532704 1355 1374 Exon 8 TCATGCTGTACACTGCCTGG 51 4648 4667 102

532705 1393 1412 Exon 8 GTTCCAGCCTTCAGGAGGGA 50 4686 4705 103

532706 1399 1418 Exon 8 GGTGCGGTTCCAGCCTTCAG 50 4692 4711 104

532707 1405 1424 Exon 8 ATGGCGGGTGCGGTTCCAGC 50 4698 4717 105

532708 1411 1430 Exon 8 GATGACATGGCGGGTGCGGT 49 4704 4723 106

532709 1417 1436 Exon 8 GAGGATGATGACATGGCGGG 49 4710 4729 107

Exon 8-9

532710 1443 1462 CCCATGTTGTGCAATCCATC 48 n/a n/a 108

Junction

532711 1449 1468 Exon 9 TCCCCGCCCATGTTGTGCAA 48 5023 5042 109

532712 1455 1474 Exon 9 ATTGGGTCCCCGCCCATGTT 48 5029 5048 110

532713 1461 1480 Exon 9 ACAGTAATTGGGTCCCCGCC 48 5035 5054 111

532714 1467 1486 Exon 9 TCAATGACAGTAATTGGGTC 47 5041 5060 112

532715 1473 1492 Exon 9 ATCTCATCAATGACAGTAAT 47 5047 5066 113

532716 1479 1498 Exon 9 TCCCGGATCTCATCAATGAC 46 5053 5072 114

Exon 9-10

532717 1533 1552 ACATCCAGATAATCCTCCCT 46 n/a n/a 115

Junction

Exon 9-10

532718 1539 1558 ACATAGACATCCAGATAATC 46 n/a n/a 116

Junction

Exon 9-10

532719 1545 1564 CCAAACACATAGACATCCAG 46 n/a n/a 117

Junction

532720 1582 1601 Exon 10 AGCATTGATGTTCACTTGGT 46 5231 5250 118

532721 1588 1607 Exon 10 AGCCAAAGCATTGATGTTCA 45 5237 5256 119

532722 1594 1613 Exon 10 CTTGGAAGCCAAAGCATTGA 45 5243 5262 120 532723 1600 1619 Exon 10 GTCTTTCTTGGAAGCCAAAG 45 5249 5268 121

532724 1606 1625 Exon 10 CTCATTGTCTTTCTTGGAAG 44 5255 5274 122

532725 1612 1631 Exon 10 ATGTTGCTCATTGTCTTTCT 44 5261 5280 123

532726 1618 1637 Exon 10 GAACACATGTTGCTCATTGT 44 5267 5286 124

532727 1624 1643 Exon 10 GACTTTGAACACATGTTGCT 43 5273 5292 125

532728 1630 1649 Exon 10 ATCCTTGACTTTGAACACAT 43 5279 5298 126

532729 1636 1655 Exon 10 TTCCATATCCTTGACTTTGA 43 5285 5304 127

532730 1642 1661 Exon 10 CAGGTTTTCCATATCCTTGA 42 5291 5310 128

532731 1686 1705 Exon 11 CTCAGAGACTGGCTTTCATC 42 5827 5846 129

532732 1692 1711 Exon 11 CAGAGACTCAGAGACTGGCT 42 5833 5852 130

516252 1698 1717 Exon 11 ATGCCACAGAGACTCAGAGA 42 5839 5858 131

532733 1704 1723 Exon 11 CAAACCATGCCACAGAGACT 41 5845 5864 132

532734 1710 1729 Exon 11 TGTTCCCAAACCATGCCACA 41 5851 5870 133

532735 1734 1753 Exon 11 TTGTGGTAATCGGTACCCTT 41 5875 5894 134

532736 1740 1759 Exon 11 GGTTGCTTGTGGTAATCGGT 40 5881 5900 135

532737 1746 1765 Exon 11 TGCCATGGTTGCTTGTGGTA 40 5887 5906 136

532738 1752 1771 Exon 11 TTGGCCTGCCATGGTTGCTT 40 5893 5912 137

532739 1758 1777 Exon 11 GAGATCTTGGCCTGCCATGG 38 5899 5918 138

532740 1803 1822 Exon 12 ACAGCCCCCATACAGCTCTC 38 6082 6101 139

532741 1809 1828 Exon 12 GACACCACAGCCCCCATACA 38 6088 6107 140

532742 1815 1834 Exon 12 TACTCAGACACCACAGCCCC 38 6094 6113 141

532743 1821 1840 Exon 12 ACAAAGTACTCAGACACCAC 37 6100 6119 142

532744 1827 1846 Exon 12 GTCAGCACAAAGTACTCAGA 37 6106 6125 143

532745 1872 1891 Exon 12 TTGATTGAGTGTTCCTTGTC 36 6151 6170 144

532746 1878 1897 Exon 12 CTGACCTTGATTGAGTGTTC 35 6157 6176 145

532747 1909 1928 Exon 13 TATCTCCAGGTCCCGCTTCT 35 6403 6422 146

532748 1967 1986 Exon 13 GAATTCCTGCTTCTTTTTTC 32 6461 6480 147

532749 1973 1992 Exon 13 ATTCAGGAATTCCTGCTTCT 32 6467 6486 148

532750 1979 1998 Exon 13 CATAAAATTCAGGAATTCCT 32 6473 6492 149

532751 1985 2004 Exon 13 CATAGTCATAAAATTCAGGA 31 6479 6498 150

532752 2006 2025 Exon 13 TGAGCTTGATCAGGGCAACG 30 6500 6519 151

532753 2012 2031 Exon 13 TATTCTTGAGCTTGATCAGG 30 6506 6525 152

Exon 13-

532754 2048 2067 14 GACAAATGGGCCTGATAGTC 30 n/a n/a 153

Junction

532755 2070 2089 Exon 14 GTTGTTCCCTCGGTGCAGGG 29 6659 6678 154

532756 2076 2095 Exon 14 GCTCGAGTTGTTCCCTCGGT 28 6665 6684 155

532757 2082 2101 Exon 14 CTCAAAGCTCGAGTTGTTCC 28 6671 6690 156

532758 2088 2107 Exon 14 GGAAGCCTCAAAGCTCGAGT 25 6677 6696 157

532759 2094 2113 Exon 14 GTTGGAGGAAGCCTCAAAGC 23 6683 6702 158

532760 2100 2119 Exon 14 GTGGTAGTTGGAGGAAGCCT 23 6689 6708 159

532761 2106 2125 Exon 14 TGGCAAGTGGTAGTTGGAGG 18 6695 6714 160

532762 2112 2131 Exon 14 TGTTGCTGGCAAGTGGTAGT 14 6701 6720 161 Table 3

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and 2

SEQ SEQ SEQ ID ID ID

SEQ ID SEQ

ISIS NO: NO: Target % NO:

Sequence NO: 2 start ID NO 1 1 Region inhibition 2

site NO: start stop stop site site site

532812 n/a n/a Exon 1 TCCAGCTCACTCCCCTGTTG 19 1593 1612 162

532813 n/a n/a Exon 1 TAAGGATCCAGCTCACTCCC 40 1599 1618 163

532814 n/a n/a Exon 1 CAGAAATAAGGATCCAGCTC 39 1605 1624 164

532815 n/a n/a Exon 1 AGGGACCAGAAATAAGGATC 0 1611 1630 165

532816 n/a n/a Exon 1 CCACTTAGGGACCAGAAATA 27 1617 1636 166

532817 n/a n/a Exon 1 TCCAGGACTCTCCCCTTCAG 39 1682 1701 167

532818 n/a n/a Exon 1 AAGTCCCACCCTTTGCTGCC 15 1707 1726 168

532819 n/a n/a Exon 1 CTGCAGAAGTCCCACCCTTT 26 1713 1732 169

532820 n/a n/a Exon 1 CAGAAACTGCAGAAGTCCCA 8 1719 1738 170

Exon 2

532821 n/a n/a - Intron AACCTCTGCACTCTGCCTTC 39 2368 2387 171

2

Exon 2

532822 n/a n/a - Intron CCCTCAAACCTCTGCACTCT 3 2374 2393 172

2

Exon 2

532823 n/a n/a - Intron TCATTGCCCTCAAACCTCTG 19 2380 2399 173

2

532824 n/a n/a Intron 2 CCACACTCATTGCCCTCAAA 37 2386 2405 174

532825 n/a n/a Intron 2 CACTGCCCACACTCATTGCC 23 2392 2411 175

532826 n/a n/a Intron 2 TTAGGCCACTGCCCACACTC 15 2398 2417 176

532827 n/a n/a Intron 2 CTAGTCCTGACCTTGCTGCC 28 2436 2455 177

532828 n/a n/a Intron 2 CTCATCCTAGTCCTGACCTT 25 2442 2461 178

532829 n/a n/a Intron 2 CCTAGTCTCATCCTAGTCCT 23 2448 2467 179

532830 n/a n/a Intron 2 ACCCTGCCTAGTCTCATCCT 30 2454 2473 180

532831 n/a n/a Intron 2 CTTGTCACCCTGCCTAGTCT 34 2460 2479 181

532832 n/a n/a Intron 2 GCCCACCTTGTCACCCTGCC 36 2466 2485 182

532833 n/a n/a Intron 2 CCTAAAACTGCTCCTACTCC 9 2492 2511 183

532834 n/a n/a Intron 4 GAGTCAGAAATGAGGTCAAA 19 3494 3513 184

Intron

532835 n/a n/a CCCTACTCCCATTTCACCTT 16 5971 5990 185

11

Intron 8

532836 n/a n/a - Exon TGTTGTGCAATCCTGCAGAA 25 5013 5032 186

9

532837 n/a n/a Intron 1 AAAGGCTGATGAAGCCTGGC 18 2123 2142 187

532838 n/a n/a Intron 7 CCTTTGACCACAAAGTGGCC 21 4461 4480 188

Intron

532839 n/a n/a AGGTACCACCTCTTTGTGGG 29 6362 6381 189

12

532840 n/a n/a Intron 1 TGGTGGTCACACCTGAAGAG 34 2143 2162 190 - Exon

2

Exon

532763 2133 2152 14-15 GCAGGGAGCAGCTCTTCCTT 40 n/a n/a 191

Junction

532764 2139 2158 Exon 15 TCCTGTGCAGGGAGCAGCTC 28 6927 6946 192

532765 2145 2164 Exon 15 TTGATATCCTGTGCAGGGAG 41 6933 6952 193

532766 2151 2170 Exon 15 AGAGCTTTGATATCCTGTGC 36 6939 6958 194

532767 2157 2176 Exon 15 ACAAACAGAGCTTTGATATC 33 6945 6964 195

532768 2163 2182 Exon 15 TCAGACACAAACAGAGCTTT 41 6951 6970 196

532769 2169 2188 Exon 15 TCCTCCTCAGACACAAACAG 49 6957 6976 197

532770 2193 2212 Exon 15 ACCTCCTTCCGAGTCAGCTT 61 6981 7000 198

532771 2199 2218 Exon 15 ATGTAGACCTCCTTCCGAGT 39 6987 7006 199

532772 2205 2224 Exon 15 TTCTTGATGTAGACCTCCTT 30 6993 7012 200

532773 2211 2230 Exon 15 TCCCCATTCTTGATGTAGAC 31 6999 7018 201

Exon

532774 2217 2236 15-16 TTCTTATCCCCATTCTTGAT 36 n/a n/a 202

Junction

Exon

532775 2223 2242 15-16 CTGCCTTTCTTATCCCCATT 56 n/a n/a 203

Junction

Exon

532776 2229 2248 15-16 TCACAGCTGCCTTTCTTATC 33 n/a n/a 204

Junction

532777 2235 2254 Exon 16 TCTCTCTCACAGCTGCCTTT 38 7119 7138 205

532778 2241 2260 Exon 16 TGAGCATCTCTCTCACAGCT 51 7125 7144 206

532779 2247 2266 Exon 16 GCATATTGAGCATCTCTCTC 39 7131 7150 207

532780 2267 2286 Exon 16 TGACTTTGTCATAGCCTGGG 56 7151 7170 208

532781 2273 2292 Exon 16 TGTCCTTGACTTTGTCATAG 36 7157 7176 209

532782 2309 2328 Exon 16 CAGTACAAAGGAACCGAGGG 30 7193 7212 210

532783 2315 2334 Exon 16 CTCCTCCAGTACAAAGGAAC 21 7199 7218 211

532784 2321 2340 Exon 16 GACTCACTCCTCCAGTACAA 31 7205 7224 212

532785 2327 2346 Exon 16 CATAGGGACTCACTCCTCCA 30 7211 7230 213

532786 2333 2352 Exon 16 GGTCAGCATAGGGACTCACT 31 7217 7236 214

Exon

532787 2352 2371 16-17 TCACCTCTGCAAGTATTGGG 42 7236 7255 215

Junction

Exon

532788 2358 2377 16-17 CCAGAATCACCTCTGCAAGT 32 n/a n/a 216

Junction

Exon

532789 2364 2383 16-17 GGGCCGCCAGAATCACCTCT 35 n/a n/a 217

Junction

532790 2382 2401 Exon 17 CTCTTGTGAACTATCAAGGG 33 7347 7366 218

532791 2388 2407 Exon 17 CGACTTCTCTTGTGAACTAT 52 7353 7372 219

532792 2394 2413 Exon 17 ATGAAACGACTTCTCTTGTG 16 7359 7378 220

532793 2400 2419 Exon ACTTGAATGAAACGACTTCT 45 7365 7384 221 17-18

Junction

Exon

532794 2406 2425 17-18 ACACCAACTTGAATGAAACG 18 n/a n/a 222

Junction

532795 2427 2446 Exon 18 TCCACTACTCCCCAGCTGAT 30 7662 7681 223

532796 2433 2452 Exon 18 CAGACATCCACTACTCCCCA 38 7668 7687 224

532797 2439 2458 Exon 18 TTTTTGCAGACATCCACTAC 35 7674 7693 225

532798 2445 2464 Exon 18 TTCTGGTTTTTGCAGACATC 45 7680 7699 226

532799 2451 2470 Exon 18 TGCCGCTTCTGGTTTTTGCA 47 7686 7705 227

532800 2457 2476 Exon 18 TGCTTTTGCCGCTTCTGGTT 61 7692 7711 228

532801 2463 2482 Exon 18 GGTACCTGCTTTTGCCGCTT 47 7698 7717 229

532802 2469 2488 Exon 18 TGAGCAGGTACCTGCTTTTG 31 7704 7723 230

532803 2517 2536 Exon 18 TTCAGCCAGGGCAGCACTTG 41 7752 7771 231

532804 2523 2542 Exon 18 TTCTCCTTCAGCCAGGGCAG 44 7758 7777 232

532805 2529 2548 Exon 18 TGGAGTTTCTCCTTCAGCCA 46 7764 7783 233

532806 2535 2554 Exon 18 TCATCTTGGAGTTTCTCCTT 49 7770 7789 234

532807 2541 2560 Exon 18 AAATCCTCATCTTGGAGTTT 30 7776 7795 235

532808 2547 2566 Exon 18 AAACCCAAATCCTCATCTTG 20 7782 7801 236

532809 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 65 7806 7825 237

532810 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 74 7812 7831 238

532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 96 7834 7853 239

Table 4

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and 2

532853 n/a n/a Intron 7 GCCCTCAAGGTAGTCTCATG 4354 4373 26 252

532854 n/a n/a Intron 6 AAGGGAAGGAGGACAGAATA 3977 3996 18 253

532855 n/a n/a Intron 1 AAAGGCCAAGGAGGGATGCT 2099 2118 9 254

Exon 8 -

532856 n/a n/a AGAGGTCCCTTCTGACCATC 4736 4755 4 255

Intron 8

532857 n/a n/a Intron 8 GCTGGGACAGGAGAGAGGTC 4749 4768 0 256

532858 n/a n/a Intron 4 TCAAATGTCTGGGAGTGTCA 3479 3498 13 257

532859 n/a n/a Intron 10 AGAAGGAGAATGTGCTGAAA 5801 5820 20 258

532860 n/a n/a Intron 17 TGCTGACCACTTGGCATCTC 7408 7427 20 259

532861 n/a n/a Intron 11 CAACTTTCACAAACCACCAT 6014 6033 18 260

532862 n/a n/a Intron 10 AGCTCTGTGATTCTAAGGTT 5497 5516 15 261

Intron 6-

532863 n/a n/a CCACCTGTGGGTGAGGAGAA 4136 4155 16 262

Exon 7

Exon 17 -

532864 n/a n/a GAGGACTCACTTGAATGAAA 7373 7392 21 263

Intron 17

532865 n/a n/a Intron 6 TGGAATGATCAGGGAGCTAG 3916 3935 30 264

532866 n/a n/a Intron 5 GTCCCTTCTCCATTTTCCCC 3659 3678 26 265

532867 n/a n/a Intron 7 TCAACTTTTTAAGTTAATCA 4497 4516 14 266

532868 n/a n/a Intron 6 GGGTGAGGAGAACAAGGCGC 4128 4147 21 267

532869 n/a n/a Intron 7 CTTCCAAGCCATCTTTTAAC 4553 4572 5 268

Exon 17 -

532870 n/a n/a AGGACTCACTTGAATGAAAC 7372 7391 18 269

Intron 17

532871 n/a n/a Intron 10 TTCCAGGCAACTAGAGCTTC 5412 5431 15 270

532872 n/a n/a Exon 1 CAGAGTCCAGCCACTGTTTG 1557 1576 13 271

Intron 17

532873 n/a n/a CCAACCTGCAGAGGCAGTGG 7638 7657 23 272

- Exon 18

532874 n/a n/a Intron 16 TGCAAGGAGAGGAGAAGCTG 7312 7331 10 273

Exon 9 -

532875 n/a n/a CTAGGCAGGTTACTCACCCA 5120 5139 21 274

Intron 9

Intron 6-

532876 n/a n/a CACCATAACTTGCCACCTGT 4148 4167 41 275

Exon 7

532877 n/a n/a Intron 12 TAGGTACCACCTCTTTGTGG 6363 6382 27 276

532878 n/a n/a Intron 11 CTTGACCTCACCTCCCCCAA 5954 5973 13 277

532879 n/a n/a Intron 12 CCACCTCTTTGTGGGCAGCT 6357 6376 33 278

532880 n/a n/a Intron 11 TTCACAAACCACCATCTCTT 6009 6028 8 279

Exon 3 -

532881 n/a n/a TTCTCACCTCCGTTGTCACA 2958 2977 17 280

Intron 3

532882 n/a n/a Intron 12 GAAAGTGGGAGGTGTTGCCT 6225 6244 19 281

532883 n/a n/a Intron 1 ACAGCAGGAAGGGAAGGTTA 2075 2094 34 282

532884 n/a n/a Intron 17 CATGCTGACCACTTGGCATC 7410 7429 18 283

Exon 4 -

532885 n/a n/a GGTCACCTTGGCAGGAAGGC 3286 3305 0 284

Intron 4

532886 n/a n/a Intron 8 GTATAGTGTTACAAGTGGAC 4804 4823 13 285

532887 n/a n/a Intron 7 GGACTTCCCTTTGACCACAA 4468 4487 18 286

532888 n/a n/a Intron 11 TCACCTTGACCTCACCTCCC 5958 5977 20 287

532889 n/a n/a Intron 15 TAGAGTGCCTCCTTAGGATG 7035 7054 27 288 532890 n/a n/a Intron 7 TGACTTCAACTTGTGGTCTG 4605 4624 16 289

532891 n/a n/a Intron 10 CAGAGAAGGAGAATGTGCTG 5804 5823 25 290

Intron 14

532892 n/a n/a AGGGAGCAGCTCTTCCTCTG 6919 6938 47 291

- Exon 15

Intron 5 -

532893 n/a n/a TGTTCCCCTGGGTGCCAGGA 3710 3729 24 292

Exon 6

532894 n/a n/a Intron 10 GGCCTGGCTGTTTTCAAGCC 5612 5631 15 293

Intron 10

532895 n/a n/a GACTGGCTTTCATCTGGCAG 5821 5840 25 294

- Exon 11

532896 n/a n/a Intron 10 GAAGGCTTTCCAGGCAACTA 5419 5438 19 295

Exon 17 -

532897 n/a n/a TCACTTGAATGAAACGACTT 7367 7386 11 296

Intron 17

532898 n/a n/a Intron 1 GGCCCCAAAAGGCCAAGGAG 2106 2125 5 297

Intron 16

532899 n/a n/a AATCACCTGCAAGGAGAGGA 7319 7338 19 298

- Exon 17

532900 n/a n/a Intron 12 GACCTTCAGTTGCATCCTTA 6183 6202 25 299

532901 n/a n/a Intron 1 TGATGAAGCCTGGCCCCAAA 2117 2136 0 300

532902 n/a n/a Intron 12 TAGAAAGTGGGAGGTGTTGC 6227 6246 0 301

532903 n/a n/a Intron 12 CCCATCCCTGACTGGTCTGG 6295 6314 14 302

532904 n/a n/a Intron 8 CCATGGGTATAGTGTTACAA 4810 4829 13 303

532905 n/a n/a Intron 2 GTGTTCTCTTGACTTCCAGG 2586 2605 23 304

532906 n/a n/a Intron 13 GGCCTGCTCCTCACCCCAGT 6597 6616 27 305

532907 n/a n/a Intron 10 GAGGCCTGGCTGTTTTCAAG 5614 5633 32 306

532908 n/a n/a Exon 1 GACTCTCCCCTTCAGTACCT 1677 1696 16 307

532909 n/a n/a Intron 8 CATGGGTATAGTGTTACAAG 4809 4828 10 308

532910 n/a n/a Intron 10 GAAGGAGAATGTGCTGAAAA 5800 5819 0 309

532911 n/a n/a Intron 7 TCACCTGGTCTTCCAAGCCA 4562 4581 0 310

532912 n/a n/a Intron 17 CTCCCCAGATAGGAAAGGGA 7391 7410 0 311

Exon 17 -

532913 n/a n/a GGACTCACTTGAATGAAACG 7371 7390 0 312

Intron 17

Intron 16

532914 n/a n/a GGCCGCCAGAATCACCTGCA 7328 7347 30 313

- Exon 17

Exon 17 -

532915 n/a n/a CTCACTTGAATGAAACGACT 7368 7387 22 314

Intron 17

532916 n/a n/a Intron 13 CTTTCCCAGCCTTTCCTCAG 6569 6588 28 315

532918 n/a n/a Intron 12 AGAAAGTGGGAGGTGTTGCC 6226 6245 3 316

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 7839 7858 90 317

Table 5

SEQ SEQ SEQ SEQ

ID ID ID ID SEQ

ISIS Target %

NO: 1 NO: 1 Sequence NO: 2 NO: 2 ID NO region inhibition

start stop start stop NO: site site site site

532919 n/a n/a Exon 1 CCAGGACTCTCCCCTTCAGT 1681 1700 4 318

532920 n/a n/a Intron 6 AGGGAAGGAGGACAGAATAG 3976 3995 25 319 532921 n/a n/a Intron 4 GAAATGAGGTCAAATGTCTG 3488 3507 30 320

532922 n/a n/a Intron 4 GGAGAGTCAGAAATGAGGTC 3497 3516 25 321

532923 n/a n/a Intron 12 GTAGAAAGTGGGAGGTGTTG 6228 6247 26 322

532924 n/a n/a Intron 10 TAGAAAGATCTCTGAAGTGC 5521 5540 24 323

532925 n/a n/a Intron 13 CTGCTCCTCACCCCAGTCCT 6594 6613 26 324

532926 n/a n/a Intron 11 CTACTGGGATTCTGTGCTTA 5927 5946 30 325

532927 n/a n/a Intron 1 CCCAAAAGGCCAAGGAGGGA 2103 2122 13 326

532928 n/a n/a Intron 17 TGACCACTTGGCATCTCCCC 7405 7424 27 327

Intron 16 -

532929 n/a n/a CCTGCAAGGAGAGGAGAAGC 7314 7333 29 328

Exon 17

Exon 16 -

532930 n/a n/a CTCTCACCTCTGCAAGTATT 7239 7258 44 329

Intron 16

532931 n/a n/a Intron 1 CCCCAAAAGGCCAAGGAGGG 2104 2123 21 330

532932 n/a n/a Intron 7 GTCTTCCAAGCCATCTTTTA 4555 4574 20 331

532933 n/a n/a Intron 8 GTTACAAGTGGACTTAAGGG 4797 4816 30 332

Intron 8 -

532934 n/a n/a CCCATGTTGTGCAATCCTGC 5017 5036 30 333

Exon 9

532935 n/a n/a Intron 15 GAGGTGGGAAGCATGGAGAA 7091 7110 17 334

532936 n/a n/a Intron 14 TGCTCCCACCACTGTCATCT 6874 6893 21 335

Exon 9 -

532937 n/a n/a AGGCAGGTTACTCACCCAGA 5118 5137 18 336

Intron 9

532938 n/a n/a Intron 11 TACTGGGATTCTGTGCTTAC 5926 5945 15 337

532939 n/a n/a Intron 13 GCCTTTCCCAGCCTTTCCTC 6571 6590 27 338

Intron 8 -

532940 n/a n/a GTGCAATCCTGCAGAAGAGA 5009 5028 21 339

Exon 9

532941 n/a n/a Intron 8 ACAGGAGAGAGGTCCCTTCT 4743 4762 20 340

532942 n/a n/a Intron 10 CCCAAAAGGAGAAAGGGAAA 5717 5736 14 341

532943 n/a n/a Intron 2 AAGCCCAGGGTAAATGCTTA 2557 2576 32 342

532944 n/a n/a Intron 1 GATGAAGCCTGGCCCCAAAA 2116 2135 22 343

532945 n/a n/a Intron 10 TGGCAGAGAAGGAGAATGTG 5807 5826 22 344

532946 n/a n/a Intron 13 TTCCCAGCCTTTCCTCAGGG 6567 6586 35 345

532947 n/a n/a Intron 10 GGCAGAGAAGGAGAATGTGC 5806 5825 30 346

532948 n/a n/a Intron 10 ACAGTGCCAGGAAACAAGAA 5471 5490 25 347

Exon 9 -

532949 n/a n/a TAGGCAGGTTACTCACCCAG 5119 5138 22 348

Intron 9

532950 n/a n/a Intron 2 TTCTCTTGACTTCCAGGGCT 2583 2602 22 349

532951 n/a n/a Intron 13 CCTGCTCCTCACCCCAGTCC 6595 6614 16 350

532953 n/a n/a Intron 7 TCCCACTAACCTCCATTGCC 4422 4441 14 351

532954 n/a n/a Intron 7 TTCCCTTTGACCACAAAGTG 4464 4483 16 352

532955 n/a n/a Intron 9 CTGGGTCCTAGGCAGGTTAC 5127 5146 30 353

532956 n/a n/a Intron 10 TCCAGGCAACTAGAGCTTCA 5411 5430 20 354

Intron 8 -

532957 n/a n/a GCCCATGTTGTGCAATCCTG 5018 5037 45 355

Exon 9

532958 n/a n/a Intron 7 GGTTCCCACTAACCTCCATT 4425 4444 18 356

532959 n/a n/a Intron 3 AGGTAGAGAGCAAGAGTTAC 3052 3071 26 357 532960 n/a n/a Intron 7 CCACTAACCTCCATTGCCCA 4420 4439 10 358

532961 n/a n/a Intron 11 TCACAAACCACCATCTCTTA 6008 6027 40 359

Exon 9 -

532962 n/a n/a TACTCACCCAGATAATCCTC 5110 5129 27 360

Intron 9

532963 n/a n/a Intron 13 TGCTCCTCACCCCAGTCCTC 6593 6612 24 361

Intron 15 -

532964 n/a n/a TCTCACAGCTGCCTTTCTGT 7115 7134 25 362

Exon 16

Exon 17 -

532965 n/a n/a GAAAGGGAGGACTCACTTGA 7379 7398 11 363

Intron 17

532966 n/a n/a Intron 7 CCATCTTTTAACCCCAGAGA 4545 4564 18 364

532967 n/a n/a Intron 13 TCCTCACCCCAGTCCTCCAG 6590 6609 27 365

532968 n/a n/a Intron 10 CTGGCAGAGAAGGAGAATGT 5808 5827 15 366

532969 n/a n/a Intron 17 TCTCCCCAGATAGGAAAGGG 7392 7411 23 367

532970 n/a n/a Intron 14 ACTTCAGCTGCTCCCACCAC 6882 6901 18 368

532971 n/a n/a Intron 1 GACAGCAGGAAGGGAAGGTT 2076 2095 13 369

Intron 13 -

532972 n/a n/a GGAGACAAATGGGCCTATAA 6640 6659 33 370

Exon 14

532973 n/a n/a Intron 14 CTGCTCCCACCACTGTCATC 6875 6894 11 371

532974 n/a n/a Intron 10 AGGAATGAAGAAGGCTTTCC 5428 5447 21 372

532975 n/a n/a Intron 14 GGGATCTCATCCTTATCCTC 6741 6760 31 373

532976 n/a n/a Intron 9 GTGCTGGGTCCTAGGCAGGT 5130 5149 16 374

532977 n/a n/a Intron 1 CAAAAGGCCAAGGAGGGATG 2101 2120 14 375

532978 n/a n/a Intron 17 CCATGCTGACCACTTGGCAT 7411 7430 20 376

532979 n/a n/a Intron 8 GGAGGCTGGGACAGGAGAGA 4753 4772 25 377

Intron 14 -

532980 n/a n/a GGAGCAGCTCTTCCTCTGGA 6917 6936 36 378

Exon 15

Exon 3 -

532981 n/a n/a TCTCACCTCCGTTGTCACAG 2957 2976 20 379

Intron 3

532982 n/a n/a Intron 13 CAGTCCTCCAGCCTTTCCCA 6581 6600 21 380

532983 n/a n/a Intron 13 AGTCCTCCAGCCTTTCCCAG 6580 6599 22 381

Intron 4 -

532984 n/a n/a TGAAGGAGTCTGGGAGAGTC 3509 3528 12 382

Exon 5

Intron 16 -

532985 n/a n/a CAGAATCACCTGCAAGGAGA 7322 7341 20 383

Exon 17

Exon 17 -

532986 n/a n/a TAGGAAAGGGAGGACTCACT 7382 7401 3 384

Intron 17

Exon 4 -

532987 n/a n/a ACCTTGGCAGGAAGGCTCCG 3282 3301 12 385

Intron 4

Intron 13 -

532988 n/a n/a GAGACAAATGGGCCTATAAA 6639 6658 15 386

Exon 14

532989 n/a n/a Intron 1 CTGAAGAGAAAGGCTGATGA 2131 2150 17 387

532990 n/a n/a Intron 6 AATGATCAGGGAGCTAGTCC 3913 3932 30 388

532991 n/a n/a Intron 17 CTTAGCTGACCTAAAGGAAT 7557 7576 22 389

532992 n/a n/a Intron 8 TGGGTATAGTGTTACAAGTG 4807 4826 17 390

532993 n/a n/a Intron 1 TGAAGAGAAAGGCTGATGAA 2130 2149 19 391

532994 n/a n/a Intron 8 GTGTTACAAGTGGACTTAAG 4799 4818 25 392 532995 n/a n/a Intron 6 ACCTGTGGGTGAGGAGAACA 4134 4153 24 393

Exon 9 -

532996 n/a n/a TCACCCAGATAATCCTCCCT 5107 5126 36 394

Intron 9

532952 2608 2627 Exon 18 TGTTGTCGCAGCTGTTTTAA 7843 7862 90 395

Example 2: Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells by MOE gapmers

Additional antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB m NA in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 4,500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3460 MGB (forward sequence

CGAAGCAGCTCAATGAAATCAA, designated herein as SEQ ID NO: 813; reverse sequence

TGCCTGGAGGGCCTTCTT, designated herein as SEQ ID NO: 814; probe sequence

AGACCACAAGTTGAAGTC, designated herein as SEQ ID NO: 815) was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000) , or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity.

Table 6

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 and 2

SEQ SEQ SEQ SEQ SEQ

ISIS Target %

ID ID Sequence ID ID ID NO region inhibition

NO: 1 NO: l NO: 2 NO: 2 NO: start stop start stop site site site site

532686 1135 1154 Exon 6 ACACTTTTTGGCTCCTGTGA 48 3819 3838 84

532687 1141 1160 Exon 6 GACTAGACACTTTTTGGCTC 63 3825 3844 85

532688 1147 1166 Exon 6 TAAGTTGACTAGACACTTTT 47 3831 3850 86

532689 1153 1172 Exon 6 CTCAATTAAGTTGACTAGAC 57 3837 3856 87

Exon 6-7

532690 1159 1178 CACCTTCTCAATTAAGTTGA 49 3843 3862 88

Junction

Exon 6-7

532691 1165 1184 ACTTGCCACCTTCTCAATTA 33 n/a n/a 89

Junction

Exon 6-7

532692 1171 1190 ACCATAACTTGCCACCTTCT 67 n/a n/a 90

Junction

532693 1177 1196 Exon 7 CTTCACACCATAACTTGCCA 56 4153 4172 91

532694 1183 1202 Exon 7 TCTTGGCTTCACACCATAAC 50 4159 4178 92

532695 1208 1227 Exon 7 ATGTGGCATATGTCACTAGA 53 4184 4203 93

532696 1235 1254 Exon 7 CAGACACTTTGACCCAAATT 52 4211 4230 94

Exon 7-8

532697 1298 1317 GGTCTTCATAATTGATTTCA 59 n/a n/a 95

Juncion

Exon 7-8

532698 1304 1323 ACTTGTGGTCTTCATAATTG 52 n/a n/a 96

Juncion

Exon 7-8

532699 1310 1329 ACTTCAACTTGTGGTCTTCA 85 n/a n/a 97

Juncion

532700 1316 1335 Exon 8 TCCCTGACTTCAACTTGTGG 96 4609 4628 98

532701 1322 1341 Exon 8 TGTTAGTCCCTGACTTCAAC 56 4615 4634 99

532702 1328 1347 Exon 8 TCTTGGTGTTAGTCCCTGAC 86 4621 4640 100

532703 1349 1368 Exon 8 TGTACACTGCCTGGAGGGCC 35 4642 4661 101

532704 1355 1374 Exon 8 TCATGCTGTACACTGCCTGG 12 4648 4667 102

532705 1393 1412 Exon 8 GTTCCAGCCTTCAGGAGGGA 27 4686 4705 103

532706 1399 1418 Exon 8 GGTGCGGTTCCAGCCTTCAG 67 4692 4711 104

532707 1405 1424 Exon 8 ATGGCGGGTGCGGTTCCAGC 26 4698 4717 105

532708 1411 1430 Exon 8 GATGACATGGCGGGTGCGGT 28 4704 4723 106

532709 1417 1436 Exon 8 GAGGATGATGACATGGCGGG 6 4710 4729 107

Exon 8-9

532710 1443 1462 CCCATGTTGTGCAATCCATC 35 n/a n/a 108

Junction

532711 1449 1468 Exon 9 TCCCCGCCCATGTTGTGCAA 28 5023 5042 109

532712 1455 1474 Exon 9 ATTGGGTCCCCGCCCATGTT 19 5029 5048 110

532713 1461 1480 Exon 9 ACAGTAATTGGGTCCCCGCC 29 5035 5054 111

532714 1467 1486 Exon 9 TCAATGACAGTAATTGGGTC 49 5041 5060 112

532715 1473 1492 Exon 9 ATCTCATCAATGACAGTAAT 45 5047 5066 113

532716 1479 1498 Exon 9 TCCCGGATCTCATCAATGAC 54 5053 5072 114

Exon 9-

532717 1533 1552 10 ACATCCAGATAATCCTCCCT 22 n/a n/a 115

Junction

Exon 9-

532718 1539 1558 10 ACATAGACATCCAGATAATC 8 n/a n/a 116

Junction

532719 1545 1564 Exon 9- CCAAACACATAGACATCCAG 30 n/a n/a 117 10

Junction

532720 1582 1601 Exon 10 AGCATTGATGTTCACTTGGT 62 5231 5250 118

532721 1588 1607 Exon 10 AGCCAAAGCATTGATGTTCA 46 5237 5256 119

532722 1594 1613 Exon 10 CTTGGAAGCCAAAGCATTGA 35 5243 5262 120

532723 1600 1619 Exon 10 GTCTTTCTTGGAAGCCAAAG 43 5249 5268 121

532724 1606 1625 Exon 10 CTCATTGTCTTTCTTGGAAG 40 5255 5274 122

532725 1612 1631 Exon 10 ATGTTGCTCATTGTCTTTCT 49 5261 5280 123

532726 1618 1637 Exon 10 GAACACATGTTGCTCATTGT 68 5267 5286 124

532727 1624 1643 Exon 10 GACTTTGAACACATGTTGCT 54 5273 5292 125

532728 1630 1649 Exon 10 ATCCTTGACTTTGAACACAT 61 5279 5298 126

532729 1636 1655 Exon 10 TTCCATATCCTTGACTTTGA 55 5285 5304 127

532730 1642 1661 Exon 10 CAGGTTTTCCATATCCTTGA 51 5291 5310 440

Exon 10-

532731 1686 1705 11 CTCAGAGACTGGCTTTCATC 41 5827 5846 129

Junction

532732 1692 1711 Exon 11 CAGAGACTCAGAGACTGGCT 59 5833 5852 130

516252 1698 1717 Exon 11 ATGCCACAGAGACTCAGAGA 57 5839 5858 131

532733 1704 1723 Exon 11 CAAACCATGCCACAGAGACT 34 5845 5864 132

532734 1710 1729 Exon 11 TGTTCCCAAACCATGCCACA 51 5851 5870 133

532735 1734 1753 Exon 11 TTGTGGTAATCGGTACCCTT 50 5875 5894 134

532736 1740 1759 Exon 11 GGTTGCTTGTGGTAATCGGT 64 5881 5900 135

532737 1746 1765 Exon 11 TGCCATGGTTGCTTGTGGTA 40 5887 5906 136

532738 1752 1771 Exon 11 TTGGCCTGCCATGGTTGCTT 49 5893 5912 137

532739 1758 1777 Exon 11 GAGATCTTGGCCTGCCATGG 47 5899 5918 138

532740 1803 1822 Exon 12 ACAGCCCCCATACAGCTCTC 48 6082 6101 139

532741 1809 1828 Exon 12 GACACCACAGCCCCCATACA 40 6088 6107 140

532742 1815 1834 Exon 12 TACTCAGACACCACAGCCCC 33 6094 6113 141

532743 1821 1840 Exon 12 ACAAAGTACTCAGACACCAC 39 6100 6119 142

532744 1827 1846 Exon 12 GTCAGCACAAAGTACTCAGA 45 6106 6125 143

532745 1872 1891 Exon 12 TTGATTGAGTGTTCCTTGTC 42 6151 6170 144

532746 1878 1897 Exon 12 CTGACCTTGATTGAGTGTTC 53 6157 6176 145

532747 1909 1928 Exon 13 TATCTCCAGGTCCCGCTTCT 31 6403 6422 146

532748 1967 1986 Exon 13 GAATTCCTGCTTCTTTTTTC 30 6461 6480 147

532749 1973 1992 Exon 13 ATTCAGGAATTCCTGCTTCT 40 6467 6486 148

532750 1979 1998 Exon 13 CATAAAATTCAGGAATTCCT 45 6473 6492 149

532751 1985 2004 Exon 13 CATAGTCATAAAATTCAGGA 43 6479 6498 150

532752 2006 2025 Exon 13 TGAGCTTGATCAGGGCAACG 61 6500 6519 151

532753 2012 2031 Exon 13 TATTCTTGAGCTTGATCAGG 47 6506 6525 152

Exon 13-

532754 2048 2067 14 GACAAATGGGCCTGATAGTC 35 n/a n/a 153

Junction

532755 2070 2089 Exon 14 GTTGTTCCCTCGGTGCAGGG 43 6659 6678 154

532756 2076 2095 Exon 14 GCTCGAGTTGTTCCCTCGGT 51 6665 6684 155 532757 2082 2101 Exon 14 CTCAAAGCTCGAGTTGTTCC 36 6671 6690 156

532758 2088 2107 Exon 14 GGAAGCCTCAAAGCTCGAGT 54 6677 6696 157

532759 2094 2113 Exon 14 GTTGGAGGAAGCCTCAAAGC 52 6683 6702 158

532760 2100 2119 Exon 14 GTGGTAGTTGGAGGAAGCCT 22 6689 6708 159

532761 2106 2125 Exon 14 TGGCAAGTGGTAGTTGGAGG 34 6695 6714 160

532762 2112 2131 Exon 14 TGTTGCTGGCAAGTGGTAGT 52 6701 6720 161

Example 3: Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells by MOE gapmers

Additional antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB m NA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 5,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. "Start site" indicates the 5'- most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3'- most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK

Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000) , or both. 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity. In case the sequence alignment for a target gene in a particular table is not shown, it is understood that none of the oligonucleotides presented in that table align with 100% complementarity with that target gene. Table 7

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1

SEQ ID SEQ ID SEQ

ISIS Target %

NO: 1 NO: 1 stop Sequence ID NO region inhibition

start site site NO:

588570 150 169 Exon 1 TGGTCACATTCCCTTCCCCT 54 396

588571 152 171 Exon 1 CCTGGTCACATTCCCTTCCC 63 397

532614 154 173 Exon 1 GACCTGGTCACATTCCCTTC 64 12

588572 156 175 Exon 1 TAGACCTGGTCACATTCCCT 62 398

588573 158 177 Exon 1 CCTAGACCTGGTCACATTCC 53 399

588566 2189 2208 Exon 15 CCTTCCGAGTCAGCTTTTTC 60 400

588567 2191 2210 Exon 15 CTCCTTCCGAGTCAGCTTTT 61 401

532770 2193 2212 Exon 15 ACCTCCTTCCGAGTCAGCTT 77 198

588568 2195 2214 Exon 15 AGACCTCCTTCCGAGTCAGC 72 402

588569 2197 2216 Exon 15 GTAGACCTCCTTCCGAGTCA 46 403

588574 2453 2472 Exon 18 TTTGCCGCTTCTGGTTTTTG 46 404

588575 2455 2474 Exon 18 CTTTTGCCGCTTCTGGTTTT 41 405

532800 2457 2476 Exon 18 TGCTTTTGCCGCTTCTGGTT 69 228

588576 2459 2478 Exon 18 CCTGCTTTTGCCGCTTCTGG 61 406

588577 2461 2480 Exon 18 TACCTGCTTTTGCCGCTTCT 51 407

516350 2550 2569 Exon 18 AGAAAACCCAAATCCTCATC 71 408

588509 2551 2570 Exon 18 TAGAAAACCCAAATCCTCAT 58 409

588510 2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 57 410

588511 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 57 411

588512 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 44 412

588513 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 37 413

588514 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 50 414

588515 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT 45 415

588516 2558 2577 Exon 18 CCCCTTATAGAAAACCCAAA 60 416

588517 2559 2578 Exon 18 ACCCCTTATAGAAAACCCAA 67 417

588518 2560 2579 Exon 18 AACCCCTTATAGAAAACCCA 57 418

588519 2561 2580 Exon 18 AAACCCCTTATAGAAAACCC 61 419

588520 2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 27 420

588521 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 25 421

588522 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 36 422

588523 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 36 423

588524 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 46 424

588525 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA 38 425

588526 2568 2587 Exon 18 CAGCAGGAAACCCCTTATAG 47 426

588527 2569 2588 Exon 18 CCAGCAGGAAACCCCTTATA 68 427

588528 2570 2589 Exon 18 TCCAGCAGGAAACCCCTTAT 63 428

532809 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 85 237

588529 2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 76 429

588530 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 74 430 588531 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 75 431

588532 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 73 432

588533 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 82 433

532810 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 88 238

588534 2578 2597 Exon 18 CGCCCCTGTCCAGCAGGAAA 86 434

588535 2579 2598 Exon 18 ACGCCCCTGTCCAGCAGGAA 86 435

588536 2580 2599 Exon 18 CACGCCCCTGTCCAGCAGGA 93 436

588537 2581 2600 Exon 18 CCACGCCCCTGTCCAGCAGG 92 437

588538 2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 94 438

588539 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 96 439

588540 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 88 440

588541 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 79 441

588542 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 83 442

588543 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC 86 443

588544 2588 2607 Exon 18 TTCAATCCCACGCCCCTGTC 90 444

588545 2589 2608 Exon 18 ATTCAATCCCACGCCCCTGT 92 445

588546 2590 2609 Exon 18 AATTCAATCCCACGCCCCTG 92 446

588547 2591 2610 Exon 18 TAATTCAATCCCACGCCCCT 88 447

588548 2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 93 448

588549 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 88 449

588550 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 89 450

588551 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 94 451

588552 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 93 452

588553 2597 2616 Exon 18 CTGTTTTAATTCAATCCCAC 96 453

588554 2598 2617 Exon 18 GCTGTTTTAATTCAATCCCA 98 454

532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 97 239

532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 95 239

588555 2600 2619 Exon 18 CAGCTGTTTTAATTCAATCC 93 455

588556 2601 2620 Exon 18 GCAGCTGTTTTAATTCAATC 96 456

588557 2602 2621 Exon 18 CGCAGCTGTTTTAATTCAAT 98 457

588558 2603 2622 Exon 18 TCGCAGCTGTTTTAATTCAA 95 458

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 97 317

588559 2605 2624 Exon 18 TGTCGCAGCTGTTTTAATTC 95 459

588560 2606 2625 Exon 18 TTGTCGCAGCTGTTTTAATT 92 460

588561 2607 2626 Exon 18 GTTGTCGCAGCTGTTTTAAT 93 461

532952 2608 2627 Exon 18 TGTTGTCGCAGCTGTTTTAA 88 395

Exon 18 /

588562 2609 2628 TTGTTGTCGCAGCTGTTTTA 90 462

Repeat

Exon 18 /

588563 2610 2629 TTTGTTGTCGCAGCTGTTTT 89 463

Repeat

Exon 18 /

588564 2611 2630 TTTTGTTGTCGCAGCTGTTT 92 464

Repeat

Exon 18 /

588565 2612 2631 TTTTTGTTGTCGCAGCTGTT 88 465

Repeat Table 8

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2 Exon 6-7

532692 1171 1190 ACCATAACTTGCCACCTTCT 15 n/a n/a 90

Junction

Exon 6-7

588580 1173 1192 ACACCATAACTTGCCACCTT 16 n/a n/a 498

Junction

Exon 6-7

588581 1175 1194 TCACACCATAACTTGCCACC 14 4151 4170 499

Junction

588610 1319 1338 Exon 8 TAGTCCCTGACTTCAACTTG 50 4612 4631 500

588612 1325 1344 Exon 8 TGGTGTTAGTCCCTGACTTC 47 4618 4637 501

588614 1396 1415 Exon 8 GCGGTTCCAGCCTTCAGGAG 47 4689 4708 502

588616 1421 1440 Exon 8 TCATGAGGATGATGACATGG 51 4714 4733 503

588618 1446 1465 Exon 9 CCGCCCATGTTGTGCAATCC 18 5020 5039 504

588620 1458 1477 Exon 9 GTAATTGGGTCCCCGCCCAT 40 5032 5051 505

588623 1482 1501 Exon 9 AAGTCCCGGATCTCATCAAT 40 5056 5075 506

Exon 9-

588624 1542 1561 10 AACACATAGACATCCAGATA 45 n/a n/a 507

Junction

588626 1585 1604 Exon 10 CAAAGCATTGATGTTCACTT 43 5234 5253 508

588628 1621 1640 Exon 10 TTTGAACACATGTTGCTCAT 45 5270 5289 509

588631 1646 1665 Exon 10 CTTCCAGGTTTTCCATATCC 53 5295 5314 510

588632 1647 1666 Exon 10 TCTTCCAGGTTTTCCATATC 56 5296 5315 511

588634 1689 1708 Exon 11 AGACTCAGAGACTGGCTTTC 35 5830 5849 512

588636 1749 1768 Exon 11 GCCTGCCATGGTTGCTTGTG 55 5890 5909 513

588638 1763 1782 Exon 11 TGACTGAGATCTTGGCCTGC 78 5904 5923 514

588640 1912 1931 Exon 13 TTCTATCTCCAGGTCCCGCT 95 6406 6425 515

588642 1982 2001 Exon 13 AGTCATAAAATTCAGGAATT 44 6476 6495 516

588645 2073 2092 Exon 14 CGAGTTGTTCCCTCGGTGCA 40 6662 6681 517

588646 2085 2104 Exon 14 AGCCTCAAAGCTCGAGTTGT 57 6674 6693 518

588648 2091 2110 Exon 14 GGAGGAAGCCTCAAAGCTCG 48 6680 6699 519

588651 2097 2116 Exon 14 GTAGTTGGAGGAAGCCTCAA 40 6686 6705 520

588652 2103 2122 Exon 14 CAAGTGGTAGTTGGAGGAAG 43 6692 6711 521

588654 2166 2185 Exon 15 TCCTCAGACACAAACAGAGC 13 6954 6973 522

588656 2172 2191 Exon 15 TTCTCCTCCTCAGACACAAA 55 6960 6979 523

588658 2196 2215 Exon 15 TAGACCTCCTTCCGAGTCAG 44 6984 7003 524

588660 2202 2221 Exon 15 TTGATGTAGACCTCCTTCCG 50 6990 7009 525

Exon 15-

588582 2219 2238 16 CTTTCTTATCCCCATTCTTG 19 n/a n/a 526

Junction

Exon 15-

588583 2221 2240 16 GCCTTTCTTATCCCCATTCT 14 n/a n/a 527

Junction

Exon 15-

532775 2223 2242 16 CTGCCTTTCTTATCCCCATT 3 n/a n/a 203

Junction

Exon 15-

588584 2225 2244 16 AGCTGCCTTTCTTATCCCCA 18 n/a n/a 528

Junction Exon 15-

588662 2226 2245 16 CAGCTGCCTTTCTTATCCCC 27 n/a n/a 529

Junction

Exon 15-

588585 2227 2246 16 ACAGCTGCCTTTCTTATCCC 59 n/a n/a 530

Junction

588664 2238 2257 Exon 16 GCATCTCTCTCACAGCTGCC 49 7122 7141 531

588666 2276 2295 Exon 16 AGATGTCCTTGACTTTGTCA 41 7160 7179 532

588668 2330 2349 Exon 16 CAGCATAGGGACTCACTCCT 41 7214 7233 533

Exon 16-

588670 2361 2380 17 CCGCCAGAATCACCTCTGCA 43 n/a n/a 534

Junction

588672 2397 2416 Exon 17 TGAATGAAACGACTTCTCTT 52 7362 7381 535

588674 2430 2449 Exon 18 ACATCCACTACTCCCCAGCT 39 7665 7684 536

588676 2448 2467 Exon 18 CGCTTCTGGTTTTTGCAGAC 69 7683 7702 537

588678 2454 2473 Exon 18 TTTTGCCGCTTCTGGTTTTT 46 7689 7708 538

588680 2466 2485 Exon 18 GCAGGTACCTGCTTTTGCCG 47 7701 7720 539

588682 2532 2551 Exon 18 TCTTGGAGTTTCTCCTTCAG 58 7767 7786 540

532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 10 7834 7853 239

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 11 7839 7858 317

Example 4: Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells by MOE gapmers

Antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB mRNA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 3,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time

PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 4-8-5

MOE, 5-9-5 MOE, 5-10-5 MOE, 3-10-4 MOE, 3-10-7 MOE, 6-7-6- MOE, 6-8-6 MOE, or 5-7-5 MOE gapmers, or as deoxy, MOE, and cEt oligonucleotides.

The 4-8-5 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction

comprising four and five nucleosides respectively. The 5-9-5 MOE gapmers are 19 nucleosides in length, wherein the central gap segment comprises of nine 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 5-7-5 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of seven 2'- deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 3-10-4 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising three and four nucleosides respectively. The 3-10-7 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising three and seven nucleosides respectively. The 6- 7-6 MOE gapmers are 19 nucleosides in length, wherein the central gap segment comprises of seven 2'- deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising six nucleosides each. The 6-8-6 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising six nucleosides each. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

The deoxy, MOE and cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an cEt sugar modification, or a deoxy modification. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an cEt sugar modification; 'd' indicates deoxyribose; and 'e' indicates a MOE modification.

"Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human CFB m NA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity. Table 9

Inhibition of CFB mRNA by deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO:

2

588822 2570 2585 Exon 18 GCAGGAAACCCCTTAT 50 7805 7820 eekddddddddddkke 572

588823 2571 2586 Exon 18 AGCAGGAAACCCCTTA 54 7806 7821 eekddddddddddkke 573

588824 2572 2587 Exon 18 CAGCAGGAAACCCCTT 35 7807 7822 eekddddddddddkke 574

588825 2573 2588 Exon 18 CCAGCAGGAAACCCCT 11 7808 7823 eekddddddddddkke 575

588826 2574 2589 Exon 18 TCCAGCAGGAAACCCC 19 7809 7824 eekddddddddddkke 576

588827 2575 2590 Exon 18 GTCCAGCAGGAAACCC 42 7810 7825 eekddddddddddkke 577

588828 2576 2591 Exon 18 TGTCCAGCAGGAAACC 0 7811 7826 eekddddddddddkke 578

588829 2577 2592 Exon 18 CTGTCCAGCAGGAAAC 49 7812 7827 eekddddddddddkke 579

588830 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 11 7813 7828 eekddddddddddkke 580

588831 2579 2594 Exon 18 CCCTGTCCAGCAGGAA 20 7814 7829 eekddddddddddkke 581

588832 2580 2595 Exon 18 CCCCTGTCCAGCAGGA 19 7815 7830 eekddddddddddkke 582

588833 2581 2596 Exon 18 GCCCCTGTCCAGCAGG 12 7816 7831 eekddddddddddkke 583

588834 2582 2597 Exon 18 CGCCCCTGTCCAGCAG 10 7817 7832 eekddddddddddkke 584

588835 2583 2598 Exon 18 ACGCCCCTGTCCAGCA 13 7818 7833 eekddddddddddkke 585

588836 2584 2599 Exon 18 CACGCCCCTGTCCAGC 13 7819 7834 eekddddddddddkke 586

588837 2585 2600 Exon 18 CCACGCCCCTGTCCAG 39 7820 7835 eekddddddddddkke 587

588838 2586 2601 Exon 18 CCCACGCCCCTGTCCA 54 7821 7836 eekddddddddddkke 588

588839 2587 2602 Exon 18 TCCCACGCCCCTGTCC 51 7822 7837 eekddddddddddkke 589

588840 2588 2603 Exon 18 ATCCCACGCCCCTGTC 65 7823 7838 eekddddddddddkke 590

588841 2589 2604 Exon 18 AATCCCACGCCCCTGT 59 7824 7839 eekddddddddddkke 591

588842 2590 2605 Exon 18 CAATCCCACGCCCCTG 70 7825 7840 eekddddddddddkke 592

588843 2591 2606 Exon 18 TCAATCCCACGCCCCT 0 7826 7841 eekddddddddddkke 593

588844 2592 2607 Exon 18 TTCAATCCCACGCCCC 48 7827 7842 eekddddddddddkke 594

588845 2593 2608 Exon 18 ATTCAATCCCACGCCC 46 7828 7843 eekddddddddddkke 595

588846 2594 2609 Exon 18 AATTCAATCCCACGCC 67 7829 7844 eekddddddddddkke 596

588847 2595 2610 Exon 18 TAATTCAATCCCACGC 75 7830 7845 eekddddddddddkke 597

588848 2596 2611 Exon 18 TTAATTCAATCCCACG 76 7831 7846 eekddddddddddkke 598

588849 2597 2612 Exon 18 TTTAATTCAATCCCAC 94 7832 7847 eekddddddddddkke 599

588850 2598 2613 Exon 18 TTTTAATTCAATCCCA 91 7833 7848 eekddddddddddkke 600

588851 2599 2614 Exon 18 GTTTTAATTCAATCCC 91 7834 7849 eekddddddddddkke 601

588852 2600 2615 Exon 18 TGTTTTAATTCAATCC 78 7835 7850 eekddddddddddkke 602

588853 2601 2616 Exon 18 CTGTTTTAATTCAATC 81 7836 7851 eekddddddddddkke 603

588854 2602 2617 Exon 18 GCTGTTTTAATTCAAT 63 7837 7852 eekddddddddddkke 604

588855 2603 2618 Exon 18 AGCTGTTTTAATTCAA 65 7838 7853 eekddddddddddkke 605

588856 2604 2619 Exon 18 CAGCTGTTTTAATTCA 76 7839 7854 eekddddddddddkke 606

588857 2605 2620 Exon 18 GCAGCTGTTTTAATTC 89 7840 7855 eekddddddddddkke 607

588858 2606 2621 Exon 18 CGCAGCTGTTTTAATT 89 7841 7856 eekddddddddddkke 608

588859 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 89 7842 7857 eekddddddddddkke 609

588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 76 7843 7858 eekddddddddddkke 610

588861 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 87 7844 7859 eekddddddddddkke 611

588862 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 85 7845 7860 eekddddddddddkke 612

588863 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 87 7846 7861 eekddddddddddkke 613

588864 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 67 7847 7862 eekddddddddddkke 614 588865 2613 2628 Exon 18 TTGTTGTCGCAGCTGT 51 n/a n/a eekddddddddddkke 615

588866 2614 2629 Exon 18 TTTGTTGTCGCAGCTG 95 n/a n/a eekddddddddddkke 616

588867 2615 2630 Exon 18 TTTTGTTGTCGCAGCT 92 n/a n/a eekddddddddddkke 617

588868 2616 2631 Exon 18 TTTTTGTTGTCGCAGC 66 n/a n/a eekddddddddddkke 618

Table 10

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

Exon 6-7

588608 1162 1181 TGCCACCTTCTCAATTAAGT 21 n/a n/a 648

Junction

Exon 6-7

588578 1167 1186 TAACTTGCCACCTTCTCAAT 22 n/a n/a 496

Junction

Exon 6-7

588579 1169 1188 CATAACTTGCCACCTTCTCA 21 n/a n/a 497

Junction

Exon 6-7

532692 1171 1190 ACCATAACTTGCCACCTTCT 56 n/a n/a 90

Junction

Exon 6-7

588580 1173 1192 ACACCATAACTTGCCACCTT 50 n/a n/a 498

Junction

588581 1175 1194 Exon 7 TCACACCATAACTTGCCACC 50 4151 4170 499

588610 1319 1338 Exon 8 TAGTCCCTGACTTCAACTTG 47 4612 4631 500

588612 1325 1344 Exon 8 TGGTGTTAGTCCCTGACTTC 47 4618 4637 501

588614 1396 1415 Exon 8 GCGGTTCCAGCCTTCAGGAG 51 4689 4708 502

588616 1421 1440 Exon 8 TCATGAGGATGATGACATGG 18 4714 4733 503

588618 1446 1465 Exon 9 CCGCCCATGTTGTGCAATCC 40 5020 5039 504

588620 1458 1477 Exon 9 GTAATTGGGTCCCCGCCCAT 40 5032 5051 505

588623 1482 1501 Exon 9 AAGTCCCGGATCTCATCAAT 45 5056 5075 506

Exon 9-10

588624 1542 1561 AACACATAGACATCCAGATA 43 n/a n/a 507

Junction

588626 1585 1604 Exon 10 CAAAGCATTGATGTTCACTT 45 5234 5253 508

588628 1621 1640 Exon 10 TTTGAACACATGTTGCTCAT 53 5270 5289 509

588631 1646 1665 Exon 10 CTTCCAGGTTTTCCATATCC 56 5295 5314 510

588632 1647 1666 Exon 10 TCTTCCAGGTTTTCCATATC 35 5296 5315 511

588634 1689 1708 Exon 11 AGACTCAGAGACTGGCTTTC 55 5830 5849 512

588636 1749 1768 Exon 11 GCCTGCCATGGTTGCTTGTG 78 5890 5909 513

588638 1763 1782 Exon 11 TGACTGAGATCTTGGCCTGC 95 5904 5923 514

588640 1912 1931 Exon 13 TTCTATCTCCAGGTCCCGCT 44 6406 6425 515

588642 1982 2001 Exon 13 AGTCATAAAATTCAGGAATT 40 6476 6495 516

588645 2073 2092 Exon 14 CGAGTTGTTCCCTCGGTGCA 57 6662 6681 517

588646 2085 2104 Exon 14 AGCCTCAAAGCTCGAGTTGT 48 6674 6693 518

588648 2091 2110 Exon 14 GGAGGAAGCCTCAAAGCTCG 40 6680 6699 519

588651 2097 2116 Exon 14 GTAGTTGGAGGAAGCCTCAA 43 6686 6705 520

588652 2103 2122 Exon 14 CAAGTGGTAGTTGGAGGAAG 13 6692 6711 521

588654 2166 2185 Exon 15 TCCTCAGACACAAACAGAGC 55 6954 6973 522

588656 2172 2191 Exon 15 TTCTCCTCCTCAGACACAAA 44 6960 6979 523

588658 2196 2215 Exon 15 TAGACCTCCTTCCGAGTCAG 50 6984 7003 524

588660 2202 2221 Exon 15 TTGATGTAGACCTCCTTCCG 27 6990 7009 525

Exon 15-

588582 2219 2238 16 CTTTCTTATCCCCATTCTTG 49 n/a n/a 526

Junction

Exon 15-

588583 2221 2240 16 GCCTTTCTTATCCCCATTCT 41 n/a n/a 527

Junction

Exon 15-

532775 2223 2242 CTGCCTTTCTTATCCCCATT 41 n/a n/a 203

16 Junction

Exon 15-

588584 2225 2244 16 AGCTGCCTTTCTTATCCCCA 43 n/a n/a 528

Junction

Exon 15-

588662 2226 2245 16 CAGCTGCCTTTCTTATCCCC 52 n/a n/a 529

Junction

Exon 15-

588585 2227 2246 16 ACAGCTGCCTTTCTTATCCC 39 n/a n/a 530

Junction

588664 2238 2257 Exon 16 GCATCTCTCTCACAGCTGCC 69 7122 7141 531

588666 2276 2295 Exon 16 AGATGTCCTTGACTTTGTCA 46 7160 7179 532

588668 2330 2349 Exon 16 CAGCATAGGGACTCACTCCT 47 7214 7233 533

Exon 16-

588670 2361 2380 17 CCGCCAGAATCACCTCTGCA 58 n/a n/a 534

Junction

588672 2397 2416 Exon 17 TGAATGAAACGACTTCTCTT 48 7362 7381 535

588674 2430 2449 Exon 18 ACATCCACTACTCCCCAGCT 29 7665 7684 536

588676 2448 2467 Exon 18 CGCTTCTGGTTTTTGCAGAC 58 7683 7702 537

588678 2454 2473 Exon 18 TTTTGCCGCTTCTGGTTTTT 45 7689 7708 538

588680 2466 2485 Exon 18 GCAGGTACCTGCTTTTGCCG 36 7701 7720 539

588682 2532 2551 Exon 18 TCTTGGAGTTTCTCCTTCAG 47 7767 7786 540

532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 96 7834 7853 239

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 96 7839 7858 317

Table 11

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

599042 2559 2575 Exon 18 CCTTATAGAAAACCCAA 19 7794 7810 5-7-5 625

598980 2560 2576 Exon 18 CCCTTATAGAAAACCCA 42 7795 7811 3-10-4 626

599043 2560 2576 Exon 18 CCCTTATAGAAAACCCA 10 7795 7811 5-7-5 626

598981 2561 2577 Exon 18 CCCCTTATAGAAAACCC 20 7796 7812 3-10-4 627

599044 2561 2577 Exon 18 CCCCTTATAGAAAACCC 12 7796 7812 5-7-5 627

598982 2562 2578 Exon 18 ACCCCTTATAGAAAACC 10 7797 7813 3-10-4 628

599045 2562 2578 Exon 18 ACCCCTTATAGAAAACC 3 7797 7813 5-7-5 628

598983 2563 2579 Exon 18 AACCCCTTATAGAAAAC 0 7798 7814 3-10-4 629

599046 2563 2579 Exon 18 AACCCCTTATAGAAAAC 18 7798 7814 5-7-5 629

598984 2564 2580 Exon 18 AAACCCCTTATAGAAAA 0 7799 7815 3-10-4 630

599047 2564 2580 Exon 18 AAACCCCTTATAGAAAA 7 7799 7815 5-7-5 630

598985 2565 2581 Exon 18 GAAACCCCTTATAGAAA 0 7800 7816 3-10-4 631

599048 2565 2581 Exon 18 GAAACCCCTTATAGAAA 9 7800 7816 5-7-5 631

598986 2566 2582 Exon 18 GGAAACCCCTTATAGAA 0 7801 7817 3-10-4 632

599049 2566 2582 Exon 18 GGAAACCCCTTATAGAA 18 7801 7817 5-7-5 632

598988 2567 2583 Exon 18 AGGAAACCCCTTATAGA 0 7802 7818 3-10-4 633

599050 2567 2583 Exon 18 AGGAAACCCCTTATAGA 8 7802 7818 5-7-5 633

598989 2568 2584 Exon 18 CAGGAAACCCCTTATAG 0 7803 7819 3-10-4 634

598990 2569 2585 Exon 18 GCAGGAAACCCCTTATA 8 7804 7820 3-10-4 635

598991 2570 2586 Exon 18 AGCAGGAAACCCCTTAT 25 7805 7821 3-10-4 636

598992 2571 2587 Exon 18 CAGCAGGAAACCCCTTA 12 7806 7822 3-10-4 637

598993 2572 2588 Exon 18 CCAGCAGGAAACCCCTT 37 7807 7823 3-10-4 638

598994 2573 2589 Exon 18 TCCAGCAGGAAACCCCT 29 7808 7824 3-10-4 639

598995 2574 2590 Exon 18 GTCCAGCAGGAAACCCC 42 7809 7825 3-10-4 640

598996 2575 2591 Exon 18 TGTCCAGCAGGAAACCC 36 7810 7826 3-10-4 641

598997 2576 2592 Exon 18 CTGTCCAGCAGGAAACC 18 7811 7827 3-10-4 642

598998 2577 2593 Exon 18 CCTGTCCAGCAGGAAAC 27 7812 7828 3-10-4 643

598999 2578 2594 Exon 18 CCCTGTCCAGCAGGAAA 61 7813 7829 3-10-4 644

599000 2580 2596 Exon 18 GCCCCTGTCCAGCAGGA 71 7815 7831 3-10-4 645

599001 2581 2597 Exon 18 CGCCCCTGTCCAGCAGG 80 7816 7832 3-10-4 646

599002 2582 2598 Exon 18 ACGCCCCTGTCCAGCAG 68 7817 7833 3-10-4 647

599003 2583 2599 Exon 18 CACGCCCCTGTCCAGCA 71 7818 7834 3-10-4 648

599004 2584 2600 Exon 18 CCACGCCCCTGTCCAGC 76 7819 7835 3-10-4 649

599005 2585 2601 Exon 18 CCCACGCCCCTGTCCAG 70 7820 7836 3-10-4 650

599006 2586 2602 Exon 18 TCCCACGCCCCTGTCCA 65 7821 7837 3-10-4 651

599007 2587 2603 Exon 18 ATCCCACGCCCCTGTCC 60 7822 7838 3-10-4 652

599008 2588 2604 Exon 18 AATCCCACGCCCCTGTC 72 7823 7839 3-10-4 653

599009 2589 2605 Exon 18 CAATCCCACGCCCCTGT 79 7824 7840 3-10-4 654

599010 2590 2606 Exon 18 TCAATCCCACGCCCCTG 73 7825 7841 3-10-4 655

599011 2591 2607 Exon 18 TTCAATCCCACGCCCCT 79 7826 7842 3-10-4 656

599012 2592 2608 Exon 18 ATTCAATCCCACGCCCC 67 7827 7843 3-10-4 657

599013 2593 2609 Exon 18 AATTCAATCCCACGCCC 65 7828 7844 3-10-4 658

599014 2594 2610 Exon 18 TAATTCAATCCCACGCC 74 7829 7845 3-10-4 659 599015 2595 2611 Exon 18 TTAATTCAATCCCACGC 71 7830 7846 3-10-4 660

599016 2596 2612 Exon 18 TTTAATTCAATCCCACG 48 7831 7847 3-10-4 661

599017 2597 2613 Exon 18 TTTTAATTCAATCCCAC 34 7832 7848 3-10-4 662

599018 2598 2614 Exon 18 GTTTTAATTCAATCCCA 56 7833 7849 3-10-4 663

599019 2599 2615 Exon 18 TGTTTTAATTCAATCCC 60 7834 7850 3-10-4 664

599020 2600 2616 Exon 18 CTGTTTTAATTCAATCC 0 7835 7851 3-10-4 665

599021 2601 2617 Exon 18 GCTGTTTTAATTCAATC 33 7836 7852 3-10-4 666

599022 2602 2618 Exon 18 AGCTGTTTTAATTCAAT 17 7837 7853 3-10-4 667

599023 2603 2619 Exon 18 CAGCTGTTTTAATTCAA 52 7838 7854 3-10-4 668

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 86 7839 7858 5-10-5 317

599024 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 88 7839 7855 3-10-4 669

599025 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 85 7840 7856 3-10-4 670

599026 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 69 7841 7857 3-10-4 671

599027 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 77 7842 7858 3-10-4 672

599028 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 73 7843 7859 3-10-4 673

599029 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 78 7844 7860 3-10-4 674

599030 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 75 7845 7861 3-10-4 675

599031 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 77 7846 7862 3-10-4 676

Exon 18 /

599032 2612 2628 TTGTTGTCGCAGCTGTT 79 n/a n/a 3-10-4

Repeat 677

Exon 18 /

599033 2613 2629 TTTGTTGTCGCAGCTGT 80 n/a n/a 3-10-4

Repeat 678

Exon 18 /

599034 2614 2630 TTTTGTTGTCGCAGCTG 78 n/a n/a 3-10-4

Repeat 679

Exon 18 /

599035 2615 2631 TTTTTGTTGTCGCAGCT 63 n/a n/a 3-10-4

Repeat 680

Table 12

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

SEQ SEQ SEQ SEQ ID ID ID ID

SEQ

ISIS NO: NO: Target % NO: NO:

Sequence Motif ID NO 1 1 region inhibition 2 2

NO: start stop start stop

site site site site

599098 2552 2568 Exon 18 GAAAACCCAAATCCTCA 57 7787 7803 4-8-5 619

599099 2553 2569 Exon 18 AGAAAACCCAAATCCTC 33 7788 7804 4-8-5 620

599100 2554 2570 Exon 18 TAGAAAACCCAAATCCT 32 7789 7805 4-8-5 621

599101 2555 2571 Exon 18 ATAGAAAACCCAAATCC 47 7790 7806 4-8-5 622

599102 2557 2573 Exon 18 TTATAGAAAACCCAAAT 59 7792 7808 4-8-5 623

599103 2558 2574 Exon 18 CTTATAGAAAACCCAAA 10 7793 7809 4-8-5 624

599104 2559 2575 Exon 18 CCTTATAGAAAACCCAA 3 7794 7810 4-8-5 625

599105 2560 2576 Exon 18 CCCTTATAGAAAACCCA 45 7795 7811 4-8-5 626

599106 2561 2577 Exon 18 CCCCTTATAGAAAACCC 49 7796 7812 4-8-5 627

599107 2562 2578 Exon 18 ACCCCTTATAGAAAACC 35 7797 7813 4-8-5 628 599108 2563 2579 Exon 18 AACCCCTTATAGAAAAC 17 7798 7814 4-8-5 629

599109 2564 2580 Exon 18 AAACCCCTTATAGAAAA 36 7799 7815 4-8-5 630

599110 2565 2581 Exon 18 GAAACCCCTTATAGAAA 20 7800 7816 4-8-5 631

599111 2566 2582 Exon 18 GGAAACCCCTTATAGAA 20 7801 7817 4-8-5 632

599112 2567 2583 Exon 18 AGGAAACCCCTTATAGA 15 7802 7818 4-8-5 633

599113 2568 2584 Exon 18 CAGGAAACCCCTTATAG 19 7803 7819 4-8-5 634

599051 2568 2584 Exon 18 CAGGAAACCCCTTATAG 26 7803 7819 5-7-5 634

599114 2569 2585 Exon 18 GCAGGAAACCCCTTATA 18 7804 7820 4-8-5 635

599052 2569 2585 Exon 18 GCAGGAAACCCCTTATA 21 7804 7820 5-7-5 635

599115 2570 2586 Exon 18 AGCAGGAAACCCCTTAT 31 7805 7821 4-8-5 636

599053 2570 2586 Exon 18 AGCAGGAAACCCCTTAT 25 7805 7821 5-7-5 636

599116 2571 2587 Exon 18 CAGCAGGAAACCCCTTA 39 7806 7822 4-8-5 637

599054 2571 2587 Exon 18 CAGCAGGAAACCCCTTA 36 7806 7822 5-7-5 637

599117 2572 2588 Exon 18 CCAGCAGGAAACCCCTT 46 7807 7823 4-8-5 638

599055 2572 2588 Exon 18 CCAGCAGGAAACCCCTT 22 7807 7823 5-7-5 638

599118 2573 2589 Exon 18 TCCAGCAGGAAACCCCT 40 7808 7824 4-8-5 639

599056 2573 2589 Exon 18 TCCAGCAGGAAACCCCT 32 7808 7824 5-7-5 639

599119 2574 2590 Exon 18 GTCCAGCAGGAAACCCC 50 7809 7825 4-8-5 640

599057 2574 2590 Exon 18 GTCCAGCAGGAAACCCC 46 7809 7825 5-7-5 640

599120 2575 2591 Exon 18 TGTCCAGCAGGAAACCC 30 7810 7826 4-8-5 641

599058 2575 2591 Exon 18 TGTCCAGCAGGAAACCC 52 7810 7826 5-7-5 641

599121 2576 2592 Exon 18 CTGTCCAGCAGGAAACC 31 7811 7827 4-8-5 642

599059 2576 2592 Exon 18 CTGTCCAGCAGGAAACC 24 7811 7827 5-7-5 642

599122 2577 2593 Exon 18 CCTGTCCAGCAGGAAAC 23 7812 7828 4-8-5 643

599060 2577 2593 Exon 18 CCTGTCCAGCAGGAAAC 37 7812 7828 5-7-5 643

599123 2578 2594 Exon 18 CCCTGTCCAGCAGGAAA 51 7813 7829 4-8-5 644

599061 2578 2594 Exon 18 CCCTGTCCAGCAGGAAA 34 7813 7829 5-7-5 644

599124 2580 2596 Exon 18 GCCCCTGTCCAGCAGGA 56 7815 7831 4-8-5 645

599062 2580 2596 Exon 18 GCCCCTGTCCAGCAGGA 51 7815 7831 5-7-5 645

599125 2581 2597 Exon 18 CGCCCCTGTCCAGCAGG 70 7816 7832 4-8-5 646

599063 2581 2597 Exon 18 CGCCCCTGTCCAGCAGG 56 7816 7832 5-7-5 646

599126 2582 2598 Exon 18 ACGCCCCTGTCCAGCAG 76 7817 7833 4-8-5 647

599064 2582 2598 Exon 18 ACGCCCCTGTCCAGCAG 61 7817 7833 5-7-5 647

599127 2583 2599 Exon 18 CACGCCCCTGTCCAGCA 67 7818 7834 4-8-5 648

599065 2583 2599 Exon 18 CACGCCCCTGTCCAGCA 64 7818 7834 5-7-5 648

599066 2584 2600 Exon 18 CCACGCCCCTGTCCAGC 40 7819 7835 5-7-5 649

599067 2585 2601 Exon 18 CCCACGCCCCTGTCCAG 37 7820 7836 5-7-5 650

599068 2586 2602 Exon 18 TCCCACGCCCCTGTCCA 31 7821 7837 5-7-5 651

599069 2587 2603 Exon 18 ATCCCACGCCCCTGTCC 39 7822 7838 5-7-5 652

599070 2588 2604 Exon 18 AATCCCACGCCCCTGTC 59 7823 7839 5-7-5 653

599071 2589 2605 Exon 18 CAATCCCACGCCCCTGT 63 7824 7840 5-7-5 657

599072 2590 2606 Exon 18 TCAATCCCACGCCCCTG 74 7825 7841 5-7-5 655

599073 2591 2607 Exon 18 TTCAATCCCACGCCCCT 53 7826 7842 5-7-5 656

599074 2592 2608 Exon 18 ATTCAATCCCACGCCCC 56 7827 7843 5-7-5 657

599075 2593 2609 Exon 18 AATTCAATCCCACGCCC 49 7828 7844 5-7-5 658 599076 2594 2610 Exon 18 TAATTCAATCCCACGCC 54 7829 7845 5-7-5 659

599077 2595 2611 Exon 18 TTAATTCAATCCCACGC 79 7830 7846 5-7-5 660

599078 2596 2612 Exon 18 TTTAATTCAATCCCACG 67 7831 7847 5-7-5 661

599079 2597 2613 Exon 18 TTTTAATTCAATCCCAC 69 7832 7848 5-7-5 662

599080 2598 2614 Exon 18 GTTTTAATTCAATCCCA 79 7833 7849 5-7-5 663

599081 2599 2615 Exon 18 TGTTTTAATTCAATCCC 57 7834 7850 5-7-5 664

599082 2600 2616 Exon 18 CTGTTTTAATTCAATCC 50 7835 7851 5-7-5 665

599083 2601 2617 Exon 18 GCTGTTTTAATTCAATC 67 7836 7852 5-7-5 666

599084 2602 2618 Exon 18 AGCTGTTTTAATTCAAT 60 7837 7853 5-7-5 667

599085 2603 2619 Exon 18 CAGCTGTTTTAATTCAA 71 7838 7854 5-7-5 668

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 82 7839 7858 5-10-5 317

599086 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 81 7839 7855 5-7-5 669

599087 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 88 7840 7856 5-7-5 670

599088 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 84 7841 7857 5-7-5 671

599089 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 81 7842 7858 5-7-5 672

599090 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 77 7843 7859 5-7-5 673

599091 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 74 7844 7860 5-7-5 674

599092 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 66 7845 7861 5-7-5 675

599093 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 89 7846 7862 5-7-5 676

Exon 18

599094 2612 2628 TTGTTGTCGCAGCTGTT 82 n/a n/a 5-7-5

/ Repeat 677

Exon 18

599095 2613 2629 TTTGTTGTCGCAGCTGT 87 n/a n/a 5-7-5

/ Repeat 678

Exon 18

599096 2614 2630 TTTTGTTGTCGCAGCTG 85 n/a n/a 5-7-5

/ Repeat 679

Exon 18

599097 2615 2631 TTTTTGTTGTCGCAGCT 78 n/a n/a 5-7-5

/ Repeat 680

Table 13

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

SEQ

SEQ ID SEQ ID SEQ ID SEQ

ISIS NO: NO: 1 Target % ID NO:

Sequence NO: 2 Motif ID NO 1 stop region inhibition 2 start

stop NO: start site site

site

site

599510 2552 2570 Exon 18 TAGAAAACCCAAATCCTCA 45 7787 7805 5-9-5 681

599331 2553 2571 Exon 18 ATAGAAAACCCAAATCCTC 46 7788 7806 5-9-5 682

599332 2554 2572 Exon 18 TATAGAAAACCCAAATCCT 38 7789 7807 5-9-5 683

599333 2556 2574 Exon 18 CTTATAGAAAACCCAAATC 1 7791 7809 5-9-5 684

599334 2557 2575 Exon 18 CCTTATAGAAAACCCAAAT 5 7792 7810 5-9-5 685

599335 2558 2576 Exon 18 CCCTTATAGAAAACCCAAA 34 7793 7811 5-9-5 686

599336 2559 2577 Exon 18 CCCCTTATAGAAAACCCAA 40 7794 7812 5-9-5 687

599337 2560 2578 Exon 18 ACCCCTTATAGAAAACCCA 39 7795 7813 5-9-5 688

599338 2561 2579 Exon 18 AACCCCTTATAGAAAACCC 57 7796 7814 5-9-5 689

599339 2562 2580 Exon 18 AAACCCCTTATAGAAAACC 26 7797 7815 5-9-5 690

599281 2562 2580 Exon 18 AAACCCCTTATAGAAAACC 15 7797 7815 6-7-6 690 599340 2563 2581 Exon 18 GAAACCCCTTATAGAAAAC 17 7798 7816 5-9-5 691

599282 2563 2581 Exon 18 GAAACCCCTTATAGAAAAC 12 7798 7816 6-7-6 691

599341 2564 2582 Exon 18 GGAAACCCCTTATAGAAAA 23 7799 7817 5-9-5 692

599283 2564 2582 Exon 18 GGAAACCCCTTATAGAAAA 18 7799 7817 6-7-6 692

599342 2565 2583 Exon 18 AGGAAACCCCTTATAGAAA 10 7800 7818 5-9-5 693

599284 2565 2583 Exon 18 AGGAAACCCCTTATAGAAA 14 7800 7818 6-7-6 693

599343 2566 2584 Exon 18 CAGGAAACCCCTTATAGAA 10 7801 7819 5-9-5 694

599285 2566 2584 Exon 18 CAGGAAACCCCTTATAGAA 13 7801 7819 6-7-6 694

599344 2567 2585 Exon 18 GCAGGAAACCCCTTATAGA 22 7802 7820 5-9-5 695

599286 2567 2585 Exon 18 GCAGGAAACCCCTTATAGA 31 7802 7820 6-7-6 695

599345 2568 2586 Exon 18 AGCAGGAAACCCCTTATAG 19 7803 7821 5-9-5 696

599287 2568 2586 Exon 18 AGCAGGAAACCCCTTATAG 12 7803 7821 6-7-6 696

599346 2569 2587 Exon 18 CAGCAGGAAACCCCTTATA 30 7804 7822 5-9-5 697

599288 2569 2587 Exon 18 CAGCAGGAAACCCCTTATA 28 7804 7822 6-7-6 697

599347 2570 2588 Exon 18 CCAGCAGGAAACCCCTTAT 46 7805 7823 5-9-5 698

599289 2570 2588 Exon 18 CCAGCAGGAAACCCCTTAT 32 7805 7823 6-7-6 698

599348 2571 2589 Exon 18 TCCAGCAGGAAACCCCTTA 44 7806 7824 5-9-5 699

599290 2571 2589 Exon 18 TCCAGCAGGAAACCCCTTA 24 7806 7824 6-7-6 699

599349 2572 2590 Exon 18 GTCCAGCAGGAAACCCCTT 60 7807 7825 5-9-5 700

599291 2572 2590 Exon 18 GTCCAGCAGGAAACCCCTT 38 7807 7825 6-7-6 700

599350 2573 2591 Exon 18 TGTCCAGCAGGAAACCCCT 49 7808 7826 5-9-5 701

599292 2573 2591 Exon 18 TGTCCAGCAGGAAACCCCT 35 7808 7826 6-7-6 701

599351 2575 2593 Exon 18 CCTGTCCAGCAGGAAACCC 46 7810 7828 5-9-5 702

599293 2575 2593 Exon 18 CCTGTCCAGCAGGAAACCC 12 7810 7828 6-7-6 702

599352 2576 2594 Exon 18 CCCTGTCCAGCAGGAAACC 49 7811 7829 5-9-5 703

599294 2576 2594 Exon 18 CCCTGTCCAGCAGGAAACC 38 7811 7829 6-7-6 703

599353 2577 2595 Exon 18 CCCCTGTCCAGCAGGAAAC 64 7812 7830 5-9-5 704

599295 2577 2595 Exon 18 CCCCTGTCCAGCAGGAAAC 33 7812 7830 6-7-6 704

599354 2578 2596 Exon 18 GCCCCTGTCCAGCAGGAAA 56 7813 7831 5-9-5 705

599296 2578 2596 Exon 18 GCCCCTGTCCAGCAGGAAA 13 7813 7831 6-7-6 705

599355 2580 2598 Exon 18 ACGCCCCTGTCCAGCAGGA 81 7815 7833 5-9-5 706

599297 2580 2598 Exon 18 ACGCCCCTGTCCAGCAGGA 57 7815 7833 6-7-6 706

599356 2581 2599 Exon 18 CACGCCCCTGTCCAGCAGG 64 7816 7834 5-9-5 707

599298 2581 2599 Exon 18 CACGCCCCTGTCCAGCAGG 39 7816 7834 6-7-6 707

599299 2582 2600 Exon 18 CCACGCCCCTGTCCAGCAG 55 7817 7835 6-7-6 708

599300 2583 2601 Exon 18 CCCACGCCCCTGTCCAGCA 45 7818 7836 6-7-6 709

599301 2584 2602 Exon 18 TCCCACGCCCCTGTCCAGC 39 7819 7837 6-7-6 710

599302 2585 2603 Exon 18 ATCCCACGCCCCTGTCCAG 27 7820 7838 6-7-6 711

599303 2586 2604 Exon 18 AATCCCACGCCCCTGTCCA 35 7821 7839 6-7-6 712

599304 2587 2605 Exon 18 CAATCCCACGCCCCTGTCC 16 7822 7840 6-7-6 713

599305 2588 2606 Exon 18 TCAATCCCACGCCCCTGTC 41 7823 7841 6-7-6 714

599306 2589 2607 Exon 18 TTCAATCCCACGCCCCTGT 70 7824 7842 6-7-6 715

599307 2590 2608 Exon 18 ATTCAATCCCACGCCCCTG 66 7825 7843 6-7-6 716 599308 2591 2609 Exon 18 AATTCAATCCCACGCCCCT 68 7826 7844 6-7-6 717

599309 2592 2610 Exon 18 TAATTCAATCCCACGCCCC 52 7827 7845 6-7-6 718

599310 2593 2611 Exon 18 TTAATTCAATCCCACGCCC 39 7828 7846 6-7-6 719

599311 2594 2612 Exon 18 TTTAATTCAATCCCACGCC 83 7829 7847 6-7-6 720

599312 2595 2613 Exon 18 TTTTAATTCAATCCCACGC 72 7830 7848 6-7-6 721

599313 2596 2614 Exon 18 GTTTTAATTCAATCCCACG 86 7831 7849 6-7-6 722

599314 2597 2615 Exon 18 TGTTTTAATTCAATCCCAC 91 7832 7850 6-7-6 723

599315 2598 2616 Exon 18 CTGTTTTAATTCAATCCCA 71 7833 7851 6-7-6 724

599316 2599 2617 Exon 18 GCTGTTTTAATTCAATCCC 89 7834 7852 6-7-6 725

599317 2600 2618 Exon 18 AGCTGTTTTAATTCAATCC 87 7835 7853 6-7-6 726

599318 2601 2619 Exon 18 CAGCTGTTTTAATTCAATC 81 7836 7854 6-7-6 727

599319 2602 2620 Exon 18 GCAGCTGTTTTAATTCAAT 75 7837 7855 6-7-6 728

599320 2603 2621 Exon 18 CGCAGCTGTTTTAATTCAA 84 7838 7856 6-7-6 729

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 92 7839 7858 5-10-5 317

599321 2604 2622 Exon 18 TCGCAGCTGTTTTAATTCA 90 7839 7857 6-7-6 730

599322 2605 2623 Exon 18 GTCGCAGCTGTTTTAATTC 89 7840 7858 6-7-6 731

599323 2606 2624 Exon 18 TGTCGCAGCTGTTTTAATT 81 7841 7859 6-7-6 732

599324 2607 2625 Exon 18 TTGTCGCAGCTGTTTTAAT 68 7842 7860 6-7-6 733

599325 2608 2626 Exon 18 GTTGTCGCAGCTGTTTTAA 71 7843 7861 6-7-6 734

599326 2609 2627 Exon 18 TGTTGTCGCAGCTGTTTTA 52 7844 7862 6-7-6 735

Exon 18 /

599327 2610 2628 TTGTTGTCGCAGCTGTTTT 88 n/a n/a 6-7-6

Repeat 736

Exon 18 /

599328 2611 2629 TTTGTTGTCGCAGCTGTTT 87 n/a n/a 6-7-6

Repeat 737

Exon 18 /

599329 2612 2630 TTTTGTTGTCGCAGCTGTT 84 n/a n/a 6-7-6

Repeat 738

Exon 18 /

599330 2613 2631 TTTTTGTTGTCGCAGCTGT 87 n/a n/a 6-7-6

Repeat 739

Table 14

Inhibition of CFB or SEQ ID NO: 2

SEQ SEQ SEQ SEQ

ID ID ID ID

SEQ

ISIS NO: NO: Target % NO: NO:

Sequence Motif ID NO 1 1 region inhibition 2 2

NO: start stop start stop

site site site site

599512 2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 74 7787 7806 3-10-7 410

599449 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 43 7788 7807 3-10-7 411

599450 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 51 7789 7808 3-10-7 412

599451 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 35 7790 7809 3-10-7 413

599452 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 34 7791 7810 3-10-7 414

599453 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT 44 7792 7811 3-10-7 415

599454 2558 2577 Exon 18 CCCCTTATAGAAAACCCAAA 54 7793 7812 3-10-7 416

599455 2559 2578 Exon 18 ACCCCTTATAGAAAACCCAA 53 7794 7813 3-10-7 417 599456 2560 2579 Exon 18 AACCCCTTATAGAAAACCCA 69 7795 7814 3-10-7 418

599457 2561 2580 Exon 18 AAACCCCTTATAGAAAACCC 46 7796 7815 3-10-7 419

599458 2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 0 7797 7816 3-10-7 420

599459 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 12 7798 7817 3-10-7 421

599460 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 17 7799 7818 3-10-7 422

599461 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 24 7800 7819 3-10-7 423

599462 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 33 7801 7820 3-10-7 424

599463 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA 38 7802 7821 3-10-7 425

599464 2568 2587 Exon 18 CAGCAGGAAACCCCTTATAG 33 7803 7822 3-10-7 426

599465 2569 2588 Exon 18 CCAGCAGGAAACCCCTTATA 49 7804 7823 3-10-7 427

599466 2570 2589 Exon 18 TCCAGCAGGAAACCCCTTAT 45 7805 7824 3-10-7 428

599467 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 60 7806 7825 3-10-7 237

599468 2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 61 7807 7826 3-10-7 429

599469 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 52 7808 7827 3-10-7 430

599470 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 45 7809 7828 3-10-7 431

599471 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 67 7810 7829 3-10-7 432

599472 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 79 7811 7830 3-10-7 433

599473 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 72 7812 7831 3-10-7 238

599474 2578 2597 Exon 18 CGCCCCTGTCCAGCAGGAAA 87 7813 7832 3-10-7 434

599475 2579 2598 Exon 18 ACGCCCCTGTCCAGCAGGAA 76 7814 7833 3-10-7 435

599476 2580 2599 Exon 18 CACGCCCCTGTCCAGCAGGA 81 7815 7834 3-10-7 436

599477 2581 2600 Exon 18 CCACGCCCCTGTCCAGCAGG 83 7816 7835 3-10-7 437

599478 2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 72 7817 7836 3-10-7 438

599479 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 81 7818 7837 3-10-7 439

599480 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 77 7819 7838 3-10-7 440

599481 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 83 7820 7839 3-10-7 441

599482 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 87 7821 7840 3-10-7 442

599483 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC 90 7822 7841 3-10-7 443

599484 2588 2607 Exon 18 TTCAATCCCACGCCCCTGTC 72 7823 7842 3-10-7 444

599485 2589 2608 Exon 18 ATTCAATCCCACGCCCCTGT 82 7824 7843 3-10-7 445

599486 2590 2609 Exon 18 AATTCAATCCCACGCCCCTG 84 7825 7844 3-10-7 446

599487 2591 2610 Exon 18 TAATTCAATCCCACGCCCCT 84 7826 7845 3-10-7 447

599488 2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 87 7827 7846 3-10-7 448

599489 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 87 7828 7847 3-10-7 449

599490 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 86 7829 7848 3-10-7 450

599491 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 87 7830 7849 3-10-7 451

599492 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 88 7831 7850 3-10-7 452

599493 2597 2616 Exon 18 CTGTTTTAATTCAATCCCAC 75 7832 7851 3-10-7 453

599433 2597 2616 Exon 18 CTGTTTTAATTCAATCCCAC 89 7832 7851 6-8-6 453

599494 2598 2617 Exon 18 GCTGTTTTAATTCAATCCCA 90 7833 7852 3-10-7 454

599434 2598 2617 Exon 18 GCTGTTTTAATTCAATCCCA 89 7833 7852 6-8-6 454

599495 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 88 7834 7853 3-10-7 239

599435 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 91 7834 7853 6-8-6 239 599496 2600 2619 Exon 18 CAGCTGTTTTAATTCAATCC 89 7835 7854 3-10-7 455

599436 2600 2619 Exon 18 CAGCTGTTTTAATTCAATCC 89 7835 7854 6-8-6 455

599497 2601 2620 Exon 18 GCAGCTGTTTTAATTCAATC 89 7836 7855 3-10-7 456

599437 2601 2620 Exon 18 GCAGCTGTTTTAATTCAATC 91 7836 7855 6-8-6 456

599498 2602 2621 Exon 18 CGCAGCTGTTTTAATTCAAT 88 7837 7856 3-10-7 457

599438 2602 2621 Exon 18 CGCAGCTGTTTTAATTCAAT 90 7837 7856 6-8-6 457

599499 2603 2622 Exon 18 TCGCAGCTGTTTTAATTCAA 81 7838 7857 3-10-7 458

599439 2603 2622 Exon 18 TCGCAGCTGTTTTAATTCAA 88 7838 7857 6-8-6 458

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 90 7839 7858 5-10-5 317

599500 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 88 7839 7858 3-10-7 317

599440 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 88 7839 7858 6-8-6 317

599501 2605 2624 Exon 18 TGTCGCAGCTGTTTTAATTC 78 7840 7859 3-10-7 459

599441 2605 2624 Exon 18 TGTCGCAGCTGTTTTAATTC 90 7840 7859 6-8-6 459

599502 2606 2625 Exon 18 TTGTCGCAGCTGTTTTAATT 87 7841 7860 3-10-7 460

599442 2606 2625 Exon 18 TTGTCGCAGCTGTTTTAATT 76 7841 7860 6-8-6 460

599503 2607 2626 Exon 18 GTTGTCGCAGCTGTTTTAAT 83 7842 7861 3-10-7 461

599443 2607 2626 Exon 18 GTTGTCGCAGCTGTTTTAAT 77 7842 7861 6-8-6 461

599504 2608 2627 Exon 18 TGTTGTCGCAGCTGTTTTAA 89 7843 7862 3-10-7 395

599444 2608 2627 Exon 18 TGTTGTCGCAGCTGTTTTAA 69 7843 7862 6-8-6 395

Exon 19 /

599505 2609 2628 TTGTTGTCGCAGCTGTTTTA 83 n/a n/a 3-10-7 462

Repeat

Exon 19 /

599445 2609 2628 TTGTTGTCGCAGCTGTTTTA 85 n/a n/a 6-8-6 462

Repeat

Exon 19 /

599506 2610 2629 TTTGTTGTCGCAGCTGTTTT 89 n/a n/a 3-10-7 463

Repeat

Exon 19 /

599446 2610 2629 TTTGTTGTCGCAGCTGTTTT 85 n/a n/a 6-8-6 463

Repeat

Exon 19 /

599507 2611 2630 TTTTGTTGTCGCAGCTGTTT 82 n/a n/a 3-10-7 464

Repeat

Exon 19 /

599447 2611 2630 TTTTGTTGTCGCAGCTGTTT 83 n/a n/a 6-8-6 464

Repeat

Exon 19 /

599508 2612 2631 TTTTTGTTGTCGCAGCTGTT 90 n/a n/a 3-10-7 465

Repeat

Exon 19 /

599448 2612 2631 TTTTTGTTGTCGCAGCTGTT 87 n/a n/a 6-8-6 465

Repeat

Example 5: Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells by MOE

gapmers

Additional antisense oligonucleotides were designed targeting human Complement Factor B (CFB) 5 nucleic acid and were tested for their effects on CFB mRNA in vitro. The antisense oligonucleotides were

tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 2,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as 4-8-5

MOE, 5-8-5 MOE, 5-9-5 MOE, 5-10-5 MOE, 6-7-6- MOE, 3-10-5 MOE, or 6-8-6 MOE gapmers.

The 4-8-5 MOE gapmers are 17 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising four and five nucleosides respectively. The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 5-9-5 MOE gapmers are 19 nucleosides in length, wherein the central gap segment comprises of nine 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 3-10-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises of ten 2'- deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising three and five nucleosides respectively. The 6-7-6 MOE gapmers are 19 nucleosides in length, wherein the central gap segment comprises of seven 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising six nucleosides each. The 6-8-6 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising six nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

"Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity. Table 15

599135 2591 2607 Exon 18 TTCAATCCCACGCCCCT 61 7826 7842 4-8-5 656

599189 2591 2608 Exon 18 ATTCAATCCCACGCCCCT 52 7826 7843 5-8-5 769

599136 2592 2608 Exon 18 ATTCAATCCCACGCCCC 68 7827 7843 4-8-5 657

599190 2592 2609 Exon 18 AATTCAATCCCACGCCCC 62 7827 7844 5-8-5 770

599137 2593 2609 Exon 18 AATTCAATCCCACGCCC 51 7828 7844 4-8-5 658

599191 2593 2610 Exon 18 TAATTCAATCCCACGCCC 54 7828 7845 5-8-5 771

599138 2594 2610 Exon 18 TAATTCAATCCCACGCC 71 7829 7845 4-8-5 659

599192 2594 2611 Exon 18 TTAATTCAATCCCACGCC 66 7829 7846 5-8-5 772

599139 2595 2611 Exon 18 TTAATTCAATCCCACGC 80 7830 7846 4-8-5 660

599193 2595 2612 Exon 18 TTTAATTCAATCCCACGC 74 7830 7847 5-8-5 773

599140 2596 2612 Exon 18 TTTAATTCAATCCCACG 66 7831 7847 4-8-5 786

599194 2596 2613 Exon 18 TTTTAATTCAATCCCACG 66 7831 7848 5-8-5 774

599141 2597 2613 Exon 18 TTTTAATTCAATCCCAC 63 7832 7848 4-8-5 662

599195 2597 2614 Exon 18 GTTTTAATTCAATCCCAC 86 7832 7849 5-8-5 775

599142 2598 2614 Exon 18 GTTTTAATTCAATCCCA 69 7833 7849 4-8-5 663

599196 2598 2615 Exon 18 TGTTTTAATTCAATCCCA 82 7833 7850 5-8-5 776

599143 2599 2615 Exon 18 TGTTTTAATTCAATCCC 59 7834 7850 4-8-5 664

599197 2599 2616 Exon 18 CTGTTTTAATTCAATCCC 79 7834 7851 5-8-5 777

599144 2600 2616 Exon 18 CTGTTTTAATTCAATCC 52 7835 7851 4-8-5 665

599198 2600 2617 Exon 18 GCTGTTTTAATTCAATCC 86 7835 7852 5-8-5 778

599145 2601 2617 Exon 18 GCTGTTTTAATTCAATC 53 7836 7852 4-8-5 666

599199 2601 2618 Exon 18 AGCTGTTTTAATTCAATC 72 7836 7853 5-8-5 779

599146 2602 2618 Exon 18 AGCTGTTTTAATTCAAT 42 7837 7853 4-8-5 667

599200 2602 2619 Exon 18 CAGCTGTTTTAATTCAAT 76 7837 7854 5-8-5 780

599147 2603 2619 Exon 18 CAGCTGTTTTAATTCAA 55 7838 7854 4-8-5 668

599201 2603 2620 Exon 18 GCAGCTGTTTTAATTCAA 87 7838 7855 5-8-5 781

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 93 7839 7858 5-10-5 317

599148 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 84 7839 7855 4-8-5 669

599202 2604 2621 Exon 18 CGCAGCTGTTTTAATTCA 89 7839 7856 5-8-5 782

599149 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 92 7840 7856 4-8-5 670

599203 2605 2622 Exon 18 TCGCAGCTGTTTTAATTC 90 7840 7857 5-8-5 783

599150 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 75 7841 7857 4-8-5 671

599151 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 80 7842 7858 4-8-5 672

599152 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 76 7843 7859 4-8-5 673

599153 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 56 7844 7860 4-8-5 674

599154 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 85 7845 7861 4-8-5 675

599155 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 89 7846 7862 4-8-5 676

Exon 18 /

599156 2612 2628 TTGTTGTCGCAGCTGTT 83 n/a n/a 4-8-5

Repeat 813

Exon 18 /

599157 2613 2629 TTTGTTGTCGCAGCTGT 78 n/a n/a 4-8-5

Repeat 678

Exon 18 /

599158 2614 2630 TTTTGTTGTCGCAGCTG 83 n/a n/a 4-8-5

Repeat 679 Exon 18 /

599159 2615 2631 TTTTTGTTGTCGCAGCT 65 n/a n/a 4-8-5

Repeat 680

599204 2606 2623 Exon 18 GTCGCAGCTGTTTTAATT 83 7841 7858 5-8-5 784

Table 16

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

599237 2578 2595 Exon 18 CCCCTGTCCAGCAGGAAA 34 7813 7830 3-10-5 757

599238 2580 2597 Exon 18 CGCCCCTGTCCAGCAGGA 14 7815 7832 3-10-5 758

599239 2581 2598 Exon 18 ACGCCCCTGTCCAGCAGG 10 7816 7833 3-10-5 759

599240 2582 2599 Exon 18 CACGCCCCTGTCCAGCAG 26 7817 7834 3-10-5 760

599241 2583 2600 Exon 18 CCACGCCCCTGTCCAGCA 11 7818 7835 3-10-5 761

599242 2584 2601 Exon 18 CCCACGCCCCTGTCCAGC 24 7819 7836 3-10-5 762

599243 2585 2602 Exon 18 TCCCACGCCCCTGTCCAG 23 7820 7837 3-10-5 763

599244 2586 2603 Exon 18 ATCCCACGCCCCTGTCCA 29 7821 7838 3-10-5 764

599245 2587 2604 Exon 18 AATCCCACGCCCCTGTCC 11 7822 7839 3-10-5 765

599246 2588 2605 Exon 18 CAATCCCACGCCCCTGTC 0 7823 7840 3-10-5 766

599247 2589 2606 Exon 18 TCAATCCCACGCCCCTGT 21 7824 7841 3-10-5 767

599248 2590 2607 Exon 18 TTCAATCCCACGCCCCTG 0 7825 7842 3-10-5 768

599249 2591 2608 Exon 18 ATTCAATCCCACGCCCCT 9 7826 7843 3-10-5 769

599250 2592 2609 Exon 18 AATTCAATCCCACGCCCC 4 7827 7844 3-10-5 770

599251 2593 2610 Exon 18 TAATTCAATCCCACGCCC 12 7828 7845 3-10-5 771

599252 2594 2611 Exon 18 TTAATTCAATCCCACGCC 2 7829 7846 3-10-5 772

599253 2595 2612 Exon 18 TTTAATTCAATCCCACGC 28 7830 7847 3-10-5 773

599254 2596 2613 Exon 18 TTTTAATTCAATCCCACG 27 7831 7848 3-10-5 774

599255 2597 2614 Exon 18 GTTTTAATTCAATCCCAC 38 7832 7849 3-10-5 775

599256 2598 2615 Exon 18 TGTTTTAATTCAATCCCA 36 7833 7850 3-10-5 776

599257 2599 2616 Exon 18 CTGTTTTAATTCAATCCC 48 7834 7851 3-10-5 777

599258 2600 2617 Exon 18 GCTGTTTTAATTCAATCC 19 7835 7852 3-10-5 778

599259 2601 2618 Exon 18 AGCTGTTTTAATTCAATC 36 7836 7853 3-10-5 779

599260 2602 2619 Exon 18 CAGCTGTTTTAATTCAAT 58 7837 7854 3-10-5 780

599261 2603 2620 Exon 18 GCAGCTGTTTTAATTCAA 35 7838 7855 3-10-5 781

GTCGCAGCTGTTTTAATTC

532917 2604 2623 Exon 18 96 7839 7858 5-10-5 317

A

599262 2604 2621 Exon 18 CGCAGCTGTTTTAATTCA 52 7839 7856 3-10-5 782

599263 2605 2622 Exon 18 TCGCAGCTGTTTTAATTC 66 7840 7857 3-10-5 783

599264 2606 2623 Exon 18 GTCGCAGCTGTTTTAATT 48 7841 7858 3-10-5 784

599265 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 46 7842 7859 3-10-5 792

599205 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 83 7842 7859 5-8-5 792

599266 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 76 7843 7860 3-10-5 793

599206 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 90 7843 7860 5-8-5 793

599267 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 53 7844 7861 3-10-5 794

599207 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 82 7844 7861 5-8-5 794

599268 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 58 7845 7862 3-10-5 795

599208 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 70 7845 7862 5-8-5 795

Exon 18 /

599269 2611 2628 TTGTTGTCGCAGCTGTTT 38 n/a n/a 3-10-5 796

Repeat

Exon 18 /

599209 2611 2628 TTGTTGTCGCAGCTGTTT 50 n/a n/a 5-8-5 796

Repeat

Exon 18 /

599270 2612 2629 TTTGTTGTCGCAGCTGTT 46 n/a n/a 3-10-5 797

Repeat Exon 18 /

599210 2612 2629 TTTGTTGTCGCAGCTGTT 76 n/a n/a 5-8-5 797

Repeat

Exon 18 /

599271 2613 2630 TTTTGTTGTCGCAGCTGT 64 n/a n/a 3-10-5 798

Repeat

Exon 18 /

599211 2613 2630 TTTTGTTGTCGCAGCTGT 78 n/a n/a 5-8-5 798

Repeat

Exon 18 /

599272 2614 2631 TTTTTGTTGTCGCAGCTG 89 n/a n/a 3-10-5 799

Repeat

Exon 18 /

599212 2614 2631 TTTTTGTTGTCGCAGCTG 84 n/a n/a 5-8-5 799

Repeat

Table 17

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

SEQ SEQ SEQ

SEQ ID ID ID ID SEQ

ISIS NO: NO: Target % NO:

Sequence NO: 2 Motif ID NO 1 1 region inhibition 2

start NO: start stop stop

site

site site site

599511 2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 38 7787 7806 6-8-6 410

599389 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 80 7788 7807 6-8-6 411

599390 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 92 7789 7808 6-8-6 412

599391 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 90 7790 7809 6-8-6 413

599392 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 87 7791 7810 6-8-6 414

599393 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT 87 7792 7811 6-8-6 415

599394 2558 2577 Exon 18 CCCCTTATAGAAAACCCAAA 74 7793 7812 6-8-6 416

599395 2559 2578 Exon 18 ACCCCTTATAGAAAACCCAA 78 7794 7813 6-8-6 417

599396 2560 2579 Exon 18 AACCCCTTATAGAAAACCCA 77 7795 7814 6-8-6 418

599397 2561 2580 Exon 18 AAACCCCTTATAGAAAACCC 89 7796 7815 6-8-6 419

599398 2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 90 7797 7816 6-8-6 420

599399 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 91 7798 7817 6-8-6 421

599400 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 88 7799 7818 6-8-6 422

599401 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 85 7800 7819 6-8-6 423

599402 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 77 7801 7820 6-8-6 424

599403 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA 85 7802 7821 6-8-6 425

599404 2568 2587 Exon 18 CAGCAGGAAACCCCTTATAG 90 7803 7822 6-8-6 426

599405 2569 2588 Exon 18 CCAGCAGGAAACCCCTTATA 89 7804 7823 6-8-6 427

599406 2570 2589 Exon 18 TCCAGCAGGAAACCCCTTAT 72 7805 7824 6-8-6 428

599407 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 87 7806 7825 6-8-6 237

599408 2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 87 7807 7826 6-8-6 429

599409 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 83 7808 7827 6-8-6 430

599410 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 88 7809 7828 6-8-6 431

599411 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 45 7810 7829 6-8-6 432

599412 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 66 7811 7830 6-8-6 433

599413 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 92 7812 7831 6-8-6 238

599414 2578 2597 Exon 18 CGCCCCTGTCCAGCAGGAAA 92 7813 7832 6-8-6 434

599415 2579 2598 Exon 18 ACGCCCCTGTCCAGCAGGAA 87 7814 7833 6-8-6 435 599416 2580 2599 Exon 18 CACGCCCCTGTCCAGCAGGA 91 7815 7834 6-8-6 436

599417 2581 2600 Exon 18 CCACGCCCCTGTCCAGCAGG 84 7816 7835 6-8-6 437

599357 2582 2600 Exon 18 CCACGCCCCTGTCCAGCAG 88 7817 7835 5-9-5 708

599418 2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 85 7817 7836 6-8-6 438

599358 2583 2601 Exon 18 CCCACGCCCCTGTCCAGCA 86 7818 7836 5-9-5 709

599419 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 91 7818 7837 6-8-6 833

599359 2584 2602 Exon 18 TCCCACGCCCCTGTCCAGC 85 7819 7837 5-9-5 834

599420 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 91 7819 7838 6-8-6 440

599360 2585 2603 Exon 18 ATCCCACGCCCCTGTCCAG 89 7820 7838 5-9-5 711

599421 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 87 7820 7839 6-8-6 441

599361 2586 2604 Exon 18 AATCCCACGCCCCTGTCCA 89 7821 7839 5-9-5 712

599422 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 90 7821 7840 6-8-6 442

599362 2587 2605 Exon 18 CAATCCCACGCCCCTGTCC 94 7822 7840 5-9-5 713

599423 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC 85 7822 7841 6-8-6 841

599363 2588 2606 Exon 18 TCAATCCCACGCCCCTGTC 88 7823 7841 5-9-5 714

599424 2588 2607 Exon 18 TTCAATCCCACGCCCCTGTC 88 7823 7842 6-8-6 444

599364 2589 2607 Exon 18 TTCAATCCCACGCCCCTGT 88 7824 7842 5-9-5 715

599425 2589 2608 Exon 18 ATTCAATCCCACGCCCCTGT 68 7824 7843 6-8-6 445

599365 2590 2608 Exon 18 ATTCAATCCCACGCCCCTG 48 7825 7843 5-9-5 716

599426 2590 2609 Exon 18 AATTCAATCCCACGCCCCTG 55 7825 7844 6-8-6 446

599366 2591 2609 Exon 18 AATTCAATCCCACGCCCCT 28 7826 7844 5-9-5 717

599427 2591 2610 Exon 18 TAATTCAATCCCACGCCCCT 13 7826 7845 6-8-6 849

599367 2592 2610 Exon 18 TAATTCAATCCCACGCCCC 21 7827 7845 5-9-5 718

599428 2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 39 7827 7846 6-8-6 448

599368 2593 2611 Exon 18 TTAATTCAATCCCACGCCC 20 7828 7846 5-9-5 719

599429 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 18 7828 7847 6-8-6 449

599369 2594 2612 Exon 18 TTTAATTCAATCCCACGCC 78 7829 7847 5-9-5 720

599430 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 24 7829 7848 6-8-6 450

599370 2595 2613 Exon 18 TTTTAATTCAATCCCACGC 25 7830 7848 5-9-5 721

599431 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 30 7830 7849 6-8-6 451

599371 2596 2614 Exon 18 GTTTTAATTCAATCCCACG 84 7831 7849 5-9-5 722

599432 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 29 7831 7850 6-8-6 452

599372 2597 2615 Exon 18 TGTTTTAATTCAATCCCAC 83 7832 7850 5-9-5 723

599373 2598 2616 Exon 18 CTGTTTTAATTCAATCCCA 81 7833 7851 5-9-5 724

599374 2599 2617 Exon 18 GCTGTTTTAATTCAATCCC 26 7834 7852 5-9-5 725

599375 2600 2618 Exon 18 AGCTGTTTTAATTCAATCC 26 7835 7853 5-9-5 726

599376 2601 2619 Exon 18 CAGCTGTTTTAATTCAATC 62 7836 7854 5-9-5 727

599377 2602 2620 Exon 18 GCAGCTGTTTTAATTCAAT 21 7837 7855 5-9-5 728

599378 2603 2621 Exon 18 CGCAGCTGTTTTAATTCAA 90 7838 7856 5-9-5 729

5-10-

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 95 7839 7858

5 867

599379 2604 2622 Exon 18 TCGCAGCTGTTTTAATTCA 88 7839 7857 5-9-5 730

599380 2605 2623 Exon 18 GTCGCAGCTGTTTTAATTC 37 7840 7858 5-9-5 869 599381 2606 2624 Exon 18 TGTCGCAGCTGTTTTAATT 33 7841 7859 5-9-5 732

599382 2607 2625 Exon 18 TTGTCGCAGCTGTTTTAAT 81 7842 7860 5-9-5 733

599383 2608 2626 Exon 18 GTTGTCGCAGCTGTTTTAA 54 7843 7861 5-9-5 734

599384 2609 2627 Exon 18 TGTTGTCGCAGCTGTTTTA 85 7844 7862 5-9-5 873

Exon 18

599385 2610 2628 TTGTTGTCGCAGCTGTTTT 59 n/a n/a 5-9-5

/ Repeat 736

Exon 18

599386 2611 2629 TTTGTTGTCGCAGCTGTTT 81 n/a n/a 5-9-5

/ Repeat 737

Exon 18

599387 2612 2630 TTTTGTTGTCGCAGCTGTT 80 n/a n/a 5-9-5

/ Repeat 738

Exon 18

599388 2613 2631 TTTTTGTTGTCGCAGCTGT 84 n/a n/a 5-9-5

/ Repeat 739

Example 6: Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells

Additional antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB m NA in vitro. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 1,000 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as deoxy,

MOE and cEt oligonucleotides. The deoxy, MOE and cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an cEt sugar modification, or a deoxy modification. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an cEt sugar modification; 'd' indicates deoxyribose; and 'e' indicates a MOE modification.

"Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence. Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000), or both, 'n a' indicates that the antisense oligonucleotide does not target that particular gene sequence with 100% complementarity. Table 18

Inhibition of CFB mRNA by deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO:

2

SEQ

SEQ SEQ SEQ ID ID ID % ID SEQ

Target NO:

ISIS NO NO: 1 NO: 1 Sequence inhibitio NO: 2 Motif ID region 2

start stop n stop NO:

start

site site site

site

599513 2551 2566 Exon 18 AAACCCAAATCCTCAT 11 7786 7801 ekkeekkdddddddkk 557

599514 2553 2568 Exon 18 GAAAACCCAAATCCTC 13 7788 7803 ekkeekkdddddddkk 801

599515 2555 2570 Exon 18 TAGAAAACCCAAATCC 54 7790 7805 ekkeekkdddddddkk 559

599516 2559 2574 Exon 18 CTTATAGAAAACCCAA 16 7794 7809 ekkeekkdddddddkk 561

599517 2560 2575 Exon 18 CCTTATAGAAAACCCA 29 7795 7810 ekkeekkdddddddkk 562

599518 2561 2576 Exon 18 CCCTTATAGAAAACCC 55 7796 7811 ekkeekkdddddddkk 563

599519 2562 2577 Exon 18 CCCCTTATAGAAAACC 31 7797 7812 ekkeekkdddddddkk 564

599520 2563 2578 Exon 18 ACCCCTTATAGAAAAC 14 7798 7813 ekkeekkdddddddkk 565

599521 2564 2579 Exon 18 AACCCCTTATAGAAAA 9 7799 7814 ekkeekkdddddddkk 566

599522 2565 2580 Exon 18 AAACCCCTTATAGAAA 8 7800 7815 ekkeekkdddddddkk 567

599523 2566 2581 Exon 18 GAAACCCCTTATAGAA 6 7801 7816 ekkeekkdddddddkk 568

599524 2567 2582 Exon 18 GGAAACCCCTTATAGA 14 7802 7817 ekkeekkdddddddkk 569

599525 2568 2583 Exon 18 AGGAAACCCCTTATAG 6 7803 7818 ekkeekkdddddddkk 570

599526 2569 2584 Exon 18 CAGGAAACCCCTTATA 16 7804 7819 ekkeekkdddddddkk 571

599527 2570 2585 Exon 18 GCAGGAAACCCCTTAT 0 7805 7820 ekkeekkdddddddkk 572

599528 2571 2586 Exon 18 AGCAGGAAACCCCTTA 6 7806 7821 ekkeekkdddddddkk 573

599529 2572 2587 Exon 18 CAGCAGGAAACCCCTT 6 7807 7822 ekkeekkdddddddkk 574

599530 2574 2589 Exon 18 TCCAGCAGGAAACCCC 29 7809 7824 ekkeekkdddddddkk 576

599531 2575 2590 Exon 18 GTCCAGCAGGAAACCC 64 7810 7825 ekkeekkdddddddkk 577

599532 2576 2591 Exon 18 TGTCCAGCAGGAAACC 43 7811 7826 ekkeekkdddddddkk 578

599533 2577 2592 Exon 18 CTGTCCAGCAGGAAAC 25 7812 7827 ekkeekkdddddddkk 820

599534 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 12 7813 7828 ekkeekkdddddddkk 580

599535 2580 2595 Exon 18 CCCCTGTCCAGCAGGA 16 7815 7830 ekkeekkdddddddkk 582

599536 2582 2597 Exon 18 CGCCCCTGTCCAGCAG 27 7817 7832 ekkeekkdddddddkk 584

599537 2583 2598 Exon 18 ACGCCCCTGTCCAGCA 35 7818 7833 ekkeekkdddddddkk 585

599538 2584 2599 Exon 18 CACGCCCCTGTCCAGC 26 7819 7834 ekkeekkdddddddkk 586

599539 2585 2600 Exon 18 CCACGCCCCTGTCCAG 33 7820 7835 ekkeekkdddddddkk 587

599540 2586 2601 Exon 18 CCCACGCCCCTGTCCA 27 7821 7836 ekkeekkdddddddkk 588

599541 2587 2602 Exon 18 TCCCACGCCCCTGTCC 52 7822 7837 ekkeekkdddddddkk 589

599542 2588 2603 Exon 18 ATCCCACGCCCCTGTC 16 7823 7838 ekkeekkdddddddkk 590

599543 2589 2604 Exon 18 AATCCCACGCCCCTGT 19 7824 7839 ekkeekkdddddddkk 591

599544 2590 2605 Exon 18 CAATCCCACGCCCCTG 33 7825 7840 ekkeekkdddddddkk 831

599545 2591 2606 Exon 18 TCAATCCCACGCCCCT 24 7826 7841 ekkeekkdddddddkk 593

599546 2592 2607 Exon 18 TTCAATCCCACGCCCC 54 7827 7842 ekkeekkdddddddkk 594

599547 2593 2608 Exon 18 ATTCAATCCCACGCCC 87 7828 7843 ekkeekkdddddddkk 595

599548 2594 2609 Exon 18 AATTCAATCCCACGCC 79 7829 7844 ekkeekkdddddddkk 596 599549 2595 2610 Exon 18 TAATTCAATCCCACGC 62 7830 7845 ekkeekkdddddddkk 597

599550 2596 2611 Exon 18 TTAATTCAATCCCACG 52 7831 7846 ekkeekkdddddddkk 598

599551 2597 2612 Exon 18 TTTAATTCAATCCCAC 27 7832 7847 ekkeekkdddddddkk 599

599577 2597 2613 Exon 18 TTTTAATTCAATCCCAC 90 7832 7848 eeekkdddddddkkeee 662

599552 2598 2613 Exon 18 TTTTAATTCAATCCCA 92 7833 7848 ekkeekkdddddddkk 600

599578 2598 2614 Exon 18 GTTTTAATTCAATCCCA 88 7833 7849 eeekkdddddddkkeee 663

599553 2599 2614 Exon 18 GTTTTAATTCAATCCC 91 7834 7849 ekkeekkdddddddkk 601

599579 2599 2615 Exon 18 TGTTTTAATTCAATCCC 79 7834 7850 eeekkdddddddkkeee 664

599554 2600 2615 Exon 18 TGTTTTAATTCAATCC 90 7835 7850 ekkeekkdddddddkk 602

599580 2600 2616 Exon 18 CTGTTTTAATTCAATCC 79 7835 7851 eeekkdddddddkkeee 665

599555 2601 2616 Exon 18 CTGTTTTAATTCAATC 79 7836 7851 ekkeekkdddddddkk 846

599581 2601 2617 Exon 18 GCTGTTTTAATTCAATC 90 7836 7852 eeekkdddddddkkeee 666

599556 2602 2617 Exon 18 GCTGTTTTAATTCAAT 47 7837 7852 ekkeekkdddddddkk 604

599582 2602 2618 Exon 18 AGCTGTTTTAATTCAAT 89 7837 7853 eeekkdddddddkkeee 849

599557 2603 2618 Exon 18 AGCTGTTTTAATTCAA 67 7838 7853 ekkeekkdddddddkk 850

599583 2603 2619 Exon 18 CAGCTGTTTTAATTCAA 49 7838 7854 eeekkdddddddkkeee 668 eeeeeddddddddddeee

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 78 7839 7858

ee 317

599558 2604 2619 Exon 18 CAGCTGTTTTAATTCA 80 7839 7854 ekkeekkdddddddkk 606

599584 2604 2620 Exon 18 GCAGCTGTTTTAATTCA 66 7839 7855 eeekkdddddddkkeee 669

599559 2605 2620 Exon 18 GCAGCTGTTTTAATTC 38 7840 7855 ekkeekkdddddddkk 607

599585 2605 2621 Exon 18 CGCAGCTGTTTTAATTC 80 7840 7856 eeekkdddddddkkeee 670

599560 2606 2621 Exon 18 CGCAGCTGTTTTAATT 16 7841 7856 ekkeekkdddddddkk 608

599586 2606 2622 Exon 18 TCGCAGCTGTTTTAATT 78 7841 7857 eeekkdddddddkkeee 671

599561 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 58 7842 7857 ekkeekkdddddddkk 609

599587 2607 2623 Exon 18 GTCGCAGCTGTTTTAAT 81 7842 7858 eeekkdddddddkkeee 672

588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 92 7843 7858 eekddddddddddkke 610

599562 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 78 7843 7858 ekkeekkdddddddkk 610

599588 2608 2624 Exon 18 TGTCGCAGCTGTTTTAA 81 7843 7859 eeekkdddddddkkeee 673

599563 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 86 7844 7859 ekkeekkdddddddkk 611

599589 2609 2625 Exon 18 TTGTCGCAGCTGTTTTA 75 7844 7860 eeekkdddddddkkeee 674

599564 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 75 7845 7860 ekkeekkdddddddkk 612

599590 2610 2626 Exon 18 GTTGTCGCAGCTGTTTT 88 7845 7861 eeekkdddddddkkeee 675

599565 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 65 7846 7861 ekkeekkdddddddkk 613

599591 2611 2627 Exon 18 TGTTGTCGCAGCTGTTT 94 7846 7862 eeekkdddddddkkeee 676

599566 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 72 7847 7862 ekkeekkdddddddkk 614

Exon 18

599592 2612 2628 TTGTTGTCGCAGCTGTT 90 n/a n/a eeekkdddddddkkeee

/ Repeat 677

Exon 18

599567 2613 2628 TTGTTGTCGCAGCTGT 82 n/a n/a ekkeekkdddddddkk

/ Repeat 615

Exon 18

599593 2613 2629 TTTGTTGTCGCAGCTGT 95 n/a n/a eeekkdddddddkkeee

/ Repeat 678

Exon 18

599568 2614 2629 TTTGTTGTCGCAGCTG 92 n/a n/a ekkeekkdddddddkk

/ Repeat 616

Exon 18

599594 2614 2630 TTTTGTTGTCGCAGCTG 86 n/a n/a eeekkdddddddkkeee

/ Repeat 679 Exon 18

599569 2615 2630 TTTTGTTGTCGCAGCT 89 n/a n/a ekkeekkdddddddkk

/ Repeat 617

Exon 18

599595 2615 2631 TTTTTGTTGTCGCAGCT 76 n/a n/a eeekkdddddddkkeee

/ Repeat 680

Exon 18

599570 2616 2631 TTTTTGTTGTCGCAGC 95 n/a n/a ekkeekkdddddddkk

/ Repeat 618

Example 7: Antisense inhibition of human Complement Factor B (CFB) in HepG2 cells

Additional antisense oligonucleotides were designed targeting human Complement Factor B (CFB) nucleic acid and were tested for their effects on CFB m NA in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected using electroporation with 500 nM antisense oligonucleotide. After a treatment period of approximately 24 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of CFB, relative to untreated control cells.

The newly designed chimeric antisense oligonucleotides in the Tables below were designed as deoxy, MOE and cEt oligonucleotides, or as 5-8-5 MOE, 5-9-5 MOE, 5-10-5 MOE, 6-7-6- MOE, 3-10-5 MOE, or 6- 8-6 MOE gapmers.

The deoxy, MOE and cEt oligonucleotides are 16 nucleosides in length wherein the nucleoside have either a MOE sugar modification, an cEt sugar modification, or a deoxy modification. The 'Chemistry' column describes the sugar modifications of each oligonucleotide, 'k' indicates an cEt sugar modification; 'd' indicates deoxyribose; and 'e' indicates a MOE modification.

The 5-8-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction

comprising five nucleosides each. The 5-9-5 MOE gapmers are 19 nucleosides in length, wherein the central gap segment comprises of nine 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 5-10-5 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising five nucleosides each. The 3-10-5 MOE gapmers are 18 nucleosides in length, wherein the central gap segment comprises of ten 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising three and five nucleosides respectively. The 6-7-6 MOE gapmers are 19 nucleosides in length, wherein the central gap segment comprises of seven 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising six nucleosides each. The 6-8-6 MOE gapmers are 20 nucleosides in length, wherein the central gap segment comprises of eight 2'-deoxynucleosides and is flanked by wing segments on the 5' direction and the 3' direction comprising six nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5-methylcytosines.

"Start site" indicates the 5 '-most nucleoside to which the gapmer is targeted in the human gene 5 sequence. "Stop site" indicates the 3 '-most nucleoside to which the gapmer is targeted human gene sequence.

Each gapmer listed in the Tables below is targeted to either the human CFB mRNA, designated herein as

SEQ ID NO: 1 (GENBANK Accession No. NM 001710.5) or the human CFB genomic sequence, designated herein as SEQ ID NO: 2 (GENBANK Accession No. NT 007592.15 truncated from nucleotides 31852000 to 31861000), or both, 'n/a' indicates that the antisense oligonucleotide does not target that particular gene

0 sequence with 100% complementarity.

Table 19

Inhibition of CFB mRNA by deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO:

2

SEQ SEQ SEQ SEQ ID ID ID ID SEQ

Target %

ISIS NO NO: 1 NO: 1 Sequence NO: 2 NO: 2 Motif ID region inhibition

start stop start stop NO: site site site site

601152 2551 2566 Exon 18 AAACCCAAATCCTCAT 22 7786 7801 eekkddddddddkkee 557

601218 2551 2566 Exon 18 AAACCCAAATCCTCAT 21 7786 7801 ekkkddddddddkeee 557

601153 2552 2567 Exon 18 AAAACCCAAATCCTCA 27 7787 7802 eekkddddddddkkee 800

601219 2552 2567 Exon 18 AAAACCCAAATCCTCA 19 7787 7802 ekkkddddddddkeee 800

601154 2553 2568 Exon 18 GAAAACCCAAATCCTC 23 7788 7803 eekkddddddddkkee 558

601220 2553 2568 Exon 18 GAAAACCCAAATCCTC 24 7788 7803 ekkkddddddddkeee 558

601155 2554 2569 Exon 18 AGAAAACCCAAATCCT 20 7789 7804 eekkddddddddkkee 801

601221 2554 2569 Exon 18 AGAAAACCCAAATCCT 0 7789 7804 ekkkddddddddkeee 801

601156 2555 2570 Exon 18 TAGAAAACCCAAATCC 11 7790 7805 eekkddddddddkkee 559

601222 2555 2570 Exon 18 TAGAAAACCCAAATCC 23 7790 7805 ekkkddddddddkeee 559

601157 2556 2571 Exon 18 ATAGAAAACCCAAATC 9 7791 7806 eekkddddddddkkee 560

601223 2556 2571 Exon 18 ATAGAAAACCCAAATC 0 7791 7806 ekkkddddddddkeee 560

601158 2557 2572 Exon 18 TATAGAAAACCCAAAT 0 7792 7807 eekkddddddddkkee 802

601224 2557 2572 Exon 18 TATAGAAAACCCAAAT 0 7792 7807 ekkkddddddddkeee 802

601159 2558 2573 Exon 18 TTATAGAAAACCCAAA 2 7793 7808 eekkddddddddkkee 803

601225 2558 2573 Exon 18 TTATAGAAAACCCAAA 0 7793 7808 ekkkddddddddkeee 803

601160 2559 2574 Exon 18 CTTATAGAAAACCCAA 0 7794 7809 eekkddddddddkkee 561

601226 2559 2574 Exon 18 CTTATAGAAAACCCAA 0 7794 7809 ekkkddddddddkeee 561

601161 2560 2575 Exon 18 CCTTATAGAAAACCCA 1 7795 7810 eekkddddddddkkee 562

601227 2560 2575 Exon 18 CCTTATAGAAAACCCA 14 7795 7810 ekkkddddddddkeee 562

601162 2561 2576 Exon 18 CCCTTATAGAAAACCC 9 7796 7811 eekkddddddddkkee 563

601228 2561 2576 Exon 18 CCCTTATAGAAAACCC 9 7796 7811 ekkkddddddddkeee 563 601163 2562 2577 Exon 18 CCCCTTATAGAAAACC 0 7797 7812 eekkddddddddkkee 564

601164 2563 2578 Exon 18 ACCCCTTATAGAAAAC 3 7798 7813 eekkddddddddkkee 565

601165 2564 2579 Exon 18 AACCCCTTATAGAAAA 0 7799 7814 eekkddddddddkkee 566

601166 2565 2580 Exon 18 AAACCCCTTATAGAAA 0 7800 7815 eekkddddddddkkee 567

601167 2566 2581 Exon 18 GAAACCCCTTATAGAA 0 7801 7816 eekkddddddddkkee 568

601168 2567 2582 Exon 18 GGAAACCCCTTATAGA 0 7802 7817 eekkddddddddkkee 569

601169 2568 2583 Exon 18 AGGAAACCCCTTATAG 0 7803 7818 eekkddddddddkkee 570

601170 2569 2584 Exon 18 CAGGAAACCCCTTATA 10 7804 7819 eekkddddddddkkee 571

601171 2570 2585 Exon 18 GCAGGAAACCCCTTAT 9 7805 7820 eekkddddddddkkee 572

601172 2571 2586 Exon 18 AGCAGGAAACCCCTTA 15 7806 7821 eekkddddddddkkee 573

601173 2572 2587 Exon 18 CAGCAGGAAACCCCTT 29 7807 7822 eekkddddddddkkee 574

601174 2573 2588 Exon 18 CCAGCAGGAAACCCCT 25 7808 7823 eekkddddddddkkee 575

601175 2574 2589 Exon 18 TCCAGCAGGAAACCCC 15 7809 7824 eekkddddddddkkee 576

601176 2575 2590 Exon 18 GTCCAGCAGGAAACCC 18 7810 7825 eekkddddddddkkee 577

601177 2576 2591 Exon 18 TGTCCAGCAGGAAACC 10 7811 7826 eekkddddddddkkee 578

601178 2577 2592 Exon 18 CTGTCCAGCAGGAAAC 11 7812 7827 eekkddddddddkkee 579

601179 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 19 7813 7828 eekkddddddddkkee 580

601180 2579 2594 Exon 18 CCCTGTCCAGCAGGAA 7 7814 7829 eekkddddddddkkee 581

601181 2580 2595 Exon 18 CCCCTGTCCAGCAGGA 3 7815 7830 eekkddddddddkkee 582

601182 2581 2596 Exon 18 GCCCCTGTCCAGCAGG 0 7816 7831 eekkddddddddkkee 583

601183 2582 2597 Exon 18 CGCCCCTGTCCAGCAG 4 7817 7832 eekkddddddddkkee 584

601184 2583 2598 Exon 18 ACGCCCCTGTCCAGCA 14 7818 7833 eekkddddddddkkee 585

601185 2584 2599 Exon 18 CACGCCCCTGTCCAGC 26 7819 7834 eekkddddddddkkee 586

601186 2585 2600 Exon 18 CCACGCCCCTGTCCAG 8 7820 7835 eekkddddddddkkee 587

601187 2586 2601 Exon 18 CCCACGCCCCTGTCCA 18 7821 7836 eekkddddddddkkee 588

601188 2587 2602 Exon 18 TCCCACGCCCCTGTCC 20 7822 7837 eekkddddddddkkee 589

601189 2588 2603 Exon 18 ATCCCACGCCCCTGTC 12 7823 7838 eekkddddddddkkee 590

601190 2589 2604 Exon 18 AATCCCACGCCCCTGT 33 7824 7839 eekkddddddddkkee 591

601191 2590 2605 Exon 18 CAATCCCACGCCCCTG 52 7825 7840 eekkddddddddkkee 592

601192 2591 2606 Exon 18 TCAATCCCACGCCCCT 46 7826 7841 eekkddddddddkkee 593

601193 2592 2607 Exon 18 TTCAATCCCACGCCCC 30 7827 7842 eekkddddddddkkee 594

601194 2593 2608 Exon 18 ATTCAATCCCACGCCC 41 7828 7843 eekkddddddddkkee 595

601195 2594 2609 Exon 18 AATTCAATCCCACGCC 40 7829 7844 eekkddddddddkkee 596

601196 2595 2610 Exon 18 TAATTCAATCCCACGC 71 7830 7845 eekkddddddddkkee 597

601197 2596 2611 Exon 18 TTAATTCAATCCCACG 42 7831 7846 eekkddddddddkkee 598

601198 2597 2612 Exon 18 TTTAATTCAATCCCAC 63 7832 7847 eekkddddddddkkee 599

601199 2598 2613 Exon 18 TTTTAATTCAATCCCA 51 7833 7848 eekkddddddddkkee 600

601200 2599 2614 Exon 18 GTTTTAATTCAATCCC 65 7834 7849 eekkddddddddkkee 601

601201 2600 2615 Exon 18 TGTTTTAATTCAATCC 49 7835 7850 eekkddddddddkkee 602

601202 2601 2616 Exon 18 CTGTTTTAATTCAATC 33 7836 7851 eekkddddddddkkee 603

601203 2602 2617 Exon 18 GCTGTTTTAATTCAAT 63 7837 7852 eekkddddddddkkee 604

601204 2603 2618 Exon 18 AGCTGTTTTAATTCAA 69 7838 7853 eekkddddddddkkee 605 GTCGCAGCTGTTTTAATT eeeeeddddddddddeeee

532917 2604 2623 Exon 18 73 7839 7858 317

CA e

601205 2604 2619 Exon 18 CAGCTGTTTTAATTCA 51 7839 7854 eekkddddddddkkee 606

601206 2605 2620 Exon 18 GCAGCTGTTTTAATTC 43 7840 7855 eekkddddddddkkee 607

601207 2606 2621 Exon 18 CGCAGCTGTTTTAATT 52 7841 7856 eekkddddddddkkee 608

601208 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 61 7842 7857 eekkddddddddkkee 609

588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 75 7843 7858 eekddddddddddkke 610

601209 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 73 7843 7858 eekkddddddddkkee 610

601210 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 80 7844 7859 eekkddddddddkkee 611

601211 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 64 7845 7860 eekkddddddddkkee 612

601212 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 86 7846 7861 eekkddddddddkkee 613

601213 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 87 7847 7862 eekkddddddddkkee 614

Exon 18 /

601214 2613 2628 TTGTTGTCGCAGCTGT 84 n/a n/a eekkddddddddkkee 615

Repeat

Exon 18 /

601215 2614 2629 TTTGTTGTCGCAGCTG 78 n/a n/a eekkddddddddkkee 616

Repeat

Exon 18 /

601216 2615 2630 TTTTGTTGTCGCAGCT 73 n/a n/a eekkddddddddkkee 617

Repeat

Exon 18 /

601217 2616 2631 TTTTTGTTGTCGCAGC 66 n/a n/a eekkddddddddkkee 618

Repeat

Table 20

Inhibition of CFB mRNA by deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO:

2

SEQ SEQ SEQ SEQ ID ID ID ID SEQ

Target %

ISIS NO NO: 1 NO: 1 Sequence NO: 2 NO: 2 Motif ID region inhibition

start stop start stop NO: site site site site

601284 2551 2566 Exon 18 AAACCCAAATCCTCAT 8 7786 7801 ekkddddddddkkeee 557

601285 2552 2567 Exon 18 AAAACCCAAATCCTCA 15 7787 7802 ekkddddddddkkeee 800

601286 2553 2568 Exon 18 GAAAACCCAAATCCTC 21 7788 7803 ekkddddddddkkeee 558

601287 2554 2569 Exon 18 AGAAAACCCAAATCCT 9 7789 7804 ekkddddddddkkeee 801

601288 2555 2570 Exon 18 TAGAAAACCCAAATCC 0 7790 7805 ekkddddddddkkeee 559

601289 2556 2571 Exon 18 ATAGAAAACCCAAATC 40 7791 7806 ekkddddddddkkeee 560

601290 2557 2572 Exon 18 TATAGAAAACCCAAAT 16 7792 7807 ekkddddddddkkeee 802

601291 2558 2573 Exon 18 TTATAGAAAACCCAAA 15 7793 7808 ekkddddddddkkeee 803

601292 2559 2574 Exon 18 CTTATAGAAAACCCAA 5 7794 7809 ekkddddddddkkeee 561

601293 2560 2575 Exon 18 CCTTATAGAAAACCCA 15 7795 7810 ekkddddddddkkeee 562

601294 2561 2576 Exon 18 CCCTTATAGAAAACCC 3 7796 7811 ekkddddddddkkeee 563

601229 2562 2577 Exon 18 CCCCTTATAGAAAACC 15 7797 7812 ekkkddddddddkeee 564

601295 2562 2577 Exon 18 CCCCTTATAGAAAACC 5 7797 7812 ekkddddddddkkeee 564

601230 2563 2578 Exon 18 ACCCCTTATAGAAAAC 14 7798 7813 ekkkddddddddkeee 565

601296 2563 2578 Exon 18 ACCCCTTATAGAAAAC 0 7798 7813 ekkddddddddkkeee 565

601231 2564 2579 Exon 18 AACCCCTTATAGAAAA 14 7799 7814 ekkkddddddddkeee 566

601297 2564 2579 Exon 18 AACCCCTTATAGAAAA 14 7799 7814 ekkddddddddkkeee 566 601232 2565 2580 Exon 18 AAACCCCTTATAGAAA 15 7800 7815 ekkkddddddddkeee 567

601298 2565 2580 Exon 18 AAACCCCTTATAGAAA 7 7800 7815 ekkddddddddkkeee 567

601233 2566 2581 Exon 18 GAAACCCCTTATAGAA 0 7801 7816 ekkkddddddddkeee 568

601299 2566 2581 Exon 18 GAAACCCCTTATAGAA 0 7801 7816 ekkddddddddkkeee 568

601234 2567 2582 Exon 18 GGAAACCCCTTATAGA 0 7802 7817 ekkkddddddddkeee 569

601300 2567 2582 Exon 18 GGAAACCCCTTATAGA 9 7802 7817 ekkddddddddkkeee 569

601235 2568 2583 Exon 18 AGGAAACCCCTTATAG 3 7803 7818 ekkkddddddddkeee 570

601301 2568 2583 Exon 18 AGGAAACCCCTTATAG 14 7803 7818 ekkddddddddkkeee 570

601236 2569 2584 Exon 18 CAGGAAACCCCTTATA 0 7804 7819 ekkkddddddddkeee 571

601302 2569 2584 Exon 18 CAGGAAACCCCTTATA 0 7804 7819 ekkddddddddkkeee 571

601237 2570 2585 Exon 18 GCAGGAAACCCCTTAT 16 7805 7820 ekkkddddddddkeee 572

601303 2570 2585 Exon 18 GCAGGAAACCCCTTAT 16 7805 7820 ekkddddddddkkeee 572

601238 2571 2586 Exon 18 AGCAGGAAACCCCTTA 11 7806 7821 ekkkddddddddkeee 573

601304 2571 2586 Exon 18 AGCAGGAAACCCCTTA 10 7806 7821 ekkddddddddkkeee 573

601239 2572 2587 Exon 18 CAGCAGGAAACCCCTT 21 7807 7822 ekkkddddddddkeee 574

601305 2572 2587 Exon 18 CAGCAGGAAACCCCTT 7 7807 7822 ekkddddddddkkeee 574

601240 2573 2588 Exon 18 CCAGCAGGAAACCCCT 6 7808 7823 ekkkddddddddkeee 575

601241 2574 2589 Exon 18 TCCAGCAGGAAACCCC 10 7809 7824 ekkkddddddddkeee 576

601242 2575 2590 Exon 18 GTCCAGCAGGAAACCC 19 7810 7825 ekkkddddddddkeee 577

601243 2576 2591 Exon 18 TGTCCAGCAGGAAACC 10 7811 7826 ekkkddddddddkeee 578

601244 2577 2592 Exon 18 CTGTCCAGCAGGAAAC 28 7812 7827 ekkkddddddddkeee 579

601245 2578 2593 Exon 18 CCTGTCCAGCAGGAAA 5 7813 7828 ekkkddddddddkeee 580

601246 2579 2594 Exon 18 CCCTGTCCAGCAGGAA 18 7814 7829 ekkkddddddddkeee 581

601247 2580 2595 Exon 18 CCCCTGTCCAGCAGGA 4 7815 7830 ekkkddddddddkeee 582

601248 2581 2596 Exon 18 GCCCCTGTCCAGCAGG 6 7816 7831 ekkkddddddddkeee 583

601249 2582 2597 Exon 18 CGCCCCTGTCCAGCAG 18 7817 7832 ekkkddddddddkeee 584

601250 2583 2598 Exon 18 ACGCCCCTGTCCAGCA 26 7818 7833 ekkkddddddddkeee 585

601251 2584 2599 Exon 18 CACGCCCCTGTCCAGC 27 7819 7834 ekkkddddddddkeee 586

601252 2585 2600 Exon 18 CCACGCCCCTGTCCAG 21 7820 7835 ekkkddddddddkeee 587

601253 2586 2601 Exon 18 CCCACGCCCCTGTCCA 0 7821 7836 ekkkddddddddkeee 588

601254 2587 2602 Exon 18 TCCCACGCCCCTGTCC 31 7822 7837 ekkkddddddddkeee 589

601255 2588 2603 Exon 18 ATCCCACGCCCCTGTC 3 7823 7838 ekkkddddddddkeee 590

601256 2589 2604 Exon 18 AATCCCACGCCCCTGT 21 7824 7839 ekkkddddddddkeee 591

601257 2590 2605 Exon 18 CAATCCCACGCCCCTG 47 7825 7840 ekkkddddddddkeee 592

601258 2591 2606 Exon 18 TCAATCCCACGCCCCT 48 7826 7841 ekkkddddddddkeee 593

601259 2592 2607 Exon 18 TTCAATCCCACGCCCC 38 7827 7842 ekkkddddddddkeee 594

601260 2593 2608 Exon 18 ATTCAATCCCACGCCC 33 7828 7843 ekkkddddddddkeee 595

601261 2594 2609 Exon 18 AATTCAATCCCACGCC 17 7829 7844 ekkkddddddddkeee 596

601262 2595 2610 Exon 18 TAATTCAATCCCACGC 40 7830 7845 ekkkddddddddkeee 597

601263 2596 2611 Exon 18 TTAATTCAATCCCACG 31 7831 7846 ekkkddddddddkeee 598

601264 2597 2612 Exon 18 TTTAATTCAATCCCAC 72 7832 7847 ekkkddddddddkeee 599

601265 2598 2613 Exon 18 TTTTAATTCAATCCCA 48 7833 7848 ekkkddddddddkeee 600

601266 2599 2614 Exon 18 GTTTTAATTCAATCCC 64 7834 7849 ekkkddddddddkeee 601 601267 2600 2615 Exon 18 TGTTTTAATTCAATCC 43 7835 7850 ekkkddddddddkeee 602

601268 2601 2616 Exon 18 CTGTTTTAATTCAATC 44 7836 7851 ekkkddddddddkeee 603

601269 2602 2617 Exon 18 GCTGTTTTAATTCAAT 66 7837 7852 ekkkddddddddkeee 604

601270 2603 2618 Exon 18 AGCTGTTTTAATTCAA 47 7838 7853 ekkkddddddddkeee 605

GTCGCAGCTGTTTTAATT eeeeeddddddddddeeee

532917 2604 2623 Exon 18 3 7839 7858

CA e 317

601271 2604 2619 Exon 18 CAGCTGTTTTAATTCA 26 7839 7854 ekkkddddddddkeee 606

601272 2605 2620 Exon 18 GCAGCTGTTTTAATTC 33 7840 7855 ekkkddddddddkeee 607

601273 2606 2621 Exon 18 CGCAGCTGTTTTAATT 34 7841 7856 ekkkddddddddkeee 608

601274 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 39 7842 7857 ekkkddddddddkeee 609

588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 72 7843 7858 eekddddddddddkke 610

601275 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 65 7843 7858 ekkkddddddddkeee 610

601276 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 65 7844 7859 ekkkddddddddkeee 611

601277 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 51 7845 7860 ekkkddddddddkeee 612

601278 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 78 7846 7861 ekkkddddddddkeee 613

601279 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 79 7847 7862 ekkkddddddddkeee 614

Exon 18 /

601280 2613 2628 TTGTTGTCGCAGCTGT 70 n/a n/a ekkkddddddddkeee

Repeat 615

Exon 18 /

601281 2614 2629 TTTGTTGTCGCAGCTG 78 n/a n/a ekkkddddddddkeee

Repeat 616

Exon 18 /

601282 2615 2630 TTTTGTTGTCGCAGCT 68 n/a n/a ekkkddddddddkeee

Repeat 617

Exon 18 /

601283 2616 2631 TTTTTGTTGTCGCAGC 61 n/a n/a ekkkddddddddkeee

Repeat 618

Table 21

Inhibition of CFB mRNA by deoxy, MOE and cEt oligonucleotides targeting SEQ ID NO: 1 or SEQ ID NO:

2

601357 2585 2600 Exon 18 CCACGCCCCTGTCCAG 26 7820 7835 kkkddddddddkeeee 587

601319 2586 2601 Exon 18 CCCACGCCCCTGTCCA 33 7821 7836 ekkddddddddkkeee 588

601358 2586 2601 Exon 18 CCCACGCCCCTGTCCA 26 7821 7836 kkkddddddddkeeee 588

601320 2587 2602 Exon 18 TCCCACGCCCCTGTCC 25 7822 7837 ekkddddddddkkeee 589

601359 2587 2602 Exon 18 TCCCACGCCCCTGTCC 23 7822 7837 kkkddddddddkeeee 589

601321 2588 2603 Exon 18 ATCCCACGCCCCTGTC 50 7823 7838 ekkddddddddkkeee 590

601360 2588 2603 Exon 18 ATCCCACGCCCCTGTC 33 7823 7838 kkkddddddddkeeee 590

601322 2589 2604 Exon 18 AATCCCACGCCCCTGT 52 7824 7839 ekkddddddddkkeee 591

601361 2589 2604 Exon 18 AATCCCACGCCCCTGT 48 7824 7839 kkkddddddddkeeee 591

601323 2590 2605 Exon 18 CAATCCCACGCCCCTG 67 7825 7840 ekkddddddddkkeee 592

601362 2590 2605 Exon 18 CAATCCCACGCCCCTG 51 7825 7840 kkkddddddddkeeee 592

601324 2591 2606 Exon 18 TCAATCCCACGCCCCT 42 7826 7841 ekkddddddddkkeee 593

601363 2591 2606 Exon 18 TCAATCCCACGCCCCT 42 7826 7841 kkkddddddddkeeee 593

601325 2592 2607 Exon 18 TTCAATCCCACGCCCC 52 7827 7842 ekkddddddddkkeee 594

601364 2592 2607 Exon 18 TTCAATCCCACGCCCC 48 7827 7842 kkkddddddddkeeee 594

601326 2593 2608 Exon 18 ATTCAATCCCACGCCC 27 7828 7843 ekkddddddddkkeee 595

601365 2593 2608 Exon 18 ATTCAATCCCACGCCC 36 7828 7843 kkkddddddddkeeee 595

601327 2594 2609 Exon 18 AATTCAATCCCACGCC 66 7829 7844 ekkddddddddkkeee 596

601366 2594 2609 Exon 18 AATTCAATCCCACGCC 49 7829 7844 kkkddddddddkeeee 596

601328 2595 2610 Exon 18 TAATTCAATCCCACGC 55 7830 7845 ekkddddddddkkeee 597

601367 2595 2610 Exon 18 TAATTCAATCCCACGC 57 7830 7845 kkkddddddddkeeee 597

601329 2596 2611 Exon 18 TTAATTCAATCCCACG 69 7831 7846 ekkddddddddkkeee 598

601368 2596 2611 Exon 18 TTAATTCAATCCCACG 68 7831 7846 kkkddddddddkeeee 598

601330 2597 2612 Exon 18 TTTAATTCAATCCCAC 58 7832 7847 ekkddddddddkkeee 599

601369 2597 2612 Exon 18 TTTAATTCAATCCCAC 65 7832 7847 kkkddddddddkeeee 599

601331 2598 2613 Exon 18 TTTTAATTCAATCCCA 45 7833 7848 ekkddddddddkkeee 600

601370 2598 2613 Exon 18 TTTTAATTCAATCCCA 42 7833 7848 kkkddddddddkeeee 600

601332 2599 2614 Exon 18 GTTTTAATTCAATCCC 84 7834 7849 ekkddddddddkkeee 601

601371 2599 2614 Exon 18 GTTTTAATTCAATCCC 79 7834 7849 kkkddddddddkeeee 601

601333 2600 2615 Exon 18 TGTTTTAATTCAATCC 61 7835 7850 ekkddddddddkkeee 602

601372 2600 2615 Exon 18 TGTTTTAATTCAATCC 71 7835 7850 kkkddddddddkeeee 602

601334 2601 2616 Exon 18 CTGTTTTAATTCAATC 61 7836 7851 ekkddddddddkkeee 603

601373 2601 2616 Exon 18 CTGTTTTAATTCAATC 57 7836 7851 kkkddddddddkeeee 603

601335 2602 2617 Exon 18 GCTGTTTTAATTCAAT 73 7837 7852 ekkddddddddkkeee 604

601374 2602 2617 Exon 18 GCTGTTTTAATTCAAT 66 7837 7852 kkkddddddddkeeee 604

601336 2603 2618 Exon 18 AGCTGTTTTAATTCAA 64 7838 7853 ekkddddddddkkeee 605

601375 2603 2618 Exon 18 AGCTGTTTTAATTCAA 61 7838 7853 kkkddddddddkeeee 605

GTCGCAGCTGTTTTAATT eeeeedddddddddde

532917 2604 2623 Exon 18 66 7839 7858

CA eeee 317

601337 2604 2619 Exon 18 CAGCTGTTTTAATTCA 53 7839 7854 ekkddddddddkkeee 606

601376 2604 2619 Exon 18 CAGCTGTTTTAATTCA 39 7839 7854 kkkddddddddkeeee 606

601338 2605 2620 Exon 18 GCAGCTGTTTTAATTC 67 7840 7855 ekkddddddddkkeee 607

601377 2605 2620 Exon 18 GCAGCTGTTTTAATTC 67 7840 7855 kkkddddddddkeeee 607 601339 2606 2621 Exon 18 CGCAGCTGTTTTAATT 63 7841 7856 ekkddddddddkkeee 608

601378 2606 2621 Exon 18 CGCAGCTGTTTTAATT 60 7841 7856 kkkddddddddkeeee 608

601340 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 40 7842 7857 ekkddddddddkkeee 609

601379 2607 2622 Exon 18 TCGCAGCTGTTTTAAT 36 7842 7857 kkkddddddddkeeee 609

588860 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 84 7843 7858 eekddddddddddkke 610

601341 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 74 7843 7858 ekkddddddddkkeee 610

601380 2608 2623 Exon 18 GTCGCAGCTGTTTTAA 78 7843 7858 kkkddddddddkeeee 610

601342 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 68 7844 7859 ekkddddddddkkeee 611

601381 2609 2624 Exon 18 TGTCGCAGCTGTTTTA 66 7844 7859 kkkddddddddkeeee 611

601343 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 71 7845 7860 ekkddddddddkkeee 612

601382 2610 2625 Exon 18 TTGTCGCAGCTGTTTT 84 7845 7860 kkkddddddddkeeee 612

601344 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 87 7846 7861 ekkddddddddkkeee 613

601383 2611 2626 Exon 18 GTTGTCGCAGCTGTTT 85 7846 7861 kkkddddddddkeeee 613

601345 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 82 7847 7862 ekkddddddddkkeee 614

601384 2612 2627 Exon 18 TGTTGTCGCAGCTGTT 79 7847 7862 kkkddddddddkeeee 614

Exon 18 /

601346 2613 2628 TTGTTGTCGCAGCTGT 73 n/a n/a ekkddddddddkkeee

Repeat 615

Exon 18 /

601385 2613 2628 TTGTTGTCGCAGCTGT 84 n/a n/a kkkddddddddkeeee

Repeat 615

Exon 18 /

601347 2614 2629 TTTGTTGTCGCAGCTG 70 n/a n/a ekkddddddddkkeee

Repeat 616

Exon 18 /

601386 2614 2629 TTTGTTGTCGCAGCTG 71 n/a n/a kkkddddddddkeeee

Repeat 616

Exon 18 /

601348 2615 2630 TTTTGTTGTCGCAGCT 71 n/a n/a ekkddddddddkkeee

Repeat 617

Exon 18 /

601387 2615 2630 TTTTGTTGTCGCAGCT 76 n/a n/a kkkddddddddkeeee

Repeat 617

Exon 18 /

601349 2616 2631 TTTTTGTTGTCGCAGC 71 n/a n/a ekkddddddddkkeee

Repeat 618

Exon 18 /

601388 2616 2631 TTTTTGTTGTCGCAGC 67 n/a n/a kkkddddddddkeeee

Repeat 618

Table 22

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

SEQ SEQ SEQ

SEQ ID ID ID ID SEQ

ISIS NO: NO: Target % NO:

Sequence NO: Motif ID NO 1 1 region inhibition 2

2 stop NO: start stop start

site

site site site

599357 2582 2600 Exon 18 CCACGCCCCTGTCCAGCAG 26 7817 7835 5-9-5 708

599358 2583 2601 Exon 18 CCCACGCCCCTGTCCAGCA 22 7818 7836 5-9-5 709

599359 2584 2602 Exon 18 TCCCACGCCCCTGTCCAGC 13 7819 7837 5-9-5 710

599360 2585 2603 Exon 18 ATCCCACGCCCCTGTCCAG 7 7820 7838 5-9-5 711

599361 2586 2604 Exon 18 AATCCCACGCCCCTGTCCA 11 7821 7839 5-9-5 712

599362 2587 2605 Exon 18 CAATCCCACGCCCCTGTCC 14 7822 7840 5-9-5 713

599363 2588 2606 Exon 18 TCAATCCCACGCCCCTGTC 17 7823 7841 5-9-5 714

599364 2589 2607 Exon 18 TTCAATCCCACGCCCCTGT 20 7824 7842 5-9-5 715 599365 2590 2608 Exon 18 ATTCAATCCCACGCCCCTG 22 7825 7843 5-9-5 716

599366 2591 2609 Exon 18 AATTCAATCCCACGCCCCT 13 7826 7844 5-9-5 717

599367 2592 2610 Exon 18 TAATTCAATCCCACGCCCC 11 7827 7845 5-9-5 718

599368 2593 2611 Exon 18 TTAATTCAATCCCACGCCC 10 7828 7846 5-9-5 719

599369 2594 2612 Exon 18 TTTAATTCAATCCCACGCC 19 7829 7847 5-9-5 720

599370 2595 2613 Exon 18 TTTTAATTCAATCCCACGC 23 7830 7848 5-9-5 721

599371 2596 2614 Exon 18 GTTTTAATTCAATCCCACG 4 7831 7849 5-9-5 722

599372 2597 2615 Exon 18 TGTTTTAATTCAATCCCAC 16 7832 7850 5-9-5 723

599373 2598 2616 Exon 18 CTGTTTTAATTCAATCCCA 3 7833 7851 5-9-5 724

599374 2599 2617 Exon 18 GCTGTTTTAATTCAATCCC 10 7834 7852 5-9-5 725

599375 2600 2618 Exon 18 AGCTGTTTTAATTCAATCC 17 7835 7853 5-9-5 726

599376 2601 2619 Exon 18 CAGCTGTTTTAATTCAATC 18 7836 7854 5-9-5 727

599377 2602 2620 Exon 18 GCAGCTGTTTTAATTCAAT 22 7837 7855 5-9-5 728

599378 2603 2621 Exon 18 CGCAGCTGTTTTAATTCAA 11 7838 7856 5-9-5 729

599511 2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 7 7787 7806 6-8-6 410

599389 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 22 7788 7807 6-8-6 411

599390 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 21 7789 7808 6-8-6 412

599391 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 27 7790 7809 6-8-6 413

599392 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 30 7791 7810 6-8-6 414

599393 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT 30 7792 7811 6-8-6 415

599394 2558 2577 Exon 18 CCCCTTATAGAAAACCCAAA 28 7793 7812 6-8-6 416

599395 2559 2578 Exon 18 ACCCCTTATAGAAAACCCAA 23 7794 7813 6-8-6 417

599396 2560 2579 Exon 18 AACCCCTTATAGAAAACCCA 53 7795 7814 6-8-6 418

599397 2561 2580 Exon 18 AAACCCCTTATAGAAAACCC 33 7796 7815 6-8-6 419

599398 2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 58 7797 7816 6-8-6 420

599399 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 23 7798 7817 6-8-6 421

599400 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 54 7799 7818 6-8-6 422

599401 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 30 7800 7819 6-8-6 423

599402 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 25 7801 7820 6-8-6 424

599403 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA 17 7802 7821 6-8-6 425

599404 2568 2587 Exon 18 CAGCAGGAAACCCCTTATAG 20 7803 7822 6-8-6 426

599405 2569 2588 Exon 18 CCAGCAGGAAACCCCTTATA 12 7804 7823 6-8-6 427

599406 2570 2589 Exon 18 TCCAGCAGGAAACCCCTTAT 51 7805 7824 6-8-6 428

599407 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 39 7806 7825 6-8-6 237

599408 2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 53 7807 7826 6-8-6 429

599409 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 65 7808 7827 6-8-6 430

599410 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 56 7809 7828 6-8-6 431

599411 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 60 7810 7829 6-8-6 432

599412 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 61 7811 7830 6-8-6 433

599413 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 40 7812 7831 6-8-6 238

599414 2578 2597 Exon 18 CGCCCCTGTCCAGCAGGAAA 41 7813 7832 6-8-6 434

599415 2579 2598 Exon 18 ACGCCCCTGTCCAGCAGGAA 37 7814 7833 6-8-6 435

599416 2580 2599 Exon 18 CACGCCCCTGTCCAGCAGGA 54 7815 7834 6-8-6 436 599417 2581 2600 Exon 18 CCACGCCCCTGTCCAGCAGG 36 7816 7835 6-8-6 437

599418 2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 53 7817 7836 6-8-6 438

599419 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 54 7818 7837 6-8-6 439

599420 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 50 7819 7838 6-8-6 440

599421 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 48 7820 7839 6-8-6 441

599422 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 55 7821 7840 6-8-6 442

599423 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC 75 7822 7841 6-8-6 443

599424 2588 2607 Exon 18 TTCAATCCCACGCCCCTGTC 69 7823 7842 6-8-6 444

599425 2589 2608 Exon 18 ATTCAATCCCACGCCCCTGT 77 7824 7843 6-8-6 445

599426 2590 2609 Exon 18 AATTCAATCCCACGCCCCTG 60 7825 7844 6-8-6 446

599427 2591 2610 Exon 18 TAATTCAATCCCACGCCCCT 72 7826 7845 6-8-6 447

599428 2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 81 7827 7846 6-8-6 448

599429 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 68 7828 7847 6-8-6 449

599430 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 58 7829 7848 6-8-6 450

599431 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 70 7830 7849 6-8-6 451

599432 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 85 7831 7850 6-8-6 452

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 85 7839 7858 5-10-5 317

599379 2604 2622 Exon 18 TCGCAGCTGTTTTAATTCA 73 7839 7857 5-9-5 730

599380 2605 2623 Exon 18 GTCGCAGCTGTTTTAATTC 77 7840 7858 5-9-5 731

599381 2606 2624 Exon 18 TGTCGCAGCTGTTTTAATT 69 7841 7859 5-9-5 732

599382 2607 2625 Exon 18 TTGTCGCAGCTGTTTTAAT 58 7842 7860 5-9-5 733

599383 2608 2626 Exon 18 GTTGTCGCAGCTGTTTTAA 52 7843 7861 5-9-5 734

599384 2609 2627 Exon 18 TGTTGTCGCAGCTGTTTTA 63 7844 7862 5-9-5 735

Exon 18

599385 2610 2628 TTGTTGTCGCAGCTGTTTT 53 n/a n/a 5-9-5 736

/ Repeat

Exon 18

599386 2611 2629 TTTGTTGTCGCAGCTGTTT 63 n/a n/a 5-9-5 737

/ Repeat

Exon 18

599387 2612 2630 TTTTGTTGTCGCAGCTGTT 64 n/a n/a 5-9-5 438

/ Repeat

Exon 18

599388 2613 2631 TTTTTGTTGTCGCAGCTGT 66 n/a n/a 5-9-5 739

/ Repeat

Table 23

Inhibition of CFB mRNA by MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

599219 2559 2576 Exon 18 CCCTTATAGAAAACCCAA 8 7794 7811 3-10-5 791

599220 2560 2577 Exon 18 CCCCTTATAGAAAACCCA 0 7795 7812 3-10-5 740

599221 2561 2578 Exon 18 ACCCCTTATAGAAAACCC 54 7796 7813 3-10-5 741

599222 2562 2579 Exon 18 AACCCCTTATAGAAAACC 3 7797 7814 3-10-5 742

599223 2563 2580 Exon 18 AAACCCCTTATAGAAAAC 0 7798 7815 3-10-5 743

599224 2564 2581 Exon 18 GAAACCCCTTATAGAAAA 0 7799 7816 3-10-5 744

599225 2566 2583 Exon 18 AGGAAACCCCTTATAGAA 60 7801 7818 3-10-5 745

599226 2567 2584 Exon 18 CAGGAAACCCCTTATAGA 0 7802 7819 3-10-5 746

599227 2568 2585 Exon 18 GCAGGAAACCCCTTATAG 37 7803 7820 3-10-5 747

599228 2569 2586 Exon 18 AGCAGGAAACCCCTTATA 0 7804 7821 3-10-5 748

599229 2570 2587 Exon 18 CAGCAGGAAACCCCTTAT 39 7805 7822 3-10-5 749

599230 2571 2588 Exon 18 CCAGCAGGAAACCCCTTA 10 7806 7823 3-10-5 750

599231 2572 2589 Exon 18 TCCAGCAGGAAACCCCTT 16 7807 7824 3-10-5 751

599232 2573 2590 Exon 18 GTCCAGCAGGAAACCCCT 9 7808 7825 3-10-5 752

599233 2574 2591 Exon 18 TGTCCAGCAGGAAACCCC 44 7809 7826 3-10-5 753

599234 2575 2592 Exon 18 CTGTCCAGCAGGAAACCC 14 7810 7827 3-10-5 754

599235 2576 2593 Exon 18 CCTGTCCAGCAGGAAACC 0 7811 7828 3-10-5 755

599236 2577 2594 Exon 18 CCCTGTCCAGCAGGAAAC 43 7812 7829 3-10-5 756

599237 2578 2595 Exon 18 CCCCTGTCCAGCAGGAAA 0 7813 7830 3-10-5 757

599238 2580 2597 Exon 18 CGCCCCTGTCCAGCAGGA 9 7815 7832 3-10-5 758

599239 2581 2598 Exon 18 ACGCCCCTGTCCAGCAGG 36 7816 7833 3-10-5 759

599240 2582 2599 Exon 18 CACGCCCCTGTCCAGCAG 11 7817 7834 3-10-5 760

599241 2583 2600 Exon 18 CCACGCCCCTGTCCAGCA 51 7818 7835 3-10-5 761

599242 2584 2601 Exon 18 CCCACGCCCCTGTCCAGC 7 7819 7836 3-10-5 762

599243 2585 2602 Exon 18 TCCCACGCCCCTGTCCAG 47 7820 7837 3-10-5 763

599244 2586 2603 Exon 18 ATCCCACGCCCCTGTCCA 37 7821 7838 3-10-5 764

599245 2587 2604 Exon 18 AATCCCACGCCCCTGTCC 35 7822 7839 3-10-5 765

599246 2588 2605 Exon 18 CAATCCCACGCCCCTGTC 21 7823 7840 3-10-5 766

599247 2589 2606 Exon 18 TCAATCCCACGCCCCTGT 61 7824 7841 3-10-5 767

599248 2590 2607 Exon 18 TTCAATCCCACGCCCCTG 51 7825 7842 3-10-5 768

599249 2591 2608 Exon 18 ATTCAATCCCACGCCCCT 58 7826 7843 3-10-5 769

599250 2592 2609 Exon 18 AATTCAATCCCACGCCCC 49 7827 7844 3-10-5 770

599251 2593 2610 Exon 18 TAATTCAATCCCACGCCC 46 7828 7845 3-10-5 771

599252 2594 2611 Exon 18 TTAATTCAATCCCACGCC 32 7829 7846 3-10-5 772

599253 2595 2612 Exon 18 TTTAATTCAATCCCACGC 23 7830 7847 3-10-5 773

599254 2596 2613 Exon 18 TTTTAATTCAATCCCACG 0 7831 7848 3-10-5 774

599255 2597 2614 Exon 18 GTTTTAATTCAATCCCAC 61 7832 7849 3-10-5 775

599256 2598 2615 Exon 18 TGTTTTAATTCAATCCCA 64 7833 7850 3-10-5 776

599257 2599 2616 Exon 18 CTGTTTTAATTCAATCCC 66 7834 7851 3-10-5 777

599258 2600 2617 Exon 18 GCTGTTTTAATTCAATCC 59 7835 7852 3-10-5 778

599259 2601 2618 Exon 18 AGCTGTTTTAATTCAATC 40 7836 7853 3-10-5 779

599260 2602 2619 Exon 18 CAGCTGTTTTAATTCAAT 38 7837 7854 3-10-5 780

599261 2603 2620 Exon 18 GCAGCTGTTTTAATTCAA 54 7838 7855 3-10-5 781 599509 2552 2570 Exon 18 TAGAAAACCCAAATCCTCA 54 7787 7805 6-7-6 681

599273 2553 2571 Exon 18 ATAGAAAACCCAAATCCTC 0 7788 7806 6-7-6 682

599274 2554 2572 Exon 18 TATAGAAAACCCAAATCCT 57 7789 7807 6-7-6 683

599275 2556 2574 Exon 18 CTTATAGAAAACCCAAATC 0 7791 7809 6-7-6 684

599276 2557 2575 Exon 18 CCTTATAGAAAACCCAAAT 44 7792 7810 6-7-6 685

599277 2558 2576 Exon 18 CCCTTATAGAAAACCCAAA 0 7793 7811 6-7-6 686

599278 2559 2577 Exon 18 CCCCTTATAGAAAACCCAA 0 7794 7812 6-7-6 687

599279 2560 2578 Exon 18 ACCCCTTATAGAAAACCCA 20 7795 7813 6-7-6 688

599280 2561 2579 Exon 18 AACCCCTTATAGAAAACCC 70 7796 7814 6-7-6 689

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 85 7839 7858 5-10-5 317

599262 2604 2621 Exon 18 CGCAGCTGTTTTAATTCA 49 7839 7856 3-10-5 782

599263 2605 2622 Exon 18 TCGCAGCTGTTTTAATTC 49 7840 7857 3-10-5 783

599264 2606 2623 Exon 18 GTCGCAGCTGTTTTAATT 62 7841 7858 3-10-5 784

599265 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 63 7842 7859 3-10-5 792

599266 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 41 7843 7860 3-10-5 793

599267 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 52 7844 7861 3-10-5 794

599268 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 51 7845 7862 3-10-5 795

Exon 18 /

599269 2611 2628 TTGTTGTCGCAGCTGTTT 58 n/a n/a 3-10-5 796

Repeat

Exon 18 /

599270 2612 2629 TTTGTTGTCGCAGCTGTT 69 n/a n/a 3-10-5 797

Repeat

Exon 18 /

599271 2613 2630 TTTTGTTGTCGCAGCTGT 69 n/a n/a 3-10-5 798

Repeat

Exon 18 /

599272 2614 2631 TTTTTGTTGTCGCAGCTG 72 n/a n/a 3-10-5 799

Repeat

599205 2607 2624 Exon 18 TGTCGCAGCTGTTTTAAT 54 7842 7859 5-8-5 792

599206 2608 2625 Exon 18 TTGTCGCAGCTGTTTTAA 62 7843 7860 5-8-5 793

599207 2609 2626 Exon 18 GTTGTCGCAGCTGTTTTA 62 7844 7861 5-8-5 794

599208 2610 2627 Exon 18 TGTTGTCGCAGCTGTTTT 66 7845 7862 5-8-5 795

Exon 18 /

599209 2611 2628 TTGTTGTCGCAGCTGTTT 60 n/a n/a 5-8-5 796

Repeat

Exon 18 /

599210 2612 2629 TTTGTTGTCGCAGCTGTT 62 n/a n/a 5-8-5 797

Repeat

Exon 18 /

599211 2613 2630 TTTTGTTGTCGCAGCTGT 65 n/a n/a 5-8-5 798

Repeat

Exon 18 /

599212 2614 2631 TTTTTGTTGTCGCAGCTG 67 n/a n/a 5-8-5 799

Repeat

Table 24

Inhibition of CFB mRNA by 5-10-5 MOE gapmers targeting SEQ ID NO: 1 or SEQ ID NO: 2

588571 152 171 Exon 1 CCTGGTCACATTCCCTTCCC 80 1873 1892 397

532614 154 173 Exon 1 GACCTGGTCACATTCCCTTC 65 1875 1894 12

588572 156 175 Exon 1 TAGACCTGGTCACATTCCCT 74 1877 1896 398

588573 158 177 Exon 1 CCTAGACCTGGTCACATTCC 72 1879 1898 399

588566 2189 2208 Exon 15 CCTTCCGAGTCAGCTTTTTC 66 6977 6996 400

588567 2191 2210 Exon 15 CTCCTTCCGAGTCAGCTTTT 66 6979 6998 401

532770 2193 2212 Exon 15 ACCTCCTTCCGAGTCAGCTT 64 6981 7000 198

588568 2195 2214 Exon 15 AGACCTCCTTCCGAGTCAGC 78 6983 7002 402

588569 2197 2216 Exon 15 GTAGACCTCCTTCCGAGTCA 74 6985 7004 403

588574 2453 2472 Exon 18 TTTGCCGCTTCTGGTTTTTG 71 7688 7707 404

588575 2455 2474 Exon 18 CTTTTGCCGCTTCTGGTTTT 72 7690 7709 405

532800 2457 2476 Exon 18 TGCTTTTGCCGCTTCTGGTT 71 7692 7711 228

588576 2459 2478 Exon 18 CCTGCTTTTGCCGCTTCTGG 59 7694 7713 406

588577 2461 2480 Exon 18 TACCTGCTTTTGCCGCTTCT 76 7696 7715 407

516350 2550 2569 Exon 18 AGAAAACCCAAATCCTCATC 58 7785 7804 408

588509 2551 2570 Exon 18 TAGAAAACCCAAATCCTCAT 6 7786 7805 409

588510 2552 2571 Exon 18 ATAGAAAACCCAAATCCTCA 10 7787 7806 410

588511 2553 2572 Exon 18 TATAGAAAACCCAAATCCTC 9 7788 7807 411

588512 2554 2573 Exon 18 TTATAGAAAACCCAAATCCT 80 7789 7808 412

588513 2555 2574 Exon 18 CTTATAGAAAACCCAAATCC 70 7790 7809 413

588514 2556 2575 Exon 18 CCTTATAGAAAACCCAAATC 71 7791 7810 414

588515 2557 2576 Exon 18 CCCTTATAGAAAACCCAAAT 78 7792 7811 415

588516 2558 2577 Exon 18 CCCCTTATAGAAAACCCAAA 72 7793 7812 416

588517 2559 2578 Exon 18 ACCCCTTATAGAAAACCCAA 80 7794 7813 417

588518 2560 2579 Exon 18 AACCCCTTATAGAAAACCCA 80 7795 7814 418

588519 2561 2580 Exon 18 AAACCCCTTATAGAAAACCC 62 7796 7815 419

588520 2562 2581 Exon 18 GAAACCCCTTATAGAAAACC 59 7797 7816 420

588521 2563 2582 Exon 18 GGAAACCCCTTATAGAAAAC 40 7798 7817 421

588522 2564 2583 Exon 18 AGGAAACCCCTTATAGAAAA 66 7799 7818 422

588523 2565 2584 Exon 18 CAGGAAACCCCTTATAGAAA 63 7800 7819 423

588524 2566 2585 Exon 18 GCAGGAAACCCCTTATAGAA 70 7801 7820 424

588525 2567 2586 Exon 18 AGCAGGAAACCCCTTATAGA 67 7802 7821 425

588526 2568 2587 Exon 18 CAGCAGGAAACCCCTTATAG 0 7803 7822 426

588527 2569 2588 Exon 18 CCAGCAGGAAACCCCTTATA 11 7804 7823 427

588528 2570 2589 Exon 18 TCCAGCAGGAAACCCCTTAT 15 7805 7824 428

532809 2571 2590 Exon 18 GTCCAGCAGGAAACCCCTTA 75 7806 7825 237

588529 2572 2591 Exon 18 TGTCCAGCAGGAAACCCCTT 16 7807 7826 429

588530 2573 2592 Exon 18 CTGTCCAGCAGGAAACCCCT 16 7808 7827 430

588531 2574 2593 Exon 18 CCTGTCCAGCAGGAAACCCC 19 7809 7828 431

588532 2575 2594 Exon 18 CCCTGTCCAGCAGGAAACCC 15 7810 7829 432

588533 2576 2595 Exon 18 CCCCTGTCCAGCAGGAAACC 29 7811 7830 433

532810 2577 2596 Exon 18 GCCCCTGTCCAGCAGGAAAC 74 7812 7831 238

588534 2578 2597 Exon 18 CGCCCCTGTCCAGCAGGAAA 21 7813 7832 434 588535 2579 2598 Exon 18 ACGCCCCTGTCCAGCAGGAA 16 7814 7833 435

588536 2580 2599 Exon 18 CACGCCCCTGTCCAGCAGGA 0 7815 7834 436

588537 2581 2600 Exon 18 CCACGCCCCTGTCCAGCAGG 8 7816 7835 437

588538 2582 2601 Exon 18 CCCACGCCCCTGTCCAGCAG 10 7817 7836 438

588539 2583 2602 Exon 18 TCCCACGCCCCTGTCCAGCA 23 7818 7837 439

588540 2584 2603 Exon 18 ATCCCACGCCCCTGTCCAGC 16 7819 7838 440

588541 2585 2604 Exon 18 AATCCCACGCCCCTGTCCAG 16 7820 7839 441

588542 2586 2605 Exon 18 CAATCCCACGCCCCTGTCCA 12 7821 7840 442

588543 2587 2606 Exon 18 TCAATCCCACGCCCCTGTCC 26 7822 7841 443

588544 2588 2607 Exon 18 TTCAATCCCACGCCCCTGTC 26 7823 7842 444

588545 2589 2608 Exon 18 ATTCAATCCCACGCCCCTGT 31 7824 7843 445

588546 2590 2609 Exon 18 AATTCAATCCCACGCCCCTG 22 7825 7844 446

588547 2591 2610 Exon 18 TAATTCAATCCCACGCCCCT 12 7826 7845 447

588548 2592 2611 Exon 18 TTAATTCAATCCCACGCCCC 20 7827 7846 448

588549 2593 2612 Exon 18 TTTAATTCAATCCCACGCCC 26 7828 7847 449

588550 2594 2613 Exon 18 TTTTAATTCAATCCCACGCC 32 7829 7848 450

588551 2595 2614 Exon 18 GTTTTAATTCAATCCCACGC 48 7830 7849 451

588552 2596 2615 Exon 18 TGTTTTAATTCAATCCCACG 57 7831 7850 452

588553 2597 2616 Exon 18 CTGTTTTAATTCAATCCCAC 49 7832 7851 453

588554 2598 2617 Exon 18 GCTGTTTTAATTCAATCCCA 64 7833 7852 454

532811 2599 2618 Exon 18 AGCTGTTTTAATTCAATCCC 78 7834 7853 239

588555 2600 2619 Exon 18 CAGCTGTTTTAATTCAATCC 48 7835 7854 455

588556 2601 2620 Exon 18 GCAGCTGTTTTAATTCAATC 55 7836 7855 456

588557 2602 2621 Exon 18 CGCAGCTGTTTTAATTCAAT 51 7837 7856 457

588558 2603 2622 Exon 18 TCGCAGCTGTTTTAATTCAA 51 7838 7857 458

532917 2604 2623 Exon 18 GTCGCAGCTGTTTTAATTCA 82 7839 7858 317

588559 2605 2624 Exon 18 TGTCGCAGCTGTTTTAATTC 58 7840 7859 459

588560 2606 2625 Exon 18 TTGTCGCAGCTGTTTTAATT 72 7841 7860 460

588561 2607 2626 Exon 18 GTTGTCGCAGCTGTTTTAAT 75 7842 7861 461

532952 2608 2627 Exon 18 TGTTGTCGCAGCTGTTTTAA 39 7843 7862 395

Exon 18 /

588562 2609 2628 TTGTTGTCGCAGCTGTTTTA 53 n/a n/a

Repeat 462

Exon 18 /

588563 2610 2629 TTTGTTGTCGCAGCTGTTTT 62 n/a n/a

Repeat 463

Exon 18 /

588564 2611 2630 TTTTGTTGTCGCAGCTGTTT 63 n/a n/a

Repeat 464

Exon 18 /

588565 2612 2631 TTTTTGTTGTCGCAGCTGTT 64 n/a n/a

Repeat 465 Example 8: Dose-dependent antisense inhibition of human CFB in HepG2 cells by 5-10-5 MOE gapmers

Gapmers from studies described above exhibiting in vitro inhibition of CFB mRNA were selected and tested at various doses in HepG2 cells. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.313 μΜ, 0.625 μΜ, 1.25 μΜ, 2.50 μΜ, 5.00 μΜ, or 10.00 μΜ concentrations of antisense oligonucleotide, as specified in the Table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ^® . Results are presented as percent inhibition of CFB, relative to untreated control cells.

The half maximal inhibitory concentration (IC ₅ o) of each oligonucleotide is also presented. CFB mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 25

Example 9: Dose-dependent antisense inhibition of human CFB in HepG2 cells

Gapmers from studies described above exhibiting in vitro inhibition of CFB mRNA were selected and tested at various doses in HepG2 cells. The antisense oligonucleotides were tested in a number of experiments with similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.08 μΜ, 0.25 μΜ, 0.74 μΜ, 2.22 μΜ, 6.67 μΜ, and 20.00 μΜ concentrations of antisense oligonucleotide, as specified in the Table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN . Results are presented as percent inhibition of CFB, relative to untreated control cells.

The half maximal inhibitory concentration (IC ₅₀ ) of each oligonucleotide is also presented. CFB mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 26

Table 27

Table 28

588862 25 64 85 94 96 98 0.1

588863 50 73 89 96 96 98 <0.1

588864 52 80 92 96 98 98 <0.1

588865 46 72 91 96 96 99 <0.1

588866 47 76 88 96 97 98 <0.1

588867 43 69 83 92 96 99 0.1

588868 43 56 65 84 93 97 0.1

Table 29

588539 34 65 88 95 98 98 0.1

588540 30 51 81 91 97 98 0.2

588549 31 57 82 95 96 98 0.1

588550 34 65 88 96 98 98 0.1

588551 47 66 87 96 98 99 <0.1

588557 40 84 95 98 98 98 <0.1

588558 45 73 93 97 98 99 <0.1

588559 51 69 83 96 98 99 <0.1

588565 19 56 81 92 96 98 0.2

Example 10: Dose-dependent antisense inhibition of human CFB in HepG2 cells

Gapmers from studies described above exhibiting in vitro inhibition of CFB mRNA were selected and tested at various doses in HepG2 cells. The antisense oligonucleotides were tested in a number of experiments with similar culture conditions. The results for each experiment are presented in separate tables shown below. Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.06 μΜ, 0.25 μΜ, 1.00 μΜ, and 4.00 μΜ concentrations of antisense oligonucleotide, as specified in the Table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ^® . Results are presented as percent inhibition of CFB, relative to untreated control cells.

The half maximal inhibitory concentration (IC ₅₀ ) of each oligonucleotide is also presented. CFB mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 32

599088 13 37 69 82 0.5

599089 3 36 55 79 0.7

599093 25 59 79 88 0.2

599094 19 29 75 89 0.4

599095 29 43 67 87 0.3

599096 23 51 70 88 0.3

599149 20 53 82 92 0.3

599188 0 21 62 85 0.8

Table 33

601383 53 81 86 94 <0.06

601382 41 76 88 94 0.1

601385 52 74 89 91 <0.06

601332 41 69 86 94 0.1

601345 36 75 86 95 0.1

601371 34 72 91 93 0.1

601384 50 78 91 95 <0.06

601380 28 57 83 92 0.2

601387 48 61 82 88 0.1

601341 28 65 83 91 0.2

601346 31 69 82 93 0.1

601335 24 56 85 92 0.2

Table 35

Table 36

599569 42 73 85 88 0.1

599578 29 49 82 89 0.2

599582 21 56 78 91 0.2

599590 24 62 80 90 0.2

601209 21 49 85 88 0.3

601210 34 64 86 92 0.1

601212 46 68 88 90 0.1

601213 54 80 90 92 <0.06

601214 38 77 88 95 0.1

601215 42 64 85 92 0.1

601216 45 57 76 89 0.1

601264 29 58 86 95 0.2

601278 51 82 83 93 <0.06

601279 44 80 92 96 0.1

601280 44 73 87 94 0.1

601281 51 80 91 94 <0.06

Example 11: Dose-dependent antisense inhibition of human CFB in HepG2 cells

Gapmers from studies described above exhibiting in vitro inhibition of CFB mRNA were selected and tested at various doses in HepG2 cells. Additionally, a deoxy, MOE and cEt oligonucleotide, ISIS 594430, was designed with the same sequence (CTCCTTCCGAGTCAGC, SEQ ID NO: 549) and target region (target start site 2195 of SEQ ID NO: 1 and target start site 6983 of SED ID NO: 2) as ISIS 588870, another deoxy, MOE, and cEt oligonucleotide. ISIS 594430 is a 3-10-3 cEt gapmer.

Cells were plated at a density of 20,000 cells per well and transfected using electroporation with 0.01 μΜ, 0.04 μΜ,0.12 μΜ, 0.37 μΜ, 1.11 μΜ, 3.33 μΜ, and 10.00 μΜ concentrations of antisense

oligonucleotide, as specified in the Table below. After a treatment period of approximately 16 hours, RNA was isolated from the cells and CFB mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3459 was used to measure mRNA levels. CFB mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN ^® . Results are presented as percent inhibition of CFB, relative to untreated control cells.

The half maximal inhibitory concentration (IC ₅ o) of each oligonucleotide is also presented. CFB mRNA levels were reduced in a dose-dependent manner in antisense oligonucleotide treated cells.

Table 37 588553 0 0 9 42 76 85 94 0.6

588555 0 52 23 58 78 83 95 0.3

588847 4 1 18 45 67 84 96 0.5

588848 0 3 13 38 67 83 95 0.6

594430 0 0 10 34 50 55 84 1.4

Example 12: Tolerability of MOE gapmers targeting human CFB in CD1 mice

CD1® mice (Charles River, MA) are a multipurpose mouse model, frequently utilized for safety and efficacy testing. The mice were treated with ISIS antisense oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Study 1 (with 5-10-5 MOE gapmers)

Groups of seven- week old male CD1 mice were injected subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS oligonucleotide. A group of male CD1 mice was injected subcutaneously once a week for 6 weeks with PBS. One group of mice was injected with subcutaneously once a week for 6 weeks with 100 mg/kg of control oligonucleotide ISIS 141923 (CCTTCCCTGAAGGTTCCTCC, designated herein as SEQ ID NO: 809, 5-10-5 MOE gapmer with no known murine target). Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 38

Plasma chemistry markers in CD1 mice plasma on

ISIS 532917 207 204 27

ISIS 532952 246 207 25

ISIS 141923 39 67 23

Weights

Body weights of the mice were measured on day 40 before sacrificing the mice. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 39

Wei hts of CDl mice on da 40

Study 2 (with 5-10-5 MOE gapmers

Groups of six- to eight-week old male CDl mice were injected subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS oligonucleotide. Two groups of male CDl mice were injected subcutaneously once a week for 6 weeks with PBS. One group of mice was injected with subcutaneously once a week for 6 weeks with 100 mg/kg of control oligonucleotide ISIS 141923. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies. Table 40

Plasma chemistr markers in CD1 mice lasma on da 45

Weights

Body weights of the mice were measured on day 42. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 45. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 41

Weights (g) of CD1 mice on day 40

Body Kidney Liver Spleen

PBS 44 0.7 2.4 0.1

PBS 43 0.7 2.4 0.2

ISIS 141923 43 0.6 2.4 0.2

ISIS 532810 41 0.6 1.9 0.1

ISIS 532952 43 0.6 2.4 0.2

ISIS 588534 44 0.7 2.8 0.2

ISIS 588536 43 0.7 2.7 0.2

ISIS 588537 43 0.7 2.4 0.2

ISIS 588538 44 0.7 2.8 0.2

ISIS 588539 44 0.6 2.7 0.2 ISIS 588545 44 0.8 3.3 0.3

ISIS 588547 42 0.6 3.3 0.3

ISIS 588548 43 0.6 2.8 0.2

ISIS 588549 42 0.6 2.8 0.3

ISIS 588551 39 0.6 2.2 0.2

ISIS 588552 41 0.6 2.2 0.2

ISIS 588558 44 0.7 3.3 0.3

ISIS 588559 43 0.6 2.7 0.3

ISIS 588561 40 0.7 2.4 0.3

ISIS 588563 41 0.7 2.4 0.2

Study 3 (with 5-10-5 MOE gapmers)

Groups of six- to eight-week old male CDl mice were injected subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS oligonucleotide. Two groups of male CDl mice were injected subcutaneously once a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 42

Plasma chemistry markers in CDl mice plasma on day 42

ALT AST Albumin BUN

(IU/L) (IU/L) (g/dL) (mg/dL)

PBS 37 108 3.1 30

PBS 45 51 3.0 27

ISIS 588544 209 168 2.9 26

ISIS 588546 526 279 3.0 22

ISIS 588550 82 136 2.7 25

ISIS 588553 79 105 3.0 24

ISIS 588554 112 220 3.2 19

ISIS 588555 95 162 2.8 25

ISIS 588556 345 236 3.0 26

ISIS 588557 393 420 2.8 24

ISIS 588560 109 148 2.7 27

ISIS 588562 279 284 2.8 22

ISIS 588564 152 188 3.0 23

ISIS 588565 247 271 2.8 28 Weights

Body weights of the mice were measured on day 42. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 42. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 43

Wei hts of CD1 mice on da 40

Study 4 (with (S) cEt gapmers and deoxy. MOE and cEt oligonucleotides ^' )

Groups of ten-week old male CD1 mice were injected subcutaneously once a week for 6 weeks with 50 mg/kg of ISIS oligonucleotide from the studies described above. In addition, two oligonucleotides, ISIS

594431 and ISIS 594432, were designed as 3-10-3 cEt gapmers and were also tested in this study. ISIS 594431(ACCTCCTTCCGAGTCA, SEQ ID NO: 550) targets the same region as ISIS 588871, a deoxy, MOE and cEt gapmer (target start site 2197 of SEQ ID NO: 1 and target start site 6985 of SEQ ID NO: 2). ISIS

594432 (TGGTCACATTCCCTTC, SEQ ID NO: 542) targets the same region as ISIS 588872 a deoxy, MOE and cEt gapmer (target start site 154 of SEQ ID NO: 1 and target start site 1875 of SEQ ID NO: 2).

Two groups of male CD1 mice were injected subcutaneously once a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, creatinine, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 44

Plasma chemistry markers in CD1 mice plasma on day 42

Weights

Body weights of the mice were measured on day 39. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 42. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 45

Weights (g) of CD1 mice

ISIS 588847 Deoxy, MOE and cEt 40 0.7 2.5 0.2

ISIS 588848 Deoxy, MOE and cEt 43 0.7 2.6 0.3

ISIS 588857 Deoxy, MOE and cEt 39 0.6 3.3 0.2

ISIS 588858 Deoxy, MOE and cEt 37 0.6 3.4 0.2

ISIS 588859 Deoxy, MOE and cEt 41 0.7 2.5 0.3

ISIS 588861 Deoxy, MOE and cEt 39 0.6 2.6 0.4

ISIS 588862 Deoxy, MOE and cEt 34 0.6 2.5 0.4

ISIS 588863 Deoxy, MOE and cEt 40 0.6 2.7 0.3

ISIS 588864 Deoxy, MOE and cEt 40 0.7 2.3 0.2

ISIS 588866 Deoxy, MOE and cEt 45 0.7 3.0 0.2

ISIS 594430 3-10-3 cEt 39 0.6 2.2 0.2

ISIS 594431 3-10-3 cEt 36 0.6 3.2 0.2

ISIS 594432 3-10-3 cEt 31 0.4 1.9 0.1

Study 5 (with MOE gapmers, (S) cEt gapmers and deoxy, MOE and cEt oligonucleotides)

Groups of eight- to nine-week old male CDl mice were injected subcutaneously once a week for 6 weeks with 50 mg/kg of ISIS oligonucleotide. Two groups of male CDl mice were injected subcutaneously once a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, creatinine, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS

oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 46

Plasma chemistry markers in CDl mice plasma on day 42

ALT AST Albumin Creatinine BUN

Chemistry

(IU/L) (IU/L) (g dL) (mg/dL) (mg/dL)

PBS - 33 84 2.9 0.2 28

PBS - 32 65 2.5 0.1 27

ISIS 532692 5-10-5 MOE 363 281 3.0 0.2 30

ISIS 532770 5-10-5 MOE 69 100 2.9 0.1 28

ISIS 532775 5-10-5 MOE 371 333 2.6 0.1 29

ISIS 532800 5-10-5 MOE 104 106 2.7 0.1 31

ISIS 532809 5-10-5 MOE 69 127 2.8 0.1 26

ISIS 588540 5-10-5 MOE 66 110 2.8 0.1 26

ISIS 588838 3-10-3 cEt 391 330 2.9 0.1 25

ISIS 588842 Deoxy, MOE and cEt 224 264 2.6 0.1 26 ISIS 588843 3-10-3 cEt 185 160 2.8 0.1 24

ISIS 588844 Deoxy, MOE and cEt 304 204 2.7 0.1 25

ISIS 588851 Deoxy, MOE and cEt 186 123 2.7 0.1 31

ISIS 588854 Deoxy, MOE and cEt 1232 925 2.7 0.1 25

ISIS 588855 Deoxy, MOE and cEt 425 321 2.7 0.1 28

ISIS 588856 Deoxy, MOE and cEt 78 101 2.4 0.1 31

ISIS 588865 Deoxy, MOE and cEt 126 145 2.5 0.1 23

ISIS 588867 Deoxy, MOE and cEt 108 112 2.5 0.1 32

ISIS 588868 Deoxy, MOE and cEt 61 124 2.5 0.1 28

ISIS 588870 Deoxy, MOE and cEt 48 69 2.4 0.1 31

ISIS 588871 Deoxy, MOE and cEt 723 881 2.5 0.1 24

ISIS 588872 Deoxy, MOE and cEt 649 654 2.7 0.1 26

Weights

Body weights of the mice were measured on day 40. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 42. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 47

Wei hts of CD1 mice

ISIS 588872 Deoxy, MOE and cEt 39 0.6 3.2 0.3

Study 6 (with deoxy. MOE and cEt oligonucleotides ^' )

Groups of eight- to nine-week old male CD1 mice were injected subcutaneously once a week for 6 weeks with 50 mg/kg of deoxy, MOE, and cEt oligonucleotides. Two groups of male CD1 mice were injected subcutaneously once a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, creatinine, bilirubin, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 48

Plasma chemistry markers in CD1 mice plasma on day 45

Weights

Body weights of the mice were measured on day 40. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 45. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 49

Weights (g) of CDl mice

Study 7 (with MOE gapmers and deoxy. MOE and cEt oligonucleotides ^' )

Groups of eight- to nine-week old male CDl mice were injected subcutaneously once a week for 6 weeks with 100 mg/kg of ISIS oligonucleotides. One group of male CDl mice was injected subcutaneously once a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, creatinine, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below. ISIS

oligonucleotides that caused changes in the levels of any of the liver or kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 50

Plasma chemistry markers in CDl mice plasma on day 45

ALT AST Albumin Creatinine BUN

Chemistry

(IU/L) (IU/L) (g dL) (mg/dL) (mg/dL)

PBS - 120 102 2.7 0.2 26

ISIS 588842 Deoxy, MOE and cEt 177 164 2.7 0.1 23 ISIS 588843 Deoxy, MOE and cEt 98 194 2.7 0.1 24

ISIS 588851 Deoxy, MOE and cEt 91 142 2.6 0.1 23

ISIS 588856 Deoxy, MOE and cEt 78 110 2.7 0.1 23

ISIS 599024 3-10-4 MOE 91 108 2.7 0.1 23

ISIS 599087 5-7-5 MOE 198 183 2.6 0.2 28

ISIS 599093 5-7-5 MOE 3285 2518 2.6 0.2 24

ISIS 599149 4-8-5 MOE 30 64 2.9 0.2 25

ISIS 599155 4-8-5 MOE 145 189 2.6 0.2 25

ISIS 599202 5-8-5 MOE 150 128 2.8 0.2 23

ISIS 599203 5-8-5 MOE 111 127 2.8 0.2 24

ISIS 599208 5-8-5 MOE 146 178 2.9 0.2 22

ISIS 599261 3-10-5 MOE 144 165 2.8 0.2 26

ISIS 599267 3-10-5 MOE 96 132 2.6 0.2 27

ISIS 599268 3-10-5 MOE 87 115 2.6 0.1 23

ISIS 599322 6-7-6 MOE 115 138 2.7 0.1 22

ISIS 599374 5-9-5 MOE 375 271 2.6 0.1 21

ISIS 599378 5-9-5 MOE 77 99 2.7 0.1 23

ISIS 599441 6-8-6 MOE 150 250 2.9 0.1 23

Weights

Body weights of the mice were measured on day 44. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 49. The results are presented in the Table below. ISIS oligonucleotides that caused changes in the weights outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 51

Weights (g) of CD1 mice

ISIS 599268 3-10-5 MOE 41 0.7 2.1 0.2

ISIS 599322 6-7-6 MOE 43 0.6 2.2 0.2

ISIS 599374 5-9-5 MOE 37 0.6 2.2 0.2

ISIS 599378 5-9-5 MOE 43 0.7 2.7 0.2

ISIS 599441 6-8-6 MOE 42 0.6 2.5 0.3

Study 8 (with MOE gapmers, deoxy, MOE and cEt oligonucleotides, and cEt gapmers)

Groups of eight- to nine-week old male CDl mice were injected subcutaneously once a week for 6 weeks with 100 mg/kg of MOE gapmers, or 50 mg/kg of deoxy, MOE and cEt oligonucleotides or cEt gapmers. One group of male CDl mice was injected subcutaneously once a week for 6 weeks with PBS. Mice were euthanized 48 hours after the last dose, and organs and plasma were harvested for further analysis.

Plasma chemistry markers

To evaluate the effect of ISIS oligonucleotides on liver and kidney function, plasma levels of transaminases, albumin, creatinine, and BUN were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). The results are presented in the Table below.

Table 52

Plasma chemistry markers in CDl mice plasma on day 43

Weights

Body weights of the mice were measured on day 36. Weights of organs, liver, kidney, and spleen were also measured after the mice were sacrificed on day 43. The results for the organ weights were expressed as a ratio to the body weights and normalized to the PBS control ratio. Table 53

Or an Wei hts/Bod wei ht BW of CD1 mice

Cytokine assays

Blood obtained from all mice groups were sent to Antech Diagnostics for measurements of the various cytokine levels, such as IL-6, MDC, ΜΙΡΙ β, IP- 10, MCPl, MIP-la, and RANTES. The results are presented in Table 54.

Table 54

C tokine levels /mL in CD1 mice lasma

Hematology assays

Blood obtained from all mice groups were sent to Antech Diagnostics for measurements of hematocrit (HCT), as well as of the various blood cells, such as WBC, RBC, and platelets, and total hemoglobin (Hb) content. The results are presented in Table 55. Table 55

Hematology markers in CD1 mice plasma

Example 13: Tolerability of antisense oligonucleotides targeting human CFB in Sprague-Dawley rats

Sprague-Dawley rats are a multipurpose model used for safety and efficacy evaluations. The rats were treated with ISIS antisense oligonucleotides from the studies described in the Examples above and evaluated for changes in the levels of various plasma chemistry markers.

Study 1 (with 5-10-5 MOE gapmers)

Male Sprague-Dawley rats, seven- to eight- week old, were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats each were injected subcutaneously once a week for 6 weeks with 100 mg/kg of 5-10-5 MOE gapmers. One control group of 6 rats was injected subcutaneously once a week for 6 weeks with PBS. Forty eight hours after the last dose, rats were euthanized and organs and plasma were harvested for further analysis.

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies. Table 56

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 57

Kidney function markers (mg/dL) in Sprague-Dawley rats

Weights

Body weight measurements were taken on day 39. Liver, heart, spleen and kidney weights were measured at the end of the study on day 42, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies. Table 58

Wei hts

Study 2 (with deoxy. MOE and cEt oligonucleotides ^' )

Male Sprague-Dawley rats, nine- to ten- week old, were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats each were injected subcutaneously once a week for 6 weeks with 100 mg/kg of deoxy, MOE, and cEt oligonucleotides. Two control groups of 3 rats each were injected subcutaneously once a week for 6 weeks with PBS. Forty eight hours after the last dose, rats were euthanized and organs and plasma were harvested for further analysis.

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured on day 42 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase), and albumin were measured and the results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 59

Liver function markers in Sprague-Dawley rats

ISIS 594430 85 106 3.7

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 60

Kidney function markers (mg/dL) in Sprague-Dawley rats

Weights

Body weight measurements were taken on day 39. Liver, heart, spleen and kidney weights were measured at the end of the study on day 42, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 61

Weights (g)

Study 3 (with MOE gapmers)

Male Sprague-Dawley rats, nine- to ten- week old, were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats each were injected subcutaneously once a week for 6 weeks with 100 mg/kg of MOE gapmers. One control group of 6 rats was injected subcutaneously once a week for 6 weeks with PBS. Forty eight hours after the last dose, rats were euthanized and organs and plasma were harvested for further analysis.

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured on day 43 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 62

Liver function markers in Sprague-Dawley rats

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 63

Kidney function markers (mg/dL) in Sprague-Dawley rats

Chemistry BUN Creatinine

PBS - 16 0.3 ISIS 588563 5-10-5 MOE 26 0.4

ISIS 599024 3-10-4 MOE 135 1.2

ISIS 599093 5-7-5 MOE 29 0.4

ISIS 599149 4-8-5 MOE 23 0.4

ISIS 599155 4-8-5 MOE 29 0.4

ISIS 599202 5-8-5 MOE 19 0.4

ISIS 599203 5-8-5 MOE 22 0.4

ISIS 599208 5-8-5 MOE 26 0.3

ISIS 599261 3-10-5 MOE 228 1.6

ISIS 599267 3-10-5 MOE 24 0.4

Weights

Body weight measurements were taken on day 39. Liver, heart, spleen and kidney weights were measured at the end of the study on day 42, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 64

Wei hts

Study 4 (with MOE gapmers)

Male Sprague-Dawley rats, nine- to ten- week old, were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats each were injected subcutaneously once a week for 6 weeks with 100 mg/kg of MOE gapmers. One control group of 6 rats was injected subcutaneously once a week for 6 weeks with PBS. Forty eight hours after the last dose, rats were euthanized and organs and plasma were harvested for further analysis.

Liver function

112 To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured on day 42 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 65

Liver function markers in Sprague-Dawley rats

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 66

Kidney function markers (mg/dL) in Sprague-Dawley rats

Weights

Body weight measurements were taken on day 39. Liver, heart, spleen and kidney weights were measured at the end of the study on day 42, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 67

Weights (g)

Study 5 (with MOE gapmers and deoxy. MOE and cEt oligonucleotides ^' )

Male Sprague-Dawley rats, nine- to ten- week old, were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4 Sprague-Dawley rats each were injected subcutaneously once a week for 6 weeks with 100 mg/kg of MOE gapmer or with 50 mg/kg of deoxy, MOE and cEt oligonucleotides. One control group of 4 rats was injected subcutaneously once a week for 6 weeks with PBS. Forty eight hours after the last dose, rats were euthanized and organs and plasma were harvested for further analysis.

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured on day 42 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L. ISIS oligonucleotides that caused changes in the levels of any markers of liver function outside the expected range for antisense oligonucleotides were excluded in further studies. Table 68

Liver function markers in S ra ue-Dawle rats

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, plasma and urine levels of blood urea nitrogen (BUN) and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Tables below, expressed in mg/dL. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 69

Kidney function markers (mg/dL) in the plasma of Sprague-Dawley rats

Table 70

Kidney function markers (mg/dL) in the urine of Sprague-Dawley rats

Weights

Body weight measurements were taken on day 39. Liver, heart, spleen and kidney weights were measured at the end of the study on day 42, and are presented in the Table below. ISIS oligonucleotides that caused any changes in organ weights outside the expected range for antisense oligonucleotides were excluded from further studies.

Table 71

Weights (g)

Study 6 (with MOE gapmers. deoxy. MOE and cEt oligonucleotides, and cEt gapmers)

Male rats were maintained on a 12-hour light/dark cycle and fed ad libitum with Purina normal rat chow, diet 5001. Groups of 4 rats each were injected subcutaneously once a week for 6 weeks with 100 mg/kg of MOE gapmers or with 50 mg/kg of deoxy, MOE and cEt oligonucleotide or cEt gapmer. One control group of 4 rats was injected subcutaneously once a week for 6 weeks with PBS. Forty eight hours after the last dose, rats were euthanized and organs and plasma were harvested for further analysis.

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, plasma levels of transaminases were measured on day 42 using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Plasma levels of ALT (alanine transaminase) and AST (aspartate transaminase) were measured and the results are presented in the Table below expressed in IU/L.

Table 72

Liver function markers

ISIS 588548 5-10-5 MOE 100 50 71 4.1

ISIS 588550 5-10-5 MOE 100 80 133 3.6

ISIS 588553 5-10-5 MOE 100 59 112 3.9

ISIS 588555 5-10-5 MOE 100 97 142 3.8

ISIS 588848 Deoxy, MOE and cEt 50 53 82 3.9

ISIS 594430 3-10-3 cEt 50 198 172 4.4

Kidney function

To evaluate the effect of ISIS oligonucleotides on kidney function, urine levels of total protein and creatinine were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400e, Melville, NY). Results are presented in the Table below. ISIS oligonucleotides that caused changes in the levels of any of the kidney function markers outside the expected range for antisense oligonucleotides were excluded in further studies.

Table 73

Total protein/creatinine ratio in the urine of rats

Weights

Body weight measurements were taken on day 39. Liver, heart, spleen and kidney weights were measured at the end of the study on day 42, and are presented in the Table below. The results for the organ weights were expressed as a ratio to the body weights and normalized to the PBS control ratio.

Table 74

ISIS 532809 5-10-5 MOE 100 2.2 1.1 1.0

ISIS 588540 5-10-5 MOE 100 2.2 1.4 1.0

ISIS 588544 5-10-5 MOE 100 2.5 1.3 1.1

ISIS 588548 5-10-5 MOE 100 2.1 1.3 1.1

ISIS 588550 5-10-5 MOE 100 3.9 1.4 1.1

ISIS 588553 5-10-5 MOE 100 4.1 1.4 1.4

ISIS 588555 5-10-5 MOE 100 1.8 1.3 1.0

ISIS 588848 Deoxy, MOE and cEt 50 3.1 1.3 1.1

ISIS 594430 3-10-3 cEt 50 1.7 1.0 1.1

Example 14: Efficacy of antisense oligonucleotides against CFB mRNA in hCFB transgenic mice

Selected compounds were tested for efficacy in human CFB transgenic mice, founder line #6. The human CFB gene is located on chromosome 6: position 31913721- 31919861. A Fosmid (ABC14-

50933200C23) containing the CFB sequence was selected to make transgenic mice expressing the human CFB gene. Cla I (31926612) and Age I (31926815) restriction enzymes were used to generate a 22,127 bp fragment containing the CFB gene for pronuclear injection. DNA was confirmed by restriction enzyme analysis using Pvu I. The 22,127 bp DNA fragment was injected into C57BL/6NTac embryos. 6 positive founders were bred. Founder #6 expressed the liver human CFB mRNA and was crossbreed to the 3 ^rd generation. Progeny from 3 ^rd generation mice were used to evaluate human CFB ASOs for human CFB mRNA reduction.

Treatment

Groups of 3 mice each were injected subcutaneously twice a week for the first week with 50 mg/kg of ISIS oligonucleotides, followed by once a week dosing with 50 mg/kg of ISIS oligonucleotides for an additional three weeks. One control group of 4 mice was injected subcutaneously twice a week for 2 weeks for the first week with PBS for the first week for an additional three weeks. Forty eight hours after the last dose, mice were euthanized and organs and plasma were harvested for further analysis. RNA Analysis

At the end of the dosing period, RNA was extracted from the liver and kidney for real-time PCR analysis of CFB mRNA levels. Human CFB mRNA levels were measured using the human primer probe set RTS3459. CFB mRNA levels were normalized to RIBOGREEN®, and also to the housekeeping gene, Cyclophilin. Results were calculated as percent inhibition of CFB mRNA expression compared to the control. All the antisense oligonucleotides effected inhibition of human CFB mRNA levels in the liver. Table 75

Percent reduction of CFB mRNA levels in hCFB mice

Example 15: In vivo antisense inhibition of murine CFB

Several antisense oligonucleotides were designed that were targeted to murine CFB mRNA

(GENBANK Accession No. NM 008198.2, incorporated herein as SEQ ID NO: 5). The target start sites and sequences of each oligonucleotide are described in the table below. The chimeric antisense oligonucleotides in the table below were designed as 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length, wherein the central gap segment is comprised of 10 2'-deoxynucleosides and is flanked on both sides (in the 5' and 3' directions) by wings comprising 5 nucleosides each. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2' -MOE modification. The internucleoside linkages throughout each gapmer are phosphorothioate (P=S) linkages. All cytosine residues throughout each gapmer are 5- methylcytosines.

Table 76

Gapmers targeting murine CFB

Treatment Groups of four C57BL/6 mice each were injected with 50 mg/kg of ISIS 516269, ISIS 516272, ISIS 516323, ISIS 516330, or ISIS 516341 administered weekly for 3 weeks. A control group of mice was injected with phosphate buffered saline (PBS) administered weekly for 3 weeks.

CFB RNA Analysis

At the end of the study, RNA was extracted from liver tissue for real-time PCR analysis of CFB, using primer probe set RTS3430 (forward sequence GGGCAAACAGCAATTTGTGA, designated herein as SEQ ID NO: 816; reverse sequence TGGCTACCCACCTTCCTTGT, designated herein as SEQ ID NO: 817; probe sequence CTGGATACTGTCCCAATCCCGGTATTCCX, designated herein as SEQ ID NO: 818). The mRNA levels were normalized using RIBOGREEN®. As shown in the Table below, some of the antisense oligonucleotides achieved reduction of murine CFB over the PBS control. Results are presented as percent inhibition of CFB, relative to control.

Table 77

Percent inhibition of murine CFB mRNA in C57BL/6 mice

Protein Analysis

CFB protein levels were measured in the kidney, liver, plasma, and in the eye by western Blot using goat anti-CFB antibody (Sigma Aldrich). Results are presented as percent inhibition of CFB, relative to PBS control, 'n/a' indicates that measurements were not taken for that sample. As shown in the Table below, antisense inhibition of CFB by ISIS oligonucleotides resulted in a reduction of CFB protein in various tissues. As shown in the Table below, systemic administration of ISIS oligonucleotides was effective in reducing CFB levels in the eye.

Table 78

Example 16: Dose-dependent antisense inhibition of murine CFB

Groups of four C57BL/6 mice each were injected with 25 mg/kg, 50 mg/kg, or 100 mg/kg of ISIS 516272, and ISIS 516323 administered weekly for 6 weeks. Another two groups of mice were injected with 100 mg/kg of ISIS 516330 or ISIS 516341 administered weekly for 6 weeks. Two control groups of mice were injected with phosphate buffered saline (PBS) administered weekly for 6 weeks.

CFB RNA Analysis

RNA was extracted from liver and kidney tissues for real-time PCR analysis of CFB, using primer probe set RTS3430. The mRNA levels were normalized using RIBOGREEN®. As shown in the Table below, the antisense oligonucleotides achieved dose-dependent reduction of murine CFB over the PBS control. Results are presented as percent inhibition of CFB, relative to control.

Table 79

Percent inhibition of murine CFB mRNA in C57BL/6

Protein Analysis

CFB protein levels were measured in the plasma by western Blot using goat anti-CFB antibody (Sigma Aldrich). As shown in the table below, antisense inhibition of CFB by the ISIS oligonucleotides resulted in a reduction of CFB protein. Results are presented as percent inhibition of CFB, relative to PBS control, 'n/a' indicates that measurements were not taken for that sample.

CFB protein levels were also measured in the eye by Western Blot. All treatment groups

demonstrated an inhibition of CFB by 95%, with some sample measurements being below detection levels of the assay.

Table 80

Percent inhibition of murine CFB protein in C57BL/6 mice 25 43

516323 50 80

100 90

516330 100 n/a

516341 200 n/a

Example 17: Effect of antisense inhibition of CFB in the NZB/W Fl mouse model

The NZB/W Fl is the oldest classical model of lupus, where the mice develop severe lupus-like phenotypes comparable to that of lupus patients (Theofilopoulos, A.N. and Dixon, F.J. Advances in

Immunology, vol. 37, pp. 269-390, 1985). These lupus-like phenotypes include lymphadenopathy, splenomegaly, elevated serum antinuclear autoantibodies (ANA) including anti-dsDNA IgG, a majority of which are IgG2a and IgG3, and immune complex -mediated glomerulonephritis (GN) that becomes apparent at 5-6 months of age, leading to kidney failure and death at 10-12 months of age.

Study 1

A study was conducted to demonstrate that treatment with antisense oligonucleotides targeting CFB would improve renal pathology in the mouse model. Female NZB/W Fl mice, 17 weeks old, were purchased from Jackson Laboratories. Groups of 16 mice each received doses of 100 μg/kg/week of ISIS 516272 or ISIS 516323 for 20 weeks. Another group of 16 mice received doses of 100 μg/kg/week of control oligonucleotide ISIS 141923 for 20 weeks. Another group of 10 mice received doses of PBS for 20 weeks and served as the control group to which all the other groups were compared. Terminal endpoints were collected 48 hours after the last dose was injected.

CFB RNA Analysis

RNA was extracted from liver and kidney tissue for real-time PCR analysis of CFB, using primer probe set RTS3430. The mRNA levels were normalized using RIBOGREEN®. As shown in the Table below, some of the antisense oligonucleotides achieved reduction of murine CFB over the PBS control. Results are presented as percent inhibition of CFB, relative to control.

Table 81

Percent inhibition of murine CFB mRNA in NZB/W Fl mice Proteinuria

Proteinuria is expected in 60% of animals in this mouse model. The cumulative incidence of severe proteinuria was measured by calculating the total protein to creatinine ratio using a clinical analyzer. The results are presented in the table below and demonstrate that treatment with antisense oligonucleotides targeting CFB achieved reduction of proteinuria in the mice compared to the PBS control and the control oligonucleotide treated mice.

Table 82

Percent cumulative incidence of severe proteinuria in NZB/W Fl mice

Survival

Survival of the mice was monitored by keeping count of the mice at the start of treatment and then again at week 20. The results are presented in the table below and demonstrate that treatment with antisense oligonucleotides targeting CFB increased survival in the mice compared to the PBS control and the control oligonucleotide treated mice.

Table 83

Number of surviving mice and % survival

Glomerular deposition

The amount of C3 deposition, as well as IgG deposition, in the glomeruli of the kidneys was measured by immunohistochemistry with an anti-C3 antibody. The results are presented in the table below and demonstrate that treatment with antisense oligonucleotides targeting CFB achieved reduction of both C3 and IgG depositions in the kidney glomeruli compared to the PBS control and the control oligonucleotide treated mice.

Table 84

Percent inhibition of glomerula deposition in NZB/W Fl mice

ISIS No C3 IgG

516272 45 20 516323 48 2

141923 0 0

Study 2

Female NZB/W Fl mice, 16 weeks old, were purchased from Jackson Laboratories. A group of 10 mice received doses of 100 μg/kg/week of ISIS 516323 for 12 weeks. Another group of 10 mice received doses of 100 μg/kg/week of control oligonucleotide ISIS 141923 for 12 weeks. Another group of 10 mice received doses of PBS for 12 weeks and served as the control group to which all the other groups were compared. Terminal endpoints were collected 48 hours after the last dose was injected.

CFB RNA Analysis

RNA was extracted from liver and kidney tissue for real-time PCR analysis of CFB, using primer probe set RTS3430. As shown in the table below, treatment with ISIS 516323 achieved reduction of murine CFB over the PBS control. Results are presented as percent inhibition of CFB, relative to control.

Table 85

Percent inhibition of murine CFB mRNA in NZB/W Fl mice

Proteinuria

The cumulative incidence of severe proteinuria was assessed by measuring urine total protein to creatinine ratio, as well as by measuring total microalbumin levels. The results are presented in the tables below and demonstrate that treatment with antisense oligonucleotides targeting CFB reduced proteinuria in the mice compared to the PBS control and the control oligonucleotide treated mice.

Table 86

Proteinuria in NZB/W Fl mice measured as urine microalbumin leve s (mg/dl)

Table 87

Proteinuria in NZB/W Fl mice measured as total protein to creatinine ratio Survival

Survival of the mice was monitored by keeping count of the mice at the start of treatment and then again at week 12. The results are presented in the table below and demonstrate that treatment with antisense oligonucleotides targeting CFB increased survival in the mice compared to the PBS control and the control oligonucleotide treated mice.

Table 88

Number of surviving mice

Example 18: Effect of antisense inhibition of CFB in the MRL mouse model

The MRL/lpr lupus nephritis mouse model develops an SLE-like phenotype characterized by lymphadenopathy due to an accumulation of double negative (CD4 ^" CD8 ^" ) and B220 ⁺ T-cells. These mice display an accelerated mortality rate. In addition, the mice have high concentrations of circulating immunoglobulins, which included elevated levels of autoantibodies such as ANA, anti-ssDNA, anti-dsDNA, anti-Sm, and rheumatoid factors, resulting in large amounts of immune complexes (Andrews, B. et al., J. Exp. Med. 148: 1198-1215, 1978).

Treatment

A study was conducted to investigate whether treatment with antisense oligonucleotides targeting CFB would reverse renal pathology in the mouse model. Female MRL/lpr mice, 14 weeks old, were purchased from Jackson Laboratories. A group of 10 mice received doses of 50 μg/kg/week of ISIS 516323 for 7 weeks. Another group of 10 mice received doses of 50 μg/kg/week of control oligonucleotide ISIS

141923 for 7 weeks. Another group of 10 mice received doses of PBS for 7 weeks and served as the control group to which all the other groups were compared. Terminal endpoints were collected 48 hours after the last dose was injected.

CFB RNA Analysis

RNA was extracted from liver tissue for real-time PCR analysis of CFB, using primer probe set

RTS3430. As shown in the Table below, ISIS 516323 reduced CFB over the PBS control. Results are presented as percent inhibition of CFB, relative to control.

Table 89

Percent inhibition of murine CFB mRNA in MRL/lpr mice

ISIS No 516323 68

141923 4

Renal pathology

Renal pathology was evaluated by two methods. Histological sections of the kidney were stained with Haematoxylin & Eosin. The PBS control demonstrated presence of multiglomerular crescents tubular casts, which is a symptom of glomerulosclerosis. In contrast, the sections from mice treated with ISIS 516323 showed absent crescents tubular casts with minimal bowman capsule fibrotic changes, moderate to severe segmental mesangial cell expansion and glomerular basement membrane thickening.

Accumulation of C3 in the kidney was also assessed by immunohistochemistry with anti-C3 antibodies. The whole kidney C3 immunohistochemistry intensity score was calculated by intensity scoring system, which was computed by capturing 10 glomeruli per kidney and calculation the intensity of positive C3 staining. The results are presented in the table below and demonstrate that treatment with ISIS 516323 reduced renal C3 accumulation compared to the control groups.

Table 90

Plasma C3 levels

Reduction of CFB inhibits activation of the alternative complement pathway, preventing C3 consumption and leading to an apparent elevation of plasma C3 levels. Plasma C3 levels from terminal bleed were measured by clinical analyzer. The results are presented in the table below and demonstrate that treatment with ISIS 516323 increased C3 levels (p< 0.001) in the plasma compared to the control groups.

Table 91

The results indicate that treatment with antisense oligonucleotides targeting CFB reverses renal pathology in the lupus mouse model. Example 19: Effect of antisense inhibition of CFB in the CFH Het mouse model

CFH heterozygous (CFH Het, CFH ^+/ ) mouse model expresses a mutant Factor H protein in combination with the full-length mouse protein (Pickering, M.C. et al., J. Exp. Med. 2007. 204: 1249-56). Renal histology remains normal in these mice up to six months old.

Study 1

Groups of 8 CFH ^+/" mice, 6 weeks old, each received doses of 75 mg/kg/week of ISIS 516323 or ISIS 516341 for 6 weeks. Another group of 8 mice received doses of 75 mg/kg/week of control oligonucleotide ISIS 141923 for 6 weeks. Another group of 8 mice received doses of PBS for 6 weeks and served as the control group to which all the other groups were compared. Terminal endpoints were collected 48 hours after the last dose was injected.

CFB RNA Analysis

RNA was extracted from liver and kidney tissue for real-time PCR analysis of CFB, using primer probe set RTS3430. As shown in the Table below, the antisense oligonucleotides reduced CFB over the PBS control. Results are presented as percent inhibition of CFB, relative to control.

Table 92

Percent inhibition of murine CFB mRNA in CFH ^+/" mice

Plasma C3 levels

Reduction of CFB inhibits activation of the alternative complement pathway, preventing C3 consumption and leading to an apparent elevation of plasma C3 levels. Plasma C3 levels from terminal plasma collection were measured by clinical analyzer. The results are presented in the table below and demonstrate that treatment with ISIS 516323 increased C3 to normal levels in the plasma.

Table 93

Plasma C3 leve s m /dL in CFH ^+/" mice

Study 2

Groups of 5 CFH ^+/" mice each received doses of 12.5 mg/kg/week, 25 mg/kg/week, 50 mg/kg/week, 75 mg/kg/week, or 100 mg/kg/week of ISIS 516323 or ISIS 516341 for 6 weeks. Another group of 5 mice received doses of 75 μg/kg/week of control oligonucleotide ISIS 141923 for 6 weeks. Another group of 5 mice received doses of PBS for 6 weeks and served as the control group to which all the other groups were compared. Terminal endpoints were collected 48 hours after the last dose was injected.

CFB RNA Analysis

RNA was extracted from liver and kidney tissue for real-time PCR analysis of CFB, using primer probe set RTS3430. As shown in the Table below, the antisense oligonucleotides reduced CFB over the PBS control in a dose dependent manner. Results are presented as percent inhibition of CFB, relative to control.

Table 94

Percent inhibition of murine CFB mRNA in the liver of CFH ^+/" mice

Plasma C3 levels

Reduction of CFB inhibits activation of the alternative complement pathway, preventing C3 consumption and leading to an apparent elevation of plasma C3 levels. Plasma C3 levels from terminal plasma collection were measured by clinical analyzer. The results are presented in the table below and demonstrate that treatment with ISIS oligonucleotides targeting CFB increased C3 levels in the plasma.

Table 95

Plasma C3 levels m /dL in CFH ^+/" mice

75 22.1

100 19.1

141923 75 8.9

Example 20: Effect of ISIS antisense oligonucleotides targeting human CFB in cynomolgus monkeys

Cynomolgus monkeys were treated with ISIS antisense oligonucleotides selected from studies described in the Examples above. Antisense oligonucleotide efficacy and tolerability, as well as their pharmacokinetic profile in the liver and kidney, were evaluated.

At the time this study was undertaken, the cynomolgus monkey genomic sequence was not available in the National Center for Biotechnology Information (NCBI) database; therefore cross-reactivity with the cynomolgus monkey gene sequence could not be confirmed. Instead, the sequences of the ISIS antisense oligonucleotides used in the cynomolgus monkeys was compared to a rhesus monkey sequence for homology. The human antisense oligonucleotides tested below are cross-reactive (with 0 or 1 mismatches) with the rhesus genomic sequence (GENBANK Accession No. NW 001116486.1 truncated from nucleotides 536000 to 545000, designated herein as SEQ ID NO: 3). The start and stop sites of each oligonucleotide targeted to SEQ ID NO: 3 is presented in the Table below. "Start site" indicates the 5'-most nucleotide to which the gapmer is targeted in the rhesus monkey gene sequence. 'Mismatches' indicates the number of nucleobases in the human oligonucleotide that are mismatched with the rhesus genomic sequence.

Table 96

Antisense oligonucleotides complementary to the rhesus CFB genomic sequence (SEQ ID NO: 3)

Treatment

Prior to the study, the monkeys were kept in quarantine for at least a 30 day period, during which the animals were observed daily for general health. The monkeys were 2-4 years old and weighed between 2 and 4 kg. Eleven groups of 4-6 randomly assigned male cynomolgus monkeys each were injected subcutaneously with ISIS oligonucleotide or PBS at four sites on the back in a clockwise rotation (i.e. left, top, right, and bottom), one site per dose. The monkeys were given four loading doses of PBS or 40 mg/kg of ISIS 532800, ISIS 532809, ISIS 588540, ISIS 588544, ISIS 588548, ISIS 588550, ISIS 588553, ISIS 588555, ISIS 588848, or ISIS 594430 for the first week (days 1, 3, 5, and 7), and were subsequently dosed once a week for 12 weeks (days 14, 21, 28, 35, 42, 49, 56, 63, 70, 77, and 84) with PBS or 40 mg/kg of ISIS oligonucleotide. ISIS 532770 was tested in a separate study with similar conditions with two male and two female

cynomolgus monkeys in the group.

Hepatic Target Reduction

RNA analysis

On day 86, liver and kidney samples were collected in duplicate (approximately 250 mg each) for

CFB mRNA analysis. The samples were flash frozen in liquid nitrogen at necropsy within approximately 10 minutes of sacrifice.

RNA was extracted from liver and kidney for real-time PCR analysis of measurement of mRNA expression of CFB. Results are presented as percent change of mRNA, relative to PBS control, normalized with RIBOGREEN ^® . RNA levels were also normalized with the house-keeping gene, Cyclophilin A. RNA levels were measured with the primer probe sets RTS3459, described above, or RTS4445 MGB (forward sequence CGAAGAAGCTCAGTGAAATCAA, designated herein as SEQ ID NO: 819; reverse sequence TGCCTGGAGGGCCCTCTT, designated herein as SEQ ID NO: 820; probe sequence

AGACCACAAGTTGAAGTC, designated herein as SEQ ID NO: 815).

As shown in the Tables below, treatment with ISIS antisense oligonucleotides resulted in reduction of

CFB mRNA in comparison to the PBS control. Analysis of CFB mRNA levels revealed that several of the ISIS oligonucleotides reduced CFB levels in liver and/or kidney. Here '0' indicates that the expression levels were not inhibited. '*' indicates that the oligonucleotide was tested in a separate study with similar conditions.

Table 97

Percent inhibition of CFB mRNA in the cynomolgus monkey liver relative to the PBS control

RTS3459/ RTS3459/ RTS445_MGB/ RTS445 MGB /

ISIS No Cyclophilin A RIBOGREEN Cyclophilin A RIBOGREEN

532770* 12 37 24 45 532800 54 45 56 46

588540 31 27 28 24

588548 68 67 68 67

588550 53 39 51 37

588553 74 59 74 59

588555 73 71 71 69

588848 9 0 6 0

594430 24 26 23 25

Table 9S

Percent inhibition of CFB mRNA in the cynomolgus monkey kidney relative to the PBS control

Protein analysis

Approximately 1 mL of blood was collected from all available animals at day 85 and placed in tubes containing the potassium salt of EDTA. The blood samples were placed in wet-ice or Kryorack immediately, and centrifuged (3000 rpm for 10 min at 4°C) to obtain plasma (approximately 0.4 mL) within 60 minutes of collection. Plasma levels of CFB were measured in the plasma by radial immunodiffusion (RID), using a polyclonal anti-Factor B antibody. The results are presented in the Table below. ISIS 532770 was tested in a separate study and plasma protein levels were measured on day 91 or 92 in that group.

Analysis of plasma CFB revealed that several ISIS oligonucleotides reduced protein levels in a sustained manner. ISIS 532770, which was tested in a separate study, reduced CFB protein levels on day 91/92 by 50% compared to baseline values. The reduction in plasma CFB protein levels correlates well with liver CFB mRNA level reduction in the corresponding groups of animals.

Table 99

Plasma protein levels (% baseline values) in the cynomolgus monkey

Day 1 Day 30 Day 58 Day 72 Day 86

PBS 113 115 95 83 86

ISIS 532800 117 68 52 39 34

ISIS 532809 104 121 100 80 71 ISIS 588540 108 72 61 40 38

ISIS 588544 118 74 53 33 29

ISIS 588548 110 41 28 20 16

ISIS 588550 104 64 54 38 37

ISIS 588553 97 42 35 18 16

ISIS 588555 107 35 37 18 18

ISIS 588848 116 95 92 69 71

ISIS 594430 104 64 59 45 46

Tolerability studies

Body weight measurements

To evaluate the effect of ISIS oligonucleotides on the overall health of the animals, body and organ weights were measured and are presented in the Table below. '*' indicates that the oligonucleotide was tested in a separate study with similar conditions and is the average of the measurements from male and female monkeys. The results indicate that effect of treatment with antisense oligonucleotides on body and organ weights was within the expected range for antisense oligonucleotides.

Table 100

Final bod wei hts in c nomol us monke

Table 101

Final organ weights (g) in cynomolgus monkey

Spleen Heart Kidney Liver

PBS 2.8 11.6 11.9 55.8

ISIS 532770* 5.0 11.3 20.6 77.9

ISIS 532800 6.2 11.9 18.6 94.4

ISIS 588540 4.0 11.4 13.5 67.1

ISIS 588548 4.1 11.7 17.3 72.0 ISIS 588550 5.8 10.9 18.5 81.8

ISIS 588553 5.0 12.7 17.2 85.9

ISIS 588555 4.7 11.8 15.9 88.3

ISIS 588848 5.0 12.7 14.4 75.7

ISIS 594430 3.9 11.9 14.8 69.9

Liver function

To evaluate the effect of ISIS oligonucleotides on hepatic function, blood samples were collected from all the study groups. The blood samples were collected from the cephalic, saphenous, or femoral veins, 48 hours post-dosing. The monkeys were fasted overnight prior to blood collection. Blood (1.5 mL) was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged (approximately 3,000 rpm for 10 min) to obtain serum. Levels of various liver function markers were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan).

Plasma levels of ALT and AST were measured and the results are presented in the Table below, expressed in IU/L. Bilirubin, a liver function marker, was similarly measured and is presented in the Table below expressed in mg/dL. '*' indicates that the oligonucleotide was tested in a separate study with similar conditions and is the average of the measurements from male and female monkeys. The results indicate that most of the antisense oligonucleotides had no effect on liver function outside the expected range for antisense oligonucleotides.

Table 102

Liver chemistry marker levels in cynomolgus monkey plasma on day 86

Kidney function To evaluate the effect of ISIS oligonucleotides on kidney function, blood samples were collected from all the study groups. The blood samples were collected from the cephalic, saphenous, or femoral veins, 48 hours post-dosing. The monkeys were fasted overnight prior to blood collection. Blood was collected in tubes without anticoagulant for serum separation. The tubes were kept at room temperature for a minimum of 90 minutes and then centrifuged (approximately 3,000 rpm for 10 min) to obtain serum. Levels of BUN and creatinine were measured using a Toshiba 200FR NEO chemistry analyzer (Toshiba Co., Japan). Results are presented in the Table below, expressed in mg/dL. '*' indicates that the oligonucleotide was tested in a separate study with similar conditions and is the average of the measurements from male and female monkeys.

For urinalysis, fresh urine from all the animals was collected in the morning using a clean cage pan on wet ice. Food was removed overnight the day before urine collection but water was supplied. Urine samples (approximately 1 mL) were analyzed for protein to creatinine (P/C) ratio using a Toshiba 200FR NEO automated chemistry analyzer (Toshiba Co., Japan). 'n.d.' indicates that the urine protein level was under the detection limit of the analyzer.

The plasma and urine chemistry data indicate that most of the ISIS oligonucleotides did not have any effect on the kidney function outside the expected range for antisense oligonucleotides.

Table 103

Renal chemistry marker levels (mg/dL) in cynomolgus monkey plasma on day 86

Table 104

Total Protein/Creatinine ratio in cynomolgus monkey

Day 44 Day 86

PBS 0.03 n.d.

ISIS 532800 0.01 n.d.

ISIS 532809 0.01 n.d. ISIS 588540 0.03 n.d.

ISIS 588544 0.01 0.09

ISIS 588548 0.01 0.01

ISIS 588550 0.04 0.01

ISIS 588553 0.05 n.d.

ISIS 588555 0.03 0.03

ISIS 588848 0.09 n.d.

ISIS 594430 0.03 n.d.

Hematology

To evaluate any effect of ISIS oligonucleotides in cynomolgus monkeys on hematologic parameters, blood samples of approximately 0.5 mL of blood was collected from each of the available study animals in tubes containing K ₂ -EDTA. Samples were analyzed for red blood cell (RBC) count, white blood cells (WBC) count, individual white blood cell counts, such as that of monocytes, neutrophils, lymphocytes, as well as for platelet count, hemoglobin content and hematocrit, using an ADVIA120 hematology analyzer (Bayer, USA). The data is presented in the Tables below. '*' indicates that the oligonucleotide was tested in a separate study with similar conditions and is the average of the measurements from male and female monkeys.

The data indicate the oligonucleotides did not cause any changes in hematologic parameters outside the expected range for antisense oligonucleotides at this dose.

Table 105

Table 106

Hematologic parameters in cynomolgus monkeys ISIS 532770* 12.4 40.9

ISIS 532800 12.3 40.5

ISIS 532809 12.2 40.4

ISIS 588540 12.5 41.5

ISIS 588544 11.9 38.1

ISIS 588548 12.3 39.6

ISIS 588550 13.4 45.0

ISIS 588553 12.6 39.8

ISIS 588555 11.6 38.1

ISIS 588848 13.2 42.7

ISIS 594430 13.4 43.1

Measurement of oligonucleotide concentration

The concentration of the full-length oligonucleotide was measured in the kidney and liver tissues. The method used is a modification of previously published methods (Leeds et al., 1996; Geary et al., 1999) which consist of a phenol-chloroform (liquid-liquid) extraction followed by a solid phase extraction. Tissue sample concentrations were calculated using calibration curves, with a lower limit of quantitation (LLOQ) of approximately 1.14 μg/g. The results are presented in the Table below, expressed as μg/g liver or kidney tissue.

Table 107

Antisense oligonucleotide distribution