OLDE, Björn (Västergatan 6, Lund, S-222 29, SE)
RÖME, Daniel (Stenbocksgatan 6, Malmö, S-211 50, SE)
STERNER, Olov (Giggatan 24, Malmö, S-21242, SE)
GODDARD, Christopher (Frank B. Dehn & Co, St. Bride's House10 Salisbury Square, London EC4Y 8JD, GB)
OWMAN, Christer (Smaviltsgränden 6, Lund, S-226 52, SE)
OLDE, Björn (Västergatan 6, Lund, S-222 29, SE)
RÖME, Daniel (Stenbocksgatan 6, Malmö, S-211 50, SE)
STERNER, Olov (Giggatan 24, Malmö, S-21242, SE)
| VIII. CLAIMS
1. Use of a compound having formula (I) in the manufacture of a medicament for the treatment of diabetes and/or cancer;
A 1 is an optional unsubstituted benzene or naphthalene carbocyclic aromatic or a heterocyclic aromatic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain at least one nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom; or
A 1 is a carbo-aromatic group selected from benzene, with up to four substituents, and napthalene substituted with up to six substituents, wherein said substituents are independently chosen from C 1 -C 6 straight-chained or branched alkyl groups , halogen, OH, CN, CF 3 and NR a R b, and may be in any position of the ring; R 3 and R b are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 3 ;
R 3 is chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight- chained or branched acyl groups, CN, and COR 4 ;
R 4 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups; R 1 is H; an unsubstituted aromatic or non-aromatic carbocyclic or heterocyclic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom; or R 1 is an aromatic or non-aromatic carbocyclic or heterocyclic group substituted with up to six substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, halogen, OH, CN, CF 3 , and NR 5 R 6 in any position of the ring;
R 5 and R 6 are independently chosen from H, C 1 -C 6 straight-chained, or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 7 ; R 7 is H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups CN, or COR 8 ;
R 8 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups,
X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; halogen; NR 9 R 1O ; R 9 and R 10 are independently selected from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups; OH; and OR 11 ;
R 11 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 2 -C 6 straight-chained or branched acyl groups; or CN; COR 12 ;
R 12 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 1 -C 6 straight-chained or branched alkoxy groups;
Y 1 is carbonyl; CH 2 ; N; S; O; R 13 ; OR 13; R 13 C=Oor OR 13 C=O; Ri 3 is C 1 -C 12 straight-chained or branched alkyl groups; or C 2 -C 12 straight-chained or branched alkenyl groups having at least one unsaturation; all optionally unsubstituted or substituted with at least one halo group. Z 1 Is N 5 S 5 O 5 R 14 Or OR 14 ;
R 14 is C 1 -C 6 straight-chained or branched alkyl groups; or Z 1 is any carbo- or heterocycle both aromatic and non-aromatic; or Z 1 is any carbo- or heterocycle both non- and aromatic preceded or succeeded by a C 1 -C 6 straight-chained or branched alkyl chain; or
Z 1 is any of the previous structures fused to the adjacent aromatic ring.
2. Use of claim 1 wherein Al is present and is selected from benzene, naphthalene, cyclohexane, decalin, pyridine and indole, optionally substituted with up to four groups independently selected from H 5 C 1 -C 6 alkyl groups , Cl 5 F 5 Br 5 OH 5 CN 5 CF 3 , NR a R b, wherein R a and R b are as defined in claim 1.
3. Use as claimed in claim 1 or claim 2 wherein R 1 is H
4. Use as claimed in any of claims 1 to 3 wherein X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; F 5 Cl 5 Br or NH 2 .
5. Use as claimed in any of claims 1 to 4 wherein Y 1 is CH 2 ; O; R 13 ; OR 13; R 13 COO or OR 13 COO 5 wherein R 13 is methyl, ethyl, n-propyl, iso-propyl or C 4 -C 8 n-alkyl.
6. Use as claimed in any of claims 1 to 5 wherein Z 1 is O 5 Rj 4 or ORi 4, wherein Rj 3 is • methyl, ethyl, n-propyl, iso-propyl, n-butyl, n-pentyl or n-hexyl.
7. Use as claimed in any of claims 1 to 6 wherein the chain length is six, seven, eight, nine, ten, eleven or twelve.
8. Use as claimed in any of claims 1 to 7 wherein the compound of formula (I) is a compound of formula (II) ;
wherein
L is a linker group selected from methyl, methylquinoline, methylisoquinoline, methylbenzoxazole, methylchroman, methylbenzeneoxy, methylindole, methylpyridine and methylnaphthyleneoxy, each unsubstituted, or optionally substituted with one or more C 1- C 6 alkyl, halo, OH, CN, CF 3 and/or NH 2 groups;
Q is a hydrocarbon chain selected from C 3 to C 14 n-alkyl or C 3 to Q 4 n-alkenyl groups, each optionally substituted one or more methyl, ethyl and/or halo group; and T is a tail group selected from H 5 OR 15 and COOR 15 , where R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, fluorobenzyl, trifluoromethylbenzyl.
9. Use as claimed in claim 8 wherein L is methyl; Q is a C 4 to Cn n-alkyl chain or a C 4 to C 11 n-alkenyl chain having one or two double bonds; and T is H, OMe or OEt.
10. Use as claimed in claim 8 wherein L is methylnapthyleneoxy; Q is C 3 to C 6 n-alkyl chain or a C 3 to C 6 n-alkenyl chain having one or two double bonds; T is OR 15 COOR 15 ; and R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl.
11. Use as claimed in claim 8 wherein L is methylbenzeneoxy; Q is C 3 to C 6 n-alkyl chain or a C 3 to C 6 n-alkenyl chain having one or two double bonds; T is OR 15 COOR 15 ; and R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl.
12. Use as claimed in any of claims 1 to 8 wherein the compound- is selected from HH2.1, HH3.1, HH5.2, HH5.3, HH 6.1, HH6.2, HH6.3, HH6.4, HH9.2, HH9.3, and HH9.4
13. Use of a compound as defined in any of claims 1 to 12 as a modulator of GPR40.
14. Use as claimed in claim 13 as a partial agonist of GPR40.
15. A pharmaceutical composition, which comprises a compound as defined in any of claims 1 12 and at least one pharmaceutically acceptable carrier or excipient.
16. A pharmaceutical composition as claimed in claim 15 wherein said compound as defined in any of claims 1 12 is present in an amount sufficient to provide an antidiabetic effect following administration.
17. A pharmaceutical composition as claimed in claim 15 or claim 16 wherein the composition is suitable for administration orally, subcutaneously, intramuscularly, intravenously, intraperitonealy, intranasaly, rectally, transcutaneously, or by inhalation.
18. A pharmaceutical composition as claimed in claim 15 or claim 16 in the form of a pharmaceutically tolerable tablet, coated tablet, capsule, liquid, emulsion, suspension, solution, powder,
gel, cream, ointment, patch or suppository.
19. An antidiabetic compound that binds to GPR40, being a compound as defined in any of claims 1 to 12.
20. A method of treating diabetes or cancer, which comprises administering to a mammal an amount of at least one compound as defined in any of claims 1 to 12 in an amount effective for treating diabetes or cancer.
21. A method as claimed in claim 20 which does not also include the administration of a 4-oxobutanoic acid.
22. The method as claimed in claim 21 , wherein the compound is administered by an oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal route.
23. A compound as defined in any of claims 8 to 12 wherein Q is a hydrocarbon chain selected from C 3 to C 14 n-alkyl or C 3 to C 14 n-alkenyl groups, each optionally unsubstituted, or substituted one or more methyl, ethyl and/or halo groups.
24. Use of a compound having formula (III) in the manufacture of a medicament for the treatment of diabetes and/or cancer;
wherein
A 1 and A 2 are independently selected from an unsubstituted benzene (6 carbons by definition) or naphthalene (10 carbons in two fused rings by definition) carbo- or heterocyclic aromatic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (examples of preferred systems are benzene, naphthalene, cyclohexane, decalin, pyridine and indole; or
A 1 are independently selected from a benzene or napthalene carbo-aromatic group substituted with up to four (benzene) or six (naphthalene) substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups , halogen, OH, CN, CF 3 and NR 1 R 2 in any position of the ring; A 1 and A 2 are independently selected from a substituted or unsubstituted 5- membered carbo- or heterocyclic aromatic ring;
R 1 and R 2 are independently chosen from H, Cj-C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 3 ;
R 1 is a heterocycle, -SO 3 H, -PO 3 H 2 , -NO 2 , carboxylic acid, or a cyclic or acyclic derivative thereof; or
R 3 is chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight- chained or branched acyl groups, CN, and COR 4 ;
R 4 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups;
R 1 is an unsubstituted aromatic or non-aromatic carbocyclic or heterocyclic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (examples of preferred systems are benzene, naphthalene, cyclohexane, decalin, pyridine and indole; or
R 1 is an aromatic. or non-aromatic carbocyclic or heterocyclic group substituted with up to six substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, halogen, OH, CN, CF 3 , and NR 1 R 2 in any position of the ring;
R 5 and R 6 are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 7 ;
R 7 is H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups CN, or COR 8 ;
R 8 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups,
X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; halogen; NR 9 R 1O ;
X 1 is H, any substituent both free or fused resulting in a heterocycle with the adjacent aromatic ring any chain consisting of any combination of C, N, O or S exceeding 2 in length;
R 9 and R 10 are independently selected from H, Cj-C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups; OH; and OR 11 ;
R 11 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 2 -C 6 straight-chained or branched acyl groups; or CN; COR 12 ; and
R 12 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 1 -C 6 straight-chained or branched alkoxy groups.
25. Use of a compound as defined in claim 24 as a modulator of GPR40.
26. Use as claimed in claim 25 as a partial agonist of GPR40.
27. Use as claimed in any of claims 24 to 26, wherein the compound is chosen from tolfenamic acid, mefenamic acid, meclofenamic acid, flufenamic acid, diclofenac, N- phenylanthranilic acid, N-(3-nitropheny) anthranilic acid, and N-(2-nitrophenyl) anthranilic acid.
28. An antidiabetic compound that binds to GPR40 having the formula as defined in claim 24.
29. A pharmaceutical composition, which comprises a compound as defined in claim 24 in an amount sufficient to produce an antidiabetic effect and a pharmaceutically acceptable carrier thereof. |
Therapeutϊc Modulators of GPR40
I. TECHNICAL FIELD
The invention relates to chemical compounds, pharmaceutical compositions, and to methods of making them. It also relates to methods of using these compounds and compositions to treat and manufacture medicaments to treat diabetes and cancers, such as breast cancer and prostate cancer. Specifically, the invention relates to compositions comprising thiazoladinediones and fenamates and their properties as ligands of fatty acid receptors.
H. BACKGROUND ART
Lipids are dietary components that perform the well-characterized metabolic function of providing energy to the cell. There is increasing evidence that lipids also serve both as extracellular chemical messenger receptor ligands and intracellular messengers that receive chemical signals generated by lipid ligands. Fatty acid receptors can act as "nutritional sensors." These fatty acid receptors, like the odorant receptors, can sense external chemical signals in the physiological environment and elicit a biological response from an effector cell. The discovery of specific free fatty acid receptors on the cell surface suggested that lipids, specifically, free fatty acids (FFAs), can regulate cell function. The first receptors to be associated with the signalling function of lipids were the intracellular nuclear peroxisomal proliferator-activated receptors (PPAR) FFA receptors, which serve as transcription factors. FFAs have also been reported to activate members of the G-protein- coupled receptor (GPCR) superfamily present on the cell surface.
GPCRs that bind to FFA ligands display a range of ligand specificity, patterns of expression, and function. For example, GPR40 and GPRl 20 are activated by medium to
long-chain free fatty acids, and short-chain fatty acids activate GPR41 and GPR43 (Kotarsky et at, Hirasawa et at, Nilsson et at, Brown et at). Each GPR displays a characteristic tissue distribution. GPR40 is preferentially expressed in pancreatic beta cells and other cells and tissues associated with the pathophysiology of type 2 diabetes (Salehi et al).
The pathogenesis of type 2 diabetes is characterized by beta cell dysfunction and progressive insulin resistance with compensatory hyperinsulinemia, marked by declining insulin secretion and increasing hyperglycemia. The long-term adaptation of the beta cell mass to rising glucose concentration is achieved mainly by increasing the number of beta cells through hyperplasia and neogenesis (Bonner- Weir).
Type 2 diabetes is also characterized by elevated plasma levels of long-chain FFAs, which further impair beta cell secretion. Normally, FFAs provide essential fuel to the beta cell, but they become toxic when chronically present at elevated levels. In the endocrine pancreas, short-term exposure of beta cells to dietary fatty acids potentiates glucose-induced insulin release, while long term exposure impairs insulin secretion and induces lipotoxicity (Unger). High levels of FFAs have been implicated in several lipotoxic effects, including loss of beta cell mass by apoptosis, inhibition of the insulin gene expression, and increasing insulin resistance in peripheral tissues (Nakamichi et al. ; Shimabukuro et at). Besides their effect on insulin secretion, FFAs have been reported to influence glucagon and somatostatin release (Gremlich et al.). Although it has been generally considered that metabolic coupling, for example, modulating the cytosolic concentration of long chain Coenzyme A, is involved in FFA regulation of insulin secretion (Deeney et al), the mechanism by which FFAs influence insulin secretion are not currently well understood.
GPR40(-/-) knockout mice are protected against obesity-induced hyperinsulinemia, hypertriglyceridemia, hepatic steatosis, increased hepatic glucose output, hyperglycemia, and glucose intolerance, all of which are conditions present in diabetes (Steneberg et ah). GPR40 mediates these pathological conditions, thus blocking this receptor in individuals that express the receptor is predicted to treat or prevent these conditions. Thus, there is a need for agents that modulate the target receptor GPR40 for the prevention and treatment of diabetes.
Methods of screening and identifying agents that affect fatty acid metabolism have been described (for example, US 2004/0019109). There remains a need for improved therapeutic agents that act on free fatty acid receptors, both as agonists and as antagonists. III. SUMMARY OF THE INVENTION
The invention provides certain compounds which are useful in therapy, in the manufacture of medicaments for the treatment of diabetes and/or cancer, in methods of treatment of diabetes and/or cancer using such compounds, in pharmaceutical compositions containing those compounds and as modulators of GRP40. The compounds are typically antidiabetic and anticancer compounds that specifically bind to GPR40 and have the formula:
A 1 is an optional unsubstituted benzene or naphthalene carbocyclic aromatic or a
heterocyclic aromatic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain at least one nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (preferred groups being quinoline, isoquinoline, benzoxazole, chroman, benzene, indole, pyridine, and naphthylene); or
A 1 is a carbo-aromatic group selected from benzene, with up to four substituents, and napthalene substituted with up to six substituents, wherein said substituents are independently chosen from C 1 -C 6 straight-chained or branched alkyl groups , halogen, OH, CN, CF 3 andNR a R b, and may be in any position of the ring; R 3 and R b are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 3 ;
R 3 is chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight- chained or branched acyl groups, CN, and COR 4 ;
R 4 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups;
R] is H; an unsubstituted aromatic or non-aromatic carbocyclic or heterocyclic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom; or R 1 is an aromatic or non-aromatic carbocyclic or heterocyclic group substituted with up to six substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, halogen, OH, CN, CF 3 , and NR 5 R 6 in any position of the ring;
R 5 and R 6 are independently chosen from H, Cj-C 6 straight-chained, or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 7 ;
R 7 is H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups CN, or COR 8 ;
Rg is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups, X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; halogen; NR 9 R 10 ;
R 9 and R 10 are independently selected from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups; OH; and OR 11 ;
R 11 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 2 -C 6 straight-chained or branched acyl groups; or CN; COR 12 ; R 12 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 1 -C 6 straight-chained or branched alkoxy groups;
Y 1 is carbonyl; CH 2 ; N; S; O; R 13 ; 0R 13; R 13 C=Oor OR 13 C=O; R 13 is C 1 -C 12 straight-chained or branched alkyl groups; or C 2 -C 12 straight-chained or branched alkenyl groups having at least one unsaturation; all optionally unsubstituted or substituted with at least one halo group. Z 1 is N, S, O, R 14 or OR 14 ;
R 14 is C 1 -C 6 straight-chained or branched alkyl groups; or Z 1 is any carbo- or heterocycle both aromatic and non-aromatic; or Z 1 is any carbo- or heterocycle both non- and aromatic preceded or succeeded by a C 1 -C 6 straight-chained or branched alkyl chain; or
Z 1 is any of the previous structures fused to the adjacent aromatic ring. The alkyl, acyl, and alkoxy groups defined above and throughout this text can be substituted -with up to three substituents chosen from halogen, OH, OCH 3 , OCH 2 CH 3 , CN,
CF 3 , NH 2 , NHCH 3 and N(CHj) 2 where context allows.
For clarity, where group Al is absent, group Y 1 will bond directly to the carbon attached to group X 1 . This corresponds, for example, to linker group L being methyl in the structures of formula II described below. In a less preferred embodiment, group Al may be a non-aromatic cyclic group such as cyclohexane or decalin.
A preferred subset of the useful compounds described above includes the following compounds of formula (II): These compounds are useful in all aspects of the invention.
wherein
L is a linker group selected from methyl, methylquinoline, methylisoquinoline, methylbenzoxazole, methylchroman, methylbenzeneoxy, methylindole, methylpyridine and methybiaphthyleneoxy, each unsubstituted, or optionally substituted with one or more C 1- C 6 alkyl, halo, OH, CN, CF 3 and/or NH 2 groups, methyl, methylbenzeneoxy and methybiaphthyleneoxy being preferred ;
Q is a hydrocarbon chain selected from C 3 to C 14 n-alkyl or C 3 to C^n-alkenyl groups, each optionally substituted one or more methyl, ethyl and/or halo group; and T is a tail group selected from H, OR 15 and COOR 15 , where R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, fluorobenzyl, trifluoromethylbenzyl.
The invention also provides that the compound described above can be an agonist, a partial agonist, or an antagonist of GPR40.
The invention provides the compound described above, wherein the compound is HH2.1, HH3.1, HH5.2, or HH5.3, as described hereinafter. The invention also provides the compound described above, wherein the compound is HH 6.1, HH6.2, HH6.3, HH6.4, HH9.2, HH9.3, or HH9.4, as described hereinafter.
The invention further provides a pharmaceutical composition, which comprises a compound described above in an amount sufficient to produce an antidiabetic effect or anticancer effect and a pharmaceutically acceptable carrier. The invention provides a compound as described above for use in therapy.
The invention provides an antidiabetic and anticancer compound that binds to GPR40 having the formula
wherein A 1 and A 2 are independently selected from an unsubstituted benzene (6 carbons by definition) or naphthalene (10 carbons in two fused rings by definition) carbo- or heterocyclic aromatic group with one ring containing 5 or 6 atoms or two fused rings
containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (examples of preferred
systems are benzene, naphthalene, cyclohexane, decalin, pyridine and indole; or
A 1 are independently selected from a benzene or napthalene carbo-aromatic group substituted with up to four (benzene) or six (naphthalene) substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups , halogen, OH, CN, CF 3 and NR 1 R 2 in any position of the ring;
A 1 and A 2 are independently selected from a substituted or unsubstituted 5- membered carbo- or heterocyclic aromatic ring;
R 1 and R 2 are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 3 ; R 1 is a heterocycle, -SO 3 H, -PO 3 H 2 , -NO 2 , carboxylic acid, or a cyclic or acyclic derivative thereof; or
R 3 is chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight- chained or branched acyl groups, CN, and COR 4 ;
R 4 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups;
R 1 is an unsubstituted aromatic or non-aromatic carbocyclic or heterocyclic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (examples of preferred systems are benzene, naphthalene, cyclohexane, decalin, pyridine and indole; or
R 1 is an aromatic or non-aromatic carbocyclic or heterocyclic group substituted with up to six substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, halogen, OH, CN, CF 3 , and NRjR 2 in any position of the ring;
R 5 and R 6 are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl
groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 7 ;
R 7 is H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups CN, or COR 8 ;
R 8 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups,
X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; halogen; NRpR 10 ;
X 1 is H, any substituent both free or fused resulting in a heterocycle with the adjacent aromatic ring any chain consisting of any combination of C, N, O or S exceeding 2 in length; R 9 and R 10 are independently selected from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups; OH; and OR 11 ;
R 11 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 2 -C 6 straight-chained or branched acyl groups; or CN; COR 12 ; and
R 12 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 1 -C 6 straight-chained or branched alkoxy groups.
The invention also provides that the compound described above can be a partial agonist of GPR40.
The invention provides the compound described above, wherein the compound is chosen from tolfenamic acid, mefenamic acid, meclofenamic acid, flufenamic acid, diclofenac, N-phenylanthranilic acid, N-(3-nitropheny) anthranilic acid, and N-(2- nitrophenyl) anthranilic acid, and derivatives thereof.
The invention further provides a pharmaceutical composition, which comprises a compound described above in an amount sufficient to produce an antidiabetic effect or anticancer effect and a pharmaceutically acceptable carrier thereof.
In another aspect, the invention provides a method of treating diabetes or cancer, which comprises administering to a mammal an amount of any of the compounds described above, or a combination thereof, in an amount effective for treating diabetes or cancer. The compound can be administered to a mammal for veterinary use, or preferably to a human, by an oral, topical, sublingual, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal route. As used herein throught, "diabetes" applies preferably to type 2 diabetes.
In a yet still further aspect the invention provides for the use of a compound of formulae I, II and/or III as described herein as a modulator of GPR40, use of such compounds as partial agonists of GPR40, and pharmaceutical compositions comprising such a compound and at least one pharmaceutically acceptable carrier or excipient.
IV. BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts a method for the preparation of glitazone derivatives. FIG. 2 depicts a method for the preparation of aliphatic thiazolidinediones.
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate aspects and/or embodiments of the invention, and together with the written description, serve to explain the principles of the invention.
FIG. 3 depicts Fenamate Structures. Fenamates, for example (A) meclofenamic acid, (B) flufenamic acid, and (C) mefenamic acid, are differentiated by their aryl substituents.
FIG. 4 depicts the results of an oral glucose tolerance test, blood glucose, for Compound ciglitazone.
FIG. 5 depicts the results of an oral glucose tolerance test, AUC, for Compound ciglitazone.
FIG. 6 depicts the results of plasma insulin measurements at time 15 minutes during the oral glucose tolerance test for Compound ciglitazone.
FIG. 7 depicts the results of an oral glucose tolerance test, blood glucose, for Compound HH 2.1 in Table 1. FIG. 8 depicts the results of an oral glucose tolerance test, AUC, for Compound
HH 2.1 in Table 1.
FIG. 9 depicts the results of plasma insulin measurements at time 15 minutes during the oral glucose tolerance test for Compound HH 2.1 in Table 1.
FIG. 10 depicts the results of an oral glucose tolerance test, blood glucose, for Compound HH 9.4 in Table 1.
FIG. 11 depicts the results of an oral glucose tolerance test, AUC, for Compound HH 9.4 in Table 1. V. DETAILED DESCRIPTION OF THE INVENTION
Definitions The terms used herein have their ordinary meanings, as set forth below, and can be further understood in the context of the specification. Unless defined otherwise, the meanings of all technical and scientific terms used herein are those commonly understood by one of ordinary skill in the art to which this invention belongs.
A "receptor" is a polypeptide that binds to a specific ligand. "Modulate" refers to the production, either directly or indirectly, of an increase or a decrease, a stimulation, inhibition, interference, or blockage in a measured activity when compared to a suitable control.
A "modulator" of a polypeptide or polynucleotide or an "agent" are terms used interchangeably herein to refer to a substance that affects, for example, increases, decreases,
stimulates, inhibits, interferes with, or blocks a measured activity of the polypeptide or polynucleotide, when compared to a suitable control.
An "agonist" is a substance that mimics or enhances the function of an active molecule.
An "antagonist" is a molecule that interferes with the activity or binding of another molecule such as an agonist, for example, by competing for the one or more binding sites of an agonist, but does not induce an active response.
"Treatment," as used herein, covers any administration or application of remedies for disease in a mammal, including a human, and includes inhibiting the disease, arresting its development, or relieving the disease, for example, by causing regression, or restoring or repairing a lost, missing, or defective function; or stimulating an inefficient process.
"Prophylaxis," as used herein, includes preventing a disease from occurring or recurring in a subject that may be predisposed to the disease. Treatment and prophylaxis can be administered to an organism, or to a cell in vivo, in vitro, or ex vivo. The cell can subsequently be administered to the subj ect.
A "pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid, or liquid filler, diluent, encapsulating material, formulation auxiliary, or excipient of any conventional type. A pharmaceutically acceptable carrier is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
With respect to ranges of values, the invention encompasses each intervening value between the upper and lower limits of the range to at least a tenth of the lower limit's unit, unless the context clearly indicates otherwise. Further, the invention encompasses any other
stated intervening values. Moreover, the invention also encompasses ranges excluding either or both of the upper and lower limits of the range, unless specifically excluded from the stated range.
With respect to chemical formulae used herein, the term Cx-Cy is used herein to indicate an organic hydrocarbon moiety having between x and y carbon atoms (inclusive) and is used to indicate all possible isomers of such moieties unless indicated otherwise, hi particular, C 1 -C 6 is used herein (unless otherwise stated, e.g. to be an n-alkyl group) to indicate all isomers including any of methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, t-butyl, n-pentyl, isopentyl, sec-pentyl, neopentyl, tert-pentyl, n-hexyl, isohexyl, sec-hexyl, tert-hexyl, neo-hexyl etc. Similarly all alkenyl groups include all isomeric positions of double bonds, and all cis/trans isomers unless otherwise indicated.
It must be noted that, as used herein and in the appended claim, the singular forms "a," "or," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "the agent" includes reference to one or more agents and equivalents thereof known to those skilled in the art.
Further, all numbers expressing quantities of ingredients, reaction conditions, % purity, polypeptide and polynucleotide lengths, and so forth, used in the specification, are modified by the term "about," unless otherwise indicated. Accordingly, the numerical parameters set forth in the specification are approximations that may vary depending upon the desired properties of the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claim, each numerical parameter should at least be construed in light of the number of reported significant digits, applying ordinary rounding techniques. Nonetheless, the numerical values set forth in the
specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors from the standard deviation of its experimental measurement.
Thiazolidinediones Thiazolidinediones (TZD) are antidiabetic pharmaceuticals intended primarily for therapy of type 2 diabetes (Bloomgarden). The antidiabetic effects of TZDs have been classified into two general actions: adipogenesis with adipose tissue remodeling and insulin sensitization. Adipogenesis and adipose tissue remodeling have been linked to PPARγ activation (Furnsinn et al). However, a growing body of evidence indicates that insulin sensitization, particularly in liver and muscle tissue, is mediated by a non-PPAR mechanism (Brunmair et al). Novel therapeutic agents of the TZD class thus can affect one or more different intracellular pathways to achieve a therapeutic effect.
TZDs control hyperglycemia by targeting these fundamental defects manifest in the disease state. They protect pancreatic beta cells against free fatty acid-induced lipotoxicity. They improve insulin sensitivity and beta cell function, both when used as monotherapeutic agents and in combination with other antidiabetic agents. The TRIPOD (TRoglitazone In the Prevention Of Diabetes) report documents the potential for thiazolidinediones to delay progression to type 2 diabetes, including via mechanisms unrelated to PPARγ activation (Azen et al.). TZDs activate GPR40 that is recombinantly expressed in human HeLa cells (U.S.
Application 20040019109). GPR40 activation has been shown to mediate fatty acid- stimulated insulin secretion from pancreatic beta cells (Salehi; Steneberg et al). TZD compounds compete with the GPR40 agonists oleic and linoleic acid. They display a biphasic dose response curve, indicating they are partial agonists. Yuan et al. have shown
that the TZD rosiglitazone blocks acute fatty acid-stimulated insulin secretion from rat pancreatic islets. Thus, some novel TZD compounds can modulate fatty acid-stimulated insulin secretion, for example, by inhibiting fatty acid activation of GPR40. The present invention provides TZD compounds, which act as modulators, for example, partial agonists, of GPR.40 and which are capable of modulating insulin secretion at therapeutically relevant concentrations.
While currently known TZDs can be effective anti-diabetic agents, they are not effective in some applications requiring anti-diabetic therapy. For example, TZDs increased the insulin sensitivity of approximately two-thirds of patients at high risk for type 2 diabetes, but had no prophylactic or therapeutic effect on the remaining one-third (Snitker et al). Novel TZDs with a demonstrated effect on the GPR40 receptor can provide therapeutic compounds for patients with needs that are not met with currently available compounds. The novel compounds of the invention, which are directed against GPR40 were designed, for example, by combining aspects of fatty acid structure with different thiazolidinedione-based scaffolds. The resulting set of compounds was tested on GPR40 reporter cells as described in more detail in Example 9. The synthesized compounds were screened both for their ability to directly stimulate GPR40 and to antagonize oleic acid activation of GPR40, using rosiglitazone as a positive control.
Some of the screened compounds demonstrated both an ability to directly stimulate GPR40 and an ability to antagonize oleic acid activation of GPR40 at lower concentrations, as demonstrated by their ability to block oleic acid-stimulated phosphatidylinositol (PI) hydrolysis in transfected HEK293 cells. These compounds are partial GPR40 agonists. They are shown in Table 1. A group of compounds exemplified by HH5.2, HH5.3, HH2.1, and HH3.1 require a chain length exceeding six to achieve significant activation of the
receptor. Increasing their chain length beyond 10 reduces receptor activation. Thus, this invention provides compounds in which the chain length is 4 to 18, preferably 5, or 6 to 10.
As used herein, the term "chain length" is used to indicate the total number of atoms beyond the "linker" moiety, such as the methylnaphthyleneoxy group to the furthest point in the molecule.
For another group of compounds exemplified by HH 6.1, HH6.2, HH6.3, HH6.4, HH9.2, HH9.3, and HH9.4, it was found that the esters generally resulted in both higher potency and efficacy. Potency correlated with the length of the alkyl chain while efficacy correlated with the aromatic system. The presence of a hydrogen-bond acceptor in the tail also contributed to their effects.
Antagonism studies indicated that the group of compounds exemplified by HH2.1, HH3.1, HH5.2, and HH5.3 were most potent as GPR40 antagonists. A chain length of eight gave the strongest inhibition of GPR40 function. Antagonism studies on HH 6.1, HH6.2, HH6.3, HH6.4, HH9.2, HH9.3, and HH9.4 showed that the presence of a terminal hydrogen- bond acceptor and a chain-length of at least six increased the antagonist properties of the compound.
In an alternative analysis, the above preference for chain length can be represented by the number of consecutive CH 2 groups in the molecule. This is believed to represents the "lipid" character of the molecule and thus be relevant to blocking of FFA effects. In particular, known TZDs typically have a "tail" portion containing no more than two consecutive CH 2 groups. In one preferred aspect, the molecules of the present invention contain at least 3 consecutive CH 2 groups in the molecule (e.g. 3 to 14). This may particularly preferably be as part of the L and/or Q groups in formula II. The group Q may
thus preferably be a C 3 to C 14 n-alkyl or C 3 to C 14 n-alkenyl group, although the lower limits of these may be C 4 or C 5 and the upper limits more preferably C 10 or C 8 .
General formulae for the TZD compounds of the present invention are given above as formulae (I) and (II) in those, the following are preferable, individually and in combination where context allows:
Al is present and is selected from benzene, naphthalene, cyclohexane, decalin, pyridine and indole, optionally substituted with up to four groups independently elected from H, C 1 -C 6 alkyl groups , Cl, F, Br, OH, CN, CF 3 , NR 3 R b , wherein R 3 and R b are as defined above. In particular, H, methyl, ethyl , Cl, F, Br, OH amd NH 2 substituents are preferable and most suitable Al groups are benzene and naphthalene.
R 1 is H in many preferred compounds.
X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; F, Cl, Br or NH 2 , especially
H.
Y 1 is CH 2 ; O; R 13 ; OR 13; R 13 COOor OR 13 COO, wherein R 13 is methyl, ethyl, n- propyl, iso-propyl or C 4 -C 8 n-alkyl. As indicated above the alkyl chain formed by Y 1 and/or Z 1 is preferably 3 to 14 carbons.
Z 1 is O, R 14 or OR 14, wherein R 13 is methyl, ethyl, n-propyl, iso-propyl, n-butyl, n- pentyl or n-hexyl.
The TZD compound of formula (I) is preferably a compound of formula (II);
wherein
L is a linker group selected from methyl, methylquinoline, methylisoquinoline, methylbenzoxazole, methylchroman, methylbenzeneoxy, and methylnaphthyleneoxy, each unsubstituted, or optionally substituted with one or more C 1- C 6 alkyl, halo, OH, CN, CF 3 and/or NH 2 groups; Q is a hydrocarbon chain selected from C 3 to C 14 n-alkyl or C 3 to C 14 n-alkenyl groups, each optionally substituted one or more methyl, ethyl and/or halo group; and
T is a tail group selected from H, OR 15 and COOR 15 , where R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, fluorobenzyl, trifluoromethylbenzyl.
In formula II, the following are preferable both individually and in combination:; L is methyl;
Q is a C 2 to C 11 n-alkyl chain or a C 4 to C 11 n-alkenyl chain having one or two double bonds, especially C 3 to Cn, most preferably C 4 to C 8 . These groups may be unsubstituted or substituted with one or more methyl, ethyl, Cl 5 F and/or Br group ; and
T is H, OMe or OEt. In formula II, the following are preferable both individually and in combination:;
L is methylnapthyleneoxy, unsubstituted, or substituted with one or more methyl, ethyl, halo, OH or CF 3 groups;
Q is C 2 to C 6 n-alkyl chain or a C 3 to C 6 n-alkenyl chain having one or two double bonds, especially C 3 to C 6 , most preferably C 4 to C 5 . These groups may be unsubstituted or substituted with one or more methyl, ethyl, Cl, F and/or Br group; and
T is OR 15 COOR 15 ; and R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, preferably R 15 is H, methyl or ethyl.
In formula II, the following are preferable both individually and in combination:;
L is methylbenzeneoxy, unsubstituted, or substituted with one or more methyl, ethyl, halo, OH or CF 3 groups;
Q is C 2 to C 6 n-alkyl chain or a C 3 to C 6 n-alkenyl chain having one or two double bonds, especially C 3 to C 6 , most preferably C 4 to C 5 . These groups may be unsubstituted or substituted with one or more methyl, ethyl, Cl, F and/or Br group; and
T is OR 15 COOR 15 ; and R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, preferably R 15 is H, methyl or ethyl.
As indicated above, in all embodiments, Q, or L and Q together where L is methyl, preferably form an n-alkyl chain of 3 to 14 carbons, preferably 4 to 10 carbons and especially 4 to 8 or 5 to 8 carbons.
In a related embodiment, the maximum number of non-hydrogen atoms between group L and the end of the molecule furthest from the thiazolidinedione ring (that is to say the chain length of groups Q and T together) should be 4 to 18 atoms, preferably 5 to 12 atoms (e.g. 6 to 12 atoms) and more preferably 6 to 10 atoms. The "chain length" and number of CH 2 groups of the exemplified compounds is listed below as examples of suitable compounds in this aspect of the invention:
Table 1 below provides common TZD compounds and TZD compounds which were identified using the screening methods described herein and in U.S. Application 20040019109. Table 1 lists the name of each structure (Substance Name) and provides the
chemical formula of the agonists and antagonists of exemplary claimed compounds (Structure), Table 1 lists the effective concentration at which 50% inhibition is observed for each compound (pEC 50 ). Table 1 also lists the relative efficacy of each compound compared to (Relative Efficacy) and the relative ability of each compound to inhibit oleic acid stimulation of GPR40 (Relative Inhibition). Finally, Table 1 lists the experimental standard error of the mean (SEM).
Table 1
*Relative inhibition is defined as the ability of a compound (30 μM) to block oleic acid (30 μM) stimulated PI hydrolysis in HEK293 cells transfected with the mouse GPR40 gene and expressing receptors at high density. **ND=No Data; ***NE=No Effect.
Many existing TZD compounds are known, as are their methods of production by extraction and by standard synthetic methods. All of the compounds of the present invention are accessable to one of normal skill in the art by those known methods, and in particular by those methods in combination with the methods and Examples described herein.
Fenamates
Fenamates share a common structure based on N-arylanthranilic acid and are differentiated by their aryl substituents, as exemplified by meclofenamic acid (FIG. 3A), flufenamic acid (FIG. 3B) 5 and mefenamic acid (FIG. 3C). Fenamates were originally described as NSAID-type anti-inflammatory agents primarily used as first-line therapeutic agents for treating arthritis. Fenamates act by blocking arachidonic acid metabolism through the cyclooxygenase enzyme. Some fenamates are also known to inhibit arachidonic acid lipoxygenase, resulting in decreased synthesis of the inflammatory mediators leukotrienes.
Studies suggest that flufenamic and tolfenamic acids suppress proliferation of human peripheral blood lymphocytes by a mechanism involving the inhibition of calcium influx, which is not related to the inhibition of prostanoid synthesis. Thus, novel fenamates that modulate GPR40, but do not suppress lymphocyte proliferation, would have a lower risk of hematological side effects than some currently available fenamate compounds.
Like TZDs, fenamates display a biphasic dose response curve when competing with oleic or linoleic acid, indicating they are partial agonists of GPR40. The present invention provides the results of an evaluation of N-arylanthranilic acids, including N- phenylanthranilic acid as scaffolds for designing GPR40 ligands.
In order to assess the agonistic and antagonistic properties of compounds based on these scaffolds towards GPR40, reporter cells expressing recombinant GPR40 were stimulated with test compounds. The results are shown in Table 2.
Table 2 provides common fenamate compounds and fenamate compounds which were identified using the screening methods described herein and in U.S. Application 20040019109. Table 2 lists the name of each structure (Substance Name) and provides the chemical formula of the agonists and antagonists of exemplary
claimed compounds (Structure). Table 2 lists the effective concentration at which 50% inhibition is observed for each compound (pEC 50 ). Table 2 also lists the relative efficacy of each compound compared to (Relative Efficacy) and the relative ability of each compound to inhibit oleic acid stimulation of GPR40 (Relative Inhibition). Finally, Table 2 lists the experimental standard error of the mean (SEM). Table 2
* Relative inhibition is defined as the ability of a compound (30 μM) to block oleic acid (30 MM) stimulated PI hydrolysis in HEK293 cells transfected with the mouse GPR40 gene and expressing receptors at high density. **ND=No Data; ***NE=No Effect.
As shown in Table 2, tolfenamic acid, mefenamic acid, and meclofenamic acid all activated GPR40. Flufenamic acid, diclofenac, and N-phenylanthranilic acid did not activate GPR40. N-(3-nitropheny) anthranilic and N-(2-nitrophenyl) anthranilic acid activated GPR40 to a lesser extent than tolfenamic acid, mefenamic acid, and meclofenamic acid.
Tolfenamic acid, mefenamic acid and meclofenamic acid were less potent than some of the most potent known fatty acid activators of GPR40 but displayed potencies within a therapeutic range. All of the tested compounds which demonstrated the ability to
activate the human GPR40 receptor also displayed antagonistic properties, as determined by their ability to block oleic acid-stimulated PI hydrolysis in transfected HEK293 cells. This indicates they are partial agonists of GPR40. This also indicates that the N-phenylanthranilic acid scaffold has intrinsic antagonistic properties. The general structure of the fenamate compounds of the invention, which interact with GPR40, is shown in formula (III) above.
The TZD and fenamate compounds of the invention can be prepared using conventional techniques. For example, FIG. 1 depicts a method for the preparation of glitazone derivatives. Either 4-hydroxybenzyl alcohol (1) or 6-hydroxy-2-hydroxymethyl naphthalene (2) (e.g. by reduction from 6-hydroxy-2-carboxylic acid) were combined with the corresponding bromide ester (3). The mixture was refluxed overnight with 1,8- dizabicyclo[5.4.0]undec-7-ene (DBU), as shown in (a), and extracted to obtain the pure ether (4). This ether (4) was mixed with pyridinium chlorochromate adsorbed onto alumina and evaporated to the aldehyde (5), as shown in (b). This aldehyde (5) was refluxed with thiazolidinedione (6) and precipitated to produce the olefin (7), as shown in (e). This olefin (7) was reduced by hydrogenation to produce the glitazone (8), as shown in (d).
FIG. 2 depicts a method for the preparation of aliphatic thiazolidinediones. A carboxylic acid (9) was mixed with its corresponding thionyl chloride and refluxed. Bromine was added, as shown in (a) to produce the corresponding α-brominated methyl ester (10), which was in turn refluxed with thiourea, acidified, extracted, and evaporated, as shown in (6), to the desired product (11).
Diabetes and cancer treatment is achieved when the compounds of the present
invention are administered to a subject requiring such treatment as an effective oral, parenteral, or intravenous dose of from 0.01 to 300 mg/kg of body weight per day. It is to be understood, however, that for any particular subject, specific dosage regimens should be adjusted according to the individual need and the professional judgment of the person administering or supervising the administration of the compound. It is to be further understood that the dosages set forth herein are exemplary.
With respect to cancer treatment, the present compounds are particularly effective in the treatment of carcinomas such as adenocarcinomas. Colorectal cancer, is a cancer particularly suitable for treatment with the present compounds. Effective amounts of the compounds of the present invention can be administered to a subject by any one of several methods, for example, orally as in capsules or tablets, parenterally in the form of sterile solutions or suspensions, and in some cases intravenously in the form of sterile solutions.
The compounds of the present invention, while effective themselves, can be formulated and administered in the form of their pharmaceutically acceptable addition salts for purposes of stability, convenience of crystallization, increased solubility, and the like. Preferred pharmaceutically acceptable addition salts include salts of mineral acids, for example, hydrochloric acid, sulfuric acid, nitric acid, and the like; salts of monobasic carboxylic acids, for example, acetic acid, propionic acid, and the like; salts of dibasic carboxylic acids, for example, maleic acid, fumaric acid, and the like; and salts of tribasic carboxylic acids, such as carboxysuccinic acid, citric acid, and the like.
Effective quantities of the compounds of the invention can be administered orally, for example, with an inert diluent or with an edible carrier. They can be enclosed in gelatin
capsules or compressed into tablets. For the purposes of oral therapeutic administration, compounds of the invention can be incorporated with an excipient and used in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums, and the like. These preparations should contain at least 0.5% of active compound of the invention, but can be varied depending upon the particular form and can conveniently be between 4% to about 70% of the weight of the unit. The amount of active compound in such a composition is such that a suitable dosage will be obtained. Preferred compositions and preparations according to the present invention are prepared so that an oral dosage unit form contains between 1.0-300 milligrams of the active compound of the invention. Tablets, pills, capsules, troches, and the like can also contain the following ingredients: a binder, such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient, such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, corn starch, and the like; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; and a sweetening agent such as sucrose; or saccharin, or a flavoring agent, such as peppermint, methyl salicylate, or orange flavoring. When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier such as a fatty oil. Other dosage unit forms can contain various materials that modify the physical form of the dosage unit, for example, as coatings. Thus, tablets or pills can be coated with sugar, shellac, or other enteric coating agents. A syrup can contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes, colorings, and flavors. Materials used in preparing these various compositions should be pharmaceutically pure and non-toxic in the amounts used.
For the purpose of parenteral therapeutic administration, the active compound of the
invention can be incorporated into a solution or suspension. These preparations should contain at last 0.1% of active compound, but can be varied between 0.5 and about 50% of the weight thereof. The amount of active compounds in such compositions is such that a suitable dosage will be obtained. Preferred compositions and preparations according to the present invention are prepared so that a parenteral dosage unit contains between 0.5 to 100 milligrams of active compound.
Solutions or suspensions can also include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methyl parabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates, and agents for the adjustment of tonicity, such as sodium chloride or dextrose. The parenteral preparation can be enclosed in ampules, disposable syringes, or multiple dose vials made of glass or plastic .
The compounds of the present invention are capable of sustained release in mammals for a period of several days or from about one to four weeks when formulated and administered as depot preparations, as for example, when injected in a properly selected pharmaceutically acceptable oil. The preferred oils are of vegetable origin, such as sesame oil, cottonseed oil, corn oil, coconut oil, soybean oil, olive oil and the like, or they are synthetic esters of fatty acids and polyfunctional alcohols, such as glycerol or propyleneglycol.
The depot compositions of the present invention are prepared by dissolving a highly
lipophilic ester, amide or carbamate of the instant invention in a pharmaceutically acceptable oil under sterile conditions. The oil is selected so as to obtain a release of the active ingredient over a desired period of time. The appropriate oil can easily be determined ■ by consulting the literature, or without undue experimentation by one skilled in the art. An appropriate dose of a compound in accordance with this embodiment of the invention is from about 0.01 to 10 mg/kg of body weight per injection. Preferably, the depot formulations of this invention are administered as unit dose preparations comprising about 0.5 to 5.0 ml of a 0.1 to 20% weight/weight solution of compound in the oil. It is to be understood that the doses set forth herein are exemplary only and that they do not, to any extent, limit the scope or practice of the invention. VI. EXAMPLES
The examples, which are intended to be purely exemplary of the invention and should therefore not be considered to limit the invention in any way, also describe and detail aspects and embodiments of the invention discussed above. The examples are not intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (for example, amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.
Example 1: Materials
Materials were obtained from commercial suppliers and were used without further purification. Meclofenamic acid was obtained from Acros (Geel, Belgium). All other chemicals were from Sigma-Aldrich (St. Louis, MO). Tetrahydrofuran was dried by
refluxing over sodium/benzophenone ketyl immediately prior to use. Flash chromatography was performed on 60 A 35-70 pm Matrex silica gel (Grace Amicon; Danvers, MA), while thin layer chromatography analyses were made on Silica Gel 60 F 254 (Merck; Whitehouse Station, NJ) plates and visualized under ultraviolet light. Example 2: Synthesis of Thiazolidinediones and Fenamates
Ciglitazone was synthesized as described by Takeda Yakuhin Kogyo Kabushiki Kaisha in EP 0 008 203 Al. Darglitazone was synthesized as described by Pfizer Int. in EP 0 332 332 Al. Englitazone was synthesized as described by Pfizer Inc. in WO 86/07056. Isaglitazone was synthesized as described by Mitsubishi Kasei Corporation in EP 0 604 983 AL Pioglitazone was synthesized as described by Takeda Chemical Industries, Ltd. in EP 0 193 256 Al. Rosiglitazone was synthesized as described by the Beecham Group PLC in EP 0 309 228 Al. Troglitazone was synthesized as described in Japanese Patent 60-51189.
HHO.1 (tolfenamic acid) was synthesized as described by Parke, Davis & Co. in BE612424. HH0.2 (mefenamic acid was synthesized as described by Whitehouse et al (1962); Winder et al (1962); and by Parke, Davis & Co. in BE612424. HH0.3
(melcofenamic acid) was synthesized as described in DEl 149015 by Parke, Davis & Co. HH0.4 (diclofenac) was synthesized as described inNL6604752 by A-G. HH0.5 (flufenarnic acid) was synthesized as described by Wilkinson et al (1948). N- phenylanthranilic acid was synthesized as described by Wieland et al (1915). N-(2- nitrophenyl)-anthranilic acid and N-(3-nitrophenyl)-anthranilic acid were synthesized as described by Ullmann (1908).
Example 3: Preparation of Glitazone Derivatives
As shown in FIG. 1, step 1 in the preparation of glitazone derivatives involved the
synthesis of the aromatic ether. To a solution of one mole of 4-hydroxybenzyl alcohol (1) or 6-hydroxy-2-naphthalenecarboxylic acid (2) (synthesized as described below), and 1.8 mole of the corresponding bromide ester (3) in acetonitrile, 1.3 mole of 1,8- dizabicyclo[5.4.0]undec-7-ene were added, and this solution was refluxed overnight. Upon recovery to room temperature, chloroform was added, and this solution was extracted with 0.05 M aqueous hydrochloric acid. The organic phase was then extracted with brine and dried over magnesium sulfate. The residue after evaporation was purified by flash chromatography with toluene and ethyl acetate to obtain the pure ether (4).
Step 2 in the preparation involved the oxydation of the alcohol. Pyridinium chlorochromate (1.5 mole) was adsorbed onto neutral alumina in a 1 :25 ratio of pyridinium chlorochromate to alumina. The resulting powder was mixed with the ether (4) at a temperature ranging between 0°C and 5°C and allowed to react at room temperature for one hour. Then enough ethylic ether was added to make a slurry, which was filtered through a short plug of neutral alumina and washed with an ether solvent until the washings showed no more than a trace of the ether (4). The solvent was evaporated to produce an aldehyde (5).
Step 3 involved condensation with thiazolidinedione. An equimolar mixture of the aldehyde (5) and thiazolidinedione (6) was dissolved in toluene containing one drop of piperidine and one drop of acetic acid. The mixture was refluxed for four hours and then allowed to stand overnight at room temperature. The olefin solid that precipitated (7) was filtered, washed with ether, and dried.
Step 4 involved reduction of the olefin. A solution of the olefin (7) dissolved in 1,4- dioxane was hydrogenated in the presence of 10% palladium over carbon at 60 psi for 50
hours at room temperature. The mixture was filtered through a bed of celite and the filtrate evaporated to produce glitazone (8).
Example 4: Preparation of 6-Hydroxy-2-Hydroxymethyl-Naphthalene (2)
Two moles of a borane/tetrahydrofuran complex solution was added dropwise at room temperature, over a period of 25 minutes to a solution of one mole of 6-hydroxy-2- naphthalenecarboxylic acid and 3,9 mole of trimethyl borate in anhydrous tetrahydrofuran. This mixture was then stirred for 3.5 hours at room temperature. After completion of the reaction, the mixture was cooled with ice-water, and vigorously stirred at room temperature for 30 minutes. Evaporation of the solvent produced the product 6-Hydroxy-2- Hydroxymethyl-Naphthalene (6-hydroxy-2-naphthyl carbinol) as white plates.
Example 5: Synthesis of HH 9.3
One mole of glitazone (8) was mixed with 15 moles of sodium hydroxide and dissolved in ethanol. This mixture was refluxed for 1.5 hours; then cooled to room temperature. Hydrochloric acid (2N) was then added until the glitazone was essentially completely precipitated. This precipitate was filtered, washed with water, and vacuum dried.
Example 6: Preparation of Aliphatic Thiazolidinediones
As shown in Figure 2, step 1 of the preparation of aliphatic thiazolidinediones involves the synthesis of α-brominated methyl esters. A mixture of five moles of a thionyl chloride and the corresponding carboxylic acid (9) was refluxed for one hour, then allowed to cool. One mole of bromine was added, and this mixture was stirred at 70°C for 16 hours. After cooling, two milliliters of methanol were added dropwise and the mixture was allowed to react for 30 minutes. The methanol was evaporated and the excess of thionyl chloride was co-evaporated with heptane to produce the corresponding α-brominated methyl ester (10).
Step 2 of the preparation of aliphatic thiazolidinediones involved the synthesis of the thiazolidinedione ring. Thiourea (1.3 moles) was dissolved in ethanol and the α- brominated methyl ester (10) was added. This mixture was refluxed for two hours, allowed to cool, and acidified with 2N hydrochloric acid. This mixture was refluxed for 15 hours. After the mixture cooled, water was added, and the mixture extracted with chloroform. The organic layer was washed with water and dried over magnesium sulfate. The solvent was then evaporated to afford the desired product (11).
Example 7: Structures Determined by Nuclear Magnetic Resonance
HH2.1: 1 H-NMR δ 9.26 (IH 3 brs), 4.27 (IH, dd, J=9.3/4.1 Hz), 2.15 (IH, m), 1.89 (IH, m), 1.44 (2H, m), 1.27 (1OH, m), 0.87 (3H, t, J=6.8 Hz); 13 C-NMR δ 176.1, 171.9, 52.3, 33.1, 32.1, 29.5, 29.4, 29.2, 27.2, 22.9, 14.4.
HH3.1: 1 H-NMR δ 9.22 (IH, brs), 4.26 (IH, dd, J=9.3/4.1 Hz), 2.15 (IH, m), 1.87 (lH,m), 1.45 (2H,m), 1.25 (14H,m),0.87 (3H,t, J=7.1 Hz); 13 C-NMR δ 176.0, 171.8, 52.3, 33.1, 32.2, 29.8, 29.8, 29.6, 29.6, 29.3, 27.3, 23.0, 14.4.
HH6.2: 1 H-NMR δ 8.93 (IH, brs), 7.12 (2H, d, J=8.5 Hz), 6.83 (2H, d, J=8.5 Hz), 4.49 (IH, dd, J=9.5/3.9 Hz), 4.12 (2H, q, J=7.1 Hz), 3.94 (2H, m), 3.44 (IH, dd, J=14.1/3.9 Hz), 3.07 (IH, dd, J=14.1/9.5 Hz), 2.37 (2H, m), 1.80 (4H, m), 1.24 (3H, t, J=7.1 Hz).
HH6.3: 1 H-NMR δ 8.05 (IH, brs), 7.73 (IH, d, J=4.7 Hz), 7.70 (IH, d, J=4.7 Hz), 7.60 (IH, s), 7.30 (IH, d, J=8.3 Hz), 7.20 (IH, d, J=8.3 Hz), 7.15 (IH, brs), 4.60 (IH, dd, J=9.5/3.6 Hz), 4.17 (2H, q, J=7.1 Hz), 4.10 (2H, t, J=5.3 Hz), 3.70 (IH, dd, J=13.0/3.6 Hz),3.20 (IH, dd, J=13.0/9.5 Hz), 2.42 (2H, t, J=5.9 Hz), 1.90 (4H, m), 1.27 (3H, t, J=7.1 Hz); 13 C-NMR δ 174.9, 173.6, 171.1, 157.0, 133.7, 130.9,128.7,127.8, 127.3, 127.3, 119.4,
106.3,67.3,60.3,53.6,38.6,33.8,28.5,21.6,14.1.
HH6.4: 1 H-NMR δ 8.14 (IH, d, J=9.2 Hz), 7.87 (2H, d, J=8.2 Hz), 7.57 (IH, m), 7.42 (2H, m), 7.36 (IH, d, J=2.5 Hz), 4.87 (IH, dd, J=I 1.4/3.3 Hz), 4.44 (IH, dd, J=14.4/3.3 Hz), 4.33 (2H, q, J=7.1 Hz), 4.28 (2H, t, J=6.4 Hz), 3.49 (IH, dd, J=UAfUA Hz), 2.54 (2H, t, J=7.4 Hz), 2.07 (2H, m), 1.93 (2H, m), 1.76 (2H, m), 1.45 (3H, t, J=7.1 Hz); 13 C-NMR δ
175.3, 173.9, 171.5, 157.1, 135.5, 132.6, 127.4, 126.6,126.1,124.9,124.5, 119.6,
107.9,
67.7, 60.4, 53.1, 36.7, 34.3, 28.9, 25.8, 24.8, 14.3. HH9.3: 1 H-NMR δ 12.10 (IH, brs), 7.76 (IH, d, J=8.6 Hz), 7.74 (IH, d, J=6.8
Hz), 7.66 (IH, brs), 7.35 (IH, dd, J=8.6/1.6 Hz), 7.29 (IH, d, J=2.3 Hz), 7.14 (IH, dd, J=9.0/2.3 Hz), 4.99 (IH, dd, J=9.2/4.3 Hz), 4.07 (2H, d, J=6.2 Hz), 3.51 (IH, dd, J=14.1/4.3 Hz), 3.23 (IH, dd, J=14.1/9.2 Hz) 5 2.31 (2H, t,J=7.4 Hz), 1.78 (2H, m), 1.69 (2H, m); 13 C- NMR δ 178.0, 175.3, 172.0, 157.4, 134.2, 132.8, 129.9, 129.1, 128.7, 128.4, 127.7, 119.9, 107.4, 68.1, 53.8, 38.1, 34.2, 28.9, 22.1.
Example 8: Cell Culture and Transfection
The reporter cell line Hffll-GPR40 (which stably expresses human GPR40) was constructed using the host reporter cell line HfTl 1 and the pIRESpuroGPR40, essentially as previously described by Kotarsky et at, 2003 and Kotarsky et at, 2001. The cell lines Hffl 1 and Hffl 1 -GPR40, which stably expressed human GPR40, were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% and 3 % fetal bovine serum (FBS), respectively. HEK293 cells were grown in DMEM with Glutamax-1 supplemented with 3% FBS and 0.5% penicillin/streptomycin. All cells were maintained in a 37°C incubator with 7% CO 2 . The mouse GPR40 open reading frame (Genbank
accession number AB095745) was amplified by a polymerase chain reaction (PCR) using the forward primer 5 1 GCCAAGCTTACCATGGACCTGCCCCCACAGCTCTCCTTCG 3' [SEQ ID No:l] and the reverse primer 5'
GGCGAATTCCTACTTCTGAATTGTTCCTCTTT GAGTC 3') [SEQ ID No.2] and subcloned into the pEAK12 expression vector (Edge BioSystems, Gaithersburg, MD). The amplified and subcloned GPR40 was transfected into HEK293 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The cells were transfected for six hours and the cells were assayed 48-72 hours later. Example 9: Reporter Assay Hffll and Hffll-GPR40 reporter cells were seeded at a density of 1.6 x 10 4 cells per well in 96 well plates in 100 μl medium. After 72 hours, test substances diluted in phosphate buffered saline (PBS) without Ca 2+ or Mg 2+ were added to the wells. After another eight hours, the incubation was interrupted by the removal of the medium. Lysis buffer (10 (μl per well) were added and the plates were stored at -80°C until analysis. Luciferase activity was measured with a luciferase assay kit (BioThema, Sweden) according to the manufacturer's instructions. All samples were run in triplicate and repeated two to six times. The luminescence assays were performed with a BMG Lumistar Galaxy luminometer as previously described.
Receptor activation also was assayed by measuring phosphatidyl insositol (PI) hydrolysis essentially as described by Chengalvala et ah, 1999. Briefly, inositol phosphates were radioactively labeled by conventional methods and cell lysates containing the labeled inositol phosphates were applied to 96 well plates containing Dowex AGl -X 8 resin. Inositol phosphates bound to the resin were eluted with ammonium formate/formic acid. The amount of radioactivity in the eluate corresponded to the amount of labeled inositol
phosphate. This assay for PI hydrolysis resulting from G-protein coupled receptor activation can be performed in a high-throughput manner. Example 10: Experimental protocol
One objective is to determine any effects in vivo of compounds on the GPR40 receptor (testing three dose levels) as determined by the amelioration of glucose tolerance in glucose intolerant male diet-induced obese (DIO) mice.
Effects of insulin levels can also be measured if considered necessary after terminating the acute glucose tests (measurement not included in budget). Animals Forty C57 mice from the Charles River, Germany are used in the present study. At 5 weeks of age the animals are shipped to the research facility.
At arrival (day -172), animals are housed individually and offered an energy-dense high-fat (HF) diet (60% energy from fat; Research Diets, New Jersey) and water ad libitum. Due to the high fat content and hence susceptibility to harshness new food is offered every other day and the old food is discarded.
The mice are housed under a 12:12 L/D cycle (lights on at 03:00 AM and lights off at 15:00 PM) and in temperature and humidity controlled rooms.
The animals are left on the diet for at least 12 weeks before experiment are commenced. Animals are control weighted every second week. Experimental OGTT
To assure a uniform randomization animals are stratified on the day before the experimentation according to blood glucose levels. At T- 15 mice are dosed with compound - --(-Sθθ-μlϊ-.pr; see-below)-.- At-time-point-θ-bloed-glucose-is-measured-again-and-glucose -is— - administered by oral gavage (lg/kg glucose (using a 250mg/ml glucose solution)) and
blood glucose is then measured at time points 15, 30, 60, 90 and 120 minutes. At T15 (15 minutes after oral glucose), a 5OMI blood sample (eye or tail blood) is collected for potential later insulin determination. Treatment Groups Mice are stratified according to fasting blood glucose levels (measured at T-45 before the OGTT). Mice are randomised (n=10 in each group) to participate in one of following drug treatment groups:
or the first OGTT
Group A: Vehicle 10% DMSO in PBS
Group B: Compound 1 (3 mg/kg)
Group C: Compound 1 (30 mg/kg)
Group D: Compound 1 (300 mg/kg)
The same outline is then used for compound 2 for the second OGTT and for compound 3 for the third OGTT. Each OGTT is separated by 7 days.
Compound is dissolved in DMSO and diluted with PBS to contain 10% DMSO in the final solution. Compound is dosed at T- 15 in a 500 μl volume administered intraperitoneally (i.p.)- Dose preparation
Dose is to be prepared fresh before gavage. Experimental tests
The animals are subjected to three oral glucose tolerance tests with a 7 day drug free interval. During the 7 drug free days, animals have free access to food and water.
Oral Glucose Tolerance Test (OGTT)
This test is carried out at 8:00 AM. Animals are fasted from the previous day at 3PM (fasting for 19 hours). To assure a uniform randomization animals are stratified on the day before experimentation according to blood glucose levels. At T- 15 mice are dosed with compound (see above). At time point 0 blood glucose is measured again and glucose is administered by oral gavage (lg/kg glucose (using a 250mg/ml glucose solution) Fresenius
Kabi, Sweden) and blood glucose is then measured at time points 0, 15, 30, 60, 90 and 120 minutes using AccuCheck Sensor (Roche Diagnostics). At Tl 5 (15 minutes after oral glucose), a 50μl blood sample (eye or tail blood) is collected for potential later insulin determination using ultrasensitive mouse insulin ELISA kit (Mercodia, Dyamid, Sweden). Data, reporting, and Statistical Evaluation
Results are presented as mean±SEM (standard error of the mean) unless otherwise stated. Statistical evaluation of the data is carried out using one-way analysis of variance (ANOVA) with appropriate post-hoc analysis between control and treatment groups in cases where statistical significance is established (p<0.05; Fisher's, Scheffe or Bonferoni). Example 12:
Selected compounds have been tested in the obese mouse model. They represent molecules from both the fenamate and thiazolidinedione groups. The animals have tolerated the three dose levels without adverse symptoms. The compounds tested induce pronounced and consistent time-related and dose-related changes in the glucose tolerance tests, as well as in plasma insulin concentrations measured 15 min after the glucose administration.
Oral glucose tolerance (OGTT) was analyzed following administration of all compounds. Plasma insulin (at time +15 min after oral glucose) was measured with
compounds 1 and 2. In the statistical analysis, the AUC stands for "area under (glucose) curve".
The results of these tests are reported in Figures 4-11.
With respect to the dose-response relationship, 30 mg/kg seems to give the best response. There is a consistent linkage pattern for both insulin and glucose (at 30 mg/kg) in that the two parameters either decrease (compound #1) or increase (compound #2). While the present invention has been described with reference to the specific embodiments thereof, it should be understood by those skilled in the art that various changes can be made and equivalents can be substituted without departing from the true spirit and scope of the invention. In addition, many modifications can be made to adapt a particular situation, material, composition of matter, process, process step or steps, to the objective, spirit and scope of the present invention. All such modifications are intended to be within the scope of the claim appended hereto.
VII. REFERENCES
The specification is most thoroughly understood in light of the above-cited patents and other references, some of which are described in more detail below and all of which are hereby incorporated in their entireties. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates, which may need to be independently confirmed. 1. Azen S.P. et al. (1998) Control Clin. Trials 19(2):217-231.
2. Bloomgarden (2005) Diabetes Care 28(2):488-493.
3. Bonner-Weir S. (2000) J MoI. Endocrinol. 24:297-302.
4. Brown A. J. et. al (2003)/. Biol. Chem. 278(13):11,312-11,319.
5. Brunmair B. et. al (2001) Diabetes 50(10):2309-2315.
6. Chengalvala M. et. al. (1999) J. Biochem. Biophys. Methods 38(3): 163-170.
7. Deeney J. et. al. (2000) Semin. Cell Dev. Biol. 11(4):267-275. 8. FumsinnC. et al. (2002) Diabetologia 45(9): 1211-1223.
9. Gremlich S. et. al. (1997) J. Biol. Chem. 272(48):30,261-30,269.
10. Hirasawa A. et. al. (2005) Nat. Med. ll(l):90-94.
11. Jimenez-Feltstrom J. et al. (2005) Cell Tissue Res. 319:221 -230. 12. Kotarsky K. et. al (2003) Biochem. Biophys. Res. Commun. 301:406-410.
13. Kotarsky K. et al. (2001) Anal Biochem. 288:209-215.
14. Nakamichi Y. et. al. (2003) Biochem. Biophys. Res. Commun. 306:832-836.
15. NilssonN. E. et. al (2003) Biochem. Biophys. Res Commun. 303:1047-1052.
16. Salehi A. et. al. (2005) Cell Tissue Res. Epublished ahead of print. 17. Shimabukuro M. et. al. (1998) Proc. Natl. Acad. Sci. 95(5):2498-2502.
18. Snitker S. et al (2004) Diabetes Care 27(6):1365-1368. 19. Steneberg P. et. al. (2005) Cell Metabolism 1 :245-258.
20. Ullmann (1908) Ann. 355:312-358.
21. Unger R. H. (2002) Annu. Rev. Med. 53:319-336. 22. Whitehouse M. W. et al. (1962) Nature 196:1323-1324.
23. Wieland et al. (1915) Ber. 48: 1 117-1121.
24. Wilkinson et al. (1948) J. Chem. Soc, Abs. 32-35.
25. Winder C. V. et al. (1962) J. Pharmacol Exp. Then 138:405-413.
26. Yuan L. et. al. (2003) Acta Pharmacol Sin. 24(5):429-434.
