MONITORING TCR-β TO DETERMINE HIV THERAPY AND DISEASE PROGRESSION

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefit of U.S. Provisional Application No.: 61/131,954, filed on June 12, 2008, the entire contents of which are incorporated herein by reference.

STATEMENT OF RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH

Research supporting this application was carried out by the Government of the United States of America as represented by the Secretary, Department of Health and Human Services. The Government has certain rights in this invention.

INCORPORATION BY REFERENCE

Each of the applications and patents cited in this text, as well as each document or reference cited in each of the applications and patents (including during the prosecution of each issued patent; "application cited documents"), and each of the PCT and foreign applications or patents corresponding to and/or paragraphing priority from any of these applications and patents, and each of the documents cited or referenced in each of the application cited documents, are hereby expressly incorporated herein by reference. More generally, documents or references are cited in this text, either in a Reference List, or in the text itself; and, each of these documents or references ("herein-cited references"), as well as each document or reference cited in each of the herein-cited references (including any manufacturer's specifications, instructions, etc.), is hereby expressly incorporated herein by reference.

BACKGROUND OF THE INVENTION

An estimated 33 million people are infected with HIV worldwide with the majority of these found in developing nations, and almost 2/3 of all HIV infections found in Sub-Saharan Africa. It was estimated that there were 2.5 million new HIV infections. It is estimated that there are 740,000 people infected with HIV in Western and Central Europe and 1.7 million people infected with HIV in Eastern Europe and Central Asia.

In 2004, the number of people in the U.S. living with HIV infection was estimated at around 425,000. The number of people with acquired immune deficiency (AIDS) was estimated at over 200,000 and the number of deaths caused by AIDS was estimated at around 75,000. Since the early 1990's the number of deaths caused by AIDS in the United States has declined, and the number of people infected with HIV has increased. The decline in ADDS-related deaths and the increase in the number of people living with HIV infection is largely attributed to the introduction of highly active antiretro viral therapy (HAART).

A large international effort has been made to provide life-saving anti-retroviral treatment (ART) to people in resource-poor countries with some significant success in countries such as Botswana, which is currently treating all eligible citizens. Unfortunately, Botswana is the exception in the developing world partly due to its relatively small and centralized population and its economical success in the past decade is the exception. Other country-wide programs, like Uganda and Rwanda have shown promise for the successful implementation of ART in resource-poor settings, but significant hurdles remain to large-scale implementation of ART due to the lack of medical and laboratory infrastructure, which is needed to properly identify and treat HIV+ patients. UNAIDS estimates that in 2007 approximately 28-30% of eligible adults and 15% of eligible children that were HIV infected were accessing antiretro viral therapy.

In particular, WHO recommendations for ART initiation are dependent on a CD4 count as well as clinical diagnosis. This test requires a FACS based reader, fresh whole blood, and a reliable cold-transport chain to obtain a proper measurement. These requirements make the CD4 count one of the more difficult roadblocks to overcome in large-scale roll-out of ART in developing nations. The WHO has amended their recommendations to allow for the use of a total lymphocyte count (TLC) in the absence of a CD4 measurement. TLC was proposed as a marker for initiation of ART in children and adults, and has been put forth as a possible solution to the need for CD4 counts in resource-limited settings. However, research from Kampala Uganda demonstrated that the TLC cut-off recommended by the WHO demonstrated poor sensitivity and could not completely replace the CD4 count. Additionally, TLC suffers from some of the same constraints that limit the CD4 test as both tests are performed using FACS based technology, require a fresh blood sample, and cold-transport chain limiting its utility in resource-limited settings.

Consequently, there is an urgent need for a functional immunological assay for HIV disease stage that does not require cold storage or fresh sample processing. Such an assay would have use in monitoring disease progression, prognosis and in determining course of treatment.

SUMMARY OF THE INVENTION

As described below, the present invention generally provides compositions and methods for identifying a subject in need of antiretioviral therapy or for monitoring the efficacy of such therapy in a subject using a biological sample that does not require cold storage. The method generally involves quantifying the number of mature T-cells in a subject sample (e.g., dried blood spot) using DNA present in the sample.

In a first aspect, the invention features a method of monitoring the progression of a disease or disorder in a subject by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, and comparing the number of rearranged TCR-β genes in the subject sample to the number of rearranged TCR-β genes in a control sample, thereby monitoring the progression of a disease or disorder in a subject.

In another aspect, the invention features a method of determining the prognosis of a subject diagnosed with a disease or disorder by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, thereby determine the prognosis of a subject diagnosed with the disease or disorder.

A method of characterizing HIV in a subject in need thereof, the method involving determining the total number of cells in a blood sample from the subject; determining the number of T cell receptor-β genes comprising an intact VD junction; and subtracting the number of cells that contain VD junction from the total number of cells in the sample; thereby determining the number of rearranged TCR-β genes. In one embodiment, the total number of

cells is detected using a housekeeping gene. In another embodiment, the characterizing determines the prognosis of the patient or is used to monitor the efficacy of a therapy.

In one embodiment, the prognosis determines course of treatment.

In one embodiment of the aspects described herein, the methods further comprise the steps of obtaining the sample from the subject. In a related embodiment, the sample is a biological sample. In a further related embodiment, the biological sample is selected from the group consisting of: dried blood, whole blood, tissue samples, and swabs, hi yet another embodiment, the biological sample is a dried blood spot.

In another embodiment, the disease or disorder is an immune disease.

In another further embodiment, the disease or disorder is human immunodeficiency virus (HIV). In another embodiment, the disease or disorder is acquired immune deficiency syndrome (AIDS).

In one embodiment, the disease or disorder is cancer. In a further embodiment, the cancer is selected from leukemia or lymphoma.

In another aspect, the invention features a method of monitoring the progression of HIV or ADDS in a subject by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell; and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, thereby monitoring the progression of HIV or AIDS in a subject. hi one embodiment of the above aspects, a decrease in the number of mature T cells in the subject compared to the control is indicative of disease progression.

In another aspect, the invention features a method of determining the prognosis of a subject diagnosed with HIV or AIDS by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, thereby determining the prognosis of a subject diagnosed with HIV or AIDS.

In one embodiment of the above aspects, the method further comprises the step of obtaining the sample.

In another embodiment, the prognosis determines course of treatment.

In another related embodiment, a number of mature T cells between 1 - 90 is indicative of poor prognosis. In a related embodiment, a poor prognosis determines an aggressive treatment regimen. In still another related embodiment, a number of mature T cells less than 50 is a marker for an aggressive treatment regimen.

In another embodiment of any one of the above aspects, treatment comprises antiretroviral (ART) therapy.

In another aspect, the invention features a method of determining the effectiveness of ART therapy in a subject infected with HIV or AIDS by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell; and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, thereby determining the effectiveness of ART therapy in a subject infected with HIV or AIDS. hi one embodiment, an increase in the number of mature T cells in the subject compared to the control is indicative of effectiveness of ART therapy.

In another embodiment, the sample is a biological sample. In a related embodiment, the biological sample is selected from the group consisting of: dried blood, whole blood, tissue samples, and swabs. In another related embodiment, the biological sample is a dried blood spot.

In another aspect, the invention features a method of determining the need for ART therapy in a subject infected with HIV or AIDS by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell; and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, thereby determining the need for ART therapy in a subject infected with HIV or AIDS.

In another embodiment of any one of the above-mentioned aspects, the subject has previously been treated with ART therapy.

In a further embodiment, the progression of HIV or ADDS determines the course of treatment.

In another embodiment of any one of the above-mentioned aspects, a number of mature T cells between 1 - 90 is a marker for initiation of a treatment regimen.

In another aspect, the invention features a method of determining the need for ART therapy in a subject infected with HIV or AIDS by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample; and wherein a number of mature T cells between 1 - 90 is a marker for initiation of ART therapy, and thereby determining the need for ART therapy in a subject infected with HIV or AIDS.

In another embodiment of any one of the above-mentioned aspects, the method further comprises the step of obtaining the sample.

In another embodiment of any one of the above-mentioned aspects, the sample is a biological sample. In a related embodiment, the biological sample is selected from the group consisting of dried blood, whole blood, tissue samples, and swabs. In a further related embodiment, the biological sample is a dried blood spot.

In another embodiment of any one of the above-mentioned aspects, the step of determining is performed by quantitative polymerase chain reaction (QPCR).

In another embodiment of any one of the above-mentioned aspects, the step of determining is performed by enzyme linked immunosorbent assay (ELISA).

In still another embodiment of any one of the above-mentioned aspects, the step of determining the number of rearranged TCR-β genes further comprises quantifying the total number of cells in the sample, quantifying the number of cells that contain unrearranged TCR-β genes; and subtracting the number of cells that contain unrearranged TCR-β genes from the total number of cells in the sample, thereby determining the number of rearranged TCR-β genes.

In one embodiment, the step of quantifying the total number of cells is performed by QPCR using primer-probe pairs specific for a housekeeping gene. In a further embodiment, the housekeeping gene is albumin.

In a related embodiment, the step of quantifying the number of cells that contain unrearranged TCR-β genes if performed by QPCR using primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene.

In another aspect, the invention features a method of determining the number of mature T cells in a sample comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, and thereby determining the number of mature T cells in a subject.

In one embodiment, the method further comprises the step of obtaining the sample.

In another embodiment, the sample is a biological sample.

In another further embodiment, the biological sample is selected from the group consisting of: dried blood, whole blood, tissue samples, and swabs. In a related embodiment, the biological sample is a dried blood spot.

In one embodiment, the step of determining is performed by quantitative polymerase chain reaction (QPCR). In another embodiment, the step of determining is performed by enzyme linked immunosorbent assay (ELISA).

In another embodiment, the step of determining the number of rearranged TCR-β genes further comprises quantifying the total number of cells in the sample, quantifying the number of cells that contain unrearranged TCR-β genes; and subtracting the number of cells that contain unrearranged TCR-β genes from the total number of cells in the sample; thereby determining the number of rearranged TCR-β genes.

In another further embodiment, the step of determining the total number of cells is performed by QPCR using primer-probe pairs specific for a housekeeping gene.

In still another embodiment, the step of determining the number of cells that contain unrearranged TCR-β genes is performed by QPCR using primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene.

In another embodiment, the invention features a method of treating a subject infected with HIV or AIDS based on the results of the methods of the aspects as described herein.

In another aspect, the invention features a method of determining the number of mature T cells in a biological sample comprising isolating DNA from the biological sample, wherein the sample is stable at room temperature, quantifying the total number of cells in the sample by QPCR using primer-probe pairs specific for a housekeeping gene, quantifying the number of cells that contain unrearranged TCR-β genes by QPCR using primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene; and subtracting the number of cells that contain unrearranged TCR-β genes from the total number of cells in the sample, and thereby determining the number of mature T cells in a subject.

In one embodiment, the method is used to monitor the progression of a disease or disorder.

In a related embodiment, the housekeeping gene is albumin.

In another embodiment, the disease or disorder is HFV.

In another embodiment, the disease or disorder is AIDS.

In another embodiment, the disease or disorder is cancer. In a related embodiment, the cancer is selected from leukemia or lymphoma.

In another further embodiment, the method is used to determine a course of treatment for a disease or disorder, hi another embodiment, hi another embodiment, the disease or disorder is an immune disease. hi another embodiment of any one of the above aspects, a number of mature T cells between 1 - 1000 is indicative of HIV infection. In another related embodiment of any one of the above aspects, a number of mature T cells between 5 - 250 is indicative of HIV infection. In still another embodiment of any one of the above aspects, a number of mature T cells between 1 - 100 is a marker for initiation of a treatment regimen. In a related embodiment, a number of mature T cells between 1 - 50 is a marker for an aggressive treatment regimen. In a further embodiment, the treatment comprises ART therapy. hi another embodiment of any one of the above aspects, the number of mature T cells can be used as a surrogate marker for CD4 cell counts. hi another aspect, the invention features a method of determining the number of mature B cells in a sample comprising isolating DNA from the sample, wherein the sample is stable at room temperature, and determining the number of rearranged B-cells, whereby a rearranged B-

cell gene identifies a mature B cell, and thereby determining the number of mature B cells in a subject.

In one embodiment, the method further comprises the step of obtaining the sample.

In another embodiment, the sample is a biological sample.

In another further embodiment, the biological sample is selected from the group consisting of: dried blood, whole blood, tissue samples, and swabs. In a related embodiment, the biological sample is a dried blood spot.

In one embodiment, the step of determining is performed by quantitative polymerase chain reaction (QPCR). In another embodiment, the step of determining is performed by enzyme linked immunosorbent assay (ELISA). hi another embodiment, the step of determining the number of rearranged B cells further comprises quantifying the total number of cells in the sample, quantifying the number of cells that contain unrearranged B cell genes; and subtracting the number of cells that contain unrearranged B cell genes from the total number of cells in the sample; thereby determining the number of rearranged B cells.

In one embodiment, the step of determining the total number of cells is performed by QPCR using primer-probe pairs specific for a housekeeping gene.

In another embodiment, the step of determining the number of cells that contain unrearranged B cell genes is performed by QPCR using primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the B cell gene.

In another embodiment, the invention features a method of treating a subject suffering from cancer or an autoimmune disease or disorder based on the results of the method of the aspect as described herein.

In another embodiment of any one of the aspects as described herein, the subject is a mammal. In a related embodiment, the mammal is a human.

In another embodiment of any one of the aspects as described herein, the method is performed prior to therapeutic intervention for the disease or disorder.

In another embodiment of any one of the aspects as described herein, the method is performed after therapeutic intervention for the disease or disorder.

In another aspect, the invention features a kit for use in determining the need for ART therapy in a subject infected with HIV or AIDS comprising primer-probe pairs specific for a

housekeeping gene, primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene, and instructions for use.

In another aspect, the invention features a kit for use in determining the number of mature T cells in a sample comprising: primer-probe pairs specific for a housekeeping gene, primer- probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene, and instructions for use.

In one embodiment of the above aspects, the sample is stable at room temperature.

In another aspect, the invention features a kit for use in monitor the progression of HIV in a subject comprising: primer-probe pairs specific for a housekeeping gene, primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene, and instructions for use.

In another aspect, the invention features a kit for use in monitor the progression of cancer in a subject comprising: primer-probe pairs specific for a housekeeping gene, primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene, and instructions for use.

In one embodiment, the cancer is leukemia or lymphoma.

In another embodiment of any one of the above-mentioned aspects, the housekeeping gene is albumin.

Other features and advantages of the invention will be apparent from the detailed description, and from the claims.

Definitions

The following definitions are provided for specific terms which are used in the following written description.

Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The

Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them below, unless specified otherwise.

As used in the specification and claims, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise.

In this disclosure, "comprises," "comprising," "containing" and "having" and the like can have the meaning ascribed to them in U.S. Patent law and can mean " includes," "including," and the like; "consisting essentially of or "consists essentially" likewise has the meaning ascribed in U.S. Patent law and the term is open-ended, allowing for the presence of more than that which is recited so long as basic or novel characteristics of that which is recited is not changed by the presence of more than that which is recited, but excludes prior art embodiments. The terms "administration" or "administering" are defined to include an act of providing a compound or pharmaceutical composition of the invention to a subject in need of treatment.

As used herein, the phrase "in combination with" is intended to refer to all forms of administration that provide the inhibitory nucleic acid molecule and the chemotherapeutic agent together, and can include sequential administration, in any order.

As used herein, the term "acquired immunodeficiency syndrome" (AIDS) refers to a set of symptoms and infections resulting from the damage to the human immune system caused by the human immunodeficiency virus (HIV). AIDS refers to the most advanced stages of infection with the human immunodeficiency virus (HIV).

As used herein, the term "antiretroviral therapy" (ART) is meant to refer to the administration of one or more antiretroviral drugs to inhibit the replication of HIV.

As used herein, the term "cancer" refers to a neoplasm or tumor resulting from abnormal uncontrolled growth of cells. The term "cancer" encompasses a disease involving both pre- malignant and malignant cancer cells. In some embodiments, cancer refers to a localized overgrowth of cells that has not spread to other parts of a subject, i.e., a benign tumor. In other embodiments, cancer refers to a malignant tumor, which has invaded and destroyed neighboring body structures and spread to distant sites. In certain examples, cancer refers to leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblasts leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), or lymphoma.

The term "control" is meant to refer to a standard or reference condition.

The term "gene" is meant to refer to a nucleic acid that encodes an RNA, for example, nucleic acid sequences including but not limited to T-cell receptor beta (TCR-β) genes.

The term "human immunodeficiency virus" or HIV as used herein is meant to refer to any HIV including laboratory strains, wild type strains, mutant strains and any biological sample comprising at least one HIV virus, such as, for example, an HIV clinical isolate. HIV strains compatible with the present invention are any such strains that are capable of infecting mammals, particularly humans. Examples include, but are not limited to, HIV-I and HIV-2. An HIV virus refers to any sample comprising at least one HIV virus. A subject may have one or more HIV viruses in his body with different mutations, for example different mutations in the env gene. Accordingly, it is to be understood that a sample may contain a variety of different HIV viruses containing different mutational profiles.

As used herein, the terms "about" or "approximately", unless otherwise indicated, refer to a value that is no more than 10% above or below the value being modified by the term.

The term "mature T cell" is meant to refer to a T cell that has undergone rearrangement of the variable, joining, and/or constant region genes of the chain of the T cell antigen receptor and expresses either CD4 or CD8 on its cell membrane.

As used herein, the term "obtaining" as in "obtaining the sample" is meant synthesizing, purchasing, or otherwise acquiring the sample.

As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, the term "subject" refers to an animal, preferably a mammal such as a non-primate (e.g., cows, pigs, horses, cats, dogs, rats etc.) and a primate (e.g., monkey and human), and most preferably a human.

The term "T-cell receptor beta" (TCR-beta) is meant to refer to one chain of the T cell receptor (TCR). The T cell receptor or TCR is a molecule found on the surface of T lymphocytes (or T cells) that is, in general, responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules. The TCR beta chain is generated by V(D)J recombination, and produces a "rearranged TCR-beta gene."

As used herein, the terms "treatment" and "therapy" can refer to any method(s), composition(s), and/or agent(s) that can be used in the prevention, treatment and/or management of a disease or disorder, for example HIV or AIDS, or one or more symptoms thereof. In certain

embodiments, the terms "treatment" and "course of therapy" refer to antiretroviral (ART) therapy useful in the management and/or treatment of HIV or AIDS or one or more symptoms thereof.

Concentrations, amounts, cell counts, percentages and other numerical values may be presented herein in a range format. It is to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited.

BRIEF DESCRIPTION OF THE DRAWINGS

Figures 1 A-IC are schematics illustrating an experimental protocol that can be used to determine T cell counts.

Figure 2 is a graph that illustrates the accuracy of the assay. The graph shows calculated T-cell Receptor-beta (TCR-Beta) counts versus estimated TCR-Beta counts.

Figure 3 (A and B) are graphs that show rearranged TCR-beta counts compared to CD4 count for initial Baltimore patient samples. Panel A shows rearranged TCR-beta count in all patients and Panel B shows rearranged TCR-beta count in patient undergoing no current treatment.

Figure 4 (A and B) are graphs that show CD4 count compared to TCR-beta count. CD4 and TCR-beta are graphed compared to TLC count. Panel A shows CD4 count versus TLC. Panel B shows TCR-beta count versus TLC.

Figure 5 is a graph showing CD4 versus TCR-beta count in patients undergoing no treatment.

Figures 6 (A) is a graph showing CD4 counts vs. TCR count of all Baltimore samples tested. Figure 6B is an ROC curve showing the relationship between the specificity and the sensitivity of the test.

Figure 7 (A) is a graph showing CD4 counts vs. TCR count in patients not receiving anti-retroviral therapy. Figure 7B is an ROC curve showing the relationship between the specificity and the sensitivity of the test in this set of patients.

Figure 8 is a graph showing TCR-beta count versus total lymphocyte counts from Ugandan HIV+ individuals (n=94). Dried blood spots were collected in Rakai Uganda from HIV positive patients participating in the Rakai Health Science Community Cohort study.

Figure 9 is a graph showing TCR-beta count multiplied times the CD4.CD8 ratio and compared to FACS derived CD4 counts. Ugandan HIV+ individual were tested for this graph (n=94). Dried blood spots were collected in Rakai Uganda from HIV positive patients participating in the Rakai Health Science Community Cohort study.

Figure 10 provides the nucleotide sequence of the TCR-Beta VD Junction.

DETAILED DESCRIPTION

The instant invention is based, at least in part, on the discovery that the number of rearranged T-cell receptor β genes (TCR-β) correlates with CD4 counts, and thus can be used in place of CD4+T cell counts to monitor disease progression, prognosis or determine therapy. The human T cell receptor comprises alpha and beta chains that are encoded by independent T cell receptor (TCR) alpha and beta genes. Prior to maturation, the T cell receptor comprises multiple variable (V), Diversity (D), and joining (J) domains. These domains are recombined during T cell maturation. The TCR alpha chain is generated by VJ recombination, and the beta chain is generated by VDJ recombination. The TCR-beta VD junction is always deleted during recombination. Because all mature T-cells contain a rearranged TCR-β gene, the number of T- cells in a patient sample can be determined by quantifying the total number of cells present in the sample and subtracting the number of cells that contain unrearranged TCR-beta genes (i.e., the number of cells that have an intact VD junction).

Thus in various embodiments, the invention provides method of determining the number of mature T cells in a sample by isolating DNA from the sample, determining the total number of cells in the sample; determining the number of cells that contain unrearranged TCR-β genes (e.g., by detecting a VD junction); and subtracting the number of cells that contain unrearranged TCR-β genes from the total number of cells in the sample; thereby determining the number of rearranged TCR-β genes.

Unlike a CD4 ⁺ T cell count, the methodology of this invention does not require an expensive FACS based reader, fresh whole blood, or cold chain transport. Because the invention described herein could be used in lieu of a CD4 ⁺ T cell count, it would reduce the costs for assessing the progression of a patients HIV infection.

While this invention could be adopted in developed countries, it has the greatest potential value to HIV programs in developing countries. Currently, CD4 ⁺ counts are viewed as unsustainable in regions of sub-Saharan Africa because of expense and the lack of infrastructure. (Taiwo BO and Murphy RL, Cytometry Part B (Clinical Cytometry), 74B, Supp 1, SI l-S 18 (2008)). The invention described herein could enable ART programs in new regions of the developing world because it does not require whole blood samples (eliminating the need for cold-chain transport) and reduces the cost required to assess the need for ART.

The instant invention is based upon the finding that T-cell enumeration can be used as a surrogate marker for CD4 cell counts to determine the HIV disease stage of a patient. The invention uses samples that are stable at room temperature, or previously frozen samples. The determination of the number of T-cells in a sample can then be used as a direct correlate of CD4 cell count and can be used to determine when a patient may start anti-HIV therapy, and if subsequent therapy is successful. This technology would allow for the researcher to monitor HIV+ patients in areas where full-scale hospitals are not accessible or available, because it eliminates the need for cold-chain transport due to the fact that the samples are stable at room temperature. Thus, the invention would allow personnel in resource poor settings to monitor CD4 counts, using T cell receptor counts as surrogate markers, without the need for full-scale laboratories. The invention can also be used by researchers and personnel who want to monitor CD4 counts, but without the need for large instruments, such as Fluorescence Activated Cell Sorting (FACS) machines. The invention would allow for samples from a large area to be gathered in large quantity, to be shipped to one central location, for processing, for example in an automated processing procedure.

The present invention features methods of monitoring the progression of a disease or disorder, or determining the prognosis of a subject suffering from a disease or disorder, for example HIV or AIDS, by determining the number of mature T cells in a sample. The invention also features methods of determining the effectiveness of ART therapy in a subject infected with HIV or AIDS, and the need for ART therapy in a subject infected with HIV or AIDS, by determining the number of mature T cells in a sample from the subject.

HIV infection is characterized by high rates of viral turnover throughout the disease process, eventually leading to CD4 depletion and disease progression (Wei X, Ghosh S K, Taylor M E, et al. (1995) Nature 343, 117 122 and Ho D D, Naumann A U, Perelson A S, et al.

(1995) Nature 373, 123 126). In an untreated patient, some 10 ¹⁰ new viral particles are produced per day.

T cells are the main target of HIV in the blood, and act as the host cell that the virus needs in order to replicate. HIV infection is associated with immunosuppression that is caused by a dramatic reduction in the helper T cell population. When the disease progresses from HIV infection to full-blown AIDS, it is because the number of T-cells has dropped to dangerous levels. AIDS is characterized by a total lymphocyte count of less than 500/mm.sup.3 and a dangerously low T-cell count of below 200. With the immune system so depleted, the body becomes highly vulnerable to opportunistic diseases. As the term suggests, these are infections and other diseases that seize the opportunity presented by a weakened defense system, and commonly include herpes simplex infection and other herpes conditions such as shingles and the oral yeast infection, thrush; Kaposi's sarcoma, characterized by the dark lesions; CKV retinitis, a herpes virus that cause blindness; meningitis; cervical cancer; and a formerly rare type of pneumonia.

CD4 count is defined as the number of CD4 cells (T-helper lymphocytes with CD4 cell surface marker). A CD4 count is used to assess immune status, susceptibility to opportunistic infections, need for antiretroviral therapy (ART) or highly active antiretroviral therapy (HAART) and opportunistic infection (OI) prophylaxis, and for defining AIDS (CD4 <200).

Normal adult CD4 count reference ranges vary by laboratory; however, ranges are generally within 500 -1500/mm ³ . There is large individual variability in measurement that reflects the method of determining CD4 count by calculation from 3 measured variables: WBC, % lymphocytes, and % lymphocytes that are CD4+ (CD4%). CD4% is less variable than absolute CD4 count; the within-subject coefficient of variation is 18% for CD4% vs 25% for CD4 count. The approximate corresponding values for CD4 count and CD4% are: >500 ~ >29%, 200-500 ~ 14-28%, <200 ~ <14%. CD4 count is usually determined by flow cytometry, and specimens must be processed within 18 hrs of collection for optimal accuracy when assayed by this method.

A number of factors have been reported to affect CD4 cell counts, including seasonal and diurnal variation (lowest at 12:30 PM, highest at 8:30 PM), surgery, viral infections, tuberculosis. CD4 counts have been found to decrease with some medications (e.g. corticosteroids, especially with acute use, less pronounced with chronic use; PEG-IFN, DFN;

cancer chemotherapy). Further, acute changes in CD4 are more often due to redistribution of CD4 in lympathics, spleen and bone marrow.

Currently, the CD4 count is the only assay that is available to monitor HIV disease stage. CD4 count is a reflection of the strength of an individual's immune system, and a CD4 count can indicate how far HIV disease has advanced (the stage of the disease) and predict the risk of complications and debilitating infections. The CD4 count is most useful when it is compared with the count obtained from an earlier test. Oftentimes, the CD4 count is used in combination with the viral load test, which measures the level of HIV in the blood, to determine the staging and outlook of the disease.

Abrupt decline in CD4 after acute HIV infection is usually followed by a rise. CD4 count after recovery from acute infection can return to normal range (close to pre-infection baseline) or CD4 count can remain low.

Without HAART, annual CD4 decline is correlated with viral load (VL), only on the population level. However, VL is poor predictor of 1-2 yr CD4 decline on individual level, accounting for less then 10% of individual variation. On HAART, a biphasic increase in CD4 is seen, 50-120 in first 3 months, which is thought to be due to redistribution of memory CD4 cells from lymphoid tissue, followed by average increase of 2-7 cells/month via expansion of naive CD4 cell population. CD4 increase can continue more than six years after HAART initiation. Normalization of CD4 count is more likely in patients who start therapy with higher CD4 counts.

CD4 response generally correlates with VL suppression, but discordant results can occur. In certain cases, it has been reported that 10% of patients have VL suppression but no CD4 rise. Thus, lack of CD4 response is not evidence of treatment failure if VL is suppressed. An abrupt decrease in CD4 often occurs after discontinuing HAART (e.g. 100-150 in 3-4 months), (information on the world wide web at hopkins- hivguide.org/management/laboratory_testing/cd4_cell_count.ht ml).

According to public health guidelines, preventive therapy should be started when an HIV-positive person who has no symptoms registers a CD4 count under 200. Some physicians will opt to consider treatment earlier, at 350. The Department of Health & Human Services ("DHHS") has issued guidelines recommending certain antiretroviral agents for treatment of established HIV infection. The DHHS panel recommended that all patients with less than 500 CD4 T cells/mm, and a viral load greater than 10,000 (bDNA) or 20,000 (RT-PCR) copies of

HIV RNA/ml, of plasma should be offered antiviral therapy. The Centers for Disease Control and Prevention considers HIV-infected persons who have CD4 counts below 200 to have AIDS, regardless of whether they are sick or well.

Lymphocyte levels are tested using a CD4 count or total lymphocyte count, which both require fresh whole blood, a reliable cold-transport chain, and an expensive FACS based reader to obtain a proper measurement. These requirements severely limit patient access to treatment, and consequently are one of the more difficult obstacles in scaling up therapy in developing nations.

Effective HIV/ AIDS care requires antiretroviral therapy (ART) as a treatment option. Antiretroviral drugs inhibit the replication of HIV. When antiretroviral drugs are given in combination, HIV replication and immune deterioration can be delayed, and survival and quality of life improved.

By the end of 2005 the World Health Organization estimated that there were just over 1.3 million people receiving antiretroviral therapy (ART) in low-income and middle-income countries, representing 20% of the 6.5 million estimated to need it. Since the need to close the treatment gap was declared a global public health emergency, and the launch of the "3 by 5" initiative by WHO and UNAIDS in December 2003, the number of people receiving ART has more than tripled. Over the last year the number of people receiving ART globally has increased by about 300 000 every six months. Scale-up in Africa has risen from 100 000 at the end of 2003 to 810 000 by the end of 2005. ART treatment programmes in resource-poor settings have efficacy rates similar to those reported for developed countries. At present the cost of ART in least developed countries ranges from US$ 300- US$ 1200 per annum. The cost of monitoring antiretroviral therapy varies with its complexity. (World Health Organization, Antiretroviral therapy for HIV infection in adults and adolescents. Recommendations for a public health approach. 2006).

For antiretroviral treatment to be effective for a long time, it has been found that treatment with more than one antiretroviral drug at a time is often necessary, i.e. combination therapy. The term Highly Active Antiretroviral Therapy (HAART) is commonly used to describe a combination of three or more anti-HF/ drugs. Five groups of anti-HIV drugs have been described: Nucleoside/Nucleotide Reverse Transcriptase Inhibitors (NRTIs) that interfere with the action of reverse transcriptase; Non-Nucleoside Reverse Transcriptase Inhibitors

(NNRTIs) that stop HIV from replicating within cells by inhibiting the reverse transcriptase protein; protease inhibitors (PI); entry inhibitors, including fusion inhibitors, that prevent HIV from entering human immune cells; integrase inhibitors.

T-cell Count

Maturation of T Cells occurs in the thymus. A first step in the maturation process is the rearrangement of the variable (V), joining (J), and constant region genes of the chain of the T cell antigen receptor. Similar rearrangement is seen in heavy chain rearrangement during immunoglobulin synthesis. The T cell receptor exists as a complex of several proteins. The T cell receptor itself is composed of two separate peptide chains, which are produced from the independent T cell receptor (TCR) alpha and beta genes. The TCR alpha chain is generated by VJ recombination, whereas the beta chain is generated by V(D)J recombination.

The instant invention relies on the distinctive nature of the TCR-beta gene which undergoes a gene rearrangement process during T-cell development to obtain a functional TCR protein. Since only mature T-cells contain a rearranged TCR-beta gene, it is possible to quantify the number of T-cells in a patient sample by quantifying the number of total cells and subtracting from that the number of cells that contain unrearranged TCR-beta genes.

Thus, the invention describes a method of determining the number of mature T cells in a sample comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, and thereby determining the number of mature T cells in a subject.

The method further comprises the step of obtaining the sample.

The sample, preferably, is a biological sample. In certain cases, the biological sample is selected from the group consisting of dried blood, whole blood, tissue samples, and swabs. In certain preferred examples, the biological sample is a dried blood spot.

Determining the number of rearranged T-cell receptor beta (TCR-β) genes may be carried out by any method known to one of skill in the art, preferably, but not limited to quantitative polymerase chain reaction (QPCR) or enzyme linked immunosorbent assay (ELISA). QPCR is based on the detection of a fluorescent reporter that increases as PCR product accumulates with each cycle of amplification. Fluorescent reporter molecules include dyes that bind double-

stranded DNA (i.e. SYBR Green) or sequence-specific probes (i.e. Molecular Beacons or TAQ MAN Probes). QPCR exceeds the limitations of traditional end-point PCR methods by allowing either absolute or relative quantification of PCR product at the end of each cycle.

In certain cases, the ELISA assay may be automated for high throughput assay of large number of samples.

In certain embodiments, the step of determining the number of rearranged TCR-β genes further comprises quantifying the total number of cells in the sample, quantifying the number of cells that contain unrearranged TCR-β genes, and subtracting the number of cells that contain unrearranged TCR-β genes from the total number of cells in the sample, and thereby determining the number of rearranged TCR-β genes.

Primer-probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-beta gene and their homologs are featured in the instant invention. Primer-probe pairs are chosen that are specific for the TCR VD junction, as the TCR- beta VD junction is always deleted during recombination. Primer-probe pairs specific for a housekeeping gene are also described. In certain examples, the housekeeping gene is albumin, however any housekeeping gene as known to one of skill in the art is suitable for use in the invention.

The primers may be labeled. Suitably, this label may be detected using fluorescence, luminescence or absorbance. In addition primers located in a region of 50 nucleotides (nt) upstream or downstream from the sequences given herein constitute part of the present invention. Specifically, the primers may be located in a region of 20 nt upstream or downstream from the sequences given herein and, constitute, as well, part of the present invention. Also, primers comprising at least 8 consecutive bases present in either of the primers described herein constitute an embodiment of the invention. Interestingly, the primers comprise at least 12 consecutive bases present in either of the primers described herein. In one aspect of the present invention the primers may contain linker regions for cloning. Optionally, the linker region of a primer may contain a restriction enzyme recognition site. Preferably, said restriction enzyme recognition site is a unique restriction enzyme recognition site. Alternatively, primers may partially anneal to the target region.

Thus, for example, in certain embodiments a QPCR reaction is run with a control sample and the target gene. The sample, e.g. the sample that is stable at room temperature (a dried blood

sample (DBS)) is run in replicate for the target gene. Standard curves are created for each run according to the cell dilutions used, and values are determined for each sample replicate. Subsequently, the highest and lowest readings for each gene of each sample are removed to increase assay accuracy, and eliminate the influence of any outliers in an unbiased manner. The resulting sample raw counts for each gene were then adjusted as shown below:

[Adjusted sample gene count = (Raw sample gene count) x (Mean of all 25% gene counts / Run-specific 25% gene count)]

The resulting adjusted counts for VD-J are averaged and subtracted from the adjusted Alb average to obtain the final rearranged TCR-β count.

The results that are obtained from the methods described herein can be used to determine a method of treating a subject infected with HTV or AIDS.

The method of determining the number of mature T cells as described herein may be used to monitor the progression of a disease or disorder. hi certain cases, the disease or disorder is any immune disease where T cells are affected. hi other cases, the disease or disorder is cancer, for example, leukemia or lymphoma. hi preferred embodiments, the disease or disorder is HIV or AIDS.

Accordingly, determining the number of mature T cells as described herein can be used to indicate HIV infection, hi certain cases, a number of mature T cells between 1 - 1000 is indicative of HIV infection, hi other certain cases, a number of mature T cells between 5 - 250 is indicative of HIV infection.

Determining the number of mature T cells as described herein can be used as a marker for initiation of a treatment regimen, for example for initiation of ART therapy. In certain cases, a number of mature T cells between 1 - 100 is a marker for initiation of a treatment regimen, hi certain cases, subjects with a number of mature T cells less than 50 have the most need to start therapy, in certain cases the most aggressive therapy. That is, a number of mature T cells between 1 - 50 is a marker for an aggressive treatment regimen, hi other certain cases, subjects with a number of mature T cells between 50 - 70 have a need to start therapy relatively soon. In other certain cases, subjects with a number of mature T cells between 70 - 100 have a moderate

need to start therapy. Subjects with a number of mature T cells greater than 100 do not need to start therapy, and can be monitored.

As with all the methods as described herein, the number of mature T cells can be used as a surrogate marker for CD4 cell counts.

Monitoring

The present invention provides new methods to monitor disease progression. In particular, the invention provides methods for HIV disease staging that do not require cold storage or fresh sample processing. The methods are based on determining the number f T cells in a sample, as described above.

A particular advantage of the invention is that it can be used as a way o f monitoring the progression of a disease or disorder, or as a prognostic indicator of the progression of a disease or disorder, for example HIV, or the onset of symptoms of AIDS in HIV-positive individuals. The method requires a blood sample that is stable at room temperature, for example a dried blood sample (DBS), as in a DBS from a finger prick. In particular the number of mature T cells in a sample from the subject can be determined, as described herein.

The number of mature T cells in a sample can be determined by isolating DNA from the sample, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell; and comparing the number of rearranged TCR-β genes in the subject sample to the number of rearranged TCR-β genes in a control sample. As described herein the sample is stable at room temperature.

Using this method the progression of a disease or disorder or the prognosis of a subject diagnosed with a disease or disorder, for example HIV or AIDS, can be determined.

A number of mature T cells between 1 - 90 is, in certain examples, indicative of poor prognosis. A poor prognosis, in many cases, will indicate an aggressive treatment regimen.

In other certain cases, determination of a count of mature T cells less than 50 is a marker for an aggressive treatment regimen.

Treatment, in preferred examples, comprises antiretroviral (ART) therapy, as described herein.

In certain examples, the method can be used to determine the progression or prognosis of a patient with any immune disease where T cells are affected.

In other cases, the method can be used to determine the progression or prognosis of a patient with cancer, for example, leukemia or lymphoma.

The prognosis can determine the course of treatment.

In preferred embodiments, the method further comprises the step of obtaining the sample from the subject.

The sample, preferably, is a biological sample. In certain cases, the biological sample is selected from the group consisting of dried blood, whole blood, tissue samples, and swabs. An ideal sample collection method for this type of test would be dried blood spots (DBS) due to the fact that they are stable at room temperature for years, and can be obtained from a simple finger prick. Thus, in certain preferred examples, the biological sample is a dried blood spot.

In any of the methods described herein the subject is a mammal, for example, but not limited to a human, monkey, or mouse.

Determining the Effectiveness of Therapy

Effective ART therapy results in sustained suppression of HIVRNA replication, resulting in gradual increases in CD4 T-lymphocyte count, sometimes to normal levels. ART does not eradicate the virus, as viral replication continues in lymphoid tissue despite suppressive treatment; however, durable suppression of viral replication and the accompanying increases in CD4 count, reverse HIV disease progression, even in persons with advanced HP/ infection. ART still, however, poses a number of challenges. Many of the effective regimens are complex, have major adverse effects, can be difficult for patients to adhere to, and can eventually (though not inevitably) lead to antiretroviral drug resistance. The use of various combinations of antiretroviral agents represents the current state of the art and significant benefits have been observed in many cases although the long term results remain to be established.

Currently, the use of the CD4 T-cell count is the major determinant in initiating therapy. Established guidelines uniformly recommend initiating ART before the CD4 count is <200 cells/μL.

The invention described herein is based on the finding that the number of T-cells (the total T cell count) in a subject's blood can be determined from a sample that is stable at room temperature, for example a dried blood sample, and the total T-cell count can be used as a surrogate marker for CD4 counts to determine the HIV disease stage of a patient, and thus can be

used to determine the need for ART therapy and the effectiveness of ART therapy. The methods described herein are based on the distinctive nature of the TCR-beta gene which undergoes a gene rearrangement process during T-cell development to obtain a functional TCR protein. As described herein, since only mature T-cells contain a rearranged TCR-beta gene, it is possible to quantify the number of T-cells in a subject sample by quantifying the number of total cells and subtracting from that the number of cells that contain unrearranged TCR-β genes.

The invention features a method of determining the effectiveness of ART therapy in a subject infected with HIV or AIDS by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, and thereby determining the effectiveness of ART therapy in a subject infected with HIV or AIDS.

Thus, using this method, an increase in the number of mature T cells in the subject compared to the control is, in certain examples, indicative of effectiveness of ART therapy.

The sample, preferably, is a biological sample. In certain cases, the biological sample is selected from the group consisting of dried blood, whole blood, tissue samples, and swabs. In certain preferred examples, the biological sample is a dried blood spot (DBS). In certain preferred examples, the DBS is from a finger prick.

DBS are an ideal sample collection method for large scale monitoring in the developing world due to the relatively simple manner in which samples can be obtained and the high stability of the sample in the absence of refrigeration. Additionally, DBS can be used to detect a range of other infectious diseases, endogenous pathogens, and genetic abnormalities over a large area. HFV drug resistance is a major concern as more patients begin ART in the developing world. Researchers have shown that it is possible to determine viral resistance from DBS. Therefore, this easily obtainable sample could provide data on HIV serologic status, a T-cell count, HIV viral load and HIV drug-resistance information.

The invention provides a method of determining the need for ART therapy in a subject infected with HFV or AIDS by determining the number of mature T cells in a sample from the subject comprising isolating DNA from the sample, wherein the sample is stable at room

temperature, determining the number of rearranged T-cell receptor beta (TCR-β) genes, whereby a rearranged T-cell receptor beta (TCR-β) gene identifies a mature T cell, and comparing the number of rearranged TCR-β genes in the subject to the number of rearranged TCR-β genes in a control sample, thereby determining the need for ART therapy in a subject infected with HIV or AIDS.

In certain cases, the subject may have previously been treated with ART therapy. Guidelines on antiretroviral therapy can be found on the world wide web at who . int/hi v/topics/arv/en/.

Using the methods of the invention, in certain cases, the progression of HIV or AIDS determines the course of treatment. For example, the progression of HIV as determined by the number of mature T cells in a sample, will determine the course of treatment that a patient received. hi certain cases, a number of mature T cells between 1 - 90 is a marker for initiation of a treatment regimen. As described above, in certain cases, the treatment regimen is ART therapy.

Any of the methods described further comprise the step of obtaining the sample.

As described above, in certain embodiments, the step of determining the number of rearranged TCR-β genes further comprises quantifying the total number of cells in the sample, quantifying the number of cells that contain unrearranged TCR-β genes, and subtracting the number of cells that contain unrearranged TCR-β genes from the total number of cells in the sample, and thereby determining the number of rearranged TCR-β genes. Methods of QPCR and ELISA can be used for the determining steps, as described herein.

The methods described herein provide a unique way to increase ART availability in the developing world, which has been shown to be the most successful method in preventing new HIV infections.

Any of the methods as described herein can be performed prior to or after therapeutic intervention for the disease or disorder.

B-cell Count

The methods of the invention are suited also for determining the number of mature B cells in a sample. In this way, the methods are essentially the same, with the detection of B-cells being determined.

Thus, in one aspect the invention features a method of determining the number of mature cells in a sample comprising isolating DNA from the sample, wherein the sample is stable at room temperature, and determining the number of rearranged B-cells, whereby a rearranged B- cell gene identifies a mature B cell, and thereby determining the number of mature B cells in a subject.

The method further comprises the step of obtaining the sample.

As described above, the sample may be a biological sample, for example dried blood, whole blood, tissue samples, and swabs. In certain embodiments, the sample is a dried blood spot.

As described above, in certain embodiments, the step of determining the number of rearranged B cell genes further comprises quantifying the total number of cells in the sample, quantifying the number of cells that contain unrearranged immunoglobulin cell genes, and subtracting the number of cells that contain unrearranged B cell genes from the total number of cells in the sample, and thereby determining the number of rearranged B cell genes.

Based on the results obtained from the method, i.e. the number of rearranged B cells, the method can be applied to a subject suffering from cancer or an autoimmune disease or disorder. For example, the method can provide a means of diagnosis, prognosis. The method can provide a way to determine need for therapeutic intervention, or the monitoring of the success of previous therapeutic intervention.

Kits

The invention also features kits. Included in the kits are primer probe pairs specific for the unrearranged configuration of the variable domain junction (VD-J) region of the TCR-β gene. Also included in the kits are primer probe pairs specific for a housekeeping gene.

The kits also include instructions for use in determining the need for ART therapy in a subject infected with HIV or AIDS, for use in determining the number of mature T cells in a sample, for use in monitor the progression of HIV in a subject. The kits also include instructions for use in treating a disease or disorder, for example an immunological disease or disorder, HIV or AIDS, or cancer.

Samples for use in the kits of the invention are, preferably, stable at room temperature.

Carrier means are suited for containing one or more container means such as vials, tubes, and the like, each of the container means comprising one of the separate elements to be used in the method. In view of the description provided herein of invention methods, those of skill in the art can readily determine the apportionment of the necessary reagents among the container means. hi certain examples, the kits are made for at home use, e.g. for at home diagnostic or testing purposes, hi other examples, the kits are suitable for at home monitoring of HIV+ subjects.

EXAMPLES

The following examples are offered by way of illustration, not by way of limitation. While specific examples have been provided, the above description is illustrative and not restrictive. Any one or more of the features of the previously described embodiments can be combined in any manner with one or more features of any other embodiments in the present invention. Furthermore, many variations of the invention will become apparent to those skilled in the art upon review of the specification. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims along with their full scope of equivalents.

All documents mentioned herein are incorporated herein by reference in their entireties.

Example 1.

The invention and methods described here rely on the distinctive nature of the TCR-beta gene which undergoes a gene rearrangement process during T-cell maturation to obtain a functional TCR protein. Due to somatic cell mutations and junctional flexibility, which occur during rearrangement, the DNA and protein sequence of the altered TCR-beta genes are highly diverse making accurate quantification of the recombined genes or proteins difficult. Therefore, the strategy employed and described herein to enumerate the number of rearranged TCR-beta genes was to determine the amounts of total cell DNA and subtract the number of TCR-beta genes remaining in germline configuration.

A schematic of the method is shown in Figures IA- 1C.

Venous blood samples were obtained from HIV+ patients attending the Moore Clinic in Baltimore. Four 50μL blood aliquots were blotted on a WHATMAN 903 filter paper card, and dried overnight at room temperature. The samples were stored in a plastic bag with desiccant at room temperature for up to three months. Twelve 3mm holes were punched out of -1.5 blood spots and used for the DNA isolation. DNA was isolated with a commercially available genomic DNA (gDNA) extraction technique (Invitrogen), and eluted in 200μL of PCR-grade water. The resulting samples were then stored at -20°C.

Two primer-probe pairs were used for the subsequent quantitative real-time PCR (QPCR). The germline configuration of the VD junction region (VD-J) of the TCR-beta was calculated using previously reported primers and probes (Chain JL et al., J Immunol Methods 300, 12 (May, 2005), which is hereby incorporated by reference in its entirety. Chain et al., supra provides the following sequences, which may be useful in the methods of the invention.

Name Forward primer sequence Reverse primer sequence Size

{bpj

V-Jg ^SB AGATCCACATTCAACCCACA GGAAGTGTGTGCTTGATGCC 895

V-DJh ^SB TGGCCACAGGAGGTCGGTTT TCCGATGGAGTTTGTCCCAG 507

Ch2 ^SB ATGGGAGGATGGAGACAACC GAGGACTTCCATCAGGATGA 508

Vh2- ^SJ GACATCCAGCTCTAAGGAGC TCCCCTCTCAGCACTCA 310

Vh4- ^SJ GACATCCAGCTCTAAGGAGC GCCTTCAGGCTCGTGTG 304

Vh4- ^SJ GACATCCAGCTCTAAGGAGC GCCTTCAGGCTCGTGTG 304

*SB designates primer sequences for the preparation of Southern blot probes and SJ designates primer sequences for the amplification of signal joints involving VYDJhI rearrangements.

Table 2: Primers and probes for real-time PCR amplicons

Name Probe sequence Forward primer sequence Reverse primer sequence Size

V- Jg*" ¹ ATGGATCCTCTTCCCGGCTTCTGC GGCATTAGATGATCCACCGACAAG AAAGAATTTAGAGCAGTGCCCAAGA 129

V-DJh"" ¹ TCTCCCGGTCTCCCACCCGC ACACGTGAAATGCTCTTTGCG TTACTCCTGCGCCTCTGTGTC 68

_Ch2 ^taq CTTGTGCCAGCATCGCAGCAATCT TGGCTTCTGGCACTCCTTG GCCATGTGAAGACAGAGGCA 65 hTREC^ TGCTCTGGTGGTCTCCTCCCA CGCTGTGCACAATGTTAC CCACTCCCCTCAAAGG 106

K)

Albumin (Alb) was used as a housekeeping gene to determine total cell number, and calculated with primers Alb-2 forward 5'-CACTTGTTGAGCTCGTGAAAC-S ', Alb-2 reverse 5'- CAGCCTTGCAGCACTTCTC-3', and Alb-2 Probe 5' FAM-

C AAGCCC AAGGC AAC AAAAGAGC A-TAMRA-3' (Sigma). Final primer and probe concentrations for both QPCR reactions were lμM, and 0.5μM, respectively. HeLa cell genomic DNA, which has 100% TCR-beta genes in germline configuration, was used as a standard for both target genes at a concentration of 6 ng/μL for an equivalent cellular DNA count of 2000 genomes/μL. (Chain et al, 2005 as above) A four step 1:10 serial dilution of the standard was performed and 5μL of each was used in a 50μL reaction for a range of detection from 10,000-10 genomic copies. In addition, a 25% mixture of gDNA derived from the T-cell clone Een 217, which has 98.3% of its TCR-β genes rearranged, and 75% HeLa cell DNA was created based on spectrophotometer derived gDNA levels, and aliquoted to be used as a control for QPCR assay variability.

The QPCR reaction was run in a 96-well format with each of the four HeLa controls, ddH2O, and the 25% mixture run in triplicate for each target gene. The DBS samples were run with 6 replicates for each target gene. Standard curves were created for each run according to the HeLa cell dilutions, and values were determined for each sample replicate. Subsequently, the highest and lowest readings for each gene of each sample were removed to increase assay accuracy, and eliminate the influence of any outliers in an unbiased manner. The resulting sample raw counts for each gene were then adjusted as shown below:

[Adjusted sample gene count = (Raw sample gene count) x (Mean of all 25% gene counts / Run-specific 25% gene count)].

The resulting adjusted counts for VD-J were averaged and subtracted from the adjusted Alb average to obtain the final rearranged TCR-β count.

Additionally, aliquots of the 25% mixture were diluted 1 :5 with water, and the resulting mixture was serially diluted 5 times at a 1 :2 ratio. The resulting samples were estimated to contain 200, 100, 50, 25, and 12.5 counts of rearranged TCR-beta. These dilutions were run using the protocol described above to determine the range and accuracy of the assay (Figure 3).

The calculated values demonstrated a strong correlation to the estimated amounts (CC = 0.985, p<0.0001) and an adequate range for the samples tested.

Samples were obtained from 64 patients who had CD4 cell counts taken within 24 hours of sample isolation. Of these, 21 patients were not on ART at that time. DNA was isolated from DBS as described above and run in the QPCR set-up. The rearranged TCR-beta counts for each patient were compared to the CD4 count derived in the Moore clinic lab. These were compared and found to correlate significantly (CC = 0.670, pO.OOOl; Pearson correlation) (Figure 3a). This was also seen when non-treated patients were identified indicating that this is most likely not a phenomenon being caused by ART (CC = 0.742, pO.OOOl; Pearson correlation) (Figure 3b). The CD4 count was also compared to TLC for these patients and found to correlate as is expected (CC = 0.557, pO.OOl; Pearson correlation) (Figure 4). In addition, the TCR-beta counts correlated better with TLC indicating that it is accurately determining T-cell counts (CC = 0.646, pO.OOOl; Pearson correlation) (Figure 5).

These data indicate that this assay can accurately determine TCR-beta rearrangements levels seen in patient samples. It also demonstrates that this detection was consistent across the approximate range of the samples seen in an infectious disease clinic. The strong correlations seen between the TCR-β count derived from DBS and the CD4 count in both the total patient population and the non-treated patients suggest that this assay could be used as a surrogate for CD4 or TLC in treatment of HIV.

Only T-cells that have undergone a significant positive and negative selection process in the thymus are found in the bloodstream with a rearranged TCR-beta gene. Thus, the TCR-beta assay is most likely detecting only fully mature or very close to fully mature T-cells, and not CD4-/CD8- dual negative T-cells which express a γ/δ TCR or lymphocyte progenitor cells which are both counted as lymphocytes by TLC. The cells containing a rearranged TCR-beta gene are almost exclusively CD8+ cytotoxic lymphocytes or CD4+ T-helper cells, the major target cell for HIV and only cells counted in a CD4 FACS based assay. Consequently, some discrepancy between this assay and the CD4 count is to be expected. Correlations between TLC and CD4, both of which are approved by the WHO for initiation of ART, have been shown to be as low as 0.41, where as the correlations between TCR-beta and CD4 seen here are significantly higher.(8) It is possible that by measuring the TCR-beta rearrangement this assay is giving a more reliable surrogate for a CD4 count which is difficult to obtain in resource-poor settings. Additionally,

this assay could represent an improvement for determining lymphocyte counts regardless of HIV status.

CD4 counts are highly predictive of HIV disease progression, and significant benefit to the long-term survival is seen in patients who begin ART earlier or before their CD4 count drops below 200.(9-11) One of the major contributing factors to HIV disease progression, however, is the loss of uninfected T-cells and the deterioration of the immune system due to bystander cell- killing.(12) Therefore, it could be beneficial to monitor the entire T-cell population when examining HIV disease progression.

DBS are an ideal sample collection method for large scale monitoring practices in the developing world due to the relatively simple manner in which samples can be obtained and the high stability of the sample in the absence of refrigeration.(13, 14) Additionally, DBS have been used for decades to monitor adult and neonatal HIV-I infection, and can be used to detect a range of other infectious diseases and genetic abnormalities. (13, 15) In theory, a technician or nurse could travel for a week or more within a developing country and gather large numbers of DBS in the field, store them in their vehicle, and return to a central lab where the DBS could be examined to determine the HFV status of all individuals. HIV+ individuals would then be tested for TCR-β counts and that information used to determine ART initiation in the area covered. This would allow the limited number of existing laboratories found in the developing world to greatly increase their impact area with little in additional capitol investment, and would allow the limited number of trained lab staff found in the developing world to streamline and maximize their efforts. The TCR-β data should provide researchers with information that could be used to predict future ART need thereby allowing for improved planning for funding and implementation in the future. Finally, this type of sample collection would be helpful to monitor and treat HIV in conflict areas where some of the most vulnerable populations in the world are found.

One drawback of the assay described here is that it relies on a functional real-time PCR machine. However, it would be possible to adapt this technology to an ELISA based assay that uses serial dilutions to obtain an approximate value for the rearranged TCR-beta genes. Multiplexing the QPCR of the two gene targets could also increase sample throughput.

The experiments described herein could play a significant role in increasing ART availability in resource-poor settings by providing researchers and clinicians with a reliable

immunological test that does not require close proximity to a functional laboratory, or the need for a stable cold-transport chain.

Example 2

In addition, ROC curve analysis of the full Baltimore data set and the no anti-retro viral therapy (ARV) set indicated that the assay has similar predictive value for beginning HIV therapy as total lymphocyte counts (Figures 6A and 6B, Figures 7A and 7B). The ROC curve analyses were generated using the following data: Full Data Set: n=135

Cell Contents:

Correlation Coefficient

P Value

Number of Samples

TCR count CD4 % CD4 count TotLymph

% ofTCR 0.547 0.124 0.239 0.284

6.670E-012 0.156 0.00530 0.00128

135 133 135 126

TCR count 0.178 0.438 0.484

0.0406 0.000000109 0.00000000925

133 135 126

CD4 % 0.735 -0.0309

7.723E-024 0.732

133 125

CD4 count 0.546

3.721E-011

126

No ARV data set: n=33

Pearson Product Moment Correlation Data source: Data 2 in Full Bmore data

Cell Contents: Correlation Coefficient P Value Number of Samples

TCR count CD4 count CD4 % TotLymph

% ofTCR 0.685 0.332 0.176 0.637 0.0000109 0.0590 0.328 0.0000880 33 33 33 32

TCR count 0.565 0.403 0.577 0.000620 0.0200 0.000552 33 33 32

CD4 count 0.869 0.358 5.243E-011 0.0445

33 32

CD4 % 0.0604 0.743 32

In another approach, to further increase the accuracy of CD4 measurement, the rearranged TCR-beta count was multiplied by the CD4:CD8 ratio obtained from the FACS reading (Figures 8 and 9). This analysis was done using samples obtained in the field in Uganda, further demonstrating that this technology could be used in an African setting. This resulting value compared the CD4 count using a Spearman Rank order correlation (r=0.695, pO.OOl). The CD4:CD8 ratio could also be obtained from two ELISAs.

The invention was carried out using, but not limited to, the following methods.

T-cell Enumeration using Dried Blood Samples

The method was carried out as follows: 1) Venous blood was drawn from HIV+ patients at the Moore clinic in Baltimore and put into tubes containing anti-coagulant for processing. 2)200 uL was removed from the tube and blotted in four spots onto Whatman 903 Protein-saver paper. These were then dried overnight. 3)12 3 mm holes were punched out of the resulting spots and put (6 each) in two micro centrifuge tubes. 4)The spots were then processed using an Invitrogen based DNA extraction kit to extract the DNA. 5)The resulting DNA was eluded into

200 uL of ddH2O and frozen at -20. 6)Standards were made at the level of 2000 copies of HeLa cell DNA per uL and aliquoted in 5OuL tubes and frozen. In addition, a 25% mix of T-cell clone DNA was mixed with HeLa cell DNA (75%) and aliquoted for use as the internal control and for the adjustment step. 7)5 uL of sample (6 replicates), the 25% mixture (3 replicates), or the 4 serial dilution (10000, 1000, 100, and 10) (3 replicates) were loaded into a mixture of real-time PCR master mix (1 :2) and primers (.5μM) and probes (1 μM) (Fam and Tamra labeled) for either Albumin or the VD-J junction region of the T-cell Beta receptor. 8)These were then mixed and put in the real-time PCR machine for 40 cycles at 60° annealing temperature for 1 minute with 15 second 95° melting step. 9)The resulting standard curves were generated from the top 3 standards and calculated automatically by the machine. The resulting raw numbers of the samples were matched to these curves, and the highest and lowest value of the six replicates was immediately removed to eliminate any effect from outliers. 10)The 25% sample's raw values for Albumin and VD-J are then calculated against a mean value of all test done (Average raw value/Run-specific raw value). This number is then multiplied by the respective raw Albumin and VD-J numbers for each sample. 1 l)The resulting adjusted numbers are then subtracted (AIb- VD-J) for a raw T-cell count for the sample. 12)These raw T-cell counts are then graphed against those patients that have CD4 counts within one day of when the DBS was isolated. The resulting correlation is highly significant and highly correlative to the known CD4 counts.

Other Embodiments

From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.

References:

1. UNAIDS, (December, 2007).

2. W. H. Orginization, http://www.who. int/3by5/publications/documents/arv_guidelines/en/ (2003 accessed April 9, 2008).

3. T. Schreibman, G. Friedland, Clin Infect Dis 38, 257 (Jan 15, 2004).

4. Lancet 366, 1868 (Nov 26, 2005).

5. L. A. Spacek, M. Griswold, T. C. Quinn, R. D. Moore, Aids 17, 1311 (Jun 13, 2003).

6. M. R. Kamya et al., Aft Health Sci 4, 94 (Aug, 2004).

7. J. L. Chain et al., J Immunol Methods 300, 12 (May, 2005).

8. D. Mbanya, F. Assah, N. Ndembi, L. Kaptue, Int J Infect Dis 11, 157 (Mar, 2007).

9. R. S. Hogg et al., Jama 286, 2568 (Nov 28, 2001).

10. F. J. Palella, Jr. et al., Ann Intern Med 138, 620 (Apr 15, 2003).

11. T. B. Hallett, S. Gregson, S. Dube, G. P. Garnett, PLoS Med 5, e53 (Mar 11, 2008).

12. M. D. Hazenberg, D. Hamann, H. Schuitemaker, F. Miedema, Nat Immunol 1, 285 (Oct, 2000).

13. S. P. Parker, W. D. Cubitt, J Clin Pathol 52, 633 (Sep, 1999).

14. T. W. McDade, S. Williams, J. J. Snodgrass, Demography 44, 899 (Nov, 2007).

15. M. Pappaioanou et al., Aids 7, 483 (Apr, 1993).