The present invention is in the domain of bacterial detection, specifically detection of Neisseria meningitidis (Nm) serogroup W, etiologic diagnosis and diagnostic kits allowing the detection of said serogroup, preferably in a biological sample.

Neisseria meningitidis is an exclusively human bacterium that can provoke severe invasive infections such as meningitis and septicemia. Meningococcal meningitis occurs sporadically in Europe and North America, but is responsible for recurrent epidemics within the African 'meningitis belt': a region spanning sub-Saharan Africa from Senegal in the west to Ethiopia in the east.

During the dry season, dust winds, cold nights and upper respiratory tract infections combine to damage the nasopharyngeal mucosa, increasing the risk of meningococcal disease. Moreover, transmission of N. meningitidis may be facilitated by overcrowded housing and by large population displacements at the regional level due to pilgrimages and traditional markets. This combination of factors explains the large epidemics which occur during the dry season in the meningitis belt.

N. meningitidis is a capsulated bacterium with the polysaccharide capsule determining the serogroups, which are differentially distributed worldwide. Twelve serogroups of N. meningitidis have been identified, with six of these— serogroups A, B, C, W, X, and Y— being responsible for virtually all invasive disease. Polysaccharide vaccines have been available for more than 30 years and variously cover one or more of serogroups MenA, C, W, and Y. Protein-conjugate capsular vaccines against MenC, more recently, A, C, W, and Y and MenA, are available. Vaccines targeting outer membrane vesicles (OMVs) have been in use in outbreak control since the 1980s. In 2014, two vaccines designed to offer broad protection against MenB, developed using subcapsular meningococcal antigens, became available. For many years, serogroup A predominates in the meningitis belt but other serogroups are also observed. Serogroup A decreased significantly since the introduction of the conjugate vaccine against serogroup A. However, other serogroups emerged or re-emerged recently in the meningitis belt such as serogroups C, W and X.

Of interest, N. meningitidis serogroup W (MenW or NmW) has now become the predominant strain across the Sub-Saharan meningitis belt. Moreover, MenW also spread elsewhere globally. In particular, a significant increase was observed in South America and more recently in the United Kingdom as well as other European countries. Surveillance of the distribution of meningococcal serogroups is therefore important and its comprehensiveness will benefit from diagnosis tools that can be widely used at the bedside. Indeed, the WHO strategy for controlling epidemic meningococcal disease, especially in the meningitidis belt is based on an early and accurate detection and rapid implementation of mass vaccination using vaccines against the appropriate serogroups. It is thus imperative to rapidly and reliably identify the serogroups involved in meningococcal infection, in order to select the most appropriate vaccine. This appropriate vaccination allows the control of the epidemic clonal spread and thus plays an essential role in limiting the incidence of the outbreaks. An error in the detection of the serogroup impairs and delays the efficacy of this control, emphasizing the importance of the rapidity, sensitivity and specificity of the serogroup determination.

Two strategies are generally applied for detecting the N. meningitidis serogroups involved in a meningococcal infection. The first one is the classic culture with subsequent identification of serogroups using specific antisera. The second one is based on the direct detection of the serogroups in a biological sample from the diagnosed or affected individuals.

With respect to culture isolation, this technique, with strain serogrouping by immune specific antisera, is generally considered as one of the reference standards for identification of N. meningitidis serogroups, since this technique is generally considered as specific, but this technique is poorly adapted to field detection, especially in Africa, where laboratory facilities can be at some distance away from the area of sample collection, necessitating special transport and preservation conditions of the samples. The time taken for sample transfer as well as the hot, dusty conditions experienced during the meningitidis season can lead to high levels of sample contamination. Moreover, the early antibiotherapy recommended in case of a suspected infection diminishes the efficacy of this method.

Regarding the non-culture tests, they rely either on immune detection or on genetic detection. Genetic detection is carried out generally by multiplex PCR method. This method is highly specific and very sensitive. It takes however several hours before a result can be obtained. Moreover, this technique is expensive and requires well-equipped laboratories with specialized technicians; this method is thus not well adapted to field conditions.

The non-culture tests based on immune detection of N. meningitidis were until recently essentially limited to latex agglutination tests on cerebrospinal fluid (CSF), such as Pastorex (Bio-Rad Laboratories, Inc.). Latex agglutination tests are rapid, sensitive, less labour- intensive and much less expensive than routine culture tests. These tests are however not routinely recommended, because they do not differentiate between serogroups W (previously known as W135) and Y, do not detect serogroup X, and their performance under field conditions lacking basic laboratory equipment is presumably weak. Furthermore, these kits require cold storage and well-trained technicians for the read-out and they may result in a few indeterminates, false negatives, and false-positives.

The Institut Pasteur has previously developed rapid diagnostic tests ( DT) for detecting N. meningitidis capsular polysaccharides (A, C, Y, Y/W and X; see inter alia PCT/EP2015/076892 and PCT/EP2016/062994). However, a specific RDT to detect NmW is lacking and this serogroup, before the present invention, was only indirectly inferred, namely by the combination of the result obtained with RDT Y/W and of the result obtained with RDT for Y, i.e. NmW is detected in case of a positive result with RDT Y/W combined with a negative result with RDT Y.

Reyes et al, 2014 discloses a monoclonal antibody against NmW polysaccharides. This antibody was however raised against purified polysaccharides, conjugated to tetanus toxoid, with a view to quantify purified NmW polysaccharides in a vaccine preparation. Neither its reactivity nor its cross-reactivity with other serogroups was tested on whole bacteria or in a biological sample; moreover, its cross-reactivity with serogroup B is unknown.

There is therefore a need to provide a rapid diagnostic test for NmW, with limited variation in performance from batch-to-batch and providing reproducible results; there is also a need to provide a more reproducible and industry grade rapid diagnostic test to complete the set of bedside diagnostic tools for the detection of meningococcal meningitis. There is thus a need to provide antibodies, especially monoclonal antibodies, capable of detecting N. meningitidis serogroup W with high sensitivity and specificity, obtainable in a reproducible manner, allowing standardized rapid diagnostic test, which remain stable over time with minimal variation in performance.

The present inventors have unexpectedly obtained and characterized two N. meningitidis serogroup W monoclonal antibodies, recognizing purified capsular polysaccharides of N. meningitidis serogroup W, capsular fragments of N. meningitidis serogroup W and N. meningitidis serogroup W bacteria in biological samples. Using these monoclonal antibodies, the inventors have obtained an immunological test to detect N. meningitidis serogroup W bacteria, and have demonstrated that these antibodies can be used in rapid diagnostic tests, to detect specifically MenW bacteria, especially in tests to detect simultaneously several serogroups of N. meningitidis including serogroup W.

According to a first aspect, the present invention is thus directed to a monoclonal antibody or an antigen-binding portion thereof, which is specific for the capsular polysaccharides of Neisseria meningitidis serogroup W (NmW). In nature, antibodies are glycoprotein molecules produced by B lymphocytes. Generally speaking, antibodies bind antigens with a high degree of specificity, and can be subdivided on the basis of physical and functional properties into five classes (or isotypes), designated IgG, IgM, IgA, IgD and IgE. These different types of antibodies share a common basic structural unit which has a molecular weight of approximately 150,000 Daltons (150 kDa) and is composed of two identical heavy (H) polypeptide chains and two identical light (L) chains, covalently bonded via interchain disulfide (S-S) linkages between cysteine residues.

The antibodies of the invention also have this structure.

Five different H chains exist in nature, designated alpha (a), gamma (γ), delta (δ), epsilon (ε), and mu (μ), which differ from each other in amino acid sequence. The isotype of a given antibody (i.e. whether it belongs to the IgA, IgG, IgD, IgE, or IgM class) is determined by the H chain of the antibody in question, the alpha H chain defining the IgA isotype, the gamma H chain defining the IgG isotype etc.... Within the IgG class there are four sub-classes designated lgG1 to lgG4, lgG2 subclass being split in two sub-groups called lgG2a and lgG2b.

Two different light (L) chains exist in nature, designated kappa (κ) and lambda (λ), which differ from each other in amino acid sequence.

The variable region of the heavy chain and the variable region of the light chain both contain three hypervariable regions, called "complementarity-determining regions" (CDRs), designated CDR1 , CDR2 and CDR3, for the heavy and for the light chains. The CDRs of the heavy and light chains have a length of about 3 to 25 amino acids and play a key role in antibody specificity. The monoclonal antibody or portion thereof according to the invention, specifically binding to NmW capsular polysaccharides, comprises at least:

a light chain variable region (Vi_) comprising a light chain CDR1 having the sequence set forth in SEQ ID NO: 1 ; a light chain CDR2 having a sequence set forth in SEQ ID NO: 2; and a light chain CDR3 having a sequence set forth in SEQ ID NO: 3 ; and - an associated heavy chain variable region (VH) comprising a heavy chain CDR1 having the sequence set forth in SEQ ID NO: 4 or 5, a heavy chain CDR2 having a sequence set forth in SEQ ID NO: 6, and a heavy chain CDR3 having a sequence set forth in SEQ ID NO: 7.

The complementarity-determining regions according to the invention have been defined by the International Immunogenetics Information System® (www.imgt.org), using well known techniques (Scaviner et al, 1999; Kaas et al, 2007). The heavy chain variable region and light chain variable region are preferably associated, within the antibody or antigen-binding portion thereof according to the invention. The antibodies of the invention may be produced inter alia by B lymphocytes, by hybridoma, by expression of the recombinant antibodies in a prokaryotic or eukaryotic host cell, or by synthetic techniques such as antibody engineering from existing antibodies. They may or may not be glycosylated.

In the context of the present invention, an 'antibody fragment' or 'antibody portion' means an antigen-binding portion of the antibody, and includes variants of such portions, even if not strictly speaking fragment of an antibody, provided they are able to specifically bind the same antigen, namely NmW capsular polysaccharides, and comprise the CDR herein described. Preferred examples of antigen-binding fragments or portions according to the invention are Fab fragments; Fab' fragments; F(ab')2 fragments, scFv (single chain variable fragment) and minibodies, as well as portions of antibody comprising at least a Fab' region. Antigen-binding portions of an antibody are easily determined by a skilled person.

Variants of such fragments include dimers, and trimers of the fragments, and inter-fragment fusions. Fragments of the invention may be monovalent (for example Fab fragments), bivalent (for example F(ab')2 fragments) or multivalent (for example a chemical conjugate comprising a trimeric Fab fragment).

Any reference in the following to an antibody fragment or portion, or fragment according to the invention, or antigen-binding fragment/portion, are used interchangeably, to design an antigen-binding portion of the antibody of the invention, specifically binding NmW capsular polysaccharides, and comprising at least a light chain variable region (Vi_) comprising a light chain CDR1 (complementarity-determining region 1 ) set forth in SEQ ID NO: 1 , a light chain CDR2 set forth in SEQ ID NO: 2 and a light chain CDR3 set forth in SEQ ID NO: 3, and an associated heavy chain variable region (VH) which comprises a heavy chain CDR1 set forth in SEQ ID NO: 4 or SEQ ID NO:5, a heavy chain CDR2 set forth in SEQ ID NO: 6 and a heavy chain CDR3 set forth in SEQ ID NO: 7.

The monoclonal antibodies and portions of the invention are thus characterized by 6 specific CDR for the heavy and light chains, the amino acid sequence of which are illustrated in Figure 4 (SEQ ID NO: 1 to 7).

The amino acid sequence of the variable region of the light chain together with the variable region of the associated heavy chain form the antigen binding site of the antibody or fragment thereof, the specificity of which is determined by the 3 CDR of the heavy chain and the 3 CDR of the light chain.

The light chain of an antibody or portion thereof according to the invention is preferably a typical kappa light chain, for example a human or murine kappa light chain.

The heavy chain of an antibody or portion thereof according to the invention is preferably a gamma (γ) heavy chain, or a fragment of such a chain preferably comprising the whole variable region, for example a fragment as found in Fab or Fab'. Even more preferably, the heavy chain of the antibody is of the subclass γ2. The idiotype of the monoclonal antibodies or portions thereof according to the invention is thus preferably IgG, and even more preferably an lgG2. According to a particularly preferred embodiment, the antibody is an lgG2a antibody.

Insofar as a kappa chain is preferred for the light chain of the antibody of the invention or fragment thereof, a particularly preferred antibody or antigen-binding portion thereof, is thus an IgGK, and more preferably an lgG2,K, especially an lgG2a,K.

It is thus preferred that the monoclonal antibodies are lgG2 antibodies or antigen-binding portions thereof, as defined above, specifically binding the capsular polysaccharides of N. meningitidis serogroup W, and comprising the 6 CDRs set forth in SEQ ID N°1 , 2, 3, 4, 6 and 7; or the 6 CDRs set forth in SEQ ID Ν , 2, 3, 5, 6 and 7.

A monoclonal antibody according to the invention is capable of specifically detecting the N. meningitidis serogroup W capsular polysaccharides in situ, i.e. on the bacteria, as part of the capsule, or on bacteria fragments or on blebs (outer membrane fragments released during bacterial growth) as found in biological samples, without need of purification, and without need of any culture step.

Due to the weak immunogenicity of the bacterial capsular polysaccharides, the antibodies recognizing capsular polysaccharides are indeed generally obtained by raising antibodies against purified capsular polysaccharides, conjugated to a peptidic moiety, e.g. tetanus toxoid or mutant of diphtheria toxin, in order to enhance the immunogenic reaction of the host animal. The lack of immunogenicity of the bacterial capsular polysaccharides is well known especially for N. meningitidis bacteria. These antibodies, raised against conjugates, do not necessarily recognize the N. meningitidis capsular polysaccharides on the bacteria, especially in biological samples, or with an altered specificity or sensitivity.

By way of contrast, the antibodies or portions thereof according to the invention are capable of specifically recognizing the NmW polysaccharides when present on the bacteria, especially as part of the capsule, or on blebs, without cross reacting with polysaccharides of other serogroups, especially without cross reacting with NmA, NmB, NmC, NmX and NmY polysaccharides. There is thus no need for purification of the polysaccharides in order to detect NmW bacteria in a sample, when using the antibodies or portions thereof according to the invention.

The antibodies or portions thereof of the invention are thus suitable for in vitro detection of N. meningitidis serogroup W in a biological sample, without purification, especially in cerebrospinal fluid samples. Monoclonal antibodies or portions thereof according to the invention are capable of recognizing both purified capsular polysaccharides of N. meningitidis serogroup W (cpsW) and N. meningitidis serogroup W isolates or fragments thereof, or blebs. Moreover, the antibodies or fragments of the invention as defined above are capable of detecting the N. meningitidis serogroup W capsular polysaccharides in solution, especially in liquid samples. The monoclonal antibodies according to the invention, as well as their fragments as defined above, are thus suitable for the in vitro detection of N. meningitidis serogroup W in biological fluids, without requiring any step of culture; they are suitable for detecting soluble antigens of NmW, especially in clinical samples, from biological fluids, especially in cerebrospinal fluid, and in any solution comprising bacterial extracts such as blebs.

A monoclonal antibody or fragment thereof according to the invention is inter alia suitable for in vitro detection of N. meningitidis serogroup W by immunochromatography. It has indeed been reported that some monoclonal antibodies, although considered as specific for NmW when screened by ELISA, appear to cross react with other N. meningitidis serogroups when assessed by immunochromatography (Chanteau et ai, 2006(a)). The monoclonal antibodies according to the invention are particularly suitable for in vitro detection of N. meningitidis serogroup W by immunochromatography, as there is no such cross reaction.

An important feature of the antibodies and fragments of the invention is indeed that their binding to the capsular polysaccharides of N. meningitidis serogroup W is specific, inter alia the antibodies and fragments of the invention do not bind to the capsular polysaccharides of the other serogroups of N. meningitidis. The terms "specifically bind" mean that the antibodies and fragments of the invention bind to the capsular polysaccharides of N. meningitidis serogroup W, as expressed on the coated surface of NmW bacteria, and do not bind to polysaccharides of other N. meningitidis serogroups or of other bacteria, especially encapsulated bacteria. This specificity is also found when the antibodies of the invention are tested by immuno-chromatography. The monoclonal antibodies according to the invention thus do not cross react with other types of bacteria; especially they do not cross react with E. coli, H. influenza, S. pneumonia. The monoclonal antibodies also do not cross react with any serogroup of the N. meningitidis other than serogroup W. Inter alia, they do not cross react with the other 5 most widespread serogroups of N. meningitidis, namely A, B, C, X and Y; more preferably they do not cross- react with any of the 1 1 other serogroups identified for N. meningitidis, namely serogroups A, B, C, X, Y, Z, E (previously known as 29E), H, I, K and L.

The monoclonal antibodies of the invention are thus highly specific for the serogroup W of N. meningitidis and therefore allow the specific detection of this serogroup and allow distinction between this serogroup and any other serogroup, especially distinction between this serogroup and the 5 other widespread serogroups A, B, C, X and Y. In this respect, it is to be mentioned that the specificity of the monoclonal antibodies of the invention is a feature which is imparted by the sequences of the CDRs set forth in SEQ ID N°1-7. By way of contrast, most of the antibodies against NmW known before the present invention are not entirely specific for NmW and thus have been disclosed as cross-reacting with other serogroups of N. meningitidis. Moreover, none of the prior monoclonal antibodies against NmW has been validated for the detection of antigens from NmW in a biological sample, especially without prior purification or culture step, contrary to the monoclonal antibodies of the invention, and/or for the detection of NmW antigens by immunochromatography.

As mentioned above, the light chain variable region of an antibody of the invention or fragment thereof as defined above, comprises a light chain CDR1 having the sequence QSLLNSRTRKNY (SEQ ID NO: 1 ), a light chain CDR2 having the sequence WAS (SEQ ID NO: 2); and a light chain CDR3 having the sequence KQSxNLLTF (SEQ ID NO:3), wherein x is either a Phenylalanine (F) or Tyrosine (Y). According to a preferred embodiment, the sequence of the light chain CDR3 is thus KQSFNLLTF (SEQ ID NO:8). According to another preferred embodiment, the sequence of the light chain CDR3 is KQSYNLLTF (SEQ ID NO:9). With respect to the heavy chain variable region of an antibody of the invention, or fragment thereof as defined above, it comprises a heavy chain CDR1 having the sequence GFTFSDAW (SEQ ID NO:4) or FTFSDAW (SEQ ID NO:5), a heavy chain CDR2 having the sequence IRNKANNHAT (SEQ ID NO: 6), and a heavy chain CDR3 having the sequence TGAYRYDRFAY (SEQ ID NO: 7).

The invention thus concerns a monoclonal antibody or fragment thereof as defined, comprising a light chain variable region which is characterized by a light chain CDR1 having the sequence QSLLNSRTRKNY; a light chain CDR2 having the sequence WAS; and a light chain CDR3 having the sequence KQSFNLLTF, associated to a heavy chain variable region characterized by either

- a heavy chain CDR1 having the sequence GFTFSDAW, a heavy chain CDR2 having the sequence IRNKANNHAT, and a heavy chain CDR3 having the sequence TGAYRYDRFAY, or

a heavy chain CDR1 having the sequence FTFSDAW, a heavy chain CDR2 having the sequence IRNKANNHAT, and a heavy chain CDR3 having the sequence TGAYRYDRFAY.

According to another embodiment, the invention concerns a monoclonal antibody or fragment thereof as defined, comprising a light chain variable region which is characterized by a light chain CDR1 having the sequence QSLLNSRTRKNY; a light chain CDR2 having the sequence WAS; and a light chain CDR3 having the sequence KQSYNLLTF, associated to a heavy chain variable region characterized by either

a heavy chain CDR1 having the sequence GFTFSDAW, a heavy chain CDR2 having the sequence IRNKANNHAT, and a heavy chain CDR3 having the sequence TGAYRYDRFAY, or a heavy chain CDR1 having the sequence FTFSDAW, a heavy chain CDR2 having the sequence IRNKANNHAT, and a heavy chain CDR3 having the sequence TGAYRYDRFAY.

A monoclonal antibody or a fragment thereof according to the invention preferably comprises a light chain region comprising or having an amino acid sequence set forth in SEQ ID NO: 10 or in SEQ ID NO:1 1 , or variants thereof, having at least 90% sequence identity to SEQ ID NO: 10 or to SEQ ID NO:1 1 , provided they have the same CDRs as those comprised in these sequences. In this respect, the CDRs comprised in SEQ ID NO: 10 are the light chain CDR1 , CDR2 and CDR3 having the sequences SEQ ID NO: 1 , 2 and 8 respectively; the CDRs comprised in SEQ ID NO:1 1 are the light chain CDR1 , CDR2 and CDR3 having the sequences SEQ ID NO: 1 , 2 and 9 respectively.

It is also preferred that a monoclonal antibody or a portion thereof according to the invention comprises a heavy chain region comprising or having an amino acid sequence set forth in SEQ ID N°12 or in SEQ ID NO:13, or variants thereof, having at least 90% sequence identity to SEQ ID NO: 12 or to SEQ ID NO: 13, provided they have the same CDRs as those comprised in these sequences. In this respect, the CDRs comprised in SEQ ID NO: 12 are the heavy chain CDR1 , CDR2 and CDR3 having the sequences SEQ ID NO: 5, 6 and 7 respectively; the CDRs comprised in SEQ ID NO: 13 are the heavy chain CDR1 , CDR2 and CDR3 having the sequences SEQ ID NO:4, 6 and 7 respectively.

Preferred monoclonal antibodies or fragments thereof according to the invention are those comprising a heavy chain region comprising an amino acid sequence set forth in SEQ ID NO: 12 and a light chain region comprising an amino acid sequence set forth in SEQ ID NO: 10, and those comprising a heavy chain region comprising an amino acid sequence set forth in SEQ ID NO:13 and a light chain region comprising an amino acid sequence set forth in SEQ ID NO:1 1.

A monoclonal antibody of the invention is for example the antibody secreted by the hybridoma cell line or cell culture B23-1 deposited at the CNCM (Collection nationale de cultures de micro-organismes (CNCM) Institut Pasteur ; 25-28, rue du Docteur Roux ; 75724 Paris Cedex 15 FRANCE), on 12 ^th July 2016, under accession number 1-51 17.

This hybridoma has been obtained by immunizing BP2 strain mice with whole inactived N. meningitidis serogroup W and fusion of immortalised myeloma cell (plasmacytoma X63_Ag8.653) with splenocytes from the immunised mice. The antibody is preferably purified from the hybridoma culture medium.

According to another embodiment, a monoclonal antibody of the invention is the antibody secreted by the hybridoma cell line or cell culture H17-1 deposited at the CNCM (Collection nationale de cultures de micro-organismes (CNCM) Institut Pasteur ; 25-28, rue du Docteur Roux ; 75724 Paris Cedex 15 FRANCE), on 12 ^th July 2016, under accession number 1-51 16. This hybridoma has been obtained in the same fusion as B23-1. The antibody is also preferably purified from the hybridoma culture medium.

The antibodies B23-1 and H17-1 are immunoglobulins G2a.

The CDRs characterizing the monoclonal antibodies of the invention, or antigen-binding portions thereof, are those of the antibodies produced by the deposited cell lines. Namely SEQ ID 1 , 2, 8, 5, 6, 7 correspond to the light chain CDR1 , 2, 3 and heavy chain CDR1 , CDR2, CDR3 respectively of B23-1 and SEQ ID 1 , 2, 9, 4, 6, 7 correspond to the light chain CDR1 , 2, 3 and heavy chain CDR1 , CDR2, CDR3 respectively of H17-1. These CDRs may thus be defined either by reference to SEQ ID N°1 , 2, 4-9 of the enclosed sequence listing, or by reference to the 6 CDRs of the two antibodies B23-1 and H17-1 deposited at the CNCM under accession number 1-51 17 and 1-51 16 respectively.

According to one aspect of the invention, the antigen-binding portion of a monoclonal antibody of the invention may be or may comprise a Fab fragment, corresponding to the entire light chain and corresponding part of the heavy chain. Fab fragments comprise the antigen-binding site.

According to another aspect, the antigen-binding portion of a monoclonal antibody of the invention may be or may comprise a Fab' fragment. In the context of the invention, a Fab' fragment is a Fab fragment in which the heavy chain additionally comprises the natural hinge region on its carboxy terminal, suitable for covalent bonding to a second antibody fragment. The hinge contains one or more amino acid residues or chemical groups which are suitable for covalent bond formation, for example a free cysteine, thereby allowing dimerization of the Fab' fragment. Alternatively, the Fab' fragment may be artificially dimerized.

The advantage of using Fab' fragments is that they can be dimerised to form F(ab')2 fragments having two antigen binding domains. F(ab')2 fragments are therefore divalent, increasing avidity of binding with respect to a Fab monomer.

According to a further embodiment of the invention, the antibody fragment of the invention may be or may comprise a Fab, Fab' or a F(ab')2 fragment, preferably a Fab portion of an IgG, most preferably of B23-1 or of H17-1.

Any fragment of monoclonal antibody according to the invention preferably comprises at least the 6 CDRs of the antibody excreted by the deposited cell line 1-51 16, or the 6 CDRs of the antibody excreted by the deposited line 1-51 17, or the 3 CDRs of the light chain of the antibody excreted by the deposited cell line 1-51 16 associated to the 3 CDRs of the heavy chain of the antibody excreted by the deposited cell line 1-51 17, or alternatively the 3 CDR of the light chain of the antibody excreted by the deposited cell line 1-51 17 associated to the 3 CDRs of the heavy chain of the antibody excreted by the deposited cell line 1-51 16.

The antibodies and portions thereof according to the invention may be fully of murine origin or fully human. Alternatively, the antibodies and fragments thereof according to the invention may combine for example a heavy chain of non-human origin, for example murine, with a light chain of human origin, or the chains may be chimeric, or antibody engineering techniques may be used to humanise the heavy chain and/or the light chain, or both.

A monoclonal antibody or fragment thereof according to the invention is preferably a murine antibody or fragment thereof, but may also be a human, rabbit, humanized or chimeric antibody, or fragment thereof.

It is to be noted that a monoclonal antibody or antigen-binding portion according to the invention, is advantageously purified, or isolated from other distinct antibodies, especially it is not part of a polyclonal serum comprising different antibodies. Preferred also are purified monoclonal antibodies or antigen-binding portions according to the invention.

The invention also concerns cells producing, synthesizing or secreting an antibody of the invention, or portion thereof as defined above, especially isolated cells or clonal population. Preferably, such cells do not produce other antibodies, especially do not produce other antibodies directed to NmW. Preferred cells are the hybridomas, inter alia the hybridoma cell lines deposited at the CNCM disclosed above. Bacterial or mammalian cells, transformed or transfected with both a vector encoding the light chain and a vector encoding the heavy chain of the antibody of the invention, or a portion thereof as defined, expressing the antibody or the portion, are also part of the present invention.

The invention is also directed to a diagnostic agent, corresponding to the monoclonal antibody of the invention, specific for NmW capsular polysaccharide, linked to or conjugated to a detection label. The linkage between the monoclonal antibody and the detection label can be any sort of linkage, either directly, or indirectly, for example via another molecule or support. The linkage may be a non-covalent linkage, for example based on electrostatic forces, or may be a covalent linkage.

A detection label as used here consists in or comprises preferably a reporter group, selected for example from enzymes, substrates, cofactors, inhibitors, dyes, radioisotopes, luminescent groups, fluorophores, colorimetric indicators, gold particles, latex particles, and biotin. Any other reporter group may also advantageously be used. Such a reporter group allows the revelation of the detection label and thus of the antibodies linked to said detection label. The way of revealing the reporter group is dependent of course on the reporter group.

In the context of the present invention, the monoclonal antibody is preferably linked to gold particles, especially when it is to be used in rapid diagnostic test such as a dipstick device. In this way, it can be visualized on a solid support without difficulty, without the need for specific equipment, and very rapidly.

The monoclonal antibodies according to the invention are indeed specifically suitable for soluble detection of antigens of NmW, thus allowing the specific detection of NmW, i.e. allowing the discrimination of serogroup W from other serogroups of N. meningitidis. According to a second aspect, the present invention is directed to different methods for the detection of NmW, or of NmW capsular polysaccharides, the detection being specific for serogroup W, allowing the discrimination between this serogroup and other serogroups of N. meningitidis.

Indeed, the monoclonal antibodies of the invention, or antigen-binding portions thereof, are advantageously used as immunological probes to specifically detect the NmW bacteria.

According to one embodiment of said method, the detection is to be made in a sample, preferably a clinical sample of a biological fluid, inter alia obtained from a patient affected or suspected to be affected by meningitis infection; i.e. without a culture step. Such a method comprises the step (1 ) of contacting the fluid with monoclonal antibodies or portions thereof according to the invention or with the diagnostic agent of the invention, and the step (2) of determining the presence or absence of NmW antigens in the fluid.

The method as described is preferably to be carried out in vitro or ex vivo. The first step of contacting the fluid with the monoclonal antibody or antigen-binding portion thereof is thus made in vitro or ex vivo. The monoclonal antibodies, or their fragments as defined according to the invention, are advantageously linked to a detection label, as disclosed above.

The antigens of NmW which are recognized by the antibodies are the capsular polysaccharides of NmW present in the biological fluid.

The monoclonal antibodies are preferably IgG, more preferably B23-1 or H17-1 , or antigen- binding portions thereof as described, especially portions comprising Fab, Fab' or F(ab')2 fragment of B23-1 or H 17-1.

The presence or absence of NmW antigens can be determined by any appropriate means known to the skilled person in the art; this depends mainly on the detection label attached to the monoclonal antibody or fragment thereof according to the invention. According to a preferred embodiment, the presence or absence of antigens of NmW can be determined by simple visual inspection, for example of the fluid sample in the presence of the monoclonal antibodies, or by visual inspection of a solid support previously contacted with the biological sample and with the monoclonal antibodies. Alternatively, any other appropriate means can be used, for example in order to quantify the interaction between the monoclonal antibodies, or antigen-binding portions thereof as defined in the present invention, and the NmW antigens in the biological fluid sample.

According to a preferred embodiment of the method, the second step of determining the presence or absence of NmW antigens is carried out by detection of the presence or absence of a complex, specifically an immune complex, formed between the monoclonal antibodies, or antigen-binding portion thereof and the antigens of NmW.

In an embodiment, the method comprises the use of a detection component, which is specific for the monoclonal antibodies or fragments thereof according to the invention, and thus allows the detection of said antibodies, even bound to their targets. As an illustration, if mouse monoclonal antibodies are used in carrying out the invention, the detection component is for example goat anti-mouse antibodies, thus allowing the detection of the presence of the monoclonal antibodies of the invention. According to this embodiment, the antigens of NmW present in the sample are preferably immobilized, such that the detection of the monoclonal antibodies or fragments thereof according to the invention is indicative of the presence of NmW antigens.

In another alternative embodiment, the method comprises the use of a detection component which is specific for the NmW antigens, for example such a component may comprise a monoclonal antibody according to the invention, or an antigen-binding portion thereof as defined, or may comprise antibodies binding both NmY and NmW antigens, as described in the experimental section and in Chanteau et al., 2006(a). As an illustration, if antibodies of the invention linked to a detection label are used in the first step of contacting, then antibodies not capable of discriminating between NmY and NmW, unlabelled but immobilized on a solid support, can be used to detect the presence of the complex between the antibodies and the antigens of NmW.

Conversely, and even more preferably, antibodies not capable of discriminating between NmY and NmW, linked to a detection label, can be used in the first step of contacting the fluid, and monoclonal antibodies or fragments thereof according to the invention are used to detect the formation of the complex between the labeled antibodies and the antigens of NmW.

The method of the invention is to be used for the specific detection of NmW, i.e. the method allows the determination of whether antigens of NmW are present or absent from the sample under consideration, preferably biological fluid, independently of any other serogroups of N. meningitidis or any other bacteria likely to be also present in said fluid.

The biological fluid to be used in carrying out the detection method is any appropriate biological fluid in which antigens of NmW are likely to be found in case of meningitidis infection. Appropriate fluids are for example cerebrospinal fluid, blood, serum, urine, joint fluid, pericardial fluid and pleural fluid. The detection means are to be adapted to the fluid considered and to the concentration of NmW antigens likely to be present. Preferred biological fluids are cerebrospinal fluid, blood, serum and urine, and more preferably cerebrospinal fluid.

The method can be carried out with IgG antibodies according to the invention, especially murine IgG antibodies, more preferably with one of the monoclonal IgG antibodies B23-1 and H17-1 , secreted by 1-51 17 and 1-51 16 respectively.

According to a preferred embodiment, the invention is directed to an in vitro method for diagnosing a N. meningitidis serogroup W infection in a subject, comprising carrying out the method as defined above, on a biological fluid sample from said subject. Preferably said subject is affected by meningitidis or is suspected to be affected, either because the subject presents some symptoms indicative of meningitidis, or because the subject has been in contact with affected persons. According to this method of diagnosing, the presence of antigens of N. meningitidis serogroup W in the sample is indicative of N. meningitidis serogroup W infection.

The sample is preferably a sample of a biological fluid as detailed above, and especially a sample of cerebrospinal fluid, a sample of blood, a sample of serum or a sample of urine. The volume of the sample may be very small, insofar as the method for diagnosing according to the invention does not require any step of culturing bacteria from said sample, a few ml_ can be sufficient or even a smaller quantity, such as around 100 or around 200 μΙ_.

The sample used for carrying out the method of the invention has preferably been obtained from the subject under sterile conditions. It is highly preferred that the method is carried out in the hours following the sampling of the fluid. Alternatively, the sample can be stored under sterile conditions, preferably in the cold, until the diagnostic method of the invention is carried out.

The detection method as described above may also be used for quantifying the presence of NmW polysaccharide in a sample. According to this embodiment, the method is carried out for example on a sample intended for immunization or vaccination, such that the monoclonal antibodies of the invention are used to quantify the NmW antigen present in the sample. According to a third aspect, the present invention is directed to a diagnostic kit or device for detecting N. meningitidis serogroup W. Such a diagnostic kit or device comprises monoclonal antibodies or antigen-binding portions thereof according to the invention, or said antibodies or fragments linked directly or indirectly, covalently or non-covalently to a detection label, corresponding to a diagnostic agent as defined above. The monoclonal antibodies according to the invention, or their antigen-binding portions, are either in a free, soluble form, or are immobilized on a support. The antibodies may advantageously be monoclonal IgG antibodies, inter alia B23-1 and H17, secreted by 1-51 17 and 1-51 16 respectively, or fragments thereof, or a mixture thereof.

According to a preferred embodiment, the kit or device also comprises a means for detecting the production of an immune complex between said antibodies and antigens of NmW. Such means can be of any type, it can be for example antibodies specific for one or the other partner of the immune complex, i.e. either antibodies directed to the capsular polysaccharides of NmW, or antibodies directed to the monoclonal antibodies of the kit or device. Suitable means also comprise any means detecting the formation of a complex on the basis of the properties of the immune complex formed, e.g. its weight, its size, etc.

Alternatively, a diagnostic kit or device for detecting N. meningitidis serogroup W comprises: - a first antibody, recognizing NmW, linked directly or indirectly, covalently or non- covalently to a detection label, either in a free, soluble form, or immobilized on a support and

- a detection antibody for detecting the production of an immune complex between said first antibody and antigens of NmW,

wherein either the first antibody, or the detection antibody, or both, are a monoclonal antibody, or a fragment thereof, according to the invention.

According to one preferred embodiment, the diagnostic kit or device according to the invention may comprise:

- antibodies recognizing NmW and NmY, linked directly or indirectly, covalently or non- covalently to a detection label, either in a free, soluble form, or immobilized on a support and

- monoclonal antibodies or fragments thereof according to the invention.

According to a preferred embodiment of the diagnostic kit or device of the invention, the kit or device is for detecting NmW in a biological fluid sample, without any culture step, especially without bacteria culture. Such a kit or device can for example be used immediately after sampling, without the usual delay due to the culture in case of serogroup W detection.

Adequate biological fluid samples have been detailed above, it includes cerebrospinal fluid, blood, serum, urine, joint fluid, pericardial fluid and pleural fluid. Preferred fluids for the diagnostic kits or devices of the invention are cerebrospinal fluid, blood, serum, and urine, and more preferably cerebrospinal fluid.

The detection is preferably carried out by immunoassay, taking advantage of an immunological reaction of NmW antigens with the monoclonal antibodies of the invention, inter alia with IgG antibodies of the invention.

In this respect, any immunoassay can be used in the context of the present invention, to detect antigens of NmW in a biological fluid sample, either in a qualitative (positive or negative) or quantitative (amount measurement) manner. Many different immunoassays have been developed, which are highly adaptable and can be applied to many different formats, depending on the needs of the end user; these different tests are all applicable in the context of the present invention, taking advantage of the high specificity and sensitivity of the monoclonal antibodies or fragments thereof according to the invention.

In addition to the antibodies to be used, namely the monoclonal antibodies or binding fragments thereof according to the invention, the second feature of an immunoassay is the technology and the system which are to be used to detect the binding of the detection antibodies to the target analyte, namely antigens of NmW.

Originally, the signal from an immunoassay resulted from an enzyme, to be bound to the complex formed by the antibodies and the target antigens, acting on a substrate to yield a colored solution, wherein the intensity of the coloration is indicative of the amount of target antigens in the test solution.

More recently new immunoassays have been developed, compressing the many steps of the previously designed immunoassays into a simplified format. One of such simplified formats is for example the nitrocellulose test strip.

Other immunoassays have been developed with improved sensitivity, allowing the detection of single molecules in a body sample. To this end, microscopic beads coated with the antibodies are added to the body sample to be analyzed, in order to capture the target antigens; the thus formed immunocomplexes are then labeled with an enzymatic reporter capable of generating a fluorescent product.

Other classical immunoassays which are well known and can be used in the context of the present invention are radioimmunoassay and fluorescent immunoassays.

Immunoassays are thus designed in many formats and the skilled person will know how to determine the most suitable immunoassays depending on the sample types including serum, plasma, whole blood, urine, or cerebrospinal fluids.

Preferred immunoassays are those which can be carried out rapidly at bedside and those which are extremely sensitive.

Immunoassays which can be advantageously used in diagnostic kits according to the invention are those relying on agglutination. In agglutination tests, a particle (latex bead or bacterium) is coupled to the monoclonal antibodies or fragments thereof according to the invention. The resulting particle complex is mixed with the sample of biological fluid to be analyzed; if the target antigen, namely antigens of NmW are present in the sample, it crosslinks the particles, producing measurable agglutination.

Usually, agglutination tests are rapid but less sensitive than many other methods.

A particularly preferred agglutination test is latex agglutination test. This test uses latex particles, coated or coupled with the monoclonal antibodies of the invention, or fragments thereof as defined. Presence of the polysaccharides of NmW leads to the agglutination of the coated latex particles. A kit or device of the invention according to this embodiment thus comprises the monoclonal antibodies of the invention, or fragments thereof as defined, coated on latex particles.

According to another embodiment, the diagnostic kits or devices of the invention are based on an enzyme-linked immunosorbent assay (ELISA) test. In ELISA test, the sample is immobilized on a solid support, usually a polystyrene microtiter plate and the monoclonal antibodies or fragments thereof according to the invention are used as detection antibody, forming a complex with the antigens of NmW, if present.

In such a case, the monoclonal antibodies present in the kits are preferably linked to an enzyme, or the kits comprise detection antibodies specific to the monoclonal antibodies of the invention and linked to an enzyme. According to a specific embodiment, the kit is suitable for use in the Simoa™ (single- molecule array) technology (Rissin et al 2010). For such a purpose, the monoclonal antibodies according to the invention, used as capture antibodies, are attached to the surface of paramagnetic beads. According to this technology, these beads are then contacted with the sample, potentially comprising NmW antigens. The beads are then washed to remove proteins non-specifically bound and incubated with a detection antibody linked to an enzyme. Such a detection antibody may be an antibody or fragment thereof according to the invention. The kits or devices according to a preferred embodiment comprise the monoclonal antibodies of the invention, or antigen-binding portions thereof, linked to beads, preferably paramagnetic beads, as capture antibodies, and also the monoclonal antibodies of the invention, linked to an enzyme, as detection antibodies. Alternatively, the kits may comprise antibodies recognizing NmW but cross-reacting with NmY, as described in the experimental section, linked to beads, and monoclonal antibodies according to the invention, linked to an enzyme, as detection antibodies.

According to still another embodiment, the kits or devices of the invention are suitable for rapid diagnostic tests, especially lateral or vertical flow assays, also known as immunochromatographic assays; more preferably they are conceived as dipstick devices. According to this embodiment, the kit or device thus comprises antibodies, linked to gold particles, as detection antibodies, and also antibodies not-linked to gold particles immobilized in a specific area of a support, as capture antibodies, wherein either the capture antibodies, or the detection antibodies are monoclonal antibodies or antigen-binding portions thereof, according to the invention. According to one embodiment, both the capture and the detection antibodies are monoclonal antibodies or portions thereof according to the invention. Other antibodies, specifically binding NmW capsular polysaccharides but also cross reacting with NmY, e.g. the antibodies C18-3 described in the experimental section and Chanteau et al., 2006(a), can advantageously be used as detection or as capture antibodies, but preferably as detection antibodies. The use of the C18-3 antibody as detection antibody, to detect NmW capsular polysaccharides, relies upon the very low probability of a double MenW/MenY patient infection ruling out the possibility of a competitive binding between Y and W bacteria. The diagnostic kits or devices of the invention are preferably stable at temperature up to 30°C, preferably up to at least 40°C, or up to at least 45°C.

Many other technologies can be used for the diagnostic tests or devices of the invention and the technologies detailed above are for illustrative purpose only.

Depending on the technology to be used for demonstrating the presence of antigens of NmW in the sample with the monoclonal antibodies of the invention, several additional components can be present in the diagnostic kits as described.

According to a preferred embodiment, the kit or device of the invention further comprises a solid support, on which the monoclonal antibodies of the invention, either linked to a detection label or not, may be immobilized, inter alia a microtiter plate, a diagnostic platform, a nitrocellulose membrane or a miniaturized lateral or vertical flow device. A diagnostic platform may comprise a membrane, for example a charged membrane, plastic, beads, strips, microtiter wells, microchannels or a combination thereof.

The kits or devices of the invention may comprise an immuno-chromatographic test strip, miniaturized lateral or vertical flow device, or enzyme-linked immunosorbent assay platform. Depending on the technology to be used for revealing the potential presence of antigens of NmW, the kits of the invention may also comprise a fluid receiving zone or chamber, preferably in or on the diagnostic platform.

The skilled person will adapt without difficulty the components of the kits, depending on the chosen technology for detecting the presence of polysaccharides of NmW in the biological fluid sample to be tested.

According to a preferred embodiment of the invention, the diagnostic kit allows the detection by enzyme-linked immunosorbent assay at subfemtomolar concentration, for example at a concentration of 1fM or below. In order to obtain such a low detection concentration, the technology to be chosen for the detection of soluble antigens of NmW is preferably the Simoa™ technology as detailed above. The advantages of this high sensitivity are that a very early detection can be carried out. This is especially useful for detecting infection in persons who have been in contact with affected patients.

According to a particularly preferred embodiment, the present invention is directed to a dipstick diagnostic device for N. meningitidis, and especially NmW. Such a device comprises a membrane, preferably a nitrocellulose membrane. This membrane advantageously comprises the following zones:

(a) a first zone comprising antibodies binding to NmW, linked directly or indirectly, covalently or non covalently to a detection label, as detection antibodies;

(b) a capture zone comprising immobilized antibodies binding to NmW, as capture antibodies, and.

(c) optionally a control zone comprising an immobilized control polypeptide, preferably antibodies recognizing the detection antibodies of the first zone, as control antibodies.

In the dipstick diagnostic device as described, either the detection antibodies, or the capture antibodies, or both the detection and the capture antibodies are monoclonal antibodies according to the invention, or fragments thereof as defined, which are thus specific to NmW. Preferably, the capture antibodies are monoclonal antibodies, or antigen-binding portions thereof according to the invention. If the capture antibodies, or the detection antibodies, are not antibodies according to the invention, they are preferably antibodies binding to the capsular polysaccharides of NmW. The diagnostic device is preferably for use with a biological fluid sample, and especially a sample of cerebrospinal fluid, urine, serum or blood of a person to be diagnosed.

The biological fluid sample to be tested is brought into contact with one extremity of the membrane. The fluid sample then migrates along the membrane, either vertically or laterally depending on the system, first through the 1 ^st zone where antigens of NmW, if present in the sample, bind to the detection antibodies. As the sample flows through the capture zone, the immune complex, formed by the detection antibodies and the antigens of NmW, bind to the immobilized capture antibodies, provided that antigens of NmW are present in the sample, thus capturing and immobilizing the detection label linked to the detection antibodies in a specific area of the membrane. Otherwise, if there are no antigens of NmW present in the sample, no detection label is captured by the capture antibodies. As the sample flows through the control zone, the detection antibodies conjugated to the detection label bind to the control antibodies, in the control zone, irrespective of whether they are bound to antigens of NmW.

It is thus imperative that the sample flows through the first zone before flowing through the capture or control zone; the respective disposition of the capture and control zones is not critical, provided that the sample flows first through the first zone.

It is particularly preferred that the detection antibodies are conjugated, preferably by covalent binding, to gold particles, for the detection. According to one embodiment, the detection antibodies are antibodies detecting both NmW and NmY, as described in Chanteau et al., 2006(a). According to another embodiment, the detection antibodies are monoclonal antibodies or antigen-binding portions thereof, as defined in the invention, especially IgG antibodies or portions thereof, according to the invention.

Regarding the control zone, the immobilized control polypeptides are advantageously antibodies, especially antibodies capable of recognizing those of the first zone, irrespective of whether said detection antibodies are conjugated to gold particles, and irrespective of whether these detection antibodies are bound to their specific antigen, namely bound to polysaccharides of NmW. According to a preferred embodiment, when the detection antibodies are antibodies of a specific mammal, for example mouse antibodies, the control antibodies are antibodies directed to antibodies of said mammal, for example goat anti- mouse antibodies. Of course, depending on the detection antibodies used in the first zone of the membrane, the control antibodies are to be adapted in order to recognize these antibodies.

Regarding the capture zone of the membrane, it comprises capture antibodies, which are not conjugated to a detection label as those antibodies present in the first zone. Preferably they are not conjugated to any detection molecule of any type. Particularly preferred capture antibodies are monoclonal antibodies of the invention, or antigen-binding portions thereof according to the invention, especially IgG antibodies or portions of the invention. Suitable means for immobilizing the control polypeptides of the control zone and the capture antibodies of the capture zone are well known to the skilled man. By definition, the antibodies of the first zone are not immobilized on the membrane and constitute a mobile phase of the device.

5 The different zones of the dipstick device are preferably distinct and not overlapping before use of the dipstick.

According to one embodiment, the detection antibodies are antibodies binding specifically NmW/Y capsular polysaccharides, such as the antibodies C18-3 disclosed in Chanteau et al, 2006(a), and the capture antibodies are monoclonal antibodies of the invention, or antigenic) binding portions thereof as herein defined.

According to an alternative embodiment, the detection antibodies are monoclonal antibodies of the invention, or antigen-binding portions thereof according to the invention, and the capture antibodies are antibodies binding NmW/Y capsular polysaccharides.

According to another embodiment, the detection and capture antibodies are monoclonal 15 antibodies of the invention, or antigen-binding portions thereof according to the invention; they are either identical or distinct. Preferred antibodies are IgG antibodies, such as B23-1 and H17-1 antibodies. For example, the detection antibodies are B23-1 and the capture antibodies are H17-1 , or the opposite. Due to the likely antigen repetition on bacteria the same monoclonal antibody could be used as capture and detection antibodies.

20 The dipstick device of the invention is simple, convenient, quick and concise and does not require special equipment and facilities as well as professional training. Furthermore, the dipstick has clear and easy to read results, simple operation and easy popularization, is applicable to matrixes, field tests of emergency on a large scale and the study of epidemiology and can aid in the infection diagnostics.

25

In a preferred embodiment, the invention is directed to a diagnostic device as described above, for simultaneous detection of NmW and at least one another serogroup of N. meningitidis. According to this embodiment, the membrane of the diagnostic device further comprises, in addition to the already described zones:

30 (d) at least one another distinct capture zone comprising immobilized antibodies binding to antigens of said at least one another serogroup of N. meningitidis.

According to this embodiment, the device also comprises in the 1 ^st zone antibodies binding to antigens of said at least one another serogroup, conjugated to a detection label. These antibodies may be either the same as those already described for the device of the invention,

35 e.g. antibodies binding polysaccharides of NmW/NmY, conjugated to a detection label, if the at least one another serogroup is NmY. Alternatively, these antibodies binding to antigens of said at least one another serogroup are distinct from those binding to antigens of NmW, conjugated to a detection label, already part of the 1 ^st zone of a diagnostic device of the invention.

Either the immobilized capture antibodies binding to antigens of said at least one another serogroup, or the detection antibodies binding to antigens of said at least one another serogroup, present in the first zone, are specific to this one another serogroup of N. meningitidis.

The invention more specifically relates to diagnostic device as described above, for simultaneous detection of NmW and at least NmY. According to this embodiment, the detection antibodies in the first zone are preferably antibodies specifically binding to both NmW/Y antigens. According to this embodiment, there is thus only one type of detection antibodies, conjugated to a detection label, but two capture zones, one comprising antibodies or fragments thereof, according to the invention, specifically binding to NmW polysaccharides, and the other distinct capture zone comprising antibodies binding specifically to NmY antigens.

Alternatively, in a device for the simultaneous detection of NmW and NmY, the device may also comprise in the first zone two distinct types of detection antibodies, one type binding to antigens of NmW and conjugated to a detection label, and another type binding to antigens of NmY and conjugated to a detection label, which can be the same or different.

The invention is also directed to a diagnostic device as herein described, for the simultaneous detection of NmW and at least NmB. According to this embodiment, the immobilized antibodies of the at least one another distinct capture zone bind to antigens of NmB, and the first zone also comprises antibodies binding to antigens of NmB, conjugated to a detection label. Preferably, the antibodies binding to antigens of NmB, either the immobilized capture antibodies or the detection antibodies, or both, bind to capsular polysaccharides of NmB. It is imperative that either the immobilized capture antibodies binding to NmB antigens or the detection antibodies binding to NmB antigens, are specific for NmB antigens, i.e. not cross-reacting with any other serogroups of N. meningitidis.

The invention is also directed to a diagnostic device as herein described, for the simultaneous detection of NmW and at least NmX, or simultaneous detection of NmW and at least NmY, or any other appropriate combination of at least two serogroups, comprising serogroup W.

According to still another embodiment, the invention is directed to a diagnostic device for simultaneous detection of NmW, and at least NmY and NmB, preferably for detection of these serogroups in a biological sample. Such a diagnostic device thus comprises a membrane, preferably a nitrocellulose membrane, having at least the following zones:

(a) a first zone comprising antibodies binding to NmW antigens, conjugated to a detection label, antibodies binding to NmY antigens, conjugated to a detection label and antibodies binding to NmB antigens, conjugated to a detection label, as detection antibodies;

(b) a capture zone comprising immobilized antibodies binding to and specific for antigens of NmW, as capture antibodies,

(c) optionally a control zone comprising immobilized control antibodies recognizing one or more or all of the detection antibodies of the first zone,

(d) a second distinct capture zone comprising immobilized antibodies binding to and specific for antigens of NmY, and

(e) a third distinct capture zone comprising immobilized antibodies binding to and specific for antigens of NmB.

As mentioned in the previous section, the immobilized antibodies of the capture zone (b) which are binding to and specific for antigens of NmW, are preferably antibodies according to the invention, or antigen-binding portion thereof as defined in the context of the invention. As already detailed, it is imperative that either the antibodies binding to NmB, conjugated to a detection label or the immobilized antibodies binding to antigens of NmB, or both, be specific for NmB antigens. Similarly, it is also imperative that either the antibodies binding to NmY antigens, conjugated to a detection label or the immobilized antibodies binding to antigens of NmY, or both, be specific for NmY antigens. According to a preferred embodiment the immobilized antibodies of the second and third distinct capture zones are specific for NmB and NmY antigens, respectively.

The detection antibodies binding to NmW, NmY and NmB antigens can de distinct or not, for example in case of cross reaction. The detection label of these detection antibodies can be identical or different; preferably the same detection label is conjugated to all detection antibodies.

The capture antibodies binding to NmW, NmY and NmB antigens of the three distinct capture zones, are preferably distinct antibodies.

The invention is also directed to alternative diagnostic devices, either for the simultaneous detection of NmW, NmY and NmB and of still another serogroup, or for the simultaneous detection of NmW, NmY and NmX, or NmW, NmY and NmA, or any other appropriate combination, depending on the most abundant serogroups in the region where the diagnostic device is to be used.

It is preferred that the capture antibodies, immobilized in the capture zone, or in one of the distinct capture zones, be present at a concentration of about 1 to 5μg per cm, preferably between 1.5 and 3 μg per cm, more preferably at a concentration of about 2 μg per cm.

According to another preferred embodiment of the invention, the diagnostic kit or device has a detection limit of the NmW capsular polysaccharide below 50 ng/mL, preferably below 10 ng/mL, preferably below 5 ng/mL, especially around 2.5 ng/mL or less, or less than 1 ng/mL, especially in case of use of the Simoa™ technology.

According to another preferred embodiment of the invention, the diagnostic kit or device has a detection limit of NmW bacteria of around 10 ⁵ CFU/mL or below, preferably of 10 ⁴ CFU/mL or below, most preferably around 5x10 ³ CFU/mL or below, inter alia 3.5x10 ³ CFU/mL.

According to another aspect, the present invention also concerns the use of a diagnostic kit or device as defined above, preferably for the in vitro diagnosis of NmW infection, in the biological sample of a subject. Said subject may be suspected of meningitis infection, or may have been in contact with infected patients.

The biological sample which can be used in this context is as defined in the other aspects of the invention, inter alia it is preferably a sample of cerebrospinal fluid, urine, serum or blood. The other preferred embodiments are as detailed above, regarding the other aspects of the invention.

The invention is also directed to the use of the diagnostic kit or device of the invention, for the simultaneous detection of NmY and NmW, or preferably NmW, NmY and NmA, or any other combination of 2, 3, 4 or more serogroups including NmW.

The invention is also directed to the use of a monoclonal antibody according to the invention, or an antigen-binding fragment or portion thereof as defined above, specifically binding

NmW, for detecting in vitro N. meningitidis serogroup W capsular polysaccharides or N. meningitidis serogroup W bacterium, preferably in a liquid sample, most preferably a biological liquid sample. It is particularly preferred that the detection is carried out by immunochromatography.

The invention also concerns the use of the monoclonal antibodies or portions thereof as defined, as a standard for characterizing and quantifying NmW in a sample. It is indeed noted that none reproducible monoclonal antibody, sufficiently sensitive and specific for NmW, is presently available as standard. In all the embodiments described herein, antigen-binding portions of the monoclonal antibodies of the invention can advantageously replace monoclonal antibodies of the invention; such antigen-binding portions being preferably Fab, Fab' and F(ab')2 as described above. LEGENDS OF FIGURES

Fig. 1. ELISA dose-response curves of the H17-1 (filled markers) and B23-1 (open markers) antibodies on cpsW (circle) or cpsY (square) coated plates X-axis: Antibody concentration in g/ml. Y-axis: OD at 492 nm.

Fig. 2. ELISA recognition by the B23-1 antibody, used at a ^g/ml concentration, of coated cps from different Neisseria meningitidis serogroups. X-axis: N.m. serogroup. Y-axis: OD at 490 nm. H17-1 (not shown) gives identical results.

Fig. 3. 3A:Dot blot recognition of different serogroups of bacteria by the H17-1 antibody (5 μg/ml). Twofold serial dilutions of bacteria (expressed in pfu on the right of the blots) were spotted vertically. The serogroup of bacteria are indicated on the bottom of the blot. 3B:Control of the presence of Y bacteria on the blot, using the K9 Y specific antibody.

B23-1 (not shown) gives identical results.

Fig. 4. Clustal alignment of amino-acid sequences of the CDR regions of H17-1 (H17), and B23-1 (B23) proteins. The CDRs (CDR1 , 2 and 3 from 5' to 3') of the light (ChL) and the heavy (ChH) chains are respectively underlined. SEQ ID NO:1 corresponds to CDR1 , SEQ ID NO:2 to CDR2 and SEQ ID NO:8 and 9 to CDR3 of the heavy chain, and SEQ ID NO:4 and 5 to CDR1 , SEQ ID NO:6 to CDR2 and SEQ ID NO:7 to CDR3 of the light chain. SEQ ID NO: 10 corresponds to amino acids 1-120 of the light chain of B23-1 ; SEQ ID NO: 1 1 corresponds to amino acids 1-120 of the light chain of H 17-1. SEQ ID NO:12 corresponds to amino acids 1-1 19 of the heavy chain of B23-1 and SEQ ID NO: 13 corresponds to amino acids 1-120 of the heavy chain of H17-1.

Fig. 5. RDT detection of Neisseria meningitidis W capsula (cpsW) using H17-1 as capture antibody and the C18-3 antibody as gold conjugate. The cpsW concentration (ng/ml) of the tested sample was written on the top of the blot. The T+ arrow indicates the location of the migration control line (anti-mouse IgG antibodies, aM), and cpsW the location of the Capture Antibody line. The detection pattern is shown on the left column.

Fig. 6. RDT detection of Neisseria meningitidis Y capsula (cpsY) using W or Y as capture antibody and the W/Y antibody as gold conjugate. The cpsY concentration (ng/ml) of the tested sample was written on the top of the blot. The T+ arrow indicates the location of the migration control line (anti-mouse IgG antibodies, aM), and cpsY the location of the Capture Antibody line. The free arrow indicates the location of the W antibody. The detection pattern is shown on the left column.

Fig. 7. RDT1 ' detection of a mix of Neisseria meningitidis W and A capsulas (CpsW and CpsA). The cps concentration (in ng/ml) of each cps in the tested sample was written on the top of the blot. The T+ arrow indicates the location of the migration control line (anti-mouse IgG (H+L) antibodies). In the left panel is also given the scheme of the RDT2 dipstick.

Fig. 8. Detection of a mix of Neisseria meningitidis capsulas in a novel dipstick organisation. The concentration (in ng/ml) of each cps in the tested sample was written on the top of the blot. The T+ arrow indicates the location of the migration control line (anti-mouse IgG (H+L) antibodies). In the left panel is given the scheme of the two new dipsticks.

Fig. 9. Detection of serial dilutions of Nm W bacteria. The concentration of bacteria per ml in 120 μΙ of sample was written on the top of the blot. The T+ arrow indicates the location of the migration control line (anti-mouse IgG (H+L) antibodies). The Nm W arrow indicates the location of the B23-1 capture antibody.

Fig.10: Schemes corresponding to RDT1 and RDT2 dipsticks described in Chanteau et al. Detection of NmW using these dipsticks necessitates two dipsticks, the first one identifying the presence of NmX or NmW (RDT1 ) and the second one confirming the presence or absence of NmY (RDT2).

Fig.11 : Detection of W serogroup bacteria in CSFs by single detection dipsticks.

Line 1 : CSF L3332 from a healthy patient ;

Line 2 : CSF BF10 from a Neisseria meningitidis W infected patient.

Fig. 12: Detection of meningococci serogroup W in human serum using the serogroup W dipstick. Fig.12A illustrates the positive and negative controls and the resulting dipsticks: the control line for both, and the test line only for the positive control. Fig. 12B illustrates the dipsticks corresponding to two spiked human sera, with different concentrations of NmW. Fig. 13: Detection of meningococci serogroup W polysaccharide in urine of infected mice as a function of time after infection.

EXAMPLES:

The inventors have developed and evaluated a new rapid diagnostic test (RDT) for detecting the capsular polysaccharide (cps) antigen of serogroup W, based on new monoclonal antibodies.

Example 1 : Materials and Methods

Purification of the capsular polysaccharide from NmW

The capsular polysaccharide of serogroup W (cpsW) was purified from the NmW strain LNP19995, by the Cetavlon extraction method as previously described (Nato et al., 1991 ). Briefly, bacteria (1 L) at late-logarithmic phase of growth were formaldehyde-inactivated (1 % v/v) and then treated with Cetavlon (0.1 % w/v) (Sigma Aldrich, France). After centrifugation, the pellet was dissolved in cold aqueous CaC (0.9M). The solubilised materials were cleared by precipitation in 25% aqueous ethanol and the remaining supernatant was precipitated by 80% aqueous ethanol. The pellet was dissolved in phosphate buffer (Na2HP04, NaH2P04, 0.2 M) and treated with Dnase and Rnase followed by proteinase K treatment (Sigma Aldrich, France) and cold phenol extraction. The extract was extensively dialyzed against distilled water and lyophilized to obtain the crude capsular polysaccharide. Ten mg of the preparation were dissolved in 2 mL of phosphate buffer K2HPO4, KH2PO4 (0.05 M), pH 7, and purified by gel filtration on a Biosep-SEC-S3000 column (300 x 21.2 cm, Phenomenex, France) that was equilibrated with the same buffer. Elution was carried out with the same phosphate buffer at 5 mL/min, and monitored at 214 nm and 280 nm. The void volume fractions containing cpsW in the high molecular-weight range were pooled and dialyzed against distilled water at 4°C, using a dialysis membrane with a cut-off size of 10K- 15K, and the residue was lyophilized. The yield was about 20 mg/L of culture. The profile of the purified cpsW was checked by proton nuclear magnetic resonance ( ¹ H NMR).

ELISA

Microtiterplates were coated overnight, at 4°C with 1 μg/ml capsula solution in PBS. Following 3 PBST (0,1 % Tween 20 containing PBS) washes, antibodies diluted in PBST-G (Gelatin 0,5% containing PBST) at the indicated concentration were added to the wells (1 ,5 hour at 37°C).

After 3 new PBS-T washes peroxidase labelled anti-mouse IgG (H+L) antibodies were added to the well diluted to \ vg/m\ in PBST-G (1 h at 37°C). After 3 PBS-T washes the peroxydase substrate solution (OPD, H2O2) was added to the wells, and the OD (optical density) read at 490 nm. For isotype determination antibody binding to cpsW coated plates were revealed by anti-mouse IgG 1 , lgG2a, lgG3 or IgM peroxidase labelled antibodies and by anti-κ or λ peroxidase labelled antibodies. Alternatively, antibody isotypes could be checked using IsoStrip Kit from Roche Applied Science (Sw). IC 50 values, expressed as ng/ml of capsules, were determined according to Friguet et al., (1985) using purified antibodies.

Antibody purification

Cells were adapted to growth in 10% Ig Low content SVF containing culture medium and cells were sent to the RD Biotech company (Besancon, Fr) for antibody purification. Antibodies were purified by Protein G precipitation out of cell culture medium depleted in bovine Ig (Low content serum) to avoid mass contamination of monoclonal antibodies by calf antibodies. Antibody purification was controlled by ELISA, and Coomassie blue analysis. Dot-blot

Serial twofold dilutions of inactivated bacteria (inactivation by heating 30 min at 56°C) or of their corresponding purified capsules, in PBS, were spotted (2μΙ) on supported nitrocellulose. After drying, blots were saturated with 4% defated milk containing PBST (PBST-M) for 30 minutes at room temperature. The antibodies were then added onto the membrane for an overnight incubation at 4°C, at a ^g/ml concentration in PBST-M. Three PBST washes (15 min each) were then performed and peroxydase labelled anti-mouse IgG (H+L) antibodies (in PBST-M) were added onto the membrane for 1 h at room temperature. Three PBST washes (15 min each) were then performed and peroxydase activity was then read with ECL substrate.

Antibody sequencing

Primers specific for lgG2a H chain:

AACTCG AG G G G C ACTCTG G G CTC (SEQ ID N°14) and

CCTAG G G G AG GTG C AG CTTG AG G AGTCAG G ACC (SEQ ID N°15)

and for κ light chain

TTCTAGACTAACACTCATTCCTGTTGAA (SEQ ID N°16) and

AAGATCTGAGCTCGTGATGACCCAGACTCCA (S EQ I D N ° 17)

were used to amplify by PCR the CDR coding regions of the antibodies. The template was the c-DNA obtained after RT PCR of the mRNA purified out from antibody producing hybridomas. The same primers were used to sequence the PCR products obtained and the forward and reverse sequences were compared.

Immunisation

BP2 (BiozziABH/RijHsd mice) were immunized in Institut Pasteur according to the protocols described in CETEA agreement N°806. Four mice (8 week old females) were IP immunized 8 times each, with 0.2 ml of a suspension of 10 ⁸ freshly heat-inactivated (inactivation by heating 30 min at 56°C) NmW bacteria at two weeks intervals. Serum samples were taken before immunization and one week after the 8 ^th injection to evaluate the immune response by enzyme-linked immunosorbent assay (ELISA) on coated capsules (see ELISA). The best responding mouse was selected to perform the hybridoma obtaining process. Fusion

A final IV boost was performed with 10 ⁸ inactivated bacteria a month after the last immunisation, and 3 days before fusion between mouse splenocytes and P3-U1 myeloma cells according to Kohler.G. and Milstein, C, 1975. Hybridomas were selected and counter- selected for lack of cross reactivity with other serogroups in ELISA.

Dipstick

One-step vertical flow immuno-chromatography dipsticks were built at Institut Pasteur using purified anti-cps mAbs that were conjugated to gold particles by British Biocell International, Cardiff, UK. (Chanteau et al., 2006(b)).

Briefly, nonconjugated cpsW-mAbs B23-1 or H17-1 were used as capture antibodies (2 μg per centimeter line), and goat anti-mouse IgG (H+L) (ICN Biomedicals, Aurora, USA) as control antibody (1 μg per line centimeter) following spraying onto nitrocellulose (Schleicher & Schuell Bioscience, Ecquevilly, France). The gold labelled monoclonal antibody C18-3, described in Chanteau et al., 2006(a) as cross recognizing Y and W cps, was used at a final OD of 5 in 3% BSA and 10% sucrose containing 50mM Phosphate buffer, pH 7.4. This single, one serotype, detection test was evolved to dual detection tests such as those described as RDT1 and RDT2 in Chanteau et al., 2006(a).

The dipstick patterns are described in the text and were build and used as RDT1 and RDT2. For the test evaluation, dipsticks were dipped (for a 10-15 min period at room temperature) in 150 μΙ_ of cps containing PBS at the indicated capsule concentration.

Example 2: Obtaining and characterization of anti-W antibodies

Whole inactivated NmW (thereafter called W) bacteria were used to immunize mice from the BP2 strain. Two lgG2a,K monoclonal antibodies named B23-1 and H17-1 were selected after screening on ELISA plate coated capsules (cps) from the W serogroup (cpsW) and counter screening on NmY cps coated plates. These IgGs were selected on their ability to bind efficiently W cps but poorly Y cps. They were purified out of corresponding hybridoma containing culture medium using protein G purification (RD Biotech, Besancon, Fr). Both were able to detect coated cpsW capsules down to few ng/ml of antibody concentration (see Fig.1 ) and were not cps Y cross reactive even at a 10 μg/ml antibody concentration.

Several immunological tests were performed demonstrating that the antibodies were specific to cps of the W serogroup and did not show detectable recognition of other cps (see Fig 2). This specificity is also observed for Neisseria meningitidis bacteria in a dot blot experiment (Fig 3). This last experiment shows that the B23-1 and the H17-1 antibodies are able to detect bacteria, as well as their capsules.

Sequencing of the two antibody's CDR demonstrated that they display very close but different CDR sequences (Fig.4).

Some of the inventors have already described in Chanteau et al. 2006(a) the obtaining of a monoclonal antibody (C18-3) binding both to the Y and the W serogroups. Gold labeling of the antibody was performed previously by BBI (British Biocell International, Cardiff, UK). The inventors have used this conjugate to detect the catching of W cps by the B23-1 or H17-1 antibodies, used as capture antibodies. In all schemes inserted left to the following dipstick figures, aM means anti mouse IgG (H+L) antibody, and the anti-Neisseria antibodies used were denominated according to their specificity: W means W specific antibody (H17-1 or B23-1 ), Y means Y specific L14-7 mAb, C means C specific B6-1 mAb, A means A specific K15-2 mAb, and X/Y means C18-3 mAb (see Table 1 , and Chanteau et al., 2006(a)). Gold- labelled antibodies are identified by a star label, in the right column of Table 1. The underlined mAbs were the ones used in the RDT1 and RDT2 dipsticks described by Chanteau et al 2006(a) and diagrammed in figure 10. Table 1 : mAbs used in this invention, with their serogroup recognition specificity (Sp). Their sub class is given, and gold-labeled mAbs used are indicated by a star. It is to be noted that these labelled mAbs were the one's used in Chanteau et al (a). The dipsticks described in this invention, called RDT1 and RDT2, are schemed in figure 10.

In all the dipstick experiments described in the following, 150 μΙ of sample were used per dipstick, unless specified, and the reaction was read after an incubation of 15 min. Longer incubations could lead to false positives. Example 3: Detection of W capsules in a single dipstick

In a first trial, the inventors built a single detection dipstick (see side scheme Fig.5), where the capture antibody was used at a 2 mg/ml concentration and the conjugate at OD 2. The dipstick was constructed like described in Chanteau et al 2006(a). To detect the W serogroup, mAb C18-3 (W/Y) was used as gold conjugate. Obviously, the use of gold-labeled W antibody instead of gold-labeled W/Y antibody is also possible.

A detection limit of 1 ng/ml of cpsW was obtained (arrow on the top of figure 5). Identical results were obtained with the two anti-W antibodies B23-1 and H17-1.

Detection of W bacteria by the single dipstick:

The inventors have then confirmed the detection capacity of dipsticks using bacteria instead of capsules. Nm W bacteria were cultivated in GCB medium and serial bacterial dilutions were performed in culture medium ranging from 10 ⁷ to 10 ⁴ bacteria/ml. Bacteria were detected using the single detection dipstick described above and using the B23-1 antibody as capture antibody. The detection limit was around 10 ⁵ bacteria per ml.

The corresponding results are presented in Fig. 9.

Identical dipsticks were used to establish that no cross-reactivity occurs with other serogroups (not shown).

Example 4: Detection of Y capsules in a dipstick bearing W as capture antibody

As a cross detection of Y and W capsules is often found, the inventors tested the detection of cpsY by a double dipstick loaded with W and Y (as positive control) capture antibodies (fig.6). While detected by the Y antibody down to a 1 ng/ml concentration, cpsY is not detected on the dipstick by the W antibody. This confirms the detection specificity of the W antibody shown in example 2 when using immunochemistry experiments. The single dipstick described in the previous paragraph was not cross reactive with A, Y, X, or C capsules used at a 1 μg/ml concentration (not shown).

Example 5: Replacement of the W Y antibody by the W antibody in RDT1

The inventors have then tested a RDT1 dipstick in which the W/Y antibody was replaced by one of the two anti-W mAbs of the invention (Fig. 7).

The left panel of Fig.7 shows that the gold conjugated antibodies used in RDT1 and 1 ' were unchanged. The RDT 2 pattern is also shown as unchanged. The detection sensitivity of both capsules reaches 1 ng/ml. Thus, in RDT1 ' the C18-3 (W/Y) antibody can be replaced by any of the two anti-W mAb of the invention. As such, the detection of W and Y do not require a comparison between RDT1 and RDT2 results to establish the presence of a W pathogen, whereas such a comparison was necessary in the detection kit described earlier (Chanteau et a/., 2006(a)).

Example 6: Reorganisation of RDTs to use 3 gold-conjugates instead of 4

In order to use only 3 conjugates and not 4 as in RDT1 and RDT2 with a view to elaborating cheaper tests, dipsticks were reorganised as shown in the left schemes of Fig.8. As W antibodies were shown to be specific for W, without cross-reaction with Y, one dipstick was created intended for the diagnostic of W and Y, but using the W/Y antibody as gold conjugate: this dipstick is called RDT3. RDT4 is devoted to the detection of the A and C serog roups.

Both dipsticks were shown to be efficient, a detection limit of approximately 2.5 ng/ml is reached for all the capsules.

Example 7: Detection of W bacteria in cerebrospinal fluids

A detection trial of NmW bacteria in cerebrospinal fluids (CSF) from a healthy (L3332) and a contaminated patient (BF10) is shown in Fig 1 1 , using single detection dipsticks as described in example 3. The bacteria are strongly detected in the BF10 CSF sample while no signal is observed in the negative L3332 sample. The content of bacterial genomes tin he BF10 CSF was estimated by PCR, to be of 10 ⁶ bacterial genomes per ml. Example 8: Detection of meningococci serogroup W in human sera.

Two non-infected human serum samples (40μΙ) were spiked with Neisseria meningitidis strain of serogroup W at a final concentration of 10 ⁵ , 10 ⁶ and 10 ⁷ CFU/ml; this technique is indeed frequently used for validation of kits for bacterial detection, including kits for N. meningitidis detection as the sensitivity data obtained with spiked samples are known to correlate well with sensitivity data obtained on corresponding bodily fluids of infected patients.

These samples were then tested by the dipstick that has been previously described in example 3 (C18-3 as gold conjugate antibody and B17-1 as capture antibody) to detect meningococcal serogroup W.

The positive control corresponds to a bacterial suspension of sergroup W strains, at 10 ⁶ CFU/ml. The negative control corresponds to PBS. As illustrated in Fig.12A, the control line is present for both controls, the test line is present only for the positive control. Presence of the test line with the control line is indicative of cpsW detection.

As shown in Fig. 12B, serogroup W was detectable for all three concentrations in the sera for both samples.

These results demonstrate the feasibility of diagnosing N. meningitidis infection in serum samples of individuals to be tested.

Example 9: Detection of meningococci serogroup W polysaccharides in urine from infected mice.

Eight week-old transgenic BLAB/c mice expressing the human transferrin were used (two males). Transgenic mice expressing human transferrin are indeed known as a suitable model for meningococcal infection (Zarantonelli et al, 2007).

The 2 mice were infected by an invasive strain of serogroup W (LNP28768) by intraperitoneal injection of 3x10 ⁷ CFU in 0.5ml of saline.

Urine aliquots were taken before infection and at 1 h, 2h, 4h, 5h and 6h after infection. Mice were then euthanized at 6h, due to severe disease symptoms.

Urine was diluted by adding one volume of saline and 40 μΙ were used in the dipsticks corresponding to those previously described in example 3.

The tests were read after 10 minutes.

Results: The dispticks are shown in Figure 13. As can been seen, no polysaccharide was detected before the infection and up to 4 hours post infection. The dipsticks were positive at 5 and 6 hours post infection.

These results demonstrate the feasibility of diagnosing N. meningitidis infection in urine samples of individuals to be tested, very early in the course of infection.

Conclusions

The present inventors have raised monoclonal antibodies specific for the W serogroup of Neisseria meningitidis. These antibodies can be substituted to the W/Y antibody so far used in the rapid diagnostic kits RDT1 and RDT2 described in Chanteau et al., 2006(a). This replacement allows escaping a comparison between RDT1 and RDT2 to conclude to the presence of W or Y bacteria in the sample.

The inventors have designed a couple of new dipsticks detecting on the same first strip the A and C serogroups, and on the second strip the Y and W serogroups. In this latest dipstick, only one gold conjugate antibody must be used instead of two, reducing the cost of the material. The inventors have also demonstrated that the newly designed dipstick can be used for the detection of the W serogroup in serum and urine.

REFERENCES

Agnememel A et al. 2015. Development and evaluation of a dipstick diagnostic test for Neisseria meningitidis serogroup X. Clin. Microbiol. 53: 449-54

Chanteau S, Dartevelle S, Mahamane AE, Djibo S, Boisier P, Nato F. 2006(a). New rapid diagnostic tests for Neisseria meningitidis serogroups A, W135, C, and Y. PLoS Med. 3 (9): e337.

Chanteau S, et al. 2006(b) Lancet. 361 : 21 1-216

Friguet et al., (1985) J. Immunol. Methods 77:305-319

Kaas, Q. and Lefranc, M.-P. 2007. Current Bioinformatics, 2, 21-30

Kohler.G. and Milstein, C. (1975). Nature, 255 : 495-497.

Nato F et al. (1991 ). J Clin Microbiol. 29: 1447-1452

Reyes et al. (2014). Biologicals, 42(6), 312-5

Rissin, DM., et al. 2010. Nat. Biotechnol. 28: 595-600

Scaviner, et al. 1999. Exp. Clin. Immunogenet., 16, 234-240.

Taha et al. Demande de Brevet n° EP 14306832. Et WO2016/079157

Zarantonelli M-L. et al (2007). Infect. Immun. 75(2):5609-5614.