OF OBTAINING AND MAINTAINING SAME, METHODS OF DEFFERENTIATION THEREOF, METHODS OF USE THEREOF AND

CELLS DERIVED THEREOF

RELATED CASES

This application claims the benefit of U.S. Provisional Application No. 60/343386, filed October 25, 2001, U.S. Provisional Application No. 60/310,625, filed August 7, 2001, U.S. Provisional Application No. 60/269,062, filed February 15, 2001, U.S. Provisional Application No. 60/268,786, filed February 14, 2001, which are hereby incorporated by reference for all purposes. Applicants also claim priority of WO 01/11011, 60/147,324 and 60/164,650 and these applications are hereby incorporated by reference into this text; any teachings therein may be used in the practice of this invention. The present application is a contihuation-in-part of WO 01/11011, which is attached herein at Appendix 1 and is part of the present application. Documents incorporated by reference into this text are not admitted to be prior art.

FIELD OF THE INVENTION The present invention relates generally to mammalian multipotent adult stem cells (MASC), and more specifically to methods for obtaining, maintaining and differentiating MASC. Uses of MASC in the therapeutic treatment of disease are also provided.

BACKGROUND OF THE INVENTION

Organ and tissue generation from stem cells, and their subsequent transplantation provide promising treatments for a number of pathologies, making stem cells a central focus of research in many fields. Stem cell technology provides a promising alternative therapy for diabetes, Parkinson's disease, liver disease, heart disease, and autoimmune disorders, to name a few. However, there are at least two major problems associated with organ and tissue transplantation.

First, there is a shortage of donor organs and tissues. As few as 5 percent of the organs needed for transplant in the United States alone ever become available to a recipient (Evans, et al. 1992). According to the American Heart Association, only 2,300 of the 40,000 Americans who needed a new heart in 1997 received one. The

00269113

American Liver Foundation reports that there are fewer than 3,000 donors for the nearly 30,000 patients who die each year from liver failure.

The second major problem is the potential incompatibility of the transplanted tissue with the immune system of the recipient. Because the donated organ or tissue is recognized by the host immune system as foreign, immunosuppressive medications must be provided to the patient at a significant cost-both financially and physically.

Xenotransplantation, or transplantation of tissue or organs from another species, could provide an alternative means to overcome the shortage of human organs and tissues. Xenotransplantation would offer the advantage of advanced planning. The organ could be harvested while still healthy and the patient could undergo any beneficial pretreatment prior to transplant surgery. Unfortunately, xenotransplantation does not overcome the problem of tissue incompatibility, but instead exacerbates it. Furthermore, according to the Centers for Disease Control, there is evidence that damaging viruses cross species barriers. Pigs have become likely candidates as organ and tissue donors, yet cross-species transmission of more than one virus from pigs to humans has been documented. For example, over a million pigs were recently slaughtered in Malaysia in an effort to contain an outbreak of Hendra virus, a disease that was transmitted to more than 70 humans with deadly results (Butler, D. 1999). Stem cells: Definition and use

The most promising source of organs and tissues for transplantation, therefore, lies in the development of stem cell technology. Theoretically, stem cells can undergo self-renewing cell division to give rise to phenotypically and genotypically identical daughters for an indefinite time and ultimately can differentiate into at least one final cell type. By generating tissues or organs from a patient's own stem cells, or by genetically altering heterologous cells so that the recipient immune system does not recognize them as foreign, transplant tissues can be generated to provide the advantages associated with xenotransplantation without the associated risk of infection or tissue rejection.

Stem cells also provide promise for improving the results of gene therapy. A patient's own stem cells could be genetically altered in vitro, then reintroduced in vivo to produce a desired gene product. These genetically altered stem cells would

00269U3

have the potential to be induced to differentiate to form a multitude of cell types for implantation at specific sites in the body, or for systemic application. Alternately, heterologous stem cells could be genetically altered to express the recipient's major histocompatibility complex (MHC) antigen, or no MHC antigen, allowing transplantion of cells from donor to recipient without the associated risk of rejection.

Stem cells are defined as cells that have extensive proliferation potential, differentiate into several cell lineages, and repopulate tissues upon transplantation. The quintessential stem cell is the embryonic stem (ES) cell, as it has unlimited self- renewal and multipotent differentiation potential (Thomson, J. et al. 1995; Thomson, J.A. et al. 1998; Shamblott, M. et al. 1998; Williams, ILL. et al. 1988; Orkin, S.

1998; Reubinoff, B.E., et al.2000). These cells are derived from the inner cell mass of the blastocyst (Thomson, J. et al. 1995; Thomson, J.A. et al. 1998; Martin, G.R. 1981), or can be derived from the primordial germ cells from a post-implantation embryo (embryonal germ cells or EG cells). ES and EG cells have been derived from mouse, and more recently also from non-human primates and humans. When introduced into mouse blastocysts, ES cells can contribute to all tissues of the mouse (animal) (Orkin, S. 1998). Murine ES cells are therefore pluripotent. When transplanted in post-natal animals, ES and EG cells generate teratomas, which again demonstrates their multipotency . ES (and EG) cells can be identified by positive staining with the antibodies to stage-specific embryonic antigens (SSEA) 1 and 4. At the molecular level, ES and EG cells express a number of transcription factors highly specific for these undifferentiated cells. These include oct-4 and Rex- 1, leukemia inhbitory factor receptor (LIF-R). The transcription factors sox-2 and Rox-1 are expressed in both ES and non-ES cells. Oct-4 is expressed in the pregastrulation embryo, early cleavage stage embryo, cells of the inner cell mass of the blastocyst, and embryonic carcinoma (EC) cells. In the adult animal, oct-4 is only found in germ cells.

Oct-4, in combination with Rox-1, causes transcriptional activation of the Zn-fmger protein Rex-1, arid is also required for maintaining ES in an undifferentiated state. The oct-4 gene is down-regulated when cells are induced to differentiate in vitro. Several studies have shown that oct-4 is required for maintaining the undifferentiated phenotype of ES cells, and that it plays a major role in determining early steps in embryogenesis and differentiation. Sox-2, is required

00269113

with oct-4 to retain the undifferentiated state of ES/EC and to maintain murine, but not human, ES cells. Human or murine primordial germ cells require presence of LIF. Another hallmark of ES cells is presence of high levels of telomerase, which provides these cells with an unlimited self-renewal potential in vitro. Stem cells have been identified in most organs or tissues. The best characterized is the hematopoietic stem cell (HSC). This mesoderm-derived cell has been purified based on cell surface markers and functional characteristics. The HSC, isolated from bone marrow (BM), blood, cord blood, fetal liver and yolk sac, is the progenitor cell that generates blood cells or following translation reinitiates multiple hematopoietic lineages and can reinitiate hematopoiesis for the life of a recipient (See Fei, R., et al, U.S. Patent No. 5,635,387; McGlave, et al, U.S. Patent No. 5,460,964; Simmons, P., etal, U.S. Patent No. 5,677,136; Tsukamoto, et al, U.S. Patent No. 5,750,397; Schwartz, et al., U.S. Patent No. ,759,793; DiGuisto, et al, U.S. Patent No. 5,681,599; Tsukamoto, et al, U.S. Patent No. 5,716,827; Hill, B., et al. 1996.) When transplanted into lethally irradiated animals or humans, HSCs can repopulate the erythroid, neutrophil-macrophage, megakaryocyte and lymphoid hemopoietic cell pool. In vitro, hemopoietic stem cells can be induced to undergo at least some self-renewing cell divisions and can be induced to differentiate to the same lineages as is seen in vivo. Therefore, this cell fulfills the criteria of a stem cell. Stem cells which differentiate only to form cells of hematopoietic lineage, however, are unable to provide a source of cells for repair of other damaged tissues, for example, heart or lung tissue damaged by high-dose chemotherapeutic agents.

A second stem cell that has been studied extensively is the neural stem cell (NSC) (Gage F.H.2000; Svendsen CN. et α/, 1999; Okabe S. et al. 1996). NSCs were initially identified in the subventricular zone and the olfactory bulb of fetal brain. Until recently, it was believed that the adult brain no longer contained cells with stem cell potential. However, several studies in rodents, and more recently also non-human primates and humans, have shown that stem cells continue to be present in adult brain. These stem cells can proliferate in vivo and continuously regenerate at least some neuronal cells in vivo. When cultured ex vivo, NSCs can be induced to proliferate, as well as to differentiate into different types of neurons and glial cells. When transplanted into the brain, NSCs can engraft and generate neural cells and

00269113

glial cells. Therefore, this cell too fulfills the definition of a stem cell, albeit a hematopoetic stem cell.

Clarke et al. reported that NSCs from Lac-Z transgenic mice injected into murine blastocysts or in chick embryos contribute to a number of tissues of the chimeric mouse or chicken embryo (Clarke, D. L. et al. 2000). LacZ-expressing cells were found with varying degree of mosaicism, not only in the central nervous system, but also in mesodermal derivatives as well as in epithelial cells of the liver and intestine but not in other tissues, including the hematopoietic system. These studies therefore suggested that adult NSCs may have significantly greater differentiation potential than previously realized but still do not have the pluripotent capability of ES or of the adult derived multipotent adult stem cells (MASC) described in Furcht et al. (International Application No. PCT/USOO/21387) and herein. The terms MASC, MAPC and MPC can also be used interchagably to describe adult derived multipotent adult stem cells. Therapies for degenerative and traumatic brain disorders would be significantly furthered with cellular replacement therapies. NSC have been identified in the sub-ventricular zone (SVZ) and the hippocampus of the adult mammalian brain (Ciccolini et al., 1998; Morrison et al., 1999; Palmer et al., 1997; Reynolds and Weiss, 1992; Vescovi et al., 1999) and may also be present in the ependyma and other presumed non-neurogenic areas of the brain (Doetsch et al.,

1999; Johansson et al, 1999; Palmer et al, 1999). Fetal or adult brain-derived NSC can be expanded ex vivo and induced to differentiate into astrocytes, oligodendrocytes and functional neurons (Ciccolini et al, 1998; Johansson et al, 1999; Palmer et al, 1999;- Reynolds et al, 1996; Ryder et al, 1990; Studer et al, 1996; Vescovi et al, 1993). In vivo, undifferentiated NSC cultured for variable amounts of time differentiate into glial cells, GABAergic.and dopaminergic neurons (Flax et al, 1998; Gage et al, 1995; Suhonen et al, 1996). The most commonly used source of NSC is allogeneic fetal brain, which poses both immunological and ethical problems. Alternatively, NSC could be harvested from the autologous brain. As it is not known whether pre-existing neural pathology will affect the ability of NSC to be cultured and induced to differentiate into neuronal and glial cells ex vivo, and because additional surgery in an already diseased brain may aggravate the underlying disease, this approach is less attractive.

00269U3

The ideal source of neurons and glia for replacement strategies would be cells harvestable from adult, autologous tissue different than the brain that was readily accessible and that can be expanded in vitro and differentiated ex vivo or in vivo to the cell type that is deficient in the patient. Recent reports have suggested that BM derived cells acquire phenotypic characteristics of neuroectodermal cells when cultured in vitro under NSC conditions, or when they enter the central nervous system (Sanchez-Ramos et al, 2000; Woodbury et al, 2000). The phenotype of the BM cells with this capability is not known. The capacity for differentiation of cells that acquire neuroectodermal features to other cell types is also unknown. A third tissue specific cell with stem cell properties is the mesenchymal stem cell (MSC), initially described by Fridenshtein (1982). MSC, originally derived from the embryonal mesoderm and isolated from adult BM, can differentiate to form muscle, bone, cartilage, fat, marrow stroma, and tendon. During embryogenesis, the mesoderm develops into limb-bud mesoderm, tissue that generates bone, cartilage, fat, skeletal muscle and possibly endothelium. Mesoderm also differentiates to visceral mesoderm, which can give rise to cardiac muscle, smooth muscle, or blood islands consisting of endothelium and hematopoietic progenitor cells. Primitive mesodermal or MSCs, therefore, could provide a source for a number of cell and tissue types. A number of MSCs have been isolated. (See, for example, Caplan, A., et al, U.S. Patent No. 5,486,359; Young, H., et al, U.S. Patent No. 5,827,735; Caplan, A., et al, U.S. Patent No. 5,811,094; Bruder, S., etal, U.S. Patent No. 5,736,396; Caplan, A., et al, U.S. Patent No. 5,837,539; Masinovsky, B., U.S. Patent No. 5,837,670; Pittenger, M., U.S. Patent No.5,827,740; Jaiswal, N., et al, 1997,; Cassiede P., et al, 1996; Johnstone, B., etal, 1998; Yoo, et al, 1998; Gronthos, S., 1994).

Of the many MSC that have been described, all have demonstrated limited differentiation to form cells generally considered to be of mesenchymal origin. To date, the most multipotent MSC reported is the cell isolated by Pittenger, et al, which expresses the SH2 ⁺ SH4 ⁺ CD29 ⁺ CD44 ⁺ CD71 ⁺ CD90 ⁺ CD106 ⁺ CD120a ⁺ CD124 ^" CD 14 ^' CD34 ^" CD45 ^" phenotype. This cell is capable of differentiating to form a number of cell types of mesenchymal origin, but is apparently limited in differentiation potential to cells of the mesenchymal lineage, as the team who

00269113

isolated it noted that hematopoietic cells were never identified in the expanded cultures (Pittenger, et al, 1999).

Other tissue-specific stem cells have been identified, including gastrointestinal stem cells (Potten, C. 1998), epidermal stem cells (Watt, F. 1997), and hepatic stem cells, also termed oval cells (Alison, M. et al. 1998). Most of these are less well characterized.

Compared with ES cells, tissue specific stem cells have less self-renewal ability and, although they differentiate into multiple lineages, they are not pluripotent. No studies have addressed whether tissue specific cells express the markers described above as seen in ES cells. In addition, the degree of telomerase activity in tissue specific or lineage comitted stem cells has not been fully explored, in part because large numbers of highly enriched populations of these cells are difficult to obtain.

Until recently, it was thought that tissue specific stem cells could only differentiate into cells of the same tissue. A number of recent publications have suggested that adult organ specific stem cells may be capable of differentiation into cells of different tissues. However, the true nature of these types of cells has not been fully discerned. A number of studies have shown that cells transplanted at the time of a BM transplant can differentiate into skeletal muscle (Ferrari 1998; Gussoni 1999). This could be considered within the realm of possible differentiation potential of mesenchymal cells that are present in marrow. Jackson published that muscle satellite cells can differentiate into hemopoietic cells, again a switch in phenotype within the splanchnic mesoderm of the embryo (Jackson 1999). Other studies have shown that stem cells from one embryonic layer (for instance splanchnic mesoderm) can differentiate into tissues thought to be derived during embryogenesis from a different embryonic layer. For instance, endothelial cells or their precursors detected in humans or animals that underwent marrow transplantation are at least in part derived from the marrow donor (Takahashi, 1999; Lin, 2000). Thus, visceral mesoderm and not splanchnic mesoderm, capabilities such as MSC, derived progeny are transferred with the infused marrow. Even more surprising are the reports demonstrating both in rodents and humans that hepatic epithelial cells and biliary duct epithelial cells can be seen in recipients that are derived from the donor marrow (Petersen, 1999; Theise, 2000; Theise, 2000).

00269113

Likewise, three groups have shown that NSCs can differentiate into hemopoietic cells. Finally, Clarke et al. reported that cells be termed NSCs when injected into blastocysts can contribute to all tissues of the chimeric mouse (Clarke et ah, 2000). It is necessary to point out that most of these studies have not conclusively demonstrated that a single cell can differentiate into tissues of different organs. Also, stem cells isolated from a given organ may not necessarily be a lineage committed cell. Indeed most investigators did not identify the phenotype of the initiating cell. An exception is the study by Weissman and Grompe, who showed that cells that repopulated the liver were present in LinThyiLowScai ⁺ marrow cells, which are highly enriched in HSCs. Likewise, the Mulligan group showed that marrow Sp cells, highly enriched for HSC, can differentiate into muscle and endothelium, and Jackson et al. showed that muscle Sp cells are responsible for hemopoietic reconstitution (Gussoni et al., 1999).

Transplantation of tissues and organs generated from heterologous ES cells requires either that the cells be further genetically modified to inhibit expression of certain cell surface markers, or that the use of chemotherapeutic immune suppressors continue in order to protect against transplant rejection. Thus, although ES cell research provides a promising alternative solution to the problem of a limited supply of organs for transplantation, the problems and risks associated with the need for immunosuppression to sustain transplantation of heterologous cells or tissue would remain. An estimated 20 immunologically different lines of ES cells would need to be established in order to provide immunocompatible cells for therapies directed to the majority of the population.

Using cells from the developed individual, rather than an embryo, as a source of autologous or from tissue typing matched allogeneic stem cells would mitigate or overcome the problem of tissue incompatibility associated with the use of transplanted ES cells, as well as solve the ethical dilemma associated with ES cell research. The greatest disadvantage associated with the use of autologous stem cells for tissue transplant thus far lies in their relatively limited differentiation potential. A number of stem cells have been isolated from fully-developed organisms, particularly humans, but these cells, although reported to be multipotent, have demonstrated limited potential to differentiate to multiple cell types.

00269113

Thus, even though stem cells with multiple differentiation potential have been isolated previously by others and by the present inventors, a progenitor cell with the potential to differentiate into a wide variety of cell types of different lineages, including fibroblasts, hepatic, osteoblasts, chondrocytes, adipocytes, skeletal muscle, endothelium, stroma, smooth muscle, cardiac muscle and hemopoietic cells, has not been described. If cell and tissue transplant and gene therapy are to provide the therapeutic advances expected, a stem cell or progenitor cell with the greatest or most extensive differentiation potential is needed. What is needed is the adult equivalent of an ES cell. BM, muscle and brain are the three tissues in which cells with apparent greater plasticity man previously thought have been identified. BM contains cells that can contribute to a number of mesodermal (Ferrari G. et al, 1998; Gussoni E. et al, 1999; Rafii S. et al, 1994; Asahara T. et al, 1997; Lin Y. et al, 2000; Orlic D. et al, 2001; Jackson K. et al, 2001) endodermal (Petersen B.E. et al, 1999; Theise, RD. et al, 2000; Lagasse E. et al, 2000; Krause D. et al, 2001) and neuroectodermal (Mezey D.S. et al, 2000; Brazelton T.R., et al, 2000, Sanchez- Ramos J. et al, 2000; Kopen G. et al, 1999) and skin (Krause, D. et al, 2001) structures. Cells from muscle may contribute to the hematopoietic system (Jackson K. et al, 1999; Seale P. et al, 2000). There is also evidence that NSC may differentiate into hematopoietic cells (Bjornson C. et al, 1999; Shih C. et al, 2001), smooth muscle myoblasts (Tsai R. Y. et al, 2000) and that NSC give rise to several cell types when injected in a mouse blastocyst (Clarke, D.L. et al, 2000).

The present study demonstrates mat cells with multipotent adult progenitor characteristics can be culture-isolated from multiple different organs, namely BM, muscle and the brain. The cells have the same morphology, phenotype, in vitro differentiation ability and have a highly similar expressed gene profile.

SUMMARY OF THE INVENTION

The present invention is a multipotent adult stem cell (MASC) isolated from a mammal, preferably mouse, rat or human. The cell is derived from a non- embryonic organ or tissue and has the capacity to be induced to differentiate to form at least one differentiated cell type of mesodermal, ectodermal and endodermal

00269113

origin. In a preferred embodiment, the organ or tissue from which the MASC are isolated is bone marrow, muscle, brain, umbilical cord blood or placenta.

Examples of differentiated cells that can be derived from MASC are osteoblasts, chondrocytes, adipocytes, fibroblasts, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, occular, endothelial, epithelial, hepatic, pancreatic, hematopoietic, glial, neuronal or oligodendrocytes. Differentiation can be induced in vivo or ex vivo.

The MASC of the present invention is also summarized as a cell that constitutively expresses oct4 and high levels of telomerase and is negative for CD44, MHC class I and MHC class II expression. As a method of treatment, this cell administered to a patient in a therapeutically effective amount. A surprising benefit of this treatment is mat no teratomas are formed in vivo.

An object of the invention is to produce a normal, non-human animal comprising MASC. Preferably, the animal is chimeric. Another embodiment of the invention is a composition comprising a population of MASC and a culture medium that expands the MASC population. It is advantageous in some cases for the medium to contain epidermal growth factor (EGF), platelet derived growth factor (PDGF) and leukemia inhibitory factor (LIF).

The present invention also provides a composition comprising a population of fully or partially purified MASC progeny. The progeny can have the capacity to be further differentiated, or can be terminally differentiated.

In a preferable embodiment, the progeny are of the osteoblast, chondrocyte, adipocyte, fibroblast, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, occular, endothelial, epithelial, hepatic, pancreatic, hematopoietic, glial, neuronal or oligodendrocyte cell type.

The present invention also provides a method for isolating and propagating MASC by obtaining tissue from a mammal, establishing a population of adherent cells, depleting the population of CD45 ⁺ cells, recovering CD45 ^" cells and culturing them under expansion conditions to produce an expanded cell population. An object of the present invention, therefore, is to produce an expanded cell population obtained by this method.

An aspect of the invention is a method for differentiating MASC ex vivo by isolating and propagating them, and then culturing the propagated cells in the

00269113

presence of desired differentiation factors. The preferred differentiation factors are basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF), dimethylsulfoxide (DMSO) and isoproterenol; or fibroblast growth factor4 (FGF4) and hepatocyte growth factor (HGF). Another aspect of the invention is the differentiated cell itself.

The invention includes a method for differentiating MASC in vivo, by isolating and expanding them, and then administering the expanded cell population to a mammalian host, wherein said cell population is engrafted and differentiated in vivo in tissue specific cells, such that the function of a cell or organ, defective due to injury, genetic disease, acquired disease or iatrogenic treatments, is augmented, reconstituted or provided for the first time. Using this method, the MASC can undergo self-renewal in vivo.

A further aspect of the invention is a differentiated cell obtained by ex vivo or in vivo differentiation. In a preferred embodiment, the differentiated cell is ectoderm, mesoderm or endoderm. In another preferred embodiment, the differentiated cell is of the osteoblast, chondrocyte, adipocyte, fibroblast, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, occular, endothelial, epithelial, hepatic, pancreatic, hematopoietic, glial, neuronal or oligodendrocyte cell type. An important application of this technology is the method of treating a patient by administering a therapeutically effective amount of MASC or their progeny. The progeny can either have the capacity to be further differentiated, or can be terminally differentiated. An unexpected benefit of this approach is that the need for pretreatment and/or post treatment of the patient with irradiation, chemotherapy, immunosuppressive agents or other drugs or treatments is reduced or eliminated. The induction of tolerance before or during treatment is also not required.

Such treatment can treat a variety of diseases and conditions, including cancer, cardiovascular disease, metabolic disease, liver disease, diabetes, hepatitis, hemophilia, degenerative or traumatic neurological conditions, autoimmune disease, genetic deficiency, connective tissue disorders, anemia, infectious disease and transplant rejection.

00269113

MASC or their progeny are administered via localized injection, including catheter administration, systemic injection, parenteral administration, oral administration, or intrauterine injection into an embryo. Administration can be in conjunction with a pharmaceutically acceptable matrix, which may be biodegradable.

MASC or their progeny, administered to a patient, alter the immune system to resist viral, bacterial or fungal infection.

Surprisingly, teratomas are not formed when MASC or their progeny are adminstered to a patient When administered to a patient, MASC or their progeny also are able to augment, reconstitute or provide for the first time the function of a cell or organ defective due to injury, genetic disease, acquired disease or iatrogenic treatments. The organ is any of bone marrow, blood, spleen, liver, lung, intestinal tract, brain, immune system, circulatory system, bone, connective tissue, muscle, heart, blood vessels, pancreas, central nervous system, peripheral nervous system, kidney, bladder, skin, epithelial appendages, breast-mammary glands, fat tissue, and mucosal surfaces including oral esophageal, vaginal and anal. Examples of diseases treatable by this method are cancer, cardiovascular disease, metabolic disease, liver disease, diabetes, hepatitis, hemophilia, degenerative or traumatic neurological conditions, autoimmune disease, genetic deficiency, connective tissue disorders, anemia, infectious disease and transplant rejection.

The MASC or their progeny home to one or more organs in the patient and are engrafted therein such that the function of a cell or organ, defective due to injury, genetic disease, acquired disease or iatrogenic treatments, is augmented, reconstituted or provided for the first time, which is surprising and unexpected. In a preferred embodiment, the injury is. ischemia or inflammation.

In another preferred embodiment, the MASC or their progeny enhance angiogenesis.

In an additional aspect of the invnetion, MASC or their progeny are genetically transformed to deliver a therapeutic agent, preferably an antiangiogenic agent.

The invention provides a therapeutic composition comprising MASC and a pharmaceutically acceptable carrier, wherein the MASC are present in an amount

00269113

effective to produce tissue selected from the group consisting of bone marrow, blood, spleen, liver, lung, intestinal tract, brain, immune system, bone, connective tissue, muscle, heart, blood vessels, pancreas, central nervous system, kidney, bladder, skin, epithelial appendages, breast-mammary glands, fat tissue, and mucosal surfaces including oral esophageal, vaginal and anal.

The invention further provides a therapeutic method for restoring organ, tissue or cellular function to a patient comprising the steps of removing MASC from a mammalian donor, expanding MASC to form an expanded population of undifferentiatied cells, and adminstering the expanded cells to the patient, wherein organ, tissue or cellular function is restored. The restored function may be enzymatic or genetic. In a preferred embodiment, the mammalian donor is the patient.

The invention provides a method of inhibiting the rejection of a heterologous MASC transplanted into a patient comprising the steps of introducing into the MASC, ex vivo, a nucleic acid sequence encoding the recipient's MHC antigen operably linked to a promotor, wherein the MHC antigen is expressed by the MASC and transplanting the MASC into the patient, wherein MHC antigen is expressed at a level sufficient to inhibit the rejection of the transplanted MASC. The patient is of the same species or another mammalian species as the donor of the MASC. An alternative method of inhibiting the rejection of a heterologous MASC transplanted into a patient comprises transgenically knocking out expression of MHC antigen in the MASC and transplanting the transgenic MASC into the patient MHC antigen is not expressed by the MASC and rejection of the transplanted cells is inhibited. An object of the invention is a method of generating blood or individual blood components ex vivo by the process of isolating MASC and differentiating the MASC to form blood or blood components. Preferably, the individual blood components are red blood cells, white blood cells or platelets.

Another aspect of the invention is a method of drug discovery comprising the steps of analyzing the genomic or proteomic makeup of MASC or their progeny, employing analysis thereof via bioinformatics and/or computer analysis using algorithms, and assembling and comparing new data with known databases to compare and contrast these.

00269113

A further aspect is a method of identifying the components of a differentiation pathway comprising the steps of analyzing the genomic or proteomic makeup of MASC, inducing differentiation of MASC in vitro or in vivo, analyzing the genomic or proteomic makeup of intermediary cells in the differentiation pathway, analyzing the genomic or proteomic makeup of terminally differentiated cells in the differentiation pathway, using bioinformatics and/or algorithms to characterize the genomic or proteomic makeup of MASC and their progeny, and comparing the data obtained in (e) to identify the components of the pathway. Using this method, differentiation that occurs in vitro can be compared with differentiation that occurs in vivo such that fundamental differences between the two systems can be characterized.

The invention provides a method of generating products in vitro that have therapeutic, diagnostic or research utility by identifying the products in MASC and isolating the products from MASC. In a preferred embodiment, the products are proteins, lipids, complex carbohydrates, DNA or RNA.

Included in the invention is a method of inducing, in a mammal, tolerance to an antigen administered to said mammal, the method comprising the step of administering to said mammal, after or simultaneously with the administration of said antigen, an effective amount of MASC or their progeny so that said mammal's humoral immune response to a subsequent challenge with said antigen is suppressed.

Also included is a method for removing toxins from the blood of a patient comprising contacting blood ex vivo with MASC derived cells, wherein said cells line a hollow, fiber based device. In a preferred embodiment, the cells are kidney or liver cells. An object of the invention is a method for delivering therapeutic products to a patient comprising contacting the blood of said patient ex vivo with MASC or their progeny, wherein said MASC or their progeny are genetically transformed to deliver a therapeutic agent.

A further object is a method for testing the toxicity of a drug comprising contacting MASC or their progeny ex vivo with said drug and monitoring cell survival. In a preferred embodiment, the progeny are selected from the group consisting of hepatic, endothelial, epithelial and kidney.

00269113

BRIEF DESCRIPTION OF DRAWINGS

The following Detailed Description, given by way of example, but not intended to limit the invention to specific embodiments described, may be understood in conjunction with the accompanying drawings, incorporated herein by reference, in which:

Fig. 1 shows a graphical illustration of the expansion potential of of bone marrow (BM), muscle and brain derived MASC.

Fig. 2 shows a scatter plot representing gene expression in (A) muscle and brain MASC and (B) bone marrow and muscle MASC. Fig.3 shows a graphical illustration of FACS analysis of undifferentiated

MASC and MASC cultured with VEGF. The plots show isotype control IgG staining profile (thin line) vs. specific antibody staining profile (thick line). Panel A shows the phenotype of undifferentiated MASC. MASC express low levels of β2- microglobulin, Flkl, Fit I and AC 133, but do not stain with any of the other anti- endothelial markers; panel B shows the phenotype of MASC cultured for 14 days with 10 ng/mL VEGF. MASC express low levels most markers associated with endothelial cells, but lost expression of AC 133; and panel C shows phenotype of MASC cultured or 3-9 days with 10 ng/mL VEGF. MASC lose expression of AC 133 by day 3 of culture with VEGF, acquire expression of Tek and VE-cadherin by day 3, Tie, vWF, CD34 and HIP12 by day 9.

Fig.4 shows a photomicrograph of engraftment and in vivo differentiation of mMASC. Slides were examined by fluorescence or confocal microscopy. Panels A, G, J, N, Q and S represent identically stained tissues of control NOD-SCID animals that were not injected with mMASC. Panels A-F show a photomicrograph of bone marrow (BM) cytospϊn from a control (A) and study (B-F) animal stained with antiβ-gal-FITC antibody and PE-conjugated antibodies to various hematopoietic antigens. A-B: CD45, C: CD19, D: MACl, E: GRl, F:TER119 and DAPI; panels G- I shows a photomicrograph of a spleen section from a control (G) and study animal (H, I) stained with anti-β-gal-FITC antibody and anti-CD45-PE antibody. Donor derived anti-β-gal ⁺ cells are seen in clusters. H is 1OX and I are 6OX magnifications; panels J-M shows a photomicrograph of a liver, section from a control mouse (J) and study animal (K-M) stained with anti-β-gal-FITC. J-L are co-stained with mouse- anti-CK-18 / anti-mouse-Cy5 plus CD45-PE and M with mouse anti-albumin / anti-

00269113

mouse Cy3 antibodies. J-K, L and M are 20X, 6OX and 1OX magnifications respectively; panels N-P show a photomicrograph of an intestine section from a control mouse and study animal (O-P), stained with anti-β-gal-FITC plus mouse- anti-pan-CK / anti-mouse-Cy5 antibodies (N-P). N and P are costained with CD45- PE antibodies. β-gal ⁺ Pan-CK ⁺ CD45 ^" epithelial cells covered 50% (solid arrow, panel P) of the circumference of villi. Pan-CK ^" / β-gal ⁺ cells in the core of the villi (open arrow-panel O) co-stained for CD45 (P); panels Q-R show a photomicrograph of a lung section from a control mouse (Q) and study animal (R) stained with anti-β- gal-FITC plus mouse-anti-pan-CK / anti-mouse-Cy5 plus CD45-PE antibodies. Several β-gal ⁺ pan-CK ⁺ donor cells are seen lining the alveoli of the recipient animal (R). CD45 ⁺ / pan-CK ^" cells of hematopoietic origin are seen distinctly from the epithelial cells; and panels S-T show a photomicrograph of a blood vessel section from a control mouse (S) and thymic lymphoma that developed in a study animal 16 weeks after transplantation (T) stained with anti-β-gal-FITC, anti-vWF-PE and TO- PRO3. β-gal ⁺ donor cells differentiated into vWF ⁺ endothelial cells in the thymic lymphoma which is of recipient origin, as the tumor cells did not stain with anti-β- GaI antibodies.

Fig.5 shows immunohistochemical evaluation of MASC-derived endothelial cells using confocal fluorescence microscopy, (a) MASC grown for 14 days in VEGF. Typical membrane staining is seen for the adhesion receptor, αvβ5, and for the adherens junction proteins, ZO- 1 , β- and γ-catenin. Scale bar = 50 μm. (b) Morphology in bright field of MASC at day 0 (upper panel) and day 21 (lower panel) after VEGF treatment. Bar = 25 μm.

Fig.6 shows a photomicrograph of MASC derived endothelial cells. Panel A shows histamine-mediated release of vWF from MASC-derived endothelium. Staining with antibodies against myosin shows cytoskeletal changes with increased numbers of myosin stress fibers, and widening of gap junctions (Arrows) (Representative example of 3 experiments). Scale bar = 60 μm; panel B shows MASC-derived endothelium takes up a-LDL. After 7 days, cells expressed Tie-1, but again did not take up a-LDL. However, acquisition of expression of vVWF on day 9 was associated with uptake of aLDL (representative example of 10 experiments). Scale bar = 100 μm; and panel C shows vascular tube formation by

00269U3

MASC-derived endothelium. After 6h, typical vascular tubes could be seen.

(Representative example of 6 experiments). Scale bar = 200 μm

Fig.7 shows a graphical illustration of FACS analysis of MASC derived endothelial cells. The Plots show isotype control IgG staining profile (thin line) vs. specific antibody staining profile (thick line) (Representative example of >3 experiments). Number above plots is the Mean Fluorescence Intensity (MFI) for the control IgG staining and the specific antibody staining. Panel A shows hypoxia upregulates Flkl and Tek expression on MASC-derived endothelial cells analyzed by flow cytometry; panel B shows that hypoxia upregulates VEGF production by MASC-derived endothelial cells. VEGF levels were measured by ELISA and the results are shown as Mean ± SEM of 6 experiments; and panel C shows that IL-Ia induces expression of class II HLA antigens and increases expression of adhesion receptors. Plots show isotype control IgG staining profile (thin line) vs. specific antibody staining profile (thick line) (Representative example of 3 experiments). Number above plots shows MFI for the control IgG staining and the specific antibody staining.

Fig. 8 shows a photomicrograph of human MASC derived endothelial cells. Panels C-F show the 3-D reconstructed figures for either anti-human β2- microglobulin-FITC (panel C) or anti-mouse-CD31-FITC (panel D) and merging of the two (Panel E), anti-vWF-Cy3 (panel F), and merging of the three staining patterns (Panel G). Panels A and B show the confocal image of a single slice stained with either anti-human β2-microglόbulϊn-FITC and anti-vWF-Cy3, or anti-mouse- CD31-Cy5 and anti-vWF-Cy3. Scale bar = 100 μm. Panel H shows wound healing resulting in a highly vascularized area in the punched ear stained with anti-β2- microglobulin-FITC and anti-vWF in mice injected with human MASC-derived endothelial cells (Top panel) or human foreskin fibroblasts (Bottom panel). Scale bar = 20 μm. C= Cartilage. D= dermis. Panel I shows that tumor angiogenesis is derived from endothelial cells generated in vivo from MASC resulting in a highly vascularized area in the tumor stained with anti-X32-microglobulin-FITC, anti-vWF and TOPRO-3. Scale bar = 20 μm.

Fig. 9 shows spiking behavior and expressed voltage-gated sodium currents in hMSC derived neuron-like cells. Panel A shows a photomicrograph of cultured hMSC-derived neurons that showed spiking behavior and expressed voltage-gated

00269113

sodium currents (the shadow of the pipette points to the cell). Panel B shows graphical illustrations of current-clamp recordings from ahMSC derived neuron. Panel C shows graphical illustrations of leak-subtracted current traces from the same hMSC derived neuron. Fig. 10 shows quantitative RT-PCR and Western blot analysis confirming the hepatocyte-like phenotype. Panels A and B show mMASC (A) and hMASC (B) cultured on Matrigel™ with FGF4 and HGF or FGF4 alone for 21 and 28 days respectively. For αFP, Cyp2b9 and Cyp2bl3, numbers under the blots are relative to mRNA from liver, as no transcripts were detected in undifferentiated MASC. Li = mouse or human liver mRNA; NT = no-template. Representative example of 5 mouse and 1 human studies, Panel C shows hMASC (B) cultured on Matrigel™ with FGF4 and HGF or FGF4 alone for 21 days. FH= FGF4 and HGF-induced hMASC on Matrigel™, Huh= Huh7 cell line used as control.

Fig. 11 shows a photomicrograph of hepatocyte-like cells. MASC induced by FGF4 produce glycogen. Glycogen storage is seen as accumulation of dark staining (Representative example of 3 studies). Scale bar = 25 μm.

DETAILED DESCRIPTION OF THE INVENTION Definitions As used herein, the following terms shall have the following meanings:

"Expansion" shall mean the propogation of a cell without differentiation. "Intermediary cells" are cells produced during differentiation of a MASC that have some, but not all, of the characteristics of MASC or their terminally differentiated progeny. Intermediary cells may be progenitor cells which are committed to a specific pathway, but not to a specific cell type.

"Normal" shall mean an animal that is not diseased, mutated or malformed, i.e., healthy animals.

"Self-renewal" shall mean the ability of cells to propagate without the addition of external stimulation. The presence of cytokines or other growth factors produced locally in the tissue or organ shall not constitute external stimulation.

"Home" shall mean the ability of certain MASC or their progeny to migrate specifically to sites where additional cells may be needed.

00269113

"Knocking out expression" shall mean the elimination of the function of a particular gene.

As used herein, "genomic or proteomic makeup" shall mean the gene or protein components of a given cell. "High levels of telomerase activity" can be correlated to the two-fold level observed in the immortal human cell line MCF7. Soule et al. (1973) J. Cancer Inst. 51:1409-1416. Application of this Technology

MASC technology could be used to replace damaged, diseased, dysfunctional or dead cells in the body of a mammal. Furthermore these cells could be injected into the host using autologous or allogeneic cells with or without nature or artificial supports, matrices or polymers to correct for loss of cells, abnormal function or cells or organs e.g. genetic such as mutations of genes affecting a protein function such as sickle cell disease, hemophilia or "storage diseases" where products accumulate in the body because of faulty processing, e.g. Guacher's, Neiman Pick's, mucopolysaccharidosis etc. Examples of restitution of dying or dead cells would be the use of MASC or their differentiated progeny in the treatment of macular degeneration and other neurodegenerative diseases.

Given the ability to have these MASC to "home" to and incorporate into organs/tissues of a host animal proliferate and differentiation they could potentially be used to provide new endothelial cells to an ischemic heart and also myocardial cells themselves, numerous other examples exist

There may be medical circumstances where transient benefits to a tissue or organs function could have desirable effects. For example, there are now cases with liver failure patients hooked up to a bioartificial liver, which was sufficient to allow for the recovery of normal liver function, obviating the need for a liver transplant. This is a serious unmet medical need, for example in one liver disease alone - hepatitis C. There are 4-5 million Americans currently infected with hepatitis C and there are estimates that 50% of these people will get cirrhosis and need a liver transplant. This is a huge public health problem that is begging for a remedy.

Hepatocytes, derived from autologous or allogeneic MASC, can be transplanted in this or other liver diseases. Such transplants may either transiently provide liver function to allow recovery of the recipient's own liver cells or permanently

00269113

repopulate a damaged liver to allow recovery of normal liver function via the donor cells.

In addition to many cell therapies where the undifferentiated MASC are administered to a human or other mammal to then differentiate into specific cells in the donor, the progeny of the MASC could be differentiated ex vivo and then be administered as purified or even mixtures of cells to provide a therapeutic benefit. These MASC in the undifferentiated state could also be used as carriers or vehicles to deliver drugs or molecules of therapeutic benefit. This could be to treat any one of a number of diseases including but not limited to cancer, cardiovascular, inflammatory, immunologic, infections, etc. So by example, a cell perhaps an endothelial cell expressing a novel or high levels of an angiogenic molecule could be administered to a patient which would be incorporated into existing blood vessels to promote angiogenesis, for example in the heart; correspondingly one could have endothelial cells producing molecules that might suppress angiogenesis that would be incorporated into blood cells and inhibit their further formation for example in diabetic retinopathy or in cancer where new blood vessel formation is key to the pathogenesis, spread and extent of the disease.

The ability to populate the BM and to form blood ex vivo has an untold use for important medical applications. For example regarding ex vivo production of blood, the transfusion of blood and blood products around the world is still performed with variable safety because of transmission of infectious agents. Blood transfusions have lead to HTV, hepatitis C and B, and now the impending threat of Mad Cow or CJD, Creuzfeldt-Jakob disease. The ability to produce blood in vitro, especially red blood cells, could provide a safe and reliable alternative to collection of blood from people. It might never fully replace blood collection from donors. hMASC or their hematopoietic progeny could be placed in animals in utero such as sheep which could form human hematopoietic cells and serve as a source for human blood components or proteins of therapeutic utility. The same could be true for hepatocytes, islets or many other cell types but would provide an alternative to producing human cells in vitro and use the animals as factories for the cells. It could also assist in blood shortages that are predicted to occur. hMASC could also conceivably be transplanted into a human embryo to correct any one of a number of defects.

00269113

Because these MASC can give rise to clonal populations of specifically differentiated cells they are a rich platform for drug discovery. This would involve doing gene expression, analyzing gene expression, discovery of new genes activated patterns of activation, proteomics and patterns of protein expression and modification surrounding this. This would be analyzed with bioinformatics, using data bases and algorithms for analyzing these data compared to publicly available or proprietary data bases. The information of how known drugs or agents might act could be compared to information derived from MASC, their differentiated progeny and from a population of people which could be available. Pathways, targets, and receptors could be identified. New drugs, antibodies or other compounds could be found to produce a biologically desirable responses. Correspondingly, the MASC and their differentiated progeny could be used as monitors for undesirable responses, coupled with databases, bioinformatics and algorithms.

These MASC derived from human, mouse, rat or other mammals appear to be the only normal, non-malignant, somatic cell (non germ cell) known to date to express very high levels of telomerase even in late passage cells. The telomeres are extended in MASC and they are karyotypϊcally normal. Because MASC injected into a mammal, home to multiple organs, there is the likelihood that newly arrived MASC in a particular organ could be self renewing. As such, they have the potential to repopulate an organ not only with themselves but also with self renewing differentiated cell types that could have been damaged, died, or otherwise might have an abnormal function because of genetic or acquired disease.

For example in type I diabetes mere is a progressive loss of insulin producing beta cells in the pancreatic islets. In various renal diseases there is progressive loss of function and in some cases obliteration of glomerulus. If in the case of diabetes, MASC or differentiated progeny might home to the pancreas and themselves or via interaction with endogenous cells within the pancreas, induce islets to be formed. This would have an ameliorating impact on diabetes. Ultimately conditions, agents or drags might be found to in vivo control, i.e. promote or inhibit their self renewing capability of the MASC and control, or enhance or inhibit the movement to differentiated progeny, e.g., islet precursors, hepatocyte precursors, blood precursors, neural and/or cardiac precursors using

00269113

MASC one will likely find pathways, methods of activation and control that might induce endogenous precursor cells within an organ to proliferate and differentiation.

This same ability to repopulate a cellular tissue or organ compartment and self renew and also differentiate could have numerous uses and be of unprecedented usefulness to meet profound unmet medical needs. So for example certain genetic diseases where there are enzyme deficiencies have been treated by BM transplantation. Often times this may help but not cure the complications of the disease where residual effects of the disease might persist in the brain or bones or elsewhere, MASC and genetically engineered MASC offer the hope to ameliorate numerous genetic and acquired diseases. They will also be useful for diagnostic and research purposes and drug discovery.

The present invention also provides methods for drug discovery, genomics, proteomics, and pathway identification; comprising analyzing the genomic or proteomic makeup of a MASC, coupled with analysis thereof via bioinformatics, computer analysis via algorithms, to assemble and compare new with known databases and compare and contract these. This will identify key components, pathways, new genes and/or new patterns of gene and protein expression and protein modification (proteomics) that could lead to the definition of targets for new compounds, antibodies, proteins, small molecule organic compounds, or other biologically active molecules that would have therapeutic benefit.

EXAMPLES The following examples are provided to illustrate but not limit the invention.

Example 1. Selection, Culture and Characterization of Mouse Multipotent Adult Stem CeUs fmMASQ

Cell Isolation and Expansion

AH tissues were obtained according to guidelines from the University of Minnesota IACUC. BM mononuclear cells (BMMNC) were obtained by ficoll- hypaque separation of BM was obtained from 5-6 week old ROSA26 mice or C57/BL6 mice. Alternatively, muscle and brain tissue was obtained from 3-day old 129 mice. Muscles from the proximal parts of fore and hind limbs were excised from and thoroughly minced. The tissue was treated with 0.2% collagenase (Sigma Chemical Co, St Louis, MO) for 1 hour at 37°C, followed by 0.1% trypsin (Invitrogen, Grand Island, NY) for 45 minutes. Cells were then triturated vigorously

00269113

and passed through a 70-um filter. Cell suspensions were collected and centrifuged for 10 minutes at 1600 rpm. Brain tissues was dissected and minced thoroughly. Cells were dissociated by incubation with 0.1% trypsin and 0.1% DNAse (Sigma) for 30 minutes at 37 ⁰ C. Cells were then triturated vigorously and passed through a 70-um filter. Cell suspension was collected and centrifuged for 10 minutes at 1600 rpm.

BMMNC or muscle or brain suspensions were plated at IxIO ⁵ ZCm ² in expansion medium [2% FCS in low glucose Dulbecco's minimal essential medium (LG-DMEM), 10 ng/mL each platelet derived growth factor (PDGF), epidermal growth factor (EGF) and leukemia inhibitory factor (LIF)] and maintained at 5xlO ³ /cm ² . After 3-4 weeks, cells recovered by trypsin/EDTA were depleted of CD45 ⁺ /glycophorin (GIy)-A ⁺ cells with micromagnetic beads. Resulting CD45 ^" /GIy-A ^" cells were replated at 10 cells/well in 96-well plates coated with FN and were expanded at cell densities between 0.5 and 1.5x 10 ³ /cm ² . The expansion potential of MASC was similar regardless of the tissue from which they were derived (Fig. 1). Characterization of MASC

Phenorypically, mMASC derived from BM, muscle and brain and cultured on FN were CD13 ⁺ , CD44 ^" , CD45 ^" , class-I and class-II histocompatibility antigen ^" , Flkl ^low and cKif , identical to the characteristics of hMASC, as described in

Internation Application No. PCT/USOO/21387. Although cell expansion during the initial 2-3 months was greater when cells were cultured on collagen type IV, laminin or Matrigel™, cells had phenotypic characteristics of MSC, i.e., expressed CD44 and did not express CDl 3. As with human cells, mMASC cultured on FN expressed transcripts for oct-4, and the LIF-R.

Approximately 1 % of wells seeded with 10 CD457GlyA ^" cells yielded continuous growing cultures. This suggests that the cells capable of initiating MASC cultures are rare and likely less that 1/1 ,000 of CD457GlyA ^" cells. mMASC cultured on FN were 8-10 μm in diameter with a large nucleus and scant cytoplasm. Several populations have been cultured for > 100 PDs. The morphology and phenotype of cells remained unchanged throughout culture. mMASC that had undergone 40 and 102 PDs were harvested and telomere lengths evaluated. Telomere length was measured using the Telomere Length Assay

00269113

Kit from Pharmingen (New Jersey, USA) according to the manufacturer's recommendations. Average telomere length (ATL) of mMASC cultured for 40 PDs was 27 Kb. When re-tested after 102 PDs, ATL remained unchanged. For karyotyping of mMASC, cells were subcultured at a 1:2 dilution 12h before harvesting, collected with trypsin-EDTA, and subjected to a 1.5h colcemid incubation followed by lysis with hypotonic KCl and fixation in acid/alcohol as previously described (Verfaillie et al., 1992). Cytogenic analysis was conducted on a monthly basis and showed a normal karyotype, except for a single.population that became hyperdiploid after 45 PDs, which was no longer used for studies. Murine MASC obtained after 46 to >80 PDs were tested by Quantitative (Q)-

RT-PCR for expression levels of Oct4 and Rexl, two transcription factors important in maintaining an undifferentiated status of ES cells. RNA was extracted from mouse MASC, neuroectodermal differentiated progeny (day 1- 7 after addition of bFGF) and mouse ES cells. RNA was reverse transcribed and the resulting cDNA underwent 40 rounds of amplification (ABI PRISM 7700, Perkin Elmer/Applied Biosystems) with the following reaction conditions: 40 cycles of a two step PCR (95°C for 15 seconds, 60 ⁰ C for 60 seconds) after initial denaturation (95°C for 10 minutes) with 2 μl of DNA solution, IX TaqMan SYBR Green Universal Mix PCR reaction buffer. Primers are listed in Table 1. Table 1: Primers used

mRNA levels were normalized using GAPDH as housekeeping gene, and compared with levels in mouse ES cells. Oct4 and Rex 1 mRNA were present at similar levels in BM, muscle and brain derived MASC. Rexl mRNA levels were

0026?! 13

similar in mMASC and niES cells, while Oct4 mRNA levels were about 1,000 fold lower in MASC than in ES cells.

Expressed gene profile of mouse BM, muscle and brain derived MASC is highly similar To further evaluate whether MASC derived from different tissues were similar, the expressed gene profile of BM, muscle and brain derived MASC was examined using U74A Affimetrix gene array. Briefly, mRNA was extracted from 2- 3xlO ⁶ BM, muscle or brain derived-MASC, cultured for 45 population doublings. Preparation of cDNA, hybridization to the U74A array containing 6,000 murine genes and 6,000 EST clusters, and data acquisition were done per manufacturer's recommendations (all from Affimetrix, Santa Clara, CA). Data analysis was done using GeneChip® software (Affimetrix). Increased or decreased expression by a factor of 2.2 fold (Iyer V.R. et al, 1999; Scherf U. et ah, 2000; Alizadeh A.A. et ah, 2000) was considered significant, r ² value was determined using linear regression analysis (Fig.2).

Comparison between the expressed gene profile in MASC from the three tissues showed that <1% of genes were expressed at >2.2-fold different levels in MASC from BM than muscle. Likewise, only <1% of genes were expressed > 2.2- fold different level in BM than brain derived MASC. As the correlation coefficient between the different MASC populations was > 0.975, it was concluded that MASC derived from the different tissues are highly homologous, in line with the phenotypic described above and the differentiation characteristics described in Example 5.

Using the mouse-specific culture conditions, mMASC cultures have been maintained for more than 100 cell doublings. mMASC cultures have been initiated with marrow from C57B1/6 mice, ROSA26 mice and C57BL/6 mice transgenic for the -HMG-LacZ.

Example 2. Selection and Culture of Rat Mnltipotent Adult Stem CeUs (rMASQ

BM and MNC from Sprague Dawley or Wistar rats were obtained and plated under conditions similar for mMASC. After 21-28 days, cells were depleted of CD45 ⁺ cells, and the resulting CD45 ^" cells were subcultured at 10 cells/well.

Similar to mMASC, rMASC have been culture expanded for > 100 PDs. Expansion conditions of rat MASC culture required the addition of EGF, PDGF-BB

00269113

and LIF and culture on FN, but not collagen type I, laminin or Matrigel™. rMASC were CD44, CD45 and MHC class I and II negative, and expressed high levels of telomerase. The ability of a normal cell to grow over 100 cell doublings is unprecedented, unexpected and goes against conventional dogma of more than two decades.

Rat MASC that had undergone 42 PDs, 72 PDs, 80 PDs, and 100 PDs, were harvested and telomere lengths evaluated. Telomeres did not shorten in culture, as was determined by Southern blot analysis after 42 PDs, 72 PDs, 80 PDs, and 100 PDs. Monthly cytogenetic analysis of rat MASC revealed normal karyotype.

Example 3. Selection and Culture of Human Multipotent Adult Stem Cells (liMASC)

BM was obtained from healthy volunteer donors (age 2-50 years) after informed consent using guidelines from the University of Minnesota Committee on the use of Human Subject in Research. BMMNC were obtained by Ficoll-Paque density gradient centrifugation and depleted of CD45 ⁺ and glycophorin-A ⁺ cells using micromagnetic beads (Miltenyii Biotec, Sunnyvale, CA).

Expansion conditions: 5x 10 ³ CD457GlyA ^" cells were diluted in 200 μL expansion medium [58% DMEM-LG, 40% MCDB-201 (Sigma Chemical Co, St Louis, MO), supplemented with IX insulin-transferrin-selenium (ITS), IX linoleic- acid bovine serum albumin (LA-BSA), 10 ^"8 M Dexamethasone, 10 ^"4 M ascorbic acid 2-phosphate (all from Sigma), 100 U penicillin and 1,000 U streptomycin (Gibco)] and 0-10% fetal calf serum (FCS) (Hyclone Laboratories, Logan, UT) with 10 ng/ml of EGF (Sigma) and 10 ng/ml PDGF-BB (R&D Systems, Minneapolis, MN)] and plated in wells of 96 well plates that had been coated with 5 ng/ml of FN (Sigma). Medium was exchanged every 4-6 days. Once wells were >40-50% confluent, adherent cells were detached with 0.25% trypsin-EDTA (Sigma) and replated at 1:4 dilution in MASC expansion medium and bigger culture vessels coated with 5 ng/ml FN to maintain cell densities between 2 and 8xlO ³ cells/cm ² . Undifferentiated MASC did not express CD31 , CD34, CD36, CD44, CD45,

CD62-E, CD62-L, CD62-P, HLA-class I and II, cKit, Tie, Tek, α _v β ₃ , VE-cadherin, vascular cell adhesion molecule (VCAM), intracellular adhesion molecule (ICAM)- L MASC expressed low/very low levels of β2-microglobulϊn, α _v βs, CDw90, AC 133, Flkl and Fltl, and high levels of CDl 3 and CD49b (Fig..3).

002691 J3

Example 4. Immunophenotypic Analysis

Immunofluorescence

1. Cultured cells were fixed with 4% paraformaldehyde and methanol at room temperature, and incubated sequentially for 30 min each with primary antibody, and with or without secondary antibody. Between steps, slides were washed with PBS/BSA. Cells were examined by fluorescence microscopy (Zeiss Axiovert; Carl Zeiss, Inc., Thornwood, NY) and confocal fluorescence microscopy (Confocal 1024 microscope; Olympus AX70, Olympus Optical Co. LTD, Japan). To assess the frequency of different cell types in a given culture, the number of cells were counted that stained positive with a given antibody in four visual fields (50-200 cells per field).

2. Harvested tissues: Cytospin specimens of blood and BM were fixed with acetone (Fisher Chemicals) for 10 min at room temperature. For solid organs, 5 μm thick fresh frozen sections of tissues were mounted on glass slides and immediately fixed in acetone for 10 min at room temperature. Following incubation with isotype sera for 20 min, cytospin preparations or tissue sections were serially stained for tissue specific antigens, β-gal and a nuclear counter stain (DAPI or TO-PRO-3). Cover slips were mounted using Slowfade-antifade kit (Molecular Probes Inc., Eugene, OR, USA). Slides were examined by fluorescence microscopy and confocal fluorescence microscopy.

3. Antibodies: Cells were fixed with 4% paraformaldehyde at room temperature or methanol at -20 ⁰ C, and incubated sequentially for 30 min each with primary Ab, and FITC or Cy3 coupled anti-mouse- or anti-rabbit-IgG Ab. Between each step slides were washed with PBS+1 %BSA. PE or FITC-coupled anti-CD45, anti-CD31, anti-CD62E, anti-Macl, anti-Grl, anti-CD19, anti-CD3, and anti-Terl 19 antibodies were obtained from BD Pharmingen. Abs against GFAP (clone G-A-5, 1:400), galactocerebroside (GaIC) (polyclonal, 1:50), MBP (polyclonal, 1:50), GABA (clone GB-69, 1:100), paralbumin (clone PARV-19, 1:2000), TuJl (clone SDL.3D10, 1:400), NF-68 (clone NR4, 1:400), NF-160 (clone NN 18, 1:40), and NF-200 (clone N52, 1:400), NSE (polyclonal, 1 :50), MAP2-AB (clone AP20, 1:400), Tau (polyclonal, 1:400), TH (clone TH-2, 1:1000), DDC (clone DDC-109, 1:100), TrH (clone WH-3, 1:1000), serotonin (polyclonal, 1:2000), glutamate (clone

00269113

GLU-4, 1:400), fast twitch myosin (clone MY-32; 1:400 dilution) were from Sigma.

DAPI and TOPRO-3 were from Molecular Probes. Abs against vWF (polyclonal; 1:50) Neuro-D (polyclonal, 1:50), c-ret (polyclonal, 1:50) andNuπϊ (polyclonal, 1 :50) were from Santa Cruz Biotechnology Inc., Santa Cruz, CA. Abs against PSA- NCAM (polyclonal, 1 :500) from Phanmingen, San Diego, CA and against serotonin transporter (clone MAB 1564, 1:400), DTP (polyclonal, 1:200), Na-gated voltage channel (polyclonal, 1:100), glutamate-receptors-5, -6 and -7 (clone 3711:500) and NMDA (polyclonal 1:400) receptor from Chemicon International, Temecula, CA. Anti-nestin (1:400) Abs were a kind gift from Dr. U. Lendahl, University of Lund, Sweden. Antibodies against NSE ( 1 :50) pan-cytokeratin (catalog number C-2562; 1:100), CK-18 (C-8541; 1:300), albumin (A-6684; 1:100) were all obtained from Sigma. Polyclonal antibodies against Flkl, Fltl, Tek, HNF-lβ were obtained from Santa Cruz Biotechnology Inc., Santa Cruz, CA. Anti-nestin (1:400) antibodies were a kind gift from Dr. U. Lendahl, University of Lund, Sweden. Control-mouse, - rabbit or,-rat IgGs and FITC/PE/Cy3- and Cy5-labeled secondary antibodies were obtained from Sigma. Rabbit anti-β-gal-FITC antibody was obtained from Rockland Immunochemicals, USA. TOPRO-3 was obtained from Molecular Probes Inc. and DAPI was obtained from Sigma.

B. X-GAL staining: Tissue sections were stained by for β-galactosidase enzyme activity using β-gal staining kit from Invitrogen, pH 7.4. Manufacturer's instructions were followed except for the fixation step, during which the tissue sections were incubated for 5 min instead of 10 min.

C. FACS: For FACS, undifferentiated MASC were detached and stained sequentially with anti-CD44, CD45, CD13, cKit, MHC-class I and π, or b2- microglobulin (BD Pharmingen) and secondary FITC or PE coupled antibodies, fixed with 2% paraformaldehyde until analysis using a FACS-Calibur (Becton- Dickinson).

Example 5. Single Cell Origin of Differentiated Lineages from MASC

The differentiation ability of mMASC or rMASC was tested by adding differentiation factors (cytokines) chosen based on what has been described for differentiation of hMASC or ES cells to mesoderm, neuroectoderm, and endoderm. Differentiation required that cells were replated at 1-2x10 ⁴ cells/cm ² in serum free medium, without EGF, PDGF-BB and LIF, but with lineage specific cytokines.

00269113

Differentiation was determined by immunohistology for tissue specific markers

[slow twitch myosin and MyoD (muscle), von-Willebrand factor (vWF) and Tek (endothelium), NF200 and MAP2 (neuroectodermal), and cytokeratin-18 and albumin (endodermal)], RT-PCR, and functional studies. MASC Differentiation into Neuroectodermal Cells

Palmer et al. showed that neuroprogenitors can be culture expanded with PDGF-BB and induced to differentiate by removal of PDGF and addition of bFGF as a differentiation factor. Based on those studies and studies conducted using hMASC, mMASC and rMASC were plated in FN coated wells without PDGF-BB and EGF but with 100 ng/mL bFGF. Progressive maturation of neuron-like cells was seen throughout culture. After 7 days, the majority of cells expressed nestin. After 14 days, 15-20% of MASC acquired morphologic and phenotypic characteristics of astrocytes (GFAP ⁺ ), 15-20% of oligodendrocytes (galactocerebroside (GaIC) ⁺ ) and 50-60% of neurons (neurofilament-200 (NF- 20O) ⁺ ). NF200, GFAP or GaIC were never found in the same cell, suggesting that it is unlikely that neuron-like cells were hMASC or glial cells that inappropriately expressed neuronal -markers. Neuron-like cells also expressed Tau, MAP2 and NSE. Approximately 50% of neurons expressed gamma-amino-butyric-acid (GABA) and parvalbumin, 30% tyrosine hydroxylase and dopa-decarboxylase (DDC), and 20% serotonin and tryptophan hydroxylase. Differentiation was similar when MASC had been expanded for 40 or >90 PDs. Q-RT-PCR, performed as described in Example 1, confirmed expression of neuroectodermal markers: on day 2 MASC expressed otxl and otx2 mRNA, and after 7 days nestin mRNA was detected.

The effect of fibroblast growth factor (FGF)-8b as a differentiation factor was tested next. This is important in vivo for midbrain development and used in vitro to induce dopaminergic and serotoninergic neurons from murine ES cells on hMASC. When confluent hMASC (n=8) were cultured with 10 ng/mL FGF-8b + EGF, differentiation into cells staining positive for neuronal markers but not oligodendrocytes and astrocytes was seen. Neurons had characteristics of GABAergic (GABA ⁺ ; 40±4%), dopaminergic (DOPA, TH, DCC and DTP ⁺ , 26±5%) and serotoninergic (TrH, serotonin and serotonin-transporter ¹ , 34±6%) neurons. DOPA ⁺ neurons stained with Abs against Nurrl suggesting differentiation to midbrain DA neurons. FGF-8b induced neurons did not have electrophysiological

00 ₂ 69113

characteristics of mature neurons. Therefore, cocultured cells from 3-week old

FGF-8b supported cultures with the glioblastoma cell line, U-87, and FGF-8b for an additional 2-3 weeks.

Neurons acquired a more mature morphology with increased cell size and number, length and complexity of the neurites, and acquired electrophysiological characteristics of mature neurons (a transient inward current, blocked reversibly by 1 uM tetrodotoxin (TTX) together with the transient time course and the voltage- dependent activation of the inward current is typical for voltage-activated sodium currents, found only in mature neurons). When hMASC (n=13) were cultured with 10 ng/m brain-derived neurotrophic factor (BDNF) + EGF, differentiation was to exclusively DOPA, TH ₅ DCC, DTP and Nurrl positive neurons. Although BDNF supports neural differentiation from ES cells and NSC (Peault, 1996; Choi et al. 1998), no studies have shown exclusive differentiation to DA-like neurons. Similar results were seen for mMASC induced with bFGF and rMASC with bFGF and BDNF. Further studies on MASC-derived neuronal cells are presented in Example 10. MASC Differentiation into Endothelial Cells

As an example of mesoderm, differentiation was induced to endothelium. Undifferentiated mMASC or rMASC did not express the endothelial markers CD31 , CD62E, Tek or vWF, but expressed low levels of Flkl . mMASC or rMASC were cultured in FN-coated wells with 10 ng/mL of the endothelial differentiation factor VEGF-B. Following treatment with VEGF for 14 days, >90% of MASC, irrespective of the number of PDs they had undergone, expressed Fltl, CD31, vWF or CD62, consistent with endothelial differentiation. Like primary endothelial cells, MASC-derived endothelial cells formed vascular tubes within 6 hours after replating in Matrigel™.

Similarly, hMASC express Flkl and Fltl but not CD34, Mucl8 (P1H12), PECAM, E- and P-selectin, CD36, or Tie/Tek. When hMASC 2xlO ⁴ cells/cm ² were cultured in serum free medium with 20 ng/mL vascular endothelial growth factor (VEGF), cells expressed CD34, VE-cadherin, VCAM and Muc-18 from day 7 on. On day 14, they also expressed Tie, Tek, Flkl and Fltl, PECAM, P-selectin and E- selectin, CD36, vWF, and connexin-40. Furthermore, cells could uptake low-

00269113

density lipoproteins (LDL). Results from the histochemical staining were confirmed by Western blot. To induce vascular tube formation, MASC cultured for 14 days with VEGF were replated on Matrigel™ with 10 ng/mL VEGF-B for 6h. Endothelial differentiation was not seen when hMASC cultured in >2% FCS were used. In addition, when FCS was left in the media during differentiation, no endothelial cells were generated.

At least 1000-fold expansion was obtained when hMASC were sub-cultured, suggesting that endothelial precursors generated from hMASC continue to have significant proliferative potential. Cell expansion was even greater when FCS was added to the cultures after day 7.

When hMASC derived endothelial cells were administered intravenously (I. V.) in NOD-SCI mice who have a human colon-carcinoma implanted under the skin, contribution of the human endothelial cells could be seen to the neovascularization in the tumors. It may therefore be possible to incorporate genetically modified endothelial cells to derive a therapeutic benefit, i.e., to inhibit angiogenesis in for example cancer or to promote it to enhance vascularization in limbs or other organs such as the heart. Further studies on MASC-derived endothelial cells are presented in Example 9. MASC Differentiation into Endoderm Whether mMASC or rMASC could differentiate to endodermal cells was tested. A number of different culture conditions were tested including culture with the diffentiation factors keratinocyte growth factor (KGF), hepatocyte growth factor (HGF) and FGF-4, either on laminin, collagen, FN or Matrigel™ coated wells. When re-plated on Matrigel™ with 10 ng/mL FGF4 + 10 ng/mL HGF, approximately 70% of MASC acquired morphologic and phenotypic characteristics of hepatocyte-like cells. Cells became epithelioid, approximately 10% of cells became binucleated, and about 70% of cells stained positive for albumin, cytokeratin (CK)-18, and HNF-IP.

Endodermal-like cells generated in FGF4 and HGF containing cultures also had functional characteristics of hepatocytes, determined by measuring urea levels in supernatants of undifferentiated MASC and FGF4 and HGF-induced MASC using the Sigma Urea Nitrogen Kit 640 according to the manufacturer's recommendations.. No urea was detected in undifferentiated MASC cultures. Urea production was 10

00269113

μg/cell/hr 14 days after adding FGF4 and HGF and remained detectable at similar levels until day 25. This is comparable to primary rat hepatocytes grown in monolayer. Presence of albumin together with urea production supports the notion of hepatic differentiation from MASC in vitro. Further studies on MASC-derived hepatocytes are presented in Example 11.

Given the likely existence of an endodermal lineage precursor cell, MASC likely give rise to a cell that forms various cells in the liver in the pancreas both exocrine and endocrine components and other endodermal derived cell tissue lineages. MASC derived from muscle or brain were induced to differentiate to

^' mesoderm (endothelial cells), neuroectoderm (astrocytes and neurons) and endoderm (hepatocyte-like cells) using the methods described above forBM-derived MASC. Transduction To demonstrate that differentiated cells were single cell derived and MASC are indeed "clonal" multipotent cells, cultures were made in which MASC had been transduced with a retroviral vector and undifferentiated cells and their progeny were found to have the retrovirus inserted in the same site in the genome.

Studies were done using two independently derived ROSA26 MASC, two C57BL/6 MASC and one rMASC population expanded for 40 to >90PDs, as well as with the eGFP transduced "clonal" mouse and "clonal" rMASC. No differences were seen between eGFP transduced and untransduced cells. Of note, eGFP expression persisted in differentiated MASC.

Specifically, murine and rat BMMNC cultured on FN with EGF ₅ PDGF-BB and LIF for three weeks were transduced on two sequential days with an eGFP oncoretroviral vector. Afterwards, CD45 ⁺ and GIyA ⁺ cells were depleted and cells sub-cultured at 10 cells/well. eGFP-transduced rat BMMNC were expanded for 85 PDs. Alternatively, mouse MASC expanded for 80 PDS were used. Subcultures of undifferentiated MASC were generated by plating 100 MASC from cultures maintained for 75 PDs and re-expanding them to > 5xlO ⁶ cells. Expanded MASC were induced to differentiate in vitro to endothelium, neuroectoderm and endodeπn. Lineage differentiation was shown by staining with antibodies specific for these cell types, as described in Example 4.

00269113

Single cell origin of mesodermal and neuroectodermal progeny

To prove single cell origin of mesodermal and neuroectodermal differentiated progeny retroviral marking was used (Jordan et ah, 1990; Nolta et al., 1996). A fraction of hMASC obtained after 20 PDs was transduced with an MFG- eGFP retrovirus. eGFP ⁺ hMASC were diluted in non-transduced MASC from the same donors to obtain a final concentration of ~5% transduced cells. These mixtures were plated at 100 cells/well and culture expanded until >2xlO ⁷ cells were obtained. 5x10 ⁶ MASC each were induced to differentiate to skeletal myoblasts, endothelium and neuroectodermal lineages. After 14 days under differentiation conditions, cells were harvested and used to identify the retroviral integration site and co-expression of eGFP and neuroectodermal, muscle and endothelial markers.

For myoblast differentiation, hMASC were plated at 2x10 ⁴ cells/cm ² in 2% FCS, EGF and PDGF containing expansion medium and treated with 3 μM 5- azacytidine in the same medium for 24h. Afterwards, cells were maintained in expansion medium with 2% FCS, EGF and PDGF-BB. For endothelial differentiation, hMASC were replated at 2xlO ⁴ cells/cm ² in serum-free expansion medium without EGF and PDGF but with 10 ng/ml VEGF-B for 14 days.

Immunofluorescence evaluation showed that 5-10% of cells in cultures induced to differentiate with 5-azacytidine stained positive for eGFP and skeletal actin, 5-10% of cells induced to differentiate to endothelium costained for eGFP and vWF, and 5-10% of cells induced to differentiate to neuroectoderm costained for eGFP and either NF-200, GFAP or MBP. To define the retroviral insertion site, the host genomic flanking region in MASC and differentiated progeny was sequenced. The number of retroviral inserts in the different populations was between one and seven. As shown in Table 2, a single, identical sequence flanking the retroviral insert in muscle* endothelium and neuroectodermal cells in population Al 6 that mapped to chromosome 7 was identified.

00269113

Table 2: Single cell origin of endothelium, muscle and neuroectodermal cells

Primers specific for the 3' LTR were designed and for the flanking genomic sequence are shown in Table 3 and using Real-time PCR, it was confirmed mat the retroviral insert site was identical in undifferentiated and differentiated cells. These results proved that the flanking sequence and the eGFP DNA sequence was present in similar quantities. Clone A12 contained two retroviral inserts, located on chromosome 1 and 7 respectively, and both flanking sequences could be detected not only in hMASC but also muscle, endothelium and neuroectodermal lineages. To determine whether this represented progeny of a single cell with two retroviral integrants or progeny of two cells, Real-Time PCR was used to compare the relative amount of the chromosome 1 and 7 flanking sequence to eGFP. It was found that similar amounts of both flanking regions were present in hMASC, muscle, endothelium and neuroectodermal cells, suggesting that a single cell with two retroviral inserts was likely responsible for the eGFP positive hMASC and differentiated progeny. In the other populations containing 3 or more retroviral

00269U3

inserts we were not able to determine whether the inserts were due to multiple insertion sites in a single cells or multiple cells contributing to the eGFP positive fraction. Nevertheless, our finding that in 2 populations, progeny differentiated into muscle, endothelium and neuroectoderm are derived from a single BM derived progenitor cell definitively proves for the first time that primitive cells can be cultured from BM that differentiate at the single cell level in cells of mesodermal lineage as well as the three different lineages of the neuroectoderm. Table 3: Flanking regions and primers

Clone Genomic sequence

Rat flanking GATCCTTGGGAGGGTCTCCTCAGATTGATTGACTGCCCACCT sequence CGGGGGTCTTTCAAAGTAACTCCAAAAGAAGAATGGGTTGTTAGTTAT

TAAACGGTTCh-AGTAAAGTTTTGGTITTGGGAATCACAGTAACAACT

CACATCACAACTCCAATCGTTCCGTGAAA

Mouse flanking GATCCTTGGGAGGGTCTCCTCAGATTGATTGACTGCCCATAAGTTA sequence TAAGCTGGCATGACTGTGTrGCrA4GGΛCΛCroGrα4AiσC

Bold: MSCV LTR; Bold and underlined: MSCV LTR primer used for Q-PCR Italics and underlined: Flanking sequence primers used for Q-PCR.

Example 6. Homing and Engraftment of Mammalian MASC into Numerous Organs in the Body mMASC were tested to determine whether they had the ability to engraft and differentiate in vivo into tissue specific cells. mMASC were grown as described in Example 1 from a LacZ transgenic C57 Black 6, ROSA 26 mouse. 10 ⁶ mMASC from the LacZ mouse were LV. injected into NOD-SCED mice tail veins with or without 250 Rads of total body radiation 4-6 hrs prior to the injection. The animals were sacrificed by cervical dislocation at 4-24 weeks after the injections. Tissue Harvest

Blood and bone marrow: 0.5-1 ml of blood was obtained at the time animals were sacrificed. BM was collected by flushing femurs and tibias. For phenotyping, red cells in blood and BM were depleted using ice cold ammonium chloride (Stem Cell Technologies Inc., Vancouver, Canada) and 10 ⁵ cells used for cytospin centrifugation. For serial transplantation, 5x10 ⁷ cells from 2 femurs and 2 tibias were transplanted into individual secondary recipients via tail vein injection. Secondary recipients were sacrificed after 7-10 weeks.

00269113

Solid organs: Lungs were inflated with 1 ml 1:4 dilution of OCT compound

(Sakura-Finetek Inc, USA) in PBS. Specimens of spleen, liver, lung, intestine, skeletal muscle, myocardium, kidney and brain of the recipient animals were harvested and cryopreserved in OCT at -80 ⁰ C and in RNA Later (Ambion Inc., Austin, TX, USA) at -20 ⁰ C for quantitative PCR. mMASC engraft and differentiate in tissue specific cells in vivo

Engraftment of the β-gal/neomycin (NEO) transgene-containing cells (Zambrowicz et ah, 1997) was tested by immunohistochemistry for β-gal and by Q- PCR for NEO. Immunohistochemistry and Q-PCR were performed as described in Examples 5 and 1 respectively. Primers are listed in Table 1.

Engraftment, defined as detection of >1% anti-β-gal cells, was seen in hematopoietic tissues (blood, BM and spleen) as well as epithelium of lung, liver, and intestine of all recipient animals as shown in Table 4 and Fig. 4.

Table 4: Engraftment levels in NOD-SCID mice transplanted with ROSA26

MASC.

00269113

β-gaf cells in BM (Fig. 4B-F) and spleen (Fig. 4H-I) co-labeled with anti-

CD45, anti-CD19, anti-Macl, anti-Grl and anti-TERl 19 Abs. Similar results were seen for peripheral blood. Of note, no β-gal ⁺ CD3 ⁺ T cells were seen in either blood, BM or spleen even though β-gal ⁺ CD3 ⁺ T-cells were seen in chimeric mice. The reason for this is currently not known.

Engraftment in the spleen occurred mostly as clusters of donor cells, consistent with the hypothesis that when MASC home to the spleen, they proliferate locally and differentiate to form a colony of donor cells, similar to CFU-S. It is not believed that differentiation of mMASC into hematopoietic cells in vivo can by attributed to contamination of the mMASC with HSC. First, BMMNC are depleted of CD45 cells by column selection before mMASC cultures are initiated. Second, early mesodermal or hematopoietic transcription factors, including brachyury (Robertson et aL, 2000), GATA-2 and GATA-I (Weiss et aL, 1995), are not expressed in undifferentiated mMASC, as shown by cDNA array analysis. Third, the culture conditions used for mMASC are not supportive for HCS. Fourth all attempts at inducing hematopoietic differentiation from hMASC in vitro, by co- culturing hMASC with hematopoietic supportive feeders and cytokines, have been unsuccessful (Reyes et aL, 2001).

Significant levels of mMASC engraftment were also seen in liver, intestine and lung. Triple-color immunohistochemistry was used to identify epithelial (CK ⁺ ) and hematopoietic (CD45*) cells in the same tissue sections of the liver, intestine and lung. In the liver, β-gal ⁺ donor-derived cells formed cords of hepatocytes (CK18 ⁺ CD45 ⁺ or albumin ¹ ), occupying about 5-10% of a given 5μm section (Fig. 4K-M). Several CKl 8 ⁺ CD45 ⁺ β-gal ^* hematopoietic cells of recipient origin were distinctly identified from the epithelial cells. Albumin ⁺ β-gal ⁺ and CKl 8 ⁺ β-gal ⁺ cells engrafted in cords of hepatocytes surrounding portal tracts, a pattern seen in hepatic regeneration from hepatic stem cells and oval cells (Alison et aL, 1998; Petersen et aL, 1999). This and the fact that only 5/20 sections contained donor cells, is consistent with the notion that stem cells engraft in some but not all areas of the liver, where they proliferate and differentiate into hepatocytes.

Engraftment in the intestine was also consistent with what is known about intestinal epithelial stem cells. In the gut, each crypt contains a population of 4-5 long-lived stem cells (Potten, 1998). Progeny of these stem cells undergo several

002691 i3

rounds of division in the middle and upper portions of cypts and give rise to epithelial cells that migrate upwards, out of the crypt, onto adjacent villi. Donor derived, β-gal ⁺ panCK ⁺ CD45 ^" epithelial cells entirely covered several villi (Fig.40- P). In some villi, β-gafpanCK ⁺ CD45 ^" cells constituted only 50% of the circumference (solid arrows, Fig. 4P) suggesting engraftment in one but not both crypts. Several β-gal ⁺ panCK ^" cells were distinctly seen in the core of intestinal villi (open arrow, Fig.40). These cells co-stained for CD45 (Fig.4P), indicating that they were donor-derived hematopoietic cells. In the lung, the majority of donor cells gave rise to β-gal ⁺ panCK ⁺ CD45 ^" alveolar epithelial cells whereas, most hematopoietic cells were of recipient-origin (panCK ^" CD45 ⁺ β-gal ^" ) (Fig.4R).

Levels of engraftment detected by immunohistochemistry were concordant with levels determined by Q-PCR for NEO (Table 4). Engraftment levels were similar in animals analyzed after 4 to 24 weeks following LV. injection of MASC (Table 4). No contribution was seen to skeletal or cardiac muscle. In contrast to epithelial tissues and the hematopoietic system, little to no cell turnover is seen in skeletal or cardiac muscle in the absence of tissue injury. Therefore, one may not expect significant contribution of stem cells to these tissues. However, engraftment was not found in skin and kidney, two organs in which epithelial cells undergo rapid turnover. It is shown in the blastocyst injection experiments (Example 8) that mMASC can differentiate into these cell types; one possible explanation for the lack of engraftment in these organs in post-natal recipients is that mMASC do not home to these organs, a hypothesis that is currently being evaluated. Although mMASC differentiated into neuroectoderm-like cells ex vivo, no significant engraftment of mMASC was seen in the brain, and rare donor cells found in the brain did not co- label with neuroectodermal markers. Two recent publications demonstrated that donor derived cells with neuroectodermal characteristics can be detected in the brain of animals that underwent BM transplantation. However, a fully ablative preparative regimen prior to transplantation or transplantation in newborn animals was used, conditions associated with break-down of the blood-brain barrier. Cells were infused in non-irradiated adult animals, or animals treated with low dose radiation, where the blood-brain barrier is intact or only minimally damaged. This may explain the lack of mMASC engraftment in the CNS.

- ^* 00269113

Confluent MASCdo not differentiate in vivo

As control, ROSA26-MASC were infused and grown to confluence prior injection. MASC allowed to become confluent lose their ability to differentiate ex vivo in cells outside of the mesoderm, and behave like classical MSC (Reyes, M. et α/.2001). Infusion of 10 ⁶ confluent mMASC did not yield significant levels of donor cell engraftment. Although few β-gal ⁺ cells were seen in BM, these cells did not co-label with anti-CD45 Abs, indicating that MSC may engraft in tissues, but are no longer able to differentiate into tissue specific cells in response to local cues. MASC derived cells in bone marrow of mice can be serially transferred BM from mouse engrafted with ROS A26 MASC was tested to determine whether they contained cells that would engraft in secondary recipients. 1.5xlO ⁷ BM cells, recovered from primary recipients 11 weeks after LV. infusion of mMASC, were transferred to secondary irradiated NOD-SCID recipients (Table 4: animal SR-I and SR-2). After 7 and 10 weeks, secondary recipients were sacrificed, and blood, BM, spleen, liver, lung and intestines of the recipient animal were analyzed for engraftment of ROSA26 donor cells by immunohistochemistry and Q- PCR for the NEO gene. A similar pattern of engraftment was seen in secondary recipients as in the primary recipients. Four-8% of BM, spleen and PB cells were β- gal ⁺ CD45 ⁺ ; six and 8% of intestinal epithelial cells were β-ga^pan-CK*, and 4 and 5% of lung epithelial cells were β-gal ⁺ pan-CK ⁺ . Levels of engraftment in the liver of secondary recipients were lower than in the primary recipients (1 and 3% vs. 5 and 8% β-gal ⁺ CKl δ ⁴ ). This suggests that mMASC may persist in the BM of the primary recipient and differentiate into hematopoietic cells as well as epithelial cells when transferred to a second recipient. MASC derived cells can produce insulin in vivo. MASC from ROSA26 mice were injected into irradiated NOD-SCID mice as described herein. The resulting MASC derived cells co-stain for LacZ and insulin in a model of streptozotocin-induced diabetes. Summary One of the critical questions in "stem cell plasticity" is whether the engrafted and differentiated donor mMASC are functional. The results described herein show that one animal developed a lymphoma in thymus and spleen after lδ weeks, as is commonly see in aging NOD-SCID mice (Prochazka et al, 1992). Phenotypic

00269113

analysis showed that this B-cell lymphoma was host-derived: CDl 9 ⁺ cells were β- gal ^" . Approximately 40% of CD45VWF ⁺ cells in the vasculasture of the tumor stained with anti- β-gal Abs, indicating that neoangiogenesis in the tumor was in part derived from donor mMASC (Fig. 4T). This suggests that MASC give rise to functioning progeny in vivo. Likewise, higher levels of mMASC engraftment and differentiation in radiosensitive organs, such as the hematopoietic system and intestinal epithelium (Table 4, p<0.001), following low dose irradiation suggests that mMASC may contribute functionally to host tissues.

These results showed that mammalian MASC can be purified, expanded ex vivo, and infused I.V., homed to various sites in the body, engraft into numerous organs, and that the cells are alive in these various organs one month or longer. Such donor cells, undifferentiated, and differentiated progeny are found, by virtue of the fluorescent marker, in organs including, but not limited to, the BM, spleen, liver and lung. These cells can be used to repopulate one or more compartments) to augment or restore cell or organ function.

Example 7. Demonstration of in vitro Hematopoiesis and Erythropoiesis

MASC from, human BM differentiate at the single cell level into neuroectodermal, endodermal and many mesodermal lineages, including endothelial cells. Because endothelium and blood are very closely related in ontogeny, it can be hypothesized that MASC can differentiate into hematopoietic cells. eGFP transduced human MASC, that are GIyA, CD45 and CD34 negative (n=20), were cocultured with the mouse yolk sac mesodermal cell line, YSM5, as suspension cell aggregates for 6 days in serum free medium supplemented with 10 ng/mL bFGF and VEGF. After six days, only eGFP ⁺ cells (i.e., MASC progeny) remained and YSM5 cells had died.

Remaining cells were transferred to methylcellulose cultures containing 10% fetal calf serum supplemented with 10 ng/mL bone mόrphogenic protein (BMP)4, VEGF, bFGF, stem cell factor (SCF), Flt3L, hyper IL6, thrombopoietin (TPO), and erythropoietin (EPO) for 2 weeks. In these cultures, both adherent eGFP ⁺ cells and small, round non-adherent cells, which formed many colonies attached to the adherent cells were detected. The non- adherent and adherent fractions were collected separately and cultured in 10%FCS containing medium with 10 ng/mL VEGF and bFGF for 7 days. Adherent cells stained positive for vWF, formed

00269113

vascular tubes when plated on ECM, and were able to uptake a-LDL, indicating their endothelial nature. 5-50% of the non-adherent cells stained positive for human specific GIyA and HLA-class I by flow cytometry. GIy-A ⁺ ZHLA-CIaSS-I ⁺ cells were selected by FACS. On Wright -Giemsa, these cells exhibited the characteristic morphology and staining pattern of primitive erythroblasts. Cells were benzidine ⁺ and human Hb ⁺ by immunoperoxidase. By RT-PCR these cells expressed human specific Hb-e, but not Hb-a.

When replated in methylcellulose assay with 20%FCS and EPO, small erythroid colonies were seen after 10 days, and 100% of these colonies stained positive for human specific GIyA and Hb. As selection of MASC depends on the depletion of CD45 ⁺ and GIy A ⁺ cells from BM, and cultured MASC are CD45 ^" and GIyA ^" at all times examined using both FACS and cDNA array analysis, contamination of MASC with hematopoietic cells is very unlikely.

Example 8. In vivo proof of the Multipotent Nature of MASC as Shown by Multiple Organ Chimerism following Blastocyst Injections of the Cells

Important for therapeutic applications of these cells is the ability of MASC to proliferate and differentiate into the appropriate cell types in vivo. Up until this point the only cells that should be capable of contributing to the full constellation of tissues and organs in the body are ES cells. In order to analyze whether MASC could show the full capability of ES cells, they were assayed to determine their contribution to the formation of various tissues by introducing them into the early blastocyst and observing the fate of their progeny.

MASC were generated from marrow of ROSA26 mice that are transgenic for the β-galactosidase (β-gal) gene (Rafii, S., et al. 1994, Blood. 84:10-13) and expanded as described in Example 1. One or 10-12 ROSA26 MASC obtained after 55-65 PDs were microinjected into 88 and 403.5-day C57BL/6 blastocysts, respectively. Blastocysts (8/mother) were transferred to 16 foster mothers and mice allowed to develop and be born as shown in Table 5.

00269113

Table 5: Degree of chimerism following MASC injection in blastocyst

MASC/ Litters Total # NEO oositive bv O-PCR blastocyst born pups born

0% 1-10% 10-20% 20-40% >40%

10-12 4/π 22 5/22 13/22 2/22 1/22 1/22 (23%) (59%) (9%) (4.5%) (4.5%) 1 3/5 15 8/15 5/15 0/15 0/15 2/15 (53%) (33%) (0%) (0%) (13%)

Seven litters were born, in line with the birth rate seen in other studies during this period. The number of mice per litter varied between 1 and 8, for a total of 37 mice. Animals born from microinjected blastocysts were of similar size as normal animals and did not display any overt abnormalities.

After four weeks, animals were evaluated for chimerism by clipping their tails and assessing the contribution of β-gal/NEO transgene containing cells to the tails by Q-PCR for NEO. Percent chimerism was determined by comparing the number of NEO copies in test samples with that in tissue from ROSA26 mice according to manufacturer's recommendations (7700 ABI PRISM Detector Software 1.6). Chimerism could be detected in 70% of mice derived from blastocysts in which 10 to 12 MASC had been injected and 50% of mice derived from blastocysts microinjected with 1 MASC (Table 5). The degree of chimerism ranged between 0.1 % to >45%. After 6 to 20 weeks, animals were sacrificed. Some mice were frozen in liquid nitrogen and thin sections were cut as described. Whole-mouse sections were stained with X-GaI. One thousand sets of digital images covering completely each section were then assembled to create a composite image of each whole-mouse section. In a representative non-chimeric animal (by Q-PCR for NEO) derived from a blastocyst in which a single MASC was injected, no X-GaI staining was seen. In contrast, the animal was 45% chimeric by R-PCR for NEO by tail clip analysis and had contribution of a single ROSA26-derived MASC to all somatic tissues.

For other animals, multiple organs were harvested and analyzed for the presence of MASC derived cells by X-GAL staining, staining with an anti-β-gal- FITC antibody, and Q-PCR for NEO. Animals that had NEO ⁺ cells in tail-clippings had contribution of the ROSA26-derived MASC in all tissues, including the brain,

00269113

retina, lung, cardiac and skeletal muscle, liver, intestine, kidney, spleen, BM, blood, and skin as shown by X-GAL staining and staining with an anti-β-gal-FITC antibody.

Chimerism was detected by X-GaI staining and anti-β-gal staining in the animals generated from blastocysts microinjected with ROSA26 MASC. β-gal ⁺ cells expressed markers typical for the tissue in which they had incorporated. β-gal ⁺ cells co-stained with anti-β-gal ⁺ FITC and anti-NF200 or GFAP and TOPRO3 - (observed at 2OX magnification)for NF200 and GFAP in the central nervous system and for dystrophin in the skeletal muscle. Lung tissue was stained for anti-β-gal- FITC and ρan-CK in alveoli and bronchi (also TOPRO3) (observed at 2OX magnification). Skeletal muscle was stained with anti-β-gal-FITC, dystrophin-PE, and TOPRO3 was observed at 2OX magnification. Heart was stained with anti-β- gal-FITC and cardiac troponin-I-Cy3, TOPRO3 was observed at 2OX magnification. Liver was stained with anti-β-gal-FITC and pan-CK-PE and TOPRO3 (was observed with 4OX magnification and 1OX magnification). Intestine was stained with anti-β-gal-FITC, pan-CK-PE, and TOPR03 was observed at 2OX magnification. Kidney was stained with anti-β-gal-FITC (glomerulus, tubulus) was observed at 2OX magnification. Marrow staining was observed with anti-β-gal-FITC and CD45-PE, GRl-PE and MACl-PE. Spleen staining was observed with anti-β-gal-FITC and CD45-PE, CD3-PE and CD 19-PE. Levels of engraftment estimated by Q-PCR for NEO Were concordant with those estimated by X-GAL and anti-β-gal-FITC staining. Summary

These data demonstrate for the first time that BM derived single MASC integrate into the developing mouse, giving rise to cells of various fates, and contributing to the generation of all tissues and organs of the three germ layers of the mouse. As all live animals, irrespective of the degree of chimerism, had normal functioning organs, these studies also suggest that MASC can differentiate in vivo in functional cells of the three germ layers. Whether MASC contribute to germ cells, when injected in a blastocyst or when injected postnatally, has not yet been tested.

Example 9. Origin of Endothelial Progenitors

Vasculogenesis, the in situ differentiation of primitive endothelial progenitors, termed angioblasts, into endothelial cells that aggregate into a primary

00 ₂ 69I13

capillary plexus is responsible for the development of the vascular system during embryogenesis (Hirashima et al, 1999). In contrast, angiogenesis, defined as the formation of new blood vessels by a process of sprouting from preexisting vessels, occurs both during development and in postnatal life (Holash et al, 1999; Yang et al, 2001). Until recently, it was thought that blood vessel formation in post-natal life was mediated by sprouting of endothelial cells from existing vessels. However, recent studies have suggested that endothelial "stem cells" may persist into adult life, where they contribute to the formation of new blood vessels (Peichev et al, 2000; Lin et al, 2000; Gehling et al, 2000; Asahara et al, 1997; Shi et al, 1998), suggesting that like during development neoangiogenesis in the adult may at least in part depend on a process of vasculogenesis. Precursors for endothelial cells have been isolated from BM and peripheral blood (Peichev et al, 2000; Watt et al., 1995). The ontogeny of these endothelial progenitors is unknown.

During development, endothelial cells are derived from mesoderm. The VEGF receptor 2, Flkl , characterizes the hemangioblasts, a bipotent stem cell found in the aorto-gonad-mesonephros region (Medvinsky et ah, 1996; Fong et al., 1999; Peault, 1996) and in fetal liver (Fong et al., 1999), and commitment of embryoid bodies to hemangioblasts is accompanied with expression of Flkl (Choi et al., 1998; Choi, 1998). Whether hemangioblasts persist in adult life is not known, and only HSC and endothelial progenitors have,been documented. Like hemangioblasts, endothelial progenitors express Flkl (Peichev et al., 2000) and one report suggested that HSC in post-natal life express Flkl (Ziegler et al., 1999). During embryology, commitment of the hemangioblast to the endothelial lineage is characterized by the sequential expression of VE-cadherin, CD31, and shortly afterwards CD34 (Nishikawa et al, 1998; Yamashita et al, 2000). In post-natal life, endothelial progenitors have been selected from BM and blood using Abs against ACl 33, Flkl, CD34, and the H1P12 Ab (Peichev et al, 2000; Lin et al, 2000; Gehling et al, 2000). AC133 has also been found on other cells, including NSCs (Uchida et al, 2000) and gastrointestinal epithelial cells (Corbeil et al, 2000). Upon differentiation to mature endothelium, the AC 133 receptor is quickly lost (Peichev et al, 2000; Gehling et al, 2000). Another receptor found on circulating endothelial cells is a mucin, MUCl 8, recognized by the H1P12 Ab (Lin et al, 2000). MUCl 8 is lost upon differentiation of endothelial progenitors to endothelium. CD34 is

00269113

expressed on endothelial progenitors, as well as on hematopoietic progenitors

(Peichev et al., 2000; Baumhueter et al., 1994) and hepatic oval cells (Crosby et al., 2001). This antigen is also lost upon differentiation of endothelial progenitors to endothelium. Most mature endothelial cells, but microvascular endothelial cells, no longer express CD34.

It is described here for the first time, the in vitro generation of vast numbers of endothelial cells that engraft in vivo and contribute to neoangiogenesis from a MASC. MASC can be culture expanded for >80 PDs and endothelial cells generated from MASC can be expanded for at least and additional 20 PDs. MASC may therefore be an ideal source of endothelial cells for clinical therapies. In addition, as MASC are ontogenically less mature than the "angioblast", this model should be useful to characterize endothelial commitment and differentiation. hMASC differentiate into cells with phenotypic characteristics of endothelium

MASC were obtained and cultured as described in Example 3. To induce endothelial differentiation, MASC were replated at 2x10 ⁴ cells/cm ² in FN-coated wells in serum-free expansion medium without EGF and PDGF-BB but with 10 ng/mL VEGF. In some instances, FCS was added. Cultures were maintained by media exchange every 4-5 days. In some instances, cells were subcultured after day 9 at a 1 :4 dilution under the same culture conditions for 20+ PDs. In order to define endothelial differentiation from MASC more extensively,

FACS and immunohistochemical analysis of cells after 3-18 days was performed. Expression of Flkl and Fltl on undifferentiated MASC was low, was maximal at day 9, and persisted until day 18. VE-cadherin, present on BM or blood endothelial progenitors (Peichev et al., 2000; Nishikawa et al., 1998), was not expressed on undifferentiated MASC, but was expressed after 3 days of culture with VEGF and persisted until day 18. MASC expressed low levels of ACl 33, found on endothelial as well as hematopoietic progenitors (Peichev et al., 2000; Gehling et al., 2000) but was no longer detectable after day 3. CD34, present on endothelial and hematopoietic progenitors (Peichev et al., 2000; Asahara et al., 1997; Rafii et al., 1994), was not present on undifferentiated MASC (Fig.4A) but was expressed from day 9 until day 18. The mucin, MUC 18, recognized by the Ab H1P12 has been used to purify endothelial progenitors from blood (Lin et al., 2000). Although MASC did

0026911S

not stain with H1P12 MASC treated with VEGF for 9 days stained positive, but expression was lost by day 18.

The endothelium specific integrin, αvβ3, (Eliceiri et al, 2000) was not present on undifferentiated MASC, whereas αvβ5 was expressed at very low levels. Expression of integrins increased progressively during differentiation and was maximal by day 14 (Fig. 5). The tyrosine kinase receptors, Tie and Tek, important for angiogenesis but not endothelial cell differentiation (Partanen et al, 1999), were not expressed on MASC. Expression of Tek could be seen after day 3 and Tie after day 7 (Fig. 6). MASC also do not express vWF, but vWF was expressed from day 9 on (Rosenberg et al, 1998; Wagner et al, 1982). More mature endothelial markers, including CD31, CD36, CD62-P (Tedder et al, 1995) (Pig. 7), and the adhesion junction proteins ZO-I, β-catenin, and γ-catenin (Fig. 5) were detected after day 14 (Li et al., 1990; Van Rijen et al, 1997; Petzelbauer et al, 2000). VCAM or CD62- E were not expressed at high level at any time point during differentiation, unless endothelium was activated with IL- lα, as described below. Differentiation to endothelium was associated with acquisition of β2-microglobulin and low levels of HLA-class I antigens, but not HLA-class II.

It has been reported previously, that endothelial differentiation can only be obtained from MASC expanded with 2% FCS or less, but not when expanded with 10% FCS (Reyes et al, 2001) as higher concentrations of FCS supports growth of classical MSC that differentiate only into osteoblasts, chondroblasts and adipocytes (Reyes et al, 2001; Pittenger et al, 1999). When FCS was present during the initial 7 days of differentiation, endothelial differentiation could not be induced. When non-confluent MASC (≤lxlO ⁴ cells/cm ² ) were induced to differentiate, endothelial was not seen. When MASC were subcultured 9-days after exposure to VEGF using serum free medium with 10 ng/mL VEGF, cells could undergo at least an additional 12 PDs. When 10% FCS and 10 ng/mL VEGF was added to the medium for subculturing, MASC-derived endothelial cells could undergo an additional 20+ PDs, irrespective of the number of PDs that MASC had undergone. Compared with undifferentiated MASC, endothelial cells were larger, and had a lower nuclear/cytoplasm ratio. Results were similar when MASC were used from cultures that had undergone 20 (n=30) or 50+ (n=25) PDs.

00269113

Functional characteristics of MASC-derived endothelium

It was tested whether VEGF-induced differentiated progeny of hMASC had functional characteristics of endothelial cells. Endothelial cells respond to hypoxia by upregulating expression of VEGF as well as the VEGF receptors Flkl and the angiogenesis receptors, Tie-1 and Tek (Kourembanas et ah, 1998). hMASC and hMASC-derived endothelial cells were incubated at 37°C in 20% or 10% O ₂ for 24h. Cells were stained with Abs against Flkl, Fltl, Tek and IgG control, fixed in 2% paraformaldehyde and analyzed by flow cytometry. In addition, VEGF concentrations in the culture supernatants was measured using an ELISA kit (AP biotech, Piscataway, NJ). MASC-derived endothelial cells and undifferentiated MASC were exposed to hypoxic conditions for 24h.

Expression of Flkl and Tek was significantly increased on MASC-derived endothelial cells exposed to hypoxia (Fig. 7), while the levels of these receptors remained unchanged on undifferentiated MASC. In addition, levels of VEGF in culture supernatants of hypoxic endothelial cultures was increased by 4 fold (Fig. 7B) whereas VEGF levels in MASC cultures exposed to hypoxia remained unchanged.

It was next tested whether MASC-derived endothelial cells would upregulate expression of HLA-antigens and cell adhesion ligands in response to inflammatory cytokines, such as IL-lα (Meager, 1999; Steeber et al., 2001). 10 ⁶ MASC and MASC-derived endothelial cells were incubated with 75 ng/ml IL-lα (R&D Systems) in serum-free medium for 24h. Cells were fixed in 2% paraformaldehyde and stained with Abs against HLA-class I, class II, β2-microglobulin, vWF, CD31, VCAM, CD62E and CD62P, or control Abs, and analyzed using a FACScalibur (Becton Dickinson).

Significantly increased levels of HLA-Class I and II, β2-microglobulin, VCAM, ECAM, CD62E, CD62P were seen by FACS analysis (Fig. 7C) on endothelial cells. In contrast, on undifferentiated MASC only upregulation of FIk was seen. Another characteristic of endothelial cells is that they take up LDL

(Steinberg et ah, 1985). This was tested by incubating MASC induced to differentiate with VEGF for 2, 3, 5, 7, 9, 12 and 15 and 21 with LDL-dfracil. The dil- Ac-LDL staining kit was purchased from Biomedical Technologies (Stoughton,

00269113

MA). The assay was performed as per manufacture's recommendations. Cells were co-labeled either with anti-Tek, -Tie-1 or -vWF Abs. After 3 days, expression of Tek was detected but no uptake of a-LDL. After 7 days, cells expressed Tie-1, but did not take up significant amounts of a-LDL. However, acquisition of expression of vWF on day 9 was associated with uptake of aLDL (Fig. 6B).

Endothelial cells contain vWF stored in Weibel Pallade bodies that is released in vivo when endothelium is activated (Wagner et al., 1982). This can be induced in vitro by stimulating cells with histamine (Rosenberg et al., 1998), which also results in activation of the cell cytoskeleton (Vischer et al., 2000). MASC- derived endothelial cells were plated at high confluency (10 ⁴ cells/cm ² ) in FN-coated chamber slides. After 24h, cells were treated with 10 μM histamine (Sigma) in serum free medium for 25min. and stained with Abs against vWF and myosin. Untreated and treated cells were fixed with methanol at -20 ⁰ C for 2 min, stained with Abs against vWF and myosin, and analyzed using fluorescence and/or confocal microscopy. vWF was present throughout the cytoplasm of untreated endothelial cells. Cytoplasm of endothelial cells treated with histamine contained significantly less vWF and vWF was only detectable in the perinuclear region, likely representing vWF present in the endoplasmic reticulum (Fig.6A). Histamine treatment caused widening of gap junctions and cytoskeletal changes with increased numbers of myosin stress fibers (Fig. 6A).

Finally, endothelial cells were tested to determine if they could form "vascular tubes" when plated on Matrigel™ or extracellular matrix (ECM) (Haralabopoulos et al., 1997). 0.5 ml extracellular matrix (Sigma) was added per well of a 24 well plate, incubated for 3h at 37 ⁰ C. 10 ⁴ MASC and MASC-derived endothelial cells were added per well in 0.5 ml of serum free plus VEGF medium and incubated at 37°C. As shown in Fig. 6C, culture of MASC derived endothelial cells on ECM resulted in vascular tube formation within 6 hours. hMASC-derived endothelial cells contribute to tumor-angiogenesis in vivo

A breeding colony of NOD-SCID mice was established from mice obtained from the Jackson Laboratories (Bar Harbor, ME). Mice were kept in specific pathogen free conditions and maintained on acidified water and autoclaved food. Trimethoprim 60 mg and sulfamethoxazole 300 mg (Hoffrnann-La Roche Inc., Nutley, NJ) per 100 ml water was given twice weekly.

00269U3

Three Lewis lung carcinoma spheroids were implanted subcutaneously in the shoulder. 3 and 5 days after implantation of the tumor, mice were injected with 0.25xl0 ⁶ human MASC-derived endothelial cells or human foreskin fibroblasts via tail vein injection. After 14 days, animals were sacrificed, tumors removed and cryopreserved using OTC compound (Santura Finetek USA Inc, Torrance, CA) at - 80 ⁰ C. In addition, the ears that were clipped to tag the mouse were also removed and cryopreserved using OTC compound at -80 ⁰ C. Five μm thick sections of the tissues were mounted on glass slides and were fixed and stained as described below. Computer-aided analysis of length and number of branches counted on five sections of each tumor showed that tumors in mice that received human MASC- derived endothelial cells had a 1.45±0.04 fold greater vascular mass than tumors in control mice that did with anti-human-β2-microglobulin or HLA-Class I Abs, combined with anti-mouse-anti-CD31 Abs and anti-vWF, anti-Tek or anti-Tie- 1 Abs, which recognize both human and mouse endothelial cells. These initial studies showed that some blood vessels in the tumor contained anti-human-β2- microglobulin or HLA-Class I positive cells that co-labeled for either vWF, Tie or Tek, but not with mouse-CD31, indicating that human MASC-derived endothelial cells contributed to tumor neoangiogenesis in vivo.

To better address the degree of contribution, 35 sequential 5 μm slides were obtained and were stained in an alternate fashion with either anti-human β2- microglobulin-FITC or anti-mouse-CD31-Cy5 and anti-vWF-Cy3. All slides were examined by confocal microscopy. The different figures were then assembled in 3- D to determine the relative contribution of human and murine endothelial cells to the tumor vessels. When tumors obtained from animals injected with human-MASC derived endothelial cells were analyzed approximately 35% of the tumor vessels were positive for anti-human β2-microglobulin as well as vWF whereas approximately 40% of endothelial cells stained positive with anti-mouse CD31 Abs (Fig. 8A-G). Tumors in animals that did not receive endothelial cells or received human fibroblasts did not contain endothelial cells that stained positive with the anti-β2-microglobulin or anti-HLA-class-I Abs Abs.

MASC-derived endothelial cells were also analyzed whether they contribute to wound healing angiogenesis. The area of the ear that had been clipped to tag the mouse was then examined. Neoangiogenesis in the ear wounds was in part derived

00269113

from the MASC derived endothelial cells. Similar to blood vessels in the tumor the percent human endothelial cells present in the healed skin wound was 30-45% (Fig. 9H).

Undifferentiated hMASC differentiate in endothelial cells in vivo 10 ⁶ undifferentiated MASC were injected I. V. in 6-week old NOD-SCID mice. Animals were maintained for 12 weeks and then sacrificed. In one animal, a thymic tumor was detected, which is commonly seen in aging NOD-SCID mice (Prochazka et al., 1992).. The thymus was removed and cryopreserved in OTC compound at -80 ⁰ C. Ten μm thick sections of the tissues were mounted on glass slides and were fixed and stained as described below.

All hematopoietic cells stained positive for mouse CD45 but not human CD45, indicating that they were murine in origin. The tumor was then stained with an anti-human β2-microglobulin-FITC Ab and an anti-vWF-Cy3 Ab that recognizes both human and mouse endothelial cells. Approximately 12% of the vasculature was derived from hMASC (Fig. 91). These studies further confirmed that the hematopoietic elements were not of human origin, as no human β2-microglobulin was detected outside of the vascular structures. Immunohistochemistrv and Data Analysis

In vitro cultures: Undifferentiated MASC or MASC induced to differentiate to endothelium for 2-18 days, plated in FN coated chamber slides were fixed with 2% paraformaldehyde (Sigma) for 4 min at room temperature. For cytoskeleton staining chamber slides were fixed with methanol for 2 min at -20 ⁰ C. For intracellular ligands, cells were permeabilized with 0.1 Triton-X (Sigma) for lOmϊn and incubated sequentially for 30h in each with primary antibody (Ab), and FITC ₅ PE or Cy5 coupled anti-mouse-, goat- or rabbit-IgG Ab. Between each step, slides were washed with PBS+1%BSA. Primary Abs against CD31, CD34, CD36, CD44, HLA-class I and -II,β2-microglobulin were used at a 1:50 dilution. Primary Abs against VCAM, ICAM, VE-cadherin, selectins, HIP12, ZO-I, connexin-40, connexin-43, MUC18, a _v b ₃ , a _v bs, B-catenin and γ-catenin (Chemicon) and Tek, Tie, vWF (Santa Cruz) were used at a 1 :50 dilution. Stress fibers were stained with Abs against myosin (light chain 2OkD, clone no. MY-21 ; 1 :200). Secondary Abs were purchased from Sigma and used at the following dilutions: anti-goat IgG-Cy-3 (1:40), anti-goat IgG-FITC (1:160), anti-mouse IgG-Cy-3 (1:150) and anti-mouse

00269113

IgG-FITC (1:320), anti-rabbit-FITC (1:160) and anti-rabbit-Cy-3 (1:30). TOPRO-3 was purchased from Sigma. Cells were examined by fluorescence microscopy using a Zeiss Axϊovert scope (Carl Zeiss, Inc., Thomwood, NY) as well as by confocal fluorescence microscopy using a Confocal 1024 microscope (Olympus AX70, Olympus Optical Co. LTD, Japan).

Tumors or normal tissue: The tissue was sliced using a cryostat in 5-10 μm thick slices. Slices were fixed with acetone for 10 min at room temperature and permeabilized with 0.1 Triton X for 5 min. Slides were incubated overnight for vWF, Tie or Tek, followed by secondary incubation with FITC, PE or Cy5 coupled ahti-mouse-, goat- or rabbit-IgG Abs and sequential incubation with Abs against mouse CD45-PE or human CD45-FITC, human β2-microglobulin-FITC, mouse CD31-FITC or TOPRO-3 for 60min. Between each step, slides were washed with PBS + 1% BSA. Slides were examined by fluorescence microscopy using a Zeiss Axiovert scope as well as by confocal fluorescence microscopy using a Confocal 1024 microscope. 3D-reconstruction consisted of the collection of sequential 0.5 μm confocal photos from 35 slides of 5μm thick to a total of 350 photos. Slides were stained with vWF-Cy3 and alternately double stained with humanβ2- microglobulin-FITC or mouse CD31-FITC. The photos from each slide were aligned with the next slide in Metamorph software (Universal Imaging Corp) and the 3D reconstruction was made in 3D Doctor Software (Able software Corp).

Volume of relative contribution of human (green) and murine endothelial cells (false colored as blue) to the 3D vessel was calculated as cubic pixels of each color. The area of each color was also calculated as square pixels in 4 vessels through the 35 slides to obtain an accurate percentage of contribution. The area of each color was also calculated in alternate slides of four different tumors. Summary

The central finding of this study is that cells that co-purify with MSC from BM have the ability to differentiate to endothelial cells that have in vitro functional characteristics indistinguishable from mature endothelial cells. It is also showv that such endothelial cells contribute to neoangiogenesis in vivo in the setting of wound healing and tumorigenesis, and that undifferentiated MASC can respond to local cues in vivo to differentiate into endothelial cells contributing to tumor angiogenesis. As the same cell that differentiates to endothelium also differentiates to other

00269113

mesodermal cell types, as well as cells of non-mesodermal origin, the cell defined here precedes the angioblast, and even the hemangioblast in ontogeny.

It has also been shown that MASC differentiate into cells that express markers of endothelial cells, but proved mat VEGF induced MASC function like endothelial cells. Endothelial cells modify lipoproteins during transport in the artery wall (Adams et al., 2000). Endothelial cells maintain a permeability barrier through intercellular junctions that widen when exposed to hemodynamic forces or vasoactive agents, such as histamine (Rosenberg et al., 1998; Li et al., 1990; Van Rijen et ah, 1997; Vischer et al., 2000). Endothelial cells release prothrombotic molecules such as vWF, tissue factor, and plasminogen activator inhibitor to prevent bleeding (Vischer et al., 2000), and regulate egress of leukocytes by changing expression levels of adhesion molecules in response to inflammation (Meager, 1999; Steeber et al., 2001). Endothelium also reacts to hypoxia by producing VEGF and expressing VEGF receptor aimed at increasing vascular density (Kourembanas et ah, 1998). Therefore it has been demonstrated that endothelial cells generated from MASC can perform all of these tasks when tested in vitro.

Finally it has been proved that in vitro generated MASC-derived endothelial cells respond to angiogenic stimuli by migrating to the tumor site and contributing to tumor vascularization as well as wound healing in vivo. This finding confirms that endothelial cells generated from MASC have all the functional characteristics of mature endothelium. The degree of contribution of endothelial cells to tumor angiogenesis and neo-angiogenesis was 35-45%, levels similar to what has been described for other sources of endothelial cells (Conway et al., 2001; Ribatti et ah, 2001). In addition, it has been found that angiogenic stimuli in vivo provided in a tumor microenvironment are sufficient to recruit MASC to the tumor bed and induce their differentiation into endothelial cells that contribute to the tumor vasculature. These studies therefore extend studies reported by other groups demonstrating that cells present in marrow can contribute to new blood vessel formation (Peichev et al., 2000; Lϊn et al., 2000; Gehling et al., 2000; Asahara et al, 1997), in a process similar to vasculogenesis, precursor responsible for this process has been identified the. This is to our knowledge the first report that identifies a cell present in post¬ natal BM as a very early progenitor for endothelial cells.

00269113

Example 10. Derivation of Neurons

Single adult BM-derived hMASC or mMASC were tested to determine whether they can differentiate ex vivo to functional neurons, as well astrocytes and oligodendrocytes aside from mesodermal cell types. mMASC and hMASC were selected and culture expanded as previously described in Examples 1 and 3, respectively. Human neural progenitor cells (hNPC) were purchased from Clonetics (San Diego, CA). hNPC were cultured and differentiated per manufactures' recommendations.

Electrophysiology: Standard whole-cell patch-clamp recording was used to examine the physiological properties of MASC-derived neurons. Voltage-clamp and current-clamp recordings were obtained using a Dagan 3900A patch-clamp amplifier (Dagan Corporation, Minneapolis) which was retrofitted with a Dagan 3911 expander unit. Patch pipettes, made from borosilicate glass, were pulled on a Narishige pipette puller (model PP-83), and polished using a Narishige microforge (model MF-83). Patch pipettes were filled with an intracellular saline consisting of (in mM) 142.0 KF, 7.0 Na ₂ SO ₄ , 3.0 MgSO ₄ , 1.0 CaCl ₂ , 5.0 HEPES, 11.0 EGTA, 1.0 glutathione, 2.0 glucose, 1.0 ATP (magnesium salt), 0.5 GTP (sodium salt). For most recordings, the fluorescent dye 5,6-carboxyfluorescein (0.5 mm; Eastman Kodak Chemicals) was also added to the pipette solution to confirm visually, using fluorescence microscopy, that the whole-cell patch recording configuration had been achieved. Pipette resistances ranged from 11 to 24 Mohm. The standard extracellular recording saline was comprised of the following (in mM): 155 NaCl, 5.0 KCl, CaCl ₂ , 1.0 MgCl ₂ , 10 HEPES, ^glucose. For some experiments 1 μM TTX was added to the standard control solution. The pH of the intracellular and extracellular recording solutions was adjusted to 7.4 and 7.8, respectively, using NaOH. All chemicals were from Sigma. PClamp 8.0 (Axon Instruments, Foster City) was used to run experiments, and to collect and store data. The data presented were corrected for a 8.4 mV liquid junctional potential, which was calculated using the JPCALC software package. Off-line analyses and graphical representations of the data were constructed using Clampfit 8.0 (Axon Instruments, Foster City) and Prism (Graphpad, San Diego).

Transduction: Retroviral supernatant was produced by incubating MFG- eGFP-containing PG13 cells, provided by Dr. G.Wagemaker, U. of Rotterdam,

00269113

Netherlands (Bierhuϊzen et al., 1997), with MASC expansion medium for 48h, filtered and frozen at -80 ⁰ C, MASC were incubated with retroviral supernatants and 8 μg/ml protamine (Sigma) for 6h. This was repeated 24h later. Transduction efficiency was analyzed by FACS. Gene microarray analysis: RNA was isolated from hMASC, bFGF or FGF-

8b+EGF induced cells using the RNeasy mini kit (Qiagene), digested with DNase I (Promega) at 37°C for Ih and re-purified using the RNeasy. The [ ³² P] dATP labeled cDNA probe, generated according to the manufacturers recommendations, was hybridzed to the Human Neurobiology Atlas Array (Clonetech # 7736-1, Clonetech Laboratories, Palo Alto, CA ₃ USA) at 68°C for 18-2Oh, followed by 4 washes in 2x SSC, 1% SDS at 68°C for 30min each time, 0.1x SSC ₅ 0.5% SDS at 68°C for 30 min, and once in 2x SSC at room temperature for 5 min. The arrays were read by a phosphorimager screen scanner (Molecular Dynamics, Storm 860) and analyzed using Atlas Image 1.0 (Clontech). Differences between undifferentiated and differentiated cells greater than 2-fold were considered significant.

PCR analysis for retroviral insert: PCR was used o amplify the flanking sequence 3 ¹ from the 3' LTR of the MFG vector in the human genomic DNA. DNA from 10 ⁶ MASC or endothelial, myoblast or neuroectodermal differentiated progeny was prepared from cells by standard methods. 300 ng of genomic DNA was digested with Ascl and a splinkerette linker was Hgated to the 5' end (Devon R. S. et al., 1995). The two oligonucleotides used for the splinkerette linker were as follows: aattTAGCGGCCGCTTGAATTtttttttgcaaaaa, (the hairpin loop forming sequence is in lower case and the upper case is the reverse complement of the second splinkerette oligo), and agtgtgagtcacagtagtctcgcgttc gAATTAAGCGGCCGCTA, (the underlined sequence is also the sequence of the linker-specific primer (LS Primer) used for the PCR and RT steps). A 5'-biotin-T7 coupled primer was used that recognizes a sequence in the eGFP gene [Biotin-ggc- cag-tga-att-gta-ata-cga-ctc-act-ata-ggc-tgg-CAC-ATG-GTC-CTG- CTG-GAG-TTC- GTG-AC; underlined portion shows the minimum promoter sequence needed for efficient in vitro transcription and the upper case is the eGFP specific sequence] and LS primer to amplify the flanking regions for 10 rounds using Advantage 2 polymerase (Clontech). The biotin labeled amplified product was captured using streptavidin-magnetic beads (Streptavidin Magnetic Particles; Roche) and the

00269U3

resultant product was further amplified using the T7 RNA polymerase an approximately 1,000 fold and then DNAase 1 treated. The resultant product was reverse transcribed using the agtgtgagtcacagtagtctcgcgttc splinkerette primer according to the superscript II protocol (Gibco), and subsequently amplified by 30 rounds of nested PCR using the primer for the 3'LTR [ggc caa gaa cag atg gaa cag ctg aat atg]. The flanking sequence in the human genome from endothelium, muscle, and neuroectodermal differentiated cells and undifferentiated MASC was sequenced.

To demonstrate mat the same insertion site was present in multiple differentiated progeny, specific primers were generated in the host-flanking genome. Real time PCR amplification (ABI PRISM 7700, Perkin Elmer/Applied Biosystems) was used to quantitate the flanking sequence compared to the eGFP sequence. Reaction conditions for amplification were as follows: 40 cycles of a two step PCR (95°C for 15 sec, 60 ⁰ C for 60 sec) after initial denaturation (95°C for 10 min.) with 2 μl of DNA solution, IX TaqMan SYBR GreenUniversal Mix (Perkin Elmer/Applied Biosystems) PCR reaction buffer. Primers used were as follows: Clone A16: LTR primer = CCA-ATA-AAC-CCT-CTT-GCA-GTT-G; Flanking sequence chromosome 7 = TCC-TGC-CAC-CAG-AAA-TAA-CC; Clone A 12 chromosome 7 sequence: LTR primer = GGA-GGG-TCT-CCT-CTG-AGT-GAT-T, Flanking sequence = CAG-TGG-CCA-GAT-CTC-ATC-TCA-C; Clone A12 chromosome 1 sequence: LTR = GGA-GGG-TCT-CCT-CTG-AGT-GAT-T; Flanking sequence = GCA-GAC-GAG-GTA-GGC-ACT-TG. The relative amount of the flanking sequence was calculated in comparison with eGFP sequence according to manufacturer's recommendations using the 7700 ABI PRISM Detector Software 1.6. Neural transplantation: Newborn (P1-P3) male Sprague Dawley rats (Charles

River Laboratories) were used in this study. The rats were anaesthetized by cryoanesthesia. The cranium was immobilized using a modified stereotaxic head holder and the scalp reflected to expose the skull, hMASC were harvested with 0.25% trypsin/EDTA, washed twice, and resuspended in PBS. The viability of the hMASC was more than 85%. A 2 μl volume of hMASC suspended in phosphate buffered saline at a concentration of 0.7xl0 ⁴ cells/μl was stereotaxically injected intracerebroventricularly with a tapered glass micropipette attached to a Hamilton syringe using the following coordinates (mm from bregma): AP -0.6, ML 0.8, DV

00269113

2.1, toothbar was set at -1. Following the injections, the scalp was sutured and the pups allowed to recover.

Four and 12 weeks after transplantation, the rats were anaesthetized with chloral hydrate (350mg/kg, i.p.), decapitated the brains removed, frozen in powered 5 dry ice, and stored at -80 ⁰ C. Fresh frozen brains were sectioned using a cryostat and fixed with 4% paraformaldehyde for 20 min immediately before staining. Sections were incubated for one hour at room temperature with blocking/permeabilization solution consisting of 2% normal donkey serum (Jackson Immuno Labs) and 0.3% triton X. Primary and secondary antibodies were diluted in the same

10 blocking/permeabilization solution for subsequent steps. Primary antibodies (mouse anti human nuclei (1 :25), anti human nuclear membrane (1 :25) and anti NeuN (1 :200) from Chemicon; rabbit anti GFAP (1 :250) from DAKO, rabbit anti NF200 (1:300) from Sigma were incubated overnight at 4°C, rinsed 3x10 minutes each in PBS and followed by secondary Gy3 (1:200) anti and FITC (1:100) antibodies (all

15 from Jackson Immuno Labs) for two hours at room temperature. Slides were examined by fluorescence microscopy using a Zeiss Axiovert scope as well as by confocal fluorescence microscopy using a Confocal 1024 microscope. hMASC acquire a neuron, astrocyte and oligodendrocyte phenotype when cultured with bFGF.

20 Neuroectodermal differentiation was done as described in Example 5.

Briefly, cells were cultured in FN-coated chamberslides or culture plates with serum-free medium consisting of 60% DMEM-LG, 40% MCDB-201 (Sigma Chemical Co, St Louis, MO), supplemented with IX ITS, IX LA-BSA, 10 ^"8 M dexamethasone, 10 ^"4 M ascorbic acid 2-phosphate (AA) (all from Sigma), 100 U

25 penicillin and 1,000 U streptomycin (Gibco). In some cultures, we added lOOng/mL bFGF whereas in other cultures 10 ng/mL EGF + 10 ng/mL FGF-8b were added (all from R&D Systems). Cells were not subcultured, but media was exchanged every 3-5 days.

Two weeks after re-plating with bFGF, 26±4% of cells expressed astrocyte

30. (GFAP+), 28±3% oligodendrocyte (MBP+) and 46±5% neuron (NF200+) markers as shown in Table 6.

00269113

Table 6: Differentiation markers on bFGF and FGF-8b induced hMSC

When hMASC were replated at higher cell densities (2xlO ⁴ cells/cm ² ) to induce differentiation, no cells with neuroectodermal phenotype could be detected, suggesting that cell-cell interactions prevent bFGF-induced neuroectodermal differentiation.

The distribution of astrocyte-, oligodendrocyte- and neuron-like cells did not differ when differentiation was induced with hMASC that had undergone 20 or 60 PDs. However, when hMASC expanded for 20 PDs were cultured with bFGF, >50% of cells died while >70% of hMASC culture expanded for >30 PDs survived and acquired a neuron-, astrocyte- or oligodendrocyte-like phenotype. This suggests that not all hMASC can be induced to acquire neural characteristics but that a subpopulation of hMASC that survives long-term in vitro may be responsible for neuronal differentiation. It has been shown that the karyotype of hMASC is normal irrespective of culture duration (Reyes et aL, 2001). Differentiation of hMASC into neuroectόdermal-like cells is therefore not likely due to transformation of MASC following long-term culture.

Most astrocyte- and oligodendrocyte-like cells died after 3 weeks. Progressive maturation of neuron-like cells was seen throughout culture. After 1 week, bFGF treated hMASC stained positive for NeuroD, Nestin, polysialated

00269113

neural cell adhesion molecule (PSA-NCAM), and tubulin-β-m (TuJI) (Table 6).

After 2 weeks, bFGF treated cells stained positive for NF68, -160, and -200, NSE, MAP2-AB, and Tau. bFGF-induced neurons did not express markers of GAB A- ergic, serotonergic or dopaminergic neurons, but expressed glutamate as well as the glutamate-receptors-5, -6 and -7 and N-methyl-D-aspartate (NMDA)-receptor, and Na ⁺ -gated voltage channels.

Further confirmation of neuroectodermal differentiation was obtained from cDNA array analysis of two independent hMASC populations induced to differentiate for 14 days with 100 ng/mLbFGF. Expression levels of nestin, otx 1 and otx2Consistent with the immunohistochemical characterization, a >2 fold increase in mRNA for nestin was detected, GFAP, glutamate-receptors 4, 5, and 6, and glutamate, and several sodium-gated voltage channels, but did not detect increases in TH or TrH mRNA levels. A >2 fold increase in mRNA levels was also found for mammalian achaete-scute homolog 1 (MASH I) mRNA, a transcription factor found only in brain (Franco Del Arno et al., 1993) and ephrin-A5 mRNA

(O'Leary and Wilkinson, 1999). The astrocyte specific markers GFAP and S100A5, and oligodendrocyte specific markers, myelin-oligodendrocyte glycoprotein precursor and myelin protein zero (PMZ), as well as Huntingtin, and major prion protein precursor mRNA were expressed >2-fold higher after exposure to bFGF. A greater than 2 fold increase was also seen for several glycine receptors, GABA- receptors, the hydroxytryptophan receptor-A and neuronal acetylcholine receptor, glycine transporter proteins, syriaptobrevin and synaptosomal-associated protein (SNAP)25. Finally, bFGF induced expression of BDNF and glia-derived neurotrophic factor (GDNF). Like hMASC, mMASC acquire a neuron, astrocyte and oligodendrocyte phenotype when cultured with bFGF.

MASC derived from other species was tested to determine whether similar results could be obtained. mMASC expanded for 40-90 PDs were replated at 10 ⁴ cells/cm ² in conditions identical to those used for hMASC. After 14 days, mMASC acquired morphologic and phenotypic characteristics of astrocytes (GFAP ⁺ ), oligodendrocytes (MBP ⁺ ) and neurons (NF-200 ⁺ , NSE ⁺ and Tau). NF200 and GFAP or MBP were never found in the same cell. In contrast to undifferentiated

00269113

mMASC, mMASC treated with bFGF were significantly larger and extended processes for >40 μm.

To determine whether neuron-like cells had functional characteristics of neurons, and if bFGF-induced cells showed evidence of voltage-gated Na ⁺ currents a patch clamp was used. No sodium currents or fast spiking behavior was seen in any of the mMASC derived neuron-like cells (n=59), even though some . cells expressed calcium currents, and in 4 cells there was evidence of spiking behavior mediated by calcium currents. Thus, bFGF induced cells did not have functional voltage-gated Na ⁺ currents, despite expression of sodium-gated voltage channel mRNA and protein. hMASC acquire a midbrain dopaminergic, serotonergic and GABAergic phenotype when cultured with EGF and FGF-8b.

FGF-8b, expressed at the mid-hindbrain boundary and by the rostral forebrain, induces differentiation of dopaminergic neurons in midbrain and forebrain and serotonergic neurons in the hindbrain (Ye et al., 1998). In vitro, FGF-8b has been used to induce dopaminergic and serotonergic neurons from murine ES cells (Lee et al, 2000). hMASC (n=8), expanded = for 20 to 60 PDs, were replated at 2xlO ⁴ cells/cm ² on FN in serum free medium with ITS and AA and with 10 ng/mL FGF-8b and lOng/mL EGF. More than 80% of cells survived for 3 weeks. FGF-8b and EGF induced differentiation into cells staining positive for neuronal markers (Table 6) (day 7: PSA-NCAM, Nestin and TuJl; day 14: NF-68, NF-160, NF-200; and day 21 : MAP2-AB, NSE, Tau, and Na ⁺ -gated voltage channels) but not oligodendrocytes and astrocytes. In contrast to our observation for bFGF induced differentiation, cells plated at 10 ⁴ cells/cm ² with EGF and FGF-8b did not lead to differentiation. After 2-3 weeks, cells had characteristics of GABAergic (GABA ⁺ , parvalbumiri ⁴ ), dopaminergic (TH ⁺ , DCC ⁺ , and DTP ⁺ ) and serotonergic (TrH ⁺ and serotonin ⁺ ) neurons (Table 6). Cells also expressed the GABA-A-receptor and glutamate receptors. Cells with a dopaminergic phenotype also stained positive with Abs against the nuclear transcription factor, Nurrl, expressed only in midbrain dopaminergic neurons (Saucedo-Cardenas et al., 1998) as well as the proto- oncogene cRet, a membrane-associated receptor protein tyrosine kinase, which is a component of the glial cell line-derived neurotrophic factor (GDNF) receptor

00269113

complex expressed on dopaminergic neurons (Trupp et ah, 1996). This suggests that FGF-8b induces a phenotype consistent with midbrain dopaminergic neurons.

Again, results from immunohistochemical studies were confirmed by cDNA array analysis on hMASC induced to differentiate for 14 days with FGF-8b+EGF. Consistent with the immunohistochemical characterization, a >2 fold increase in mRNA for TH, TrH, glutamate, several glutamate-receptors, and sodium-gated voltage channels was detected. As parvalbumin and GABA are not present on the array, their expression could not be confirmed by mRNA analysis. Consistent with the almost exclusive neural differentiation seen by immunhistochemnistry, there was no increase in expression of GFAP, S 100 A5 mRNA nor mRNA for the oligodendrocyte specific marker, PMZ. FGF-8b+EGF induced cells expressed >2 fold more tyrosine kinase receptor (Trk)A, BDNF and GDNF, several glycine-, GABA-and hydroxytryptamine-receptors, and.several synaptic proteins. Coculture with the glioblastoma cell line U87 enhances neuron maturation. Irrespective of the culture conditions used, hMASC-derived neurons did not survive more than 3-4 weeks in culture. As neither culture contained glial cells after 3 weeks, it is possible that neuronal cells that express both glutamate and glutamate- receptors died due to glutamate toxicity (Anderson and Swanson, 2000). Alternatively, factors required for neural cell survival, differentiation and maturation provided by glial cells might not be present in the cultures (Blondel et ah, 2000; Daadi and Weiss, 1999; Wagner et ah, 1999). To test this hypothesis, cells from 3- week old FGF-8b+EGF cultures were cocultured with the glioblastoma cell line, U- 87, in serum-free medium supplemented with FGF-8b+EGF for an additional 2 weeks. The glioma cell line, U-87, [American Tissue Cell Collection (Rockville,

MD)] was maintained in DMEM+10% FCS (Hyclόne Laboratories, Logan, UT). Cells from 3 -week old FGF-8b+EGF containing cultures were labeled with the lipophylic dye, PKH26 (Sigma), as per manufacturer's recommendations. Labeled cells were replated in FN coated chamber slides in FGF-8b+EGF containing serum free medium together with 1,000 U-87 cells and maintained an additional 2-3 weeks with media changes every 3-5 days. To assure that PKH26 present in MASC- derived cells did not transfer to the U-87 cell line, U-87 cells were cultured in BSA-

00269113

containing medium and 20 μl PKH26 dye for 7 days. No labeling of glioma cells was detected.

Under these serum-free conditions, U-87 cells ceased to proliferate but survived. hMASC derived neurons were labeled with the membrane dye, PKH26, prior to coculture with U-87 cells to allow us to identify the hMASC-derived cells by fluorescence microscopy. FGF-8b+EGF induced neurons cocultured after 3 weeks with U-87 cells and the same cytokines survived for at least 2 additional weeks. Neurons acquired a more mature morphology with increased cell size as well increased number, length and complexity of the neurites. The electrophysiological characteristics of PKH26 labeled neural cells derived from hMASC after coculture with U-87 cells by whole-cell current clamp and voltage-clamp after current-injection was evaluated (Fig. 9B). Current-clamp demonstrated spiking behavior in response to injected current in 4/8 of PKH26 labeled hMASC-derived cells present in FGF-8b+EGF/U-87 cultures. The resting membrane potential of spiking and non-spiking cells was -64.9±5.5mV and -

29.7±12.4mV, respectively. For each cell studied, input resistance of spiking and non-spiking cells was 194.3 (37.3) and 216.3 (52.5) Mohm, respectively. An example of one of the cells in which w observed spiking behavior is shown in Fig. 9B. The top panel shows a family of voltage traces which was elicited from a spiking cell under control conditions. A DC current was first injected in the cell to hold them in the range of -100 to -120 mV. A current injection protocol, as shown in the middle panel, was then used to drive the membrane potential to different levels. As shown in this example, depolarizing current steps that were sufficiently large to bring the cell to threshold for action potential, evoked a. single spike. The ' lower panel shows that the spiking behavior of the cells could be blocked by 1 μM TTX, suggesting that the action potentials are mediated by Na-gated voltage channels. Leak-subtracted current records, obtained in voltage-clamp mode from the same cells (Fig. 9C), demonstrated an inward current that was transient in time course and activated at voltages more positive than -58 mV, as well as outward currents. The transient inward current was blocked reversibly by 1 μM TTX. This pharmacology, together with the transient time course and the voltage-dependent activation of the inward current is typical for voltage-gated Na ⁺ currents, found only in mature neurons and skeletal muscle cells (Sah et al, 1997; Whittemore et al.,

00269113

1999). Skeletal muscle markers in these neuron-like cells was not detected. These studies suggest that treatment with FGF-8b+EGF and co-culture with glioblastoma cellsfresults ininaturation to cells with the fundamental characteristics of excitable neurons, TTX-sensitive voltage-gated Na ⁺ currents. hMASC transplanted in ventricles of newborn rats differentiate in cells expressing . astrocyte and neuronal markers

1.4x10 ⁴ hMASC were stereotactically injected in the lateral ventricles of PI¬ PS Sprague Dawley rats. After 4 and 12 weeks, animals were sacrificed and analyzed for presence of human cells and evidence of differentiation of hMASC to neuroectoderm. Human cells, identified by staining with a antibodies against human nuclei or human nuclear membrane could be seen in the SVZ up to 400 μm away from the ventricle in animals analyzed after 4 weeks, and after 12 weeks, human cells could also be seen deeper in the brain parenchyma such as in the hippocampus and along the fornix. Some human cells had typical astrocyte morphology and stained positive with antHϊFAP antibodies, whereas other cells stained positive with anti-Neu-N antibodies, NF-200 and anti-human nuclear membrane antibodies. Triple staining showed that human nuclear antigen positive Neu-N positive cells did not coexpress and GFAP. Summary The central finding of this work is that single post-natal BM-derived MASC can be induced to differentiate not only into mesodermal cell types but also cells with mature neuronal characteristics, as well as astrocyte and oligodendrocyte characteristics. Time-dependent as well as culture-method-dependent maturation of MASC to cells with neuroectodermal features was shown. Double staining definitively demonstrated that neuronal or glial cells were authentic and results were not due to inappropriately expressed neuronal or glial markers. These results were confirmed at the mRNA level. Retroviral marking studies were used to demonstrate that the neurons, astrocytes and oligodendrocytes were derived from a single MASC that also differentiates into muscle and endothelium, as the sequence of the host cell genomic region flanking the retroviral vector was identical in all lineages. hMASC did not only acquire phenotypic but also electrophysiological characteristics of mature neurons, namely TTX-sensitive voltage-gated Na ⁺ currents. Finally, it was

00269113

also shown that MASC can differentiate in vivo into cells expressing neuronal and astrocyte markers.

Using retroviral marking of hMASC combined with PCR-based sequencing of the genomic sequence flanking the 3'-LTR of the retroviral insert, it was shown that neurons are derived from the same hMASC that differentiate into astrocytes and oligodendrocytes, as well as into endothelium and muscle (Jordan et al, 1990). This conclusively demonstrates that MASC can, at the single cell level, differentiate to cells of mesodermal and neuroectodermal lineages. The cells with the ability to differentiate not only into mesodermal cell types but also neuroectodermal cell types multipotent adult stem cells, or MASC were re-named. Sanchez-Ramos et al.

(Sanchez-Ramos et al, 2000) and Woodbury et al (Woodbury et al, 2000) showed that populations of human or rodent MSC can express markers of astrocytes and neurons, but not oligodendrocytes in vitro. However, neither study provided evidence that the same cell that acquired neuroectodermal markers could also differentiate into mesodermal cells. Furthermore, neither study showed that cells expressing neuronal markers also acquired functional neuronal characteristics. Thus, although suggestive for neural differentiation, these reports did not conclusively demonstrate neural and glial differentiation from MSC.

It was also shown that hMASC transplanted in the ventricle of newborn rats can migrate in the neurogenic subventricular zone and into the hippocampus where they respond to local cues to differentiate into cells expressing astrocyte and neuronal markers. This model was chosen because migration and differentiation of NSC to specific neuronal phenotypes occurs to a much greater extent when transplantation is done in germinal areas of the brain man in non-neurogenϊc areas, and when transplants are done in newborn animals compared with adult animals (Bjorklund and Lindvall, 2000; Svendsen and Caldwell, 2000). Although hMASC are multipotent and differentiate into cells outside of the neuroectoderm, hMASC did not form teratomas. The number of cells that had migrated outside the subventricular area was low after 4 weeks, but increased after 12 weeks. The ease with which MASC can be isolated from post-natal BM, expanded and induced to differentiate in vitro to astrocytes, oligodendrocytes or neuronal cell types may circumvent one of the key problems in NSC transplantation, namely the availability of suitable donor tissue.

00269113

Example 11. MASC Differentiation into Hepatocvte-like CeUs

During embryogenesis, the first sign of liver morphogenesis is a thickening of the ventral endodermal epithelium, which occurs between e7.5 and e8.5 in the mouse (Zaret ELS., 2001). Little is known about the signals involved in initial endoderm formation and subsequent endoderm specification. Early in gastrulation (e6-e7) endoderm is not specified, not even in an anterior/posterior direction (Melton D., 1997). However, recent studies showed that ex vivo exposure of endoderm to FGF4 posteriorizes the early endoderm, which is now competent to express hepatic markers (Wells J.M. et al., 1999). By e8.5 in the mouse, definitive endoderm has formed the gut tube and expresses HNF3β (Zaret K.S., 2000). The foregut endoderm is induced to the hepatocyte lineage by acidic (a)FGF and bFGF, both produced by the adjacent cardiac mesoderm (Zaret K.S., 2001), which are required to induce a hepatic fate and not the default pancreatic fate (Zaret K.S., 2001). Basic morphogenetic proteins (BMP's) produced by the transversum mesenchyme are also required as they increase levels of the GATA4 transcription factor which promote the ability of endoderm to respond to FGF's (Zaret K.S., 2001). GATA4 and HNF3β are required for hepatic specification and are important effectors of downstream events leading to hepatocyte differentiation, as they upregulate markers of hepatocyte specific expression such as albumin, among others.

In most instances, mature hepatocytes can undergo several cell divisions and are responsible for hepatic cell replacement. As a result, there has been great controversy about the existence and function of a liver stem cell. During extensive liver necrosis due to chemical injury or when hepatocytes are treated with chemicals that block their proliferation, a population of smaller cells with oval shape, termed oval cells, emerges and proliferates (Petersen, B.E., 2001). These oval cells may constitute the "stem cell" compartment in the liver. Oval cells reside in the smallest units of the biliary tree, called the canals of Herring, from where they migrate into the liver parenchyma (Theise N.D., et al., 1999). Oval cells are bi-potential, giving rise in vitro and in vivo to both hepatocytes and bile ductular epithelium. Oval cells express several hematopoietic markers such as Thy 1.1, CD34, Flt3-receptor, and c- Kit, and also express αFP, CKl 9, γ-glutamyl-transferase, and OV-6. The origin of

00269113

oval cells is not known (Petersen, B.E., 2001; Kim T.H. et al, 1997; Petersen, B.E.,

2001).

Until recently, it was believed that hepatocytes could only be derived from cells of endodermal origin and their progenitors. However, recent studies suggest that non-endodermal cells may also form hepatocytes in vivo and in vitro (Petersen, B.E., 2001; Pittenger M.F. et al, 1999). Following bone marrow (BM) transplantation, oval cells are derived from the donor BM (Theise N.D., et al, 1999). Transplantation of enriched hematopoietic stem cells (HSC) in FAH ^v' mice, an animal model of tyrosenimia type I, resulted in the proliferation of large numbers of donor LacZ* hepatocytes and animals had restored biochemical function of the liver (Lagasse E. et al, 2000). Furthermore, single HSC may not only repopulate the hematopoietic system but also contribute to epithelium of lung, skin, liver and gut (Krause D.S. et al, 2001). Exocrine pancreatic tumor cells treated in vitro with dexamethasone (Dex) with or without oncostatin M (OSM) may acquire a hepatocyte phenotype (Shen CN. et al, 2000). Finally, mouse embryonic stem (ES) cells spontaneously acquire a hepatocyte phenotype, a process that is enhanced by treatment with aFGF, HGF, OSM, and Dex (Hamazaki T. et al, 2001).

It was demonstrated here that single MASC not only differentiate into mesodermal and neuroectodermal cells, but also into cells with morphological, phenotypic and functional characteristics of hepatocytes in vitro. mMASC rMASC, and hMASC acquire a hepatocyte-like phenotype when cultured. with FGF4 and/or HGF. mMASC, rMASC and hMASC were selected and cultured as described. To determine optimal conditions for MASC differentiation into hepatocyte-like cells, the effect of different extracellular matrix (ECM) components was tested and cytokines known to induce hepatocyte differentiation in vivo or from ES cells (Zaret K.S., 2001) on mMASC or rMASC differentiation to hepatocytes. As differentiation requires cell cycle arrest, the effect of cell density was also tested. To demonstrate differentiation to hepatocyte like cells, cells were stained after 14 days with Abs against albumin, CKl 8, and HNF3β.

Optimal differentiation of mMASC or rMASC to albumin, CK18 and HNF3β positive epithelioid cells was seen when MASC were plated at 21.5xlO ³ cells/cm ² in the presence of 10 ng/ml FGF4 and 20 ng/ml HGF on Matrigel™ as

00269113

shown in Table 7A. After 14 days, the percent albumin, CKl 8 and HNF3β positive epithelioid cells was 61.4±4.7%, and 17.3% of cells were binucleated. When plated on FN, differentiation to CKl 8 and HNF3β positive epithelioid cells was also seen, even though only 53.1±6.3% of cells stained and fewer (10.9%) binucleated cells were seen.

Culture with either FGF4 or HGF yielded albumin, CKl 8 and HNF3β positive epithelioid cells, but the percent albumin, CKl 8 and HNF3β positive cells was higher when mMASC or rMASC were treated with both FGF4 and HGF as shown in Table 7A. Addition of aFGF, bFGF, FGF7, BMP's, or OSM did not increase the percent cells positive for hepatocyte markers, while 1% DMSO and 0.1 mM-10 mM Sodium Butyrate did not support differentiation of mMASC or rMASC to cells positive for hepatocyte markers.

When cell densities between 2.5 and 25x10 ³ cells/cm ² were tested, the highest percent cells with hepatocyte markers was seen in cultures seeded at 21.5xlO ³ cells/cm ² . No hepatocyte differentiation was seen when cells were plated at <12.5xlO ³ cells/cm ² . hMASC were plated at 3-3OxIO ³ cells/cm ² on lOng/mL FN or 1% Matrigel™ with aFGF, bFGF, FGF7, 1% DMSO, HGF, and / or FGF4. Only cells treated with lOng/ml FGF4 alone, 20ng/ml HGF alone, or a combination of both differentiated into epithelioid cells that expressed albumin, CK18 and HNF3β. hMASC plated at 15-3OxIO ³ cell/cm ² differentiated into epithelioid cells whereas hMASC plated at 3xlO ³ cell/cm ² died. Like mMASC or rMASC, the percent albumin, CKl 8 and HNF3β positive epithelioid cells was higher when hMASC were cultured on Matrigel™ (91.3% ± 4.4) than on FN (89.5% ± 5.4), and the percent binucleated cells was higher on Matrigel™ (31.3%) than on FN (28.7%) as shown in Table 7B.

Table 7: Optimization of MASC differentiation into hepatocyte like cells.

00269113

61

- = 0% + = 20%, -H- = 30%, +++ = 40%, ++++ = 60%, = 80% cells staining positive for specific markers and NT = not tested.

Phenotypic characterization of MASC differentiation to hepatocvte-like cells Hepatocyte differentiation was further evaluated over time by immunofluorescence and confocal microscopy for early (HNF3β, GATA4, CKl 9, αFP) and late (CKl 8, albumin, HNF lα) markers of hepatocyte differentiation. mMASC or rMASC plated on Matrigel™ with FGF4 and HGF enlarged from 8μm to 15μm diameter as shown in Table 8A. On d21-d28, approximately 60% of cells were epithelioid and surrounded by smaller round or spindle shaped cells. Undifferentiated mMASC or rMASC did not express any of the liver specific transcription factors or cytoplasmic markers. After 4 days, cells expressed HNF3β, GATA4 and αFP, low levels of CKl 9, and very rare cells stained positive for HNF lα, albumin or CKl 8. At seven days, the large epithelioid cells stained positive for HNF3β, GATA4, HNFlα with increasing staining for albumin and CKl 8. Only rare cells expressed αFP. After 14, 21 and 28 days, the large epithelioid cells stained positive for GATA4, HNF3β, HNFlα, CKl 8 and albumin, but not αFP or CKl 9. The smaller cells surrounding the nodules of epithelioid cells stained positive forCK19 and αFP. hMASC was plated on Matrigel™ with FGF4 and HGF or FGF4 alone enlarged from 10-12μm to 20-30μm diameter by d21. After 7 days, cells expressed HNF3β, GATA4 and low levels of CKl 9, while few cells stained positive for albumin or CKl 8. After 14 and 21 days, >90% of epithelioid cells stained positive

00269113

for GATA4, HNF3β, HNFlα, HNF4, CK18 and albumin, while only rare cells stained positive for αFP or CKl 9 as shown in Figure 1OB.

Table 8: Immunohistochemistry Pattern of Hepatocyte Marker Expression

+ = Marker is expressed, - = Marker is not expressed and NT = not tested

Hepatocvte-like cells are derived from the same single hMASC that differentiated into neuroectoderm and endoderm

It has been shown that single mMASC or rMASC differentiate into endothelium, neuroectoderm and CKl 8 and albumin positive endodermal cells. It

. \ has also been shown that single hMASC differentiate into mesoderm and neuroectoderm. The same single hMASC was tested to determine whether they can differentiate into hepatocyte-Iike cells. MASC were obtained, cultured and expanded as described. For differentiation, mMASC or rMASC were plated at 5-. 25xlO ³ cells/cm ² on 0.01-10μg/ml fibronectin (FN), 0.01-8μg/ml collagen (Sigma Chemical Co, St. Louis, MO), or 1% Matrigel™ (Becton-Dickinson) in serum-free medium {60% low glucose DMEM (DMEM-LG; Gibco-BRL, Grand Island, NY), 40% MCDB-201 (Sigma), supplemented with IX insulin/transferrin/selenium, 4.7 μg/ml linoleic acid, 1 mg/ml bovine serum albumin (BSA), 10 ^"8 M dexamethasone, 10 ^"4 M ascorbic acid 2-phosphate (all from Sigma), 1 OOU/ml penicillin, 100/ml U streptomycin (Gibco)], with 2% FCS (Hyclone, Logan Utah) and 10 ng/mL each epidermal growth factor (EGF) (Sigma), leukemia inhibitory factor (LIF; Chemicon, Temecula, CA), and platelet derived growth factor (PDGF-BB; R&D Systems, Minneapolis, MN). hMASC were plated at 15-30xl0 ³ cells/cm ² on 0.1 μg/ml FN, or 1% Matrigel™ in the same medium without LIF (Reyes M.,.2OO2). After 8-12h, media were removed, cells washed twice with phosphate buffered saline (PBS)

00 ₂ 69113

(Fischer) and cultured in serum-free medium supplemented with 5-50ng/ml HGF, aFGF, bFGF, FGF4, FGF7, or OSM; or 10 mg/ml dimethyl-sulphoxide (DMSO), or 0.1-1 mM sodium butyrate.

Transduction of hMASC with eGFP was performed using an eGFP-cDNA containing retrovirus and expanded to >5X10 ⁶ cells. Twenty percent was induced to differentiate into muscle, endothelium, neuroectoderm and endoderm. For clone A16 a single retroviral insertion site was present in undifferentiated MASC as well as mesodermal and neuroectodermal differentiated cells and eGFP ⁺ clone A16 MASC differentiated into CKl 8 and albumin positive cells. The same insertion site was present in FGF4-treated MASC generated from the same cell population (5'- TAG CGGCCGCTTGAATTCGAACGCGAGACTACTGTGACT CACACT-3', Chromosome 7), proving that single hMASC differentiate into endoderm aside from mesoderm and neuroectoderm. Quantitative RT-PCR demonstrates that FGF4 and HGF induces hepatocyte specification and differentiation. ^s

Hepatocyte differentiation by quantitative RT-PCR was confirmed for early (HNF3β, GATA4, CK19, αFP) and late (CKl 8, albumin, HNFlα, cytochrome P450) markers of hepatocyte differentiation. RNA was extracted from 3xlO ⁵ MASC or MASC induced to differentiate to hepatocytes. mRNA was reverse transcribed and cDNA was amplified as follows: 40 cycles of a two step PCR (95°C for 15", 6O ⁰ C for 60") after initial denaturation (95°C for 10') with 2μl of DNA solution, IX TaqMan SYBR Green Universal Mix PCR reaction buffer using a ABI PRISM 7700 (Perkin Elmer/Applied Biosystems). Primers used for amplification are listed in Table 9. Table 9: Primers used

00269113

mRNA levels were normalized using β-actin (mouse and human) or 18S (rat) as housekeeping genes and compared with mKNA levels in fteshly isolated rat or mouse hepatocytes, rat hepatocytes cultured for 7 days, or mRNA from human adult liver RNA purchased from Clontech, Palo Alto, California.

On d0, mMASC and rMASC expressed low levels of albumin αFP, CKl 8, CK19, TTR, HNF3β, HNFlα and GATA4 mRNA, but no CYP2B9 and CYP2B13 (mouse) or CYP2B1 (rat) mRNA (Fig. 10). Following treatment of mMASC or rMASC with FGF4 and HGF, expression of HNF3β and GATA4 mRNA increased on d2, became maximal by d4, decreasing slightly and leveling off by dl4. mRNA for αFP, and CKl 9 increased after d2, and became maximal by d4 and decreased

00269113

thereafter. TTR ήiRNA increased after d4, was maximal by d7 and leveled off.

CKl 8, Albumin, HNFl α and P450 enzyme mRNA increased after d7 and was maximal on dl4. Between dl4 and d21, FGF4 and HGF induced MASC expressed albumin, TTR, CKl 8, CYP2B9 and CYP2B13 (mouse) and CYP2B1 (rat) mRNA. Undifferentiated hMASC expressed low levels of albumin, CKl 8, and

CK19, CYPlBl, but not αFP (Fig. 10) and CYP2B6 mRNA. Levels of albumin, CKl 8, CK19, CYPlBl mRNA increased significantly in hMASC cultured with FGF4 alone or with FGF4 and HGF for 14 days compared to day 0 (MASC) cultures. Levels of albumin, CK18 and CYPlBl mRNA continued to increase and were higher on d28. Although, CYPlBl is not a specific hepatocyte marker, its upregulation suggests hepatocyte commitment and maturation. Low levels of CYP2B6, 0.5% to 1.0% of fresh liver mRNA's could be seen on dl4 and d21 but not d0. mRNA levels of immature hepatocyte markers (CK 19 and αFP) decreased as differentiation progressed and were higher in cultures induced with FGF4 alone, whereas mRNA levels for mature hepatocytes (CKl 8 and albumin) were higher in FGF4 and HGF-induced hMASC.

Western Blot demonstrates that FGF4+HGF induces hepatocyte specification and differentiation

Expression of hepatocyte-specific genes was also confirmed by Western Blot and performed as described by Reyes et a (2000). Abs to αFP, human albumin, CK18 were diluted 1:1000 in blocking buffer. Goat anti- β-actin (1:1000) was from Santa Cruz. Secondary Abs were HRP-linked goat anti-mouse and HRP-linked donkey anti-goat (Amersham, Arlington Heights). ECL was performed according to manufacturers instructions (Amersham). Undifferentiated hMASC did not express CKl 8, albumin, or αFP protein (Fig. 1 OB). After treatment for 35 days with FGF4 alone or FGF4 and HGF, hMASC expressed albumin and CKl 8, but not αFP, consistent with the histochemical analysis. mMASC. rMASC and hMASC acquire hepatocyte functional activity

Five different assays were used to determine whether cells with morphologic and phenotypic characteristics of hepatocytes also had functional hepatocyte attributes.

Urea production and secretion by hepatocyte-like cells was measured at various time points throughout differentiation. Urea concentrations were determined

00269113

by colorimetric assay (Sigma Cat 640-1) per manufacturer's instructions. Rat hepatocytes grown in monolayer and fetal mouse liver buds were used as positive controls, and culture medium as negative control. The assay can detect urea concentrations as low as 10 mg/ml. As the assay also measures ammonia, samples were assessed before and after urease addition.

No urea or ammonia was detected in culture medium alone. Undifferentiated MASC did not produce urea. Following treatment with FGF4 and HGF, urea production by MASC increased in a time dependent manner. The time course for urea production in mouse and rat cultures was similar. For hMASC treated with FGF4 and HGF, urea was not detected on d4, was similar to mouse and rat cultures by dl2, and exceeded that in mouse or rat cultures on d21. Levels of urea produced by MASC-derived hepatocytes were similar to that in monolayer cultures of primary rat hepatocytes. For all three species, significantly more urea was produced by cells differentiated on Matrigel™ compared to FN. Albumin production was measured at various time points throughout the differentiation. Rat albumin concentrations were determined by a competitive enzyme linked immunoassay (ELISA) described previously (Tzanakakis E.S., et ah, 2001; Wells J.M. et al., 2000). Human and mouse albumin concentrations were determined using a similar ELISA method with substitution of human or mouse albumin and anti-human or anti-mouse albumin Abs for the rat components where appropriate. Peroxidase conjugated anti-human-albumin and reference human albumin were from Cappel. Peroxidase conjugated and affinity purified anti-mouse albumin and reference mouse albumin were from Bethyl Laboratories (Montgomery, Texas). To ensure specificity of the ELISA, human, mouse, and rat Abs were incubated for 2 hrs at 37"C with 3% BSA in distilled water (dH ₂ O). ELISA's had a sensitivity of at least 1 ng/ml.

Undifferentiated MASC did not secrete albumin. Following treatment with FGF4 and HGF, mMASC, rMASC and hMASC produced albumin in a time dependent manner. As was seen for urea production, MASC differentiated on Matrigel™ produced higher amounts of albumin than when cultured on FN. Mouse, rat, and human cells secreted similar levels of albumin, even though albumin was not detected in human cultures on d3. Levels of albumin produced by mouse, rat

00269113

and human MASC-derived hepatocytes were similar to those seen in monolayer cultures of primary rat hepatocytes.

Cytochrome P450 activity was next assessed in aggregates of MASC-derived hepatocytes and primary rat liver hepatocyte spheroids using the PROD assay. mMASC-hepatocyte aggregates were formed by plating dl4 FGF4 and HGF treated mMASC at 5xlO ⁴ cells/cm ² on non-tissue culture plates, which were placed on a shaker at 10 revolutions per minute for 5h. Cell aggregates were transferred to Primaria™ dishes and allowed to compact for 4 days in the presence or absence of ImM phenobarbital. hMASC-hepatocyte aggregates were formed by hanging drop method. Briefly, 10 ³ hMASC treated for 24 days with FGF4 and HGF were placed into lOOμL drops with or without ImM phenobarbital. After 4 days, aggregates were collected and cytochrome P450 activity assessed by PROD assay. Pentoxyresorufϊn (PROD) (Molecular Probes, Eugene, Oregon) is O-dealkylated by Cytochrome P450, changing a non-fluorescent compound into a fluorescent compound, resorufin (Tzanakakis B.S. et al., 2001). Fluorescence intensity caused by PROD metabolism consequently estimates cytochrome P450 (CYP) activity. Assessment and detection of resorufin in situ was performed using confocal microscopy as described (Tzanakakis E.S. et al., 2001).

No PROD activity was seen in aggregates of undifferentiated mMASC or hMASC. However, mMASC (18 days with FGF4 and HGF) and hMASC (28 days, FGF4 alone) induced to form aggregates had significant PROD activity. PROD activity in MASC-derived hepatocyte aggregates was similar to that of primary rat hepatocyte aggregates. A number of different cells have P450 activity, but P450 activity up-regulation by phenobarbital is only seen in hepatocytes. Therefore, P450 was also tested in the presence or absence of phenobarbital. Without phenobarbital, several P450 enzymes partially participate in PROD metabolism giving an inflated fluorescence value for those samples. In contrast, in the phenobarbital induced aggregates, PROD activity is almost wholly metabolized by mouse cytochromes Cyp2b9, Cyp2blO, and Cyp2bl3, rat cytochrome Cyp2bl/2 (Tzanakakis E.S. et al, 2001), and in human, by CYP2B6. Therefore increased fluorescent activity is smaller than the actual increase in the protein expression of the stated cytochrome P450 enzymes. When aggregates were cultured for 96 hours with phenobarbital, a 32% to 39% increase in PROD activity was seen, suggesting presence of functional

00269113

hepatocyte specific Cyp2b9, Cyp2blO, and Cyp2bl3 in mMASC and CYP2B6 in hMASC-derived hepatocytes.

MASC-derived hepatocytes were also assessed for their ability to take up LDL by incubating FGF4 treated hMASC with LDL-dil-acil. Cells were co-labeled either with anti-CKl 8 or anti-Pan-CK and HNF-3β or GATA4 Abs. After 7 days, low level uptake of a-LDL was detected, which increased to become maximal on d21.

Another metabolic function of hepatocytes is glycogen production or gluconeogenesis. The levels of glycogen storage were analyzed by periodic acid Schiff (PAS) staining of FGF4 and HGF induced mouse MASC and FGF induced hMASC at d3, d7, dl4, and d21. For PAS, slides were oxidized in 1% periodic acid for 5' and rinsed 3 times in dH ₂ O. Afterwards slides were treated with Schiff s reagent for 15% rinsed in dH ₂ O for 5-10', stained with Mayer's hematoxylin for 1' and rinsed in dH ₂ O. Glycogen storage was first seen by dl4 and maximum levels were seen after d21 (Fig. 11).

Hepatocyte Isolation and Culture

Hepatocytes were harvested from 4-6 week old male Sprague-Dawley rats as described (Seglen P.O., 1976). Hepatocyte viability after the harvest ranged from 90-95%. Hepatocytes were cultured as described (Tzanakakis E.S. et ah, 2001; Tzanakakis E.S. et ah, 2001). To form a monolayer, hepatocytes were cultured on 35 mM Fischer culture plates (Fischer Scientific, Pittsburgh, PA) coated with 8μg/cm ² collagen (Cohesion Technologies, Palo Alto, CA). To form spheroids, hepatocytes were cultured on 35-mm Primaria™ dishes (Becton Dickinson). Under both conditions, seeding density Was 5xlO ⁴ cells/cm ² . 12h after initial plating, medium was changed to remove dead and unattached cells. Medium was replaced every 48 hours thereafter. Summary

It has been shown that a single post-natal mouse, rat and human BM-derived MASC can differentiate in vitro into an endodermal cell type with hepatocyte phenotype and function. MASC, cultured under hepatocyte differentiation conditions, expressed in a time-dependent fashion primitive and mature hepatocyte markers, shown by immunofluorescence microscopy of double and triple labeled cells. The protein expression profile was hepatocyte specific and not spurious, as

00269113

non-hepatocyte markers were not co-expressed with hepatocyte antigens. Results from immunohistochemistry were confirmed by Western blot. In addition, RT-PCR corroborated upregulation of the transcription factors HNF3β and GATA4 known to be important in endoderm specification and transcription factors required for subsequent hepatocyte differentiation, such as HNF3β, and cytoplasmic proteins such as CKl 9, CKl 8, αFP and albumin.

Although it was shown that FGF4 alone or both FGF4 and HGF induced MASC into cells with morphological and phenotypic characteristics of hepatocytes, this alone does not prove that cells have differentiated into hepatocytes unless one can demonstrate acquisition of functional characteristics of hepatocytes. Therefore, several functional tests were done in combination to identify functional hepatocytes. mMASC, rMASC or hMASC produced urea and albumin, contained phenobarbital inducible cytochrome P450 activity, could take up Dil-acil-LDL, and contained glycogen granules. Although urea production is characteristic of hepatocyte activity, kidney tubular epithelium also produces urea (Hedlund E. et aL, 2001 ). In contrast, albumin production is a specific test for the presence and metabolic activity of hepatocytes (Hedlund E. et al. _t 2001). Cytochrome P450, although found in hepatocytes, is also present in many other cell types (Jarukamjorn K. et aL, 1999). However, Cyp2bl activity in rat (TzanakaMs E.S. et aL, 2001), Cyp2b9 and Cyp2b 13 in mouse (Li-Masters T. et aL, 2001; Zelko I. Et aL, 2000), and CYP2B6 in human is considered relatively hepatocyte specific. Presence of these forms of P450 was shown by RT-PCR. The specificity for hepatocytes is enhanced further when P450 activity is inducible by phenobarbital (Rader D.J. et aL, 2000), as shown. Although LDL uptake is seen in hepatocytes (Oh S.H. et aL, 2000), other cells such as endothelium have a similar capability (Avital I. et aL, 2001). Finally, only hepatocytes can generate and store glycogen. When taken together, these functional tests demonstrate that MASC from mouse, rat or humans treated in vitro with FGF4 and HGF not only express hepatocyte markers but also have functional characteristics consistent with hepatocyte metabolic activities. Several studies have shown that BM derived cells may differentiate into hepatocyte-like cells in vivo and in vitro (Petersen B.E. et aL, 1999; Theise N.D. et aL, 2000; Krause D.S. et aL, 2001; Pittenger M.F. et aL, 1999; Wang S. et aL, 2001; Lagasse E. et aL, 2000). However, most studies have not addressed the phenotype of the BM cell

00269113

that differentiates into cells with hepatocyte phenotype. It is unknown whether the cells staining positive for hepatocyte markers had functional characteristics of hepatocytes, and whether cells that differentiate into hepatocytes can also differentiate into mesodermal cells, such as hematopoietic cells. Lagasse et al. demonstrated that cKit'Thyi ¹⁰ "' Scal ⁺ Lin ^+* cells present in murine BM differentiate into cells with not only hepatocyte phenotype but also hepatocyte function (Lagasse E. et al, 2000). Even though such results could be seen when as few as 50 cells were transplanted, this study did not prove that the same cell that differentiates into hematopoietic cells also differentiates into hepatocytes. Krause et al showed that a single cell can repopulate the hematopoietic system and give rise to rare hepatocytes. However, no functional assessment of the hepatocytes was done (Krause D.S. et al., 2001). Avital et al recently published that βim ^' , Thy- 1 ⁺ cells in mouse BM express albumin, HNF4, C/EBPα, and Cytochrome P4503A2 mRNA and protein (Wilmut L, et al., 1997), a phenotype of hepatocyte progenitors usually found in the liver. Thus, presence of such hepatocyte progenitor cells in BM could explain the in vivo differentiation of bone marrow into hepatocytes noted in recent studies (Krause D.S. eial., 2001; Lagasse E. et al., 2000).

To address the question whether cells giving rise to functional hepatocyte- like cells also give rise to other cell types, retroviral marking was used (Reyes M. et ah, 2001; Jiang Y., 2002). It has been recently shown that cells expressing albumin, CK18 and HNFlα can be generated from the same mMASC and rMASC that differentiate into cells with endothelial and neuroectodermal phenotype (Jiang Y., 2002). It is confirmed that similar results are seen for hMASC. Extending recently published studies demonstrating derivation of cells with mesodermal and neuroectodermal phenotype and function from single hMASC (Reyes M., 2002), it is., shown here that the same single hMASC also differentiates into cells with hepatocyte morphology and phenotype. Thus, it is demonstrated for the first time that MASC that do not express hepatocyte markers and have no functional hepatocyte activity exist in BM, which depending on the culture conditions, acquire a hepatocyte phenotype and functional characteristics of hepatocytes, or phenotypic and functional characteristics of mesodermal and neuroectodermal cells.

00269113

Example 12. Transplantation of LacZ Transgenic MASC to Treat Hemophiliac

Mice

MASC were derived from ROSA26 mice containing the β-gal/NEO transgene (10 ⁶ cells/mouse) and were LV. injected into hemophiliac mice (N=S) without prior irradiation. The animals were sacrificed at 1 (N=2) and 2 months (N=3) post-MASC transplantation. Bone marrow cytospins and frozen sections of liver, spleen, skeletal muscle, heart, lung and intestine were stained for presence of β-gal antigen using a FITC-conjugated anti-β-gal antibody and pan-cytokeratin or CD45. Tissues were also analyzed by Q-PCR for the β-gal gene as described in Example 6.

Preliminary analysis indicates that one of the three animals (M3) analyzed at 2 months post-injection had 0.1% of pulmonary epithelial cells derived from the donor cells by immunohistochemistry and Q-PCR. Immunohistochemistry also showed that animal M5 had <1% engraftment of CD45 ⁺ donor cells in the spleen, marrow and intestine. Tissues of the animal M4 had some donor derived cells on immunohistochemistry; PCR data on this animal is pending.

All publications, patents and patent applications are incorporated herein by reference as though individually incorporated by reference. While in the foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

00269113

REFERENCES

Adams, R.H., and Klein, R. (2000). Eph receptors and ephrin ligands. Essential mediators of vascular development. Trends Cardiovasc Med. 10:183-188.

Alison, M., and Sarraf, C. (1998). Hepatic stem cells. J Hepatol 29: 678-83. Alizadeh, A.A., M.B. Eisen, R.E. Davis, C. Ma, LS. Lossos, A. Rosenwald,

J.C. Boldrick, H. Sabet, T. Tran, X. Yu, J.L Powell, L. Yang, G.E. Marti, T. Moore, JJ. Hudson, L. LU. D.B. Lewis, R. Tibshirani, G. Sherlock, W.C. Chan, T.C. Greiner, D.D. Weisenburger, J.O. Armitage, R. Warnke, and L.M. Staudt. 2000. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature.403:503-511.

Anderson, C. M., and Swanson, R. A. (2000). Astrocyte glutamate transport: review of properties, regulation, and physiological functions. GUa 31:1-14.

Anderson, D. J., Gage, F. H., and Weissman, I. L. (2001). Can stem cells cross lineage boundaries? Nat Med., 393-5. Arsenijevic, Y., and Weiss, S. (1998). Insulin-like growth facor-I is a differentiation factor for postmitotic CNS stem cell-derived neuronal precursors: distinct actions from those of brain-derived neurotrophic factor. JNeurosci l 8:118- 28.

Asahara, T., Masuda, H., Takahashi, T., Kalka, C, Pastore, C, Silver, M., Kearne, M., Magner, M., and Isner, J. M. (1999). Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85:221-8.

Asahara, T., Murohara, T.,.Sullivan, A., Silver, M., van der Zee, R., Li, T., Witzenbichler, B., Schatteman, G., and Isner, J. (1997). Isolation of putative progenitor endothelial cells for angiogenesis. Science 275, 964-967.

Avital, L, Inderbitzin, D., Aoki, T., Tyan, D.B., Cohen, A.H., Ferraresso, C,

Baumhueter, S., Dybdal, N., Kyle, C, and Lasky, L. (1994). Global vascular expression of murine CD34 a sialomucin-like endothelial ligand for L-selectin. Blood 84:2554. Ben-Shushan, E., Thompson, J. R., Gudas, L. J., and Bergman, Y. (1998).

Rex- 1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox- 1, binding to an adjacent site. MoI Cell Biol 18: 1866-78.

00269113

Bierhuizen, M. F., Westerman, Y., Visser, T. P., Dimjati, W., Wognum, A.

W., and Wagemaker , G. (1997). Enhanced green fluorescent protein as selectable marker of retroviral-mediated gene transfer, in immature hematopoietic bone marrow cens. Blood 90:3304-15. Bjorklund, A., and Lindvall, O. (2000). Cell replacement therapies for central nervous system disorders. NatNeurosci 3: 537-44.

Bjornson, C, R. Rietze, B. Reynolds, M. Magli, and A. Vescovi. (1999). Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science. 283:354-357. Blondel, O., Collin, C, McCarran, W. J., Zhu, S., Zamostiano, R., Gozes, L,

Brenneman, D. E., and McKay, R. D. (2000). A glia-derived signal regulating neuronal differentiation. JNeurosci.20:8012-20.

Bradley, A. (1987). Production and analysis of chimaeric mice. In Teratocarcinomas and ES Cells: A Practical Approach. E.J. Robertson, ed. Oxford: IRL Press, 113-151.

Brazelton, T. R., Rossi, F. M. V., Keshet, G. I., and Blau, H. E. (2000). From Marrow to Brain: Expression of Neuronal Phenoτypes in Adult Mice. Science 290:1775-1779.

Bruder, S., etal, U.S. Patent No. 5,736,396 Brustle, O., Jones, K., Learish, R., Karram, K., Choudhary, K., Wiestler, O.,

Duncan, L ₅ and McKay, R. (1999). ES Cell-Derived Glial Precursors: A Source of Myelinating Transplants. Science 285:754-6.

Brustle, O., Spiro, A. C, Karram, K., Choudhary, K., Okabe, S., and McKay, R. D. (1997). ES cells differentiate into oligodendrocytes and myelinate in culture and after spinal cord transplantation. Proc. Natl. Acad. ScL USA 94:14809-14814.

Butler, D., (1999) FDA warns on primate xenotransplants. Nature 398:549.

Caplan, A., et al, U.S. Patent No. 5,486,359

Caplan, A., et al, U.S. Patent No. 5,811,094

Caplan, A., et al, U.S. Patent No. 5,837,539 Cassiede P., Dennis, J. E., Ma, F., Caplan, A. L, (1996). Osteochondrogenic potential of marrow mesenchymal progenitor cells exposed to TGF-beta 1 or PDGF- BB as assayed in vivo and in vitro. J Bone Miner Res. 9:1264-73.

00269113

Cereghini, S. (1996). Liver-enriched transcription factors and hepatocyte differentiation. FASEB J.10:267-82.

Choi, K. (1998). Hemangioblast development and regulation. Biochem Cell Biol. 76:947-956. Choi, K., M. Kennedy, A. Kazarov, J.C. Papadimitriou, and G. Keller.

(1998). A common precursor for hematopoietic and endothelial cells. Development. 125:725-732.

Ciccolini, F., and Svendsen, C. N. (1998). Fibroblast growth factor 2 (FGF- 2) promotes acquisition of epidermal growth factor (EGF) reponsiveness in mouse striata] precursor cells: Identification of neural precursors responding to both EGF and FGF-2. J Neuroscience 18:7869-7880.

Clarke, D. L., Johansson, C. B., Wilbertz, J., Veress, B., Nilsson, E., Karlstrom, H., Lendahl, U., and Frisen, J. (2000). Generalized potential of adult NSCs. Science 288:1660-3. Conway, E.M., Collen, D., and Carmeliet, P. (2001). Molecular mechanisms of blood vessel growth. Cardiovasc Res. 49:507-521.

Corbeil, D., Roper, K., Hellwig, A., Tavian, M., Miraglia, S,. Watt, S.M., Simmons, P.J., Peault, B., Buck, D.W., and Huttner, W.B. (2000). The human AC 133 HSC antigen is also expressed in epithelial cells and targeted to plasma membrane protrusions. J Biol Chem. 275:5512-5530.

Crosby, H.A., Kelly, D. A., and Strain, AJ.2001. Human hepatic stem-like cells isolated using c-kit or CD34 can differentiate into biliary epithelium. Gastroenterology. 120:534-544.

Daadi, M. M., and Weiss, S. (1999). Generation of tyrosine hydroxylase- producing neurons from precursors of the embryonic and adult forebrain. J NeurosciΛ9:4484-97.

Dahlstrand, J., Lardelli, M., and Lendahl, U. (1995). Nestin mRNA expression correlates with the central nervous system progenitor cell state in many, but not all, regions of developing central nervous system. Brain Res Dev Brain Res. 84:109-29.

Devon R. S., Porteous D. J., and J., B. A. (1995). Splink-erettes improved vectorettes for greater efficiency in PCR walking. Nucleic Acids Res 23:1644-1645.

DiGuisto, etal, U.S. Patent No.5,681,599

00269H3

Doetsch, F., Caille, I., Lim, D. A., Garcia- Verdugo, J. M., and Alvarez-

Buylla, A. (1999). Subventricular zone astrocytes are NSCs in the adult mammalian brain. Cell 97:703-716.

Eliceiri, B.P., and Cheresh, D.A. (2000). Role of alpha v integrins during angiogenesis. Cancer J Sci Am. 6, Suppl 13:S245-249.

Evans, et al., (1992). J. Am. Med. Assoc, 267:239-246.

Faloon, P., Arentson, E., Kazarov, A., Deng, C. X., Porcher, C, Orkin, S., and Choi, K. (2000). Basic fibroblast growth factor positively regulates hematopoietic development. Development. 127:1931-1941. Fei, R., et al, U.S. Patent No.5,635,387

Ferrari, G., Cusella-De Aήgelis, G., Coletta, M., Paolucci, E., Stornaiuolo, A., Cossu, G., and Mavilio, F. (1998). Muscle regeneration by bone marrow- derived myogenic progenitors. Science 279:528-30.

Flax, J. D., Sanjay, A., Yang, C, Simonin, C, Wills, A. M., Billinghurst, L. L., Jendoubi, M., Sidman, R. L., Wolfe, J. H., Kim, S. E., and Snyder, E. Y. (1998). Engraftable human NSCs respond to developmental cues replace neurons and express foreign genes. Nature Biotech 16:1033-1038.

Fong, G. H., Zhang, L., Bryce, D. M., and Peng, J. (1999). Increased hemangioblast commitment, not vascular disorganization, is the primary defect in flt-1 knock-out mice. Development. 126:3015-3025.

Franco Del Arno, F., Gendron-Maguire, M., Swiatek, P. J., and Gridley, T. (1993). Cloning, sequencing and expression pf the mouse mammalian achaete-scute homolog a (MASH 1 ). Biochem Biophys Acta 1171 :323-7.

Frankel, M. S. (2000). In Search of Stem Cell Policy. Science 298:1397. Fridenshtein, A. (1982). Stromal bone marrow cells and the hematopoietic microenvironment. Arkh Patol 44:3-11.

Furcht et al International Application No. PCT/USOO/21387.

Gage, F. H. (2000). Mammalian NSCs. Science 287:1433-1438.

Gage, F., Coates, P., Palmer, T., Kuhn, H., Fisher, L., Suhonen, J., Peterson, D., Suhr, S., and Ray, J. (1995). Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain. Proc Natl Acad Sci USA 92Λ1879- 83.

00269113

Gehling, U.M., Ergun, S., Schumacher, U., Wagener, C, Pantel , K., Otte,

M., Schuch, G., Schafhaυsen, P., Meiide, T., Kilic, N., Kluge, K., Schafer, B., Hossfeld, D.K. and Fiedler, W. (2000). In vitro differentiation of endothelial cells from AC 133-positive progenitor cells. Blood. 95:3106-3112. Gritti, A., Frolichsthal-Schoeller, P., Galli, R., Parati, E. A., Cova, L.,

Pagano, S. F., Bjornson, C. R., and Vescovi, A. L. (1999). Epidermal and fibroblast growth factors behave as mitogenic regulators for a single multipotent stem cell-like population from the subventricular region of the adult mouse forebrain. JNeurosci. 19:3287-97. Gronthos, S., Graves, S., Ohta, S., and Simmons, P. (1994). The STRO-1+ ^' fraction of adult human bone marrow contains the osteogenic precursors. Blood 84: 4164-73.

Guenechea, G., Gan, O., Dorrell, C, and Dick, J. E. (2001). Distinct classes of human stem cells that differ in proliferative and self-renewal potential. Nat Immunol 2:75-82.

Gussoni, E., Soneoka, Y., Strickland, C, Buzney, E., Khan, M., Flint, A., Kunkel, L., and Mulligan, R. (1999). Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401 :390-4.

Hamazaki, T., liboshi, Y., Oka, M., Papst, PJ., Meacham, A.M., Zon, L.I., and Terada, N.2001. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett 497:15-19.

Haralabopoulos, G.C., D.S. Grant, H.K. Kleinman, and M.E. Maragoudakis. (1997). Thrombin promotes endothelial cell alignment in Matrigel in vitro and angiogenesis in vivo. Am J Physiol. 273:C239-245. Hedlund, E., Gustafsson, J.A., and Warner, M. (2001). Cytochrome P450 in the brain; a review. Curr DrugMetαb 2:245-263.

Hill, B., Rozler, E., Travis, M., Chen, S., Zannetino, A., Simmons, P., GaIy, A., Chen, B., Hoffman, R. (1996). High-level expression of a novel epitope of CD59 identifies a subset of CD34+ bone marrow cells highly enriched for pluripotent stem cells. Exp Hemαtol. 8:936-43.

Hirashima, M., H. Kataoka, S. Nishikawa, N. Matsuyoshi , and S.Nishikawa. (1999). Maturation of ES cells into endothelial cells in an invitro model of vasculogenesis. Blood. 93:1253-1263.

00269113

Holash, J., Maisonpierre, P.C., Compton, D., Boland, P., Alexander, C.R.,

Zagzag, D., Yancopoulos, G.D., and Wiegand, SJ. (1999). Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science. 284:994-998. Hu, Z., Evarts, R. P., Fujio, K., Marsden, E. R., and Thorgeirsson, S. S.

(1993). Expression of hepatocyte growth factor and c-met genes during hepatic differentiation and liver development in the rat. Am JPatholΛ42:l 823-30.

Iyer, V.R., Eisen, M.B., Ross, D.T., Schuler, G., Moore, T., Lee, J.C.F., Trent, J.M., Staudt, L.M., Hudson, JJ., Boguski, M.S., Lashkari, D., Shalon, D., Botstein, D., and Brown, P.O. (1999). The transcriptional program in the response of human fibroblasts to serum. Science. 283:83-87.

Jackson, K., Majka, S. M., Wang, H., Pocius, J., Hartley, C, Majesky, M. W., Entman, M. L., Michael, L., Hirschi, K. K., and M.A., G. (2001). Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J CHn Invest 107:1395-1402.

Jackson, K., Mi, T., and Goodell, M. A. (1999). Hematopoietic potential of stem cells isolated from murine skeletal muscle. Proc Natl Acad Set USA 96:14482-6.

Jaiswal, N., et al., (1997). J. Cell Biochem. 64(2):295-312. Jarukamjorn, K., Sakuma, T., Miyaura, J., and Nemoto, N. (1999). Different regulation of the expression of mouse hepatic cytochrome P4502B enzymes by glucocorticoid and phenobarbital. Arch Biochem Biophys 369:89-99.

Jiang, Y.2002. Submitted.

Johansson, C. B., Momma, S., Clarke, D. L., Risling, M., Lendahl, U., and Frisen, J. (1999). Identification of a NSC in the adult mammalian central nervous system. Cell. 96:25-34.

Johnstone, B., Hering, T. M., Caplan, A. L, Goldgberg, V. M., Yoo, J. U. (1998). In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res. 1:265-72. Jordan, C. T., and Van Zant, G. (1998). Recent progress in identifying genes regulating HSC function and fate. Curr Opin Cell Biol. 10:716-20.

Jordan, C, McKearn, J., and Lemischka, I. (1990). Cellular and developmental properties of fetal HSCs. Cell 61:953-963.

00269113

Kim, T.H., Mars, W.M., Stolz, D.B., Petersen, B.E., and Michalopoulos,

G.K. (1997). Extracellular matrix remodeling at the early stages of liver regeneration in the rat. Hepatology 26:896-904.

Kopen, G., D. Prockop, and D. Phinney. 1999. Marrow stromal cells migrate throughout forebrain and cerebellum, and they differentiate into astrocytes after injection into neonatal mouse brains. Proc Natl Acad Sci U S A. 96: 10711 - 10716.

Kourembanas, S., Morita, T., Christou, H., Liu, Y., Koike, H., Brodsky, D-, Arthur, V., and Mitsial, S.A. (1998). Hypoxic responses of vascular cells. Chest. 11 (Suppl 1):25S-28S. Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O., Hwang, S.,

Gardner, R., Neufeel, S., and Sharkis, S. I. (2001). Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105:369-77.

Lagasse, E., Connors, H., AI-Dhalimy, M., Reitsma, M., Dohse, M., Osborne, L., Wang, X., Finegold, M., Weissman, I.L., and Grompe, M. (2000): Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med. 6:1229-1234.

Larsson, J., Goumans, M J., Sjostrand, LJ., van Rooijen, M. A., Ward, D., Leveen, P., Xu, X., ten Dϊjke, P., Mummery, C.L., and Karlsson, S. (2001). Abnormal angiogenesis but intact hematopoietic potential in TGF-beta type I receptor-deficient mice. EMBO J. 20: 1663-1673.

Lazar, A., Peshwa, M. V., Wu, F. J., Chi, C. M., Cerra, F. B., and Hu, W. S. (1995). Formation of porcine hepatocyte spheroids for use in a bioartificial liver. Cell Transplant 4:259-68.

Lee, S. H., Lumelsky, N., Studer, L., Auerbach, J. M., and McKay, R. D. (2000). Efficient generation of midbrain and hindbrain neurons from mouse ES cells. Nat Biotechnol 18:675-9.

Lewis, I. D., Almeida-Porada, G., Du, J., Lemischka, I. R., Moore, K. A., Zanjani, E. D., and Verfaillie, C. M. (2001). Long-term repopulating cord blood stem cells are preserved after ex-vivo culture in a non-contact system. Blood 97:441- 9.

Li, C.X., and Poznansky, MJ. (1990). Characterization of the ZO-I protein in endothelial and other cell lines. J Cell Sci. 2:231 -7. 97:231-237.

00269H3

U-Masters, T., and Morgan, E.T. 2001. Effects of bacterial lipopolysaccharide on Phenobarbital-induced CYP2B expression in mice. Drug Metab Dispos 29:252-257.

Lm ₅ Y., Weisdorf, D. J., Solovey, A., and Hebbel, R. P. (2000). Origins of circulating endothelial cells and endothelial outgrowth from blood. J CHn InvesJ 105:71-7.

Liu, S., Qu, Y., Stewart, T. J., Howard, M. J., Chakrabortty, S., Holekamp, T. F., and McDonald, J. W. (2000). ES cells differentiate into oligodendrocytes and myelinate in culture and after spinal cord transplantation. Proc Natl Acad Sci USA 97:6126-31.

Mahley, R.W., and Ji, Z.S. (1999). Remnant lipoprotein metabolism: key pathways involving cell-surface heparan sulfate proteoglycans and apolipoprotein E. J Lipid Res 40:1-16.

Martin, G.R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocaracinoma stem cells. Proc Natl Acad Sci U.S.A. 12:7634-8.

Masinovsky, B., U.S. Patent No. 5,837,670

Mathon, N. F., Malcolm, D. S., Harrisingh, M. C, Cheng, L., and Lloyd, A. C. (2001). Lack of Replicative Senescence in Normal Rodent GHa. Science 291:872- 875.

McGlave, et at, U.S. Patent No. 5,460,964

Meager, A. (1999). Cytokine regulation of cellular adhesion molecule expression in inflammation. Cytokine Growth Factor Rev. 10:27-39.

Medvinsky, A., and Dzierzak, E. (1996). Definitive hematopoiesis is autonomously initiated by the AGM region. Cell. 86:897.

Melton, D. (1997). Signals for tissue induction and organ formation in vertebrate embryos. Harvey Led 93:49-64.

Mezey, E., Chandross, K. J., Harta, G-, Maki, R.A., and McKercher, S. R. (2000). Turning Blood into Brain: Cells Bearing Neuronal Antigens Generated in vivo from Bone Marrow. Science 290:1779-1782.

Miyajima, A., Kjnoshita, T., Tanaka, M., Kamiya, A., Mukouyama, Y., arid Hara, T. (2000). Role of Oncostatin M in hematopoiesis and liver development. Cytokine Growth Factor Rev 11:177-183.

00269113

Morrison, S. J., White, P. M., Zock, C, and Anderson, D. J. (1999).

Prospective identification isolation by flow cytometry and in vivo self-renewal of multipotent mammalian neural crest stem cells. Cell. 96:737-749.

Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D., Chambers, L, Scholer, H., and Smith, A. (1998). Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct 4. Cell 95:379-91.

Nishikawa, S., Nishikawa, S., Hirashima, M., Matsuyoshi, N., and Kodama, H. (1998). Progressive lineage analysis by cell sorting and culture identifies FLKI+VEcadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development 125:1747-1757.

Nishikawa, S.I., Nishikawa, S., Kawamoto, H., Yoshida, H., Kizumoto, M., Kataoka, H. and Katsura, Y. (1998). In vitro generation of lymphohematopoietic cells from endothelial cells purified from murine embryos. Immunity. 8:761-769. Niwa, H., Miyazaki, J., and Smith, A. G. (2000). Quantitative expression of

Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372-6.

Nolta, J., Dao, M., Wells, S., Smogorzewska, E., and Kohn, D. (1996). Transduction of pluripotent human HSCs demonstrated by clonal analysis after engraftment in immune-deficient mice. Proc Natl Acad Sd USA 93:2414-9.

Odorico, J. S., Kaufman, D. S., and Thomson, J. A. (2001). Multilineage differentiation from human ES cell lines. Stem Cells 19:193-204.

Oh, S.H., Miyazaki, M., Kouchi, H., Inoue, Y., Sakaguchi, M., Tsuji, T., Shima, N., Higashio, K., and Namba, M. (2000). Hepatocyte growth factor induces differentiation of adult rat bone marrow cells into a hepatocyte lineage in vitro. Biochem Biophys Res Commun 279:500-504.

Okabe, S., Forsberg-Nilsson, K., Spiro, A. C, Segal, M., and McKay ,-R. D. (1996). Development of neuronal precursor cells and functional postmitotic neurons from ES cells in vitro. Mech Dev 59:89-102. O'Leary, D. D., and Wilkinson, D. G. (1999). Eph receptors and ephrins in neural development. CuffOpin Neurobiol 9:65-73.

Qrkin, S. (1998). Embryonic stem cells and transgenic mice in the study of hematopoiesis. Int. J. Dev. Biol.42:927-34.

00269113

Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, L, Anderson, S. M., Li, B.,

Pickel, J., McKay, R., Nadal-Ginard, B., Bodine, D. M., Leri, A., and Anversa, P. (2001). Bone marrow cells regenerate infarcted myocardium. Nature 410:701-5.

O'Shea, K. (1999). ES cell models of development. Anat Rec 15:32-41. Palmer, T. D., Markakis, E. A., Willhoite, A. R., Safar, F., and Gage, F. H.

(1999). Fibroblast growth factor-2 activates a latent neurogenic program in NSCs from diverse regions of the adult CNS. JNeurosci 19:8487-97.

Palmer, T. D., Takahashi, J., and Gage, F. H. (1997). The adult rat hippocampus contains primordial NSCs. MoI Cell Neurosci 8:389-404. Partanen, J., and DJ. Dumont. (1999). Functions of Tie 1 and Tie2 receptor tyrosine kinases in vascular development. Curr Top Microbiol Immunol. 237:159- 172.

Peault, B. 1996. Hematopoiedc stem cell emergence in embryonic life: developmental hematology revisited. J. Hematother. 5:369. Peichev, M., Naiyer, A.J., Pereira, D., Zhu, Z., Lane, WJ., Williams, M., Oz,

M.C., Hicklin, DJ., Witte, L., Moore, M.A., and Rafii, S. (2000). Expression of VEGFR 2 and AC133 by circulating human CD34(+) cells identifies a population of functional endothelial precursors. Blood. 95:952-958.

Peshwa, MV, WU FJ, Follstad BD, Cerra, F.B., and Hu, W.S. 1994. Kinetics of hepatocyte spheroid formation. Biotechnology Progress 10:460-466.

Petersen, B. E., Bowen, W. C, Patrene, K. D., Mars, W. M., Sullivan, A. K., Murase, N., Boggs, S. S., Greenberger, J. S., and Goff, J. P. (1999). Bone marrow as a potential source of hepatic oval cells. Science 284:1168-1170.

Petersen, B.E.2001. Hepatic "stem" cells: coming full circle. Blood Cells MoI Dis 27:590-600.

Petersen, B.E., Bowen, W.C., Patrene, K.D., Mars, WJSl., Sullivan, A.K., Murase, N., Boggs, S.S., Greenberger, J.S., and Goff, J.P. 1999. Bone marrow as a potential source of hepatic oval cells. Science 284:1168-1170.

Petzelbauer, P., Halama, T., and Groger, M. (2000). Endothelial adherens junctions. Jlnvestig Dermatol Symp Proc. 5:10-13.

Pittenger, M. F., Mackay, A. M., Beck, S. C ₅ Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S., and Marshak, D. R. (1999). Multilineage potential of adult human MSCs. Science 284:143-147.

00269113

Pittenger, M., U.S. Patent No. 5,827,740

Ploemacher, R. E., and Brons, N. H. (1988), Isolation of hemopoietic stem cell subsets from murine bone marrow: I. Radioprotective ability of purified cell suspensions differing in the proportion of day-7 and day- 12 CFU-S. Exp Hematol 16:21-6.

Potten, C. (1998). Stem cells in gastrointestinal epithelium: numbers, characteristics and death. Philos Trans R Soc Lond B Biol Sd 353:821-30.

Prochazka, M., H.R. Gaskins, L.D. Shultz, and E.H. Leiter. (1992). The nonobese diabetic scid mouse: model for spontaneous thymomagenesis associated with immunodeficiency. Proc Natl Acad Sd USA. 89:3290-3294.

Rader, D. J., and Dugi, K.A. (2000). The endothelium and lipoproteins: insights from recent cell biology and animal studies. Semin Thromb Hemost 26:521-528.

Rafii, S., F. Shapiro, J. Rimarachin, R. Nachman, B. Ferris, B. Weksler, M. Moore, arid A. Asch. (1994). Isolation and characterization of human bone marrow microvascular endothelial cells: hematopoietic progenitor cell adhesion. Blood. 84:10-20.

Rafii, S., Shapiro, F., Pettengell, R., Ferris, B., Nachman, R., Moore, M., and Asch, A. (1995). Human bone marrow microvascular endothelial cells support long- term proliferation and differentiation of myeloid and megakaryocytic progenitors.

Reinhardt, R. L., Khoruts, A.; Merica* R., ZeIl, T., and Jenkins, M. K. (2001). Visualizing the generation of memory CD4 T cells in the whole body. Nature 401:101-105. Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A., and Bongso, A.

(2000). ES cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotech 18:399-404.

Reyes, M., and Verfaillie, CM. (2001). Characterization of multipotent adult progenitor cells, a subpopulation of mesenchymal stem cells. Ann N Y Acad Sd 938:231-233; discussion 233-235.

Reyes, M., Lund, T., Lenvik, T., Aguiar, D., Koodie, L., and Verfaillie, CM. (2001). Purification and ex vivo expansion of postnatal human marrow mesodermal progenitor cells. Blood. 98:2615-2625.

00269113

Reynolds, B., and Weiss, S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255:1707-10.

Reynolds, B., and Weiss, S. (1996). Clonal and population analyses demonstrate that an EGF-responsive mammalian embryonic CNS precursor is a stem cell. Dev Biol 175: 1-13

Ribatti, D., A. Vacca, B. Nico, L. Roncali, and F. Dammacco. (2001). Postnatal vasculogenesis. MechDev. 100:157-163.

Richards, L. J., Kilpatrick, T. J., and Bartlett, P. F. (1992). De novo generation of neuronal cells from the adult mouse brain. Proc Natl Acad Set USA. 89:8591-5.

Rideout, W. M., 3rd, Wakayama, T., Wutz, A., Eggan, K., Jackson-Grusby, L., Dausman, J., Yanagimachi, R., and Jaenisch, R. (2000). Generation of mice from wild-type and targeted ES cells by nuclear cloning. Nat Genet 24:109-10. Robertson, S. M., Kennedy, M., Shannon, J. M., Keller, G. (2000). A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development 11 :2447-59.

Rosenberg, J.B., P.A. Foster, RJ. Kaufman, E.A. Vokac, M. Moussalli, P.A. Kroner, and R.R. Montgomery. (1998). Intracellular trafficking of factor VIII to von Willebrand factor storage granules. J CHn Invest. 101:613-624.

Rozga, J., Arnaout, W.S., and Demetriou, A.A. (2001). Isolation, characterization, -derived hepatocyte stem cells. Biochem Biophys Res Commun 288:156-164.

Ryder, E. F., Snyder, E. Y., and Cepko, C. L. (1990). Establishment and characterization of multipotent neural cell lines using retrovirus vector-mediated oncogene transfer. JNeurobiol 21:356-375.

Sah, D. W., Ray, J., and Gage, F. H. (1997). Regulation of voltage- and ligand-gated currents in rathippocampal progenitor cells in vitro. JNeurobiol 32:95- 110. Sanchez-Ramos, J., Song, S., Cardόzo-Pelaez, F., Hazzi, C ₅ Stedeford, T.,

Willing, A., Freeman, T. B., Saporta, S., Janssen, W., Patel, N., Cooper, D. R., and Sanberg, P. R. (2000). Adult bone marrow stromal cells differentiate into neural cells in vitro. Exp Neurol. 164:247-56.

00269113

Saucedo-Cardenas, O., Quintana-Hau, J. D., Le, W. D., Smidt, M. P., Cox, J.

J., De Mayo, F., Burbach, J. P., and Conneely, O. M. (1998). Nurrl is essential for the induction of the dopaminergic phenotype and the survival of ventral mesencephalic late dopaminergic precursor neurons. Proc Natl Acad Sd USA 95: 4013-8.

Scherf, U., D.T. Ross, M. Waltham, L.H. Smith, J.K. Lee, L. Tanabe, KW. Kohn, W.C. Reinhold, T.G. Myers, D.T. Andrews, D.A. Scudiero, M.B. Eisen, E.A. Sausville, Y. Pommier, D. Botstein, P.O. Brown, and J.N. Weinstein. (2000). A gene expression database for the molecular phafmacology of cancer. Nat Biotech. 24:236-244.

Scholer, H. R., Hatzopoulos, A. K., Balling, R., Suzuki, N., and Grass, P. (1989). A family of octamer-specifϊc proteins present during mouse embryogenesis: evidence for germline-specifϊc expression of an Oct factor. EMBO J 8:2543-50.

Schuldiner, M., Yanuka, O., Itskovitz-Eldor, J., Melton, D. A., and Benvenisty, N. (2000). From the cover: effects of eight growth factors on the differentiation of cells derived from human ES cells. Proc Natl Acad Sd U SA 97:11307-12.

Schwartz, et al, U.S. Patent No. ,759,793

Seglen, P.O. (1976). Preparation of isolated rat liver cells. Methods Cell Biol 13:29-83.

Shamblott, M., Axelman, J., Wang, S., Bugg, E., Littlefield, J., Donovan, P., Blumenthal, P., Huggins, G., Gearhart, J.: (1998) Derivation of pluripotent stem cells from cultured human primordial germ cells. Proc. Natl. Acad. ScL U.SA. 95:13726-31. Shen, C.N., Slack, J.M., and Tosh, D. (2000). Molecular basis of transdifferentiation of pancreas to liver. Nat Cell Biol. 2:879-887.

Shi, Q., S. Rafii, M. Hong-De Wu, E.S. Wijelath, C. Yu, A. Ishida, Y. Fujita, S. Kothari, R. MoMe, L.R. Sauvage, M.A.S. Moore, R.F. Storb, and W.P. Hammond. (1998). Evidence for circulating bone marrow-derived endothelial cells. Blood. 92:362-367.

Shih, CC, Y. Weng, A. Mamelak, T. LeBon, M.C. Hu, and S. Forman. (2001). Identification of a candidate human neurohematopoietic stem-cell population. Blood. 98:2412-2422.

00269113

Simeone, A. (1998). Otxl and Otx2 in the development and evolution of the mammalian brain. EMBO 117:6790-8.

Simmons, P., et al, U.S. Patent No. 5,677,136

Soule HD, et al. (1973) A human cell line from a pleural effusion derived from a breast carcinoma. J Natl Cancer Inst; 51 (5): 1409- 16.

Southern, P. J., Blount, P., and Oldstone, M. B. (1984). Analysis of persistent virus infections by in situ hybridization to whole-mouse sections. Nature 312:555-8.

Steeber, D.A., and T. Tedder, F. (2001). Adhesion molecule cascades direct lymphocyte recirculation and leukocyte migration during inflammation. Immunol Res. 22:299-317.

Steinberg, D., Pittman, R.C. and Carew, T.E. (1985). Mechanisms involved in the uptake and degradation of low density lipoprotein by the artery wall in vivo. Ann N Y Acad ScL 454:195-206. Studer, L., Spenger, C, Seller, R., Othberg, A., Lindvall, O., and Odin, P.

(1996). Effects of brain-derived neurotrophic factor on neuronal structure of dopaminergic neurons in dissociated cultures of human fetal mesencephalon. Exp Brain Res 108:328-36.

Suhonen, J., Peterson, D., Ray, J., and Gage, F. (1996). Differentiation of adult hippocampus-derived progenitors into olfactory neurons in vivo. Nature 383:624-7.

Svendsen, C. N., and Caldwell, M. A. (2000). NSCs in the developing central nervous system: implications for cell therapy through transplantation. Prog Brain Res. 127:13-34. Svendsen, C. N., Caldwell, M. A., Ostenfeld, T. (1999). Human neural stem cells: Isolation, expansion and transplantation. Brain Path 9:499-513.

Tang, D. G., Tokumoto, Y. M., Apperly, J. A., Lloyd, A. C, and Raff, M. C. (2001). Lack of replicative senescence in cultured rat oligodendrocyte precursor cells. Science 291:868-71. Tedder, T., Steeber, D., Chen, A., and Engel, P. ( 1995). The selections: vascular adhesion molecules. FASEBJ.9:866.

00269113

Theise, N. D., Badve, S., Saxena, R., Henegariu, O., Sell, S., Crawford, J.

M., and Krause, D. S. (2000). Derivation of hepatocytes from bone mairow cells in mice after radiation-induced myeloablation. Hepatology 31:235-40.

Theise, N.D., Saxena, R., Portmann, B.C., Thung, S.N., Yee, H., Chiriboga, L., Kumar, A., and Crawford, J.M. (1999). The canals of Hering and hepatic stem cells in humans. Hepatology 30:1425-1433.

Thomson, J. A., Itskovitz-Eldor, J., Shapiro, S. S., Waknitz, M. A., Swiergiel, J. J., Marshall, V. S., and Jones, J. M. (1998). ES cell lines derived from human blastocysts. Science 282:114-7. Thomson, J., Kalisman J., Golos, J., Durning, M., Harris, C, Becker, R.,

Hearn, J. (1995) Isolation of a primate embryonic stem cell line. Proc. Natl. Acad. ScI U.S.A. 92:7844-8,

Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A. S., Sieber, B. A., Grigoriou, M., Kilkenny, C, Salazar-Grueso, E., Pachnis, V., and Arumae, U. (1996). Functional receptor for GDNF encoded by the c-ret proto-oncogene. Nature 381:785-9.

Tsai, R. Y. and McKay, R.D: (2000). Cell contact regulates fate choice by cortical stem cells. /. Neurosci. 20:3725-35.

Tsukamoto, etal, U.S. Patent No. 5,750,397 Tsukamoto, et al, U.S. Patent No. 5,716,827

Tzanakakis, E.S., Hansen, L.K., and Hu, W.S. (2001). The role of actin filaments and microtubules in hepatocyte spheroid self-assembly. Cell Motil Cy toskeleton 48:175-189.

Tzanakakis, E.S., Hsiao, CC, Matsushita, T., Remmel, R.P., and Hu, W.S. (2001). Probing enhanced cytochrome P4502B 1 /2 activity in rat hepatocyte spheroids through confocal laser scanning microscopy. Cell Transplant. 10:329342.

Uchida, N., Buck, D. W., He, D., Reitsma, MJ., Masek, M., Phan, T.V., Tsukamoto, A.S., Gage, F.H., and Weissman, I.L. (2000). Direct isolation of human central nervous system stem cells. Proc Natl Acad Sd USA. 97:14720-14725. Van Rijen, H., van Kempen, MJ., Analbers, LJ., Rook, M.B., van

Ginneken, A.C, Gros, D., and Jongsma, HJ. (1997). Gap junctions in human umbilical cord endothelial cells contain multiple connexins. Am J Physiol. 272:C117-130.

00269113

Verfaillie, C, Miller, W., Boylan, K., McGlave, P. (1992). Selection of benign primitive hematopoietic progenitors in chronic myelogenous leukemia on the basis of HLA-DR antigen expression. Blood. 79:1003-1010.

Vescovi, A. L., Paraati, E. A., Gritti, A., Poulin, P., Ferrario, M., Wanke, E., Frolichsthal-Schoeller, P., Cova, L., Arcellana-Panlilio, M., Colombo, A., and Galli, R. (1999). Isolation and cloning of multipotential stem cells from the embryonic human CNS and establishment of transplantable human NSC lines by epigenetic stimulation. Exp Neurol 156:71-83.

Vescovi, A., Reynolds, B., Fraser, D., and Weiss, S. (1993). bFGF regulates the proliferative fate of unipotent (neuronal) and bipotent (neuronal/astroglial) EGF- generated CNS progenitor cells. Neuron 11: 951-66.

Vischer, UJM., H. Barth, and CB. Wollheim. (2000). Regulated von Willebrand factor secretion is associated with agonist-specific patterns of cytoskeletal remodeling in cultured endothelial cells. Arterioscler Thromb Vase Biol. 20:883-891.

Wagner, D.D., Olmsted, J.B., and Marder, VJ. (1982). Immunolocalization of von Willebrand protein in Weibel-Palade bodies of human endothelial cells. J. Cell Biol. 95:355-360.

Wagner, J., Akerud, P., Castro, D. S., Holm, P. C, Canals, J. M., Snyder, E. Y., Perlmann, T., and Arenas, E. (1999). Induction of a midbrain dopaminergic phenotype in Nurrl-overexpressing NSCs by type 1 astrocytes. Nat Biotech 17:653- 9.

Wakitani, S., Saito, T., and Caplari, A. (1995). Myogenic cells derived from rat bone marrow MSCs exposed to 5-azacytidine. Muscle Nerve 18: 1417-26. Wang, X., AI-Dhalimy, M., Lagasse, E., Finegold, M., and Grompe, M.

(2001). Liver repopulation and correction of metabolic liver disease by transplanted adult mouse pancreatic cells. Am J Pathol 158:571-579.

Watt, F. (1997). Epidermal stem cells: markers patterning and the control of stem cell fate. Philos Trans R Soc LondB Biol Sci 353: 831-6. Watt, S., Gschmeissner, S., and Bates,P. (1995). PECAM-I : its expression and function as a cell adhesion molecule on hemopoietic and endothelial cells. Leuk Lymph. 17:229.

00269113

Weiss, M. J., Orkin, S. H. (1995) GATA transcription factors: key regulators of hematopoiesis. Exp Hematol.2:99-107.

Weissman, I. L. (2000). Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science 287:1442-6. Wells, J. M., and Melton, D. A. (2000). Early mouse endoderm is patterned by soluble factors from adjacent germ layers. Development. 127:1563-72.

Wells, J.M., and Melton, D.A. (1999). Vertebrate endoderm development. Annu Rev Cell Dev Biol 15:393-410.

Whittemore, S. R., Morassutti, D. J., Walters, W. M., Liu, R. H., and Magnuson, D. S. (1999). Mitogen and substrate differentially affect the lineage restriction of adult rat subventricuiar zone neural precursor cell populations. Exp Cell Res 252:75-95.

Williams, R. L., Hilton, D. J., Pease, S., Willson, T. A., Stewart, C. If, Gearing, D. P., Wagner, E. F., Metcalf, D., Nicola, N. A., and Gough, N. M. (1988). Myeloid leukemia inhibitory factor maintains the developmental potential of ES cells. Nature 336:684-7.

Wilmut, I., Schnieke, A. E., McWhir, J., Kind, A. J., and Campbell, EL H. (1997). Viable offspring derived from fetal and adult mammalian cells. Nature 385:810-3. Woodbury, D., Schwarz, E. J., Prockop, D. J., and Black, I. B. (2000). Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 15:364-70.

Yamashita, J., Itoh, H., Hirashima, M., Ogawa, M., Nishikawa, S., Yurugi, T., Naito, M., Nakao, K., and Nishikawa, S. (2000). Flkl-positive cells derived from ES cells serve as vascular progenitors. Nature. 408:92-96.

Yang, J., Nagavarapu, U., Relloma, K., Sjaastad, M.D., Moss, W.C., Passaniti, A., and Herron, G.S. (2001). Telomerized human microvasculature is functional in vivo. Nat Biotechnol. 19:219-224.

Ye, W., Shimamura, K., Rubenstein, J., Hynes, M., and Rosenthal, A. (1998). FGF and Shh signals control dopaminergic and serotonergic cell fate in the anterior neural plate. Cell 93:755-66.

00269U3

Yoneya, T., Tahara, T., Nagao, K., Yamada, Y., Yamamoto, T., Osawa, M.,

Miyatani, S., and Nishikawa, M. (2001). Molecular cloning of delta-4, a new mouse and human Notch ligand. JBiochem. 129:27-34.

Yoo, J. U., Barthel, T. S., Nishimura, K., Solchaga, L., Caplan, A. L, Goldberg, V. M., Johnstone, B. (1998). Then chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J Bone Joint Surg Am. 12:1745-57.

Young, H., et al, U.S. Patent No. 5,827,735

Zambrowicz, B. P., Imamoto, A., Hering, S., Herzenberg, L. A., Kerr, W. G., and Soriano, P. (1997). Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc Natl Acad Sd USA. 94:3789-94.

Zaret, K.S. (2000). Liver specification and early morphogenesis. Mech Dev 92:83- 88. Zaret, K.S. (2001). Hepatocyte differentiation: from the endoderm and beyond. Curr Opin Genet Dev. 11:568-574.

Zelko, L, and Negishϊ, M. (2000). Phenobarbital-elicited activation of nuclear receptor CAR in induction of cytochrome P450 genes. Biochem Biophys Res Commun. 277:1-6. Zhao, R. C. H., Jiang, Y., and Verfaillie, C. M. (2000). A model of human p210BCW"BL mediated CML by transducing primary normal human CD34+ cells with a BCR/ABL containing retroviral vector. Blood. 97:2406-12.

Ziegler, B., M. Valtieri, G. Porada, R. De Maria, R. Muller, B. Masella, M. Gabbianelli, I. Casella, E. Pelosi, T. Bock, E. Zanjani, and C. Peschle. (1999). KDR Receptor: A Key Marker Defining HSCs. Science. 285:1553 1558.

00269113

MULTIPOTENT ADULT STEM CELLS AND METHODS FOR ISOLATION

Portions of the present invention were made with support of the United States Government via a grant from the National Institutes of Health/National Institute of Allergy and Infectious Diseases to Morayama Reyes under grant number 1F31 AI-GnlO291. The U.S. Government may therefore have certain rights in the invention.

Field of the Invention

The invention relates generally to methods for isolation of stem cells, cells isolated by the methods, and therapeutic uses for those cells. More specifically, the invention relates to isolated marrow-derived progenitor cells which have the potential to differentiate to form cells of a variety of cell lineages, as well as methods for isolating the cells and for inducing specific differentiation of the cells isolated by the method, and specific markers that are present in these cells such as proteins and transcription factors.

Background of the Invention

Organ and tissue generation from stem cells and their subsequent transplantation provide promising treatments for a number of pathologies, making stem cells a central focus of research in many fields. Using stem cells for generation of organs and tissues for transplantation provides a promising alternative therapy for diabetes, Parkinson's disease, liver disease, heart disease, and autoimmune disorders, to name a few. However, there are at least two major problems associated with organ and tissue transplantation. First, there is a shortage of donor organs and tissues. As few as 5 percent of the organs needed for transplant in the United States along ever become available to a recipient. (Evans, et at, J. Am. Med. Assoc. (1992) 267: 239-246.) According to the American Heart Association, only 2,300 of the 40,000 Americans who needed a new heart in 1997 received one, and the American Liver Foundation reports that there are fewer than 3,000 donors for the nearly 30,000 patients who die each

year from liver failure. The second major problem is the potential incompatibility of the transplanted tissue with the immune system of the recipient. Because the donated organ or tissue is recognized by the host immune system as foreign, anti-rejection medications must be provided to the patient at a significant cost— both financially and physically.

Xenotransplantation, or transplantation of tissue or organs from another species, could provide an alternative means to overcome the shortage of human organs and tissues. Xenotransplantation would offer the advantage of advanced planning of the transplant, allowing the organ to be harvested while still healthy and allowing the patient to undergo any beneficial pretreatment prior to transplant surgery. Unfortunately, xenotransplantation does not overcome the problem of tissue incompatibility, but instead exacerbates it. Furthermore, according to the Centers for Disease Control, there is evidence that damaging viruses cross species barriers. Pigs have become likely candidates as organ and tissue donors, yet cross-species transmission of more than one virus from pigs to humans has been documented. For example, over a million pigs were recently slaughtered in Malaysia in an effort to contain an outbreak of Hendra virus, a disease that was transmitted to more than 70 humans with deadly results. (Butler, D., Nature (1999) 398: 549.)

Stem cells: Definition and use

The most promising source of organs and tissues for transplantation therefore lies in the development of stem cell technology. Theoretically, stem cells can undergo self-renewing cell division to give rise to phenotypically and genotypically identical daughters for an indefinite time and ultimately can differentiate into at least one final cell type. By generating tissues or organs from a patient's own stem cells, or by genetically altering heterologous cells so that the recipient immune system does not recognize them as foreign, transplant tissues can be generated to provide the advantages associated with xenotransplantation without the associated risk of infection or tissue rejection.

Stem cells also provide promise for improving the results of gene therapy. A patient's own stem cells could be genetically altered in vitro, then

reintroduced in vivo to produce a desired gene product These genetically altered stem cells would have the potential to be induced to differentiate to form a multitude of cell types for implantation at specific sites in the body, of for systemic application. Alternately, heterologous stem cells could be genetically altered to express the recipient's major histocompatibility complex (MHC) antigen, or no MHC, to allow transplant of those cells from donor to recipient without the associated risk of rejection.

Stem cells are defined as cells that have extensive, some would say indefinite, proliferation potential that differentiate into several cell lineages, and that can repopulate tissues upon transplantation. The quintessential stem cell is the embryonal stem (ES) cell, as it has unlimited self-renewal and multipotent differentiation potential. These cells are derived from the inner cell mass of the blastocyst, or can be derived from the primordial germ cells from a post-implantation embryo (embryonal germ cells or EG cells). ES and EG cells have been derived from mouse, and more recently also from non-human primates and humans. When introduced into mouse blastocysts or blastocysts of other animals, ES cells can contribute to all tissues of the mouse (animal). When transplanted in post-natal animals, ES and EG cells generate teratomas, which again demonstrates their multipotency. ES (and EG) cells can be identified by positive staining with the antibodies SSEAl and SSEA4.

At the molecular level, ES and EG cells express a number of transcription factors highly specific for these undifferentiated cells. These include oct-4 and Rex-1. Also found are the LIF-R and the transcription factors sox-2 and Rox-1, even though the latter two are also expressed in non-ES cells. oct-4 is a transcription factor expressed in the pregastrulation embryo, early cleavage stage embryo, cells of the inner cell mass of the blastocyst, and in embryonic carcinoma (EC) cells, oct-4 is down-regulated when cells are induced to differentiate in vitro and in the adult animal oct-4 is only found in germ cells. Several studies have shown that oct-4 is required for maintaining the undifferentiated phenotype of ES cells, and plays a major role in determining early steps in embryogenesis and differentiation, oct-4, in combination with Rox-1, causes transcriptional activation of the Zn-finger protein Rex-1, and is

also required for maintaining ES in an undifferentiated state. Likewise, sox-2, is needed together with oct-4 to retain the undifferentiated state of ES/EC and to maintain murine (but not human) ES cells. Human or murine primordial germ cells require presence of LIF. Another hallmark of ES cells is presence of telomerase, which provides these cells with an unlimited self-renewal potential in vitro.

Stem cells have been identified in most organ tissues. The best characterized is the hematopoietic stem cell. This is a mesoderm-derived cell that has been purified based on cell surface markers and functional characteristics. The hematopoietic stem cell, isolated from bone marrow, blood, cord blood, fetal liver and yolk sac, is the progenitor cell that reinitiates hematopoiesis for the life of a recipient and generates multiple hematopoietic lineages (see Feϊ, R., et al, U. S. Patent No.5,635,387; McGlave, et al, U. S. Patent No. 5,460,964; Simmons, P., et al, U. S. Patent No. 5,677,136; Tsukamoto, et al, U.S. Patent No. 5,750,397; Schwartz, et al, U.S. Patent

No. ,759,793; DiGuisto, et al, U.S. Patent No. 5,681,599; Tsukamoto, et al, U. S. Patent No. 5,716,827; Hill, B., et al, Exp. Hematol. (1996) 24 (8): 936-943). When transplanted into lethally irradiated animals or humans, hematopoietic stem cells can repopulate the erythroid, neutrophil-macrophage, megakaryocyte and lymphoid hemopoietic cell pool. In vitro, hemopoietic stem cells can be induced to undergo at least some self-renewing cell divisions and can be induced to differentiate to the same lineages as is seen in vivo. Therefore, this cell fulfills the criteria of a stem cell. Stem cells which differentiate only to form cells of hematopoietic lineage, however, are unable to provide a source of cells for repair of other damaged tissues, for example, heart or lung tissue damaged by high-dose chemotherapeutic agents.

A second stem cell that has been studied extensively is the neural stem cell (Gage FH: Science 287:1433-1438, 2000; SvendsenCN et al, Brain Path 9:499-513, 1999; Okabe S et al, Mech Dev 59:89-102, 1996). Neural stem cells were initially identified in the subventricular zone and the olfactory bulb of fetal brain. Until recently, it was believed that the adult brain no longer contained cells with stem cell potential. However* several studies in rodents, and more

recently also non-human primates and humans, have shown that stem cells continue to be present in adult brain. These stem cells can proliferate in vivo and continuously regenerate at least some neuronal cells in vivo. When cultured ex vivo, neural stem cells can be induced to proliferate, as well as to differentiate into different types of neurons and glial cells. When transplanted into the brain, neural stem cells can engraft and generate neural cells and glial cells. Therefore, this cell too fulfills the definition of a stem cell.

Mesenchymal stem cells (MSC), originally derived from the embryonal mesoderm and isolated from adult bone marrow, can differentiate to form muscle, bone, cartilage, fat, marrow stroma, and tendon. During erabryogenesis, the mesoderm develops into limb-bud mesoderm, tissue that generates bone, cartilage, fat, skeletal muscle and possibly endothelium. Mesoderm also differentiates to visceral mesoderm, which can give rise to cardiac muscle, smooth muscle, or blood islands consisting of endothelium and hematopoietic progenitor cells. Primitive mesodermal or mesenchymal stem cells, therefore, could provide a source for a number of cell and tissue types. A third tissue specific cell that has been named a stem cell is the mesenchymal stem cell, initially described by Fridenshtein (Fridenshtein, Arkh. Patol., 44:3-11, 1982). A number of mesenchymal stem cells have been isolated (see, for example, Caplan, A., et al, U. S. Patent No. 5,486,359; Young, H., et al, U. S. Patent No. 5,827,735; Caplan, A., et al, U. S. Patent No. 5,811,094; Bruder, S., et al, U. S. Patent No. 5,736,396; Caplan, A., et al, U. S. Patent No. 5,837,539; Masinovsky, B., U. S. Patent No.5,837,670; Pittenger, M., U. S. Patent No. 5,827,740; Jaiswal, N., et al, J. Cell Biochem. (1997) 64(2): 295-312; Cassiede P.. et al. J. Bone Miner. Res. (1996> 11(9): 1264-1273; Johnstone, B., et al, (1998) 238(1): 265-272; Yoo, et al, J. Bone Joint Surg. Am. (1998) 80(12): 1745-1757; Gronthos, S., Blood (1994) 84(12): 4164-4173; Makino, S., et al, J. Clin. Invest. (1999) 103(5): 697-705). Of the many mesenchymal stem cells that have been described, all have demonstrated limited differentiation to form only those differentiated cells generally considered to be of mesenchymal origin. To date, the most multipotent mesenchymal stem cell reported is the cell isolated by Pittenger, et al., which expresses the SH2 ⁺ SH4* CD29 ⁺ CD44 ⁺

CD71 ⁺ CD90 ⁺ CD106 ⁺ CD120a ⁺ CD124 ⁺ CD14 ^" CD34 ^" CD45 ^' phenotype. This cell is capable of differentiating to form a number of cell types of mesenchymal origin, but is apparently limited in differentiation potential to cells of the mesenchymal lineage, as the team who isolated it noted that hematopoietic cells were never identified in the expanded cultures. fPittenger, et al.. Science (1999) 284: 143-147.)

Other stem cells have been identified, including gastrointestinal stem cells, epidermal stem cells, and hepatic stem cells, also termed oval cells (Potten C, Philos Trans R Soc Lond B Biol Sci 353:821-30, 1998; Watt F, Philos.Trans R Soc Lond B Biol Sci 353:831, 1997; Alison M et al, Hepatol 29:678-83, 1998). Most of these are less well characterized.

Compared with ES cells, tissue specific stem cells have less self-renewal ability and, although they differentiate into multiple lineages, they are not multipotent. No studies have addressed whether tissue specific cells express markers described above of ES cells. In addition, the degree of telomerase activity in tissue specific stem cells has not been fully explored, in part because large numbers of highly enriched populations of these cells are difficult to obtain.

Until recently, it was thought that organ specific stem cells could only differentiate into cells of the same tissue. A number of recent publications have suggested that adult organ specific stem cells may be capable of differentiating into cells of different tissues. A number of studies have shown that cells transplanted at the rime of a bone marrow transplant can differentiate into skeletal muscle (Ferrari Science 279:528-30, 1998; Gussoni Nature 401:390-4, 1999). This could be considered within the realm of possible differentiation potential of mesenchymal cells that are present in marrow. Jackson published that muscle satellite cells can differentiate into hemopoietic cells, again a switch in phenotype within the splanchnic mesoderm (Jackson PNAS USA 96:14482-6, 1999). Other studies have shown that stem cells from one embryonal layer (for instance splanchnic mesoderm) can differentiate into tissues thought to be derived during embryogenesis from a different embryonal layer. For instance, endothelial cells or their precursors detected in humans or animals that

underwent marrow transplantation are at least in part derived from the marrow donor (Takahashi, Nat Med 5:434-8, 1999; Lin, Clin Invest 105:71-7, 2000). Thus, visceral mesoderm and not splanchnic mesoderm, such as MSC, derived progeny are transferred with the infused marrow. Even more surprising are the reports demonstrating both in rodents and humans that hepatic epithelial cells and biliary duct epithelial cells are derived from the donor marrow (Petersen, Science 284:1168-1170, 1999; Theise, Hepatology 31:235-40, 2000; Theise, Hepatology 32:11-6, 2000). Likewise, three groups have shown that neural stem cells can differentiate into hemopoietic cells. Finally, Clarke et al. reported that neural stem cells injected into blastocysts can contribute to all tissues of the chimeric mouse (Clarke, Science 288:1660-3, 2000).

It is necessary to point out that most of these studies have not conclusively demonstrated that a single cell can differentiate into tissues of different organs. Indeed most investigators did not identify the phenotype of the initiating cell. An exception is the study by Weissman and Grompe, who showed that cells thatrepopulated the liver were present in LmThV ₁ LoWSCa ₁ + marrow cells, which are highly enriched in hematopoietic stem cells. Likewise, the Mulligan group showed that marrow Sp cells, highly enriched for HSC, can differentiate into muscle and endothelium, and Jackson et al. showed that muscle Sp cells are responsible for hemopoietic reconstitution (Gussoni et al., Nature 401:390-4, 1999).

Transplantation of tissues and organs generated from heterologous embryonic stem cells requires either that the cells be further genetically modified to inhibit expression of certain cell surface markers, or that the use of chemotherapeutic immune suppressors continue in order to protect against transplant rejection. Thus, although embryonic stem cell research provides a promising alternative solution to the problem of a limited supply of organs for transplantation, the problems and risks associated with the need for immunosuppression to sustain transplantation of heterologous cells or tissue would remain. An. estimated 20 immunologically different lines of embryonic stem cells would need to be established in order to provide immunocompatible

cells for therapies directed to the majority of the population (Wadman, M., Nature (1999) 398: 551).

Using cells from the developed individual, rather than an embryo, as a source of autologous or allogeneic stem cells would overcome the problem of tissue incompatibility associated with the use of transplanted embryonic stem cells, as well as solve the ethical dilemma associated with embryonic stem cell research. The greatest disadvantage associated with the use of autologous stem cells for tissue transplant thus far lies in their limited differentiation potential. A number of stem cells have been isolated from fully-developed organisms, particularly humans, but these cells, although reported to be multipotent, have demonstrated limited potential to differentiate to multiple cell types.

Thus, even though stem cells with multiple differentiation potential have been isolated previously by others and by the present inventors, a progenitor cell with the potential to differentiate into a wide variety of cell types of different lineages, including fibroblasts, osteoblasts, chondrocytes, adipocytes, skeletal muscle, endothelium, stroma, smooth muscle, cardiac muscle and hemopoietic cells, has not been described. If cell and tissue transplant and gene therapy are to provide the therapeutic advances expected, a stem cell or progenitor cell with the greatest or most extensive differentiation potential is needed. What is needed is the adult equivalent of an embryonic stem cell.

Summary of the Invention

The present invention provides an isolated multipotent mammalian stem cell that is surface antigen negative for CD44, CD45, and HLA Class I and IL The cell may also be surface antigen negative for CD34, Muclδ, Stro-1, HLA- class-I and may be positive for oct3/4 mRNA, and may be positive for hTRT mRNA. hi particular, the cell may be surface antigen negative for CD31, CD34, CD36, CD38, CD45, CD50, CD62E and CD62P, HLA-DR, Muclδ, STRO-I, cKϊt, Tie/Tek, CD44, HLA-class I and 2-microglobulin and is positive for CDlO, CD13, CD49b, CD49e, CDw90, Flkl, EGF-R, TGF-Rl and TGF-R2, BMP-RlA, PDGF-RIa and PDGF-RIb. The present invention provides an isolated multipotent non-embryonic, non-germ cell line cell that expresses

transcription factors oct3/4, REX-I and ROX-I. It also provides an isolated multipotent cell derived from a post-natal mammal that responds to growth factor LIF and has receptors for LIF.

The cells of the present invention described above may have the capacity to be induced to differentiate to form at least cine differentiated cell type of mesodermal, ectodermal and endodermal origin. For example, the cells may have the capacity to be induced to differentiate to form cells of at least osteoblast, chondrocyte, adipocyte, fibroblast, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, endothelial, epithelial, hematopoietic, glial, neuronal or oligodendrocyte cell type. The cell may be a human cell or a mouse cell. The cell may be from a fetus, newborn, child, or adult. The cell may be derived from an organ, such as from marrow, liver or brain.

The present invention further provides differentiated cells obtained from the multipotent adult stem cell described above, wherein the progeny cell may be a bone, cartilage, adipocyte, fibroblast, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, endothelial, epithelial, endocrine, exocrine, hematopoietic, glial, neuronal or oligodendrocyte cell. The differentiated progeny cell may be a skin epithelial cell, liver epithelial cell, pancreas epithelial cell, pancreas endocrine cell or islet cell, pancreas exocrine cell, gut epithelium cell, kidney epithelium cell, or an epidermal associated structure (such as a hair follicle). The differentiated progeny cell may form soft tissues surrounding teeth or may form teeth.

The present invention provides an isolated transgenic multipotent mammalian stem cell as described above, wherein genome of the cell has been altered by insertion of preselected isolated DNA, by substitution of a segment of the cellular genome with preselected isolated DNA, or by deletion of or inactivation of at least a portion of the cellular genome. This alteration may be by viral transduction, such as by insertion of DNA by viral vector integration, or by using a DNA virus, RNA virus or retroviral vector. Alternatively, a portion of the cellular genome of the isolated transgenic cell may be inactivated using an antisense nucleic acid molecule whose sequence is complementary to the sequence of the portion of the cellular genome to be inactivated. Further, a

portion of the cellular genome may be inactivated using a ribozyme sequence directed to the sequence of the portion of the cellular genome to be inactivated The altered genome may contain the genetic sequence of a selectable or screenable marker gene that is expressed so that the progenitor cell with altered genome, or its progeny, can be differentiated from progenitor cells having an unaltered genome. For example, the marker may be a green, red, yellow fluorescent protein, Beta-gal, Neo, DHFR™, or hygromycin. The cell may express a gene that can be regulated by an inducible promoter or other control mechanism to regulate the expression of a protein, enzyme or other cell product. The present invention provides a cell that may express high levels of telomerase and may maintain long telomeres after extended in vitro culture, as compared to the telomeres from lymphocytes from the same donors. The telomeres may be about 11 - 16 KB in length after extended in vitro culture.

The present invention provides a cell differentiation solution comprising factors that modulate the level of oct3/4 expression for promoting continued growth or differentiation of undifferentiated multipotent stem cells.

The present invention provides a method for isolating multipotent adult stem cells (MASQ. The method involves depleting bone marrow mononuclear cells of CD4.T glycophorin A ⁺ cells, recovering CD45- glycophorin A- cells, plating the recovered CD45- glycophorin A- cells onto a matrix coating, and culturing the plated cells in media supplemented with growth factors. The step of depleting may involved negative selection using monoclonal or polyclonal antibodies. The growth factors may be chosen from PDGF-BB, EGF, IGF, and LIF. The last step may further involve culturing in media supplemented with dexamethasone, linoleic acid, and/or ascorbic acid.

The present invention provides a culture method for isolating multipotent adult stem cells involving adding the cells to serum-free or low-serum medium containing insulin, selenium, bovine serum albumin, linoleic acid, dexamethasone, and platelet-derived growth factor. The serum-free or low- serum medium may be low-glucose DMEM in admixture with MCDB. The insulin may be present at a concentration of from about 10 to about 50 μg/ml. The serum-free or low-serum medium may contain an effective amount of

transferrin at a concentration of greater than 0 but less than about 10 μg/ral, the selenium may be present at a concentration of about 0.1 to about 5 μg /ml, the bovine serum albumin may be present at a concentration of about 0.1 to about 5 μg /ml, the linoleic acid may be present at a concentration of about 2 to about 10 μg /m, and the dexamethasone may be present at a concentration of about 0.005 to 0.15 μM. The serum-free medium or low-serum medium may contain about 0.05 - 0.2 mM L-ascorbic acid. The serum-free medium or low-serum medium may contain about 5 to about 15 ng/ml platelet-derived growth factor, 5 to about 15 ng/ml epidermal growth factor, 5 to about 15 ng/ml insulin-like growth factor, 10-10,000 IU leukemia inhibitory factor. The present invention further provides a cultured clonal population of mammalian multipotent adult stem cells isolated according to the above-described method.

The present invention provides a method to permanently and/or conditionally immortalize MASC derived cells and differentiated progeny by transferring telomerase into MASC or differentiated progeny.

The present invention provides a method to reconstitute the hematopoietic and immune system of a mammal by administering to the mammal fully allogenic multipotent stem cells (MASC), derived hematopoietic stem cells, or progenitor cells to induce tolerance in the mammal for subsequent multipotent stem cell derived tissue transplants or other organ transplants.

The present invention provides a method of expanding undifferentiated multipotent stem cells into differentiated hair follicles by administering appropriate growth factors, and growing the cells.

The present invention provide numerous uses for the above-described cells. For example, the invention provides a method of using the isolated cells by performing an in utero transplantation of a population of the cells to form chimerism of cells or tissues, thereby producing human cells in prenatal or post¬ natal humans or animals following transplantation, wherein the cells produce therapeutic enzymes, proteins, or other products in the human or animal so that genetic defects are corrected. The present invention also provides a method of using the cells for gene therapy in a subject in need of therapeutic treatment, involving genetically altering the cells by introducing into the cell an isolated

pre-selected DNA encoding a desired gene product, expanding the cells in culture, and introducing the cells into the body of the subject to produce the desired gene product.

The present invention provides a method of repairing damaged tissue in a human subject in need of such repair by expanding the isolated multipotent adult stem cells in culture, and contacting an effective amount of the expanded cells with the damaged tissue of said subject The cells may be introduced into the body of the subject by localized injection, or by systemic injection. The cells may be introduced into the body of the subject in conjunction with a suitable matrix implant The matrix implant may provide additional genetic material, cytokines, growth factors, or other factors to promote growth and differentiation of the cells. The cells may be encapsulated prior to introduction into the body of the subject, such as within a polymer capsule.

The present invention provides a method for inducing an immune response to an infectious agent in a human subject involving genetically altering an expanded clonal population of multipotent adult stem cells in culture express one or more pre-selected antigenic molecules that elicit a protective immune response against an infectious agent, and introducing into the subject an amount of the genetically altered cells effective to induce the immune response. The present method may further involve, prior to the second step, the step of differentiating the multipotent adult stem cells to form dendritic cells.

The present invention provides a method of using MASCs to identify genetic polymorphisms associated with physiologic abnormalities, involving isolating the MASCs from a statistically significant population of individuals from whom phenotypic data can be obtained, culture expanding the MASCs from the statistically significant population of individuals to establish MASC cultures, identifying at least one genetic polymorphism in the cultured MASCs, inducing the cultured MASCs to differentiate, and characterizing aberrant metabolic processes associated with said at least one genetic polymorphism by comparing the differentiation pattern exhibited by an MASC having a normal genotype with the differentiation pattern exhibited by an MASC having an identified genetic polymorphism.

The present invention further provides a method for treating cancer in a mammalian subject involving genetically altering multipotent adult stem cells to express a tumoricidal protein, an anti-angiogenic protein, or a protein that is expressed on the surface of a tumor cell in conjunction with, a protein associated with stimulation of an immune response to antigen, and introducing an effective anti-cancer amount of the genetically altered multipotent adult stem cells into the mammalian subject.

The present invention provides a method of using MASCs to characterize cellular responses to biologic or pharmacologic agents involving isolating MASCs from a statistically significant population of individuals, culture expanding the MASCs from the statistically significant population of individuals to establish a plurality of MASC cultures, contacting the MASC cultures with one or more biologic or pharmacologic agents, identifying one or more cellular responses to the one or more biologic or pharmacologic agents, and comparing the one or more cellular responses of the MASC cultures from individuals in the statistically significant population.

The present invention also provides a method of using specifically differentiated cells for therapy comprising administering the specifically differentiated cells to a patient in need thereof. It further provides for the use of genetically engineered multipotent stem cells to selectively express an endogenous gene or a transgene, and for the use of MASCs grown in vivo for transplantation/administration into an animal to treat a disease. For example, neuroretinal cells derived from multipotent stem or MASCs can be used to treat blindness caused by among other things but not limited to neuroretinal disease caused by among other things macular degeneration, diabetic retinopathy, glaucoma, retinitis pigmentosa. The cells can be used to engraft a cell into a mammal comprising administering autologous, allogenic or xenogenic cells, to restore or correct tissue specific metabolic, enzymatic, coagulation, structural or other function to the mammal. The cells can be used to engraft a cell into a mammal, causing the differentiation in vivo of cell types, and for administering the differentiated stem cells into the mammal. The. cells, or their in vitro or in vivo differentiated progeny, can be used to correct a genetic disease,

degenerative disease, cardiovascular disease, metabolic storage disease, neural, or cancer disease process. They can be used to produce gingiva-like material for treatment of periodontal disease. They can be used to develop skin epithelial tissue derived from multipotent stem cells that can be utilized for skin grafting and plastic surgery. They could be used to enhance muscle such as in the penis or heart. The can be used to produce blood ex vivo for therapeutic use, or to produce human hematopoietic cells and/or blood in prenatal or post natal animals for human use. They can be used as a therapeutic to aid for example in the recovery of a patient from chemotherapy or radiation therapy in treatment of cancer, in the treatment of autoimmune disease, to induce tolerance in the recipient They can be used to treat AIDS or other infectious diseases.

The cardiomyocytes or MASC can be used to treat cardiac diseases including among others but not limited to myocarditis, cardiomyopathy, heart failure, damage caused by heart attacks, hypertension, atherosclerosis, heart valve dysfunction. A genetically engineered multipotent mammalian derived stem cell, or its differentiated progeny, can be used to treat a disease with CNS deficits or damage. Further the multipotent mammalian derived stem cell, or its neuronally related differentiated cell, can be used to treat a disease with neural deficits or degeneration including among but not limited to stroke, Alzhemier's, Parkinson's disease, Huntington's disease, AE)S associated dementia, spinal cord injury, metabolic diseases effecting the brain or other nerves.

A multipotent mammalian derived stem cell or their differentiated progeny such as stromal cells can be used to support the growth and differentiation of other cell types in vivo or in vitro, including but not limited to hematopoietic cells, pancreatic islet or beta cells, hepatocytes, etc. The stem cell, or cartilage differentiated progeny, can be used to treat a disease of the joints or cartilage including but not limited to cartilage tears, cartilage thinning, osteoarthritis. Moreover, the stem cells or their osteoblast differentiated progeny can be used to ameliorate a process having deleterious effects on bone including among but not limited to bone fractures, non-healing fractures, osteoarthritis, "holes" in bones cause by tumors spreading to bone such as prostate, breast, multiple myloma etc.

The present invention also provides a kit for providing immunization to induce a protective immune response in a human subject. The kit may contain, separately packaged, media and antibodies for isolation of multipotent adult stem cells from a bone marrow aspirate; media and cellular factors for culture of the isolated multipotent adult stem cells; and genetic elements for genetically altering the multipotent adult stem cells to produce antigenic molecules. The kit may further contain media and cellular factors effective to differentiate the multipotent adult stem cells to form tissue-specific cell types. The genetic elements may be viral vectors, and the viral vectors may contain the nucleotide sequence encoding one or more antigens of bacterial or viral origin. The genetic elements may be plasmids containing a nucleotide sequence encoding a bacterial, viral, or parasite antigen. The plasmids may be packaged with components for calcium phosphate transfection. The genetic elements may be vectors comprising nucleotide sequences encoding antigens common to cancer cells, or the genetic elements may be vectors containing nucleotide sequences encoding antigens of parasitic organisms.

The present invention further provides a method of gene profiling of a multipotent derived stem cell as described above, and the use of this gene profiling in a data bank. It also provides for the use of gene profiled multipotent stem cells as described above in data bases to aid in drug discovery.

Brief Description of the Drawings

Fig. Ia and Fig. Ib are photographs of undifferentiated MASCs of the present invention. Cells lacking CD45 expression, as well as glycophorin-A expression were selected by immunomagnetic bead depletion and FACS. Cells recovered after sorting are small blasts (Fig. Ia). 5000 cells were plated in fibronectin coated wells of 96 well plates in defined medium consisting of DMEM, 10 ng/fnl IGF, 10 ng/ml EGF and lOng/ml PDGF-BB as well as transferrin, selenium, bovine serum albumin, dexamethasone, linoleic acid, insulin and ascorbic acid. After 7-21 days, small colonies of adherent cells develop. (Figure Ib).

Fig. 2 is a graph illustrating expansion rates for MASCs in culture. CD45-/GlyA- cells were plated in fibronectin-coated wells of 96 well plates in defined medium consisting of DMEM, 10ng/ml IGF, lOng/ml EGF and 10ng/ml PDGF-BB as well as transferrin, selenium, bovine serum albumin, dexamethasone, linoleic acid, insulin and ascorbic acid with or without 2% FCS. When semi-confluent, cells were recovered by trypsinization and sub-cultured twice weekly at a 1:4 dilution under the same culture conditions.

Fig.3 Telomere length of MASCS from a donor, age 35, was cultured at reseeding densities of 2XlO ³ cells/cm ² for 23 and 35 cell doublings. Telomere length was determined using standard techniques. Telomere length was 9kB. This was 3kB longer than telomere length of blood lymphocytes obtained from the same donor. Telomere length evaluated after 10 and 25 cell doublings resp. and again after 35 cells doublings, was unchanged. As controls, we tested HL60 cells (short telomeres) and 293 cells (long telomeres). Fig.4 illustrates the general protocol for culture, transduction, differentiation, and confirmation of differentiation used by the inventors for MASCs of the present invention. Transduction with an eGFP-containing retroviral vector was performed after culture as indicated. Half-confluent MASC were exposed for six hours on two sequential days to MFG-eGFP containing PA317 supernatant made in MASC medium (i.e., DMEM, 2% FCS, EGF, PDGF-BB, transferrin, selenium, bovine serum albumin, dexamethasone, linoleic acid, insulin and ascorbic acid) in the presence of 10 μg/mL protamine. Twenty-four hours after the last transduction, cells were trypsinized and subjected to FACS selection. Thirty to seventy percent of MASCs were eGFP positive. One to one hundred eGFP positive cells/well were sorted using the ACDU device on the FACS m FN coated wells of 96 well plates, in the same MASC medium. Of these wells, approximately 2/plate containing 10 cells/well produced MASC progeny. Clones were then culture expanded. Eight to 10 sub- populations of these expanded cells were induced to differentiate along different pathways, with differentiation being confirmed using the techniques indicated.

Fig.5 illustrates the differentiation protocol used by the inventors to induce the MASCs of the present invention to differentiate to form osteoblasts,

chondroblasts and adipocytes as indicated. Depicted are the cytokines needed and the appropriate tests to demonstrate induction of terminal differentiation.

Fig. 6. illustrates results of immunohistochemistry staining for bone sialoprotein on day 15 as well as Western blot analysis for bone sialoprotein on days 7, 11 and 14 after culture after induction of MASCs with with 10' ⁷ M dexamethasone, β-glycerophosphate and 1OmM ascorbic acid. In the middle panel, results of toluidin blue staining for cartilage as well as Western blot analysis for collagen type II on days 7, 11 and 14 shows differentiation to chondrocytes following culture of MASCs in micromass in serum free medium with 100 agJtaL TGF-βl. In the lower panel, oil-red staining on day 14 and Western blot analysis for PPARg shows differentiation following treatment of MASCs with 10% horse serum.

Fig. 7. shows Western blot analysis for muscle proteins. Panel A, hows results of culture of confluent MASCs with 3μM 5-azacytidine for 24h. Cultures were men maintained in MASC expansion medium (DMEM, 2% FCS, EGF, PDGF-BB, transferrin, selenium, bovine serum albumin, dexamethasone, linoleic acid, insulin and ascorbic acid). Differentiation was evaluated by Western blot. 5 days after induction with either 5-azacytidine, the Myf5, Myo-D and Myfδ transcription factors could be detected in approximately 50% of cells. After 14-18 days, Myo-D was expressed at significantly lower levels, whereas Myf5 and Myfδ persisted. We detected desmin and skeletal actin as early as 4 days after induction, and skeletal myosin at 14 days. By immunohistochemistry, 70-80% of cells expressed mature muscle proteins after 14 days (not shown). Treatment with either 5-azacytidine or retinoic acid resulted in expression of Gata4 and Gata6 during the first week of culture. In addition, low levels of troponin-T could be detected from day 2 on, which may suggest that fetal muscle . generated as cardiac troponin-T is found in embryonal skeletal muscle. Smooth muscle actin was detected at 2 days after induction and persisted till 14 days. In panel B, we added lOOng/mL PDGF as the sole cytokine to confluent MASCS maintained in serum-free medium for 14 days. Presence of smooth muscle markers was evaluated by Western blot Smooth muscle actin was detected from day 2 on and smooth muscle myosin after 6 days. Approximately 70% of cells

stained positive with anti-smooth muscle actin and myosin antibodies on day 15 by immunohistochemistry. We found presence of myogenin from day 4 on and desmin after 6 days. We also detected Myf5 and Myf6 proteins after 2-4 days, which persisted till day 15. No Myo-D was detected. In panel C, confluent MASCS were exposed to retinoic acid and then cultured in serum-free medium with lOOng/mL bFGF. Cells were then analyzed by Western blot. Gata4 and Gataό were expressed as early as day 2 and persisted till day 15. Cardiac troponin-T was expressed after day 4 and cardiac troponin-I from day 6 on, while we could detect ANP after day.11 (not shown). These cardiac proteins were detected in >70% of cells by immuno-histochemistry on day 15 (not shown). We found the transcription factor MyflS from day 2 on. Expression of desmin started on day 6 and myogenin on day 2. We also found skeletal actin. When the cultures were maintained for >3 weeks, cells formed syncithia. We also saw infrequent spontaneous contractions occurring in the cultures, which were propagated over several mm distance.

Fig.8 is a photomicrograph showing fusion of myoblasts and myotubes to form multinucleated myotubes. Myoblasts from an eGFP transduced population of MASC subsequently induced with 5-azacytidin for 24 and maintained in MASC expansion medium were cocultured with myoblasts generated from non e-GFP transduced MASCS from the same donor. To induce myotubes, MASC derived myoblasts 9obtained after induction of non-transduced MASC with 5- azacytidin for 24 h after which they were maintained in MASC expansion medium for 14 days) were cultured with 10% horse serum in DMBM. Once multinucleated cells were formed, myotubes were incubated with PKH26 (a red membrane dye), washed and cocultured with eGFP transduced myotubes generated as described above in the presence of 10% horse serum. After 2 days, cells were examined under an fluorescence microscope. The photomicrograph shows that the eGFP positive myoblast has fused with the PKH26 labeled myotube. Fig. 9 is a cartoon depicting methods used by the inventors to induce endothelium differentiation from MASCs of the present invention and markers used to detect endothelium differentiation.

Fig. 10 is a series of photographs of immunofluorescence staining for von Willebrand factor and CD34 markers as well as a Western blot analysis for the endothelial cell surface receptor Tie/Tek to confirm endothelial cell differentiation. MASCs express Flkl but not CD34, PECAM, E- and P-selectin, CD36, Tie/Tek or Fltl . When MASCs were cultured serum-free MASCs medium with 20 ng/mL VEGF we saw the appearance of CD34 on the cell surface and cells expressed vWF by day 14 (immuno-fluorescence). In addition, cells expressed Tie / Tek, as shown on Western blot analysis on days 7, 11 and 14. When VEGF induced cells were cultured on matrigel or collagen type IV, vascular tube formation was seen.

Fig. 11 is a series of photomicrographs showing that MASCs differentiate to astrocytes, oligodendrocytes and neural cells when cultured with SCF, FlG-L, Tpo and Epo for 14 days after which they were cultured in SCF and EGF containing MASC medium by the hematopoietic supportive feeder AFT024. Cells were labeled with antibodies against glial-fibrilar-acidic-protein (GFAP) (astrocytes), galactocerebroside (GaIC) (oligodendrocytes) and neurofilament-68 and 200 (neurons).

Fig. 12 is a series of photomicrographs showing that when low density MASCs are cultured in fibronectin coated wells with 100 ng/mL bFGF, neurons develop. 20±2% cells stained positive for β-tubulin-IH, 22±3% for neurofilament-68, 50±3% for neurofilament- 160, 20±2% for neurofilament-200, 82±5% for neuron-specific-enolase (NSE) and 80±2% for microtubule- assocaited-protein-2 (MAP2). The number of neurites per neuron increased from 3±1 , to 5±1 and 7±2 from 2, 3 to 4 weeks after differentiation. Not shown, after - 2 weeks in culture, 26±4% of cells were GFAP positive, 28±3% GaIC positive, whereas fewer cells were GFAP or GaIC positive after 4 weeks.

Fig. 13 shows RT-PCR results and Western blot analysis for GFAP, myelin basic protein (MBP) and neurofilament-200 x, x and days after induction of MASCs with bFGF. Fig.14 shows effect of 100 ng/mL bFGF, or 10 ng/mL of either FGF-9,

FGF-8, FGF-10, FGF-4, BDNF, GDNF, or CNTF on neural development from MASCs. The nature of the differentiated cells was identified by

immunohistochemistry using antibodies agiants GFAP, GaIC, neurofilament 200, tyrosine hydroxylase (TH), GABA and parvalbumine, and acetylcholine (CAT). When cultured for 3 weeks with bFGF, MASC differentiated into neurons, astrocuytes and oligodendrocytes. We did not detect GABA, parvalbumin, tyrosine hydroxylase, DOPA-decarboxylase, or tryptophan hydroxylase. When cultured for 3 weeks with lOng/mL FGF-9 and EGF MASCs generated astrocytes, oligodendrocytes and GABAergic and dopaminergic. When MASCs were cultured with lOng/mL FGF-8 and EGF for 3 weeks both dopaminergic and GABAergic neurons were produced. Culture of MASCs in lOng/mL FGF-10 and EGF for three weeks generated astrocytes and oligodendrocytes, but not neurons. When treated with lOng/mL FGF-4 and EGF for 3 weeks MASCs differentiated into astrocytes and oligodendrocytes but not neurons. When MASCs were treated with IOng/mL BDNF and EGF exclusive differentiation into tyrosine hydroxylase positive neurons was seen. When cultured with GDNF MASCs differentiated into GABAergic and dopaminergic neurons. When cultured with exclusive differentiation into GABAergic neurons was seen after three weeks.

Fig. 15. Undifferentiated MASCs were implanted around a parietal infarct caused by ligation of middle cerebral artery in the brain of Wistar rats. Rats were maintained on cyclosporin and function of the paralyzed limbs examined 6 weeks after injection of the MASCs. As control, animals received saline injections or media conditioned by MASCs. Results are shown for limb placement testing 6 weeks after transplantation of the MASCs or control solutions. Functional improvement to levels equivalent to mat of sham animals was only seen in rats transplanted with MASCS.

Fig. 16 Undifferentiated MASCs were implanted around a parietal infarct caused by ligation of middle cerebral artery in the brain of Wistarrats, Rats were maintained on cyclosporin and function of the paralyzed limbs examined 6 weeks after injection of the MASCs. After 2 and 6 weeks, animals were sacrificed to determine neural phenotype. Because of autofluorescence of the brain following transplantation with eGFP ⁺ cells, we had to resort to immunόhistochemical analysis of the graft. The majority of eGFP* cells were detected in the grafted area itself at 2 weeks. After 6 weeks, eGFP ⁺ cells

migrated outside the graft. At 2 weeks, cells staining with an anti-eGFP antibody remained spherical in nature and ranged from 10-30 μm in diameter. After 6 weeks, eGFP* cells were significantly smaller and neurites could be seen in the grafted area, extending out to the normal brain tissue. Presence of human cells was confirmed by staining with a human specific nuclear antibody, NuMa (not shown). This antibody will in the future be used to identify human cells in the graft allowing double and triple staining with immunofluorescent antibodies. Using human specific anti-nestin antibodies, we detected small clusters of nestin-positive cells in the same location of the graft as the NuMa-positive cells and GFP ⁺ cells, suggestive of neuroectodermal differentiation. In addition, we found positive staining for β-tubulin in and Neurofilament-68 and -160, Oligo Marker and GFAP, suggesting differentiation to neuronal and glial cells.

Fig. 17 shows immunohistochemical and Western blot analysis for cytokeratin 18 and 19 after MASCs were treated with HGF and KGF. After 14 days, large epithelioid cells could be seen that expressed cytokeratin 18 and 19.

Detailed Description of the Invention Whether stem cells that are committed to a certain lineage have the ability of undergoing a genetical re-programming similar to what occurs in the "cloning process" or "trans-differentiate" is not known. The present inventors have shown that multipotent stem cells persist even after birth in multiple organs (such as marrow, liver, brain) when purified from these organs and cultured in vitro can proliferate without obvious senescence and can differentiate into multiple cell types, different from the tissues they were derived from. The phenotype of stem cells derived from different organs with "plasticity" is similar (CD45 CD44ΗLA-DRΗLA-calss Ioct3/4 mRNA ⁺ and hTRT ¹ ). In addition, the characteristics of such stem cells are similar to that of, for instance, primordial germ cells from which they may be a direct descendant. The present inventors have evidence that a small fraction of marrow cells, as well as cells in brain and liver, express genes commonly only found in ES or EG cells (oct-4, Rex-1). Furthermore, the present inventors have detected

eGFP+ cells in marrow and brain of newborn mice transgenic for the oct-4/eGFP construct, further demonstrating that oct-4 expressing cells are present in tissues other than germ cells in post-embryonic life. Therefore, a small number of stem cells may persist throughout an adult, living in different organs that have multipotent characteristics. This explains the perceived plasticity of stem ceϋs derived from multiple organs.

Selection And Phenotype Of Multipotent Adult Stem Cells

The present invention provides multipotent adult stem cells (MASCs), isolated from human or mouse (and other species) adults, newborns, or fetuses, that can differentiate to form bone cells, cartilage, adipocytes, fibroblasts, bone marrow stromal cells, skeletal muscle, smooth muscle, cardiac muscle, endothelium, epithelial cells (keratinocytes), hemopoietic, glial, neuronal and oligodendrocyte progenitor cells. These cells exhibit differentiation phenotypes more akin to an embryonic stem cell than to any adult-derived stem cell described to date.

The multipotent adult stem cells described herein were isolated by the method developed by the inventors, who identified a number of specific cell surface markers that characterize the MASCs. The method of the present invention can be used to isolate multipotent adult stem cells from any adult, child, or fetus, of human, murine and other species origin. In addition, in mouse, these cells have been isolated from brain and liver. It is therefore now possible for one of skill in the art to obtain bone marrow aspirates, brain or liver biopsies, and possibly other organs, and isolate the cells using positive or negative selection techniques known to those of skill in the art, relying upon the surface markers expressed on these cells, as identified by the inventors, without undue experimentation.

A. MASCs from human marrow:

To select the multipotent adult stem cells, bone marrow mononuclear cells are derived from bone marrow aspirates, which can be obtained by standard means known to those of skill in the art (see, for example, Muschler, G.F., et al., J. Bone Joint Sure. Am. (1997) 79(11): 1699-709, Batinic, D., et al., Bone

Marrow Transplant. (1990) 6(2):103-7). The multipotent adult stem cells are present within the bone marrow (or other organs such as liver or brain) but do not express the common leukocyte antigen CD45 or erythroblast specific glycophorin-A (GIy-A). The mixed population of cells is subjected to aFicoll Hypaque separation. Cells are then subjected to negative selection using anti- CD45 and anti-Gly-A antibodies, depleting the population of CD45 ⁺ and GIy-A ⁺ cells, and recovering the remaining approximately 0.1% of marrow mononuclear cells. Cells can also be plated in fibronectin coated wells and cultured as described below for 2-4 weeks after which the cells are depleted of CD45 ⁺ and GIy-A ⁺ cells. Alternatively, positive selection is used to isolate cells using a combination of cell-specific markers identified by the inventors and described herein, such as the leukemia inhibitory factor (LIF) receptor. Both positive and negative selection techniques are known to those of skill in the art, and numerous monoclonal and polyclonal antibodies suitable for negative selection purposes are also known in the art (see, for example, Leukocyte Typing V. Schlossman, et al., Eds. (1995) Oxford University Press) and are commercially available from a number of sources. Techniques for mammalian cell separation from a mixture of cell populations have also been described by Schwartz, et al., in U. S. Patent No. 5,759,793 (magnetic separation), Basch, et al.. J. Immunol. Methods (1983) 56: 269 (immunoaflnity chromatography), and Wysocki and Sato, Proc. Natl _τ Acad. Sci. flTSAI (1978) 75: 2844 (fluorescence-activated cell sorting). (Fig. IA) Recovered CD457GlyA ^" cells are plated onto culture dishes coated with 5- 115 ng/ml (preferably about 7-10 ng/ml) serum fibronectin or other appropriate matrix coating. Cells are maintained in Dulbecco Minimal Essential Medium (DMEM) or other appropriate cell culture medium, supplemented with 1- 50 ng/ml (preferably about 5-15 ng/ml) platelet-derived growth factor-BB (PDGF-BB), 1-50 ng/ml (preferably about 5-15 ng/ml) epidermal growth factor (EGF), 1-50 ng/ml (preferably about 5-15 ng/ml) insulin-like growth factor (IGF), or 100-10,000 IU (preferably about 1,000 IU) LIF, with 10 ¹⁰ to lO ^" * M dexamethasone or other appropriate steroid, 2-10 μg/ml linoleic acid, and 0.05- 0.15 uM ascorbic acid. Other appropriate media include, for example, MCDB, MEM, IMDM, and RPMI. Cells can either be maintained without serum, in the

presence of 1-2% fetal calf serum, or, for example, in 1-2% human AB serum or autologous serum. (Fig. IB)

The present inventors have shown that MASCs cultured at low density express the LIF-R, and these cells do not or minimally express CD44 whereas cells cultured at high density, that have characteristics of MSC, loose expression ofLIF-R but express CD44. 1-2% CD45 ^' GlyA- cells are CD44 ^' and < 0.5% CD45 GlyA ^" cells are LEF-R ⁺ . FACS selected cells were subjected to quantitative RT-PCR (real time PCR) for oct-4 mRNA. oct-4 mRNA levels were 5 fold higher in CD45 GlyA ^* CD44- and 20-fold higher in CD45 ^" GlyA ^" LIF-R ⁺ cells than in unsorted CD45 GlyA ^" cells. Sorted cells were plated in MASC culture with lOng/mL EGF, PDGF-BB and LIF. The frequency with which MASC started growing was 30-fold higher in CD45 ^" GlyALIF-R ⁺ cells and 3 fold higher in CD45'GlyA ^" CD44 ^" cells than in unsorted CD45 GIyA ^' cells. When human cells are re-seeded at -0.5XlO ³ cells/cm ² , cultures grow poorly and die. When re-seeded at >10xl0 ³ cells/cm ² every 3 days, cells stop proliferating after <30 cell doublings and, as will be discussed below, this also causes loss of differentiation potential. When re-seeded at 2XlO ³ cells/cm ² every 3 days, >40 cell doublings can routinely be obtained, and some populations have undergone >70 cell doublings. Cell doubling time was 36-48h for the initial

20-30 cell doublings. Afterwards cell-doubling time was extended to as much as 60-72h. (Fig. 2)

Telomere length of MASCs from 5 donors (age 2 years-55 years) cultured at reseeding densities of 2XlO ³ cells/cm ² for 23-26 cell doublings was between 11-13 kB. This was 3-5kB longer than telomere length of blood lymphocytes obtained from the same donors. Telomere length of cells from 2 donors evaluated after 23 and 25 cell doublings resp. and again after 35 cells doublings, was unchanged. The karyotype of these MASCS was normaL (Fig. 3) B. MASCs from murine tissues: Marrow from C57/BL6 mice was obtained and mononuclear cells or cells depleted of CD45 and GIyA positive cells plated under the same culture conditions used for human MASCs (IOng/mL human PDGF-BB and EGF).

When marrow mononuclear cells were plated, we depleted CD45* cells 14 days after initiation of culture to remove hemopoietic cells. As for human MASCs, cultures were re-seeded at 2,000 cells/cm ² every 2 cell doublings. In contrast to what we saw with human cells, when fresh murine marrow mononuclear cells depleted on day 0 of CD45 ⁺ cells were plated in MASCs culture, no growth was seen. When murine marrow mononuclear cells were plated, and cultured cells 14 days later depleted of CD45* cells, cells with the morphology and phenotype similar to that of human MASCs appeared. When cultured with PDGF-BB and EFG alone, cell doubling was slow (>6 days) and cultures could not be maintained beyond 10 cell doublings. Addition of 100-10,000 ng/mL

(preferably 1,000 IU) LIF significantly improved cell growth and > 70 cell doublings have been obtained.

Marrow, brain or liver mononuclear cells from 5-day old FVB/N mice were plated in MASCs cultures with EGF, PDGF-BB and LIF on fibronectin. 14 days later, CD45 ⁺ cells were removed and cells maintained in MASCs culture conditions as described above. Cells with morphology and phenotype similar to that of human MASCs and murine marrow C57/B16 MASCs grew in cultures initiated with marrow, brain or liver cells from FVB/N mice. C- Phenotype of MASCs. L Human MASCs.

Immunophenotypic analysis by FACS of human MASCs obtained after 22-25 cell doublings showed that cells do not express CD31, CD34, CD36, CD38, CD45, CD50, CD62E and -P, HLA-DR, Muclδ, STRO-I, cKit, Tie/Tek; and express low levels of CD44, HLA-class I, and β2-microglobulin, but express CDlO, CD13, CD49b, CD49e, CDw90, FM (N>10).

Once cells undergo >40 doublings in cultures re-seeded at 2XlO ³ ZCm ² , the phenotype becomes more homogenous and no cell expressed HLA-class-I or CD44 (n=6). When cells were grown at higher confluence, they expressed high levels of Muclδ, CD44, HLA-class I and β2-microglobulin, which is similar to the phenotype described for MSC (N=8) (Pittenger, Science (1999) 284: 143- 147).

Immunhistochemistry showed that human MASCs grown at 2XlO ³ ZCm ² seeding density express EGF-R, TGF-Rl and -2, BMP-RlA ₁ PDGF-RIa and -B, and that a small subpopulation (between 1 and 10%) of MASCs stain with anti-SSBA4 antibodies (Kannagi R, EMBO J 2:2355-61, 1983). Using Clontech cDNA arrays we evaluated the expressed gene profile of human MASCs cultured at seeding densities of 2xl0 ³ /cm ² for 22 and 26 cell doublings and found the following profiles:

A. MASCS do not express CD31, CD36, CD62E, CD62P, CD44-H, cKit, Tie, receptors for ILl, IL3, EL6, ILl 1, G-CSF, GM-CSF, Epo, FItB-L, or CNTF, and low levels of HLA-class-I, CD44-E and Muc-18 mRNA.

B. MASCs express mRNA for the cytokines BMPl, BMP5, VEGF, HGF, KGF, MCPl; the cytokine receptors Flkl, EGF-R, PDGF-Rlα, gpl30, LIF-R, activin-Rl and -R2, TGFR-2, BMP-RlA; the adhesion receptors CD49c, CD49d, CD29; and CDlO. C. MASCs express mRNA for hTRT and TRFl; the POU-domain transcription factor oct-4 c sox-2 (required with oct-4 to maintain undifferentiated state of ES/EC, Uwanogho D, Mech Dev 49:23-36, 1995), sox-11 (neural development), sox-9 (chondrogenesis, Lefebvre V, Matrix Biol 16:529-40, 1998); homeodeomain transcription factors: Hoχa4 and -a5 (cervical and thoracic skeleton specification; organogenesis of respiratory tract, Packer AI, Dev Dyn 17:62-74, 2000), Hox-a9 (myelopoiesis, Lawrence H, Blood 89:1922, 1997), Dlx4 (specification of forebrain and peripheral structures of head, Akunenko MA, JNeurosci 14:3475-86, 1994), MSXl (embryonic mesoderm, adult heart and muscle, chondro- and osteogenesis, Foerst-Potts L, Dev Dyn

209:70-84, 1997), PDXl (pancreas, Offield MF, Development 122:983- 95, 1996)

D. Presence of oct-4, LIF-R, and hTRT mRNA has been confirmed by RT-PCR. E. In addition RT-PCR showed that Rex-1 mRNA (required with oct-4 to maintain ES in an undifferentiated state, Rosfiord E, Biochem Biophys Res Cormnun 203:1795-802, 1997) and Rox-1 mRNA (required with

oct-4 for transcription of Rex-1, Ben-Shushan E, Cell Biol 18:1866-78,

1998) are expressed in MASCs. oct-4 is a transcription factor expressed in the pregastrulation embryo, early cleavage stage embryo, cells of the inner cell mass of the blastocyst, and in embryonic carcinoma (EC) cells (Nichols J, et al Cell 95:379-91 , 1998), and is down-regulated when cells are induced to differentiate. Expression of oct-4 plays an important role in determining early steps in embryogenesis and differentiation, oct-4, in combination with Rox-1, causes transcriptional activation of the Zn-finger protein Rex-1, also required for maintaining ES undiffereniated (Rosfjord E, Rizzino A. Biochem Biophys Res Commun

203:1795-802, 1997; Ben-Shushan E, et al, MoI Cell Biol 18:1866-78, 1998. In addition, sox-2, expressed in ES/EC, but also in other more differentiated cells, is needed together with oct-4 to retain the undifferentiated state of ES/EC (Uwanogho D, Rex M, Cartwright EJ, Pearl G, Healy C, Scotting PJ, Sharpe PT: Embryonic expression of the chicken Sox2, Sox3 and Soxl 1 genes suggests an interactive role in neuronal development MechDev 49:23-36, 1995). Maintenance of murine ES cells and primordial germ cells requires presence of LJ-F whereas this requirement is not so clear for human and non-human primate ES cells. The present inventors observed that oct-4, Rex-1 and Rox-1 are expressed in MASCs derived from human and murine marrow and from murine liver and brain. Human MASCs express the LJJF-R and stain positive with SSEA-4. Initial experiments show that human MASCs are enriched by selection OfLDF-R ⁺ cells even though it is not yet clear if their growth is affected by LIF. In contrast, LIF aids in the growth of murine MASCs. Finally, oct-4, LEF-R, Rex-1 and Rox-1 mRNA levels increase in human MASCs cultures beyond 30 cell doublings, which results in phenorypically more homogenous cells. In contrast, MASCs cultured at high-density lose expression of these markers. This is associated with senescence before 40 cell doublings and loss of differentiation to cells other than chondroblasts, osteoblasts and adipocytes. Thus, the presence of oct-4, combined with Rex-1, Rox-1, sox-2, and the LIF-R are markers that correlate with presence of the most primitive cells in MASCs cultures.

The present inventors have examined mice transgenic for an oct-4 promoter-eGFP gene. In these animals, eGFP expression is seen in primordial germ cells as well as in germ cells after birth. As MASCs express oct-4, the present inventors tested whether eGFP positive cells could be found in marrow, brain, and liver of these animals after birth. eGFP* cells (1% brightest population) were sorted from marrow, brain and liver from 5 day-old mice. When evaluated by fluorescence microscopy, <1 % of sorted cells from brain and marrow were eGFP ⁺ . oct-4 mRNA could be detected by Q-RT-PCR in the sorted population. Sorted cells have been plated under conditions that support murine MASCs (fibronectin coated wells with EGF, PDGF, LIF). Cells survived but did not expand. When transferred to murine embryonic fibroblasts, cell growth was seen. When replated again under MASC conditions, cells with morphology and phenotype of MASCs were detected. 2. Murine MASCs. As for human celts, C57/BL6 MASCs, cultured with EGF, PDGF-BB and

LIF are CD44 and HLA-class-I negative, stain positive with SSEA-4, and express transcripts for oct-4, LIF-R, Rox-1 and sox-2. Likewise, MASCs from FVB/N marrow, brain and liver express oct3/4 mRNA.

Culturing Multipotent adult stem cells

Multipoteήt adult stem cells (MASCs) isolated as described herein can be cultured using methods of the invention. Briefly, culture in low-serum or serum- free medium is preferred to maintain the cells in the undifferentiated state. Serum-free medium used to culture the cells, as described herein, is supplemented as described in Table I.

* Preferred concentrations are shown in parentheses. Because MASCs express the LIF-R and some cells express oct-4, it was tested whether addition of LIF would improve culture. Addition of lOng/mL LIF to human MASCs did not affect short-term cell growth (same cell doubling time till 25 cell doublings, level of oct-4 expression). In contrast to what was seen with human cells, when fresh murine marrow mononuclear cells depleted on day 0 of CD45* cells were plated in MASCs culture, no growth was seen. When murine marrow mononuclear cells were plated, and cultured cells 14 days later depleted of CD45 ⁺ cells, cells with the morphology and phenotype similar to that of human MASCs appeared. This suggests that factors secreted by hemopoietic cells may be needed to support initial growth of murine MASCs. When cultured with PDGF-BB and EFG alone, cell doubling was slow (>6 days) and cultures could not be maintained beyond 10 cell doublings. Addition of lOng/mL LIF significantly enhanced cell growth.

Once established in culture, cells can be frozen and stored as frozen stocks, using DMEM with 40% FCS and 10% DMSO. Other methods for preparing frozen stocks for cultured cells are also known to those of skill in the art.

Inducing MASCs to Differentiate to Form Committed Progenitors and Tissue- Specific Cell Types

Using appropriate growth factors, chemokines, and cytokines, MASCs of the present invention can be induced to differentiate to form a number of cell lineages, including, for example, a variety of cells of mesodermal origin as well as cell from neuroectodermal origin (glial cells, oligodendrocytes, and neurons) as well as endodermal origin.

A. Splanchnic mesoderm

1. Osteoblasts: Confluent MASCs were cultured with about 10 ^" "-10 ^"8 M (preferably about 10 ^"7 M) dexamethasone, β-glycerophosphate and 5-20 mM

(preferably 1OmM) ascorbic acid. To demonstrate presence of osteoblasts, we used Von Kossa staining (silver reduction of CaPo4), or antibodies against bone sialoprotein, osteonectin, osteopontin and osteocalcin (immunohistochemistry/ Western). After 14-21 days of culture, >80% of cells stained positive with these antibodies. ( Fig. 5, 6)

2. Chondroblasts: MASCs were trypsinlzed, and cultured in serum-free DMEM supplemented with 50-1,00 ng/mL (preferably 100 ng/mL) TGF-βl in micromass suspension culture. Small aggregates of cartilage formed in the bottom of the tubes that stained positive with toluidin blue. Collagen type I was detected initially throughout the micromass (day 5) but after 14 days was only detected in the outer layer of fibrinous cartilage. Collagen type II became detectable after 5 days and strongly stained the micromass by day 14. Staining for bone sialoprotein was negative or minimally positive in the outer fibrinous cartilage layer. Variable staining was found for osteonectin, osteocalcin and osteopontin. Presence of collagen type II was confirmed by Western blot and RT-PCR. In addition, RTrPCR on cells recovered after 5days showed presence of the cartilage specific transcription factors CARTl and CD-RAPl . (Fig. 5, 6)

3. Adipocyte: To induce adipocyte differentiation, about 10 ^"7 to about 10^ M (preferably about 10 ^'7 M) dexamethasone, about 50 to about 200 μg/ml (preferably about 100 μg/ml) insulin or media supplemented with approximately 20% horse serum can be used. Adipocyte differentiation can be detected by examination with light microscopy, staining with oil-red, or detection of

lipoprotein lipase (LPL), adipocyte lipid-binding protein (aP2), or peroxisome proliferator-activated receptor gamma (PPAR ). Methods for detection of cellular markers and products are known to those of skill in the art, and can include detection using specific ligands, such as, for example, troglitazone (TRO) and rosiglitazone (RSG), which bind to PPARγ. (Fig 5, 6)

4. Expressed gene profile of cartilage and bone. The present inventors examined genes expressed upon differentiation to osteoblasts and chondroblasts. In particular, they examined the expressed gene profile of MASCs (n=3) and MASCs switched to osteoblast or chondroblast culture conditions for two days to determine whether a relative homogenous switch to the two specific lineages is seen, using Clonetech and Invitrogen cDNA arrays. A partial list of changes detected is shown in table 2. This is by no means a conclusive evaluation of the expressed gene profile in MASCs,.osteoblasts and chondroblasts. However, the results indicate that differentiation of MASCs to bone and cartilage induces significant and divergent changes in expressed gene profile, consistent with the observation that most cells within a culture can be induced to differentiate along a given pathway.

5. Expressed gene profile of bone by subtractive hybridization: The present inventors used a subtraction approach to identify genetic differences between undifferentiated MASCs and committed progeny. PoIy-A mRNA was extracted from undifferentiated MASCs and cells induced to differentiate to the osteoblast lineage for 2 days. Subtraction and amplification of the differentially expressed cDNAs was done using the PCR-Select kit from Clonetech, as per manufacturer's recommendation without modification. We started to analyze gene sequences expressed in day 2 osteoblast cultures but not in undifferentiated MASCs. 1) The present inventors sequenced 86 differentially expressed cDNA- sequences. We confirmed by Northern that the mRNAs are indeed specifically expressed in day 2 osteoblast progenitors and not MASCs. The sequences were compared (using the BLAST algorithm) to the following databases: SwissProt, GenBank protein and nucleotide collections, ESTs, murine and human EST contigs.

2) Sequences were categorized by homology: 8 are transcription factors, 20 are involved in cell metabolism; 5 in chromatin repair; 4 in the apoptosis pathway; 8 in mitochondrial function; 14 are adhesion receptors / ECM components; 19 are published EST sequences with unknown function and 8 are novel.

3) For 2 of the novel sequences, the present inventors started to perform Q-RT- PCR on MASCs induced to differentiate to bone for 12h, 24h, 2d, 4d, 7d and 14d from 3 individual donors. Genes are expressed during the initial 2 and 4 days of differentiation respectively, and down regulated afterwards. 4} The present inventors have also started to analyze genes present in undifferentiated MASCs but not day 2 osteoblasts. Thirty differentially expressed genes have been sequenced and 5 of them are EST sequences or unknown sequences.

B. Muscle Differentiation to any muscle phenotype required that MASCs be allowed to become confluent prior to induction of differentiation.

1. Skeletal muscle: To induce skeletal muscle cell differentiation, confluent MASCs cells were treated with about 1 to about 3 μM (preferably about 3 μM) 5-azacytidine in MASC expansion medium for 24 hours. Cultures were then maintained in MASCs medium. Differentiation was evaluated by Western blot and immunohistochemistry. Skeletal muscle differentiation in vitro can be demonstrated by detecting sequential activation of Myf-5, Myo-D, Myf-6, myogenin, desmin, skeletal actin and skeletal myosin, either by immunohistochemistry or Western blot analysis using standard techniques known to those of skill in the art and commercially available antibodies. Five days after induction with either 5-azacytidine the Myf5, Myo-D and MyflS transcription factors could be detected in approximately 50% of cells. After 14-18 days, Myo-D was expressed at significantly lower levels, whereas Myf5 and Myf6 persisted. Desmin and skeletal actin were detected as early as four days after induction, and skeletal myosin at 14 days. By immunohistochemistry, 70-80% of cells expressed mature muscle proteins after 14 days. Treatment with 5-azacitidine resulted in expression of Gata4 and Gataό during the first week of culture. In addition, low levels of troponin-T could be detected from day two onwards. Smooth muscle actin was detected at two days after induction and persisted for 14 days. When 20% horse serum was added, a fusion of myoblasts into myotubes that were multinucleated was seen. (Fig. 7) Using double fluorescent labeling we could show that transduced myoblasts could be caused to fuse with differentially lateral myocytes (Fig. 8).

2. Smooth muscle: Smooth muscle cells can also be induced by culturing MASCs in serum-free medium, without growth factors, supplemented with high concentrations (about 50 to about 200 ng/ml, preferably about

100 ng/ml) of platelet-derived growth factor (PDGF). Cells should preferably be confluent at initiation of differentiation. Terminally differentiated smooth muscle cells can be identified by detecting expression of desmin, smooth muscle specific actin, and smooth muscle specific myosin by standard methods known to those of skill in the art. Smooth muscle actin was detected from day two onwards and smooth muscle myosin after 14 days. Approximately 70% of cells stained positive with anti-smooth muscle actin and myosin antibodies. A

presence of myogenin was seen from day four onwards and desmin after 6 days. Myf5 and Myf6 proteins were also detected after 2-4 days, which persisted till day 15. No Myo-D was detected. (Fig. 7)

3. Cardiac muscle: Cardiac muscle differentiation can be accomplished by adding about 5 to about 200 ng/ml (preferably about 100 ng/ml) basic fibroblast growth factor (bFGF) to the standard serum-free culture media without growth factors, as previously described. Confluent MASCs were exposed to μM (preferably about 3 μM) 5-azacytidine and to 10 ^"5 -10 ^"7 M (preferably 10 ^" *M) retinoic acid, and then cultured in MASC expansion medium afterwards. Alternatively, MASCs were cultured with either of these inducers alone or a combination of both and then cultured in serum-free medium with 50-200 ng/mL (preferably lOOng/mL FGF2 or a combination of 5-20ng/mL (preferably 10 ng/mL) BMP-4 and 100 ng/mL FGF2. We found expression of proteins consistent with cardiomyocytes. Gata4 and Gataβ were expressed as early as day 2 and persisted till day 15. Cardiac troponin-T was expressed after day 4 and cardiac troponin-I from day 6 on, while we could detect ANP after day 11. These cardiac proteins were detected in >70% of cells by immuno- histochemistry on day 15. We found the transcription factor Myfδ from day 2 on. Expression of desmin started on day 6 and myogenin on day 2. We also found skeletal actin. When the cultures were maintained for >3 weeks, cells formed syncithia. We also saw infrequent spontaneous contractions occurring in the cultures, which were propagated over several mm distance. (Fig.7)

C. Endothelial Cells MASCs express Flkl but not CD34, PECAM, E- and P-selectin, CD36, Tie/Tek or Fltl. When MASCs were cultured serum-free MASCs medium with 20 ng/mL VEGF we saw the appearance of CD34 on the cell surface and cells expressed vWF by day 14 (immuno-fluorescence) (Fig. 9, 10). In addition, cells expressed Tie, Tek, Flkl and Fltl, PECAM, P-selectin and E-selectin, and CD36. Results from the histochemical staining were confirmed by Western blot. When VEGF induced cells were cultured on matrigel or collagen type IV, vascular tube formation was seen. (Fig. 9, 10)

D. Hemopoietic Cells As MASCs differentiate into CD34 ⁺ endothelial cells and recent studies show that CD34 ^" Flkl ⁺ cells can be induced to

differentiate into endothelial cells as well as hemopoietic cells, we tested whether MASCs could be induced to differentiate in hemopoietic precursors. MASCs were replated on collagen type IV in PDGF-BB-and EGF-containing MASCs medium with 5% FCS and lOOng/mL SCF that was conditioned by the AFT024 feeder, a fetal liver derived mesenchymal line that supports murine and human repopulating stem cells ex vivo. Cells recovered from these cultures expressed cKit, cMyb, Gata2 and G-CSF-R but not CD34 (RT-PCR). Because hemopoiesis is induced by factors that are released by embryonal visceral endoderm, we co-cultured human MASCs with βGal ⁺ murine EBs in the presence of human SCF, FK3-L, Tpo and Epo. In 2 separate studies, we detected a small population of βGal ^" cells that expressed human CD45.

E. Stromal cells: The inventors induced "stromal" differentiation by incubating MASCs with IL-lα, FCS, and horse serum. To demonstrate that these cells can support hemopoiesis, feeders were irradiated at 2,GOO cGy and CD34 ⁺ cord blood cells plated in contact with the feeder. After 1, 2 and 5 weeks, progeny was replated in methylcellulose assay to determine the number of colony forming cells (CFC). A 3-5-fold expansion of CFC was seen after 2 weeks and maintenance of CFC at 5 weeks, which was similar to cultures of CD34 ^* cells in contact with the murine fetal liver derived feeder, AFT024. F. Neuronal Cells Surprisingly. MASCs induced with VEGF. the hemopoietic cytokines SCF, FU3-L, Tpo and Epo in MASCs medium containing EGF conditioned by the hematopoietic supportive feeder AFT024 differentiated into glial-fibrilar-acidic-protein (GFAP) positive astrocytes, galactocerebroside (GaIC) positive oligodendrocytes and neurofilament positive neurons (Fig. 11) The inventors hypothesized that production of FGF2 by the AFT024 feeders and addition of EGF to the cultures might induce differentiation to neuronal cells in vitro.

They then examined the effect FGF2, known to play a key role in neural development and ex vivo culture of neural precursors, on MASCs derived neural development. When <50% confluent cultures of human marrow derived MASCs (n=7) that had been cultured with EGF and PDGF-BB were switched to medium containing 50-500 ng/mL (preferably lOOng/mL) FGF2, differentiation to cells

expressing of astrocytes, oligodendrocytes and neurons was seen after 2-4 weeks (Fig. 11) After two weeks in culture, 26±4% of cells were GFAP positive, 28±3% GaIC positive and 46±5% neurofilament-200 positive. When reexamined after three weeks, fewer cells were GFAP or GaIC positive, but 20±2% cells stained positive for β-tubulin-m, 22±3% for neurofilament-68, 50±3% for neurofiIament-160, 20±2% for neurofilament-200, 82±5% for neuron-specific-enolase (NSE) and 80±2% for niicrotubule-assocaited-protein-2 (MAP2) (Fig. 11) GABA, parvalbumin, tyrosine hydroxylase, DOPA-decarboxylase, and tryptophan hydroxylase were not detected. The number of neurites per neuron increased from 3±1, to 5±1 and 7±2 from 2, 3 to 4 weeks after differentiation; Differentiation to cells with characteristics of astrocytes, oligodendrocytes and neurons was confirmed by demonstrating presence of GFAP, myelin basic protein (MBP) and neurofilament-200 by Western blot and RT-PCR analysis in FGF2 treated but not 3VIASCs). FGF-9, first isolated from a glioblastoma cell line, induces proliferation of glial cells in culture. FGF-9 is found in vivo in neurons of the cerebral cortex, hippocampus, substantia nigra, motor nuclei of the brainstem and Purkinje cell layer. When cultured for 3 weeks with 5-50 ng/raL (preferably lOng/mL) FGF-9 and EGF MASCs generated astrocytes, oligodendrocytes and GABAergic and dopaminergic. During CNS development, FGF-8, expressed at the mid/hindbrain boundary and by the rostral forebrain, in combination with Sonic hedgehog, induces differentiation of dopaminergic neurons in midbrain and forebrain. It was found that when MASCs were cultured with 5-50 ng/mL (preferably lOng/mL) FGF-8 and EGF for 3 weeks both dopaminergic and GABAergic neurons were produced. FGF-10 is found in the brain in very low amounts and its expression is restricted to the hippocampus, thalamus, midbrain and brainstem where it is preferentially expressed in neurons but not in glial cells. Culture of MASCs in 5-50 ng/mL (preferably lOng/mL) FGF-10 and EGF for three weeks generated astrocytes and oligodendrocytes, but not neurons. FGF-4 is expressed by the notochord and is required for the regionalisation of the midbrain. When treated with 5-50 ng/mL (preferably 1 Ong/mL) FGF-4 and EGF

for 3 weeks MASCs differentiated into astrocytes and oligodendrocytes but not neurons.

Other growth factors that are specifically expressed in the brain and that affect neural development in-vivo and in-vitro include brain derived neurotrophic factor (BDNF), glial derived neurotrophic factor (GDNF) and ciliary neurotrophic factor (CNTF)- BDNF is a member of the nerve growth factor family that promotes in vitro differentiation of NSC, human subependymal cells, and neuronal precursors to neurons and promotes neurite outgrowth of hippocamal stem cells in vivo. Consistent with the known function of BDNF to support survival of dopaminergic neurons of the substantia nigra, when MASCs were treated with 5-50 ng/mL (preferably lOng/mL) BDNF and EGF exclusive differentiation into tyrosine hydroxylase positive neurons was seen. GDNF is a member of the TGF- superfamily. In early neurogenesis, GDNF is expressed in the anterior neuroectoderm suggesting that it may play a key role in neuronal development. GDNF promotes survival of motor neurons in peripheral nerve and muscle and has neurotrophic and differentiation abilities. It was found that 5-50 ng/mL (preferably lOng/mL) GDNF induced MASCs to differentiate into GABAergic and dopaminergic neurons. CNTF, first isolated from ciliary ganglion, is a member of the gpl30 family of cytokines. CNTF promotes neuronal survival early in development. In embryonic rat hippocampal cultures CNTF increased the numbers of GABAergic and cholinergic neurons. In addition, it prevented cell death of GABAergic neurons and promoted GABA uptake. 5-50 ng/mL (preferably lOng/mL) CNTF exerted the same GABAergic induction on MASCs as they differentiated exclusively into GABAergic neurons after three weeks of exposure to CNTF.

The fate of MASCs transplanted into rat brain was also examined. 50,000 eGFP* MASCs were transplanted stereotactically around a parietal infarct induced in Wistar rats, maintained on cyclosporin. Limb-placement was tested six weeks after transplant of saline, MASCs conditioned medium, or MASCs. Functional improvement to levels equivalent to that of sham animals was only seen in rats transplanted with MASCs (Fig. 15).

After two and six weeks, animals were sacrificed to determine neural phenotype. Because of autofluorescence of the brain following transplantation with eGFP ⁺ cells, immunohistochemical analysis of the graft was performed. The majority of eGFP ⁺ cells were detected in the grafted area itself at two weeks (Fig. 16). After five weeks, eGFP ^* cells migrated outside the graft. At two weeks, cells staining with an anti-eGFP antibody remained spherical in nature and ranged from 10-30 μm in diameter. After six weeks, cells with an anti-eGFP antibody were significantly smaller and dendrites could be seen in the grafted area, extending out to the normal brain tissue. Presence of human cells was . confirmed by staining with a human specific nuclear antibody, NuMa. This antibody can be used to identify human cells in the graft allowing double and triple staining with immunofluorescent antibodies.

Using human specific anti-nestin antibodies, the present inventors detected small clusters of nestin-positive cells in the same location of the graft as the NuMa-positive cells and GFP ⁺ CeIIs, suggestive of neuroectodermal differentiation. In addition, they found positive staining for -tubulin HI and Neurofilament-68 and -160, Oligo Marker and GFAP, suggesting differentiation to neuronal and glial cells (not shown).

G. Epithelial Cells The inventors treated confluent MASCs (N=4) with lOng/mL hepatocyte growth factor (HGF), alone or in combination with keratinocyte growth factor (KGF). After 14 days, large epithelioid cells could be seen that expressed the HGF receptor, cytokeratin 8, 18 and 19. Presence of cytokeratin-19 suggests possible differentiation to biliary epithelium. Changing the matrix from fibronectiπ to a collagen gel or matrigel unproved generation of cytokeratin-18 expressing cells with morphology of epithelial cells. (Fig. 17)

Single Cell Origin of Differentiated Lineages,

To address if MASCs are clonal, the inventors have sorted by FACS 1 and 10 MFG-eGFP transduced eGFP* cells per well and cultured cells to generate 10* cells. Transduction was done as follows: MASCs replated 24h earlier were exposed for 6 h on 2 sequential days to MFG-eGFP or MSCV-eGFP packaged in the PGl 3 cell line and lOμg/mL protamine. Between 40-70% of

MASCS were transduced. Expression of eGFP persisted for at least 3 months ex vivo, and persisted in a large fraction of cells following differentiation. When a single cell was sorted, no growth was seen in > 1,000 wells. However, when 10 cells were deposited/ well, cell growth was seen in 3% of wells, extensive expansion to > 10 ⁷ cells was seen in only 0.3% of wells. These cells were then induced to differentiate into all mesodermal cell types (osteoblasts, chondroblasts, adipocytes, skeletal and smooth muscle cells, and endothelium). Differentiation was again shown by immunohistochemistry and Western blot. Cells were also subjected to inverse PCR to demonstrate that the sequences in the human DNA flanking the viral insert were similar. The inventors found that the retroviral gene was inserted in the same site in the human genome in MASCs and differentiate progeny in 3 independent clones.

MASC Engrafiment The inventors initiated studies to examine if MASCs engraft and persist in vivo.

1. The inventors injected eGFP ^v MASCs intramuscularly into NOD-SCID mice. Animals were sacrificed 4 weeks later and muscle examined to determine if, as has been described for human ES cells, teratomas develop. In 5/5 animals, no teratomas were seen. eGFP positive cells were detected.

2. The inventors infused eGFP ⁺ MASCs IV intrauterine in fetal SCID mice. Animals were evaluated immediately after birth. PCR analysis demonstrated presence of eGFP ⁺ cells in heart, lung, liver, spleen and marrow.

3. The inventors transplanted MASCs stereotaxically in the intact brain or infarcted brain of rats, they acquire a phenotype compatible with neural cells, and persist for at least 6 weeks.

Applications of MASCs

1. osteoblasts: MASCs of the present invention that have been induced to differentiate to form bone cells can be used as cell therapy or for tissue regeneration in osteoporosis, Paget's disease, bone fracture, osteomyelitis, osteonecrosis, achondroplasia, osteogenesis imperfecta, hereditary multiple

exostosis, multiple epiphyseal dysplasia, Marian's syndrome, mucopolysaccharidosis, neurofibromatosis or scoliosis, reconstructive surgery for localized malformations, spina bifida, hemivertebrae or fused vertebrae, limb anomalies, reconstruction of tumor-damaged tissue, and reconstruction after infection, such as middle ear infection.

2. chondrocytes: MASCs of the present invention can be induced to differentiate to form cartilage cells for cell therapy or tissue regeneration in age- related diseases or injuries, in sports-related injuries, or in specific diseases such as rheumatoid arthritis, psoriasis arthritis, Reiter's arthritis, ulcerative colitis, Crohns' disease, ankylosing spondylitis, osteoathritis, reconstructive surgery of the outer ear, reconstructive surgery of the nose, and reconstructive surgery of the cricoid cartilage.

3. adipocytes: Adipocytes derived from the MASCs can. be used in resculpting during reconstructive or cosmetic surgery, as well as for the treatment of Type II diabetes. In reconstructive surgery, adipocytes differentiated as described by the method of the present invention can be used for breast reconstruction after mastectomy, for example, or for reshaping tissue lost as a result of other surgery, such as tumor removal from the face or hand. In cosmetic surgery, adipocytes produced from the cells of the present invention by the method of the present invention can be used in a variety of techniques, such as breast augmentation, or for reduction of wrinkles in aging skin. Adipocytes thus derived can also provide an effective in vitro model system for the study of fat regulation.

4. fibroblasts: Fibroblasts derived from the MASCs can be used for cell therapy or tissue repair to promote wound healing or to provide connective tissue support, such as scaffolding for cosmetic surgery.

5. Skeletal muscle: MASCs can be induced to differentiate to form skeletal muscle cells for cell therapy or tissue repair in the treatment of Duchene muscular dystrophy, Becker muscular dystrophy, myotonic dystrophy, skeletal myopathy, and reconstructive surgery to repair skeletal muscle damage.

6. Smooth muscle: MASCs can be induced to differentiate to form smooth muscle cells for cell therapy or tissue repair in the treatment of

developmental abnormalities of the gastrointestinal system, such as oesophageal atresia, intestinal atresia, and intussusception, as well as for replacement of tissues after surgery for bowel infarction or colocolostomy.

Smooth muscle cells formed from the MASCs of the present invention can also be used for bladder or uterine reconstruction, for neovascularization, for repair of vessels damaged by, for example, atherosclerosis or aneurysm. Smooth muscle precursor cells (mesangial cells) can be used as an in vitro model for glomerular diseases or for cell therapy or tissue regeneration in diabetic neuropathy. Smooth muscle precursors can also be used to repair macula densa of the distal convoluted tubule or juxtaglomerular tissues, which play a role in blood pressure regulation.

7. cardiomyocytes: Cardiomyocytes derived from the MASCs can be useful for cell therapy or tissue repair for treating heart tissue damaged following myocardial infarction, in conjunction with congestive heart failure, during valve replacement, by congenital heart anomalies, or resulting from cardiomyopathies or endocarditis. Cells can be delivered locally, especially by injection, for increased effectiveness. Microglial cells differentiated from MASCs cart be used to treat spinal cord injuries and neurodegenerative disorders, such as Huntingtons disease, Parkinsons disease, Multiple Sclerosis, and Alzheimers disease, as well as repair of tissues damaged during infectious disease affecting the central nervous system. Microglial cells that have been genetically altered to produce cytokines can also be used for transplantation for the treatment of infectious disease in the central nervous system where access is limited due to the blood-brain barrier. Glial cells can also be used to produce growth factors or growth factor inhibitors for regeneration of nerve tissue after stroke, as a consequence of multiple sclerosis, amylotropic lateral sclerosis, and brain cancer, as well as for regeneration after spinal cord injury.

8. stromal cells: Stromal cells derived from the MASCs of the present invention can be used as transplant cells for post-chemotherapy bone marrow replacement, as well as for bone marrow transplantation. In breast cancer, for example, a bone marrow aspirate is obtained from a patient prior to an aggressive chemotherapy regimen. Such chemotherapy is damaging to tissues,

particularly to bone marrow. MASCs isolated from the patient's bone marrow can be expanded in culture to provide enough autologous cells for re-population of the bone marrow cells. Because these cells can differentiate to multiple tissues types, cells introduced either locally or systemically provide an added advantage by migrating to other damaged tissues, where cellular factors in the tissue environment induce the cells to differentiate and multiply.

9. endothelial cells: MASCs can be differentiated by the methods described to produce endothelial cells, which can be used in the treatment of Factor VHI deficiency, as well as to produce angiogenesis for neovascularization. Endothelial cells can also provide an in vitro model for tumor suppression using angiogenic inhibitors, as well as an /π vitro model for vasculitis, hypersensitivity and coagulation disorders. Using these cultured endothelial cells and rapid screening methods known to those of skill in the art, thousands of potentially useful therapeutic compounds can be screened in a more timely and cost-effective manner.

10. hematopoietic cells: MASCs can differentiate into hematopoietic cells. Cells of the present invention can therefore be used to repopulate the bone marrow after high dose chemotherapy. Prior to chemotherapy, a bone marrow aspirate is obtained from the patient. Stem cells are isolated by the method of the present invention, and are grown in culture and induced to differentiate. A mixture of differentiated and undifferentiated cells is then reintroduced into the patient's bone marrow space. Clinical trials are currently underway using hematopoietic stem cells for this purpose. The stem cells of the present invention, however, provide the additional benefit of further differentiation to form cells that can replace those damaged by chemotherapy in other tissues as well as in bone marrow. Hematopoietic cells derived from the MASCs can be further differentiated to form blood cells to be stored in blood banks, alleviating the problem of a limited supply of blood for transfusions.

11. Neuroectodermal cells: Microglial cells differentiated from MASCs can be used to treat spinal cord injuries and neurodegenerative disorders, such as

Huntingtons disease, Parkinsons disease, Multiple Sclerosis, and Alzheimers disease, as well as repair of tissues damaged during infectious disease affecting

the central nervous system. Microglial cells that have been genetically altered to produce cytokines can also be used for transplantation for the treatment of infectious disease in the central nervous system where access is limited due to the blood-brain barrier. Glial cells can also be used to produce growth factors or growth factor inhibitors for regeneration of nerve tissue after stroke, as a consequence of multiple sclerosis, amylotropic lateral sclerosis, and brain cancer, as well as for regeneration after spinal cord injury.MASCs induced to form oligodendrocytes and astrocytes, for example, can be used for transplant into demyelinated tissues, especially spinal cord, where they function to myelinate the surrounding nervous tissues. This technique has been demonstrated effective in mice, using embryonic stem cells as the source of oligodendrocyte and astrocyte precursors (Brustle, O., et ah, Science (1999) 285: 754-756). The MASCs of the present invention exhibit the broad range of differentiation characteristic of embryonic cells, but provide the added advantage of contributing autologous cells for transplant.

The cells of the present invention can be used in cell replacement therapy and/or gene therapy to treat congenital neurodegenerative disorders or storage disorders such as, for instance, mucopolysaccharidosis, leukodystrophies (globoid-cell leukodystrophy, Canavan disease), fucosidosis, GM2 gangliosidosis, Niemann-Pick, Sanfilippo syndrome, Wolman disease, and Tay Sacks. They can also be used for traumatic disorders such as stroke, CNS bleeding, and CNS trauma; for peripheral nervous system disorders such as spinal cord injury or syringomyelia; for retinal disorders such as retinal detachment, macular degeneration and other degenerative retinal disorders, and diabetic retinopathy.

12. Ectodermal epithelial cells: Moreover, the epithelial cells of the present invention can also be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of skin disorders such as alopecia, skin defects such as bum wounds, and albinism. 13. Endodermal epithelial cells: Epithelial cells derived from the

MASC of the present invention can be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of several organ diseases. The cells

could be used to treat or alleviate congenital liver disorders, for example, storage disorders such as mucopolysaccharidosis, leukodystrophies, GM2 gangliosidosis; increased bilirubin disorders, for instance Crigler-Najjar syndrome; ammonia disorders such as inborn errors of the urea-cycle, for instance Ornithine decarboxylase deficiency, citrullinemϊa, and argininosuccinic aciduria; inborn errors of amino acids and organic acids such as phenylketoinuria, hereditary tyrosinemia, and Alpha 1 -antitrypsin deficiency; and coagulation disorders such as factor VIH and EX deficiency. The cells can also be used to treat acquired liver disorders due to viral infections. The cells of the present invention can also be used in ex vivo applications such as to generate an artificial liver (akin to kidney dialysis), to produce coagulation factors and to produce proteins or enzymes generated by liver epithelium.

These epithelial cells of the present invention can also be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of biliary disorders such as biliary cirthosis and biliary atresia.

The epithelial cells of the present invention can also be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of pancreas disorders such as pancreatic atresia, pancreas inflammation, and Alphal -antitrypsin deficiency. Further, as pancreas epithelium can be made from the cells ofthe present invention, and as neural cells can be made, beta- cells can be generated. These cells can be used for the therapy of diabetes (subcutaneous implantation or intra-pancreas or intra-liver implantation. Further, the epithelial cells ofthe present invention can also be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of gut epithelium disorders such as gut atresia, inflammatory bowel disorders, bowel infarcts, and bowel resection.

14. Modification of MASC to ensure absence of senescence under less than optimal culture conditions: Although MASC have long telomeres (12kb) and the telomere length is not different in cells from donors of different ages. Upon ex vivo culture ofthe MASC, telomeres do not shorten for an extended period of time, Le., for over 4 months in ex vivo culture (or > 35 cell doublings). This may persist longer. Telomerase is present in MASC derived from people of

all ages. When MASC cells are cultured under confluent conditions, senescence occurs and telomere begin to shorten. As extensive expansion in relative high dense cultures may be preferable for production, commercial or other purposes, MASC can be transduced/transfected with a telomerase-containing construct, which will prevent senescence of cells. As these cells could then be used for in vivo transplantation, it would be preferable that telomerase be removed from the cell prior to transplantation. This can be accomplished by engineering the telomerase construct such that it is located between two LoxP sites. The Cre recombinase will be able to then excize telomerase. Cre can be transfected/ transduced into the target cell using a second vector/plasmϊd or as part of the telomerase-containing construct. Cre can be introduced in a constitutively active form, or as an inducible enzyme, for instance by flanking the protein with one or more mutated ligand binding domains of the human estrogen receptor (ER) that can be induced by 4-hydroxy-tamoxifen (OHT), but not natural ER ligands, or by using a tetracyclin or rapamacine inducible, or other drug inducible system. 15. Approaches for transplantation to prevent immune rejection: a. universal donor cells: MASC can be manipulated to serve as universal donor cells for cell and gene therapy to remedy genetic or other diseases and to replace enzymes. Although undifferentiated MASC express no HLA-type I, HLA-type H antigens or beta-2 microglobulin, some differentiated progeny express at least type I HLA-antigens. MACS can be modified to serve as universal donor cells by eliminating HLA-type I and HLA-type II antigens, and potentially introducing the HLA-antigens from the prospective recipient to avoid that the cells become easy targets for NK-mediated killing, or become susceptible to unlimited viral replication and / or malignant transformation. Elimination of HLA-antigens can be accomplished by homologous recombination or via introduction of point-mutations in the promoter region or by introduction of a pointmutation in the initial exon of the antigen to introduce a stop-codon, such as with chimeroplasts. Transfer of the host HLA-antigen can be achieved by retroviral, Ientiviral, adeno associated virus or other viral transduction or by transfection of the target cells with the HLA-antigen cDNA's.

MASC can be used to establish and set amount or a given range or level of a protein in the body or blood b. Intrauterine transplant to circumvent immune recognition: MASC can be used in intrauterine transplantation setting to correct generic abnormalities, or to introduce cells that will be tolerated by the host prior to immune system development. This can be a way to make human cells in large quantities such as blood, in animals or it could be used as a way to correct human embryo genetic defects by transplanting cells that make the correct protein or enzyme.

16. Gene therapy: Until now, human cells used for gene therapy have been essentially limited to bone marrow and skin cells, because other types of cells could not be extracted from the body, grown in culture, genetically altered, then successfully reimplanted into the patient from whom the tissue was taken. (Anderson, W.F., Nature (1998) 392: 30; Anderson, W.F., Scientific American (1995) 273: 1-5; Anderson, W.F. Science (1992) 256: 808-813) MASCs of the present invention can be extracted and isolated from the body, grown in culture in the undifferentiated state or induced to differentiate in culture, and genetically altered using a variety of techniques, especially viral transduction. Uptake and expression of genetic material is demonstrable, and expression of foreign DNA is stable throughout development. Retroviral and other vectors for inserting foreign DNA into stem cells are known to those of skill in the art. (Mochizuki, H., et al, J. Virol (1998) 72(11): 8873-8883; Robbins, P., et al., J. Virol. (1997) 71(12): 9466-9474; Bierhuizen, M., et al., BJood. (1997) 90(9): 3304-3315; Douglas, J., et al., Hum. Gene Ther. (1999) 10(6): 935-945; Zhang, G., et al., Biochem. Biophvs. Res. Commun. (1996) 227(3): 707-711). Once transduced using a retroviral vector, enhanced green fluorescent protein (eGFP) expression persists in terminally differentiated muscle cells, endothelium, and c-Kit positive cells derived from the isolated MASCs, demonstrating that expression of retroviral vectors introduced into MASC persists throughout differentiation. Terminal difFerentiation was induced from cultures initiated with 10 eGFP ⁺ cells previously transduced by retroviral vector and sorted a few weeks into the initial MASC culture period.

Hematopoietic stem cells, although limited in differentiation potential, demonstrate utility for gene therapy (see Kohn, D. B., Curr. Qpin. Pediatr. (1995) 7: 56-63). The cells of the present invention provide a wider range of differentiated cell types which can retain transduced or transfected DNA when terminally differentiated, as demonstrated by the fact that terminally differentiated muscle cells, endothelium, and c-Kit positive cells retained enhanced green fluorescent protein expression although the retroviral vector had been introduced into the undifferentiated stem cell.

MASCs of the present invention provide other advantages over hematopoietic stem cells for gene therapy, as well. Stem cells of the present invention are relatively easy to isolate from bone marrow aspirates obtained under local anesthesia, easy to expand in culture, and easy to transfect with exogenous genes. Adequate numbers of hematopoietic stem cells for the same purpose must be isolated from at least one liter of marrow and the cells are difficult to expand in culture (see Prockop, D. J., Science (1997) 276: 71-74).

Candidate genes for gene therapy include, for example, genes encoding Apolipoprotein E (which has been correlated with risk for Alzheimer's disease and cardiovascular disease), MTHFR (variants of which have been associated with increased homocysteine levels and risk of stroke), Factor V (which has been correlated with risk of thrombosis), ACE (variants of which have been correlated with risk of heart disease), CKR-5 (which has been associated with resistance to HTV), HPRT (hypoxanthine-guanine phosphoribosyl transferase, the absence of which results in Lesch-Nyhan disease), PNP (purine nucleoside phosphorylase, the absence of which results in severe immunodeficiency disease), ADA (adenosine deaminase, the absence of which results in severe combined immunodeficiency disease), p21 (which has been proposed as a candidate gene for treatment for ataxia telangiectasia), p47 (the absence of which is correlated with lack of oxidase activity in neutrophils of patients with chronic granulomatous disease, GenBank accession number M55067 and M38755), Rb (the retinoblastoma susceptibility gene associated with tumor formation,

GenBank accession number Ml 5400), KVLQTl (a potassium channel protein, with aberrant forms associated with cardiac arrhythmias, GenBank accession

number U40990), the dystrophin gene (associated with Duchenne muscular dystrophy, GenBank accession numbers MI8533, M17154, and Ml 8026), CFTR (the transmembrane conductance regulator associated with cystic fibrosis, GenBank accession number M28668), phosphatidylinositol 3-kinase (associated with ataxia telangiectasia, GenBank accession number U26455), and VHL (loss or mutation of the protein is associated with Von-Hippel Lindau disease: Latif, F., et al., Science (1993) 260: 1317 1320). Other diseases which can be treated effectively using these genetically-altered cells includ, Factor IX deficiency, adenosine deaminase deficiency (associated with severe combined immunodeficiency disease, or SCDOS), and diabetes, and deficiencies in glucocerebrosidase, α-iduronidase.

These novel genes can be driven by an inducible promoter so that levels of enzyme can be regulated. These inducible promoter systems may include a mutated ligand binding domain of the human estrogen receptor (ER) attached to the protein to be produced. This would require that the individual ingests tamoxifen to allow expression of the protein. Alternatives are tetracyclin on or off systems, RU486, and a rapamycin inducible system. An additional method to obtain relative selective expression is to use tissue specific promoters. For instance in the brain, one can introduce a transgene driven by the neuron-specific enolase promoter (Ad-NSE) or the glial fibrillary acidic protein promoter

(GFAP) promoter, which will allow almost exclusive expression in brain tissue. Likewise, endothelial expression only may be obtained by using the Tec promoter or the VE-cadherin promoter.

Genetically altered MASCs can be introduced locally or infused systemically. Human stem cells with more limited differentiation potential, when transfected with a gene for factor IX, secrete the protein for at least 8 weeks after systemic infusion into SCID mice. (Keating, A,, et al., Blood (1996) 88: 3921.) MASCs of the present invention, having a broader differentiation potential than any non-embryonic stem cell described thus far, provide an added advantage for systemic or local administration, because they can migrate to a variety of tissues, where cytokines, growth factors, and other factors induce

differentiation of the cell. The differentiated cell, now a part of the surrounding tissue, retains its ability to produce the protein product of the introduced gene.

In Parkinson's disease, for example, clinical trials have shown that mesencephalic dopamine neurons obtained from human embryo cadavers can survive and function in the brains of patients with Parkinson's disease. PET scans have indicated that [ ^I8 F]fluorodopa uptake in the area around the cell graft is increased after transplantation, and remains so for at least six years in some patients. (See Dunnett, S. and A. Bjorklund. Nature (1999) 399 (Suppl.) A32-A- 39; Lindvall, O., Nature Biotech. (1999) 17: 635-636; Wagner, J., et al, Nature Biotech. (1999) 17: 653-659.) Unlike the embryonic cells, isolated MASCs as described by the present invention provide a ready supply of cells for transplant, yet maintain the differentiation potential that makes embryonic cell transplant therapy an attractive alternative for disease treatment.

For AIDS therapy, MASCs of the present invention can be genetically engineered to produce Rev MlO, a transdominant negative mutant of Rev that blocks the. function of a wild-type Rev produced in HIV-infected cells. (Bevec, D. et al, Proc. Natl. Acad. Sci. USA (1992) 89: 9870-9874; Ranga, U., et al, Proc. Natl. Acad. Sci. USA (1998^ 95(31: 1201-1206.) Once induced to differentiate into hematopoietic lineage cells and introduced into the patient, MASCs repopulate the HTV-infected patient's depleted T cell supply. Since the genetically altered cells possess the mutant Rev MlO, they will be resistant to the lethal effects of infection by most strains of HIV.

Genetically altered MASCs can also be encapsulated in an inert carrier to allow the cells to be protected from the host immune system while producing the secreted protein. Techniques for microencapsulation of cells are known to those of skill in the art (see, for example, Chang, P., et al, Trends in Biotech. (1999) 17(2): 78-83). Materials for microencapsulation of cells include, for example, polymer capsules, alginate-poly-L-tysine-alginate microcapsules, barium poly-L- lysine alginate capsules, barium alginate capsules, polyacrylonitrile/polyvinylchloride (PAN/PVC) hollow fibers, and polyethersulfone (PES) hollow fibers. U. S. Patent No. 5,639,275 (Baetge, E-. et al.), for example, describes improved devices and methods for long-term, stable

expression of a biologically active molecule using a biocompatible capsule containing genetically engineered cells. Such biocompatible immunoisolatory capsules, in combination with the MASCs of the present invention, provide a method for treating a number of physiologic disorders, including, for example, diabetes and Parkinson's disease.

In the diabetic patient, for example, heterologous stem cells which have been genetically altered to produce insulin at physiologically therapeutic levels can be encapsulated for delivery within the patient's tissues. Alternately, autologous stem cells can be derived from the patient's own bone marrow aspirate for transduction with a retroviral vector as previously described. Once genetically altered to produce physiologically therapeutic levels of insulin, these cells can be encapsulated as described by Chang or Baetge and introduced into the patient's tissues where they remain to produce insulin for extended periods of time. Another advantage of microencapsulation of cells of the present invention is the opportunity to incorporate into the microcapsule a variety of cells, each producing a biologically therapeutic molecule. MASCs of the present invention can be induced to differentiate into multiple distinct lineages, each of which can be genetically altered to produce therapeutically effective levels of biologically active molecules. MASCs carrying different genetic elements can be encapsulated together to produce a variety of biologically active molecules.

MASCs of the present invention can be genetically altered ex vivo, eliminating one of the most significant barriers for gene therapy. For example, a subject's bone marrow aspirate is obtained, and from the aspirate MASCs are isolated. The MASCs are men genetically altered to express one or more desired gene products. The MASCs can then be screened or selected ex vivo to identify those cells which have been successfully altered, and these cells can be reintroduced into the subject, either locally or systemically. Alternately, MASCs can be genetically altered and cultured to induce differentiation to form a specific cell lineage for transplant. In either case, the transplanted MASCs provide a stably-transfected source of cells that can express a desired gene product. Especially where the patient's own bone marrow aspirate is the source

of the MASCs, this method provides an immunologically safe method for producing transplant cells. The method can be used for treatment of diabetes, cardiac myopathy, neurodegenerative disease, and adenosine deaminase deficiency, to name only a few of a multitude of examples. In diabetes, for example, MASCs can be isolated, genetically altered to produce insulin, then transplanted into the patient suffering from the disease. Where the disease is associated with autoimmunity, MASCs can be genetically altered to express either an altered MHC or no MHC in order to avoid immune surveillance. Suppression of MHC expression in transplanted pancreatic islet cells has been successfully performed using an adenoviral vector expressing the E3 region of the viral genome. Cells of the present invention can be stably transfected or transduced, as the inventors have demonstrated, and can therefore provide a more permanent source of insulin for transplant into a diabetic patient. Donor MASCs, particularly if genetically altered to alter MHC expression, and autologous MASCs, if genetically altered to express the desired hemoglobin gene products, can be especially effective in cell therapy for the treatment of sickle cell anemia and thalassemia.

Methods for Genetically Altering MASCs Cells isolated by the method described herein can be genetically modified by introducing DNA or KNA into the cell by a variety of methods known to those of skill in the art. These methods are generally grouped into four major categories: (1) viral transfer, including the use of DNA or RNA viral vectors, such as retroviruses (including lentiviruses), Simian virus 40 (SV40), adenovirus, Sindbis virus, and bovine papillomavirus for example; (2) chemical transfer, including calcium phosphate transfection and DEAE dextran transfection methods; (3) membrane fusion transfer, using DNA-loaded membranous vesicles such as liposomes, red blood cell ghosts, and protoplasts, for example; and (4) physical transfer techniques, such as microinjection, electroporation,.or direct "naked" DNA transfer. MASCs can be genetically altered by insertion of pre-selected isolated DNA, by substitution of a segment of the cellular genome with pre-selected isolated DNA, or by deletion of or

inactivation of at least a portion of the cellular genome of the cell. Deletion or inactivation of at least a portion of the cellular genome can be accomplished by a variety of means, including but not limited to genetic recombination, by antisense technology (which can include the use of peptide nucleic acids, or PNAs), or by ribozyme technology, for example. Insertion of one or more pre¬ selected DNA sequences can be accomplished by homologous recombination or by viral integration into the host cell genome. The desired gene sequence can also be incorporated into the cell, particularly into its nucleus, using a plasmid expression vector and a nuclear localization sequence. Methods for directing polynucleotides to the nucleus have been described in the art The genetic material can be introduced using promoters that will allow for the gene of interest to be positively or negatively induced using certain chemicals/drugs, to be eliminated following administration of a given drug / chemical, or can be tagged to allow induction by chemicals (including but not limited to the tamoxifen responsive mutated estrogen receptor) expression in specific cell compartments (including but not limited to the cell membrane). Homologous recombination

Calcium phosphate transfection, which relies on precipitates of plasmid DNA/calcium ions, can be used to introduce plasmid DNA containing a target gene or polynucleotide into isolated or cultured MASCs. Briefly, plasmid DNA is mixed into a solution of calcium chloride, then added to a solution which has been phosphate-buffered. Once a precipitate has formed, the solution is added directly to cultured cells. Treatment with DMSO or glycerol can be used to improve transfection efficiency, and levels of stable transfectants can be improved using bis-hydroxyethylaminb ethanesulfonate (BES). Calcium phosphate transfection systems are commercially available (e.g., ProFection® from Promega Corp., Madison, WI).

DEAE-dextran transfection, which is also known to those of skill in the art, may be preferred over calcium phosphate transfection where transient transfection is desired, as it is often more efficient.

Since the cells of the present invention are isolated cells, microinjection can be particularly effective for transferring genetic material into the cells.

Briefly, cells are placed onto the stage of a light microscope. With the aid of the magnification provided by the microscope, a glass micropipette is guided into the nucleus to inject DNA or RNA. This method is advantageous because it provides delivery of the desired genetic material directly to the nucleus, avoiding both cytoplasmic and lysosomal degradation of the injected polynucleotide. This technique has been used effectively to accomplish germline modification in transgenic animals.

Cells of the present invention can also be genetically modified using electroporation. The target DNA or RNA is added to a suspension of cultured cells. The DNA/RNA-cell suspension is placed between two electrodes and subjected to an electrical pulse, causing a transient permeability in the cell's outer membrane that is manifested by the appearance of pores across the membrane. The target polynucleotide enters the cell through the open pores in the membrane, and when the electric field is discontinued, the pores close in approximately one to 30 minutes.

Liposomal delivery of DNA or RNA to genetically modify the cells can be performed using cationϊc liposomes, which form a stable complex with the polynucleotide. For stabilization of the liposome complex, dioleoyl phosphatidylethanolamine (DOPE) or dioleoyl phosphatidylcholine (DOPC) can be added. A recommended reagent for liposomal transfer is Lipofectin® (Life Technologies, Inc.), which is commercially available. Lipofectin®, for example, is a mixture of the cationic lipid N-[l-(2,3-dioleyloyx)propyl]-N-N-N-trimethyl ammonia chloride and DOPE. Delivery of linear DNA, plasmid DNA, or RNA can be accomplished either in vitro or in vivo using liposomal delivery, which may be a preferred method due to the fact that liposomes can carry larger pieces of DNA, can generally protect the polynucleotide from degradation, and can be targeted to specific cells or tissues. A number of other delivery systems relying on liposomal technologies are also commercially available, including Effectene™ (Qiagen), DOTAP (Roche Molecular Bϊochemicals), FuGene 6™ (Roche Molecular Biochemicals), and Transfectam® (Promega). Cationic Iipid- mediated gene transfer efficiency can be enhanced by incorporating purified viral or cellular envelope components, such as the purified G glycoprotein of the

vesicular stomatitis virus envelope (VSV-G), in the method of Abe, A., et al (J. Virol. (1998) 72: 6159-6163).

Gene transfer techniques which have been shown effective for delivery of DNA into primary and established mammalian cell lines using lipopolyamme- coated DNA can be used to introduce target DNA into MASCs. This technique is generally described by Loeffler, J. and Behr, J., Methods in Enzvmology (1993) 217: 599-618.

Naked plasmid DNA can be injected directly into a tissue mass formed of differentiated cells from the isolated MASCs. This technique has been shown to be effective in transferring plasmid DNA to skeletal muscle tissue, where expression in mouse skeletal muscle has been observed for more than 19 months following a single intramuscular injection. More rapidly dividing cells take up naked plasmid DNA more efficiently. Therefore, it is advantageous to stimulate cell division prior to treatment with plasmid DNA. Microprojectile gene transfer can also be used to transfer genes into

MASCs either in vitro or in vivo. The basic procedure for microprojectile gene transfer was described by J. Wolff in Gene Therapeutics (1994) at page 195. Briefly, plasmid DNA encoding a target gene is coated onto microbeads, usually 1-3 micron sized gold or tungsten particles. The coated particles are placed onto a carrier sheet inserted above a discharge chamber. Once discharged, the carrier sheet is accelerated toward a retaining screen. The retaining screen forms a barrier which stops further movement of the carrier sheet while allowing the polynucleotide-coated particles to be propelled, usually by a helium stream, toward a target surface, such as a tissue mass formed of differentiated MASCs. Microparticle injection techniques have been described previously, and methods are known to those of skill in the art (see Johnston, S. A., et al, Genet. Eng. (NYV (1993) 15: 225-236; Williams, R.S., et al, Proc. Natl. Acad. Sci: USA (1991) 88: 2726-2730; Yang, N.S., et al, Proc. Natl. Acad. Sci. USA (1990) 87: 9568- 9572). Signal peptides can be attached to plasmid DNA, as described by

Sebestyen, et al (Nature Biotech. (1998) 16: 80-85), to direct the DNA to the nucleus for more efficient expression.

Viral vectors are used to genetically alter MASCs of the present invention and their progeny. Viral vectors are used, as are the physical methods previously described, to deliver one or more target genes, polynucleotides, antisense molecules, or ribozyme sequences, for example, into the cells. Viral vectors and methods for using them to deliver DNA to cells are well known to those of skill in the art. Examples of viral vectors which can be used to genetically alter the cells of the present invention include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors (including lentiviral vectors), alphaviral vectors (e.g., Sindbis vectors), and herpes virus vectors.

Retroviral vectors are effective for transducing rapidly-dividing cells, although a number of retroviral vectors have been developed to effectively transfer DNA into non-dividing cells as well (Mochizuki, H., et al., J. Virol. (1998)72: 8873-8883). Packaging cell lines for retroviral vectors are known to those of skill in the art. Packaging cell lines provide the viral proteins needed for capsid production and virion maturation of the viral vector. Generally, these include the gag, pol, and env retroviral genes. An appropriate packaging cell line is chosen from among the known cell lines to produce a retroviral vector which is ecotropic, xenotropic, or amphotropic, providing a degree of specificity for retroviral vector systems.

A retroviral DNA vector is generally used with the packaging cell line to produce the desired target sequence/vector combination within the cells. Briefly, a retroviral DNA vector is a plasmid DNA which contains two retroviral LTRs positioned about a multicloning site and SV40 promoter so that a first LTR is located 5 to the S V40 promoter, which is operationally linked to the target gene sequence cloned into the multicloning site, followed by a 3 second LTR. Once formed, the retroviral DNA vector can be transferred into the packaging cell line using calcium phosphate-mediated transfection, as previously described. Following approximately 48 hours of virus production, the viral vector, now containing the target gene sequence, is harvested.

Targeting of retroviral vectors to specific cell types was demonstrated by Martin, F., et ah, (J. Virol. (1999) 73: 6923-6929), who used single-chain

variable fragment antibody directed against the surface glycoprotein high- molecular-weight melanoma-associated antigen fused to the amphotropic murine leukemia virus envelope to target the vector to delivery the target gene to melanoma cells. Where targeted delivery is desired, as, for example, when differentiated cells are the desired objects for genetic alteration, retroviral vectors fused to antibody fragments directed to the specific markers expressed by each cell lineage differentiated from the MASCs of the present invention can be used to target delivery to those cells.

Lentiviral vectors are also used to genetically alter cells of the invention. Many such vectors have been described in the literature and are known to those of skill in the art. Salmons, B. and Gunzburg, W.H., "Targeting of Retroviral Vectors for Gene Therapy." Hum. Gene Therapy (1993Ϊ 4: 129-141. These vectors have been effective for genetically altering human hematopoietic stem cells (Sutton, R., et al., J. Virol. (1998) 72: 5781-5788). Packaging cell lines have been described for lentivirus vectors (see Kafri, T., et al., J. Virol. (1999) 73: 576-584; Dull, T., et al., J. Virol. (1998) 72: 8463-8471).

Recombinant herpes viruses, such as herpes simplex virus type I (HSV-I) have been used successfully to target DNA delivery to cells expressing the erythropoietin receptor (Laquerre, S., et al., J. Virol. (1998) 72: 9683-9697). These vectors can also be used to genetically alter the cells of the present invention, which the inventors have demonstrated to be stably transduced by a viral vector.

Adenoviral vectors have high transduction efficiency, can incorporate DNA inserts up to 8 Kb, and can infect both replicating and differentiated cells. A number of adenoviral vectors have been described in the literature and are known to those of skill in the art (see, for example, Davidson, BX., et ah, Nature Genetics (1993) 3: 219-223; Waener. K. et al. Proc. Natl. Acad. Sci. USA (1992)89: 6099-6103). Methods for inserting target DNA into an adenovirus vector are known to those of skill in the art of gene therapy, as are methods for using recombinant adenoviral vectors to introduce target DNA into specific cell types (see Wold, W., Adenovirus Methods and Protocols. Humana Methods in Molecular Medicine (1998), Blackwell Science, Ltd.). Binding affinity for

certain cell types has been demonstrated by modification of the viral vector fiber sequence. Adenovirus vector systems have been described which permit regulated protein expression in gene transfer (Molin, M., et al., J. Virol. (1998) 72: 8358-8361). A system has also been described for propagating adenoviral vectors with genetically modified receptor specificities to provide transductional targeting to specific cell types (Douglas, J., et al., Nature Biotech. (1999) 17: 470-475). Recently described ovine adenovirus vectors even address the potential for interference with successful gene transfer by preexisting humoral immunity (Hofinann, C, et al., J. Virol. (1999) 73: 6930-6936). Adenovirus vectors are also available which provide targeted gene transfer and stable gene expression using molecular conjugate vectors, constructed by condensing plasmid DNA containing the target gene with polylysine, with the polylyshre linked to a replication-incompetent adenovirus. (Schwarzenberger, P., et al, J. Virol. (1997) 71: 8563-8571.) Alphavirus vectors, particularly the Sindbis virus vectors, are also available for transducing the cells of the present invention. These vectors are commercially available (Invitrøgen, Carlsbad, CA) and have been described in, for example, U.S. Patent No. 5,843,723, as well as by Xiong, C, et al., Science (1989) 243: 1188-1191; Bredenbeek, PJ., et al., J. Virol. (1993) 67: 6439- 6446: and Frolov. L. et al.. Proc. Natl Acad. Sci. USA (1996) 93: 11371-11377.

The inventors have shown that MASC possess good transduction potential using the eGFP-MND lentiviral vector described by Robbins, etal. (L yjrol. (1997) 71(12): 9466-9474) and eGFP-MGF vector. Using this method, 30-50% of MASC can be transduced after a short exposure of 4.6 hours to an enhanced green fluorescent protein (eGFP) vector containing supernatants made in PA3-17 packaging cells (an amphotropic packaging cell line derived ftorn NIH 3T3 fibroblasts and described by Miller, A.D., and C. Buttimore in MoI. Cell. Biol. (1986) 6: 2895-2902), combined with protamine (8 mg/ml). Expression of eGFP persists throughout the culture of undifferentiated MASC. In addition, transfection using lipofectamine has been successfully used to introduce transgenes in MAPCs.

Successful transfection or transduction of target cells can be demonstrated using genetic markers, in a technique that is known to those of skill in the art. The green fluorescent protein of Aequorea victoria, for example, has been shown to be an effective marker for identifying and tracking genetically modified hematopoietic cells (Persons, D., et al., Nature Medicine (1998) 4:

1201-1205). Alternative selectable markers include the β-Gal gene, the truncated nerve growth factor receptor, drug selectable markers (including but not limited to NEO, MTX, hygromycin)

17. MASCs Are Useful For Tissue Repair: The stem cells of the present invention can also be used for tissue repair. The inventors have demonstrated that MASCs of the present invention differentiate to form a number of cell types, including fibroblasts, osteoblasts, chondrocytes, adipocytes, skeletal muscle, endothelium, stromal cells, smooth muscle, cardiac muscle, and hemopoietic cells. For example, MASCs induced to differentiate into osteoblasts, by the method previously described herein, can be implanted into bone to enhance the repair process, to reinforce weakened bone, or to resurface joints. MASCs induced to differentiate into chondrocytes, by the method previously described, can be injected into joints to resurface joint cartilage. Caplan, et al. (U. S. Patent No.5,855,619) describe a biomatrix implant including a contracted gel matrix into which mesenchymal stem cells have been incorporated. The implant is designed for repair of a tissue defect, especially for injury to tendon, ligament, meniscus, or muscle. Cartilage, for example, can be formed by the addition of chondrocytes in the immediate area around a porous, 3-dimensional scaffold made, for example, of collagen, synthetic polyglycolic acid fibers, or synthetic polylactic fibers. The inventors have shown that MASCs of the present invention differentiate to form chondrocytes, for example, which can be deposited in and around a collagen, synthetic polyglycolic, or synthetic polylactic or other scaffold material to provide an implant to facilitate tissue repair. Matrices are also used to deliver cells of the present invention to specific anatomic sites, where particular growth factors incorporated into the matrix, or encoded on plasmids incorporated into the matrix for uptake by the cells, can be

used to direct the growth of the initial cell population. DNA can be incorporated within pores of the matrix, for example, during the foaming process used in the formation of certain polymer matrices. As the polymer used in the foaming process expands, it entraps the DNA within the pores, allowing controlled and sustained release of plasmid DNA. Such a method of matrix preparation is described by Shea, et al, in Nature Biotechnology (1999) 17: 551-554.

Plasmid DNA encoding cytokines, growth factors, or hormones can be trapped within a polymer gene-activated matrix carrier, as described by Bonadio, J., et al., Nature Medicine (1999) 5: 753-759. The biodegradable polymer is then implanted near a broken bone, for example, where MASCs are implanted and take up the DNA, which causes the MASCs to produce a high local concentration of the cytokine, growth factor, or hormone, accelerating healing of the damaged tissue.

Cells provided by the present invention, or MASCs isolated by the method of the present invention, can be used to produce tissues or organs for transplantation. Oberpenning, et al. (Nature Biotechnology (1999) 17: 149-155) reported the formation of a working bladder by culturing muscle cells from the exterior canine bladder and lining cells from the interior of the canine bladder, preparing sheets of tissue from these cultures, and coating a small polymer sphere with muscle cells on the outside and lining cells on the inside. The sphere was then inserted into a dog's urinary system, where it began to function as a bladder. Nicklason, et al., Science (1999) 284: 489-493, reported the production of lengths of vascular graft material from cultured smooth muscle and endothelial cells. Other methods for forming tissue layers from cultured cells are known to those of skill in the art (see, for example, Vacanti, et al., U. S. Patent No. 5,855,610). These methods can be especially effective when used in combination with cells of the present invention, which have a broader range of differentiation than any previously-described non-embryonic stem cells.

MASCs of the present invention can be used to repopulate heart muscle cells by either direct injection into the area of tissue damage or by systemic injection, allowing the cells to home to the cardiac tissues. This method can be particularly effective if combined with angiogeriesis. Both the methods of

injection and methods for promoting angiogenesis are known to those of skill in the art. The MASCs of the present invention provide a broader differentiation range to provide a more varied source of cells for cardiac or other tissue repair utilizing these techniques. MASCs of the present invention are also useful, for example, for the purpose of repopulating the bone marrow after high dose chemotherapy. Prior to chemotherapy, a bone marrow aspirate is obtained from the patient. Stem cells are isolated by the method of the present invention, and are grown in culture and induced to differentiate. A mixture of differentiated and undifferentiated cells is then reintroduced into the patient's bone marrow space. Clinical trials are currently underway using hematopoietic stem cells for this purpose. The MASCs of the present invention, however, provide the additional benefit of further differentiation to form cells that can replace those damaged by chemotherapy in other tissues as well as in bone marrow. Alternately, the method described by Lawman, et al. (WO 98/42838) can be used to change the histocompatibility antigen of stem cells from an allogeneic donor or donors. Using this method, panels of available bone marrow transplants can be generated for preparation of frozen stocks, storage, and administration to patients who are unable, as in leukemia patients, for example, to provide their own bone marrow for reconstitution.

Re-population of a patient's immune system cells or blood cells can be accomplished, for example, by isolating autologous stem cells from the patient, culturing those cells to expand the population, then reintroducing the cells into the patient. This method can be particularly effective where the immune system or bone marrow cells must be depleted by radiation and/or chemotherapy for therapeutic purposes, such as in the case, for example, of patients diagnosed with multiple myeloma, non-Hodgkins lymphoma, autoimmune disease, or solid tumor cancers.

For the treatment of leukemias, autoimmune disease, or genetic diseases such as sickle cell anemia or thalassemia, re-population of the patient's blood or immune system cells with allogeneic cells of the present invention, or isolated by the method of the present invention, can be performed, particularly when the

histocompatibility antigen has been altered in the manner described by Lawman, et al. (WO 98/42838).

For the purposes described herein, either autologous or allogeneic MASCs of the present invention can be administered to a patient, either in differentiated or undifferentiated form, genetically altered or unaltered, by direct injection to a tissue site, systemically, on or around the surface of an acceptable matrix, or in combination with a pharmaceutically acceptable carrier.

19. MASCs Provide a Model System for Studying Differentiation Pathways: Cells of the present invention are useful for further research into developmental processes, as well. Ruley, et al. (WO 98/40468), for example, have described vectors and methods for inhibiting expression of specific genes, as well as obtaining the DNA sequences of those inhibited genes. Cells of the present invention can be treated with the vectors such as those described by Ruley, which inhibit the expression of genes that can be identified by DNA sequence analysis. The cells can then be induced to differentiate and the effects of the altered genotype/phenotype can be characterized.

Hahn, et al. (Nature (1999) 400: 464-468) demonstrated, for example, that normal human epithelial fibroblast cells can be induced to undergo tumorigenic conversion when a combination of genes, previously correlated with cancer, were introduced into the cells.

Control of gene expression using vectors containing inducible expression elements provides a method for studying the effects of certain gene products upon cell differentiation. Inducible expression systems are known to. those of skill in the art. One such system is the ecdysone-inducible system described by No, D., et al. Proc. Natl. Acad. Sci. USA (1996) 93: 3346-3351.

MASCs can be used to study the effects of specific genetic alterations, toxic substances, chemotherapeutic agents, or other agents on the developmental pathways. Tissue culture techniques known to those of skill in the art allow mass culture of hundreds of thousands of cell samples from different individuals, providing an opportunity to perform rapid screening of compounds suspected to be, for example, teratogenic or mutagenic.

For studying developmental pathways, MASCs can be treated with specific growth factors, cytokines, or other agents, including suspected teratogenic chemicals. MASCs can also be genetically modified using methods and vectors previously described. Furthermore, MASCs can be altered using antisense technology or treatment with, proteins introduced into the cell to alter expression of native gene sequences. Signal peptide sequences, for example, can be used to introduce desired peptides or polypeptides into the cells. A particularly effective technique for introducing polypeptides and proteins into the cell has been described by Rojas, et al., in Nature Biotechnology (1998) 16: 370-375. This method produces a polypeptide or protein product that can be introduced into the culture media and translocated across the cell membrane to the interior of the cell. Any number of proteins can be used in this manner to determine the effect of the target protein upon the differentiation of the cell. Alternately, the technique described by Phelan et al. (Nature Biotech. (1998) 16: 440-443) can be used to link the herpes virus protein VP22 to a functional protein for import into the cell.

Cells of the present invention can also be genetically engineered, by the introduction of foreign DNA or by silencing or excising genomic DNA, to produce differentiated cells with a defective phenotype in order to test the effectiveness of potential chemotherapeutic agents or gene therapy vectors.

20. MASCs Provide a Variety of Differentiated and Undifferentiated Cultured Cell Types for High-Throughput Screening: MASCs of the present invention can be cultured in, for example, 96-well or other multi-well culture plates to provide a system for high-throughput screening of, for example, target cytokines, chemoldnes, growth factors, or pharmaceutical compositions in pharmacogenomics or pharmacogenetics. The MASCs of the present invention provide a unique system in which cells can be differentiated to form specific cell lineages from the same individual. Unlike most primary cultures, these cells can be maintained in culture and can be studied over time. Multiple cultures of cells from the same individual and from different individuals can be treated with the factor of interest to determine whether differences exist in the effect of the cellular factor on certain types of differentiated cells with the same genetic

makeup or on similar types of cells from genetically different individuals. Cytokines, chemokines, pharmaceutical compositions and growth factors, for example, can therefore be screened in a timely and cost-effective manner to more clearly elucidate their effects. Cells isolated from a large population of individuals and characterized in terms of presence or absence of genetic polymorphisms, particularly single nucleotide polymorphisms, can be stored in cell culture banks for use in a variety of screening techniques. For example, multipotent adult stem cells from a statistically significant population of individuals, which can be determined according to methods known to those of skill in the art, provide an ideal system for high-throughput screening to identify polymorphisms associated with increased positive or negative response to a range of substances such as, for example, pharmaceutical compositions, vaccine preparations, cytotoxic chemicals, mutagens, cytokines, chemokines, growth factors, hormones, inhibitory compounds, chemotherapeutic agents, and a host of other compounds or factors. Information obtained from such studies has broad implication for the treatment of infectious disease, cancer, and a number of metabolic diseases.

In the method of using MASCs to characterize cellular responses to biologic or pharmacologic agents, or combinatorial libraries of such agents, MASCs are isolated from a statistically significant population of individuals, culture expanded, and contacted with one or more biologic or pharmacologic agents. MASCs can be induced to differentiate, where differentiated cells are the desired target for a certain biologic or pharmacologic agent, either prior to or . after culture expansion. By comparing the one or more cellular responses of the MASC cultures from individuals in the statistically significant population, the effects of the biologic or pharmacologic agent can be determined. Alternately, genetically identical MASCs, or cells differentiated therefrom, can be used to screen separate compounds, such as compounds of a combinatorial library. Gene expression systems for use in combination with cell-based high-throughput screening have been described (see Jayawickreme, C. and Kost, T., Curr. Opin. Biotechnol. (1997) 8: 629-634). A high volume screening technique used to identify inhibitors of endothelial cell activation has been described by Rice, et

α/., which utilizes a cell culture system for primary human umbilical vein endothelial cells. (Rice, et al., Anal. Biochem. (1996) 241 : 254-259.) The cells of the present invention provide a variety of cell types, both terminally differentiated and undifferentiated, for high-throughput screening techniques used to identify a multitude of target biologic or pharmacologic agents. Most important, the cells of the present invention provide a source of cultured cells from a variety of genetically diverse individuals who may respond differently to biologic and pharmacologic agents.

MASCs can be provided as frozen stocks, alone or in combination with prepackaged medium and supplements for their culture, and can be additionally provided in combination with separately packaged effective concentrations of appropriate factors to induce differentiation to specific cell types. Alternately, MASCs can be provided as frozen stocks, prepared by methods known to those of skill in the art, containing cells induced to differentiate by the methods described hereinabove.

21. MASCs and Genetic Profiling: Genetic variation can have indirect and direct effects on disease susceptibility. Ih a direct case, even a single nucleotide change, resulting in a single nucleotide polymorphism (SNP), can alter the amino acid sequence of a protein and directly contribute to disease or disease susceptibility. Functional alteration in the resulting protein can often be detected in vitro. For example, certain APO-lipoprotein E genotypes have been associated with onset and progression of Alzheimer's disease in some individuals.

DNA sequence anomalies can be detected by dynamic-allele specific hybridization, DNA chip technologies, and other techniques known to those of skill in the art Protein coding regions have been estimated to represent only about 3% of the human genome, and it has been estimated that there are perhaps 200,000 to 400,000 common SNPs located in coding regions.

Previous investigational designs using SNP-associated genetic analysis have involved obtaining samples for genetic analysis from a large number of individuals for whom phenotypic characterization can be performed. Unfortunately, genetic correlations obtained in this manner are limited to

identification of specific polymorphisms associated with readily identifiable phenotypes, and do not provide further information into the underlying cause of the disease.

MASCs of the present invention provide the necessary element to bridge S the gap between identification of a genetic element associated with a disease and the ultimate phenotypic expression noted in a person suffering from the disease. Briefly, MASCs are isolated from a statistically significant population of individuals from whom phenotypic data can be obtained (see Collins, et al., Genome Research (1998) 8: 1229-1231). These MASC samples are then 0 cultured expanded and subcultures of the cells are stored as frozen stocks, which can be used to provide cultures for subsequent developmental studies. From the expanded population of cells, multiple genetic analyses can be performed to identify genetic polymorphisms. For example, single nucleotide polymorphisms can be identified in a large sample population in a relatively short period of time 5 using current techniques, such as DNA chip technology, known to those of skill in the art (Wang, D., et al, Science (1998) 280: 1077-1082; Chee, M., et al, Science (1996) 274: 610-614; Cargill, M., et al, Nature Genetics (1999) 22: 231-238; Gilles, P., et al, Nature Biotechnology (1999) 17: 365-370; Zhao, L.P., et al, Am. J. Human Genet. (1998) 63: 225-240). Techniques for SNP analysis have also been described by Syvanen (Syvanen, A., Hum. Mut. (1999) 13: MOl. Xiong (Xione. M. and L. Jin. Am. J. Hum. Genet. (1999) 64: 629- 640), Gu ( Gu, Z., et al., Human Mutation (1998) 12: 221-225), Collins (Collins, F., et aL _t Science (1997) 278: 1580-1581), Howell (Howell, W., et al, Nature Biotechnology (1999) 17: 87-88), Buetow (Buetow, K., et al., Nature Genetics (1999) 21: 323-325). and Hoogendoom (Hoogendoom. B.. et al.. Hum. Genet. (1999) 104: 89-93).

When certain polymorphisms are associated with a particular disease phenotype, cells from individuals identified as carriers of the polymorphism can be studied for developmental anomalies, using cells from non-carriers as a control. MASCs of the present invention provide an experimental system for studying developmental anomalies associated with particular genetic disease presentations, particularly, since they can be induced to differentiate, using

certain methods described herein and certain other methods known to those of skill in the art, to form particular cell types. For example, where a specific SNP is associated with a neurodegenerative disorder, both undifferentiated MASCs and MASCs differentiated to form neuronal precursors, glial cells, or other cells 5 of neural origin, can be used to characterize the cellular effects of the polymorphism. Cells exhibiting certain polymorphisms can be followed during the differentiation process to identify genetic elements which affect drug sensitivity, chemokine and cytokine response, response to growth factors, hormones, and inhibitors, as well as responses to changes in receptor expression 0 and/or function. This information can be invaluable in designing treatment methodologies for diseases of genetic origin or for which there is a genetic predisposition.

In the present method of using MASCs to identify genetic polymorphisms associated with physiologic abnormalities, MASCs are isolated S from a statistically significant population of individuals from whom phenotypic data can be obtained (a statistically significant population being defined by those of skill in the art as a population size sufficient to include members with at least one genetic polymorphism) and culture expanded to establish MASC cultures. DNA from the cultured cells is then used to identify genetic polymorphisms in 0 the cultured MASCs from the population, and the cells are induced to differentiate. Aberrant metabolic processes associated with particular genetic polymorphisms are identified and characterized by comparing the differentiation patterns exhibited by MASCs having a normal genotype with differentiation patterns exhibited by MASCs haying an identified genetic polymorphism or 5 response to putative drugs.

22. MASCs Provide Safer Vaccine Delivery: MASCs cells of the present invention can also be used as antigen-presenting cells when genetically altered to produce an antigenic protein. Using multiple altered autologous or allogeneic progenitor cells, for example, and providing the progenitor cells of the present invention in combination with plasmids embedded in a biodegradable matrix for extended release to transfect the accompanying cells, an immune response can be elicited to one or multiple antigens, potentially improving the

ultimate effect of the immune response by sequential release of antigen- presenting cells. It is known in the art that multiple administrations of some antigens over an -extended period of time produce a heightened immune response upon ultimate antigenic challenge. Alternately, MASCs can be used as antigen- presenting cells, in the method of Zhang, et al. (Nature Biotechnology (1998) 1: 1045-1049), to induce T-cell tolerance to specific antigen.

Many current vaccine preparations incorporate added chemicals and other substances, such as antibiotics (to prevent the growth of bacteria in vaccine cultures), aluminum (adjuvant), formaldehyde (to inactivate bacterial products for toxoid vaccines), monosodium glutamate (stabilizer), egg protein (component of vaccines prepared using embryonated chicken eggs), sulfites (stabilizer), and thimerosol (a preservative). Partly due to these added components, there is currently a broad-based public concern over the safety of vaccine preparations. Thimerosol, for example, contains mercury and is made from a combination of ethyl mercuric chloride, thiosalicylic acid, sodium hydroxide and ethanol. Furthermore, some studies, although inconclusive, have suggested a possible link between some vaccine components and potential complications such as those diseases commonly associated with autoimmunity. Thus, more effective vaccine therapies are needed and public cooperation with vaccine initiatives will be easier to promote if there is a greater degree of comfort with the method of vaccination.

MASCs of the present invention can be differentiated to form dendritic cells, which present antigen to T cells and thereby activate them to respond against foreign organisms. These dendritic cells can be genetically altered to express foreign antigens, using techniques previously described. A particular advantage of this method of vaccine delivery lies in the fact that more than one antigen can be presented by a single genetically altered cell.

Differentiated or undifferentiated MASC vaccine vectors of heterologous origin provide the added advantage of stimulating the immune system through foreign cell-surface markers. Vaccine design experiments have shown that stimulation of the immune response using multiple antigens can elicit a

heightened immune response to certain individual antigens within the vaccine preparation.

Immunologically effective antigens have been identified for hepatitis A, hepatitis B, varicella (chickenpox), polio, diphtheria, pertussis, tetanus, Lyme disease, measles, mumps, rubella, Haemophilus influenzae type B (SSb), BCG, Japanese encephalitis, yellow fever, and rotavirus, for example.

The method for inducing an immune response to an infectious agent in a human subject using MASCs of the present invention can be performed by expanding a clonal population of multipotent adult stem cells in culture, genetically altering the expanded cells to express one or more pre-selected antigenic molecules to elicit a protective immune response against an infectious agent, and introducing into the subject an amount of genetically altered cells effective to induce the immune response. Methods for administering genetically altered cells are known to those of skill in the art. An amount of genetically altered cells effective to induce an immune response is an amount of cells which produces sufficient expression of the desired antigen to produce a measurable antibody response, as determined by methods known to those of skill in the art. Preferably, the antibody response is a protective antibody response that can be detected by resistance to disease upon challenge with the appropriate infectious agent.

23. MASCs and Cancer Therapy: MASCs of the present invention provide a novel vehicle for cancer therapies. For example, MASCs can be induced to differentiate to form endothelial cells or precursors which will home to endothelial tissues when delivered either locally or systemically. The cells participate in formation of blood vessels to supply newly-formed tumors

(angiogenesis), and divide and proliferate in the endothelial tissue accordingly. By genetically engineering these cells to undergo apoptosis upon stimulation with an externally-delivered element, the newly-formed blood vessels can be disrupted and blood flow to the tumor can be eliminated. An example of an. externally-delivered element would be the antibiotic tetracycline, where the cells have been transfected or transduced with a gene which promotes apoptosis, such as Caspase or BAD, under the control of a tetracycline response element.

Tetracycline responsive elements have been described in the literature (Gossen, M. & Bujard, H., Proc. Natl. Acad. Sci. USA (1992) 89: 5547-5551), provide in vivo transgene expression control in endothelial cells (Sarao, R. & Dumont, D., Transgenic Res. (1998) 7: 421-427), and are commercially available ((XONETECH Laboratories, Palo Alto, CA).

Alternately, undifferentiated MASCs or MASCs differentiated to form tissue-specific cell lineages can be genetically altered to produce a product, for export into the extracellular environment, which is toxic to tumor cells or which disrupts angiogenesis (such as pigment epithelium-derived factor (PEDF), described by Dawson, ef α/., Scjejice (1999) 285: 245-248). For example, Koivunen, et al., describe cyclic peptides containing an amino acid sequence which selectively inhibits MMP-2 and MMP-9 (matrix metalloproteinases associated with tύmorigeήesis), preventing tumor growth and invasion in animal models and specifically targeting angiogenic blood vessels in vivo (Koivunen, E., Nat. Biotech. (1999) 17: 768-774). Where it is desired mat cells be delivered to the tumor site, produce a tumor-inhibitory product, and then be destroyed, cells can be further genetically altered to incorporate an apoptosis- promoting protein under the control of an inducible promoter.

MASCs also provide a vector for delivery of cancer vaccines, since they can be isolated from the patient, cultured ex vivo, genetically altered ex vivo to express the appropriate antigens, particularly in combination with receptors associated with increased immune response to antigen, and reintroduced into the subject to invoke an immune response to the protein expressed on tumor cells. 24. Kits Containing MASCs or MASC Isolation and Culture Components: MASCs of the present invention can be provided in kits, with appropriate packaging material. For example, MASCs can be provided as frozen stocks, accompanied by separately packaged appropriate factors and media, as previously described herein, for culture in the undifferentiated state. Additionally, separately packaged factors for induction of differentiation, as previously described, can also be provided.

Kits containing effective amounts of appropriate factors for isolation and culture of a patient's stem cells are also provided by the present invention. Upon

obtaining a bone marrow aspirate from the patient, the clinical technician only need select the stem cells, using the method described herein, with the anti-CD45 and anti-glycophorin A provided in the kit, then culture the cells as described by the method of the present invention, using culture medium supplied as a kit component. The composition of the basic culture medium has been previously described herein.

One aspect of the invention is the preparation of a kit for isolation of MASCs from a human subject in a clinical setting. Using kit components packaged together, MASCs can be isolated from a simple bone marrow aspirate. Using additional kit components including differentiation factors, culture media, and instructions for inducing differentiation of MASCs in culture, a clinical technician can produce a population of antigen-presenting cells (APCs) from the patient's own bone marrow sample. Additional materials in the kit can provide vectors for delivery of polynucleotides encoding appropriate antigens for expression and presentation by the differentiated APCs. Plasmids, for example, can be supplied which contain the genetic sequence of, for example, the hepatitis B surface antigen or the protective antigens of hepatitis A, adenovirus, Plasmodium falciparum, or other infectious organisms. These plasmids can be introduced into the cultured APCs using, for example, calcium phosphate transfection materials, and directions for use, supplied with the kit. Additional materials can be supplied for injection of genetically-altered APCs back into the patient, providing an autologous vaccine delivery system.

The invention will be further described by reference to the following detailed examples.

EXAMPLES Example 1. Isolation of MASCs from Bone Marrow Mononuclear Cells

-Bone marrow mononuclear cells were obtained from bone marrow aspirates from the posterior iliac crest of >80 healthy human volunteers. Ten to 100 cubic centimeters of bone marrow was obtained from each subject, as shown in Table 2, which indicates the approximate number of mononuclear cells isolated from each subject. Mononuclear cells (MNC) were obtained from bone

marrow by centri&gation over a Ficoll-Paque density gradient (Sigma Chemical Co, St Louis, MO). Bone marrow MNC were incubated with CD45 and Glycophorin A microbeads (Miltenyi Biotec, Sunnyvale, CA) for 15 minutes and CD457Gly-A ⁺ cells removed by placing the sample in front of a SuperMACS magnet. The eluted cells are 99.5% CD457 GIyA ^" .

As shown in Table 2, depletion of CD45 ⁺ GIyA ⁺ cells resulted in recovery of CD45- GIyA- cells which constituted approximately 0.05 to 0.10% of the total bone marrow mononuclear cells.

Number of Number of 45- Number of MASCs

Volume of Bone mononuclear BM /GIyA- cell post- (estimated by limiting

Marrow fee") cells post ficolled MACS dilution assav. LDA)

50 100 millions 100,000 50

25 80 60,000 35

25 50 14,000 10

50 100 50,000 30

10 150 75,000 30

30 100 100,000 25

25 80 75,000 35

100 190 78,000 25

100 150 60,000 15

100 160 160,000 85

100 317 400,000 50

100 200 150,000 70

50 160 160,000 85

50 115 150,000 70

25 60 60,000 30

100 307 315,000 100

100 216 140,000 80

50 130 150,000 40

100 362 190,000 60

50 190 150,000 40

100 200 185,000 100

100 387 300,000 170

50 100 130,000 20

150 588 735,000 300

We selected cells that do not express the common leukocyte antigen, CD45, or the erythroid precursor marker, glycophorin-A (GIyA). CD45 ^' GlyA ^' cells constitute 1/10* marrow mononuclear cells. CD45 ^' GlyA ^" cells were plated in wells coated with fibrohectin in with 2% FCS, and EGF, PDGF-BB, dexamethasone, insulin, linoleic acid, and ascorbic acid. After 7-21 days, small clusters of adherent cells developed. Using limiting dilution assays, we determined that the frequency of cells giving rise to these adherent clusters is 1/5XlO ³ CD45 GlyA- cells. When colonies appeared (about IQ ³ cells) cells were recovered by trypsinization and re-plated every 3-5 days at a 1 :4 dilution under the same culture conditions. Cell densities were maintained between 2-8xlO ³ cells / cm ² . Cell doubling time was 48-6Oh. Immunophenotypic analysis by FACS of cells obtained after 10-12 cell doubling showed mat cells did not express CD31, CD34, CD36, CD38, CD45, CD50, CD62E and CD62-P, Mucl8, cKit, Tie/Tek, and CD44. Cells expressed no HLA-DR or HLA-class-I and expressed low levels of β2-microglobulin. Cells stained highly positive with antibodies, against CDlO, CDl 3, CD49b, CD49e, CDw90, Flkl. The MASC phenotype remained unchanged for >30 cell doublings (n=15). MASC cultures with cells capable of proliferating beyond 30 cell doublings and differentiating to all mesodermal cell- types (see below) have been established from >85% of donors, age 2 — 50 years. In 10 donors, we have expanded MASC for > 50 cell doublings. When cells were cultured in serum-free medium, also supplemented with lOng/mL IGF, cell doubling was slower (>60h), but >40 cell doublings could be obtained. As was seen for cells cultured with 2% FCS without IGF, cells cultured in serum-free

medium were HLA-class-I and CD44 negative, and could differentiate into all mesodermal phenotypes, as described below.

When cells were plated on collagen-type-I or laminin in stead of fibronectin, they expressed CD44 and HLA-DR, and could not be expanded beyond 30 cell doublings. When EGF or PDGF were omitted cells did not proliferate and died, while increased concentrations of these cytokines allowed initial growth of MASC but caused loss of proliferation beyond 20-30 cell doublings. Addition of higher concentrations of dexamethasone also caused loss of proliferation beyond 30 cell doubling. When cells were cultured with >2% FCS in the culture medium they expressed CD44, HLA-DR and HLA-class-I. Likewise, culture at high density (^δxlO ³ cells / cm ² ) was associated with the acquisition of CD44, HLA-DR and HLA-cIass-I and Muc-18, which is similar to the phenotype described for MASC. Culture at high density or with higher concentrations of FCS was also associated with loss of expansion capacity, and cells did not proliferate beyond 25-30 cell doublings.

We attempted to clone MASC by replating MASC at 1 cell/well once cultures had been established. From 3 donors, we plated >2000 cells singly in FN coated 96 well plates with the same culture medium. In no well did we detect cell growth. Of note, when cells were deposited at 10 cells/well, we found cell growth in approximately 4% of wells. Progeny of 5% of these wells could be expanded to >10 ⁷ cells.

Telomere length of MASC from 5 donors (age 2-50 years) cultured for 15 cell doublings was between 11-16 kB. In 3 donors, this was 3 kB longer than telomere length of blood lymphocytes obtained from the same donors. Telomere length of cells from 1 donor evaluated after 15 cell doublings, 30 cells doublings and 45 cell doublings remained unchanged. Cytogenetic analysis of MASC recovered after 30 cell doublings showed a normal karyotype.

Example 2. Differentiation of MASCs To induce osteoblast differentiation, serum-free medium was supplemented with 10 ^'7 M of dexamethasone, 10 mM ascorbic acid, and 10 mM -glycerophosphate. Osteoblast differentiation was confirmed by detection of

calcium mineralization, alkaline phosphatase expression, and production of bone sialoprotein, osteopontin, osteocalcin and osteonectin, which are relatively specific for bone development (see Fig. 7). ^•

To induce differentiation into cartilage, serum-free medium, as previously described, was supplemented with 100 ng/ml TGF- 1 (R&D Systems, Minneapolis, MN). Cells were induced to differentiate while adherent to fibronectin, or in suspension culture, with both methods producing differentiated cartilage cells. Differentiation to form cartilage cells was confirmed by detection of collagen type II, as well as the glycosaminoglycan aggrecan (see Fig. 7). To induce adipocyte differentiation, 10 ^"7 M dexamethasone and 100 μg/ml insulin were added to the culture medium. Adipocyte differentiation was also induced by replacing serum-free medium with medium containing 20% horse serum. Adipocyte differentiation was detected by detection of LPL and aP2. To induce skeletal myocyte differentiation, >80% confluent MASCs were treated with either 3μM 5-azacytidine for 24h and then maintained in MASC medium with EGF and PDGF-BB, expression of muscle specific proteins was seen as early as 5 days after changing culture conditions. Two days after induction, we detected the Myf5, Myo-D and Myf6 transcription factors. After 14-18 days, Myo-D was expressed at significantly lower levels, whereas My£5 and Myf6 persisted. We detected desmin and sarcomeric actin as early as 4 days after induction, and fast-twitch and slow-twitch myosin at 14 days (Fig.7). By immunohistochemistry, 70-80% of cells expressed mature muscle proteins after 14 days. When we added 20% horse serum we demonstrated fusion of myoblasts into myotubes that were multinucleated (Fig.7). Of note, treatment with 5- azacytidine also induced expression of Gata4 and Gataό during the first week of culture, and cardiac troponin-T after 14 days. In addition, smooth muscle actin was detected at 2 days after induction and persisted till 14 days.

Smooth muscle cell differentiation was when we added lOOng/mLPDGF as the sole cytokine to confluent MASC maintained in serum-free MASC medium for 14 days. Cells expressed markers of smooth muscle (Fig.x). We found presence of myogenin from day 4 on and desmin after 6 days. Smooth

muscle actin was detected from day 2 on and smooth muscle myosin after 14 days. After 14 days, approximately 70% of cells stained positive with anti- smooth muscle actin and myosin antibodies. We could also detect Myf5 and Myf6 proteins, but not Myo-D after 2-4 days, which persisted till day 15. (Fig. 7).

Cardiac muscle differentiation was induced by adding 100 ng/ml basic fibroblast growth factor (bFGF) to the standard serum-free culture media previously described herein. Cells were confluent at onset of bFGF treatment To induce further development of cardiac tissues, 100 ng/ml 5-azacytidine, 100 ng/ml bFGF, and 25 ng/ml bone morphogenetic proteins 2 and 4 (BMP-2 and BMP-4) were added to the culture medium. Cells were >80% confluent at onset of treatment to induce cardiac tissue differentiation. Gata4 and Gataδ were expressed as early as day 2 and persisted till day 15. Expression of Myf6 and desmin was seen after day 2 and myogenin after day 6. Cardiac tropordn-T was expressed after day 4 and cardiac troponin-I and ANP after day 11. These mature cardiac proteins were detected in >70% of cells by immunohistochemistry on day 15. When the cultures were maintained for >3 weeks, cells formed syncithia and we saw infrequent spontaneous contractions occurring in the cultures, which were propagated over several mm distance. (Fig. 7) Again, we also detected Myf5 and myf6 and smooth muscle actin after day 6.

Vascular endothelial growth factor (VEGF), at a concentration of 20 ng/ml, was added to serum-free medium minus other growth factors to induce endothelial cell differentiation by day 15-20 ex vivo. Endothelial cell differentiation was confirmed by immunofluorescence staining to detect cellular proteins and receptors associated with endothelial cell differentiation. Results are shown in Fig. 7.

Hematopoietic differentiation was induced by culturing MASCs in collagen type IV coated wells with in PDGF-BB-and EGF-containing MASC medium with 5% FCS and lOOng/mL SCF that was conditioned by the AFT024 feeder, a fetal liver derived mesenchymal line that supports murine and human repopulating stem cells ex vivo. Cells recovered from these cultures expressed cKit, cMyb, Gata2 and G-CSF-R but not CD34 (RT-PCR). Because hemopoiesis

is induced by factors that are released by embryonal visceral endoderm, we co- cultured human MASCs with βGaf murine EBs in the presence of human SCF, Flt3-L, Tpo and Epo. In 2 separate studies, we detected a small population of βGal ^" cells that expressed human CD45 We induced "stromal" differentiation by incubating MASC with DL- lα,

FCS, and horse serum. To demonstrate that these cells can support hemopoiesis, feeders were irradiated at 2Gy and CD34 ⁺ cord blood cells plated in contact with the feeder. After 2 weeks, progeny was replated in methylcellulose assay to determine the number of colony forming cells (CFC). A 3-5-fold expansion of CFC was seen.

Confluent MASC cultures were treated with hepatocyte growth factor (HFG) and KGF. After 14 days, cells expressed MET (the HGF receptor), associated with hepatic epithelial cell development, cytokeratinl8 and 19.

Example 4. Transduction of MASCs from Adult Marrow

Once MASC cultures have been established after about 3-10 subcultures, MASCs were retrovirally transduced with an enhanced green fluorescence protein (eGFP) containing vector on two consecutive days. Retroviral vectors that were used were the MFG-eGFP or MND-eGFP-SN constructs, kindly provided by Donald Kόhn, M.D., LA Childrens Hospital, Los Angeles, CA. Both vectors were packaged in the amphotropic cell linePA317 or the Gibon- ape leukemia packaging cell line PG13. Retroviral supernatant was produced by incubating the producer feeder with MASCs expansion medium for 48 hours. Supernatant was filtered and frozen at -8O ⁰ C until use. Semiconfluent MASCs were subcultured in MASCs expansion culture medium. After 24 hours media was replaced with retrovirus containing supernatants and 8 g/mL protamine (Sigma) for 5 hours. This was repeated 24 hours later. Two to three days after the last transduction, eGFP ⁺ cells were selected on a FACS Star Plus Flow cytometer with a Consort computer (all from Becton Dickinson Inc) at 10 cells/well of 96 well plates coated with 5 ng/mL FN, and 40-85% of adherent cells expressed the eGFP gene. Using the automatic cell deposition unit (ACDU) on the fluorescence activated cell sorter, 10 eGFP* cells per well of 96

well plates coated with fibronectin were sorted. Cells were maintained in MASCs expansion medium for 1-7 months. After 3-4 weeks, adherent cells had reached confluence in 3-4% of flie wells. The cells were again culture expanded. Progeny of <1 well per plate could be expanded to generate >10 ⁷ cells (an additional 48 cell doublings). Thus, 1/10 ⁷ -1/10 ⁸ bone marrow cells has extensive proliferative potential.

The clonal expanded cell populations were then divided in 5-10 populations. Some cells were cryopreserved undifferentiated, whereas other cells were induced to differentiate into osteoblasts, chondrocytes, stromal cells, skeletal and smooth muscle myoblasts and endothelial cells. To demonstrate differentiation along a given pathway, and to confirm tissue identity, cells were either examined by immunohistochemistry and/or Western blot for proteins known to be present in the differentiated cell types.

Single cell sorting or ring cloning has been used to show single cell origin of a cell population. However, because MASC are adherent cells it is possible that two rather than a single cell are selected by FACS or by ring cloning. The fact that integration of retroviruses is random was used to prove clonal origin of all differentiated cells. Because of the random viral integration, the host cell DNA that flanks the retroviral LTR is cell specific. Upon cell division, all daughter cells can be identified based on presence of the retrovirus in the identical location in the host cell genome.

Inverse polymerase chain reaction (PCR) was used to amplify the host cell DNA flanking the 3 and the 5 LTR of the retroviral insert. Inverse PCR was done using a protocol kindly provided to us by Jan Nolta, Ph.D., LA Children Hospital, Los Angeles, CA. Briefly, DNA was extracted from undifferentiated MASC as well as from differentiated progeny, cut with Taq\ (Invitrogen) the fragments ligated and inverse PCR performed to obtain the sequence of the 5' flanking host cell DNA. This inverse PCR technique or Southern blot analysis have extensively been used in hematopoietic stem cell biology to demonstrate that every differentiated lineage is derived from a single cell. Once the flanking DNA had been amplified, 200-300 bases were sequenced and primers were designed that specifically recognize the flanking

DNA. Undifferentiated and differentiated cells were then subjected to PCR using one primer specific for the flanking DNA and one primer that recognizes the 5' long terminal repeat (LTR) to amplify DNA from the differentiated progeny. For each of the 3 samples that were examined a single cell specific DNA sequence flanking the 5' LTR, which was identical for undifferentiated and differentiated cells was identified. This proves single cell origin of all cells of "mesodermal" origin.

Using this technique, the present studies confirm that osteoprogenitor cells exist in marrow and these cells can differentiate into osteoblasts, chondrocytes, adipocytes, fibroblasts, and marrow stromal cells. The present inventors also demonstrate that a single marrow derived cell can give rise to cells from both splanchnic and visceral mesoderm. Further, the karyotype of cells that have been cultured for more than nine months is normal indicating that their massive expansion capacity is due to their stem cell nature or not because of tumor genesis or immortalization.

Example 5. Generation of Glial and Neuronal Cells from Adult Bone Marrow Mesenchymal Stem Cells

Differentiated neurons are postmitotic and little or no neuronal regeneration is observed in vivo. Therapies for neurodegenerative and traumatic disorders of the brain may be significantly furthered if new, proliferating neural stem cells (NSC) could be introduced in the defective areas of the brain which would resume the function of the defective tissue. It has now been discovered that MASCs selected from post-natal bone marrow that differentiate to all mesodermal cell types can also differentiate to neurons, oligodendrocytes, and astrocytes.

MASC cultures were established as described in example 1. Neural development was induced as follows. Generation of neurons, astrocytes and oligodendrocytes was done in medium consisting of neural differentiation medium. This medium comprised the following: 10-95% DMEM-LG

(preferably about 60%), 5-90% MCDB-201 (preferably about 40%), IX ITS, IX LA-BSA, W to IQf ⁹ M Dexamethasone (preferably about 10 ^"8 M), 10 ³ to 10 ^s M

ascorbic acid 2-phosphate (preferably about 10* M) and 0.5-100 ng/mL EGF (preferably about 10 ng/mL). The medium may also contain one or more of the following cytokines in order to induce differentiation into certain cell types: 5-50 ng/mL bFGF (preferably about 100 ng/mL) — astrocyte, 5 oligodendrocyte, neuron (type unknown));

5-50 ng/mL FGF-9 (preferably about 10 ng/mL) ~ astrocyte, oligodendrocyte, GABAergic and dopaminergic neurons

5-50 ng/mL FGF-8 (preferably about 10 ng/mL) — dopaminergic, serotoninergic and GABAergic neurons, no glial cells

10. 5-50 ng/mL FGF-10 (preferably about 10 ng/mL) - astrocytes, oligodendrocytes, not neurons

5-50 ng/mL FGF-4 (preferably about 10 ng/mL) — astrocytes, oligodendrocytes but not neurons

5-50 ng/mL BDNF (preferably about 10 ng/mL) — Dopaminergic 15 neurons only)

5-50 ng/mL GDNF (preferably about 10 ng/mL) - GABAergic and dopaminergic neurons

5-50 ng/mL CNTF (preferably about 10 ng/mL) ~ GABAergic neurons only 0 The choice of growth factors to induce differentiation of MASCs into neural cells was based on what is known in embryonic development of the nervous system or from studies that evaluated in vitro NSC differentiation. AU culture medium was serum-free and supplemented with EGF, which is a strong ectodermal inducer. FGFs play a key role in neuronal development. When 5 human post-natal marrow derived MASCs were cultured with both 1 OOng/mL bFGF and lOng/mL EGF, differentiation to astrocytes, oligodendrocytes and neurons was seen. Astrocytes were identified as glial-fibrilar-acidic-protein (GFAP) positive cells, oligodendrocytes were identified as glucocerebroside positive (GaIC) and neurons were identified as cells that express in a sequential 0 fashion NeuroD, Tubulin-ϋlB (Tuji), synaptophysin and neurofilament 68, 160 and 200. Cells did not express markers of GAGAergic, dopaminergic or serotoninergic neurons.

FGF-9, first isolated from a glioblastoma cell line, induces proliferation of glial cells in culture. FGF-9 is found in vivo in neurons of the cerebral cortex, hippocampus, substantia nigra, motor nuclei of the brainstem and Purldnje cell layer. When cultured for 3 weeks with IOng/mL FGF-9 and EGF MASCs generated astrocytes, oligodendrocytes and GABAergic and dopaminergic.

During CNS development, FGF-8, expressed at the mid/hindbrain boundary and by the rostral forebrain, in combination with Sonic hedgehog, induces differentiation of dopaminergic neurons in midbrain and forebrain. It was found that when MASCs were cultured with IOng/mL FGF-8 and EGF for 3 weeks both dopaminergic and GABAergic neurons were produced. FGF-10 is found in the brain in very low amounts and its expression is restricted to the hippocampus, thalamus, midbrain and brainstem where it is preferentially expressed in neurons but not in glial cells. Culture of MASCs in IOng/mL FGF-10 and EGF for three weeks generated astrocytes and oligodendrocytes, but not neurons. FGF-4 is expressed by the notochord and is required for the regionalisation of the midbrain. When treated with IOng/mL FGF-4 and EGF for 3 weeks MASCs differentiated into astrocytes and oligodendrocytes but not neurons.

Other growth factors that are specifically expressed in the brain and that affect neural development in-vivo and in-vitro include brain derived neurotrophic factor (BDNF), glial derived neurotrophic factor (GDNF) and ciliary neurotrophic factor (CNTF). BDNF is a member of the nerve growth factor family that promotes in vitro differentiation of NSC, human subependymal cells, and neuronal precursors to neurons and promotes neurite outgrowth of hippocamal stem cells in vivo. Consistent with the known function of BDNF to support survival of dopaminergic neurons of the substantia nigra, when MASCs were treated with IOng/mL BDNF and EGF exclusive differentiation into tyrosine hydroxylase positive neurons was seen. GDNF is a member of the TGF- superfamily. In early neurogenesis, GDNF is expressed in the anterior neuroectoderm suggesting that it may play a key role in neuronal development. GDNF promotes survival of motor neurons in peripheral nerve and muscle and has neurotrophic and differentiation abilities. It was found that GDNF induced

MASCs to differentiate into GABAergic and dopaminergic neurons. GNTF, first isolated from ciliary ganglion, is a member of the gpl30 family of cytokines. CNTF promotes neuronal survival early in development. In embryonic rat hippocampal cultures CNTF increased the numbers of GABAergic and cholinergic neurons. In addition, it prevented cell death of GABAergic neurons and promoted GABA uptake. CNTF exerted the same GABAergic induction on MASCs as they differentiated exclusively into GABAergic neurons after three weeks of exposure to CNTF.

Some hematopoietic cytokines have been shown to be trophic factors of NSC, such as IL-11 and LIF, as mentioned above. In addition, in vitro studies on neuronal precursor cells have shown that SCF, Flt3L, EPO, TPO, G-CSF, and CSF-I act early in the differentiation of neural cells whereas IL5, IL7, IL9, and ILl 1 act later in neuronal maturation. MASCs induced with a combination of early acting cytokines (10 ng/mL Thrombopoietin (kind gift from Amgen Inc., Thousand Oaks, CA), 10 ng/mL granulocyte colony stimulating factor (Amgen), 3U erythropoietin (Amgen) and 10 ng/mL interIeukin-3 (RScD Systems), followed by culture for 1 month in a medium conditioned by the murine fetal liver feeder layer, AFT024 (a kind gift from Dr. Dior Lemishka, Princeton University, NJ) supplemented with 14ng/mL fetal liver tyrosine kinase-3 lϊgand (a kind gift from Immunex Inc, Seattle, WA) and 15ng/mL SCF (a kind gift from Amgen) differentiated into astrocytes, oligodendrocytes and neurons. Neurons generated under these conditions were immature as they expressed neurofilament 68 but not 200.

In some cultures, MASCs had been retrovirally transduced with an eGFP containing vector (described in Example 4 above). Differentiated glial and neuronal cells continued to express eGFP. This indicates that these cells can be genetically modified without interfering with their differentiation. Thus, undifferentiated MASCs can generate a neural stem cell that then gives rise to astrocytes, oligodendrocytes and neurons. The ease with which MASCs can be isolated from post-natal marrow, ex vivo expanded and induced to differentiate in vitro to glial cells or specific

neuronal cell types circumvents one of the key problems in NSC transplantation, namely the availability of suitable donor tissue.

The cells of the present invention can be used in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of congenital neurodegenerative disorders or storage disorders such as, for instance, mucopolysaccharidosis, leukodystrophies (globoid-cell leukodystrophy, Canavan disease), fucosidosis, GM2 gangliosidosis, Niemann-Pick, Sanfilippo syndrome, Wblman disease, and Tay Sacks. They can also be used to treat or alleviate symptoms of acquired neurodegenerative disorders such as Huntingtons, Parkinsons, Multiple Sclerosis, and Alzheimers. They can also be used for traumatic disorders such as stroke, CNS bleeding, and CNS trauma; for peripheral nervous system disorders such as spinal cord injury or syringomyelia; for retinal disorders such as retinal detachment, macular degeneration and other degenerative retinal disorders, and diabetic retinopathy.

Example 6. Hematopoietic development

Hematopoietic Stem Cells (HSC) are mesodermal in origin. It was long thought that HSC originate from yolk sac mesoderm. There is ample evidence that primitive erythroid cells originate in the yolk sac. It is less clear whether definitive hemopoiesis also originates from cells in the yolk sac. A series of recent studies in chick embryos, murine and human embryos have suggested that definitive hemopoiesis may be derived from mesodermal cells present in the embryo proper, namely in the AGM region. Ih humans, between day 22 and 35, a small population OfFIkI ⁺ cells develops in the dorsal aorta that differentiates into CD34 ⁺ endothelial or hemopoietic cells. It is believed that these are the cells that colonize the fetal liver. Although cells with hemopoietic potential originate in the dorsal aorta, their differentiation and commitment to mature hemopoietic cells requires that they migrate to the liver where the endodermal environment is conducive for hemopoietic development In contrast, cells that remain in the AGM region will not develop into hemopoietic cells.

Some of the clones in the present MASC cultures have hemopoietic potential. MASC differentiate into endothelial cells and form what resembles

embryoid bodies. These same cell aggregates differentiate into hemopoietic cells. The small, suspended aggregates were trypsinized, and replated on FN, collagen type IV or ECM. Medium consisted either of 0.5-1000 ng/mL PDGF- BB (preferably about 10 ng/mL) and 0.5-1000 ng/mL EGF (preferably about 10 ng/mL) containing MASC medium supplemented with 5-1000 ng/mL SCF (preferably about 20 ng/mL) or a combination of IL3, G-CSF, Flt3-L and SCF (2-1000 ng/mL, preferably about 10-20 ng/mL). Alternatively 0.5-1000 ng/mL PDGF-BB (preferably about 10 ng/mL) and 0.5-1000 ng/mL EGF (preferably about 10 ng/mL) containing MASC medium was used with 5% FCS and 1-1000 ng/mL SCF (preferably about 100 ng/mL) that was conditioned by AFT024 cells. Cells recovered ftom either of these cultures expressed cKit, cMyb, Gata2 and G-CSF-R (RT-PCR/ immunohistochemistry) indicating that hemopoietic differentiation is achievable.

Example 7. Epithelial development

Applicants have also been able to demonstrate epithelial development Briefly, a vessel was coated with 1-100 ng/mL fibronectin along with other ECM products such as 1-100 ng/mL laminin, collagens or IV and matrigel. The medium used comprised the following: 10-95% DMEM-LG, 5-90% MCDB- 201, IX ITS, IX LA-BSA, IO ⁷ -10 ^'9 M Dexamethasone (preferably lO ^'8 ), lO' ³ to 10 ^*5 M ascorbic acid 2-ρhosphate (preferably 10 ^"4 ). The medium may also contain one or more of the following cytokines

0.5-100 ng/mL EGF (preferably about 10 ng/mL) 0.5-1000 ng/mL PDGF-BB (preferably about 10 ng/mL) 0.5-1000 ng/mL HGF (hepatocyte growth factor) (preferably about 10 ng/mL)

0.5-1000 ng/mL KGF (keratinocyte growth factor) (preferably about 10 ng/mL)

Some of the cells were pancytokeratin positive, and cytokeratin 18 and 19 positive, which would suggest that these cells are endodermal in origin (Le., hepatic epithelium, biliary epithelium, pancreatic acinary cells, or gut epithelium). Some of the cells demonstrated the presence ofH-Met, or the

hepatocyte growth factor receptor, which are specific for hepatic epithelium and renal epithelium. Other cells demonstrated the presence of keratin, which is compatible with skin epithelium.

The cells of the present invention can be used in cell replacement therapy 5 and/or gene therapy to treat or alleviate symptoms of several organ diseases. The cells could be used to treat or alleviate congenital liver disorders, for example, storage disorders such as mucopolysaccharidosis, leukodystrophies, GM2 gangliosidosis; increased bilirubin disorders, for instance Crigler-Najjar syndrome; ammonia disorders such as inborn errors of the urea-cycle, for 0 instance Ornithine decarboxylase deficiency, citrullinemia, and argininosuccinic aciduria; inborn errors of amino acids and organic acids such as phenylketoinuria, hereditary tyrosinemia, and Alpha 1 -antitrypsin deficiency; and coagulation disorders such as factor VIII and IX deficiency. The cells can also be used to treat acquired liver disorders due to viral infections. The cells of the S present invention can also be used in ex vivo applications such as to generate an artificial liver (akin to kidney dialysis), to produce coagulation factors and to produce proteins or enzymes generated by liver epithelium.

The cells of the present invention can also be used to in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of biliary disorders 0 such as biliary cirthosis and biliary atresia.

The cells of the present invention can also be used to in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of pancreas disorders such as pancreatic atresia, pancreas inflammation, and Alphal -antitrypsin deficiency. Further, as pancreas epithelium can be made from the cells of the present invention, and as neural cells can be made, beta-cells can be generated. These cells can be used for the therapy of diabetes (subcutaneous implantation or intra-pancreas or intra-liver implantation.

Further, the cells of the present invention can also be used to in cell replacement therapy and/or gene therapy to treat or alleviate symptoms of gut epithelium disorders such as gut atresia, inflammatory bowel disorders, bowel infarcts, and bowel resection.

Moreover, the cells of the present invention can also be used to in ctfU replacement therapy and/or gene therapy to treat or alleviate symptoms of sϊcm disorders such as alopecia, skin defects such as burn wounds, and albinism.

Example 8: Expressed gene profile of MASCS. cartilage and bone

Using Clontech and Invitrogen cDNA arrays the inventors evaluated the expressed gene profile of human MASCs cultured at seeding densities of 2xlO ³ /cm ² for 22 and 26 cell doublings. Ih addition the inventors evaluated changes in gene expression when MASCs were induced to differentiate to cartilage and bone for 2 days.

- MASCs do not express CD31, CD36, CD62E, CD62P, CD44-H, cKit, Tie, receptors for ILl, IL3, IL6, ILl 1, G-CSF, GM-CSF, Epo, Flt3-L, or CNTF, and low levels of HLA-class-L CD44-E and Muc-18 mRNA.

- MASCs express mRNA for the cytokines BMPl, BMP5, VEGF, HGF, KGF, MCPl ; the cytokine receptors Flkl, EGF-R, PDGF-Rl α, gpl30, LIF-R, activin-Rl and -R2, TGFR-2, BMP-RlA; the adhesion receptors CD49c, CD49d, CD29; and CDlO.

- MASCs express mRNA for hTRT, oct-4, sox-2, sox-11, sox-9, hoχa4, -5, -9, Dlx4, MSXl, PDXl — Both cartilage and bone lost / had decreased expression oct-4, sox-2, Hoxa4, 5, 9; Dlx4, PDXl, hTRT, TRFl, cyclins, cdk's, syndecan-4; dystroglycan integrin oc2, cc3, βl, FLKl, LIF-R, RAR-α, RARγ, EGF-R, PDGF-RIa and -B, TGF-Rl and -2, BMP-RlA, BMPl and 4, HGF, KGF, MCPl

- Osteoblast differentiation was associated with acquisition of/ increase in expression of Hox7, hoxll, sox22, cdki's, syndecan-4, decorin, lumican, fibronectin, bone sialoprotein, TIMP-I, CD44, β8, β5 integrin, PTHr-P, Leptin-R, VitD3-R, FGF-R3, FGF-R2, Estrogen-R, wnt-7a, VEGF-C, BMP2

- Cartilage differentiation was associated with acquisition of Sox-9, FREAC, hox-11 , hox7, CARTl , Notch3, cdki's, collagen-IL fibronectin, decorin,

cartilage glycoprotein, cartilage oligomeric matrix protein, MMPs and TlMPs, N-cadherin, CD44, αl and α6 integrin, VitD3-R, BMP2, BMP7

Example 9. Characterization of Differentially Expressed Genes in MASCs vs. Osteoblasts by Subtractive Hybridization

The present inventors used a subtraction approach to identify genetic differences between undifferentiated MASCs and committed progeny. PoIy-A mRN A was extracted from undifferentiated MASCs and cells induced to differentiate to the osteoblast lineage for 2 days. Subtraction and amplification of the differentially expressed cDNAs was done using the PCR-Select kit from Clonetech, as per manufacturer's recommendation without modification. Gene sequences expressed in day 2 osteoblast cultures were analyzed, but not those in undifferentiated MASCs.

Eighty-six differentially expressed cDNA-sequences were sequenced. It was confirmed by Northern that the mRNAs were indeed specifically expressed in day 2 osteoblast progenitors and not MASCs. The sequences were compared (using the BLAST algorithm) to the following databases: SwissProt, GenBank protein and nucleotide collections, ESTs, murine and human EST contigs.

Sequences were categorized by homology: 8 are transcription factors, 20 are involved in cell metabolism; 5 in chromatin repair; 4 in the apoptosis pathway; 8 in mitochondrial function; 14 are adhesion receptors /ECM components; 19 are published EST sequences with unknown function and 8 are novel.

For 2 of the novel sequences, Q-RT-PCR was performed on MASCs induced to differentiate to bone for 12h, 24h, 2d, 4d, 7d and 14d from 3 individual donors. Genes are expressed during the initial 2 and 4 days of differentiation respectively, and down regulated afterwards.

Genes present in undifferentiated MASCs, but not day 2 osteoblasts, were also analyzed. Thirty differentially expressed genes have been sequenced and 5 of them are EST sequences or unknown sequences. Presence of these genes in MASCs but not day 2 osteoblasts is confirmed by Northern blot

Example IQ. MASC Engraftment

Studies were initiated to examine if MASCs engraft and persist in vivo. eGFP ^* MASCS were injected intramuscularly into NOD-SCID mice. Animals were sacrificed 4 weeks later and muscle examined to determine if, as has been described for human ES cells, teratomas develop. In 5/5 animals, no teratomas were seen. eGFP positive cells were detected. Also, eGFP ⁺ MASCS IV were infused intrauterine in fetal SCID mice. Animals were evaluated immediately after birth. PCR analysis demonstrated presence of eGFP ⁺ cells in heart, lung, liver, spleen and marrow. When MASCs are transplanted stereotaxically in the intact brain or infarcted brain of rats, they acquire a phenotype compatible with neural cells, and persist for at least 6 weeks. These studies show that human MASCs can engraft in vivo and differentiate in an organ specific fashion without developing into teratomas. The studies also show that MASCs are distinctly different than embryonic stem cells or germ cells. MASCs represent a new class of multipotent stem cells that can be derived from multiple organs of adults and children.

Example 11: Demonstration of the ability to select, expand and characterize MASCs from murine origin.

MASCs can be generated from mouse marrow and can be present in organs other than marrow.

1. Identification of MASCs in mouse marrow

The investigators selected MASCs from mouse marrow. Marrow from C57/BL6 mice was obtained and mononuclear cells or cells depleted of CD45 and GIyA positive cells (n=6) plated under the same culture conditions used for human MASCs (lOng/mL human PDGF-BB and EGF). When marrow mononuclear cells were plated, we depleted CD45* cells 14 days after initiation of culture to remove hemopoietic cells. As for human MASCs, cultures were re- seeded at 2,000 cells/cm ² every 2 cell doublings.

In contrast to what we saw with human cells, when fresh murine marrow mononuclear cells depleted on day 0 of CD45 ⁺ cells were plated in MASCs culture, no growth was seen. When murine marrow mononuclear cells were plated, and cultured cells 14 days later depleted of CD45 ⁺ cells, cells with the morphology and phenotype similar to that of human MASCs appeared. This suggests that factors secreted by hemopoietic cells may be needed to support initial growth of murine MASCs. When cultured with PDGF-BB and EFG alone, cell doubling was slow (>6 days) and cultures could not be maintained beyond 10 cell doublings. Addition of lOng/mL LIF improved cell growth and > 70 cell doublings have been obtained. When cultured on laminin, collagen type IV or matrigel, cell growth was seen, but cells were CD44+ and HLA-class-I positive. As for human cells, C57/BL6 MASCs cultured with LIF on fibronectin coated dishes are CD44 and HLA-class-I negative, stain positive with SSEA-4, and express transcripts for oct-4, LIF-R and sox-2. MASCS derived from mouse marrow can be induced to differentiate into cardiac muscle cells, endothelium and neuroectodermal cells using methods also used to induce differentiation of human MASCs. Therefore, C57B16 mouse marrow derived MASCs are equivalent to those obtained from human marrow.

2. MASCs are present in tissues other than marrow

The inventors examined if MASCs are present in other organs such as liver and brain. Marrow, brain or liver mononuclear cells from 5-day old FVB/N mice, dissociated with collagenase and trypsin were plated in MASC cultures with EGF, PDGF-BB and LIF on fibronectin. 14 days later, CD45 ⁺ cells were removed and cells maintained in MASCs culture conditions as described above. Cells with morphology similar to that of human MASC and murine MASC derived from marrow of C57/B16 mice grew in cultures initiated with marrow, brain or liver cells. Cells expressed oct-4 mRNA.

The inventors also examined mice transgenic for an oct-4 promoter-eGFP gene. In these animals, eGFP expression is seen in primordial germ cells as well as in germ cells after birth. As MASCs express oct-4, we tested whether eGFP positive cells could be found in marrow, brain, and liver of these animals after

birth. We sorted eGFP ⁺ cells (1% brightest population) from marrow, brain and liver from 5 day-old mice. When evaluated by fluorescence microscopy, <1% of sorted cells from brain and marrow were eGFP*. oct-4 mRNA could be detected by Q-RT-PCR in the sorted population. Sorted cells have been plated under conditions that support murine MASCs (fibronectin coated wells with EGF, PDGF, LIF). Cells survived but did not expand. When transferred to murine embryonic fibroblasts, cell growth was seen. When subsequently transferred to MASC cultures, cells with morphology and phenotype similar to that of MASC derived using classical MASC selection and culture methods from human marrow or marrow of C57/B16 or FVB/N mice were obtained.

The invention is described with reference to various specific and preferred embodiments and techniques. However, it should be understood that many variations and modifications may be made while remaining within its scope. All referenced publications, patents and patent documents are intended to be incorporated by reference, as though individually incorporated by reference.

REFERENCES

1. Thomson J, Kalishman J, Golos T, Durning M, Harris C, Becker R, Heam J: Isolation of a primate embryonic stem cell line. Proc Natl Acad Sci U S A 92:7844-8, 1995

2. Thomson JA, Itskovitz-EIdor J, Shapiro SS, Waknitz MA, Swiergiel JJ, Marshall VS, Jones JM: Embryonic stem cell lines derived from human blastocysts. Science 282: 114-114, 1998

3. Shamblott M, Axelman J, Wang S, Bugg E, Littlefield J, Donovan P, Blumenthal P, Huggins G, Gearhart J: Derivation of pluripotent stem cells from cultured human primordial germ cells. Proc Natl Acad Sci U S A 95:13726-31, 1998

4. Williams RL, Hilton DJ, Pease S, Willson TA, Stewart CL, Gearing DP, Wagner EF, Metcalf D, Nicola NA, Gough NM: Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336:684-7, 1988

5. Orlάn S: Embryonic stem cells and transgenic mice in the study of hematopoiesis. Int J Dev Biol 42:927-34, 1998

6. Weissman EL: Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science 287: 1442-6, 2000

7. Gage FH: Mammalian Neural Stem Cells. Science 287:1433-1438., 2000

8. Svendsen CN, Caldwell MA, Ostenfeld T: Human neural stem cells: Isolation, expansion and transplantation. Brain Path 9:499-513, 1999

9. Okabe S, Forsberg-Nilsson K, Spiro AC, Segal M, McKay RD: Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech Dev 59:89-102, 1996

10. Potten C: Stem cells in gastrointestinal epithelium: numbers, characteristics and death. Philos Trans R Soc Lond B Biol Sci 353:821- 30, 1998 11. Watt F: Epidermal stem cells: markers patterning and the control of stem cell fate. Philos Trans R Soc Lond B Biol Sci 353:831, 1997 12. Alison M, Sarraf C: Hepatic stem cells. J Hepatol 29:678-83, 1998

13. Haynesworth SE, Barber MA, Caplan IA: Cell surface antigens on human marrow-derived mesenchymal cells are detected by monoclonal antibodies. Bone 13:69-80, 1992

14. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR: Multilineage potential of adult human mesenchymal stem cells. Science 284:143-147, 1999

15. Gronthos S, Zannettino AC, Graves S, Ohta S, Hay SJ, Simmon PJ: Differential cell surface expression of the STRO-I and alkaline phosphatase antigens on discrete developmental stages in primary cultures of human bone cells. J Bone Miner Res 14:47-56, 1999

16. Prockop D: Marrow stromal cells as stem cells for norihematopoietic tissues. Science 276:71-4, 1997

17. Jackson K, Mi T, Goodell MA: Hematopoietic potential of stem cells isolated from murine skeletal muscle. Proc Natl Acad Sci U S A

96:14482-6, 1999

18. Ferrari G, Cusella-De Angelis G, Coletta M, Paolucci E, Stornaiuolo A, Cossu G, Mavilio F: Muscle regeneration by bone marrow-derived myogenic progenitors. Science 279:528-30, 1998 19. Gussoni E, Soneoka Y, Strickland C, Buzney E, Khan M, Flint A, Kunkel L, Mulligan R: Dystrophin expression in the mdx mouse restored by stem cell transplantation. Nature 401 :390-4, 1999

20. Asahara T, Masuda H, Takahashi T, Kalka C, Pastore C, Silver M, Kearne M, Magner M, Isner JM: Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization. Circ Res 85:221-8, 1999

21. Lin Y, Weisdorf DJ, Solovey A, Hebbel RP: Origins of circulating endothelial cells and endothelial outgrowth from blood. J CUn Invest 105:71-7, 2000 22. Petersen BE, Boweή WC, Patrene KD, Mars WM, Sullivan AK, Murase N, Boggs SS, Greenberger JS, Goff JP: Bone marrow as a potential source of hepatic oval cells. Science 284: 1168-1170, 1999

23. Theise ND, Badve S, Saxena R, Henegariu O, Sell S, Crawford JM, Krause DS: Derivation of hepatocytes from bone marrow cells in mice after radiation-induced myeloablation. Hepatology 31:235-40, 2000

24. Theise ND, Nimmakayalu M, Gardner R, IIlei PB, Morgan G, Teperman L, Henegariu O, Krause DS: Liver from bone marrow in humans. Hepatology 32: 11-6, 2000

25. Frarikel MS: In Search of Stem Cell Policy. Science 298: 1397., 2000

26. Greider C: Telomeres and senescence: the history, the experiment, the future. Curr Biol 8:178-81, 1998 27. Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A: Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotech 18:399-404, 2000

28. Nichols J, Zevnik B, Anastassiadis K, Niwa H, Klewe-Nebenius D, Chambers I, Scholer H, Smith A: Formation of pluripotent stem cells in the mammalian embryo depends on the POU transcription factor Oct4.

Cell 95:379-91, 1998

29. Rosfjord E, Rizzino A: The octamer motif present in the Rex-1 promoter binds Oct-1 and Oct-3 expressed by EC cells and ES cells. Biochem Biophys Res Commun 203:1795-802, 1997 30. Ben-Shushan E, Thompson JR, Gudas LJ, Bergman Y: Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. MoI Cell Biol 18:1866-78, 1998 31. Uwanogho D, Rex M, Cartwright EJ, Pearl G, Healy C, Scotting PJ,

Sharpe PT: Embryonic expression of the chicken Sox2, Sox3 and Soxll genes suggests an interactive role in neuronal development Mech Dev

49:23-36, 1995

32. Baum C, Weissman I, Tsukamoto A, Buckle A, Peault B: Isolation of a candidate human hematopoietic stem cell population. Proc Natl Acad Sci

USA 89:2804, 1992

33. Jordan C, McKearn J, Leniischka I: Cellular and developmental, properties of fetal hematopoietic stem cells. Cell 6L:953-963, 1990

34. Bhatia M, Wang J, Knapp U, Bonnet D, Dick J: Purification of primitive human hematopoietic cells capable of repopulating immune-deficient mice. Proc Natl Acad Sci USA 94::5320, 1997

35. Goodell M, Rosenzweig M, Kim H, Marks D, DeMaria M, Paradis G, Grupp S, Sieff C, Mulligan R, Johnson R: Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of 34 antigen exist in multiple species. Nature Medicine 3:1337-1345, 1997 36. Zijlmans JM, Visser JW, Kleiverda K, Kluin PM, Willemze R, Fibbe WE: Modification of rhodamine staining allows identification of hematopoietic stem cells with preferential short-term or long-term bone marrow-repopulating ability. Proc Natl Acad Sci USA 92:8901-8905, 1995 37. Phillips RL, Ernst RE, Brunk B, Ivanova N, Mahan MA, Deanehan JK, Moore KA, Overton GC, Lemischka IR: The genetic program of hematopoietic stem cells. Science 288:1635-40, 2000

38. Martin GR: Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78:7634-8, 1981

39. Wobus AM, Holzhausen H, Jakel P, Schoneich J: Characterization of a pluripotent stem cell line derived from a mouse embryo. Exp Cell Res 52:212-9, 1984

40. Kannagi R, Cochran NA, Ishigami F, Hakomori S, Andrews PW, Knowles BB, Softer D: Stage-specific embryonic antigens (SSEA-3 and

-4) are epitopes of a unique globo-series ganglioside isolated from human teratocarcinoma cells. EMBO J 2:2355-61, 1983

41. Scholer HR, Hatzopoulos AK, Balling R, Suzuki N, Grass P: A family of octamer-specific proteins present during mouse embryogenesis: evidence for germline-specific expression of an Oct factor. EMBO J 8:2543-50,

1989

42. Yuan H, Corbi N, Basilico C, Dailey L: Developmental-specific activity of the FGF-4 enhancer requires the synergistic action of Sox2 and Oct-3. Genes Dev 9:2635-45, 1995

43. Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby PW, Staudt LM: A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345:686-92, 1990

44. Pikarsky E, Sharir H, Ben-Shushan E, Bergman Y: Retinoic acid represses Oct-3/4 gene expression through several retinoic acid- responsive elements located in the promoter-enhancer region. MoI Cell Biol 14:1026-38, 1994

45. Niwa H, Miyazaki J, Smith AG: Quantitative expression of Ocf-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24:372-6, 2000

46. Cooke JE, Godin I, Ffrench-Constant C, Heasman J, Wylie CC: Culture and manipulation of primordial germ cells. Methods Enzymol 255:37-58,

1993

47. Hodes RJ: Telomere length, aging, and somatic cell turnover. J Exper Med 190:153-156, 1999

48. Choi K, Kennedy M, Kazarov A, Papadimitriou JC, Keller G: A common precursor for hematopoietic and endothelial cells. Development 125:725-

732, 1998

49. Medvinsky A, Dzierzak E: Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86:897, 1996

50. Yoder M, Hiatt K, Mukherjee P: In vivo repopulating hematopoietic stem cells are present in the murine yolk sac at day 9.0 postcoitus. Proc. Natl.

Acad. Sci. USA 94:6776, 1997

51. Spangrude G, Heimfeld S, Weissman I: Purification and characterization of mouse hematopoietic stem cells. Science 241 :58, 1988

52. Tricot G, Gazitt Y, Leemhuis T, Jagannath S, Desikan KR, Siegel D, Fassas A, Tindle S, Nelson J, Juttner C, Tsukamoto A, Hallagan J,

Atkinson K, Reading C, Hoffman R, Barlogie B: Collection, tumor contamination, and engraftment kinetics of highly purified hematopoietic

progenitor cells to support high dose therapy in multiple myeloma. Blood 91:4489-95, 1998

53. Gothot A, Pyatt R, McMahel J, Rice S, Srour EF: Functional heterogeneity of human CD34(+) cells isolated in subcompartments of the GO /Gl phase of the cell cycle. Blood 90:4384-4393, 1997

54. Goodell M, Brose K, Paradis G, Conner A, Mulligan R: Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183:1797-1806, 1996

55. McCune JM, Namikawa R, Kaneshima H, Shultz LD, Lieberman M, Weissman IL: The SCID-hu mouse: murine model for the analysis of human hematolymphoid differentiation and function. Science 24:1632- 1639, 1988

56. Moore. KA, Hideo E, Lemischka IR: In vitro maintenance of highly purified transplantable hematopoietic stem cells. Blood 89:4337-437, 1997

57. Fraser C, Szilvassy S, Eaves C, Humphries R: Proliferation of totipotent hematopoietic stem cells culture at limiting dilution on supportive marrow stroma. Proc Natl Acad Sci USA 89:1968-1972, 1992

58. McKay R: Stem cells in the central nervous system. Science 276:66-71, 1997

59. Huard JM, Youngentob SL, Goldstein BJ, Luskin MB, Schwob JE: Adult olfactory epithelium contains multipotent progenitors that give rise to neurons and non-neuronal cells, J Comp Neurol 400:469-486, 1998

60. Palmer TD, Takahashi J, Gage FH: The adult rat hippocampus contains primordial neural stem cells. MoI Cell Neurosci 8:389-404, 1997

61. Lois C, Alvarez-Buylla A: Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci U S A 90:2074-7, 1993

62. Roy NS, Wang S, Jiang L, Kang J, Benraiss A, Harrison-Restelli C, Fraser RA, Couldwell WT, Kawaguchi A, Okano H, Nedergaard M,

Goldman SA: In vitro neurogenesis by progenitor cells isolated from the adult human hippocampus. Nat Med 5:271-7, 2000

63. Johansson CB, Momma S, Clarke DL, Rjsling M, Lendabl U, Frisen J: Identification of a neural stem cell in the adult mammalian central nervous system. 199896:25-34, 1999

64. Fridenshtein A: Stromal bone marrow cells and the hematopoietic microenvironment Arkh Patol 44:3-11, 1982

65. Wakitani S, Saito T, Caplan A: Myogenic cells derived from rat bone marrow mesenchymal stem cells exposed to 5-azacytidine. Muscle Nerve 1417-26:18, 1995

66. Gronthos S, Graves S, Ohta S, Simmons P: The STRO-1+ fraction of adult human bone marrow contains the osteogenic precursors. Blood

84:4164-73, 1994

67. Colter DC, Class R ₁ DiGirolamo CM, Prockop DJ: Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow, roc Natl Acad Sci U S A 97:3213-8, 2000 68. Yui J, Chiu C, Lansdorp P: Telomerase activity in candidate stem cells from fetal liver and adult bone marrow. Blood 91:91(9):3255-62, 1998 69. Bjomson C, Rietze R, Reynolds B, Magli M, Vescovi A: Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo, science 283:354-7, 1999 70. Almeida Porada G, Crapnell H, Porada C, Benoit H, Quesenberry P, Zanjani ED: Ih vivo hematopoietic potential of human neuronal stem cells. Exp Hematol 28, Supplement 1 :61 (abstract), 2000

71. Clarke DL, Johansson CB, Wilbertz J, Veress B, Nilsson E, Karlstrom H, Lendahl U, Frisen J: Generalized potential of adult neural stem cells. Science 288:1660-3, 2000

72. Rideout WM, 3rd, , Wakayama T, Wutz A, Eggan K, Jackson-Grusby L, Dausman J, Yanagimachi R, Jaenisch R: Generation of mice from wild- type and targeted ES cells by nuclear cloning. Nat Genet 24:109-10, 2000

73. Wihnut I, Schnieke AE, McWhir J, Kind AJ, Campbell KH: Viable offspring derived from fetal and adult mammalian cells. Nature 385:810-

3, 1997

74. Tsonis PA: Regeneration in vertebrates. Dev Biol 221 :273-84, 2000

75. Lemischka I: The power of stem cells reconsidered? Proc Natl Acad Sci U S A 96:1493-5, 1999

76. Anderson R, Fassler R, Georges-Labouesse E, Hynes RO, Bader BL, Kreidberg JA, Schaible K, Heasman J, Wylie C: Mouse primordial germ cells lacking betal integrins enter the geπnline but fail to migrate normally to the gonads. Development 126:1655-64, 1999

77. Keller G, Snodgrass HR: Human embryonic stem cells: the future is now. Nat Med 5:151-152, 1999

78. Lefebvre V, de Crombrugghe B: Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biol 16:529-40, 1998

79. Yoshida K, Chambers I, Nichols J, Smith A, Saito M, Yasukawa K, Shoyab M, Taga T, Kishimoto T: Maintenance of the pluripotential phenotype of embryonic stem cells through direct activation of gpl30 signalling pathways. Mech Dev 45:163-71, 1994 80. Ma YG, Rosfjord E, Huebert C, Wilder P, Tiesman J, Kelly D, Rizzino A: Transcriptional regulation of the murine k-FGF gene in embryonic cell lines. Dev Biol 154:45-54, 1992

81. Anderson R, Copeland TK, Scholer H, Heasman J, Wylie C: The onset of germ cell migration in the mouse embryo. Mech Dev 91 :61-8, 2000 82. Gerstenfeld LC, Shapiro FD:. Expression of bone-specific genes by hypertrophic chondrocytes: implication of the complex functions of the hypertrophic chondrocyte during endochondral bone development J Cell Biohem 62:1-9, 1996

83. Binette F, McQuaid DP, Haudenschild DR, Yaeger PC, McPherson JM, Tubo R: Expression of a stable articular cartilage phenotype without evidence of hypertrophy by adult human articular chondrocytes in vitro. J OrthopRes 16:207-16, 1998

84. Cai RL: Human CARTl, a paired-class homeodomaϊn protein, activates transcription through palindromic binding sites. Biochem Biophys Res Commun 250:305-11, 1998

85. Dietz UH, Sandell LJ: Cloning of a retinoic acid-sensitive mRNA expressed in cartilage and during chondrogenesis. J Biol Chem 271:3311- 6, 1996

86. Koiiieczny SF, Emerson CPJr. Differentiation, not determination, regulates muscle gene activation: transfection of troponin I genes into multipotential and muscle lineages of 10T1/2 cells. MoI Cell Biol 5:2423-32, 1985

87. Dinsmore J, Ratliff J, Deacon T, Pakzaban P, Jacoby D, Galpem W, Isacson O: Embryonic stem cells differentiated in vitro as a novel source of cells for transplantation. Cell Transplant 5:131-143, 1996

88. Chen J, Goldhamer D: Transcriptional mechanisms regulating MyoD expression in the mouse. Cell Tissue Res 296:213-9, 1999

89. Wasserman S: FH proteins as cytoskeletal organizers. Cell Biology 8:111-115, 1998 90. Mesnard L, Samson F, Espinasse I, Durand J, Neveux JY, Mercadier JJ: Molecular cloning and developmental expression of human cardiac troponin T. FEBS Lett 328:139-44, 1993

91. Doumit ME, Merkel RA: Conditions for isolation and culture of porcine myogenic satellite cells. Tissue Cell 24:253-62, 1992 92. Hirschi KK, Rohovsky SA, D'Amore PA: PDGF, TGF-beta, and heterotypic cell-cell interactions mediate endothelial cell-induced recruitment of 10T1/2 cells and their differentiation to a smooth muscle fate. J Cell Biol 141:805-14, 1998

93. Miano J, Cserjesi P, Ligon K, Periasamy M, Olson E: Smooth muscle myosin heavy chain exclusively marks the smooth muscle lineage during mouse embryogenesis. Circ Res 75:803-12, 1994

94. Wobus AM, Kaomei G, Shan J, Wellner MC, Rohwedel J, Ji G, Fleischmann B, Katus HA, Hescheler J, Franz WM: Retinoic acid accelerates embryonic stem cell-derived cardiac differentiation and enhances development of ventricular cardiomyocytes. J MoI Cell Cardiol

29:1525-39, 1998

95. Laverriere AC, MacNeill C, Mueller C, Poelmaπn RE, Bunch JB, Evans T: GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J Biol Chem 269:23177-84, 1994

96. Bhavsar PK, Dhoot GK, dimming DV, Butler-Browne GS, Yacoub MH, Barton PJ: Developmental expression of troponin I isoforms in fetal human heart FEBS Lett 292:5-8, 1991

97. Forssmann W, Richter R, Meyer M: The endocrine heart and natriuretic peptides: histochemistry, cell biology, and functional aspects of the renal . urodilatin system. Histochem Cell Biol 110:335-57, 1998 98. Punzel M, Wissink S, Miller J, Moore K, Lerrrischka L Verfaillie C: The myeloid-lymphoid initiating cell (ML-IC) assay assesses the fate of multipotent human progenitors in vitro, blood 93:3750-6, 1999

99. Thiemann FT, Moore KA, Smogorzewska EM, Lemischka IR, Crooks GM: The murine stromal cell line AFT024 acts specifically on human CD34+CD38- progenitors to maintain primitive function and immunophenotype in vitro. Exp Hematol 26:612-619, 1998

100. Rosenberg JB, Foster PA, Kaufman RJ, Vokac EA, Moussalli M, Kroner PA, Montgomery RR: Intracellular trafficking of factor VJH to von Willebrand factor storage granules. J Clin Invest 101:613-24, 1998 101. Baumhueter S, Dybdal N, Kyle C, Lasky L: Global vascular expression of murine CD34 a sialomucin-like endothelial ligand for L-selectin. Blood 84:2554, 1994

102. Hamagushi L Huang XL, Takakura N, Tada J, Yamagushi Y, Kodama H, Suda T: In vitro hematopoietic and endothelial cell development from cells expressing TEK receptor in murine aorta-gonad-mesonephros region. Blood 93:1549-1556, 1999

103. Shalaby F, Ho J, Stanford W, Fischer K, Schuh A, Schwartz L, Bernstein A, Rossant J: A requirement for FM in primitive and definitive hematopoiesis and vasculogenesis. Cell 89:981-90, 1997 104. Newman P: The biology of PECAM-I. J Clin Invest 99:3, 1997

105. Tedder T, Steeber D, Chen A, Engel P: The selectins: vascular adhesion molecules. FASEB J 9:866, 1995

106. Nishikawa S, Nishikawa S, Hirashima M, Matsuyoshi N, Kodama H: Progressive lineage analysis by cell sorting and culture identifies FLKl+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development 125:1747-57, 1998

5 107. Belaoussoff M, Farrington SM, Baron MH: Hematopoietic induction and respecification of A-P identity by visceral endoderm signaling in the mouse embryo. Development 125:5009-18, 1988

108. Weiss S, Dunne C, Hewson J, Wohl C, Wheatley M, Peterson AC, Reynolds BA: Multipotent CNS stem cells are present in the adult

10 mammalian spinal cord and ventricular neuroaxis. J Neurosci 16:7599-

609, 1996

109. Shihabuddin LS, Ray J, Gage FH: FGF-2 is sufficient to isolate progenitors found in the adult mammalian spinal cord. Exp Neurol 148:577-86, 1997

^% 15 110. Ciccolini F, Svendsen CN: Fibroblast growth factor 2 (FGF-2) promotes acquisition of epidermal growth factor (EGF) reponsiveness in mouse striatal precursor cells: Identification of neural precursors responding to both EGF and FGF-2. JNeuroscience 18(19):7869-7880, 1998

111. Julien J, Mushynski W: Neurofilaments in health and disease. Prog 20 Nucleic Acid Res MoI Biol 61:1-23, 1998

112. Schaafsma H, Ramaekers F: Cytokeratin subtyping in normal and neoplastic epithelium: basic principles and diagnostic applications. Pathol Annu 29:21-62, 1994

113. Lazaro CA, Rhim JA, Yamada Y, Fausto N: Generation of hepatocytes 25 from oval cell precursors in culture. Cancer Res 58:5514-22, 1998

114. Kiem H, Heyward P, Winkler A, Potter J, Allen J, Miller A, Andrew R: Gene transfer into marrow repopulating cells: comparison between amphotropic and gibbon ape leukemia virus pseudotyped retroviral vectors in a competitive repopulation assay in baboons. Blood 90:4638-

30 45., 1997

115. Nolta J, Dao M, Wells S, Smogorzewska E, Kohn D: Transduction of pluripotent human hematopoietic stem cells demonstrated by clonal

analysis after engraftment in immune-deficient mice. Proc Natl Acad Sci U S A 93:2414-9, 1996

116. Huibregtse BA, Johnstone B, Goldberg VM, Caplan AI: Effect of age and sampling site on the chondro-osteogenic potential of rabbit marrow- derived mesenchymal progenitor cells. Orthop Res 18:18-24, 2000

117. Bandyopadhyay P, Ma X, Linehan-Stieers C, Kren B, Steer C: Nucleotide exchange in genomic DNA of rat hepatocytes usingRNA/DNA oligonucleotides. Targeted delivery of liposomes and polyethyleneimine to the asialoglycoprotein receptor. J Biol Chem :10163-72, 1999

118. Sielaff TD, Nyberg SL, Rollins MD, Hu MY, Amiot B, Lee A, Wu FJ, Hu WS, Cerra FB: Characterization of the three-compartment gel- entrapment porcine hepatocyte bioartificial liver. Cell Biol Toxicol 13:357-64, 1997 119. Peshwa MV, Wu FJ, Sharp HL, Cerra FB, Hu WS: Mechanistics of formation and ultrastructural evaluation of hepatocyte spheroids. 32:197- 203, 1996

120. Rogler LE: Selective bipotential differentiation of mouse embryonic hepatoblasts in vitro. Am J Pathol 150:591-602, 1997 121. Block GD, Locker J, Bowen WC, Petersen BE, Katyal S, Strom SC, Riley T, Howard TA, Michalopoulos GK: Population expansion, clonal growth, and specific differentiation patterns in primary cultures of hepatocytes induced by HGF/SF, EGF and TGF alpha in a chemically defined (HGM) medium. J Cell Biol 132:1133-49, 1996 122. Hao QL, Thiemann FT, Petersen D, Smogorzewska EM, Crooks GM: Extended long-term culture reveals a highly quiescent and primitive human hematopoietic progenitor population. Blood 88:3306-3313, 1996

123. Visser JW, BoI SJ, van den Engh G: Characterization and enrichment of murine hemopoietic stem cells by fluorescence activated cell sorting. Exp Hematol 9:644-55, 1981

124. Gothot A, van der Loo JC, Clapp DW, Srour EF: Cell cycle-related changes in repopulating capacity of human mobilized peripheral blood

CD34(+) cells in non-obese diabetic/severe combined immune-deficient mice. Blood 92:2641-9, 1998

125. Klug MG, Soonpaa MH, Koh GY, Field LJ: Genetically selected cardiomyocytes from differentiating embronic stem cells form stable intracardiac grafts. J Clin Invest 98:216-24, 1996

126. Kipriyanov SM, Little M: Generation of recombinant antibodies. MoI Biotechnol 12:173-201, 1999

127. Shinohara N, Demura T, Fukuda H: Isolation of a vascular cell wall- specific monoclonal antibody recognizing a cell polarity by using a phage display subtraction method. Proc Natl Acad Sci U S A 97:2585-90, 2000

128. Iyer VR, Eisen MB, Ross DT, Schuler G, Moore T, Lee JCF, Trent JM, Staudt LM, Hudson JJ, Boguski MS, Lashkari D, Shalon D, Botstein D, Brown PO: The transcriptional program in the response of human fibroblasts to serum. Science 283:83-7, 1999 129. Scherf U, Ross DT, Waltham M, Smith LH, Lee JK, Tanabe L, Kohn KW, Reinhold WC, Myers TG, Andrews DT, Scudiero DA, Eisen MB, Sausville EA, Pommier Y, Botstein D, Brown PO, Weinstein JN: A gene expression database for the molecular pharmacology of cancer. Nat Biotech 24:236-44, 2000 130. Alizadeh AA, Eisen MB, Davis RE, Ma C, Lossos IS, Rosenwald A, Boldrick JC, Sabet H, Tran T, Yu X, Powell JI, Yang L, Marti GE, Moore T, Hudson JJ, Lu L, Lewis DB, Tibshirani R, Sherlock G, Chan WC, Greiner TC, Weisenburger DD, Armitage JO, Warnke R, Staudt LM: Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403:503-11 , 2000

131. Diehn M, Eisen MB, Botstein D, Brown PO: Large-scale identification of secreted and membrane-associated gene products using DNA microarrays. Nat Biotech 25:58-62, 2000

132. Wang E, Miller LD, Ohnmacht GA, Liu ET, Marincola FM: High- fidelity mRNA amplification for gene profiling. Nat Biotechnol 18:457-

9, 2000

133. Somia NV, Schmitt MJ, Vetter DE, Van Antwerp D, Heinemann SF, Verma IM: LFG: an anti-apoptotic gene that provides protection from Fas-mediated cell death. Proc Natl Acad Sci U S A 96:12667-72, 1999

134. Elefanty AG, Begley CG, Metcalf D, Bamett L, Kontgen F, Robb L: Characterization of hematopoietic progenitor cells that express the transcription factor SCL, using a lacZ "knock-in" strategy. Proc Natl Acad Sci U S A 95:11897-902, 1998

135. Asahara T, Takahashi T, Masuda H, Kalka C, Chen D, Iwaguro H, Inai Y, Silver M, Isner J: VEGF contributes to postnatal neovascularization by mobilizing bone marrow-derived endothelial progenitor cells. EMBO

J 18:3964-72, 1999

136. Robbins P, Skelton D, Yu X, Halene S, Leonard E, Kohn D: Consistent, persistent expression from modified retroviral vectors in murine hematopoietic stem cells. Proc Natl Acad Sci (USA) 95: 10182-87, 1998 137. Case S, Price M, Jordan C, Yu X, Wang L, Bauer G, Haas D, Xu D, Stripecke R, Naldini L, Kohn D, Crooks G: Stable transduction of quiescent CD34(+)GD38(-) human hematopoietic cells by HTV-l-based lentiviral vectors. Proc Natl Acad Sci U S A 96:2988-93, 1999

138. Ucbida N, Sutton R, Friera A, He D, Reitsma M, Chang W, Veres G, Scollay R, EL. W: HTV, but not murine leukemia virus, vectors mediate high efficiency gene transfer into freshly isolated G0/G1 human hematopoietic stem cells. Proc Natl Acad Sci U S A 95:11939-44, 1998

139. Takahashi T, Kalka C, Masuda H, Chen D, Silver M, Kearney M, Magner M, Isner JM, Asahara T: Ischemia- and cytokine-induced . mobilization of bone marrow-derived endothelial progenitor cells for neovascularization. Nat Med 5:434-8, 1999

140. Pbinney DG, Kopen G, Isaacson RL, Prockop DJ: Plastic adherent stromal cells from the bone marrow of commonly used strains of inbred mice: variations in yield, growth, and differentiation. J Cell Biochem 72:570-85, 1999

141. Svendsen CN, Skepper J, Rosser AE, ter Borg MG, Tyres P, Ryken T: Restricted growth potential of rat neural precursors as compared to mouse. Brain Res Dev Brain Res 99:253-8, 1997

142. Cheshier SH, Morrison SJ, Liao X, Weissman IL: In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem.

Proc Natl Acad Sci U S A 96:3120-5, 1999

143. Homer PJ, Power AE, Kempeimann G, Kuhn HG, Palmer TD, Winkler J, Thai LJ, Gage FH: Proliferation and differentiation of progenitor cells throughout the intact adult rat spinal cord. J Neurosci 20:2218-28, 2000 144. Randall TD, Weissman EL: Phenotypic and functional changes induced at the clonal level in hematopoietic stem cells after 5-fluorouracil treatment. Blood 89:3596-606, 1997

WHAT IS CLAIMED TS:

1. An isolated multipotent mammalian stem cell that is surface antigen negative for CD44, CD45, and HLA Class I and π.

2. The isolated cell of claim 1 , wherein the cell is surface antigen negative for CD34, CD44, CD45, and HLA Class I and H

3. The isolated cell of claim 2, wherein the cell is surface antigen negative for CD34, CD44, CD45, HLA-DR, Muclδ, Stro-1, HLA-class-I and is positive for oct3/4 mRNA.

4. The isolated cell of claim 3, wherein the cell is surface antigen negative for CD34, CD44, CD45, HLA-DR, Mucl8, Stro-1, HLA-class-I and is positive for oct3/4 mRNA and hTRT mRNA.

5. The isolated cell of claim 4, wherein the cell is surface antigen negative for CD31, CD34, CD36, CD38, CD45, CD50, CD62E and CD62P, HLA-DR, Mucl8, STRO-1, cKit, Tie/Tek, CD44, HLA-class I and 2-microglobulin and is positive for CDlO, CD13, CD49b, CD49e, CDw90, Flkl, EGF-R, TGF-Rl and TGF-R2, BMP-RlA, PDGF-RIa and PDGF-RIb.

6. An isolated multipotent non-embryonic, non-germ cell line cell that expresses transcription factors ocβ/4, REX-I and ROX-I .

7. An isolated multipotent cell derived from a post-natal mammal that responds to growth factor LIF and has receptors for LIF.

8. The isolated cell of claims 1, 6 or 7, wherein the cell has the capacity to be induced to differentiate to form at least one differentiated cell type of mesodermal, ectodermal and endodermal origin.

9. The isolated cell of claims 1, 6 or 7, wherein the cell has the capacity to be induced to differentiate to form cells of at least osteoblast, chondrocyte, adipocyte, fibroblast, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, endothelial, epithelial, hematopoietic, glial, neuronal or oligodendrocyte cell type.

10. The isolated cell of claims 1, 6 or 7, wherein the cell is a human cell.

11. The isolated cell of claims 1 , 6 or 7, wherein the cell is a mouse cell.

12. The isolated cell of claims 1, 6 or 7, wherein the cell is from a fetus, newborn, child, or adult.

13. The isolated cell of claims 1 , 6 or 7, wherein the cell is from a newborn, child, or adult.

14. The isolated cell of claims 1, 6 or 7, wherein the cell is derived from an organ.

15. The isolated cell of claim 14, wherein the organ is marrow, liver or brain.

16. A differentiated progeny cell obtained from the multipotent adult stem cell of claims 1, 6 or 7 wherein the progeny cell is a bone, cartilage, adipocyte, fibroblast, marrow stroma, skeletal muscle, smooth muscle, cardiac muscle, endothelial, epithelial, endocrine, exocrine, hematopoietic, glial, neuronal or oligodendrocyte cell.

17. The differentiated progeny cell of claim 16, wherein the progeny cell is a skin epithelial cell, liver epithelial cell, pancreas epithelial cell, pancreas endocrine cell or islet cell, pancreas exocrine cell, gut epithelium cell, kidney epithelium cell, or an epidermal associated structure.

18. The differentiated progeny cell of claim 17, wherein the epidermal associated structure is a hair follicle.

19. The differentiated progeny cell of claim 16, wherein the progeny cell can form soft tissues surrounding teeth or can form teeth.

20. An isolated transgenic multipotent mammalian stem cell comprising an isolated multipotent adult stem cell as in claim 1, 6 or 7, wherein its genome has been altered by insertion of preselected isolated DNA, by substitution of a segment of the cellular genome with preselected isolated DNA, or by deletion of or inactivation of at least a portion of the cellular genome.

21. The isolated transgenic cell of claim 20 wherein the genome is altered by viral transduction.

22. The isolated transgenic cell of claim 20 wherein the genome is altered by insertion of DNA by viral vector integration.

23. The isolated transgenic cell of claims 21 or 22 wherein the genome is altered by using a DNA virus, RNA virus or retroviral vector.

24. The isolated transgenic cell of claim 20 wherein a portion of the cellular genome is inactivated using an antisense nucleic acid molecule whose sequence is complementary to the sequence of the portion of the cellular genome to be inactivated.

25. The isolated transgenic cell of claim 20 wherein a portion of the cellular genome is inactivated using a ribozyme sequence directed to the sequence of the portion of the cellular genome to be inactivated.

26. The isolated transgenic cell of claim 20 wherein the altered genome contains the genetic sequence of a selectable or screenable marker gene that is expressed so that the progenitor cell with altered genome, or its . progeny, can be differentiated ftom progenitor cells having an unaltered genome.

27. The isolated transgenic cell of claim 26 wherein the marker is a green, red, yellow fluorescent protein, Beta-gal, Neo, DHFR ^m , or hygromycin.

28. The isolated transgenic cell of claim 20, wherein the cell expresses a gene that can be regulated by an inducible promoter or other control mechanism to regulate the expression of a protein, enzyme or other cell product.

29. The isolated cell of claim 1 , 6 or 7, wherein the cell expresses high levels of telomerase and maintains long telomeres after extended in vitro culture, as compared to the telomeres from lymphocytes from the same donors.

30. The isolated cell of claim 28, wherein the cell maintains telomeres of about 11 — 16 KB in length after extended in vitro culture.

31. A cell differentiation solution comprising factors that modulate the level of oct3/4 expression for promoting continued growth or differentiation of undifferentiated multipotent stem cells.

32. A method for isolating multipotent adult stem cells (MASC), comprising:

(a) depleting bone marrow mononuclear cells of CD45 ⁺ glycophorin A ⁺ CeUs,

(b) recovering CD45- glycophorin A- cells,

(c) plating the recovered CD45- glycophorin A- cells onto a matrix coating, and

(d) culturing the plated cells in media supplemented with growth factors.

33. The method of claim 32 wherein the step of depleting comprises negative or positive selection using monoclonal or polyclonal antibodies.

34. The method of claim 32 wherein the growth factors are chosen from PDGF-BB, EGF, IGF, and LIF.

35. The method of claim 32 wherein step (d) further comprises culturing in media supplemented with dexamethasone, linoleic acid, and/or ascorbic acid.

36. A culture method for isolated multipotent adult stem cells comprising adding the cells to serum-free or low-serum medium containing insulin, selenium, bovine serum albumin, linoleic acid, dexamethasone, and platelet-derived growth factor.

37. The culture method of claim 36 wherein the serum-free or low-serum medium is low-glucose DMEM in admixture with MCDB.

38. The culture method of claim 36 wherein insulin is present at a concentration of from about 10 to about 50 μg/ml.

39. The culture method of claim 36 wherein the serum-free or low-serum medium contains an effective amount of transferrin at a concentration of greater than 0 but less than about 10 μg/ml.

40. The culture method of claim 36 wherein selenium is present at a concentration of about 0.1 to about 5 μg/ml.

41. The culture method of claim 36 wherein bovine serum albumin is present at a concentration of about 0.1 to about 5 μg/ml.

42. The culture method of claim 36 wherein linoleic acid is present at a concentration of about 2 to about 10 μg/ml.

43. The culture method of claim 36 wherein dexamethasone is present at a concentration of about 0.005 to 0.15 μM,

44. The culture method of claim 36 wherein the serum-free medium or low- serum medium contains about 0.05 - 0.2 mM L-ascorbic acid.

45. The culture method of claim 36 wherein the serum-free medium or low- serum medium contains about 5 to about 15 ng/ml platelet-derived growth factor, 5 to about 15 ng/ml epidermal growth factor, 5 to about 15 ng/ml insulin-like growth factor, 10-10,000 IU leukemia inhibitory factor.

46. A cultured clonal population of mammalian multipotent adult stem cells isolated according to the method of claim 32.

47. A method to permanently and/or conditionally immortalize MASC derived cells and differentiated progeny comprising transfering telomerase into MASC or differentiated progeny.

48. A method to reconstitute the hematopoietic and immune system of a mammal comprising administering to the mammal fully allogenic multipotent stem cells, derived hematopoietic stem cells, or progenitor cells to induce tolerance in the mammal for subsequent multipotent stem cell derived tissue transplants or other organ transplants.

49. A method of expanding undifferentiated multipotent stem cells into differentiated hair follicles comprising administering appropriate growth factors, and growing the cells.

50. A method of using the isolated cell of claims 1, 6 or 7, comprising in utero transplantation of a population of the cells to form chimerism of cells or tissues, thereby producing human cells in prenatal or post-natal humans or animals following transplantation, wherein the cells produce therapeutic enzymes, proteins, or other products in the human or animal so that genetic defects are corrected.

51. A method of using the cells of claim 1, 6 or 7 for gene therapy in a subject in need of therapeutic treatment, comprising:

(a) genetically altering the cells by introducing into the cell an isolated pre-selected DNA encoding a desired gene product,

(b) expanding the cells in culture, and

(c) introducing the cells into the body of the subject to produce the desired gene product.

52. A method of repairing damaged tissue in a human subject in need of such repair, the method comprising:

(a) expanding the isolated multipotent adult stem cells of claims 1, 6 or 7 in culture, and

(b) contacting an effective amount of the expanded cells with the damaged tissue of said subject

53. The method of claims 51 or 52, wherein the cells are introduced into the body of the subject by localized injection.

54. The method of claims 51 or 52, wherein the cells are introduced into the body of the subject by systemic injection.

55. The method of claims 51 or 52, wherein the cells are introduced into the body of the subject in conjunction with a suitable matrix implant.

56. The method of claims 51 or 52, wherein the matrix implant provides additional genetic material, cytokines, growth factors, or other factors to promote growth and differentiation of the cells.

57. The method of claims 51 or 52, wherein the cells are encapsulated prior to introduction into the body of the subject.

58. The method of claim 57 wherein the encapsulated cells are contained within a polymer capsule.

59. A method for inducing an immune response to an infectious agent in a human subject comprising

(a) genetically altering an expanded clonal population of multipotent adult stem cells of claims 1, 6 or 7 in culture express one or more pre¬ selected antigenic molecules that elicit a protective immune response against an infectious agent, and

(b) introducing into the subject an amount of the genetically altered cells effective to induce the immune response.

60. The method of claim 59 further comprising prior to step (b) the step of differentiating the multipotent adult stem cells to form dendritic cells.

61. A method of using MASCs to identify genetic polymorphisms associated with physiologic abnormalities, comprising

(a) isolating the MASCs from a statistically significant population of individuals from whom phenotypic data can be obtained,

(b) culture expanding the MASCs from the statistically significant population of individuals to establish MASC cultures,

(c) identifying at least one genetic polymorphism in the cultured MASCs,

(d) inducing the cultured MASCs to differentiate, and

(e) characterizing aberrant metabolic processes associated with said at least one genetic polymorphism by comparing the differentiation pattern exhibited by an MASC having a normal genotype with the differentiation pattern exhibited by an MASC having an identified genetic polymorphism.

62. A method for treating cancer in a mammalian subject comprising

(a) genetically altering multipotent adult stem cells of claim 1, 6 or 7 to express a tumoricidal protein, an anti-angiogenic protein, or a protein that is expressed on the surface of a tumor cell in conjunction with a protein associated with stimulation of an immune response to antigen, and

(b) introducing an effective anti-cancer amount of the genetically altered multipotent adult stem cells into the mammalian subject

63. A method of using MASCs to characterize cellular responses to biologic or pharmacologic agents comprising

(a) isolating MASCs from a statistically significant population of individuals,

(b) culture expanding the MASCs from the statistically significant population of individuals to establish a plurality of MASC cultures,

(c) contacting the MASC cultures with one or more biologic or pharmacologic agents,

(d) identifying one or more cellular responses to the one or more biologic or pharmacologic agents, and

(e) comparing the one or more cellular responses of the MASC cultures from individuals in the statistically significant population.

4652