The subject of the present invention are mutated strains of Escherichia coli, a method and kit for testing potential antibacterial agents that are activators of bacterial mechanoreceptive channels which make use of the mutated strains.

Ion channels are specialised membrane proteins that facilitate the flow of ions across a cell membrane along to a concentration gradient. In their closed state, channels do not conduct ions, and they may open under the influence of an altered membrane electrical potential (voltage- gated channels), ligands, or mechanical tension of the membrane (mechanoreceptive channels). During opening, a channel element referred to as the gate changes its position and uncovers the pore of the channel, enabling ion flow. Channel opening times are very short (several miliseconds), and ion movement occurs at a rate in the neighbourhood of 10 ⁶ ions/s. Ion channels may conduct particular ions, and are then referred to as having selectivity filters. Depending on the type of ion conducted, we can distinguish cationic and anionic channels, and among the former: potassium, sodium and calcium channels. Ion flux through a channel occurs along the concentration gradient on both sides of the cell membrane.

Mechanically gated channels (MG) are activated by the mechanical tensioning of the cell membrane and their existence has been observed in animal, plant and bacterial cells. MG channels, in addition to electrically gated and ligand-modulated ion channels constitute the third major ion channel class. MG channels are detectors of all manner of mechanical stimuli that play a role in touch, hearing, and equilibrium maintenance. They may react to membrane tension caused by forces generated by a cell itself during fission, morphogenesis and growth, and they may constitute a universal protective mechanism in all cells against osmotic shock (sudden shits in environmental osmolarity) and it is this property that seems to explain their occurrence in bacteria (Hamill O.P., Martinac B., 2001, Molecular basis of mechanotransduction in living cells. Physiol. Rev. 81, 685-740). Two bacterial MG channels from the plasmalemma of Escherichia coli: MscS (low conductivity MG channel) and MscL (high-conductivity MG channel) are, thus far, the best studied mechanoreceptive proteins, both in terms of structure and function. Bacterial MG channels are characterised by high conductivity and large tension values that gate them. These are characteristics that differ them from eukaryotic MG channels. The conductivity of the MscL channel is some 100-fold that of the medium eukaryotic channel (MscS conductivity is about 30-fold) (Koprowski P., Grajkowski W., Kubalski A., Bakteryjne kanafy jonowe jako struktury modelowe., Kosmos, 2005, torn 54, No. 4 (269) str. 373-379).

Most bacteria, including pathogenic ones, occur in osmotically stochastic environments(i.e. human organism - water). During hypotonic shock (transfer from high osmolarity into low osmolarity) bacterial membranes are subjected to considerable osmotic pressure, which may lead to disruption of the cell. It has been demonstrated that the mechanically gated channels MscS and MscL, which are opened by cell membrane tension are necessary for the survival of osmotic shock by bacteria. Escherichia coli cells devoid of the active products of the mscS and mscL genes and subjected to osmotic shock undergo lysis. In accordance with the essential role of the mechanically gated channels MscS and MscL in bacteria, the genes of these proteins are found in all sequenced bacterial genomes. These channels constitute a pathway for "ejecting" excess osmoliths and water from the cell in a short time. Thus they are channels of the highest conductivity. The regulation of their activity is of key significance in cell survival. Uncontrolled opening results in the de-energization and death of cells. A series of mutants of MscL and MscS channels have been discovered, whose expression is toxic to cells {gain-of -function phenotype). Such a phenotype is possible due to the relatively extensive ion flux in conditions under which a wild-type channel remains closed. A greatly reduced gating threshold has been observed in the mutant channels.

Patent US 6,537,778 Bl discloses nucleic acids encoding an eukaryotic mechanically gated protein (Msc), methods of isolating modulators (meaning activators, inhibitors, enhancers, etc.) of mechanically gated conducting channels using isolated, naturally occurring or recombinant Msc proteins or fragments thereof using in vitro and in vivo binding assays known from the art and kits for isolating Msc protein modulators containing appropriate reagents and instructions..

Patents US 6,942,979 Bl, US 2003/0049697 Al, US 7,468,422 B2, US 2006/0024729 Al and US 2009/0162368 Al disclose a purified protein encompassing a mechanically gated potassium channel and at least one polyunsaturated fatty acid, as well as rilusol, the use of such channels in the identification of potential drugs as well as methods of identifying substances capable of modulating the potassium flux through the potassium channel TRAAK treated with arachidonic acid. Patent description US 7,429,449 B2 discloses methods of identifying inhibitors and activators of eukaryotic potassium channles using Saccharomyces cerevisiae cells, which do not express the functional endogenous potassium channels TRK1, TRK2 and TOK1, but which express heterologous, eukaryotic potassium channels as well as methods of manufacturing and uses of such mutant cells.

Patent description US 2003/0073117 Al discloses novel mechanically gated channel proteins obtained from mice and humans(SACl and hSAC respectively), which are specifically expressed in the kidney and play a role in the non-selective transport of cations into cells in response to an appropriate mechanical stimulus, DNA encoding such cells, a method of identifying activators and inhibitors of the cation channel activity using these proteins as well as an antibody against these proteins.

European patent description EP 1 535 903 Al and the international patent application WO 2005/051902 A2 disclose compounds and methods used in the chemical modification of the protein channel for use in pharmaceutical carriers for the controlled and/or local release of therapeutic molecules (i.e. small molecules, peptides, proteins and other macromolecules), as well as compounds sensitive to pH and/or light capable of modifying a mechanically gated channel such as the MscL protein of E. coli or its functional equivalent, the use of these compounds in the transformation of a mechanically gated channel into a pH and/or photo gated channel as well as the use of such altered channels in the production of drugs.

Patent description US 7,396,816 B2 discloses novel polypeptides which specifically inhibit the activity of a mechanically gated channel as well as inhibitors of the mechanically gated channel and drugs against atrial fibrilation containing such polypeptided and their salts.

Patent description WO 2005/002521 A2 describes, amongst others, methods for identifying compounds which inhibit the expression of a gene of a potassium-transporting protein or the biological activity of this gene which encompass testing ligand binding, testing protein activity, cell assays and assays for the expression of TRK gene expression.

International application WO 2005/070122 discloses methods of identifying agents which decrease the activity of mechanically gated ion channels, preferentially a Ca 2+ permeable channel (MscCa), as well as methods using agents that decrease the activity of mechanically gated ion channels, which encompass for example methods of treating cancer, methods of decreasing metastases and methods of reducing cancer symptoms Recently, a different method has been used to isolate mutants of MscS channel. A strain of E. coli, LB2003 (trkA kupl (trkDl) kdpABC5 rpsL metE thi rha gal), lacking potassium transporters, requires a high concentration of potassium ions in the medium for optimal groth (>30 mM K ⁺ ). A strain possessing potassium transporters can grow in submilimolar concentrations of K ⁺ ions. The expression in LB2003 of proteins constituting alternate pathways of K ⁺ ion transport (i.e. membrane channels which open due to a particular stimulus and facilitate the influx/efflux of K ⁺ from and into the cell) facilitates the restitution of cell growth in low-potassium media. This strategy has been used in the past in the isolation of genes encoding potassium channels. Mutants have been isolated that contain a series of mutations in the transmembrane domain of MscS, which has previously been identified as the channel gate. Furthermore, it turned out that the over-expression of a number of these mutants in a wild type strain inhibits cell growth. This phenotype is caused by a decreased channel opening threshold and the de-energization of the cells gain-of -function phenotype).

Chemical compounds that open mechanically gated channels will mimic such mutations and will also lead to cell death. Such compounds with bacteriostatic or bacteriocidal properties will be of potential pharmacological use.

The subject of the present invention are mutated strains of Escherichia coli MG61655 (ATCC No. 47076), lacking all potassium transporters, meaning Kdp, Kup and Trk (AKtrans), including strains lacking at least one among of the mechanically gated channel genes mscS and mscL (AKtrans AmscS and/or AmscL). In particular, the present invention relates to Escherichia coli strains MG61655 (ATCC No. 47076) lacking all potassium transporters, meaning Kdp, Kup and Trk (AKtrans), which have further been devoided of the mechanically gated channel gene mscS (AKtrans AmscS), or the mechanically gated channel gene mscL (AKtrans AmscL) or both mechanically gated channel genes mscS and mscL (AKtrans AmscS AmscL).

The subject of the present invention is also a method of testing chemical compounds for particular antibacterial properties, which makes use of the abovementioned mutant strains, in which:

- during the first stage of selection, the growth of mutant cultures of E. coli (AKtrans) lacking all potassium transporters, in the presence of a tested substance and various concentrations, including limiting concentrations of potassium, wherein the growth of the strain under such conditions indicates the facilitation of potassium transport into the cell by the examined substance,

- preferentially, during the second stage of selection, cell growth is measured in a culture of E. coli (AKtrans) mutants lacking all potassium transporters and a culture of mutants lacking all potassium transporters and both genes encoding mechanically gated channels, mscS and mscL, meaning E. coli (AKtrans AmscS AmscL), in the presence of a compound selected during stage one, at various concentrations, wherein the growth of both strains indicates that the tested substance is not active with regard to the MscS and MscL channel proteins, whereas the growth of the E. coli (AKtrans) in strain and the concurrent non-growth of E. coli (AKtrans AmscS AmscL) means that the examined substance is active against mechanically gated channels,

- preferentially, during the third stage of selection, the growth of a culture of E. coli (AKtrans AmscL) mutants is measured in the presence of a compound selected during the second stage (one which demonstrates an effect on mechanically gated channels) at various concentrations and limiting potassium concentrations, and cell growth demonstrates that this compound is a specific MscS channel activator,

- preferentially, during the fourth stage of selection, the growth of a culture of E. coli (AKtrans AmscS) mutants is measured in the presence of a compound selected during the second stage (demonstrating its effect on the activity of mechanically gated channels) at various concentrations and at limiting concentrations of potassium, wherein the growth of the of the culture indicates that the tested compound is a specific activator of the MscL channel.

The subject of the present invention is also a kit for testing chemical compounds as potential antibacterial substances, which contains the mutant strains mentioned above.

Production of the mutant strains of Escherichia coli, MG61655 (ATCC No. 47076) All deletions are made using a standard method (Datsenko and Wanner, 2000). The following procedure facilitates the generation of multiple deletions. In this method, the cassette bearing kanamycine resistance and flanked with FRT sequences recognised by the FLP recombinase, a part of plasmid pKD13, is used as a template for PCR. The primers used in this reaction contain the P regions complementary to the template at their 3 '-ends and H regions, complementary to the gene flanking sequence subject to deletion at their 5' ends. Next, the PCR products are transformed into E. coli cells expressing the λ RED recombinase of the pKD46 plasmid which facilitates the homologous recombination of the transforming PCR products. The cells are then cultured at 37°C on a selection medium containing kanamycin in order to isolate integrants of the kanamycin resistance gene. The isolated clones are cultured without antibiotics at 43 °C in order to eliminate plasmid pKD46. Next, the cells are transformed with plasmid pCP20 which expresses the FLP recombinase, which facilitates the excision of the kanamycin resistance gene from the genome. The transformants are selected at 30°C on ampicilin, whereafter they are passaged non-selectively at 43°C. In this fashion, the plasmid pCP20 is eliminated from the cells. The bacteria are then tested for the loss of the antibiotic markers. Deletions are confirmed using PCR and the primers kl 5'- CGGCCAC AGTCGATGAATCC-3 ' and k2 5'-CGGTGCCCTGAATGAACTGC-3'.

Datsenko KA, Wanner BL (2000. ) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 6640-6645.

Li, C, Edwards, M.D., Jeong, H., Roth, J., and I.R. Booth. 2007. Identification of mutations that alter the gating of the Escherichia coli mechanosensitive channel protein, MscK. Mol. Microbiol. 64:560-574.

Method of testing potential antibacterial compounds

The strain of E. coli (AKtrans), lacking potassium transporters, requires a high concentration of potassium ions (> 30 mM K ⁺ ) in the medium for full growth, whereas a strain possessing the transporters can grow on submilimolar concentrations of K ⁺ ). The expression, in E. coli AKtrans, of proteins constituting alternate K ⁺ transport pathways (i.e. membrane channels that open due to a particular stimulus and facilitate the influx/efflux of K ⁺ to and from the cell), makes it possible to re-establish cell growth on media with low potassium concentrations (1-5 mM K ⁺ ). Mechanically gated channels with mutations in the channel gate (leaking) also enable K ⁺ flux at low potassium concentrations. Over-expression of a number of these mutants in a wild-type strain inhibits cell growth. This phenotype is caused by the decreased channel opening threshold and the deenergization of the cell (gain-of-function, phenotype, GOF).

Assay using the mutant E. coli (AKtrans AmscS AmscL) - initial selection step of compounds in terms of perforation of mechanically gated channels

The assays encompass the measurement of the growth of mutant strains of E. coli (AKtrans) in the presence of several concentrations of tested small molecule compounds (concentrations in the nanomolar to micromolar range). The growth of the strain in limiting potassium concentrations is evidence of the facilitation of potassium influx into the cell in the presence of the tested compound. E. coli ( AKtrans) as well as E. coli ( AKtrans AmscS AmscL) grow on high-K ⁺ media. If the addition of a compound from the pool of compounds evaluated for possible antibacterial activity causes a decrease in the minimum potassium concentration necessary for the growth of both strains, this means that the substance does not act upon the channel proteins MscS and MscL, but alters the properties of the membrane and/or membrane proteins other than mechanically gated channels, causing it to leak. On the other hand, the growth of E. coli (AKtrans) and non-growth of E. coli (AKtrans AmscL AmscS) in the presence of the examined compound indicates an effect on mechanically gated channel activity. This effect may be direct(through binding to the protein) or indirect (by incorporation into the plasmalemma and the modification of its properties). The differentiation between these scenarios is performed using the presence of limiting concentrations of potassium and of the tested compound, and both strains: E. coli (AKtrans AmscL) and E. coli (AKtrans. AmscS). In this case, the growth of both strains in the presence of the tested substance is evidence of the non-specific activity of the compound on mechanically gated channels (the MscS and MscL proteins exhibit no amino-acid nor structural similarity). On the other hand, the growth of one of the two strains identifies th e compound as a specific activator of one of the channels.

Assay using the mutant E. coli (AKtrans AmscL).

The tested substance, identified previously as enabling the growth of strain E. coli (AKtrans), but not E. coli (AKtrans AmscS AmscL), is tested on E. coli (AKtrans AmscL). If the tested substance facilitates the growth of the strain E. coli (AKtrans AmscL) in low concentrations of potassium ions, this means that it is a specific activator of the MscS channel. The use of such a substance at a higher concentration than in the assays described above can lead to cell death. The effect will be achieved by the permeability of the closed MscS channel and is comparable to a mutation in various regions of the channel, i.e. the GOF mutation A98S in the gate which lowers the threshold of activation of the channel (Edwards et al., 2005).

Assays using the mutant E. coli (AKtrans AmscS).

The tested substance, identified previously as enabling the growth of strain E. coli (AKtrans), but not E. coli (AKtrans AmscS AmscL), is tested on E. coli (AKtrans AmscS). If the tested substance facilitates the growth of the strain E. coli (AKtrans AmscS) in low concentrations of potassium ions, this means that it is a specific activator of the MscL channel. The use of such a substance at a higher concentration than in the assays described above can lead to cell death. The effect will be achieved by the permeability of the closed MscL channel and is comparable to a mutation in various regions of the channel, i.e. the GOF mutation V23A in the gate region which lowers the activation threshold of the channel (Ou et al., 1998).

The above assays can be performed in the presence in media containing the polymyxin B nonapeptide (PMBN) at a concentration of 1-10 μg/ml. PMBN is a derivative of polymyxin B that does not exhibit biocidal properties at concentrations of 1-10 μg ml, but which permeabilise the external membrane (1-3).

1) Susceptibility of gram-negative bacteria to polymyxin B nonapeptide (1984) Viljanen P, Vaara M. Antimicrob Agents Chemother. 25(6):701-5

2) Binding of polymyxin B nonapeptide to gram-negative bacteria (1985) Vaara M, Viljanen P. Antimicrob Agents Chemother. 27(4):548-54

3) Leakage of periplasmic proteins from Escherichia coli mediated by polymyxin B nonapeptide (1986) Dixon RA, Chopra I. Antimicrob Agents Chemother. 1986 May;29(5):781-8

4) Edwards MD, Li Y, Kim S, Miller S, Bartlett W, Black S, Dennison S, Iscla I, Blount P, Bowie JU, Booth IR. (2005) Pivotal role of the glycine-rich TM3 helix in gating the MscS mechanosensitive channel. Nat Struct Mol Biol. 12(2) : 113-9.

5) Ou X, Blount P, Hoffman RJ, Kung C. (1998) One face of a transmembrane helix is crucial in mechanosensitive channel gating. Proc Natl Acad Sci U S A.95(19): 11471-5.

The following examples better illustrate the nature of the present invention.

Example 1. Production of mutants

Materials and methods: KLM medium: 10 g/1 bacto tryptone (DIFCO), 5 g/1 yeast extract (DIFCO), lOg/1 KCl, pH=7.0. The non-limiting medium for the growth of E. coli (AKtrans) mutants was K _n5 containing K ₂ HP0 ₄ , 46 mM; KH ₂ P0 ₄ , 23 mM; (NH ₄ ) ₂ S0 ₄ , 8 mM; MgS0 ₄ , 0,4 mM; FeS0 ₄ , 6 μΜ; sodium citrate, 1 mM; thiamine hydrochloride, 1 mg/1; and glucose, 0,2% (Li et al., 2007). In order to obtain potassium-free medium, Ko, we used Na ₂ HP0 ₄ , 46 mM; NaH ₂ P0 ₄ , 23 mM; (NH ₄ ) ₂ S0 ₄ , 8 mM; MgS0 ₄ , 0,4 mM; FeS0 ₄ , 6 μΜ; sodium citrate, 1 mM; thiamine hydrochloride, 1 mg/1; and glucose, 0,2% (mass/volume). In order to prepare a medium with a medium potassium content, we mixed K115 and Ko media in appropriate proportions.

Strains lacking the activities of the three potassium transporters Kdp, Kup and Trk, have been described in literature numerous times. In order to inactivate all potassium transporters, meaning Kdp, Kup and Trk we performed sequential deletions of genes for subunits of the transporters kdpABC, kup and trkA. The resulting strain, E. coli (AKtrans), was used for the deletion of mechanically gated channel genes mscS and mscL in order to obtain strains with the following genotypes: E. coli (AKtrans AmscL), E. coli (AKtrans AmscS) and E. coli (AKtrans AmscL AmscS).

For this reason we used primers 1 and 2 for the PCR amplification (using Pfu polymerase (Stratagene) in the manufacturer's buffer and recommended conditions) of the kanR cassette of the plasmid pKD13 (Datsenko and Wanner, 2000). Each of the primer pairs 1 and 2 consisted of two fragments, H and P, with the following structure5 ^v -H _x P _x -3\ Therefore, primer 1 had the structure

The P fragments were constant, and had the following sequences:

PI:

5 ' - ATTCCGGGG ATCCGTCGACC-3 ' and

P2:

5 ' -TGTAGGCTGGAGCTGCTTCG3 '

The H fragments were variable and specific for the deletion of a given gene:

- trkA deletion:

HI :

5 ' -TAATA AGGCGTC ATTAGACGCCTTATTA ATTAC AAGAAGAAAGGGCTTGG-3 ' H2:

5 ' -TTTACGCTAAGCT AATC AAAAAGTGATGAGATAACGGGTCGCGACTGATG-3 '

- kdpABC deletion:

HI:

5 ' -GACTC ATATTCAGTGCTC ACTC AATATC ATC AGGAGAGATATTCCGCC AC-3 ' H2:

5 ' -GTC ATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACC ATG-3 '

- kup deletion:

HI :

5 ' -CCCCTTATGAAGA AAGGAGGCGTCTGGCGTTAGATTTCGACCTGAGTACC-3 ' H2:

5 ' -GCC AAGGG ACTA AGCAC ACATTTCATATTTCAACGAAAGACTAGTCTATG-3 '

- mscS deletion: HI :

5 ' -CAGAGAGTATTATCTGGCCTCAGCGTTGATTACGC AGCTTTGTCTTCTTT-3 ' H2:

5 ' -GGCGGAGTGTATTTCTCC ATTTTGAGTC AGTTGAA AAGGAATATTGAATG-3 ' - mscL deletion:

HI:

5 ' - ACC ACTGGTCTTCTGCTTTC AGGCGCTTGTTAAGAGCGGTTATTCTGCTC-3 ' H2:

5 ' -TTAAC ATTTGTTAGACTTATGGTTGTCGGCTTC ATAGGGAGA ATAACATG-3 '

The PCR products were transformed via electroporation into the wild-type strain MG1655 (ATCC, No. 47076) of E. coli bearing the plasmid pKD46. The transformation was performed over 1 hour at 37°C in SOC medium. The transformants were selected on KLM solid medium with kanamycine (25 μg ml) at 37°C. Next, the transformants were passaged on LB without antibiotics and cultured at 43 °C. The cells were tested for ampicillin sensitivity (loss of plasmid pKD46). Clones sensitive to ampicillin were then transformed with the plasmid pCP20. Transformants were selected on KLM medium with ampicillin (100 μg ml) at 30°C, and then passaged on KLM without antibiotics at 43°C. Next, the individual colonies of E. coli were tested on KLM with ampicillin or kanamycin in order to confirm the loss of both antibiotic markers.

The resulting strains: E. coli (AKtrans), E. coli (AKtrans AmscL), E. coli (AKtrans AmscS) and E. coli ( AKtrans AmscL AmscS) were tested for growth in various concentrations of potassium: non-limiting on media with a potassium concentration of 115 mM (K115), as well as limiting with a potassium concentration of 1 and 15 mM (K _1; K ₁₅ ). All of the abovementioned strains grew only on K115 medium and failed to grow on Ki and K15.

Example 2. Assay identifying potential antibacterial compounds

Media: The non-limiting medium for the growth of E. coli (AKtrans) mutants was K115 containing K ₂ HP0 ₄ , 46 mM; KH ₂ P0 ₄ , 23 mM; (NH ₄ ) ₂ S0 ₄ , 8 mM; MgS0 ₄ , 0,4 mM; FeS0 ₄ , 6 μΜ; sodium citrate, 1 mM; thiamine hydrochloride, 1 mg/1; and glucose, 0,2% (Li et al., 2007). In order to obtain potassium-free medium, Ko, we used Na ₂ HP0 ₄ , 46 mM; NaH ₂ P0 ₄ , 23 mM; (NH ₄ ) ₂ S0 ₄ , 8 mM; MgS0 ₄ , 0,4 mM; FeS0 ₄ , 6 μΜ; sodium citrate, 1 mM; thiamine hydrochloride, 1 mg/1; and glucose, 0,2% (mass/volume). In order to prepare a medium with a median potassium content, we mixed K115 and Ko media in appropriate proportions.

The following bacterial strains: E. coli (AKtrans), E. coli (AKtrans AmscL), E. coli (AKtrans AmscS) and E. coli (AKtrans AmscL AmscS) were cultured on K115 overnight. Next day, the bacteria of each strain were diluted to OD ₆ oo ~ 0,01 in K _1; K5, K ₁₀ , and K15 media. The diluted cultures were aliquoted in batches of 100 μΐ into microtitration plates (96-well). These aliquots were supplemented with low molecular weight compounds at concentrations from 1 to 1000 nM. The cultures in the microtitration plates were incubated overnight at 37 °C with slight agitation (70 RPM). Growth of bacteria in individual wells was evaluated visually or using a SpectraMax plate reader (Molecular Devices) at a wavelength of 600 nm.

Example 3. A kit for testing compounds as potential substances with antibacterial activity

A kit for testing compounds as potential substances with antibacterial activity contains bacterial strains E. coli (AKtrans), E. coli (AKtrans AmscL), E. coli (AKtrans AmscS) and E. coli (AKtrans AmscL AmscS), as the non-limiting medium to the growth of E. coli (AKtrans) it contains K _n s containing K ₂ HP0 ₄ , 46 mM; KH ₂ P0 ₄ , 23 mM; (NH ₄ ) ₂ S0 ₄ , 8 mM; MgS0 ₄ , 0,4 mM; FeS0 ₄ , 6 μΜ; sodium citrate, 1 mM; thiamine hydrochloride, 1 mg/1; and glucose, 0,2% (Li et al., 2007), as well as a medium devoid of potassium ion , Ko, containing Na ₂ HP0 ₄ , 46 mM; NaH ₂ P0 ₄ , 23 mM; (NH ₄ ) ₂ S0 ₄ , 8 mM; MgS0 ₄ , 0.4 mM; FeS0 ₄ , 6 μΜ; sodium citrate, 1 mM; thiamine hydrochloride, 1 mg/1; and glucose, 0,2% (mass/volume).