Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
MUTATIONS IN THE CYSTIC FIBROSIS GENE
Document Type and Number:
WIPO Patent Application WO/2005/016251
Kind Code:
A2
Abstract:
The present invention relates to the cystic fibrosis gene and the field of genetic screening. More specifically, the described embodiments concern nucleic acids and proteins that encode novel mutations in the cystic fibrosis gene and methods to screen for the presence or absence of mutations or polymorphism’s in the cystic fibrosis gene. Approaches to screen for the presence or absence of mutations that are correlated with cystic fibrosis and approaches to design primers that generate extension products that facilitate the resolution of multiple extension products in a single lane of a gel or in a single run on a column are also provided.

Inventors:
Dunlop, Charles L. M. (2233 Martin Street, Unit 422 Irvine, CA, 92612, US)
Kammescheidt, Anja (31262 Brooks Street, Laguna Beach, CA, 92651, US)
Application Number:
PCT/US2004/022376
Publication Date:
February 24, 2005
Filing Date:
July 12, 2004
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
AMBRY GENETICS CORPORATION (100 Technology Drive, Irvine, CA, 92618, US)
Dunlop, Charles L. M. (2233 Martin Street, Unit 422 Irvine, CA, 92612, US)
Kammescheidt, Anja (31262 Brooks Street, Laguna Beach, CA, 92651, US)
International Classes:
A61K; (IPC1-7): A61K/
Attorney, Agent or Firm:
Hart, Daniel (Knobbe, Martens Olson & Bear, LLP, 2040 Main Street, 14th Floo, Irvine CA, 92614, US)
Download PDF:
Claims:
WHAT IS CLAIMED IS :
1. A method of identifying the presence or absence of a mutation or polymorphism in the cystic fibrosis transmembrane conductance regulator (CFTR) gene of a subject comprising : providing a CFTR nucleic acid from said subject ; providing at least one primer set from TABLE A, TABLE B, or TABLE X ; contacting said nucleic acid and said at least one primer set ; generating an extension product from said at least one primer set, wherein said extension product comprises said mutation or polymorphism ; and identifying the presence or absence of said mutation or polymorphism in said subject by analyzing the composition of said extension product, the migration of said extension product on a gel, or the chromatographic properties of said extension product.
2. The method of Claim 1, wherein at least two primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
3. The method of Claim 1, wherein at least three primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
4. The method of Claim 1, wherein at least four primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
5. The method of Claim 1, wherein at least five primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
6. The method of Claim 1, wherein at least six primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
7. The method of Claim 1, wherein at least seven primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
8. The method of Claim 1, wherein at least eight primer sets from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
9. The method of Claim 1, wherein said at least one primer set is from TABLE A.
10. The method of Claim 1, wherein said at least one primer set is from TABLE B.
11. The method of Claim 1, wherein said at least one primer set is from TABLE X.
12. The method of Claim 9, wherein a plurality of extension products are generated from a plurality of primer sets from TABLE A and said extension products are grouped according to TABLE 3 and each group of extension products are separated on a single lane of a gel.
13. The method of Claim 10, wherein a plurality of extension products are generated from a plurality of primer sets from TABLE B and said extension products are grouped according to TABLE E and each group of extension products are separated on a single lane of a gel.
14. The method of Claim 11, wherein a plurality of extension products are generated from a plurality of primer sets from TABLE X and said extension products are grouped according to TABLE Y and each group of extension products are separated on a single lane of a gel.
15. A method of identifying the presence or absence of a genetic marlcer in the cystic fibrosis transmembrane conductance regulator (CFTR) gene of a subject comprising : providing a DNA sample from said subject ; providing at least one primer set that is any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X ; contacting said DNA and said at least one primer set ; generating an extension product from said at least one primer set that comprises a region of DNA that includes the location of said genetic marker ; separating said extension product on a gel ; and identifying the presence or absence of said genetic marker in said subject by analyzing the separation of the extension product.
16. The method of Claim 15, wherein at least two primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE 2, or TABLE X are contacted with said DNA.
17. The method of Claim 15, wherein at least three primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
18. The method Of Claim 15, wherein at least four primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
19. The method of Claim 15, wherein at least five primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
20. The method of Claim 15, wherein at least six primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
21. The method of Claim 15, wherein at least seven primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
22. The method of Claim 15, wherein at least eight primer sets that are any number between 175 nucleotides upstream or downstream of a primer set from TABLE A, TABLE B, or TABLE X are contacted with said DNA.
23. The method of Claim 15, wherein said at least one primer set is a primer set that is any number between 175 nucleotides upstream or downstream of a primer set from TABLE A.
24. The method of Claim 15, wherein said at least one primer set is a primer set that is any number between 175 nucleotides upstream or downstream of a primer set from TABLE B.
25. The method of Claim 15, wherein said at least one primer set is a primer set that is any number between 175 nucleotides upstream or downstream of a primer set from TABLE X.
26. The method of Claim 1, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
27. The method of Claim 1, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
28. The method of Claim 9, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
29. The method of Claim 9, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
30. The method of Claim 10, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
31. The method of Claim 10, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
32. The method of Claim 11, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
33. The method of Claim 11, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
34. The method of Claim 12, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
35. The method of Claim 12, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
36. The method of Claim 13, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
37. The method of Claim 13, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
38. The method of Claim 14, wherein at least one of the mutations listed in TABLE Z is said mutation or polymorphism.
39. The method of Claim 14, wherein at least one of the mutations listed in TABLE AA is said mutation or polymorphism.
40. The method of Claim 1, wherein said at least one primer set comprises a fluorescent label.
41. The method of Claim 9, wherein said at least one primer set comprises a fluorescent label.
42. The method of Claim 10, wherein said at least one primer set comprises a fluorescent label.
43. The method of Claim 11, wherein said at least one primer set comprises a fluorescent label.
44. The method of Claim 12, wherein said at least one primer set comprises a fluorescent label.
45. The method of Claim 13, wherein said at least one primer set comprises a fluorescent label.
46. The method of Claim 14, wherein said at least one primer set comprises a fluorescent label.
47. The method of Claim 15, wherein said at least one primer set comprises a fluorescent label.
48. The method of Claim 26, wherein said at least one primer set comprises a fluorescent label.
49. The method of Claim 27, wherein said at least one primer set comprises a fluorescent label.
50. The method of Claim 28, wherein said at least one primer set comprises a fluorescent label.
51. The method of Claim 29, wherein said at least one primer set comprises a fluorescent label.
52. The method of Claim 30, wherein said at least one primer set comprises a fluorescent label.
53. The method of Claim 31, wherein said at least one primer set comprises a fluorescent label.,.
54. The method of Claim 32, wherein said at least one primer set comprises a fluorescent label.
55. The method of Claim 33, wherein said at least one primer set comprises a fluorescent label.
56. The method of Claim 34, wherein said at least one primer set comprises a fluorescent label.
57. The method of Claim 35, wherein said at least one primer set comprises a fluorescent label.
58. The method of Claim 36, wherein said at least one primer set comprises a fluorescent label.
59. The method of Claim 37, wherein said at least one primer set comprises a fluorescent label.
60. The method of Claim 38, wherein said at least one primer set comprises a fluorescent label.
61. The method of Claim 39, wherein said at least one primer set comprises a fluorescent label.
62. Use of at least one primer set from TABLE A, TABLE B, or TABLE X to identify the presence or absence of a mutation or polymorphism on a CFTR gene.
63. The use of Claim 62, wherein at least one primer of said primer set comprises a fluorescent label.
64. The use of Claim 62, wherein a plurality of primer sets from TABLE A are used to generate extension products that are grouped according to TABLE 3 and each group of extension products are separated on a single lane of a gel.
65. The use of Claim 62, wherein a plurality of primer sets from TABLE B are used to generate extension products that are grouped according to TABLE E and each group of extension products are separated on a single lane of a gel.
66. The use of Claim 62, wherein a plurality of primer sets from TABLE X are used to generate extension products that are grouped according to TABLE Y and each group of extension products are. separated on a single lane of a gel.
Description:
MUTATIONS IN THE CYSTIC FIBROSIS GENE FIELD OF THE INVENTION The present invention relates to the field of genetic screening. More specifically, the described embodiments concern nucleic acids and proteins that encode mutant or polymorphic variants of the cystic fibrosis gene and methods to screen for the presence or absence of these mutations or polymorphisms. Approaches to screen for the presence or absence of mutations or polymorphisms that are associated with cystic fibrosis and/or conditions associated with cystic fibrosis and approaches to design primers that generate extension products that facilitate this analysis are also provided.

BACKGROUND OF THE INVENTION Despite the tremendous progress in molecular biology and the identification of genes, mutations, and polymorphisms responsible for disease, the ability to rapidly screen a subject for the presence of multiple disorders has been technically difficult and cost prohibitive. Current DNA- based diagnostics allow for the identification of a single mutation or polymorphism or gene per analysis. Although high-throughput methods and gene chip technology have enabled the ability to screen multiple samples or multiple loci within the same sample, these approaches require several independent reactions, which increases the time required to process clinical samples and drastically increases the cost. Further, because of time and expense, conventional diagnostic approaches focus on the identification of the presence of DNA fragments that are associated with a high frequency of mutation, leaving out analysis of other loci that may be critical to diagnose a disease. The need for a better way to diagnose genetic disease is manifest.

With the advent of multiplex Polymerase Chain Reaction (PCR), the ability to use multiple primer sets to generate multiple extension products from a single gene is at hand. By hybridizing isolated DNA with multiple sets of primers that flank loci of interest on a single gene, it is possible to generate a plurality of extension products in a single PCR reaction corresponding to fragments of the gene. As the number of primers increases, however, the complexity of the reaction increases and the ability to resolve the extension products using conventional techniques fails. Further, since many diseases are caused by changes of a single nucleotide, the rapid detection of the presence or absence of these mutations or polymorphisms is frustrated by the fact that the PCR products that indicate both the diseased and non-diseased state are of the same size.

Developments in gel electrophoresis and high performance liquid chromatography (HPLC), however, have enabled the separation of double-stranded DNAs based upon differences in their melting behaviors, which has allowed investigators to resolve DNA fragments having a single mutation or single polymorphism. Techniques such as temporal temperature gradient gel

electrophoresis (TTGE) and denaturing high performance liquid chromatography (DHPLC) have been used to screen for small changes or point mutations in DNA fragments.

The separation principle of TTGE, for example, is based on the melting behavior of DNA molecules. In a denaturing polyacrylamide gel, double-stranded DNA is subject to conditions that will cause it to melt in discrete segments called"melting domains."The melting temperature Tm of these domains is sequence-specific. When the Tm of the lowest melting domain is reached, the DNA will become partially melted, creating branched molecules. Partial melting of the DNA reduces its mobility in a polyacrylamide gel.

Since the Tm of a particular melting domain is sequence-specific, the presence of a mutation or polymorphism will alter the melting profile of that DNA in comparison to the wild-type or non- polymorphic DNA. That is, a heteroduplex DNA consisting of a wild-type or non-polymorphic strand annealed to mutant or poymorphic strand, will melt at a lower temperature than a homoduplex DNA strand consisting of two wild-type or non-polymorphic strands. Accordingly, the DNA containing the mutation or polymorphism will have a different mobility compared to the wild-type or non-polymorphic DNA.

Similarly, the separation principle of DHPLC is based on the melting or denaturing behavior of DNA molecules. As the use and understanding of HPLC developed, it became apparent that when HPLC analyses were carried out at a partially denaturing temperature, i. e., a temperature sufficient to denature a heteroduplex at the site of base pair mismatch, homoduplexes could be separated from heteroduplexes having the same base pair length. (See e. g., Hayward- Lester, et al., Genuine Research 5 : 494 (1995) ; Underhill, et al., Proc. Natl. Acad. Sci. USA 93 : 193 (1996) ; Oefner, et al., DHPLC Workshop, Stanford University, Palo Alto, Calif., (Mar. 17, 1997) ; Underhill, et al., Genome Research 7 : 996 (1997) ; Liu, et al., NucleicAcid Res., 26 : 1396 (1998), all of which and the references contained therein are hereby expressly incorporated by reference in their entireties). Techniques such as Matched Ion Polynucleotide Chromatography (M1PC) and Denaturing Matched Ion Polynucleotide Chromatography (DMIPC) have also been employed to increase the sensitivity of detection. It was soon realized that DHPLC, which for the purposes of this disclosure includes but is not limited to, MIPC, DMIPC, and ion-pair reverse phase high- performance liquid chromatography, could be used to separate heteroduplexes from homoduplexes that differed by as little as one base pair. Various DHPLC techniques have been described in U. S.

Pat. Nos. 5, 795, 976 ; 5, 585, 236 ; 6, 024, 878 ; 6, 210, 885 ; Huber, et al., Cltromatog7ap7lia 37 : 653 (1993) ; Huber, et al., Anal. Biochem. 212 : 351 (1993) ; Huber, et al., Anal. Claim. 67 : 578 (1995) ; O'Donovan et al., Genetics 52 : 44 (1998), Am JHum Genet. Dec ; 67 (6) : 1428-36 (2000) ; Ann Hum Genet. Sep : 63 (Pt 5) : 383-91 (1999) ; Biotechniques, Apr ; 28 (4) : 740-5 (2000) ; Biotechniques.

Nov ; 29 (5) : 1084-90, 1092 (2000) ; Cliff Chem. Aug ; 45 (8 Pt 1) : 1133-40 (1999) ; Clin Cherra.

Apr ; 47 (4) : 635-44 (2001) ; Geiioinics. Aug 15 ; 52 (1) : 44-9 (1998) ; Genetics. Mar 15 ; 56 (3) : 247-53 (1999) ; Genet Test. ; 1 (4) : 237-42 (1997-98) ; Genet Test. : 4 (2) : 125-9 (2000) ; Hum Genet.

Jun ; 106 (6) : 663-8 (2000) ; Hum Genet. Nov ; 107 (5) : 483-7 (2000), Hum Genet. Nov ; 107 (5) : 488-93 (2000) ; Hum Mutat. Dec ; 16 (6) : 518-26 (2000) ; Hum Mutat. 15 (6) : 556-64 (2000) ; Hum Mutat.

Mar ; 17 (3) : 210-9 (2001) ; J Bioc1lem Biophys Metlaods. Nov 20 ; 46 (1-2) : 83-93 (2000) ; J BiocAle77l Biophys Methods. Jan 30 ; 47 (1-2) : 5-19 (2001) ; Mutat Res. Nov 29 ; 430 (1) : 13-21 (1999) ; Nucleic Acids Res. Mar 1 ; 28 (5) : E13 (2000) ; and Nucleic Acids Res. Oct 15 ; 28 (20) : E89 (2000), all of which, including the references contained therein, are hereby expressly incorporated by reference in their entireties. References which are cited in the present disclosure are not necessarily prior art and therefore their citation does not constitute an admission that such references are prior art in any jurisdiction.

Cystic fibrosis (CF) is the most common severe autosomal recessive genetic disorder in the Caucasian population. Approximately 1 in 20 persons are carriers of the disease. (Boat et al, The Metabolic Basis of Inherited Disease, 6th ed, pp 2649-2680, McGraw Hill, N. Y. (1989)).

Conditions that are related to cystic fibrosis include chronic pulmonary disease, pancreatic exocrine insufficiency, and elevated sweat electrolyte levels. However, there is no clear phenotype that directs an approach to the exact nature of the genetic basis of the disease, or that allows for an identification of the cystic fibrosis gene. The nature of the CF defect in relation to the population genetics data has not been readily apparent. Both the prevalence of the disease and the clinical heterogeneity have been explained by several different mechanisms : high mutation rate, heterozygote advantage, genetic drift, multiple loci, and reproductive compensation.

Investigators have isolated and cloned the cystic fibrosis (CF) gene, which has allowed for the identification of several mutant or polymorphic variants of the CF gene and the development of screening and diagnostic tests for CF utilizing nucleic acid probes and antibodies to the gene product. (See U. S. Patent Nos. 5, 5433, 99 ; 5, 981, 178 and 6, 201, 107, all of which are herein expressly incorporated by reference in its entirety). Despite these efforts, there remains a need for more approaches to the screening for mutations and/or polymorphisms on the CF gene and the identification of more mutations and/or polymorphisms that are related to the CF phenotype.

BRIEF SUMMARY OF THE INVENTION Aspects of the invention concern rapid and inexpensive but efficient approaches to determine the presence or absence of genetic markers associated with or related to cystic fibrosis or a cystic fibrosis phenotype. Several oligonucleotide primers specific for the human cystic fibrosis transmembrane conductance regulator (CFTR or CF) gene have been developed (e. g., TABLE A, TABLE B, TABLE 2, and TABLE X). These primers and oligonucleotides that are any number between 1-75 nucleotides upstream or downstream of said primers are unique in sequence and in their ability to generate extension products that melt evenly over vast stretches of nucleotides, which greatly improves the sensitivity of detection (e. g., single base mutations). It was then realized that by grouping extension products with similar melting behaviors, one can rapidly and efficiently separate multiple extension products on the basis of melting behavior on the same lane

of a TTGE gel or in the same run on a DHPLC. Accordingly, a rapid, inexpensive and efficient approach to determine whether a subject is afflicted with cystic fibrosis or is a carrier of the disease has been discovered, whereby extension products are generated from a subject's DNA using the primers described herein, the extension products are grouped or mixed according to their melting behavior, and the grouped or mixed extension products are separated on the basis of melting behavior (e. g., one group per lane of a TTGE gel). Not only does the pooling of extension products reduce cost and the time to perform the analysis but, because the extension products are optimized for melting behavior, the sensitivity of detection remains very high.

By one approach, for example, a method of identifying the presence or absence of a genetic marker in the human cystic fibrosis transmembrane conductance regulator (CFTR) gene of a subject is conducted by providing a DNA sample from said subject ; providing at least one primer set from TABLE A ; contacting said DNA and said at least one primer set ; generating an extension product from said at least one primer set that comprises a region of DNA that includes the location of said genetic marker ; separating said extension product on the basis of melting behavior ; and identifying the presence or absence of said genetic marker in said subject by analyzing the melting behavior of said extension product. In related embodiments, at least 2, 3, 4, 5, 6, 7, or 8 primer sets from TABLE A are contacted with said DNA. In more related embodiments, the extension products generated from said 2, 3, 4, 5, 6, 7, or 8 primer sets are grouped according to TABLE 3 and separated on the basis of melting behavior.

By another approach, a method of identifying the presence or absence of a genetic marker in the human cystic fibrosis transmembrane conductance regulator (CFTR) gene of a subject is conducted by providing a DNA sample from said subject ; providing at least one primer set from TABLE 2 ; contacting said DNA and said at least one primer set ; generating an extension product from said at least one primer set that comprises a region of DNA that includes the location of said genetic marker ; separating said extension product on the basis of melting behavior ; and identifying the presence or absence of said genetic marker in said subject by analyzing the melting behavior of said extension product. In related embodiments, at least 2, 3, 4, 5, 6, 7, or 8 primer sets from TABLE 2 are contacted with said DNA. In more related embodiments, the extension products generated from said 2, 3, 4, 5, 6, 7, or 8 primer sets are grouped according to TABLE 3 and separated on the basis of melting behavior.

In another set of embodiments, a method of identifying the presence or absence of a genetic marker in the human cystic fibrosis transmembrane conductance regulator (CFTR) gene of a subject is conducted by providing a DNA sample from said subject ; providing at least one primer set that is any number between 1-75 nucleotides upstream or downstream of a primer set from TABLE B ; contacting said DNA and said at least one primer set ; generating an extension product from said at least one primer set that comprises a region of DNA that includes the location of said genetic marker ; separating said extension product on the basis of melting behavior ; and identifying the

presence or absence of said genetic marker in said subject by analyzing the melting behavior of said extension product. In related embodiments, at least 2, 3, 4, 5, 6, 7, or 8 primer sets from TABLE B are contacted with said DNA. In more related embodiments, the extension products generated from said 2, 3, 4, 5, 6, 7, or 8 primer sets are grouped according to TABLE E and separated on the basis of melting behavior.

In still a further embodiment, a method of identifying the presence or absence of a genetic marker in the human cystic fibrosis transmembrane conductance regulator (CFTR) gene of a subject is conducted by providing a DNA sample from said subject ; providing at least one primer set that is any number between 1-75 nucleotides upstream or downstream of a primer set from TABLE X ; contacting said DNA and said at least one primer set ; generating an extension product from said at least one primer set that comprises a region of DNA that includes the location of said genetic marker ; separating said extension product on the basis of melting behavior ; and identifying the presence or absence of said genetic marker in said subject by analyzing the melting behavior of said extension product. In related embodiments, at least 2, 3, 4, 5, 6, 7, or 8 primer sets from TABLE X are contacted with said DNA. In more related embodiments, the extension products generated from said 2, 3, 4, 5, 6, 7, or 8 primer sets are grouped according to TABLE Y and separated on the basis of melting behavior.

More embodiments concern the mutations/polymorphisms identified on the CF gene using the nucleic acids and proteins comprising the methods described herein. TABLES Z and AA list several novel mutations/polymorphisms identified on the CF gene (referred to collectively as variants). The fragments in which these variants were identified are also provided, as well as, information regarding the presence or absence of other CF mutations or polymorphisms in the sample. Additionally, TABLES Z and AA provide clinical data, such as whether the patient had typical or atypical CF, sweat test data, and other conditions related to CF disease. The information provided in TABLES Z and AA strongly supports the conclusion that several of the mutations/polymorphisms identified herein are correlated to, associated with, or are predictive of the CF disease state.

Accordingly, aspects of the invention also include isolated or purified nucleic acids that are the amplification products identified in TABLE BB. Furthermore, the peptides or proteins encoded by these nucleic acids and the antibodies thereto are embodiments of the invention. These compositions are useful as tools for diagnostics (e. g. probes), drug discovery, and research.

Additional embodiments of the invention feature methods of the invention that utilize fluorescent labels. In some embodiments, fluorescent labels are incorporated into PCR products and facilitate detection and indentification of PCR products analyzed by methods of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS FIGURE 1 shows a melting curve for the extension product CF3A spanning nucleotides 112-275 of the human cystic fibrosis transmembrane conductance regulator (CFTR) gene. The x axis shows the number of nucleotides and the y axis shows the temperature.

FIGURE 2 shows a melting curve for the extension product CF3B spanning nucleotides 215-300 of the CFTR gene. The x axis shows the number of nucleotides and the y axis shows the temperature.

FIGURE 3 shows a melting curve for the extension product CFTR1B spanning nucleotides 228-323 of the CFTR gene. The x axis shows the number of nucleotides and the y axis shows the temperature.

FIGURE 4 shows a melting curve for the extension product CFTR1A spanning nucleotides 123-230 of the CFTR gene. The x axis shows the number of nucleotides and the y axis shows the temperature.

FIGURE 5 shows results from experiments using primers with fluorescent tags to amplify portions of exon 10 of the Cystic Fibrosis Transmembrane Regulator (CTFR) gene. Two polymorphisms were amplified in this experiment : deltaF508 (DF508) and M470V. These results reveal the homozygous state of the clinical DNA samples used in the reactions when the products are mixed with wildtype DNA before analysis via TTGE. Texas Red (tr) and Oregon Green (og) tags are used. Banding patterns for wild type (WT), heterozygous (HET), homozygous (HOMO) and mixtures of these patterns (in the right hand side lanes, containing mixtures of tr and og products) are shown.

DETAILED DESCRIPTION OF THE INVENTION Embodiments described herein concern methods to screen for the presence or absence of multiple mutations or polymorphisms in a plurality of genes, thus, improving the speed and lowering the cost to diagnose genetic diseases. Particularly preferred embodiments concern approaches to screen multiple loci in the human cystic fibrosis transmembrane conductance regulator (CFTR or CF) gene so as to identify the presence or absence of polymorphisms/mutations therein, determine a cystic fibrosis carrier status or to make a determination of the predilection for disease. Several embodiments also permit very sensitive detection of single base mutations, single base mismatches, and small nuclear polymorphisms (SNPs), as well as, larger alterations in DNA at multiple loci, in a plurality of genes, in multiple samples. Further, by employing a DNA standard or by screening a plurality of DNA samples in the same assay, improved sensitivity of detection can be obtained.

A unique approach to designing primers and extension products generated therefrom is described in the context of an assay that was performed to detect the presence or absence of genetic markers, polymorphisms, or mutations on the Cystic Fibrosis Transmembrane Conductance Regulator gene (CFTR or CF). This application is related to U. S. Patent Application No.

10/300683, which claims priority to U. S. Provisional Application No. 60/333531, both of which are hereby expressly incorporated by reference in their entireties.

Embodiments include methods of identifying the presence or absence of a plurality of genetic markers in a subject in the same gene or separate genes. One method is practiced, for example, by providing a DNA sample from said subject, providing a plurality of nucleic acid primer sets that hybridize to said DNA at regions that flank said plurality of genetic markers, wherein each primer set has a first and a second primer and, wherein said plurality of genetic markers exist on the same gene or a plurality of genes, contacting said DNA and said plurality of nucleic acid primer sets in a single reaction vessel or multiple reaction vessels, generating, in said reaction vessel (s), a plurality of extension products that comprise regions of DNA that include the location of said plurality of genetic markers, separating said plurality of extension products on the basis of melting behavior in a single lane or multiple lanes of a gel or a single run or multiple runs on a column, and identifying the presence or absence of said plurality of genetic markers in said subject by analyzing the melting behavior of said plurality of extension products. In some aspects of this method the separation on the basis of melting behavior is accomplished by TTGE and in other embodiments the separation on the basis of melting behavior is accomplished by DHPLC. In some embodiments, said extension products are first separated by size for a period sufficient to separate populations of extension products and then separated by melting behavior. The size separation can be accomplished on the TTGE gel or DHPLC column prior to separating on the basis of melting behavior.

Preferably, after generating the extension products by an amplification technique (e. g., Polymerase Chain Reaction or PCR), the extension products are grouped and pooled according to their predicted and/or actual melting behavior. In this way, multiple extension products, which correspond to different regions on the same gene or different regions on a plurality of genes can be separated on the same lane of a TTGE gel or in the same run on a DHPLC column. By carefully designing the primers, such that the extension products generated therefrom melt over large stretches of DNA (approximately 25, 50, 75, 100, 125, or 150 nucleotides) at roughly the same temperature (within up to 1. 5°C of one another), it was unexpectedly discovered that multiple extension products (2, 3, 4, 5, 6 or more) can be separated on the same lane of a TTGE gel or in the same run on an DHPLC column, thereby substantially reducing the cost of conducting the analysis.

In some embodiments, the subject is selected from the group consisting of a plant, virus, bacteria, mold, yeast, animal, and human and either the first or the second primer comprise a GC clamp. Additionally, the first or second primer or both can include a miniclamp comprising a plurality of guanine and/or cytosine nucleotides, which can improve or adjust the melting behavior of the resulting extension product so as to make the extension product more amenable to the assay described herein. In other aspects of the invention, either the first or the second primer hybridize to a sequence within an intron. Preferably, at least one of the plurality of genetic markers is indicative

of a disease selected from the group consisting of familial hypercholesterolemia (FH), cystic fibrosis, Tay-sachs, thalassemia, sickle cell disease, phenylketonuria, galactosemia, fragile X syndrome, hemophilia A, myotonic dystrophy, medium-chain acyl CoA dehydrogenase, maturity onset diabetes, cystinuria, methylmolonic acidemia, urea cycle disorders, hereditary fructose intolerance, hereditary hemachromatosis, neonatal thrombocytopenia, Gaucher's disease, tyrosinemia, Wilson's disease, alcaptonuria, hypolactasia, Baker's disease, argininemia Adenomatous polyposis coli (APC), Adult Polycystic Kidney disease, a-l-antitrypsin deficiency, Duchenne Muscular Dystrophy, Hemophilia A, Hereditary Nonpolyposis colorectal cancer, Huntingtons disease, Marfans syndrome, Myotonic dystrophy, Neurofibromatosis, Osteogenesis imperfecta, Retinoblastoma, Sickle cell disease, Freidrichs ataxia, Hemoglobinopathies, Leber's hereditary optic neuropathy, MCAD, Canavan's disease, Retintitus Pigmentosa, Bloom Syndrome, Fanconi anemia, and Neimann Pick disease.

In other embodiments, the plurality of primer sets consist of at least 3, 4, 5, 6, or 7 primer sets. Additionally, in some embodiments, the plurality of genes consist of at least 2, 3, 4, 5, 6, or 7 genes. The method above preferably generates the extension products using the Polymerase Chain Reaction (PCR) and the method can be supplemented by a step in which a control DNA is added.

Another embodiment concerns a method of identifying the presence or absence of a plurality of genetic markers in a plurality of subjects. This method is practiced by providing a DNA sample from said plurality of subjects, providing a plurality of nucleic acid primer sets that hybridize to said DNA at regions that flank said plurality of genetic markers, wherein each primer set has a first and a second primer and, wherein said plurality of genetic markers exist on the same gene or on a plurality of genes, contacting said DNA and said plurality of nucleic acid primer sets in a single reaction vessel or multiple vessels, generating, in said reaction vessel (s), a plurality of extension products that comprise regions of DNA that include the location of said plurality of genetic markers, separating said plurality of extension products on the basis of melting behavior in a single lane or multiple lanes of a gel or a single run or multiple runs on a column, and identifying the presence or absence of said plurality of genetic markers in said plurality of subjects by analyzing the melting behavior of said plurality of extension products. In some aspects of this embodiment, the separation on the basis of melting behavior is accomplished by TTGE and in other embodiments the separation on the basis of melting behavior is accomplished by DHPLC.

As above, preferably, after generating the extension products by the amplification technique (e. g., PCR) from the plurality of subjects, the extension products are grouped and pooled according to their predicted and/or actual melting behavior. By separating multiple extension products generated from a plurality of subjects in the same lane of a TTGE gel or in the same run on a DHPLC column, the cost of analysis is substantially reduced. Because the incidence of polymorphism or mutation in the population as a whole is small, the large scale screening, described above, can be performed. When a polymorphism and/or mutation is detected in this type

of assay, single subject assays can be performed, as described above, to identify the subject (s) that have the polymorphism and/or mutation.

In other embodiments, the subject is selected from the group consisting of a plant, virus, bacteria, mold, yeast, animal, and human and either the first or the second primer comprise a GC clamp. In other aspects of this embodiment, either the first or the second primer hybridize to a sequence within an intron. Preferably, at least one of the plurality of genetic markers is indicative of a disease selected from the group consisting of familial hypercholesterolemia (FH), cystic fibrosis, Tay-sachs, thalassemia, sickle cell disease, phenylketonuria, galactosemia, fragile X syndrome, hemophilia A, myotonic dystrophy, medium-chain acyl CoA dehydrogenase, maturity onset diabetes, cystinuria, methylmolonic acidemia, urea cycle disorders, hereditary fructose intolerance, hereditary hemachromatosis, neonatal thrombocytopenia, Gaucher's disease, tyrosinemia, Wilson's disease, alcaptonuria, hypolactasia, Baker's disease, argininemia Adenomatous polyposis coli (APC), Adult Polycystic Kidney disease, a-l-antitrypsin deficiency, Duchenne Muscular Dystrophy, Hemophilia A, Hereditary Nonpolyposis colorectal cancer, Huntingtons disease, Marfans syndrome, Myotonic dystrophy, Neurofibromatosis, Osteogenesis imperfecta, Retinoblastoma, Sickle cell disease, Freidrichs ataxia, Hemoglobinopathies, Leber's hereditary optic neuropathy, MCAD, Canavan's disease, Retintitus Pigmentosa, Bloom Syndrome, Fanconi anemia, and Neimann Pick disease.

In more embodiments, the plurality of subjects consist of at least 2, 3, 4, 5, 6, or 7 subjects.

In more aspects of this embodiment, the plurality of primer sets consist of at least 3, 4, 5, 6, or 7 primer sets. Additionally, in some embodiments, the plurality of genes consist of at least 2, 3, 4, 5, 6, or 7 genes. The method above preferably generates the extension products using PCR and the method can be supplemented by a step in which a control DNA is added.

Still another embodiment involves a method of identifying the presence or absence of a mutation or polymorphism in a subject. This method is practiced by providing a DNA sample from said subject, generating a population of extension products from said sample, wherein said extension products comprise a region of said DNA that corresponds to the location of said mutation or polymorphism, providing at least one control DNA, wherein said control DNA corresponds to the extension product but lacks said mutation or polymorphism, contacting said control DNA and said population of extension products in a single reaction vessel, thereby forming a mixed DNA sample, heating said mixed DNA sample to a temperature sufficient to denature said control DNA and said DNA sample, cooling said mixed DNA sample to a temperature sufficient to anneal said control DNA and said DNA sample, separating said mixed sample on the basis of melting behavior in a single lane or multiple lanes of a gel or a single run or multiple runs on a column, and identifying the presence or absence of said mutation or polymorphism by analyzing the melting behavior of said mixed DNA sample. By this approach, the addition of the control DNA followed by the heating and cooling steps, forces heteroduplex formation, if a polymorphism or mutation is

present, which facilitates identification. In some aspects of this embodiment, the control DNA is DNA obtained or amplified from a second subject and the presence or absence of a mutation or polymorphism is known. In other aspects of the invention, heteroduplex formation can be forced by pooling the extension products generated from a plurality of subjects and denaturing and annealing, as above. Because the predominant genotype in a plurality of subjects lacks polymorphisms or mutations in the gene (s) analyzed, the majority of the DNA will force heteroduplex formation with any polymorphic or mutant DNA in the pool. Accordingly, the identification of mutant and/or polymorphic DNA is facilitated and the cost of the analysis is reduced. In some aspects of this embodiment, the separation on the basis of melting behavior is accomplished by TTGE and in other embodiments the separation on the basis of melting behavior is accomplished by DHPLC.

Still more embodiments concern the primers or groups of primers disclosed herein (preferably CFTR specific primers), kits containing said nucleic acids, and methods of using these primers or groups of primers to diagnose a carrier status or the presence of disease (e. g., cystic fibrosis). These nucleic acid primers can be used to efficiently determine the presence or absence of a polymorphism or mutation in a multiplex PCR reaction that screens a plurality of genes and a plurality of subjects in a single reaction vessel or multiple reaction vessels. Additionally, reaction vessels comprising a DNA sample, and a plurality of nucleic acid primer sets that hybridize to said DNA sample at regions that flank a plurality of genetic markers, wherein said plurality of genetic markers exist on a single gene or a plurality of genes are embodiments. Further, a reaction vessel comprising a plurality of DNA samples obtained from a plurality of subjects and a plurality of nucleic acid primer sets that hybridize to said plurality of DNA samples at regions that flank a plurality of genetic markers, wherein said plurality of genetic markers exist on a plurality of genes or on a single gene are embodiments. Still more aspects of the invention include a reaction vessel containing a plurality of extension products (2, 3, 4, 5, 6, 7, 8, 9, or 10 or more), which melt at approximately the same temperature (e. g., 0°C-1. 5°C from one another).

Other embodiments concern a gel having lanes and adapted to separate different DNAs comprising a plurality of extension products, in a single lane of said gel, wherein said plurality of extension products melt at approximately the same temperature but are resolvable on said gel and, which correspond to regions of DNA located on a plurality of genes or on a single gene and, wherein said regions of DNA comprise loci that indicate a genetic trait and a gel having lanes and adapted to separate different DNAs comprising a plurality of extension products, in a single lane of said gel, wherein said plurality of extension products correspond to regions of DNA located on a plurality of genes or on a single gene in a single individual or a plurality of subjects and, wherein said regions of DNA comprise loci that indicate a genetic trait.

Additional embodiments include a DHPLC column adapted to separate different DNAs comprising a plurality of extension products, wherein said plurality of extension products melt at

approximately the same temperature but are resolvable on said column and, which correspond to regions of DNA located on a plurality of genes or a single gene or and, wherein said regions of DNA comprise loci that indicate a genetic trait and a DHPLC column adapted to separate different DNAs comprising a plurality of extension products, wherein said plurality of extension products correspond to regions of DNA located on a plurality of genes or on a single gene in a single individual or a plurality of subjects and, wherein said regions of DNA comprise loci that indicate a genetic trait.

More embodiments concern nucleic acids and peptides/proteins containing the polymorphisms/mutations described herein, as well as antibodies directed to said peptides.

TABLES Z and AA lists several unique mutations/polymorphisms identified on the CF gene, the fragments in which these variants were identified, and information regarding the presence or absence of other CF mutations or polymorphisms in the sample. Further, TABLES Z and AA provide associative data, such as whether the patient had typical or atypical CF, sweat test data, and other clinical manifestations or conditions that are associated with or related to CF disease. The data provided in TABLES Z and AA provide evidence that several of the listed mutations/polymorphisms are correlated to, associated with, or are predictive of the CF symptoms or the CF disease state. Thus, the isolated or purified nucleic acids containing one or more of the mutations/polymorphisms identified in TABLES Z and AA, the amplification products featured in TABLE BB and the peptides or proteins encoded by these nucleic acids, provided are particularly useful for diagnostics, drug discovery, and research tools. Accordingly, methods of performing diagnostic assays, drug discovery, and research are also embodiments. More description of the compositions and methods described above is provided in the in the following sections. jlpproaches to facilitate and reduce the cost of genetic analysis Aspects of the invention described herein concern approaches to analyze DNA samples for the presence or absence of a plurality of genetic markers that reside on a plurality of genes in a single assay. Some embodiments allow one to rapidly distinguish a plurality of DNA fragments in a single sample that differ only slightly in size and/or composition (e. g., a single base change, mutation, or polymorphism). Other embodiments concern methods to screen multiple genes from a subject, in a single assay, for the presence or absence of a mutation or polymorphism. An approach to achieve greater sensitivity of detection of mutations or polymorphisms present in a DNA sample is also provided. Preferred embodiments, however, include methods to screen multiple genes, in a plurality of DNA samples, in a single assay, for the presence or absence of mutations or polymorphisms.

It was discovered that multiple extension products that have slight differences in length and/or composition can be resolved by separating the DNA on the basis of melting temperature. By one approach, a plurality of varying lengths of double-stranded DNA are applied to a denaturing gel and the double-stranded DNAs are separated by applying an electrical current while the temperature

of the gel is raised gradually. By slowly increasing the temperature while the DNA is electrically separated on a polyacrylamide gel containing a denaturant (e. g., urea), the dsDNA eventually denatures to partially single stranded (branched molecules) DNA. Because branched or heteroduplex DNA migrates more rapidly or more slowly than dsDNA or homoduplex DNA, one can quickly determine the differences in melting behavior between DNA fragments, compare this melting temperature to a standard DNA (e. g., a wild-type DNA or non-polymorphic DNA), and identify the presence or absence of a mutation or polymorphism in the screened DNA. This technique efficiently separates multiple DNA fragments, generated by a single multiplex PCR reaction on a plurality of loci from different genes (e. g., in one experiment, 10 different loci were analyzed in the same reaction and each of the extension products, some that differed by only a single mutation, were efficiently resolved).

It was also discovered that multiple extension products that have slight differences in length and/or composition can be resolved by separating the DNA by DHPLC. By one approach, a plurality of varying lengths of double-stranded DNA are applied to a ion-pair reverse phase HPLC column (e. g., alkylated non-porous poly (styrene-divinylbenzene)) that has been equilibrated to an appropriate denaturing temperature, depending on the size and composition of the DNA to be separated (e. g., 53°C to 63°C) in an appropriate buffer (e. g., O. 1mM triethylamine acetate (TEAA) pH 7. 0). Once applied to the column, the double stranded DNA binds to the matrix. By slowly increasing the presence of a denaturant (e. g., acetonitrile in TEAA), the dsDNA eventually denatures to partially single stranded (branched molecules) DNA and elutes from the column.

Preferably a linear gradient is used to slowly elute the bound DNA. Detection can be accomplished using a U. V. detector, radioactivity, dyes, or fluoresence. In some embodiments, the extension products are first separated on the basis of size using a shallow gradient of denaturant for a time sufficient to separate individual populations of extension products and then on the basis of melting behavior using a deeper gradient of denaturant. The techniques described in the following references can also be modified for use with aspects of the invention : U. S. Pat. Nos. 5, 795, 976 ; 5, 585, 236 ; 6, 024, 878 ; 6, 210, 885 ; Huber, et al., Claromatographia 37 : 653 (1993) ; Huber, et al., Anal. Biochem. 212 : 351 (1993) ; Huber, et al., Anal. Chenu. 67 : 578 (1995) ; O'Donovan et al., Genomics 52 : 44 (1998), Am JHum Genet. Dec ; 67 (6) : 1428-36 (2000) ; An7l Hum Genet. Sep : 63 (Pt 5) : 383-91 (1999) ; Biotech77iques, Apr ; 28 (4) : 740-5 (2000) ; Biotech7tiques. Nov ; 29 (5) : 1084-90, 1092 (2000) ; Clin Cherra. Aug ; 45 (8 Pt 1) : 1133-40 (1999) ; Clin Clean. Apr ; 47 (4) : 635-44 (2001) ; Genetics. Aug 15 ; 52 (1) : 44-9 (1998) ; Genomics. Mar 15 ; 56 (3) : 247-53 (1999) ; Genet Test.

; 1 (4) : 237-42 (1997-98) ; Genet Test. : 4 (2) : 125-9 (2000) ; Hunt Genet. Jun ; 106 (6) : 663-8 (2000) ; Hum Genet. Nov ; 107 (5) : 483-7 (2000) ; Hum Genet. Nov ; 107 (5) : 488-93 (2000) ; Hum Mutat.

Dec ; 16 (6) : 518-26 (2000) ; Hum Mutat. 15 (6) : 556-64 (2000) ; Hum Mutat. Mar ; 17 (3) : 210-9 (2001) ; J Biochem Biophys Methods. Nov 20 ; 46 (1-2) : 83-93 (2000) ; J Biochem Biophys Methods. Jan 30 ; 47 (1-2) : 5-19 (2001) ; Mutat Res. Nov 29 ; 430 (1) : 13-21 (1999) ; Nucleic Acids Res. Mar

1 ; 28 (5) : E13 (2000) ; and Nucleic Acids Res. Oct 15 ; 28 (20) : E89 (2000), all of which are hereby expressly incorporated by reference in their entireties including the references cited therein,.

Because branched or heteroduplex DNA elutes either more rapidly or more slowly than homoduplex DNA, one can quicldy determine the differences in melting behavior between DNA fragments, compare this melting temperature to a standard DNA (e. g., a wild-type or non- polymorphic homoduplex DNA), and identify the presence or absence of a mutation or polymorphism in the screened DNA This technique efficiently separates multiple DNA fragments, generated by a single multiplex PCR reaction on a plurality of loci from different genes.

Some of the embodiments described herein have adapted the DNA separation techniques described above to allow for high-throughput genetic screening of organisms (e. g., plant, virus, bacteria, mold, yeast, and animals including humans). Typically, multiple primers that flank genetic markers (e. g., mutations or polymorphisms that indicate a congenital disease or a trait) on different genes are employed in a single amplification reaction or multiple amplification reactions and the multiple extension products are separated on a denaturing gel or by DHPLC according to their melting behavior. The presence or absence of mutations or polymorphisms, also referred to as "genetic markers", in the subject's DNA are then detected by identifying an aberrant melting behavior in the extension products (e. g., migration on a gel that is too fast or too slow or elution from a DHPLC column that is too fast or too slow). Advantageously, some embodiments provide a greater understanding of a subject's health or predilection for disease because more loci that are indicative of disease, for example, are analyzed in a single assay. Further, some embodiments drastically reduce the cost of performing such diagnostic assays because many different genes and markers for disease can be screened simultaneously in a single assay.

By one approach, for example, a biological sample from the subject (e. g., blood) is obtained by conventional means and the DNA is isolated. Next, the DNA is hybridized with a plurality of nucleic acid primers that flank regions of a plurality of genetic loci or markers that are associated with or linked to the plurality of traits to be analyzed. Although 10 different loci have been detected in a single assay (requiring 20 primers), more or less loci can be screened in a single assay depending on the needs of the user. Preferably, each assay has sufficient primers to screen at least three different loci, which may be located on three different genes. That is, the embodied assays can employ sufficient primers to screen at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 24 or more, independent loci or markers that are indicative of a disease in a single assay (e. g., in the same tube or multiple tubes) and these loci can be on different genes. Because more than one loci or marker can be detected by a single set of primers, the detection of 20 different markers, for example, can be accomplished with less than 40 primers. However, in many assays, a different set of primers is needed to detect each different loci. Thus, in several embodiments, at least 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, or more primers are used.

Desirably, the primers hybridize to regions of human DNA that flank markers or loci associated with or linked to human diseases such as : familial hypercholesterolemia (FH), cystic fibrosis, Tay-sachs, thalassemia, sickle cell disease, phenylketonuria, galactosemia, fragile X syndrome, hemophilia A, myotonic dystrophy, medium-chain acyl CoA dehydrogenase, maturity onset diabetes, cystinuria, methylmolonic acidemia, urea cycle disorders, hereditary fructose intolerance, hereditary hemachromatosis, neonatal thrombocytopenia, Gaucher's disease, tyrosinemia, Wilson's disease, alcaptonuria, hypolactasia, Baker's disease, argininemia Adenomatous polyposis coli (APC), Adult Polycystic Kidney disease, a-l-antitrypsin deficiency, Duchenne Muscular Dystrophy, Hemophilia A, Hereditary Nonpolyposis colorectal cancer, Huntingtons disease, Marfans syndrome, Myotonic dystrophy, Neurofibromatosis, Osteogenesis imperfecta, Retinoblastoma, Sickle cell disease, Freidrichs ataxia, Hemoglobinopathies, Leber's hereditary optic neuropathy, MCAD, Canavan's disease, Retintitus Pigmentosa, Bloom Syndrome, Fanconi anemia, and Neimann Pick disease. It should be understood, however, that the list above is not intended to limit the invention in any way and the techniques described herein can be used to detect and identify any gene or mutation or polymorphism desired (e. g., polymorphisms or mutations associated with alcohol dependence, obesity, and cancer).

Once the primers are hybridized to the subject's DNA, a plurality of extension products having the marker or loci indicative of the trait are generated. Preferably, the extension products are generated through a polymerase-driven amplification reaction, such as multiplex PCR or multiplex Ligase Chain Reaction (LCR). In some embodiments, one or more fluorescent labels are employed. That is, by some methods, individual extension products are generated by PCR in the presence of different fluorescent labels so that the resulting extension products are fluoresce at different wavelengths (e. g., different colors are seen for each individual extension product on a detector). These embodiments facilitate the analysis of multiple patient samples in the same assay or multiple markers on the same or different genes. The extension products are then pooled according to similar melting behaviors and then the pooled samples are separated on the basis of melting behavior (e. g., TTGE or DHPLC).

In some approaches, for example, the extension products are isolated from the reactants in the amplification reaction, suspended in a non-denaturing loading buffer, and are loaded on a TTGE denaturing gel (e. g., an 8%, 7M urea polyacrylamide gel). The sample can be heated to a temperature sufficient to denature a DNA duplex and then cooled to a temperature that allows reannealing, prior to suspending the DNA in the non-denaturing loading buffer. The extension products are then loaded into a single lane or multiple lanes, as desired. Next, an electrical current is applied to the gel and extension products. Subsequently, the temperature of the denaturing gel is gradually raised, while maintaining the electrical current, so as to separate the extension products on the basis of their melting behaviors. Once the fragments have been separated by size and melting behavior, one can identify the presence or absence of mutations or polymorphisms at the

screened loci by analyzing the migration behavior of the extension products. By employing the fluorescent labels above, one can rapidly identify the differing extension products or patient samples, as well.

Several techniques and modified equipment have been developed to facilitate the TTGE process. For example, modified gel combs were developed to enable the use of multi-tip-pipettes.

It was discovered that the spacing of conventional gel combs was such that a multi-tip-pipette (e. g., a pipette that contains four, 6, 8, or more pipette tips) could not be used. The pipette tips on the multi-tip-pipettes did not coordinate to the well spacing on the gel. This was largely because the multi-tip-pipettes were developed for use with tissue-culture dishes rather than gels. Accordingly, gel combs were designed and built to have well spacing that coordinated with the spacing on the multi-tip-pipettes, which facilitated the gel-loading process, improved the overall efficiency of the assay, and reduced the cost of the assay in terms of technician time. Thus, gel combs comprising a well spacing that coordinates with a multi-tip-pipette and methods of loading a gel comprising applying a sample to the gel with a multi-tip-pipette are embodiments of the invention. Related embodiments concern gel combs comprising a variety of well widths but having a spacing that allows for the application of a sample using a multi-tip-pipettes. One of skill in the art can readily appreciate that an infinite number of gel comb embodiments are possible, since the spacing on the gel comb can be adjusted as well as the spacing on a multi-tip-pipette, however, it must be emphasized that these embodiments of the invention concern the coordination of the gel comb spacing with the spacing on the multi-tip-pipette.

A gel turntable is another piece of equipment that was used to facilitate the diagnostic methods described herein. The gel turn table is a turntable that rests underneath the gel box allowing the technician to easily rotate the gel box so as to load both gels. Conventional TTGE gel boxes (e. g. Biorad) contain two gels/box that are positioned one in front of the other. This positioning complicates the loading procedure because, after loading the first gel, the technician must carefully turn the gel box, which is resting on a flat surface, so as to gain access to the second gel. Frequently, during the rotation, the samples loaded in the first well spill out, contaminate other wells or are lost altogether. The gel turntable overcomes this problem by allowing the technician to easily spin the gel box so as to gain access to the second gel. The turn table itself can be made out of several materials (e. g., wood, plastic, lucite, and acrylic) but is preferably made of slate. The turntable has the appearance of a record player and comprises a base, a pivotable joint joined to the base, and a flat platform connected to the pivotable joint onto which the gel box rests. The pivotable joint preferably contains ball bearings to facilitate the rotation but ball bearings are not essential. Again, the gel turntable is a modification that facilitates the diagnostic methods described herein, reducing the costs of the assays because less technician time is required to load the gels.

In other approaches, the extension products are isolated from the reactants and suspended in a DHPLC buffer (e. g., 0. 1M TEAA pH 7. 0). The extension products are then injected onto a

DHPLC column (e. g., an ion-pair reverse phase HPLC column composed of alkylated non-porous poly (styrene-divinylbenzene)) that has been equilibrated to an appropriate denaturing temperature, depending on the size and composition of the DNA to be separated (e. g., 53°C to 63°C) in an appropriate buffer (e. g., O. lmM triethylamine acetate (TEAA) pH 7. 0) and the extension products are allowed to bind. The presence of a denaturant (e. g., acetonitrile in TEAA) on the column is gradually raised over time so as to slowly elute the extension products from the column. Preferably a linear gradient is used. Presence of the extension products in the eluant is preferably accomplished using a UV detector (e. g., at 260 and/or 280 nm), however, greater sensitivity may be obtained using radioactivity, binding dyes, fluorescence or the techniques described in U. S. Pat.

Nos. 5, 795, 976 ; 5, 585, 236 ; 6, 024, 878 ; 6, 210, 885 ; Huber, et al., Chromatographia 37 : 653 (1993) ; Huber, et al., Anal. Biochem. 212 : 351 (1993) ; Huber, et al., Anal. Chem. 67 : 578 (1995) ; and O'Donovan et al., Genomics 52 : 44 (1998), which are all hereby incorporated by reference in their entireties including the references cited therein.

The appearance of a slower or faster migrating band at a temperature below or above the predicted melting point for the particular extension product in the TTGE approach, for example, indicates the presence of a mutation or polymorphism in the subject's DNA. Similarly, the appearance of a slower or faster eluting peak at a concentration of denaturant predicted to elute a wild-type or non-polymorphic homoduplex extension product in the DHPLC approach indicates the presence of a mutation or polymorphism in the subject's DNA. A heterozygous sample will display both homoduplex bands (wild-type homoduplexes and mutant homoduplexes), as well as, two heteroduplex bands that are the product of mutant/wild-type annealing. Because of base pair mismatches in these fragments, they melt significantly sooner than the two homoduplex bands.

Accordingly, a user can rapidly identify the presence or absence of a mutation or polymorphism at the screened loci by either the TTGE or DHPLC approach and determine whether the tested subject has a predilection for a disease.

In a related embodiment, greater sensitivity is obtained by adding a"standard"DNA or "control"DNA to the DNA to be screened prior to amplification or after amplification, prior to separation of the DNA on the TTGE gel or DHPLC column. This insures the presence of heteroduplexes in the case of either a homozygous mutant, which normally would not display heteroduplexes, or a heterozygous mutant. Desired DNA standards include, but are not limited to, DNA that is wild-type for at least one of the traits that are being screened. Preferred standards include, but are not limited to, DNA that is wild-type for all of the traits that are being screened. A DNA standard can also be a mutant or polymorphic DNA. In some embodiments, particularly when the control DNA is added after amplification, the DNA standard is an extension product generated from a wild-type genomic DNA or a mutant genomic DNA. By this approach, the amplification phase of the method is performed as described above. That is, DNA from the subject to be screened and the DNA standard are hybridized with nucleic acid primers that flank regions of

the genetic loci or markers that are associated with or linked to the traits being tested. In some embodiments, the DNA standard extension products are fluorescently labeled differently than the extension products generated from the screened samples so as to facilitate identification.

Extension products are then generated. If the subject being tested has at least one trait that is detected by the assay (e. g., a congenital disorder), then two populations of extension products are generated, a first population that corresponds to the standard DNA and a second population that corresponds to the subject's DNA having at least one mutation or polymorphism. Next, preferably, the two populations of extension products are isolated from the amplification reactants and are denatured by heat (e. g., 95°C for 5 minutes), then are allowed to anneal by cooling (e. g., ice for 5 minutes). This ensures the formation of the heteroduplex bands in the presence of any relatively small mutation (e. g., point mutation, small insertion, or small deletion). The isolation and denaturing/annealing steps are not practiced with some embodiments, however.

Subsequently, by the TTGE approach, the two populations of extension products are suspended in a non-denaturing loading buffer and loaded on a denaturing polyacrylamide gel and separated on the basis of melting behavior, as described above. By the DHPLC approach, the two populations of extension products are suspended in a suitable buffer (e. g., 0. 1M TEAA pH 7. 0), loaded onto a buffer and temperature equilibrated DHPLC column and a linear gradient of denaturant is applied, as described above. Because the two populations of extension products are not perfectly complementary, they form heteroduplexes. Heteroduplexes are less stable than homoduplexes, have a lower melting temperature, and are easily differentiated from homoduplexes using the DNA separation techniques described above. One can identify the presence or absence of mutations or polymorphisms at the screened loci, for example, by comparing the migration behavior or elution behavior of the extension products generated from the screened DNA with the migration behavior or elution behavior of the DNA standard. If heteroduplexes are present, generally, two additional bands that correspond to the single extension product will appear on the gel or the extension products will elute from the column more rapidly than the control or standard DNA alerting the user to the presence of a mutation or polymorphism. Accordingly, a significant increase in sensitivity is obtained and a user can rapidly identify the presence or absence of a mutation or polymorphism in the tested DNA sample and, thereby, determine whether the screened subject has a predilection for a particular trait (e. g., a congenital disease). As stated above, by employing different fluorescent labels during individual amplification reactions, different fluorescently labeled extension products can be generated, these differently labeled extension products can be separated in the same lane of a gel and the identification of particular markers can be facilitated.

Similarly, an increase in sensitivity can be obtained by mixing DNA from a plurality of subjects prior to amplification. Because the frequency of mutations or polymorphisms for most disorders are very low in the population, most of the extension products generated are wild-type

DNA. Thus, most of the pool of DNA behaves as a DNA standard. That is, the predominant structure formed upon annealing after denaturation is a homoduplex, which can be rapidly distinguished from any heteroduplex that would appear if a subject were to have a polymorphism or mutation. Of course, extension products previously generated from multiple subjects can be used as control DNA by mixing the previously generated extension products with the extension products generated from the DNA that is being screened prior to electrophoresis. In several embodiments, the DNA from at least 2 subjects is mixed. Desirably, the DNA from at least 3 subjects is mixed.

Preferably, the DNA from at least 4 subjects is mixed. It should be understood, however, that the DNA from at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more subjects can be mixed prior to amplification or prior to separation on the basis of melting behavior, in accordance with some of the described embodiments. Again, by employing different fluorescent labels during individual amplification reactions, different fluorescently labeled extension products can be generated, these products can be separated in the same lane of a gel and the identification of genetic markers, in particular the same markers on different subjects (e. g., the amplification reactions for different subjects employ different fluorescent markers) can be facilitated.

, In one embodiment, for example, DNA from a plurality of subjects to be tested is obtained by conventional methods, pooled, and hybridized with the desired nucleic acid primers. Extension products are then generated, as before. If at least one of the subjects being tested has at least one congenital disorder that is detected by the screen then two populations of extension products will be generated, a first population that corresponds to DNA from subjects that have the wild-type gene and a second population that corresponds to DNA from subjects having at least one mutant or polymorphic gene.

By one approach, the two populations of extension products are then isolated from the amplification reactants, suspended in a non-denaturing loading buffer, denatured by heat, annealed by cooling, and are separated by TTGE, as described above. By another approach, the two populations of extension products are isolated from the amplification reactants, suspended in a DHPLC loading buffer (0. 1M TEAA pH 7. 0), denatured by heat, annealed by cooling, and are separated on a DHPLC column, as described above. The presence of a subject in the DNA pool having at least one mutation or polymorphism is identified by analyzing the migration behavior of the DNA on the gel or the elution behavior from the column. The appearance of a slower or faster migrating band at a temperature below or above the predicted melting point for a particular extension product on the gel indicates the presence of a mutation or polymorphism in the DNA from one of the subjects. Similarly, the appearance of a slower or faster eluting extension product from the DHPLC column indicates the presence of a mutation or polymorphism in the DNA from one of the subjects. By repeating the analysis with smaller and smaller pools of samples, one can identify the individual (s) in the pool that has the mutation or polymorphism. Additionally, DNA standards can be used, as described above, to facilitate identification of the individual (s) having the

mutation or polymorphism. Advantageously, some embodiments can be used to screen multiple samples at multiple loci that are on found on a plurality of genes in a single assay, thus, increasing sample throughput. The analysis of a plurality of DNA samples in the same assay also unexpectedly provides greater sensitivity. The section below describes a DNA separation technique that can be used with the embodiments described herein.

Multiple extension products of similar composition can be separated on the same lane of a denaturing gel or i7l tl7e same run on a DHPLC column It was discovered that multiple fragments of DNA, which vary slightly in length and/or composition, can be rapidly and efficiently resolved on the basis of melting behavior. Although the preferred methods for differentiating multiple fragments of DNA on the basis of melting behavior involve TTGE gel electrophoresis and DHPLC, it is contemplated that other conventional techniques that are amenable to DNA separation on the basis of melting behavior can be equivalently employed (e. g., size exclusion chromatography, ion exchange chromatography, and reverse phase chromatography on high pressure (e. g., HPLC), low pressure (e. g., FPLC), gravity- flow, or spin-columns, as well as, thin layer chromatography).

By one approach, a polyacrylamide gel having a porosity sufficient to resolve the DNA fragments on the basis of size (e. g., 4-20% acrylamide/bis acrylamide gel having a set concentration of denaturant) is used. The amount of denaturant in the gel (e. g., urea or formamide) can vary according to the length and composition of the DNA to be resolved. The concentration of urea in a polyacrylamide gel, for example, can be 3M, 3. 5M, 4M, 4. 5M, 5M, 5. 5M, 6M, 6. 5M, 7M, 7. 5M, or 8M. In preferred embodiments, an 8% polyacrylamide gel with 7M urea is used. It should be emphasized, however, that other types of polyacrylamide gels, equivalents thereof, and agarose gels can be used.

The DNA samples to be resolved are placed in a non-denaturing buffer and can be loaded directly to the gel. In some embodiments, for example, when heteroduplex formation is desired to increase the sensitivity of the assay, it is desirable to heat the double stranded DNA to a temperature that permits denaturation (e. g., 95°C for 5-10 minutes) and then slowly cool the DNA to a temperature that allows annealing (e. g., ice for 5-10 minutes) prior to mixing with the loading buffer. Preferably, the DNA is loaded onto the gel in a total volume of 10-20p1. Preferably, a Temporal Temperature Gradient Gel Electrophoresis (TTGE) apparatus is used. A commercially available system that is suitable for this technique can be obtained from BioRad. The gel can be run at 120, 130, 140, 150, 175, 200, 220, 250, 275, or 300 V for 1. 5-10 hours, for example.

Once the DNA has been loaded, an electrical current is applied to begin separating the fragments on the bass of size and the temperature of the gel is raised gradually. In one embodiment, for example, the melting behavior separation is performed by raising the temperature beyond 60°C, 61°C, 62°C, 63°C, 64°C, 65°C, 66°C, 67°C, 68°C, 69°C, 70°C, 71°C, 72°C, 73°C, 74°C, or 75°C at approximately 5. 0 C°/hour-0. 5°C/hour in 0. 1°C increments.

Once the extension products have been separated by melting behavior, the gel can be stained to reveal the separated DNA. Many conventional stains are suitable for this purpose including, but not limited to, ethidium bromide stain (e. g., 1% ethidium bromide in a 1. 25X Tris Acetate EDTA pH 8. 0 (TAE) solution), fluorescent stains, silver stains, and colloidal gold stains.

In some embodiments, it is desirable to destain the gel (e. g., 20 minutes in a 1. 25X TAE solution).

After staining, the gel can be analyzed visually (e. g., under a U. V. lamp) and/or with a digital camera and computer software such as, the Eagle Eye System by Stratagene or the Gel Documentation System (BioRad). Additionally, when fluorescent markers are employed, conventional detectors that emit various wavelengths of light can be used so as to identify the presence and position of separated fluorescently labeled extension products.

Mutations or polymorphisms are easily identified by comparing the migration behavior of the DNA to be screened with the migration behavior of a control DNA and/or by monitoring the melting temperature of the extension products generated from the screened DNA. Desirable "control"DNA or"standard"DNA includes a DNA that is wild-type or non-polymorphic for at least one loci that is screened and preferred standard DNA is wild-type or non-polymorphic for all of the loci that are being screened. Because this DNA separation technique is sufficiently sensitive to identify a single base pair substitution in a DNA fragment up to 600 base pairs in length, small changes in the melting behaviors and migration of the extension products can be rapidly identified.

The standard or control DNA can also be fluorescently labeled (preferably with a fluorescent label that is different than the one employed for the screened samples) to facilitate the analysis.

By another approach, DHPLC is used to resolve heteroduplex and homoduplex molecules of several PCR extension products in a single assay. Preferably, the heteroduplex and homoduplex extension products are separated from each other by ion-pair reverse phase high performance liquid chromatography. In one embodiment, a DHPLC column that contains alkylated non-porous poly (styrene-divinylbenzene) is used. Preferably, the DHPLC column is equilibrated in an appropriate degassed buffer, referred to as Buffer"A" (e. g., 0. 1M TEAA pH 7. 0) and is kept at a constant temperature somewhat below the predicted melting temperature of the extension products (e. g., 53°C-60°C, preferably 50°C). A plurality of extension products that may be generated from a plurality of different loci, as described herein, are suspended in Buffer A and are injected onto the DHPLC column. The Buffer A is then allowed to run through the column for a time sufficient to insure that the extension products have adequately bound to the column. Preferably, flow rate and the amount of gas (e. g., argon or helium) are adjusted and kept constant so that the pressure on the column does not exceed the recommended level. Gradually, degassed denaturing buffer, referred to as Buffer"B", (e. g., 0. 1M TEAA pH 7. 0 and 25% acetonitrile) is applied to the column. Although an isocratic gradient can be used, a gradual linear gradient is preferred. By one approach, to separate fragments that range in size from 200-450 bp, for example, a gradient of 50%-65% Buffer B (0. 1M TEAA pH 7. 0 and 25% acetonitrile) is used. Of course, as the size of extension products

to be separated on the DHPLC column decreases, the gradient and/or the amount of denaturant in Buffer B can be reduced, whereas, as the size of extension products to be separated on the DHPLC column increases, the gradient and/or the amount of denaturant in Buffer B can be increased.

The DHPLC column is designed such that double stranded DNA binds well but as the extension products become partially denatured the affinity to the column is reduced until a point is reached at which the particular extension product can no longer adhere to the column matrix.

Typically, heteroduplexes denature before homoduplexes, thus, they would be expected to elute more rapidly from the column than homoduplexes.

In some embodiments, particularly embodiments concerning the separation of a plurality of different extension products (e. g., extension products generated from a plurality of loci), the choice of primers and, thus, the extension products generated therefrom, requires careful design. For example, a GC-clamp or other artificial sequence can be used to adjust the melting characteristics and increase the length of a particular DNA fragment, if needed, to facilitate separation on the DHPLC or improve resolution of the extension products. Additionally, a miniclamp can be used with one or more of the primer sets. A miniclamp comprising a plurality of guanine nucleotides, for example, can stabilize the melting profile of an extension product, making it melt more evenly, thereby facilitating the analysis according to the assays described herein. For example, in TABLE X, CFTR4A-as2 can comprise a miniclamp 12 (a string of 12 guanine nucleotides), CFTR16B-s2 can comprise a miniclamp 8 (a string of 8 guanine nucleotides), CFTR17A-s3 can comprise a miniclamp 9 (a string of 9 guanine nucleotides), and CFTR23B-s3 can comprise a miniclamp 11 (a string of 11 guanine nucleotides). By one approach, each set of primers in a multiplex reaction are designed and selected to generate an extension product that has a unique homoduplex and heteroduplex elution behavior. In this manner, each species can be easily identified. A list of extension products generated by use of the primers of the invention are given in TABLE BB.

By another approach, each set of primers are designed to generate extension products that have homoduplexes with very similar melting characteristics. By this strategy, all of the homoduplexes will elute at the same or very similar concentration of denaturant, which is different than the concentration of denaturant required to elute the heteroduplexes. Accordingly, the elution of a species of extension product outside of the expected range for the homoduplexes indicates the presence of a mutation or polymorphism.

In the case that the extension products happen to have overlapping retention times/elution behaviors, the DHPLC conditions can be adjusted to include a primary separation on the basis of size prior to increasing the concentration of the denaturant on the column to improve resolution.

The techniques described in Huber, et al., Anal. Chem. 67 : 578 (1995), hereby expressly incorporated by reference in its entirety, can be adapted for use with the novel DHPLC separation approach described herein. In one embodiment, for example, the alkylated non-porous poly (styrene-divinylbenzene) DHPLC column can be used to separate the extension products on the

basis of size for a time sufficient to group the various populations of extension products (i. e., the homoduplexes and heteroduplexes generated from a single independent set of primers constitute a single population of extension products) prior to separating on the basis of melting behavior.

By one approach, the extension products are applied to the column, as above, in Buffer A and a shallow linear gradient of Buffer B (e. g., 30%-50% of a solution of 0. 1M TEAA pH 7. 0 and 25% acetonitrile for 200-450 bp extension products) is applied so as to resolve the various populations of extension products. Then, a deeper linear gradient of Buffer B (e. g., 50%-65% of a solution of 0. 1M TEAA pH 7. 0 and 25% acetonitrile for 200-450 bp extension products) is applied to resolve the homoduplexes from the heteroduplexes within each individual population of extension product. In this manner, the homoduplexes and heteroduplexes from each population of extension product can be resolved despite having overlapping elution behaviors.

It should be understood that the, separation based on size can be performed at virtually any temperature as long as the extension products do not denature on the column, however, the amount of denaturant in Buffer B and the type of gradient may have to be adjusted. For example, the size separation can be accomplished at 4°C-23°C, or 23°C-40°C, or 40°-50°C, or 50°C-60°C.

Additionally, the size separation can be accomplished while the column is being gradually equilibrated to the temperature that is going to be used for the DHPLC. It should also be understood that the size separation can be performed on the same column with the appropriate gradient (shallow for a time sufficient to separate on the basis of size followed by a deeper gradient to separate on the basis of melting behavior). Additionally, columns in series can be used to separate extension products that have overlapping retention times/elution behaviors. For example, a first DHPLC column can be used to separate on the basis of size and a second DHPLC column can be used to separate on the basis melting behavior.

Mutations or polymorphisms are easily identified using the DHPLC techniques above by comparing the elution behavior of the DNA to be screened with the elution behavior of a control DNA. As above, desirable"control"DNA or"standard"DNA includes a DNA that is wild-type or non-polymorphic for at least one loci that is screened and preferred standard DNA is wild-type or non-polymorphic for all of the loci that are being screened. Control or standard DNA can also include extension products that are homoduplexes by virtue of a mutation or polymorphism or plurality of mutations or polymorphisms. Since the elution behavior of the wild type or non- polymorphic DNA or a homozygous mutant or polymorphism, represents the elution behavior of a homoduplex, one can use DHPLC values obtained from separating these controls, such as the retention time, elution time, or amount of denaturant required to elute the homoduplex as a basis for comparison to a screened sample to identify the presence of homoduplexes. Similarly, a control DNA can be a known heteroduplex and the elution behavior values described above can be used to identify the presence of a heteroduplex in a screened sample.

Additionally, the separated extension products can be collected after passing through the DHPLC column or TTGE gel or reamplified and sequenced to verify the existence of the mutation or polymorphism. Further, the identified products can be isolated from the gel and sequenced.

Sequencing can be performed using the conventional dideoxy approach (e. g., Sequenase kit) or an automated sequencer. Preferably, all possible mutant fragments are sequenced using the CEQ 2000 automated sequencer from Beclcman/Coulter and the accompanying analysis software. TABLE W lists several sequencing primers and conditions used in the CFTR assay described herein. By using these primers, many of the mutations/polymorphisms provided in TABLES Z and AA were discovered. The mutations or polymorphisms identified by sequencing can be compiled along with the respective melting behaviors and the sizes of extension products. This data can be recorded in a database so as to generate a profile for each loci.

Additionally, this profile information can be recorded with other subject-specific information, for example family or medical history, so as to generate a subject profile. By creating such databases, individual mutations can be better characterized. Mutation analysis hardware and software can also be employed to aid in the identification of mutations or polymorphisms. For example, the"ALFexpress II DNA Analysis System", available from Amersham Pharmacia Biotech and the"Mutation Analyser 1. 01", also available from Amersham Pharmacia Biotech, can be used.

Mutation Analyser automatically detects mutations in sample sequence data, generated by the ALFexpress II DNA analysis instrument. The section below describes embodiments that allow for the identification of a mutation or polymorphism at multiple loci in a plurality of genes in a single assay.

Identification of the presence or absence of a mutation or polylizorphisin at multiple loci in a plurality of genes in a single assay The DNA separation techniques described herein can be used to rapidly identify the presence or absence of a mutation or polymorphism at multiple loci in a plurality of genes in a single assay (e. g., in a single reaction vessel or multiple reaction vessels). Accordingly, a biological sample containing DNA is obtained from a subject and the DNA is isolated by conventional means.

For some applications, it may be desired to screen the RNA of a subject for the presence of a genetic disorder (e. g., a congenital disease that arises through a splicing defect). In this case, a biological sample containing RNA is obtained, the RNA is isolated, and then is converted to cDNA by methods well known to those of skill in the art. DNA from a subject or cDNA synthesized from the mRNA obtained from a subject can be easily and efficiently isolated by various techniques known in the art. Also known in the art is the ability to amplify DNA fragments from whole cells, which can also be used with the embodiments described herein. Thus, the DNA sample for use with the embodiments described herein need only be isolated in the sense that the DNA is in a form that allows for PCR amplification.

In some embodiments, genomic DNA is isolated from a biological sample by using the Amersham Pharmacia Biotech"GenomicPrep Blood DNA Isolation Kit". The isolation procedure involves four steps : (1) cell lysis (cells are lysed using an anionic detergent in the presence of a DNA preservative, which limits the activity of endogenous and exogenous Dnases) ; (2) RNAse treatment (contaminating RNA is removed by treatment with RNase A) ; (3) protein removal (cytoplasmic and nuclear proteins are removed by salt precipitation) ; and (4) DNA precipitation (genomic DNA is isolated by alcohol precipitation). EXAMPLE 1 also describes an approach that was used to isolate DNA from human blood.

Once the sample DNA has been obtained, primers that flank the desired loci to be screened are designed and manufactured. Preferably, optimal primers and optimal primer concentrations are used. Desirably, the concentrations of reagents, as well as, the parameters of the thermal cycling are optimized by performing routine amplifications using control templates. Primers can be made by any conventional DNA synthesizer or are commercially available. Optimal primers desirably reduce non-specific annealing during amplification and also generate extension products that resolve reproducibly on the basis of size or melting behavior and, preferably, both. Preferably, the primers are designed to hybridize to sample DNA at regions that flank loci that can be used to diagnose a trait, such as a congenital disease (e. g., loci that have mutations or polymorphisms that indicate a human disease).

Desirably, the primers are designed to detect loci that diagnose conditions selected from the group consisting of familial hypercholesterolemia (FH), cystic fibrosis, Tay-sachs, thalassemia, sickle cell disease, phenylketonuria, galactosemia, fragile X syndrome, hemophilia A, myotonic dystrophy, medium-chain acyl CoA dehydrogenase, maturity onset diabetes, cystinuria, methylmolonic acidemia, urea cycle disorders, hereditary fructose intolerance, hereditary hemachromatosis, neonatal thrombocytopenia, Gaucher's disease, tyrosinemia, Wilson's disease, alcaptonuria, hypolactasia, Baker's disease, argininemia Adenomatous polyposis coli (APC), Adult Polycystic Kidney disease, a-l-antitrypsin deficiency, Duchenne Muscular Dystrophy, Hemophilia A, Hereditary Nonpolyposis colorectal cancer, Huntingtons disease, Marfans syndrome, Myotonic dystrophy, Neurofibromatosis, Osteogenesis imperfecta, Retinoblastoma, Sickle cell disease, Freidrichs ataxia, Hemoglobinopathies, Leber's hereditary optic neuropathy, MCAD, Canavan's disease, Retintitus Pigmentosa, Bloom Syndrome, Fanconi anemia, and Neimann Pick disease.

Preferably, the primers are designed to detect the presence or absence of polymorphisms or mutations associated with cystic fibrosis. Primers can be designed to amplify any region of DNA, however, including those regions known to be associated with diseases such as alcohol dependence, obesity, and cancer. It should be understood that the embodiments described herein can be used to detect any gene, mutation, or polymorphism found in plants, virus, molds, yeast, bacteria, and animals.

Preferred primers are designed and manufactured to have a GC rich"clamp"at one end of a primer, which allows the dsDNA to denature in a"zipper-like"fashion. As one of skill will appreciate, PCR requires a"primer set", which includes a first and a second primer, only one of which has the GC clamp so as to allow for separation of the double stranded molecule from one end only. Since the GC clamp is significantly stable, the rest of the fragment melts but does not completely separate until a point after the inflection point of the DNA, which contains the mutation or polymorphism of interest. The denaturant in the gel or on the column allows the temperature of melting to be lower and allows the inflection point of the melt to be longer in terms of temperature and, thus, the sensitivity to temperature at the inflection point is less (i. e., increment temperature = less increment melting), which increases the resolution.

Additionally, desirable primers are designed with a properly placed GC-clamp so that extension products that contain a single melting domain are produced. Further, miniclamps can be used on one or both of the primer sets to improve the melting behavior for the purposes of the assay. Preferably, the primers are selected to complement regions of introns that flank exons containing the genetic markers of interest so that polymorphisms or mutations that reside within the early portions of exons are not masked by the GC clamp. For example, it was discovered that GC clamps significantly perturb melting behavior and can prevent the detection of a polymorphism or mutation by melting behavior if the mutation or polymorphism resides too close to the GC clamp (e. g., within 40 nucleotides). By performing amplification reactions with control templates, optimal primer design and optimal concentration can be determined. The use of computer software, including, but not limited to, WinMelt or MacMelt (Bio-Rad) and Primer Premire 5. 0 can aid in the creation and optimization of primers and proper positioning of the GC-clamp. Accordingly, many of the primers and groupings of primers described herein, as used in a particular assay (e. g., to screen for cystic fibrosis) are embodiments of the invention. EXAMPLE 2 further describes the design and optimization of primers that allowed for the high-throughput multiplex PCR technique described herein.

Once optimal primers are designed and selected, the DNA sample is screened using the inventive multiplex PCR technique. In some embodiments, for example, approximately 25ng- 500ng of template DNA (preferably, 200ng for human genomic DNA) is suspended in a buffer comprising : lOmM Tris (pH 8. 4), 50mM KC1, 1. 5mM MgCIZ, 200uM dNTPs, 50pmol of each primer, and 1 unit Taq polymerase per primer set in a total volume of 50gel. Preferably, amplification is performed under the same conditions that were used to design the primers. In some embodiments, for example, amplification is performed on a conventional thermal cycler for 30 cycles, wherein each cycle is : 1 minute @ 95°C, 58°C for 1 minute, 72°C for 1 minute. Final extension is performed at 72°C for 5 minutes. When the primers have a GC clamp, it was found that conditions often favor an amplification reaction having over 40 cycles, wherein each cycle is : 35 seconds @ 95°C, 120 seconds @ 50-57°C, and 60 seconds + 3 seconds/cycle @ 72°C. Thermal

cyclers are available from a number of scientific suppliers and most are suitable for the embodiments described herein.

Once the PCR reaction is complete, the extension products are desirably isolated by centrifugal microfiltration using a standard PCR cleanup cartridge, for example, Qiagen's QIAquick 96 PCR Purification Kit, according to manufacture's instructions. Isolation or purification of the extension products is not necessary to practice the invention, however. The isolated extension products can then be suspended in a non-denaturing loading buffer and either loaded directly on a DHPLC column or TTGE denaturing gel. The sample can also be denatured by heating (e. g., 95°C for 5-10 minutes) and annealed by cooling (e. g., ice for 5-10 minutes) prior to loading onto the DHPLC column or TTGE denaturing gel. The various extension products are then separated on a TTGE denaturing gel or DHPLC column on the basis of melting behavior, as described above and, after separation, the extension products can be analyzed for the presence or absence of polymorphisms or mutations. EXAMPLES 3 and 4 describe experiments that verified that multiple loci on a plurality of genes can be screened in a single assay. The section below describes a method of genetic analysis, wherein improved sensitivity of detection was obtained by adding a DNA standard to the screened DNA.

Improved sensitivity was obtained when a DNA standard was mixed with the screened DNA It was also discovered that greater sensitivity in the inventive multiplex PCR reactions described herein can be obtained by mixing a DNA standard with the DNA to be tested prior to conducting amplification or after amplification but prior to separation on the basis of melting behavior. Desired DNA standards include, but are not limited to, DNA that is wild-type for at least one of the traits that are being screened and preferred DNA standards include, but are not limited to, DNA that is wild-type for all of the traits that are being screened. DNA standards can also be mutant or polymorphic DNA. In some embodiments, particularly when the control DNA is added after amplification, the DNA standard is an extension product generated from a wild-type genomic DNA or a mutant genomic DNA. Optionally, the control DNA can be labeled with a fluorescent label, which can be a label that is different than the fluorescent label used to label the extension products generated from the screened sample DNA. In this manner, the standard or control DNA is easily differentiated from the DNA that is being screened.

By one approach, the DNA from the subject to be screened and the DNA standard are pooled and then the amplification reaction, as described above, is performed. Accordingly, optimal primers are designed and selected and approximately 25ng-500ng of template DNA (preferably, 200ng for human genomic DNA) is suspended in a buffer comprising : lOmM Tris (pH 8. 4), 50mM KC1, 1. 5mM MgCl2, 2001lM dNTPs, 50pmol of each primer, and 1 unit Taq polymerase per primer set in a total volume of 50, ul. Preferably, amplification is performed under the same conditions that were used to design the primers. In some embodiments, amplification is performed on a conventional thermal cycler for 30 cycles, wherein each cycle is : 1 minute @ 95°C, 58°C for 1

minute, 72°C for 1 minute. Final extension is performed at 72°C for 5 minutes. When the primers have a GC clamp, however, conditions often favor an amplification reaction having over 40 cycles, wherein each cycle is : 35 seconds @ 95°C, 120 seconds @ 50-57°C, and 60 seconds + 3 seconds/cycle @ 72°C.

If the subject being tested has at least one disorder that is detected by the assay then two populations of extension products are generated, a first population that corresponds to the standard DNA and a second population that corresponds to the subject's DNA having at least one mutation or polymorphism. The pool of extension products are desirably isolated from the amplification reactants, as above, and are suspended in a non-denaturing loading buffer. Preferably, the extension products are then denatured by heat (e. g., 95°C for 5 minutes), and are allowed to anneal by cooling (e. g., ice for 5 minutes) prior to loading on the TTGE denaturing gel or DHPLC column. In this manner, the formation of heteroduplexes will be favored if the subject has a mutation or polymorphism because the two populations of extension products are not perfectly complementary.

However, the isolation and denaturing/annealing steps are not necessary for some embodiments.

By another approach, the DNA standard is added to the extension products generated from the tested subject's DNA after the amplification reaction. As above, the pooled DNA sample is preferably denatured by heat (e. g., 95°C for 5 minutes), and allowed to anneal by cooling (e. g., ice for 5 minutes). This second approach also produces heteroduplexes if the extension product and the DNA standard are not perfectly complementary.

Next, the TTGE denaturing gel or DHPLC column is loaded and the extension products are separated on the basis of melting behavior, as described above. Since heteroduplexes are less stable than homoduplexes and have a lower melting temperature, the presence or absence of a mutation or polymorphism in the tested DNA sample is easily determined. By comparing the migration behavior or elution behavior of the extension products generated from the screened DNA with the migration behavior of the DNA standard, a user can rapidly determine the presence or absence of a mutation or polymorphism (e. g., two additional bands that correspond to the single extension product will appear on the gel when a mutation or polymorphism is present in the tested DNA or a population of extension products will elute from the DHPLC column earlier than homoduplex controls or the majority of homoduplexes present in the sample). The section below describes a method of genetic analysis, wherein improved efficiency and sensitivity of detection was obtained by screening multiple DNA samples in the same assay.

Improved sensitivity was obtained when multiple DNA samples were screened in the sanze assay It was also discovered that an improved sensitivity of detection and increased throughput could be obtained by mixing DNA from a plurality of subjects prior to amplification. Because the frequency of mutations or polymorphisms for most disorders are very low in the population, most of the extension products generated correspond to wild-type or non-polymorphic DNA.

Accordingly, most of the DNA in a reaction comprising DNA from a plurality of subjects behave similar to a DNA standard. That is, the predominant structure formed upon annealing after denaturation is a homoduplex, which can be rapidly distinguished from any heteroduplex that would appear if a subject were to have a mutation or polymorphism. Although the reaction is "dirty"from the perspective that the identity of each subject's DNA is not known initially, the identity of any polymorphic or mutant DNA can be determined through a process of elimination.

For example, by repeating the analysis with smaller and smaller pools of samples, one can identify the individual (s) in the pool that have the mutation or polymorphism. Additionally, DNA standards can be used, as described above, to facilitate identification of the individual (s) having the mutation or polymorphism. Optionally, the each DNA can be labeled with a different fluorescent label so that identification of the variant is easily determined.

By one approach, DNA from a plurality of subjects to be tested is obtained by conventional methods, pooled, and hybridized with the desired nucleic acid primers. Accordingly, optimal primers are designed and selected and approximately 25ng-500ng of template DNA (preferably, 200ng for human genomic DNA) is suspended in a buffer comprising : 10rnM Tris (pH 8. 4), 50rnM KC1, 1. 5mM MgClz, 200uM dNTPs, 50pmol of each primer, and 1 unit Taq polymerase per primer set in a total volume of 501l1. Preferably, amplification is performed under the same conditions that were used to design the primers. In some embodiments, amplification is performed on a conventional thermal cycler for 30 cycles, wherein each cycle is : 1 minute @ 95°C, 58°C for 1 minute, 72°C for 1 minute. Final extension is performed at 72°C for 5 minutes. When the primers have a GC clamp, however, conditions often favor an amplification reaction having over 40 cycles, wherein each cycle is : 35 seconds @ 95°C, 120 seconds @ 50-57°C, and 60 seconds + 3 seconds/cycle @ 72°C.

The pool of extension products are preferably isolated from the amplification reactants, as above, and are suspended in a non-denaturing loading buffer. Preferably, the extension products are then denatured by heat (e. g., 95°C for 5 minutes), and are allowed to anneal by cooling (e. g., ice for 5 minutes). In this manner, the formation of heteroduplexes will be favored if the subject has a mutation or polymorphism because the two types of extension products are not perfectly complementary. Again, the isolation and denaturing/annealing steps are not performed in some embodiments and fluorescent labels can be employed.

Next, the TTGE denaturing gel or DHPLC column is loaded and the extension products are separated on the basis of melting behavior, as described above. When one of the subjects being tested has at least one trait that is detected by the screen, heteroduplexes are detected on the gel or eluting from the DHPLC column. The assay can be then repeated with smaller pools of samples and assays with a DNA standard can be conducted with individual samples to confirm the identity of the subject having the mutation or polymorphism. EXAMPLE 5 describes an experiment that verified that an improved sensitivity can be obtained by mixing a plurality of DNA samples.

EXAMPLE 6 describes an experiment that verified that multiple genes and multiple loci therein can be screened in a plurality of subjects, in a single assay. EXAMPLE 7 describes the screening of multiple genes and multiple loci therein, in a plurality of subjects, in a single assay using a DHPLC approach. The section below describes the optimization of primer design in the context of an approach that was used to detect mutations and/or polymorphisms in the CFTR gene.

Optitizizatioiz of primer design and extension product design facilitates identification of genetic markers associated with cysticfibrosis A preferred embodiment concerns the identification of the presence or absence of genetic markers, mutations, or polymorphisms in one or more subjects that are associated with cystic fibrosis. By one approach, almost the entire CFTR gene was scanned for the presence or absence of genetic markers, mutations, or polymorphisms that contribute to cystic fibrosis. (See EXAMPLE 8). TABLE A provides the sequences of exons of the CFTR gene and several oligonucleotide primers that have been used to screen regions of the CFTR gene for the presence or absence of genetic markers, polymorphisms, and mutations that are associated with cystic fibrosis. Where indicated, the notation (GC) refers to a GC clamp. TABLE B also lists many oligonucleotide primers that have been used to screen regions of the CFTR gene for the presence or absence of genetic markers, polymorphisms, and mutations that are associated with cystic fibrosis. TABLE B also shows starting and ending point for each primer as it relates to the publicly available gene sequence for the CFTR gene (GenBank Accession No. AH006034, the contents of which are expressly incorporated by reference in its entirety, also provided in SEQ. ID No. 45). The positions on the table do not account for GC clamps or miniclamps. TABLE X also lists more primers that can be used in the assays described herein. It is contemplated that primers that are any number between 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides upstream or down stream of the primers identified in TABLE A, B, or X can be used with embodiments of the invention so long as these primers produce extension products that melt over long stretches of DNA (approximately 25, 50, 75, 100, 125, or 150 nucleotides) at approximately the same temperature (within 0°C-1. 5°C) and are resolvable on a TTGE gel or DHPLC column. TABLE B and TABLE X further provide the nucleotide positions on the CFTR gene (GenBank Accession No. AH006034) that are 50 nucleotides upstream or down stream of the listed oligonucleotides. The positions on the tables do not account for GC clamps or miniclamps.

In some embodiments, the primers CF9T-s : (5'TAATGGATCATGGGCCATGT 3 (SEQ.

ID. NO. 46)) and CF9T-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAAGAGACATG GACACCAAAT 3' (SEQ. ED. NO. 47)) are also used.

The sequence of the CFTR gene sequence can also be obtained from GenBank entries AC000061 or AC000111, all of which are herein expressly incorporated by reference in their entireties. Accordingly, embodiments include methods of analyzing the cystic fibrosis gene for the

presence or absence of a mutation/polymorphisms whereby primers that are any number from 1-75 nucleotides upstream or down stream from the beginning or ending of the primers listed in TABLE A, B, or TABLE X are used. It is also preferred that said methods use primers that produce extension products that melt over long stretches of DNA (approximately 25, 50, 75, 100, 125, or 150 nucleotides) at approximately the same temperature (within 0°C-1. 5°C) and are resolvable on a TTGE gel or DHPLC column. Preferably, these extension products are obtained, grouped, and separated as described below.

By one approach, samples of DNA were obtained from several subjects to be screened using the approaches described herein and were disposed in a plurality of 96-well micro-titer plates such that a single row of each plate corresponded to a single tested subject. In some cases, 7 total plates were used per assay, wherein each plate has 7 sample lanes (i. e., 7 subjects analyzed) and an eighth lane was used for positive control sample DNA. Amplification buffer, amplification enzyme (e. g., Taq polymerase), and DNTPs were added to the sample DNA in each well, as described above, and a plurality of primer sets that encompass the most of the gene (e. g., 61 primer sets) were to yield a final volume of logo. The primer sets that were employed in a first set of tests are identified in TABLE A. TABLE C describes the plate setup for these amplification reactions, whereas TABLE D describes the conditions for the TTGE separation for these tests, whereas TABLE E describes the groupings for the various fragments for TTGE separation. Preferred methods of analyzing the cystic fibrosis gene employ the primers of TABLE A to generate extension products that are grouped according to TABLE E and separated by melting behavior (e. g., TTGE). By using this approach, a rapid, inexpensive, and efficient determination of the presence or absence of a marker associated with cystic fibrosis can be ascertained. The names of the extension products,"fragments"in TABLE C, TABLE D, and TABLE E correspond to the names of the primer sets used throughout. The"position"refers to the location of the well on the 96 well plate and the"Multi G"refers to the grouping pool of the extension products prior to TTGE.

Although multiplex PCR reactions can be employed, preferably, each primer set is run in an individual reaction. Conditions for PCR were, in one case for example : 5 minutes at 96°C for initial denaturing followed by 35 total cycles of : 30 seconds at 94°C and 30 seconds at the annealing temperature or at a gradient of 49°C to 63°C and a final 10 minutes at 72°C to complete synthesis of any partial products. Most preferred are primers that have an annealing temperature between 49°C and 63°C, though many of the primer sets have annealing temperatures that are at 49°C, 52°C, 59°C, and 62. 4°C. An approximately 3°C window is allowed for each plate (e. g., primers having annealing temperatures that are within 3°C of one another are grouped on a single plate). Programs such as WINMELT were used to determine whether the primers could be grouped into various primer sets that have similar annealing temperatures so that individual groups of primers can be amplified by Polymerase Chain Reaction (PCR) on the same plate.

Once the extension products had been generated they were grouped, pooled, and mixed with loading dye. Thirteen Multi G groups were used and the extension products"fragments" generated by the various primer sets, which belong to one of the thirteen groups are identified in TABLE C and TABLE E. After grouping and pooling, the samples were loaded onto a TTGE gel.

TABLE C also lists the start and stop temperatures for the TTGE, for each Multi G group. Again, the positions on the table do not account for GC clamps or miniclamps. Preferably, the TTGE is run with a very shallow temperature gradient, e. g., about 1. 0°C/hour for a total of three hours, at high voltage, e. g., 150 volts. Once the separation was complete, the gels were grouped, stained with ethidum bromide, and analyzed by the Decode system. The analysis above was rapid, inexpensive, and very effective at detecting mutations and/or polymorphisms, many of which go undetected or are not analyzed by others in the field.

Whereas many in the field seek to design primers that optimally anneal with a template DNA, it has been discovered that primers can also be designed to produce an optimal extension product (e. g., a fragment of short length with a reliable and rapid melting point). Preferably, primers are designed to generate extension products that are approximately 100-300 nucleotides in length and that have long stretches of DNA that melt at approximately the same temperature (e. g., DNA stretches that are 25, 35, 45, 55, 65, 75, 85, 95, 100, 125, 15, 175, or 200 nucleotides that melt at the same temperature or within about a 0°C to about a 1. 5°C temperature difference). Programs such as WINMELT were used to evaluate the melting behavior of extension products generated from the various primer sets and test TTGE separation of the extension products generated by the various primer sets were also performed to ensure that the predicted melting behavior was represented on the gel. FIGURES 1-4 show graphs of four extension products produced by two of the primer sets, described herein. The flat melting curve is preferred for the applications described herein because the extension products melt rapidly and are quickly retarded in the gel, which improves resolution and allows multiple different extension products to be separated in the same lane on a TTGE gel. That is, by grouping extension products that have flat melting profiles, which are within approximately 1. 5°C of one another, it allows a shallow TTGE temperature ramp (e. g., 1°C change per hour for 3 hours) or shallow DHPLC temperature ramp, which increases the sensitivity, allowing multiple extension products to be separated in the same lane, which increases throughput and reduces the cost of the analysis.

TABLES E and BB show characteristics and sequences of extension products generated by the primers described herein. Additionally, in some cases, the PCR annealing temperature for the primer set used to generate the extension product ("PCR temp.") and a subjective rating of performance is also provided. The approximate melting temperature ("App Tm") of the extension product and its length with and without the GC clamp is provided. A range for the predicted annealing temperature for the PCR and the range for the actual annealing temperature for PCR is provided. The TTGE melting temperature range is also given. Further, the Multi G group is also

listed. The following examples describe the foregoing methodologies in greater detail. The first example describes an approach that was used to isolate DNA from human blood.

As stated above, the primers provided in TABLE X can be used to identify mutations/polymorphisms on the CF gene and/or diagnose or determine the predilection for CF in a tested subject. It is contemplated that primers that are any number between 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleotides upstream or down stream of the primers identified in TABLE X can be used. (See Example 9). Some of these primers may contain miniclamps. The extension products obtained from the amplification reactions employing these primers are grouped and separated according to the parameters set forth in TABLE Y. In this manner, the presence or absence of a mutation/polymorphism on the CF gene is rapidly identified and the predilection for a symptom or condition related to CF or a CF disease state can be readily determined. Accordingly, the primers listed in TABLE X, the extension products made therefrom (e. g. TABLE BB), the groupings of extension products set forth in TABLE Y, and methods of using the primers in TABLE X to generate extension products that are grouped and separated according to the parameters set forth in TABLE Y are embodiments of the invention. The next section describes several of the nucleic acid and peptide embodiments of the invention.

Mutations/poly7norphis7ns on tl1e cystic fibrosis gene Several novel mutations/polymorphisms on the CF gene were discovered using the techniques described herein. (See TABLES Z and AA). Accordingly, nucleic acids containing one or more of the mutations/polymorphisms and peptides or proteins encoded by said nucleic acids, provided that the mutations/polymorphisms result in an amino acid change, are embodiments of the invention.

Some embodiments comprise nucleic acids that are at least six nucleotides in length and contain one or more of the mutations/polymorphisms found in TABLES Z or AA. Preferably, the nucleic acid embodiments comprise at least 12, 15, or 17 consecutive nucleotides from the CF gene and include one or more of the mutations/polymorphisms found in TABLES Z or AA. More preferably, the nucleic acid embodiments comprise at least 20-30 consecutive nucleotides from the CF gene and contain one or more of the mutations/polymorphisms found in TABLES Z or AA. In some cases, the nucleic acid embodiments comprise more than 30 nucleotides from the CF gene and contain one or more of the mutations/polymorphisms found in TABLES Z or AA. In other cases, the nucleic acid embodiments comprise at least 40, at least 50, at least 75, at least 100, at least 150, or at least 200 consecutive nucleotides from the CF gene and contain one or more of the mutations/polymorphisms found in TABLES Z or AA. That is, nucleic acid embodiments of the invention can comprise 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500,

600, 700, 800, 900, 1000 or more consecutive nucleotides of the CFTR gene including one or more of the mutations/polymorphisms identified in TABLES Z or AA.

Some embodiments comprise recombinant nucleic acids having a portion of the CF gene and one or more of the mutations/polymorphisms found in TABLES Z or AA (e. g., constructs, vectors containing a promoter operably linked to said CF gene containing said one or more of the mutations/polymorphisms found in TABLES Z or AA, and expression constructs). A recombinant construct can be capable of replicating autonomously in a host cell. Alternatively, the recombinant construct can become integrated into the chromosomal DNA of the host cell. Such a recombinant polynucleotide comprises a polynucleotide of genomic or cDNA, of semi-synthetic or synthetic origin by virtue of human manipulation. Therefore, recombinant nucleic acids comprising sequences otherwise not naturally occurring are provided by embodiments of this invention.

Although one or more of the mutations/polymorphisms found in TABLES Z or AA, as it appears in nature can be employed, it will often be altered, e. g., by deletion, substitution, or insertion and will be accompanied by sequence not present in a human. Probes can be designed and manufactured by oligonucleotide synthesis and cDNA or genomic libraries can be screened so as to isolate natural sources of the nucleic acid embodiments and homologs thereof. Alternatively, such nucleic acids can be provided by amplification of sequences resident in genomic DNA or other natural sources by PCR.

The nucleic acids of the present invention can also be used as reagents in isolation procedures and diagnostic assays. For example, sequences from nucleic acids containing one or more of the mutations/polymorphisms found in TABLES Z or AA can be detectably labeled and used as probes to isolate other sequences capable of hybridizing to them. In addition, sequences containing one or more of the mutations/polymorphisms found in TABLES Z or AA can be used to make PCR primers by conventional oligonucleotide synthesis for use in isolation and diagnostic procedures, as described herein. Additionally, nucleic acids containing one or more of the mutations/polymorphisms found in TABLES Z or AA can be present in a cell line (e. g., to study the effect on the transporter).

More embodiments concern the isolated or purified peptides or proteins containing an amino acid encoded by one or more of the mutations/polymorphisms found in TABLES Z or AA, preferably a peptide or protein containing an amino acid change as a result of said mutation/polymorphism. The term"isolated"requires that the material be removed from its original environment (e. g., the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid or protein present in a living cell is not isolated, but the same nucleic acid or protein, separated from some or all of the coexisting materials in the natural system, is isolated. The term"purified"does not require absolute purity ; rather it is intended as a relative definition. For example, recombinant nucleic acids and proteins are routinely purified to electrophoretic homogeneity, as detected by ethidum bromide staining or Coomassie staining, and are suitable in several assays despite having the presence of contaminants.

Several approaches to synthesize, express, and isolate or purify the peptide embodiments described herein can be employed. By one approach, nucleic acids containing the coding sequence for the CF protein or portions thereof and one or more of the mutations/polymorphisms found in TABLES Z or AA are obtained and cloned into a suitable expression vector such that the coding region is operably linked to a heterologous promoter. The nucleic acid can, for example, contain one or more of the mutations/polymorphisms found in TABLES Z or AA and encode a polypeptide comprising at least 3, 5, 7, 10, 15, 25, 60, 75, or 100 or more consecutive amino acids of the CF protein. That is, the peptide embodiments can comprise 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, or more consecutive amino acids of the CFTR protein including one or more of the polymorphisms described in TABLES Z or AA. The nucleic acid encoding the protein or polypeptide to be expressed is operably linked to a promoter in an expression vector using conventional cloning technology. The expression vector can be any of the mammalian, yeast, insect, parasite, or bacterial expression systems known in the art. Commercially available vectors and expression systems are available from a variety of suppliers including Genetics Institute (Cambridge, MA), Stratagene (La Jolla, California), Promega (Madison, Wisconsin), and Invitrogen (San Diego, California). If desired, to enhance expression and facilitate proper protein folding, the codon context and codon pairing of the sequence can be optimized for the particular expression organism in which the expression vector is introduced, as explained by Hatfield, et al., U. S.

Patent No. 5, 082, 767, incorporated herein by this reference. Further, a secretory leader sequence can be incorporated so as to facilitate purification of the peptide.

For example, the CF gene, or portion thereof containing one or more of the mutations/polymorphisms in TABLES Z or AA can be cloned into the pED6dpc2 vector using conventional techniques. The resulting pED6dpc2 constructs can be transfected into a host cell, such as COS 1 cells. Methotrexate resistant cells are selected and expanded. Preferably, the protein expressed from the extended cDNA is released into the culture medium thereby facilitating purification.

Another embodiment contemplated by the present inventors utilizes the"Xpress system for expression and purification" (Invitrogen, San Diego, CA). The Xpress system is designed for high- level production and purification of recombinant proteins from bacterial, mammalian, and insect cells.

The Xpress vectors produce recombinant proteins fused to a short N-terminal leader peptide which has a high affinity for divalent cations. Using a nickel-chelating resin (Invitrogen), the recombinant protein can be purified in one step and the leader can be subsequently removed by cleavage with enterokinase.

Another vector for the expression of a peptide encoded by a nucleic acid containing one or more of the mutations/polymorphisms found in TABLES Z or AA, is the pBlueBacHis2 Xpress.

The pBlueBacHis2 Xpress vector is a Baculovirus expression vector containing a multiple cloning site, an ampicillin resistance gene, and a lac z gene. By one approach, the nucleic acid, containing one or more of the mutations/polymorphisms found in TABLES Z or AA is cloned into the pBlueBacHis2 Xpress vector and SF9 cells are infected. The expression protein is then isolated and purified according to the maufacturer's instructions. If desired, the proteins can be ammonium sulfate precipitated or separated based on size or charge prior to electrophoresis. The protein encoded by the CF gene that contains one or more of the mutations/polymorphisms found in TABLES Z or AA, or portion thereof can also be purified using standard immunochromatography techniques. In such procedures, a solution containing the protein, such as the culture medium or a cell extract, is applied to a column having antibodies against the secreted protein attached to the chromatography matrix. The secreted protein is allowed to bind the immunochromatography column. Thereafter, the column is washed to remove non-specifically bound proteins. The specifically bound secreted protein is then released from the column and recovered using standard techniques.

If antibody production is undesirable, the nucleic acid containing one or more of the mutations/polymorphisms found in TABLES Z or AA or portion thereof can be incorporated into expression vectors designed for use in purification schemes employing chimeric polypeptides. In such strategies the coding sequence of the CF nucleic acid containing the one or more of the mutations/polymorphisms found in TABLES Z or AA is inserted in frame with the gene encoding the other half of the chimera. The other half of the chimera can be (3-globin or a nickel binding polypeptide encoding sequence. A chromatography matrix having antibody to P-globin or nickel attached thereto is then used to purify the chimeric protein. Protease cleavage sites can be engineered between the P-globin gene or the nickel binding polypeptide and the CF nucleic acid such as enterokinase. Thus, the two polypeptides of the chimera can be separated from one another by protease digestion.

One useful expression vector for generating p-globin chimerics is pSG5 (Stratagene), which encodes rabbit (3-globin. Intron II of the rabbit p-globin gene facilitates splicing of the expressed transcript, and the polyadenylation signal incorporated into the construct increases the level of expression. These techniques as described are well known to those skilled in the art of molecular biology. Standard methods are published in methods texts such as Davis et al., (Basic Methods in Molecular Biology. L. G. Davis, M. D. Dibner, and J. F. Battey, ed., Elsevier Press, NY, 1986) and many of the methods are available from Stratagene, Life Technologies, Inc., or Promega. Polypeptide can additionally be produced from the construct using in vitro translation systems such as the In vitro Express Translation Kit (Stratagene).

In addition to preparing and purifying the peptides described herein using recombinant DNA techniques, approaches in chemical synthesis (such as solid phase peptide synthesis) can also be used. (See Merrifield et al., J. Am. Chem. Soc. 85 : 2149 (1964), Houghten et al., Proc. Natl.

Acad. Sci. USA, 82 : 51 : 32 (1985), and Stewart and Young (solid phase peptide synthesis, Pierce

Chem Co., Rockford, IL (1984)). Such polypeptides can be synthesized with or without a methionine on the amino terminus.

Following synthesis or expression and purification of the proteins encoded by the nucleic acids containing one or more of the mutations/polymorphisms found in TABLES Z or AA, the purified proteins can be used to generate antibodies. While antibodies capable of specifically recognizing the protein of interest can be generated using synthetic 15-mer peptides by injecting the synthetic peptides into mice to generate antibody, a more diverse set of antibodies can be generated using recombinant or purified protein or fragments thereof.

By one approach, substantially pure protein or polypeptide is isolated from a transfected or transformed cell. The concentration of protein in the final preparation is adjusted, for example, by concentration on an Amicon filter device, to the level of a few micrograms/ml. Monoclonal or polyclonal antibody to the protein can then be prepared as follows : Monoclonal antibody to epitopes of any of the peptides identified and isolated as described can be prepared from murine hybridomas according to the classical method of Kohler, G. and Milstein, C., Nature 256 : 495 (1975) or derivative methods thereof. Briefly, a mouse is repetitively inoculated with a few micrograms of the selected protein or peptides derived therefrom over a period of a few weeks.

The mouse is then sacrificed, and the antibody producing cells of the spleen isolated. The spleen cells are fused in the presence of polyethylene glycol with mouse myeloma cells, and the excess unfused cells destroyed by growth of the system on selective media comprising aminopterin (HAT media). The successfully fused cells are diluted and aliquots of the dilution placed in wells of a microtiter plate where growth of the culture is continued. Antibody-producing clones are identified by detection of antibody in the supernatant fluid of the wells by immunoassay procedures, such as ELISA, as originally described by Engvall, E., Meth. En2yMtol. 70 : 419 (1980), and derivative methods thereof.

Selected positive clones can be expanded and their monoclonal antibody product harvested for use.

Detailed procedures for monoclonal antibody production are described in Davis, L. et al. Basic Methods in Molecular Biology Elsevier, New York. Section 21-2.

Polyclonal antiserum containing antibodies to heterogenous epitopes of a single protein can be prepared by immunizing suitable animals with the expressed protein or peptides derived therefrom described above, which can be unmodified or modified to enhance immunogenicity. Effective polyclonal antibody production is affected by many factors related both to the antigen and the host species. For example, small molecules tend to be less immunogenic than others and can require the use of carriers and adjuvant. Also, host animals vary in response to site of inoculations and dose, with both inadequate or excessive doses of antigen resulting in low titer antisera. Small doses (ng level) of antigen administered at multiple intradermal sites appears to be most reliable. An effective immunization protocol for rabbits can be found in Vaitukaitis, J. et al. J : Clin. Endocrinol. Metab.

33 : 988-991 (1971).

Booster injections can be given at regular intervals, and antiserum harvested when antibody titer thereof, as determined semi-quantitatively, for example, by double immunodiffusion in agar against known concentrations of the antigen, begins to fall. See, for example, Ouchterlony, O. et al., Chap. 19 in : Handbook of Experimental Immunology D. Wier (ed) Blackwell (1973). Plateau concentration of antibody is usually in the range of 0. 1 to 0. 2 mg/ml of serum (about 12 uM). Affinity of the antisera for the antigen is determined by preparing competitive binding curves, as described, for example, by Fisher, D., Chap. 42 in : Manual of Clinical Immunolosv. 2d Ed. (Rose and Friedman, Eds.) Amer. Soc. For Microbiol., Washington, D. C. (1980). These antibodies can be used to differentiate peptides containing one or more of the mutations/polymorphisms found in TABLES Z or AA from wild-type CF peptides.

Additionally, the peptides and nucleic acids containing one or more of the mutations/polymorphisms found in TABLES Z or AA can be used in various high throughput screening approaches to identify drugs that interact with these targets. Generally, high throughput drug discovery searches for a protein, peptide, peptidomimetic, or chemical that will interact on a defined target such as the CF protein, or a polypeptide fragment thereof containing one or more of the mutations/polymorphisms found in TABLES Z or AA. By one approach, a library of proteins, polypeptides, peptides, peptidomimetics, or chemicals, collectively referred to as"agents", is screened against the target in biological assays and agents which interact with the target are identified and used directly as therapeutics or as a basis to develop new therapeutics using combinatorial chemistry and protein modeling.

For example, one approach to high throughput drug discovery involves the analysis of the physical flow of conducting ions through an ion channel of interest in the presence and absence of an agent. For one pico amp of ionic current, roughly 106 ions \s pass can through an ion channel.

By utilizing the property of monovalent thallium (T (IF)) ions to crystallize at very low concentration with halide ions, such as Br, functional ion channels can be labeled. Operationally, once thallium ions are applied to one side of the membrane, they will pass through the channel pores, create a local increase in thallium concentration, and eventually crystallize with Br ions that are present on the other side of the membrane. The crystals grow to a visible size and thus mark the location of ion channels on the membrane (see, e. g., Lopatin et al., Biophysical Journal 74 : 2159- 2170 (1998)).

In one aspect of the invention, a first group of xenopus oocytes (experimental) are injected with roughly 5 ng of CF cRNA containing one or more of the mutations/polymorphisms found in TABLES Z or AA into the animal (dark) hemisphere (pole) and a measurement of oocyte current and membrane potential are recorded so as to provide a baseline value. As a control, the current and membrane potential of a second group xenopus oocytes that have been injected with roughly 5 ng of wild-type CF cRNA is measured. The two groups of ooctyes are then injected with roughly 50 nl of 30 mM KBr, so as to bring the intracellular concentration of KBr to roughly 3 mM, and

voltage-clamped with a 2-microelectrode voltage clamp in a thallium-containing solution. 40 x 410 ms linear voltage ramps from-80 mV to +50 mV are then applied at a frequency of 0. 75 Hz to drive the inward flow of thallium ions and the ionic currents are recorded. The two groups of oocytes are then photographed. Multiple white crystals will be visible by light microscope on the animal hemisphere if the control or experimental oocytes allow for ion transport. By comparing the relative abilities of the two groups of oocytes to crystalize thalium, one of skill in the art can easily determine the extent to which the particular CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA functions as an ion transporter.

Additionally, the crystalization assay described above can be performed in a multi-well format and libraries of agents, such as peptides, peptidomimetics, and chemicals can be screened for their ability to interfere with the level of ion transport potentiated by the particular CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA. In this manner, agents can be rapidly screened for their ability to interact with the particular CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA and thereby modulate ion transport.

In an alternative method, liposomes having the wild-type CF protein (control) or a CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA (experimental) are loaded with bromine ions (or). Subsequently, the two groups of liposomes are contacted with thallium ions and electrical current is applied. The local increase in thallium concentration inside the liposome is detected by microscopic observation of crystals which form at the location of the ion channels. By comparing the relative abilities of the two groups of liposomes to crystalize thalium, one of skill in the art can easily determine the extent to which the particular CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA performs as an ion transporter. Additionally, the crystalization assay described above can be performed in a multi-well format and libraries of agents, such as peptides, peptidomimetics, and chemicals can be screened for their ability to modulate the ion transport.

To directly measure ion transport, an agarose-hemi-clamp technique based on the capacity of agarose to electrically conduct ions as well as free solution while obviating the bulk flow of ions is used. (See, e. g., Lopatin et al.) By this approach, oocytes expressing the wild-type CF gene (control) and oocytes expressing the CF gene containing the one or more of the mutations/polymorphisms found in TABLES Z or AA (experimental) are voltage-clamped in a T1C1 bath solution, and 2 microelectrodes are used to record ion currents. Subsequently, the clamp circuit is switched off, the electrodes are removed, and the cell is completely embedded in 1% agar in the T1C1 solution. After the agar is set and cooled to room temperature, the piece of gel containing the cell is cut out and the cell is voltage-clamped again. By comparing the relative abilities of the control and experimental oocytes to conduct electricity, one of skill in the art can easily determine the extent to which the particular CF protein containing the one or more of the

mutations/polymorphisms found in TABLES Z or AA functions as an ion transporter.

Additionally, the agarose-hemi-clamp technique described above can be performed in a multi-well format and libraries of agents, such as peptides, peptidomimetics, and chemicals can be screened for their ability to modulate the ion transport.

By an alternative approach, multimeric supports having attached the wild-type CF protein or a CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA, or polypeptide fragment thereof, are employed and impedance analysis of ion transport through the immobilized protein is determined. (Steinem et al., Bioelectro Chemistry and Bioenersetics. 42 : 213-220, (1997)).

In this embodiment, two types of multimeric supports are constructed by reconstituting the wild-type protein (control) or the CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA (experimental) into large unilamellar vesicles (LUV) of dimethyldioctadecylammoniumbromide (DODAB) which are then fused onto a negatively charged monolayer of 3-mercaptopropionic acid (MPA). An initial determination of impedance in the presence of different monovalant cations at varying concentrations is then made for the two types of multimeric supports. A. C. impedance spectroscopy, as an integral electrochemical method, is used because it offers the possibility to determine the electric parameters of thin films such as biomembranes without redoxactive marker ions. Thus, ions that permeate the membrane exhibit a resistance parallel to the membrane capacitance and in series to the capacitance of the substrate.

A. C. impedance analysis is performed using an SI 1260 impedance gain/phase analyzer from Solartron Instruments (Great Britain) controlled by a personal computer, however, those of skill in the art would be able to use other A. C. impedance analyzers. To prepare the control or experimental multimeric support, gold electrodes are exposed for about 10 minutes to a 10 mM solution of the MPA so as to form a highly oriented self-assembled monolayer. Afterwards, the electrodes are rinsed extensively with a Tris buffer solution pH 8. 6 to remove any remaining physisorbed molecules. To control the surface coverage and, therefore, the quality of the film, each step is monitored by impedance spectroscopy. A capacitance of about 9 mM F/cm2 is a reference value for a successfully deposited monolayer.

Large unilamellar vesicles (LUV) of DODAB (1. 5 mg/ml) with 1 mol % wild-type CF protein or CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA are prepared by a method of extrusion in the same buffer solution, as known by those of skilled in the art. (Steinem et al., Biochim. Biophys. Acta 1279 : 169-180 (1996)). The LLIV vesicles are added to the prepared MPA monolayer in the electrochemical cell. A bilayer is formed at room temperature without stirring the solution. After one hour, the process is finished and the vesicle suspension is replaced by pure buffer.

The formation of the solid supported bilayer is then observed by impedance spectroscopy and measurements are taken in the absence of ions. Subsequently, impedance measurements are taken in the presence of different concentrations of LiCl, NaCl, KC1, and CsCl. After addition of different concentrations of one kind of ion to the DODAB bilayer, the solution is replaced by pure buffer and an impedance spectrum is recorded in order to ensure that the solid supported bilayer was not disrupted. The extent to which the particular CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA has the ability to transport the particular ion will be ascertainable given that the impedance of the electrochemical system decreases significantly as the concentration of the ion increases.

Similar to the methods described above, a high throughput system can be designed to screen libraries of compounds or agents which would interact with the particular CF protein containing the one or more of the mutations/polymorphisms found in TABLES Z or AA and, thereby, modulate ion transport. In essence, the approach above is scaled up and impedance spectroscopy is performed on multiple measuring chambers each having a set of working electrodes. Impedance measurements are taken before the addition of the agent from the library of peptides, peptidomimetics, and chemicals so that a baseline reading for a particular ion is determined. Once the baseline is recorded, different agents are added to each measuring chamber and impedance measurements are again recorded. Agents which interact with the transporter and effect ion transport are then identified according to the relative change in impedence in the presence of the agent. That is, an increase in the impedance of the electrical system when the agent is present, as compared to its absence, for example, will indicate that the compound interferes with the ability of the protein to transport the ion. The examples below provide more detail on particular aspects of the invention.

As used in the present specification and claims, the terms"comprise,""comprises,"and "comprising"mean"including, but not necessarily limited to."For example, a method, apparatus, molecule or other item which contains A, B, and C may be accurately said to comprise A and B.

Likewise, a method, apparatus, molecule or other item which"comprises A and B"may include any number of additional steps, components, atoms or other items as well.

Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it is readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit and scope of that which is described and claimed.

EXAMPLE 1 A sample of blood was obtained from a subject to be tested by phlebotomy. A portion of the sample (e. g., approximately 1. 0ml) was added to approximately three times the sample volume or 3. 0ml of a lysis solution (lOmM KHCO3, 155mM NH4C1, 0. lrnM EDTA) and was mixed gently.

The lysis solution and blood were allowed to react for approximately five minutes. Next, the

sample was centrifuged (x500g) for approximately 2 minutes and the supernatant was removed.

Some of the supernatant was left (e. g., on the walls of the vessel) to facilitate suspension. The pellet was then vortexed for approximately 5-10 seconds. An extraction solution, which contains chaotrope and detergent (Qiagen), was then added (e. g., 5001l1), the sample was vortexed again for approximately 5-10 seconds, and the solution was allowed to react for five minutes at room temperature.

Next, a GFX column, which are pre-packed columns containing a glass fiber matrix, was placed under vacuum (e. g., a Microplex 24 vacuum system) and the extracted solution containing the DNA was transferred to the column (e. g., in 500 ; nl aliquots). Once all of the sample has been passed through the column, the vacuum was allowed to continue for approximately 5 minutes.

Subsequently, a wash solution (Tris-EDTA buffer in 80% ethanol) was added (e. g., approximately 500ut) under vacuum. Once the wash solution had been drained from the column, the vacuum was allowed to continue for approximately 15 minutes. The GFX columns containing the DNA were then placed into sterile microfuge tubes but the lids were kept open.

Elution buffer (lOmM Tris-HCI, 1mM EDTA, pH 8. 0) was then added to the column (e. g., approximately 1001l1 of buffer that was heated to approximately 70°C) and the buffer was allowed to react with the column for approximately 2 minutes. Then, the tubes containing the columns were centrifuged at x5000g for approximately 1. 5 minutes. After centrifugation, the column was discarded and the microfuge tube containing the isolated DNA was stored at-20°C. The example below describes the design and optimization of primers that allowed for the inventive high- throughput multiplex PCR technique, described herein.

EXAMPLE 2 Sets of primers for PCR amplification were designed for every exon of the following genes : Cystic Fibrosis Transmembrane Reductase (CFTR), Beta-hexosaminidase alpha chain (HEXA), PAH, Alpha globin-2 (HBA2), Beta globin (HBB), Glucocerebrosidase (GBA), Galactose-l- phosphae uridyl transferase (GALT), Medium chain acyl-CoA dehydrogenase (MCAD), Protease inhibitor 1 (PI), Factor VIII, FMR1, and Aspartoacylase (ASPA). The primers were designed from sequence information that was available from GenBank or from sequence information obtained from Ambry Genetics Corporation. Information regarding mutations or polymorphisms was obtained from The Human Gene Mutation Database.

One of the primers in each primer set contained a GC-clamp. It was discovered that the addition of a GC-clamp significantly altered the melting profile of the DNA extension product.

Further, proper positioning of the GC-clamp served to level the melting profile. It was desired to position the GC-clamp so that a single melting domain across the fragment was created. Proper positioning of the GC-clamp was oftentimes needed to prevent the GC-clamp from masking the presence of a mutation or polymorphism (e. g., if the mutation or polymorphism is too close to the GC-clamp). Software was also used to optimize primer design. For example, many primers were

designed with the aid of Primer Premiere 4. 0 and 5. 0 and appropriate positioning of the GC-clamps was determined using WinMelt software from BioRad. To maintain sensitivity of the test, the primers were designed to anneal at a minimum of 40 base pairs either upstream or downstream of the nearest known mutation in the intronic region of the genes.

Although multiplex PCR can be technically difficult when using the quantity of primers described herein, it was discovered that almost all of the PCR artifacts disappeared when salt concentration, temperature, primer selection, and primer concentration were carefully optimized.

Optimization was determined for each primer set alone and in combination with other primer sets.

Optimization experiments were conducted using Master Mix from Qiagen and a Thermocyler from MJ Research. The conditions for thermal cycling were 5 minutes @ 95°C for the initial denaturation, then 30 cycles of : 30 seconds @ 94°C, 45 seconds @ 48-68°C, and 1 minute @ 72°C.

A final extension was performed at 72°C for 10 minutes.

In addition to primer compatibility, primers were selected to facilitate identification of extension products by electrophoresis. To optimize primer design in this regard, separate PCR reactions were conducted for each individual set of primers and the extension products were separated by the inventive DNA separation technique, described above. Identical parameters were maintained for each assay and the migration behavior for each extension product was analyzed (e. g., compared to a standard to determine a Rf value for each fragment). An Rf value is a unit less value that characterizes a fragment's mobility relative to a standard under set conditions. In many primer optimization experiments, for example, the generated extension products were compared to a standard extension product obtained from amplification of the first exon of the PAH (phenylalanine hydroxylase) gene. A measurement of the distance of migration of each band in comparison to the distance of migration of the first exon of PAH was recorded and the Rf value was calculated according to the following : , ration distance of fragment) cm (migration distance of PAH exon 1) cm By conducting these experiments, it was verified that the selected primers did not produce extension products that overlapped on the gel. Optimal primer selection was obtained when optimal PCR parameters were maintained and the extension products produced dissimilar Rf values.

Finally, the multiplex PCR was tested with all sets of primers and it was verified that few artifacts were created during amplification. Embodiments of the invention include the primers provided in the tables and sequence listing provided herein and methods of using said primers and/or groups of primers. The example below describes an experiment that verified that the embodiments described herein effectively screen multiple loci present on a plurality of genes in a single assay.

EXAMPLE 3 Two independent PCR reactions were conducted to demonstrate that multiple loci on a plurality of genes can be screened in a single assay using an embodiment of the invention. In a first

reaction, seven different loci from four different genes were screened and, in the second reaction, eight different loci from four different genes were screened. The primers used in each multiplex reaction are provided in TABLE 1.

TABLE 1* Multiplex #1 Multiplex #2 Factor VIII4 (SEQ. ID. Nos. 7 and 25) CFTR 23 (SEQ. ID. Nos. 3 and 21) Factor VIII 11 (SEQ. ID. Nos. 9 and 27) CFTR 18 (SEQ. ID. Nos. 2 and 20) Factor VIII 24 (SEQ. ID. Nos. 10 and 28) Factor VIII 11 (SEQ. ID. Nos. 9 and 27) PAH 9 (SEQ. ID. Nos. 18 and 36) Factor VIII 3 (SEQ. ID. Nos. 6 and 24) GBA 6 (SEQ. ID. Nos. 15 and 33) CFTR 24 (SEQ. ID. Nos. 37 and 38) Factor VIII 1 (SEQ. ID. Nos. 4 and 22) GBA 4 (SEQ. ID. Nos. 14 and 32) GALT 9 (SEQ. ID. Nos. 17 and 35) GALT 9 (SEQ. ID. Nos. 17 and 35) GBA 3 (SEQ. ID. Nos. 13 and 31) *Primers are stored in a 50, uM storage stock and a 12. 5uM working stock.

Abbreviations are : Phenyl alanine hydroxylase (PAH), Glucocerebrosidase (GBA), Galactose-l- phosphate uridyl transferase (GALT), and cystic fibrosis transmembrane reductase (CFTR). The numbers following the abbreviations represent the exons probed.

The amplification was carried out in 25gl reactions using a 2X Hot Start Master Mix, which contains Hot Start Taq DNA Polymerase, and a final concentration of 1. 5mM MgCl2 and 200, uM of each dNTP (commercially available from Qiagen). In each reaction, 12. 5, u1 of Hot Start Master Mix was mixed with Ijul of genomic DNA (approximately 200ng genomic DNA), which was purified from blood using a commercially available blood purification kit (Pharmacia or Amersham). Primers were then added to the mixture (0. 5uM final concentration of each primer).

Then, ddH20 was added to bring the final volume to 25gel.

Thermal cycling for the Multiplex #1 reaction was performed using the following parameters : 15 minutes @ 95°C for 1 cycle ; 30 seconds @ 94°C, 1 minute @ 53°C, 1 minute and 30 seconds @ 72°C for 35 cycles ; and 10 minutes @ 72°C for 1 cycle. Thermal cycling for the Multiplex #2 reaction was performed using the following parameters : 15 minutes @ 95°C for 1 cycle ; 30 seconds @ 94°C, 1 minute @ 49°C, 1 minute and 30 seconds @ 72°C for 35 cycles ; and 10 minutes @ 72°C for 1 cycle.

After the amplification was finished, approximately 5p1 of each PCR product was mixed with 5gel of non-denaturing gel loading dye (70% glycerol, 0. 05% bromophenol blue, 0. 05% xylene cyanol, 2mM EDTA). The DNA in the two reactions was then separated on the basis of melting behavior on separate denaturing gels. Each gel was a 16 x 16cm, 1 mm thick, 7M urea, 8% acrylamide/bis (37. 5 : 1) gel composed in 1. 25 x TAE (50mM Tris, 25mM acetic acid, 1. 25mM

EDTA). Separation was conducted for 4 hours at 150 V on the Dcode system (BioRad) and the temperature ranged from 51°C to 63°C with a temperature ramp rate of 3°C/hour. Subsequently, the gels were stained in lpg/ml ethidium bromide in 1. 25 x TAE for 3 minutes and destained in 1. 25 x TAE buffer for 20 minutes. The gels were then photographed using the Gel Doc 1000 system from BioRad.

The primers in TABLE 1 were selected and manufactured because they produced extension products with very different Rf values and the extension products were clearly resolved by separation on the basis of melting behavior. Although some bands were more visible than others on the gel, seven distinct bands were observed on the gel loaded with extension products generated from the Multiplex 1 reaction and eight distinct bands were observed on the gel loaded with extension products generated from the Multiplex 2 reaction. These results verified that the described method effectively screened multiple loci on a plurality of genes in a single assay. The example below describes another experiment that verified that the embodiments described herein can be used to effectively screen multiple loci present on a plurality of genes in a single assay.

EXAMPLE 4 Experiments were conducted to differentiate extension products generated from wild-type DNA and extension products generated from mutant DNA. Samples of genomic DNA that had been previously identified to contain mutations or polymorphisms were purchased from Coriell Cell Repositories. The mutation or polymorphism that was analyzed in this experiment was the delta- F508 mutation of the CFTR gene. This mutation is a 3 bp deletion in exon 10 of the CFTR gene.

Other loci analyzed in these experiments included the Fragile X gene, exon 17 ; Fragile X gene, exon 3 ; Factor VIII gene exon 2 ; and the Factor VIII gene, exon 7. Both the known mutant and a control wild-type for CFTR exon 10 were amplified within a multiplex reaction and individually.

PCR amplification was conducted as described in EXAMPLE 3 ; however, 0. 25uM (final concentration) of each primer was used. The primers used in these experiments were CFTR 10 (SEQ. ID. Nos. 1 and 19), FragX 17 (SEQ. ID. Nos. 12 and 30), FragX 3 (SEQ. ID. Nos. ll and 29), Factor VIII 7 (SEQ. ID. Nos. 8 and 26) and Factor VIM 2 (SEQ. ID. Nos. 5 and 23). The numbers following the abbreviations represent the exons probed.

The DNA templates that were analyzed included known wild-type genomic DNA, known mutant genomic DNA, mixed wild-type genomic DNA from various subjects, and mixed wild-type and mutant genomic DNA. Approximately 200ng of genomic DNA was added to each reaction.

The mixed wild-type and mutant DNA sample had approximately 100ng of each DNA type.

Thermal cycling was carried out with a 15-minute. step at 95°C to activate the Hot Start Polymerase, followed by 30 cycles of 30 seconds at @ 94°C, 1 minute at @ 53°C, 1 minute and 30 seconds at @ 72°C ; and 72°C for 10 minutes.

After amplification, approximately zip of the PCR product was mixed with 5PLI of non- denaturing gel loading dye (70% glycerol, 0. 05% bromophenol blue, 0. 05% xylene cyanol, 2mM

EDTA). The samples were then separated on a 16 x 16cm, 1 mm thick, 6M urea, 6% acrylamide/bis (37. 5 : 1) gel in 1. 25 x TAE (50mM Tris, 25mM acetic acid, 1. 25mM EDTA) for 5 hours at 130 V using the Dcode system (BioRad). The temperature ranged from 40°C to 50°C at a temperature ramp rate of 2°C/hour. The gels were then stained in lu. gel ethidium bromide in 1. 25 x TAE for 3 minutes and destained in 1. 25 x TAE buffer for 20 minutes. The gels were then photographed using the Gel Doc 1000 system from BioRad.

The resulting gel revealed that the lane containing the extension products generated from the wild-type DNA using the CFTR10 primers had a mobility commensurate to the wild-type DNA standard, as did the extension products generated from the other primers and the wild-type DNA.

That is, a single band appeared on the gel in these lanes. The lane containing the extension products generated from the template having the F508 mutant, on the other hand, showed 2 bands.

One of the bands had the same mobility as the extension products generated from the wild-type or DNA standard and the other band migrated slightly faster. These two populations of bands represent the two populations of homoduplexes (i. e., wild-type/wild-type and mutant/mutant). The top band is the wild-type homoduplex and the lower band is the mutant F508 homoduplex.

Similarly, the lane that contained the wild-type/mutant DNA mix exhibited two populations of extension products, one representing the wild-type homoduplex population and the other representing the mutant homoduplex. Since F508 is a 3 bp deletion it failed to form heteroduplex bands in sufficient quantity to be visible on the gel. Thus, this experiment demonstrated that the described method effectively screened multiple genes, in a single assay, and detected the presence of a polymorphism in one of the screened genes. The example below describes an experiment that demonstrated that an improved sensitivity can be obtained by mixing a plurality of DNA samples.

EXAMPLE 5 This example describes two experiments that verified that an improved sensitivity of detection can be obtained by (1) mixing the DNA samples from a plurality of subjects prior to amplification or by (2) mixing amplification products before separation on the basis of melting behavior. In these experiments, PCR amplifications of exon 9 of the GBA gene (Glucocerebrosidase gene) were used. DNA samples known to contain a mutation in exon 9 of the GBA gene were purchased from Coriell Cell Repositories. These DNA samples contain a homozygous mutation in exon 9 of the GBA gene (the N370S mutation).

In a first experiment, single amplification of exon 9 was performed in a 25 ut reaction. A Taq PCR Master Mix (containing Taq DNA Polymerase and a final concentration of 1. 5mM MgCl2 and 200, uM dNTPs) (Qiagen) was mixed with 0. 5uM (final concentration) of primers (SEQ. ID.

Nos. 16 and 34). The template genomic DNAs analyzed in this experiment included wild-type DNA, mutant DNA, and various mixtures of wild-type and mutant DNA. For the single non-mixed reactions, approximately 200ng of genomic DNA was used for amplification. In the mixed samples, approximately 200ng of DNA was again used, however, the percentage of wild-type to

mutant genomic DNA varied. Thermal cycling was performed according to the following parameters : 10 minutes @ 94°C ; 30 cycles of 30 seconds @ 94°C, 1 minute @ 44. 5°C, and 1 minute and 30 seconds @ 72°C ; and 10 minutes @ 72°C.

In the second experiment, the amplification products were mixed prior to separation on the basis of melting behavior. Amplification of both wild-type and mutant (N370S) exon 9 of the GBA gene was performed using 25) J. l reactions, as before. The Taq Master Mix obtained from Qiagen was mixed with 200ng of genomic DNA and 0. 5uM final concentration of both primers (SEQ. ID.

Nos. 16-34). PCR was carried out for 30 cycles with an annealing temperature of 56°C for 1 minute. The denaturation and elongation steps were 94°C for 30 seconds and 72°C for 1 minute and 30 seconds. Final elongation was carried out at 72°C for 10 minutes. The extension products obtained from the single amplification of wild-type GBA exon 9 was then mixed with the extension products obtained from the single amplification of the mutant GBA exon 9. Next, the pooled DNA was subjected to denaturation at 95°C for 10 minutes and cooled on ice for 5 minutes, then heated to 65°C for 5 minutes and cooled to 4°C. This denaturation and annealing procedure was performed to facilitate the formation of heteroduplex DNA.

Once the extension products from both experiments were in hand, approximately 5, u1 of both the prior to PCR mixture and post PCR mixture were loaded on 16 x 16cm, lmm thick gels (7M Urea/8% acrylamide (37. 5 : 1) gel in 1. 25 x TAE) using the gel loading dye and the Dcode system (BioRad), described above. The DNA on the gel was then separated at 150 V for 5 hours and the temperature was uniformly raised 2°C/hour throughout the run starting at 50°C and ending at 60°C. The gel was stained in lu. gel ethidium bromide in 1. 25 x TAE buffer for 3 minutes and destained in buffer for 20 minutes.

It should be noted that the GBA gene has a pseudo gene, which was co-amplified by the procedure above. An extension product generated from this psuedo gene migrated slightly faster than the extension product generated from the true expressed gene on the gel. In all lanes, the band representing the extension product generated from the psuedo gene was present. Then next fastest band on the gel was the extension product generated from the GBA exon 9 wild-type allele. The extension product generated from the mutant GBA exon 9 allele migrated with the wild-type allele and was virtually indistinguishable on the basis of melting behavior due to the single base difference.

The heteroduplexes formed in the mixed samples were easily differentiated from the homoduplexes. The samples mixed prior to PCR showed both homoduplexes (wild-type and mutant) along with heteroduplexes, which appeared higher on the gel. Thus, by mixing samples, either prior to amplification or prior to separation on the basis of melting behavior an improved sensitivity of detection was obtained. Since homoduplex bands no longer need to be resolved to identify a mutation or polymorphism, only the heteroduplex bands need to be resolved, the throughput of diagnostic analysis was greatly improved. The example below describes experiments

that verified that the embodiments taught herein can be used to effectively screen multiple genes in a plurality of subjects, in a single assay, for the presence or absence of a polymorphism or mutation.

EXAMPLE 6 Two experiments were conducted to verify that multiple genes from, a plurality of subjects can be screened in a single assay for the presence or absence of a genetic marker (e. g. a polymorphism or mutation) that is indicative of disease. These experiments also demonstrated that an improved sensitivity of detection could be obtained by mixing DNA samples either prior to generation of extension products or prior to separation on the basis of melting behavior.

In both experiments, five different extension products were generated from three different genes in a single reaction vessel. The five different extension products were generated using the following primers : Factor VIII 1 (SEQ. ID. Nos. 4 and 22) ; GBA 9 (SEQ. ID. Nos. 16 and 34) ; GBA 11 (SEQ. ID. Nos. 39 and 40) ; GALT 5 (SEQ. ID. Nos. 41 and 42), and GALT 8 (SEQ.

ID. Nos. 43 and 44). Abbreviations are : Glucocerebrosidase (GBA) and Galactose-1-phosphate uridyl transferase (GALT). The numbers following the abbreviations represent the exons probed.

Extension products were generated for each experiment in 25 pi amplification reactions using Qiagen's 2X Hot Start Master Mix (Contains Hot Start Taq DNA Polymerase, and a final concentration of 1. 5 mM MgCl2 and 200 pM of each dNTP). To each reaction, 12. 5 pi of Hot Start Master Mix was added to 1 pi of genomic DNA (approximately 200ng genomic DNA for the mutant DNA sample and the wild-type DNA sample), which was purified from human blood using Pharmacia Amersham Blood purification kits. For the experiment in which the DNA samples from a plurality of subjects were mixed prior to generation of the extension products, approximately 100ng of wild-type genomic DNA was mixed with approximately 100ng of mutant N370S genomic DNA. In both experiments, primers were added to achieve a final concentration of 0. 5 LM for each primer and a final volume of 25 pi was obtained by adjusting the volume with ddH20.

Thermal cycling for both experiments was performed using the following parameters : 15 minutes @ 95°C for 1 cycle ; 30 seconds @ 94 °C, one minute @ 57°C, and one minute 30 seconds @ 72 °C for 35 cycles ; and 10 minutes @ 72 °C for 1 cycle. After amplification, the extension products generated from the wild-type and mutant templates (the un-mixed samples) were separated from the PCR reactants using a PCR Clean Up kit (Qaigen). Then, approximately 10 pi of the wild-type and mutant DNA were removed from each tube and gently mixed in a single reaction vessel. This preparation was then denatured at 95°C for 1 minute and rapidly cooled to 4°C for 5 minutes. Finally, the preparation was brought to 65 °C for an additional 1. 5 minutes. The extension products generated from the mixed sample (wild-type DNA and mutant DNA mixed prior to amplification) were stored until loaded onto a denaturing gel.

Next, approximately 10 : 1 of the unmixed sample was combined with 10 pi of loading dye and approximately 5 pi of the mixed sample was combined with 5 pi of loading dye. The loading

dye was composed of 70 % glycerol, 0. 05 % bromophenol blue, 0. 05% xylene cyanol, and 2 mM EDTA). The samples in loading dye were then loaded on separate 16 x 16 cm, 1 mm thick, 7M urea, 8% acrylamide/bis (37. 5 : 1) gels in 1. 25 x TAE (50 mM Tris, 25 mM acetic acid, 1. 25 mM EDTA). The DNA was separated on the basis of melting behavior for 5 hours at 150 V on the Dcode system (BioRad). The temperature ranged from 56°C to 68 °C at a temperature ramp rate of 2°C/hr. The gels were then stained in 1, ug/ml ethidium bromide in 1. 25 x TAE for 3 minutes and destained in 1. 25 x TAE buffer for 20 minutes. The gels were photographed using the Gel Doc 1000 system (BioRad).

In all lanes of the gel, 5 extension products generated from three different genes were visible in the following order from top to bottom : Factor VIII 1, GBA 9, GBA 11, GALT 8, and GALT 5. Two different extension products were generated from the GBA 9 primers, as described above. The less intense band below the homoduplex bands corresponded to an extension product generated from the pseudogene. In the lanes loaded with extension products generated from only the wild-type or mutant DNA template, it was difficult to distinguish the wild type homoduplex from the N370S mutant homoduplex. In the lane loaded with the extension products generated from the mixed DNA templates (wild-type and mutant DNA mixed prior to amplification) and the lane loaded with extension products (generated from wild type and mutant DNA separately) that were mixed after amplification, heteroduplex bands were easily visualized. These experiments verified that multiple genes can be screened in a plurality of individuals in a single assay and that a single nucleotide mutation or polymorphism can be detected. Further, these experiments demonstrate that screening a plurality of DNA samples in a single reaction vessel or adding a control DNA before or after amplification greatly improves the sensitivity of detection. By practicing the methods taught in this example, the throughput of diagnostic screening can be drastically improved and the cost of identifying genetic traits can be significantly reduced. The example below describes approaches to screen multiple genes in a plurality of subjects, in a single assay, for the presence or absence of a polymorphism or mutation using DHPLC.

EXAMPLE 7 Multiple genes in a plurality of subjects, in a single assay, can be screened for the presence or absence of a polymorphism or mutation using a DHPLC separation approach. For example, five different extension products can be generated using the following primers : Factor VIII 1 (SEQ. ID.

Nos. 4 and 22) ; GBA 9 (SEQ. ID. Nos. 16 and 34) ; GBA 11 (SEQ. ID. Nos. 39 and 40) ; GALT 5 (SEQ. ID. Nos. 41 and 42), and GALT 8 (SEQ. ID. Nos. 43 and 44). Abbreviations are : Glucocerebrosidase (GBA) and Galactose-1-phosphate uridyl transferase (GALT). The numbers following the abbreviations represent the exons probed. The extension products can be generated in 25 ul amplification reactions using Qiagen's 2X Hot Start Master Mix (Contains Hot Start Taq DNA Polymerase, and a final concentration of 1. 5 mM MgCl2 and 200 uM of each dNTP).

To each reaction, 12. 5 ul of Hot Start Master Mix is added to 1 ul of genomic DNA (approximately 200ng genomic DNA for the mutant DNA sample and the wild-type DNA sample), which is purified from human blood using Pharmacia Amersham Blood purification kits. By another approach, the DNA samples from a plurality of subjects can be mixed prior to generation of the extension products. In this case, approximately 100ng of wild-type genomic DNA is mixed with approximately 100ng of mutant N370S genomic DNA. Primers are added to achieve a final concentration of 0. 5 uM for each primer and a final volume of 25 RI is obtained by adjusting the volume with ddH20.

Thermal cycling is performed using the following parameters : 15 minutes @ 95°C for 1 cycle ; 30 seconds @ 94°C, one minute @ 57°C, and one minute 30 seconds @ 72°C for 35 cycles ; and 10 minutes @ 72°C for 1 cycle. After amplification, the extension products generated from the wild-type and mutant templates (if un-mixed samples) are separated from the PCR reactants using a PCR Clean Up kit (Qiagen). Then, approximately 10 gel of the wild-type and mutant DNA are removed from each tube and gently mixed in a single reaction vessel. This preparation is then denatured at 95°C for 1 minute and rapidly cooled to 4°C for 5 minutes. Finally, the preparation is brought to 65°C for an additional 1. 5 minutes. The extension products generated from the mixed sample (wild-type DNA and mutant DNA mixed prior to amplification) can be stored until loaded onto a DHPLC column.

Next, the extension products are loaded on to a 50 x 4. 6 mm ion pair reverse phase HPLC column that is equilibrated in degassed Buffer A (0. 1 M triethylamine acetate (TEAA) pH 7. 0) at 56°C. A linear gradient of 40%-50 % of degassed Buffer B (0. 1 M triethylamine acetate (TEAA) pH 7. 0 and 25% acetonitrile) is then performed over 2. 5 minutes at a flow rate of 0. 9 ml/min at 56°C, followed by a linear gradient of 50%-55. 3% Buffer B over 0. 5 minutes, and finally a linear gradient of 55. 3%-61% Buffer B over 4 minutes. U. V. absorption is monitored at 260nm, recorded and plotted against retention time.

When the loaded sample is un-mixed extension products, the extension products generated from only the wild-type or mutant DNA template, it is difficult to distinguish the wild type homoduplex from the N370S mutant homoduplex. When the loaded sample is the mixed extension products, the extension products generated from the mixed DNA templates (wild-type and mutant DNA mixed prior to amplification), or the extension products (generated from wild type and mutant DNA separately) that were mixed after amplification, heteroduplex elution behavior is detected. By practicing the methods taught in this example, the throughput of diagnostic screening can be drastically improved and the cost of identifying genetic traits can be significantly reduced. The example below describes an approach that was used to diagnostically screen patient samples for cystic fibrosis.

EXAMPLE 8 Sets of primers for PCR amplification were designed for every exon and one deep intronic region of the CFTR gene. The primers were designed from sequence information that was available from GenBank or from sequence information obtained from Ambry Genetics Corporation.

Information regarding mutations or polymorphisms was obtained from The Human Gene Mutation Database.

Primer sets and PCR stacking groups were designed for optimal sensitivity for TTGE, as described above. DNA from one individual was amplified with each primer set in a separate reaction, then stacked in average groups of three fragments/gel for gel analysis. Preferably, one of the primers in each primer set contained a GC-clamp. It was discovered that the addition of a GC- clamp significantly altered the melting profile of the DNA extension product. Further, proper positioning of the GC-clamp served to level the melting profile. It was desired to position the GC- clamp so that a tight single melting domain across the fragment was created. Proper positioning of the GC-clamp was often times needed to prevent the GC-clamp from masking the presence of a mutation or polymorphism (e. g., if the mutation or polymorphism is too close to the GC-clamp).

Software was also used to optimize primer design. For example, many primers were designed with the aid of Primer Premiere 4. 0 and 5. 0 and appropriate positioning of the GC-clamps was determined using WinMelt software from BioRad. To maintain sensitivity of the test, the primers were designed to anneal at a minimum of 40 base pairs either upstream or downstream of the nearest known mutation in the intronic region of the genes.

Optimization was determined for each primer set. Optimization experiments were conducted using Hotstart Master Mix from Qiagen and a Thermocyler from MJ Research.

Resulting PCR conditions for all fragments were 15 minutes @ 95°C for the initial denaturation, then 35 cycles of : 30 seconds @ 94°C, 30 seconds @ 46-62°C, and 30 seconds @ 72°C. A final extension was performed at 72°C for 10 minutes. Approximately 15 u. l PCR reactions contained 7. 5 jul Qiagen 2x Hotstart Master Mix, 50-200 ng genomic DNA, sense and antisense primer for each fragment at a final concentration of 0. 5-1 jus. Prior to gel loading and stacking of gel groups PCR samples were heated and re-annealed to provide best heteroduplex formation. PCR product was heated to 95°C for 5 min, 50°C for 10 min, then brought to 4°C.

On occasion, diagnostic patient samples may contain mutations that are homozygous in nature, and sporadically homozygous mutation band may settle in line with the wild-type band.

The most common mutation for CF (allele frequency-70% known as dF508) has this situation.

Therefore, wild-type gDNA was always mixed with the diagnostic sample for exon 10 (primer set 10C) and heteroduplex formation was performed. This creates heteroduplex bands which will predict a dF508, either homozygous or heterozygous for the patient. Approximately 4 ill of the 10C-amplified PCR sample from each patient was removed from the PCR plate, transferred into

200 jul strip tubes, mixed with 4 ul of 10C amplified wild type DNA, heated to 95°C for 5 min, 50°C for 10 min, 4°C and added back to the assay.

PCR products (approximately 4-8 u. l each depending on signal strength) were then assembled for groups of equal melting characteristics and mixed with loading dye consisting of 70% glycerol, 0. 05% bromophenol blue, 0. 05% xylene cyanol, 2 mM EDTA). DNA was separated on denaturing gels (7 M urea, 8% acrylamide/bis (37. 5 : 1) in 50 mM Tris, 25 mM acetic acid, 1. 25 mM EDTA) for 3-5 hours at 125 V or 150 V on the Dcode system. (Biorad). Temperature ranged from 45. 5°C to 64°C with ramp rates of 1. 0-1. 5°C/hr depending on gel groups. The gels were stained in 1 : g/ml ethidium bromide in 1. 25 x TAE for 3 minutes and destained in 1. 25 x TAE buffer for 20 minutes. The gels were photographed using the Gel Doc 1000 system (BioRad). TABLE 2 lists the primers used in this assay. TABLE 3 shows the TTGE gel grouping and temperatures used for TTGE separation. TABLE 3 also names the extension products generated from the various primer sets employed and the positions of each fragment on the gel after separation. Previous experiments, described above, have demonstrated that extension products generated from primers that are any number between 1-75 nucleotides upstream or downstream from the primers listed in TABLE A (e. g., the primer sets listed in TABLE 2) can be grouped and efficiently separated in accordance with rules set forth herein. Preferably, the primers listed in TABLE 2 are used to generate extension products that are grouped according to TABLE 3 and are separated on the basis of melting behavior (e. g., TTGE).

TABLE 2 TABLE 3 TTGE Group Listing for CFTR Gene Gene Ext. Group Position run group PCR temp product , £ 5 7 f !'Å 456. 5-52. $ 49 FTR 682 "t""'B ,.'-125V..,..-""'""49 'CETR 17 rr f 52 ,, :, run, ime,, 4 our$ CFTR 21 1 & m. f''Mh ; time. 4. 67. j 52 CFTR 12 2 À u 4 60 5A, 2, B C, FTR 7A 2 G. : = £ 62 E CFTR. 6B (A, 49 'CFTR 7D 3 8 60 CFTR, SB 3 C < s F. 1 . CFTik 17B4 4 : 1- A 49 CFTRk 06B1 V 4 B : 54 , CFTR 6A3-2 4 C 52 CFTR 8B2 5 A 47. 5-53 52 CFTR 2B5 5 B 150 V 49 CFTR 13A 6 A 1 rr 59 CFTR 8A 6 B run time 5. 5 hours 60 C : FTR 11A 7 A 50. 5-56. 5 49 CFTR 19A 7 B 125V 54 ! CFTR 19B 7 C 1. 5 rr 59 tCFTR 14B2-3 8 A run time 4 hours 60 ' ; CFTR 13B3 8 B 49 CFTR 2163 8 C 46 CFTR 14A3 9 A j :, 54 CFTR 17A2 9 B 60 ! CFTR 4B 9 C 1 52 'CFTR 13F2. A, 46 ICFTR 23A3 10 i B 4. 46 CCFTR 19in 10 C iL 49 tEiTR 14A2 10 D R 62 CFTR 3A2 11 A 50. 5-56. 5 46 CFTR 18A 11 B 125 V 60 CFTR 2A 11 C 1. 2 rr 54 CFTR 10 12 A run time 5 hours 59 CFTR 14A1 12 B 46 CFTR 22A2 12 C 52 C-FTR'lOC3 1, 3 A :.,. ; 50., 5-56. 5 CFTR 13 126, V.' 52 CFTR 3B Ai :., .., 1. a ry 54 ICFTR.'I'8B, 1 B. rut=time 4 iours 60 1 CFTR 17A16'i4 C,, 52 CFTR 9Ts 15 A 50. 5-56. 5 59 CFTR 9C 15 B 150 V prerun 30 min 59 CFTR 23B2 16 A 1. 2 rr 49 CFTR 13C 16 B run time 5 hours 60 ! CFTR.. ; 22C :. i Z. A 4. -' ; 59 'TR 022B 1 z ß= i ; ia 59 ; C'. . : 6A2 1 ?' : ... . rr 49 FCFTR 5A... 18. M. ; ''''' 54 CFTR 13C 16 B run time 5 hours 60 C-V,.-TR'22B 7 59 s CFTIt A (8 C'E f-i 60 , CFTR 1E3'1' (8 e. G ;. ; 2,, 54 E g ß ß 54 CFT-R 17B2 20, :,, A 49 : "' 62 FTR'I ? 3 : f. 49 CFTR'93 2 (l. _, 52 '=R 1'7BZ 20l ! A T 2 ß'i D i ; ; 49 (CFTR 24B° t.,,, C_ 52 52 CFTR 20 21 A 55-60 49 CFTR 7C 21 B 150 V, 1 rr, run time 60 5 hours tF'TR if 013E ; 22 ; s4 f 59 CFTR lB 23 B 59 Scs 23 A.. 1. 5trZZr. ;, 62 run time . 3 :'hour$

*Note :"Ext. Product"= Extension Product. For example, extension product CFTR16A-5 was generated using sense and anti-sense primers CF 16A-a5 and CF 16A-as5 (Seq. ID No. s 124 and 125, respectively). Similarly with regard to Tables B and E, and Tables X and Y, primers designated by extension product name and sense and anti-sense notations ("s"and"as", respectively) are used to generate the respective extension products (e. g. see Table BB).

The example below describes an approach that can be used to diagnostically screen patient samples for the presence or absence of mutations/polymorphisms on the CF gene.

EXAMPLE 9 Sets of primers for PCR amplification are designed to amplify regions of interest along the CFTR gene. Primer sets and stacking groups are designed for optimal sensitivity for TTGE, as described above. The primers identified in TABLE X are used in amplification reactions according to the conditions set forth in TABLE Y. For example, PCR conditions are 15 minutes @ 95°C for the initial denaturation, then 35 cycles of : 30 seconds @ 94°C, 30 seconds @ 46-62°C (see TABLE Y conditions), and 30 seconds @ 72°C. A final extension is preferably performed at 72°C for 10 minutes. Approximately 15 u. l PCR reactions contain 7. 5 gel Qiagen 2x Hotstart Master Mix, 50- 200 ng genomic DNA, sense and antisense primer for each fragment at a final concentration of 0. 5 -1, uM DNA. Once the extension products are obtained (see TABLE BB for extension products), they are stacked according to the grouping in TABLE Y and are separated by TTGE. Prior to gel loading and stacking of gel groups PCR samples are heated and re-annealed to provide best heteroduplex formation. PCR product is heated to 95°C for 5 min, 50°C for 10 min, then brought to 4°C.

PCR products (approximately 4-8 ul each depending on signal strength) are then assembled for groups of equal melting characteristics and mixed with loading dye consisting of 70% glycerol, 0. 05% bromophenol blue, 0. 05% xylene cyanol, 2 mM EDTA). DNA is separated on denaturing gels (7 M urea, 8% acrylamide/bis (37. 5 : 1) in 50 mM Tris, 25 mM acetic acid, 1. 25 mM EDTA) for 3-5 hours at 125 V or 150 V on the Dcode system. (Biorad). Temperature ranges from 45. 5°C to 64°C with ramp rates of 1. 0-1. 5°C/hr depending on gel groups. The gels are stained in 1 llg/ml ethidium bromide in 1. 25 x TAE for 3 minutes and destained in 1. 25 x TAE buffer for 20 minutes.

The gels are photographed using the Gel Doc 1000 system (BioRad). By employing the assay described above, one can readily identify the presence or absence of mutations/polymorphisms on the CF gene, which indicate, correlate to, or are associated with symptoms of CF, CF disease states, or CF carrier or disease status.

The next example describes another approach that can be used to identify the presence or absence of mutations/polymorphisms in the CF gene.

EXAMPLE 10 In this example, fluorescently labeled primers that detect the presence of absense of polymorphisms in the CTFR gene were employed. Exon 10 of the CFTR gene was amplified with a primer set that detects the entire exon using a PCR protocol similar to that of Example 8. PCR was performed as described in Example 8 with a primer set that was modified with Texas Red (primers were obtained from MWG Biotech), and a second primer set that was modified with Oregon Green (also from MWG). Extension products were analyzed on TTGE side by side after being forced into a heteroduplex against themselves or by mixing with a control DNA. The extension products were analyzed on TTGE and the common mutation for deltaF508 and polymorphism M470V was observed.

Results revealed the same banding pattern on TTGE for each individual fragment regardless of the modification state of the primer. Results also indicate the homozygous state of the DNA samples if the samples were mixed with wildtype DNA, which appears as a visually apparent heterozygous banding pattern (Fig. 5, Panel A). Poststaining of TTGE gels in EtBr also showed the same banding pattern for those products amplified with Texas Red modified or Oregon Green modified primers and unmodified primers. (Fig. 5, Panels B and C).

This example demonstrates that the use of fluorescently labeled primers allows one to rapidly identify the presence or absence of polymorphisms in an analyzed gene without staining or autoradiography and to rapidly differentiate the identity of individual extension products that are mixed and segregated on the same lane of a TTGE gel.

The next example describes another approach that can be used to identify the presence or absence of mutations/polymorphisms in the CF gene.

EXAMPLE 11 In one embodiment of the invention, the techniques described above in Example 8 can be used to screen DNA samples isolated from patient blood samples for mutations associated with cystic fibrosis. In some embodiments of the invention, if a DNA sample generates a positive result in the assay, the existence of one or more mutations associated with cystic fibrosisis confirmed with DNA sequencing of the relevant exons. TABLE X provides primer pairs to be used for the sequencing of various regions of the CTFR gene, including first and second choices in some instances. A protocol for PCR-based sequencing reactions using these primers, as well as the primer sequences themselves, are also provided in TABLE W. Using the primers, the primer pairings and the protocol provided, a person with skill in the art is able to sequence any or all of the exons of CTFR genes and confirm the existence of cystic fibrosis-related or other mutations in the coding sequences of the gene.

The next example describes another approach that can be used to identify the presence or absence of mutations/polymorphisms in the CF gene.

EXAMPLE 12 Using a protocol similar to that of Example 8, the assay for CTFR polymorphisms is performed with primers that have been modified with a fluorescent label for visualization on a fluorescent imager. In this Example, the short primer (without the GC clamp sequence) of each primer pair listed in TABLE X is modified by the addition of a fluorescent label such as Texas Red (absorption peak 595 nm, emission peak 615 nm) or Oregon Green (absorption peak 496 nm, emission peak 524 nm) (primers are obtained from MWG Biotech). The GC clamp primer is used in the unmodified form.

Primer sets and PCR stacking groups are designed for optimal sensitivity for TTGE, as described in Example 8. In particular embodiments, DNA from one individual is amplified with each primer set in a separate reaction, then stacked in average groups of three fragments/gel for gel

analysis. PCR conditions for all fragments are as follows : 15 minutes @ 95°C for the initial denaturation, then 35 cycles of : 30 seconds @ 94°C, 30 seconds @ 47-58. 5°C, and 30 seconds @ 72°C. A final extension is performed at 72°C for 10 minutes. The approximately 15 1ll PCR reactions contain 7. 5 ul Qiagen 2x Hotstart Master Mix, 50-200 ng genomic DNA, sense and antisense primers for each fragment at a final concentration of 0. 5-1 juM. Prior to gel loading and stacking of gel groups, PCR samples are heated and re-annealed to provide best heteroduplex formation. Each PCR product is heated to 95°C for 5 min, 50°C for 10 min, then brought to 4°C.

PCR products (approximately 4-8 1ll each depending on signal strength) are then assembled into groups of products with equal melting characteristics and mixed with loading dye consisting of 70% glycerol, 0. 05% bromophenol blue, 0. 05% xylene cyanol, 2 mM EDTA). DNA is separated on denaturing gels (7 M urea, 8% acrylamide/bis (37. 5 : 1) in 50 mM Tris, 25 mM acetic acid, 1. 25 mM EDTA) for 3-5 hours at 125 V or 150 V on the Dcode system. (Biorad). Temperature ranges from 45°C to 67°C are used with ramp rates of 1. 0-1. 5°C/hr, depending on gel groups. The gels are imaged on a fluorescent image, and images are captured in the respective channel. Gels can also be photographed using the Versadoc 1000 system (BioRad).

Resulting images show extension products in the respective channel, e. g. presenting as a red pattern for Texas Red modified primers, and as a green pattern for Oregon Green modified primers.

Moreover, since the labeled extension products fluoresce in different spectra, this method allows for the simultaneous visualization of multiple DNA samples at once. For example, if one sample of primer has been previously amplified with Texas Red modified primers and the another with Oregon Green modified primers. one can multiplex the same extension product from 2 or more different DNA samples at the gel stage of the process.

In a specific embodiment, DNA from one individual is amplified with each primer set in separate reactions, using short primers labeled with the Texas Red fluorescent tag. DNA from another individual is amplified with primer sets labeled with the Oregon Green fluorescent tag.

Prior to gel loading and stacking of gel groups, Texas Red tagged extension product and Oregon Green tagged extension product are mixed at equal ratios, and re-annealed to provide heteroduplex formation. Mixed PCR products are heated to 95°C for 5 min, 50°C for 10 min, then brought to 4°C.

The PCR products (approximately 4-8 ul of each depending on signal strength) are then assembled into groups of products with equal melting characteristics and mixed with loading dye.

DNA is separated on denaturing gels, and gels are imaged on a fluorescent imager. Images for each gel are captured in both channels, after which they are overlayed for viewing of both colors.

Whenever the extension products have identical sequence, the banding pattern appears as yellow on the overlay image. If one extension product is missing, the other extension product will be visible (red or green). Moreover, since all products are forced into a heteroduplex, any one homozygous mutation appear as a heterozygous pattern after having been mixed with wildtype sequence. The

heterozygous pattern may present as a distinct pattern of 2 yellow, 1 red and 1 green band, or as a compressed yellow pattern of all 4 bands, depending on the specific melting temperature shift of each duplex. Most importantly, this mandatory heteroduplex formation of every fragment in the assay facilitates homozygous detection. This provides an advantage over conventional TTGE, since the homozygous mutations can be the most difficult to resolve on gel. In addition, the cost for analyzing samples is reduced because each gel is loaded with a multiple number of DNA samples.

As noted above, heteroduplexes have one or more mismatched base pairs between the two strands comprising the duplex. Creating heteroduplexes in the TTGE samples permits a greater difference in melting tempertures between PCR products with different sequences than would be seen between homoduplexes differing in sequence by only one or a few bases. Heteroduplex formation assists with the melting temperature (Tm) calculations in various Tm calculating software programs, such as the Bio-Rad Winmelt software. In order to get efficient and sensitive TTGE PCR fragments, it is helpful to have the regions of sensitivity be linear within 0. 1° C. Consistent predictions of Tm ranges within that level of specificity are difficult to obtain. By increasing the difference in melting temperture of double stranded PCR products in a sample through the formation of heteroduplexes, the need for precise melting temperture predictions is reduced.

Another aspect of the invention involves the importance of analysis consistencies in the laboratory. In TTGE, SSCP, DGGE, or any other denaturing assay, the primary determinant for the detection of an abnormality is the mobility shift of the fragment. Even if the assay works technically, the shift may be so slight that it is only apparent if it is known that there is a mutation on the input DNA. Mobility shifts should be visually significant in order to be detected every single time. By creating multicolor heteroduplex under denaturing conditions, color change is added to the visual criteria whereby the mutation can be detected. This additional visual criteria increases the sensitivity of the assay.

Although the invention has been described with reference to embodiments and examples, it should be understood that various modifications can be made without departing from the spirit of the invention.

TABLE A CF exon 1 541 gggaggggtg ctggcggggg tgcgtagtgg gtggagaaag ccgctagagc aaatttgggg 601 ccggaccagg cagcactcgg cttttaacct gggcagtgaa ggcgggggaa agagcaaaag 661 gaaggggtgg tgtgcggagt aggggtgggt ggggggaatt ggaagccaaa tgacatcaca 721 gcaggtcaga gaaaaagggt tgagcggcag gcacccagag tagtaggtct ttggcattag 781 gagcttgagc ccagacggcc ctagcaggga ccccagcgcc cagagaccAT GCAGAGGTCG 841 CCTCTGGAAA AGGCCAGCGT TGTCTCCAAA CTTTTTTTCA Ggtgagaagg tggccaaccg 901 agcttcggaa agacacgtgc ccacgaaaga ggagggcgtg tgtatgggtt gggtttgggg 961 taaaggaata agcagttttt aaaaagatgc gctatcattc attgttttga aagaaaatgt 1021 gggtattgta gaataaaaca gaaagcatta agaagagatg gaagaatgaa ctgaagctga 1081 ttgaatagag agccacatct acttgcaact gaaaagttag aatctcaaga ctcaagtacg 1141 ctactatgca cttgttttat ttcatttttc taagaaacta aaaatacttg ttaataagta (SEQ. ID. NO. 174)

CFTRlA-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GGAAGCCAAATGACATCACAGC 3' (SEQ. ID. NO. 175) CFTRlA-as : 5'TGAAAAAAAGTTTGGAGACAACGC 3' (SEQ. ID. NO. 176) CFTRlB-s : 5'CCCAGCGCCCAGAGACC 3' (SEQ. ID. NO. 177) CFTRlB-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ACTGCTTATTCCTTTACCCCAA 3' (SEQ. ID. NO. 178) CFTRl-s-tag : 5'GGGTGGTGTGCGGAGTA 3' (SEQ. ID. NO. 179) CFTRl-as-tag : 5'CAAAACAATGAATGATAGCG 3' (SEQ. ID. NO. 180) CF exon 2 1 aaaccatact attattccct cccaatccct ttgacaaagt gacagtcaca ttagttcaga 61 gatattgatg ttttatacag gtgtagcctg taagagatga agcctggtat ttatagaaat 121 tgacttattt tattctcata tttacatgtg cataattttc catatgccag aaaagttgaa 181 tagtatcaga ttccaaatct gtatggagac caaatcaagt gaatatctgt tcctcctctc 241 tttattttag CTGGACCAGA CCAATTTTGA GGAAAGGATA CAGACAGCGC CTGGAATTGT 301 CAGACATATA CCAAATCCCT TCTGTTGATT CTGCTGACAA TCTATCTGAA AAATTGGAAA 361 Ggtatgttca tgtacattgt ttagttgaag agagaaattc atattattaa ttatttagag 421 aagagaaagc aaacatatta taagtttaat tcttatattt aaaaatagga gccaagtatg 481 gtggctaatg cctgtaatcc caactatttg ggaggccaag atgagaggat tgcttgagac 541 caggagtttg ataccagcct gggcaacata gcaagatgtt atctctacac aaaataaaaa 601 gttagctggg aatggtagtg catgcttgta (SEQ. ID. NO. 181) CF2A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CCAGAAAAGTTGAATAGTATCAG 3' (SEQ. ID. NO. 182) CF2A-as : 5'AGATTGTCAGCAGAATCAA 3'(SEQ. ID. NO. 183) CFTR2-s-tag : 5'GACAGTCACATTAGTTCAG 3' (SEQ. ID. NO. 184) CFTR2-as-tag : 5'TGTTTGCTTTCTCTTCT 3'(SEQ. ID. NO. 185) CF2B-s5 : 5'ATACCAAATCCCTTCTG 3' (SEQ. ID. NO. 186) CF2B-as5 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TGCTTTCTCTTCTCTAAAT 3' (SEQ. ID. NO. 187) CF exon 3 1 aggaatctgc cagatatctg gctgagtgtt tggtgttgta tggtctccat gagattttgt 61 ctctataata cttgggttaa tctccttgga tatacttgtg tgaatcaaac tatgttaagg 121 gaaataggac aactaaaata tttgcacatg caacttattg gtcccacttt ttattctttt 181 gcagAGAATG GGATAGAGAG CTGGCTTCAA AGAAAAATCC TAAACTCATT AATGCCCTTC 241 GGCGATGTTT TTTCTGGAGA TTTATGTTCT ATGGAATCTT TTTATATTTA GGGgtaagga 301 tctcatttgt acattcatta tgtatcacat aactatatgc atttttgtga ttatgaaaag 361 actacgaaat ctggtgaata ggtgtaaaaa tataaaggat gaatccaact ccaaacacta 421 agaaaccacc taaaactcta gtaaggataa gtaa (SEQ. ID. NO. 188) CF3A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TGGTGTTGTATGGTCT 3' (SEQ. ID. NO. 189) CF3A-as : 5'AACATAAATCTCCAGAA 3' (SEQ. ID. NO. 190) CF3B-s : 5'GCTGGCTTCAAAGAAAAATCC 3' (SEQ. ID. NO. 191) CF3B-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CACCAGATTTCGTAGTCTTTTCA 3' (SEQ. ID. NO. 192) CFTR-3-s-tag : 5'TGGTGTTGTATGGTCTC 3' (SEQ. ID. NO. 193) CFTR-3-as-tag : 5'TTAGGTGGTTTCTTAGTG 3' (SEQ. ID. NO. 194)

CF exon 4 1 ccactattca ctgtttaact taaaatacct catatgtaaa cttgtctccc actgttgcta 61 taacaaatcc caagtcttat ttcaaagtac caagatattg aaaatagtgc taagagtttc 121 acatatggta tgaccctcta tataaactca ttttaagtct cctctaaaga tgaaaagtct 181 tgtgttgaaa ttctcagggt attttatgag aaataaatga aatttaattt ctctgttttt 241 ccccttttgt agGAAGTCAC CAAAGCAGTA CAGCCTCTCT TACTGGGAAG AATCATAGCT 301 TCCTATGACC CGGATAACAA GGAGGAACGC TCTATCGCGA TTTATCTAGG CATAGGCTTA 361 TGCCTTCTCT TTATTGTGAG GACACTGCTC CTACACCCAG CCATTTTTGG CCTTCATCAC 421 ATTGGAATGC AGATGAGAAT AGCTATGTTT AGTTTGATTT ATAAGAAGgt aatacttcct 481 tgcacaggcc ccatggcaca tatattctgt atcgtacatg ttttaatgtc ataaattagg 541 tagtgagctg gtacaagtaa gggataaatg ctgaaattaa tttaatatgc ctattaaata 601 aatggcagga ataattaatg ctcttaatta tccttgataa tttaattgac ttaaactgat 661 aattattgag tatc (SEQ. ID. NO. 195) CF4A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AATTTCTCTGTTTTTCCCCTT 3' (SEQ. ID. NO. 196) CF4A-as : 5'AGCTATTCTCATCTGCATTCCA 3' (SEQ. ID. NO. 197) CF4B-s : 5'GACACTGCTCCTACACC 3'(SEQ. ID. NO. 198) CF4B-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TCAGCATTTATCCCTTA 3' (SEQ. ID. NO. 199) CF4-s-tag : 5'ATAACARATCCCAAGTC 3'(SEQ. ID. NO. 200) CF4-as-tag : 5'TGTACCAGCTCACTACC 3' (SEQ. ID. NO. 201) CF exon 5 1 taattatttc tgcctagatg ctgggaaata aaacaactag aagcatgcca gtataatatt 61 gactgttgaa agaaacattt atgaacctga gaagatagta agctagatga atagaatata 121 attttcatta cctttactta ataatgaatg cataataact gaattagtca tattataatt 181 ttacttataa tatatttgta ttttgtttgt tgaaattatc taactttcca tttttctttt 241 agACTTTAAA GCTGTCAAGC CGTGTTCTAG ATAAAATAAG TATTGGACAA CTTGTTAGTC 301 TCCTTTCCAA CAACCTGAAC AAATTTGATG AAgtatgtac ctattgattt aatcttttag 361 gcactattgt tataaattat acaactggaa aggcggagtt ttcctgggtc agataatagt 421 aattagtggt taagtcttgc tcagctctag cttccctatt ctggaaacta agaaaggtca 481 attgtatagc agagcaccat tctggggtct ggtagaacca cccaactcaa aggcacctta 541 gcctgttgtt aataagattt ttcaaaactt aattcttatc agaccttgct tcttttaaac (SEQ. ID. NO. 202) CF5A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ATAATATATTTGTATTTTGTTTGTTG 3' (SEQ. ID. NO. 203) CF5A-as : 5'AATTTGTTCAGGTTGTTGGA 3' (SEQ. ID. NO. 204) CF5B-s : 5'AGCTGTCAAGCCGTGTTC 3' (SEQ. ID. NO. 205) CF5B-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ATCTGACCCAGGAAAACTC 3' (SEQ. ID. NO. 206) CF5-s-tag : 5'TGCTGGGAAATAAAAC 3' (SEQ. ID. NO. 207) CF5-as-tag : 5'AGAATGGTGCTCTGCT 3' (SEQ. ID. NO. 208) CF exon 6A 1 gacatgatac ttaagatgtc caatcttgat tccactgaat aaaaatatgc ttaaaaatgc 61 actgacttga aatttgtttt ttgggaaaac cgattctatg tgtagaatgt ttaagcacat 121 tgctatgtgc tccatgtaat gattacctag attttagtgt gctcagaacc acgaagtgtt 181 tgatcatata agctcctttt acttgctttc tttcatatat gattgttagt ttctaggggt 241 ggaagataca atgacacctg tttttgctgt gcttttattt tccagGGACT TGCATTGGCA 301 CATTTCGTGT GGATCGCTCC TTTGCAAGTG GCACTCCTCA TGGGGCTAAT CTGGGAGTTG 361 TTACAGGCGT CTGCCTTCTG TGGACTTGGT TTCCTGATAG TCCTTGCCCT TTTTCAGGCT

421 GGGCTAGGGA GAATGATGAT GAAGTACAGg tagcaaccta ttttcataac ttgaaagttt 481 taaaaattat gttttcaaaa agcccacttt agtaaaacca ggactgctct atgcatagaa 541 cagtgatctt cagtgtcatt aaattttttt tttttttttt tttgagacag agtctagatc 601 tgtcacccag gctggagtgc agtggcacga tcttggctca ctgcactgca acttctgcct 661 cccaggctca agcaattctc ctgcctcagc ctccggagta gctgggatta gaggcgcatg (SEQ. ID. NO. 209) CF6A-1-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTGTTAGTTTCTAGGGGTGG 3' (SEQ. ID. NO. 210) CF6A-l-as : 5'AAGGACTATCAGGAAACCAAG 3' (SEQ. ID. NO. 211) CF6A-2-s : 5'GCTAATCTGGGAGTTGTTAC 3' (SEQ. ID. NO. 212) CF6A-2-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AGTTATGAAAATAGGTTGCTAC 3' (SEQ. ID. NO. 213) 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGGAGAATGAT- CF6A-3-s2 : GATGAAG 3' (SEQ. ID. NO. 214) CF6A-3-as2 : 5'ACACTGAAGATCACTGTTCTA 3' (SEQ. ID. NO. 215) CF6a-s-tag : 5 CTCCTTTTACTTGCTTTC 3' (SEQ. ID. NO. 216) CF6a-as-tag : 5 GAGCAGTCCTGGTTTTA 3' (SEQ. ID. NO. 217) CF exon 6B atgagtctgtacagcgtctggcacataggaggcatttaccaaacagtagttattattttt gttaccatctatt <BR> <BR> tgataataaaataatgcccatctgttgaataaaagaaatatgacttaaaaccttgagcag ttcttaatagata atttgacttgtttttactattagattgattgattgattgattgattgatttacagAGATC AGAGAGCTGGGAA <BR> <BR> GATCAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGC ATACTGCTGGGAA<BR> <BR> <BR> <BR> GAAGCAATGGAAAAAATGATTGAAAACTTAAGACAgtaagttgttccaataatttcaata ttgttagtaattc tgtccttaattttttaaaaatatgtttatcatggtagacttccacctcatatttgatgtt tgtgacaatcaaa tgattgcatttaagttctgtcaatattcatgcattagttgca (SEQ. ID. NO. 218) CF6B-1-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CCTTGAGCAGTTCTTAATAGATA 3' (SEQ. ID. NO. 219) CF6B-l-as : 5'ATGCCTTAACAGATTGGATAT 3' (SEQ. ID. NO. 220) CF6B-2-s : 5'GAAAATATCCAATCTGTTAAG 3' (SEQ. ID. NO. 221) CF6B-2-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TGAGGTGGAAGTCTACCA 3' (SEQ. ID. NO. 222) CF6b-s-tag : 5'AAAACCTTGAGCAGTT 3' (SEQ. ID. NO. 223) CF6b-as-tag : 5'GGTGGAAGTCTACCATG 3' (SEQ. ID. NO. 224) CF exon 7 1 tttacaagta ctacaagcaa aacactggta ctttcattgt tatcttttca tataaggtaa 61 ctgaggccca gagagattaa ataacatgcc caaggtcaca caggtcatat gatgtggagc 121 caggttaaaa atataggcag aaagactcta gagaccatgc tcagatcttc cattccaaga 181 tccctgatat ttgaaaaata aaataacatc ctgaatttta ttgttattgt tttttatagA 241 ACAGAACTGA AACTGACTCG GAAGGCAGCC TATGTGAGAT ACTTCAATAG CTCAGCCTTC 301 TTCTTCTCAG GGTTCTTTGT GGTGTTTTTA TCTGTGCTTC CCTATGCACT AATCAAAGGA 361 ATCATCCTCC GGAAAATATT CACCACCATC TCATTCTGCA TTGTTCTGCG CATGGCGGTC 421 ACTCGGCAAT TTCCCTGGGC TGTACAAACA TGGTATGACT CTCTTGGAGC AATAAACAAA 481 ATACAGgtaa tgtaccataa tgctgcatta tatactatga tttaaataat cagtcaatag 541 atcagttcta atgaactttg caaaaatgtg cgaaaagata gaaaaagaaa tttccttcac 601 taggaagtta taaaagttgc cagctaatac taggaatgtt caccttaaac ttttcctagc 661 atttctctgg acagtatgat ggatgagagt ggcatttatg caaattacct taaaatccca 721 ataatactga tgtagctagc agctttgaga aa (SEQ. ID. NO. 225)

CF7A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AGACCATGCTCAGATCTTCCATT 3' (SEQ. ID. NO. 226) CF7A-as : 5'GCTGCCTTCCGAGTCAGTTTCAGT 3' (SEQ. ID. NO. 227) CF7C-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ACTGAAACTGACTCGGAAGG 3' (SEQ. ID. NO. 228) CF7C-as : 5'ATGGTACATTACCTGTATTTTGTTTA 3' (SEQ. ID. NO. 229) CF7D-s : 5'CTGTACAAACATGGTATGACTCTCTT 3' (SEQ. ID. NO. 230) CF7D-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GTGAAGGAAATTTCTTTTTCTATCT 3' (SEQ. ID. NO. 231) CF7-s-tag : 5'AATATAGGCAGAAAGACT 3' (SEQ. ID. NO. 232) CF7-as-tag : 5'GAACTGATCTATTGACTGA 3' (SEQ. ID. NO. 233) CF exon 8 1 gcacattagt gggtaattca gggttgcttt gtaaattcat cactaaggtt agcatgtaat 61 agtacaagga agaatcagtt gtatgttaaa tctaatgtat aaaaagtttt ataaaatatc 121 atatgtttag agagtatatt tcaaatatga tgaatcctag tgcttggcaa attaacttta 181 gaacactaat aaaattattt tattaagaaa taattactat ttcattatta aaattcatat 241 ataagatgta gcacaatgag agtataaagt agatgtaata atgcattaat gctattctga 301 ttctataata tgtttttgct ctcttttata aatagGATTT CTTACAAAAG CAAGAATATA 361 AGACATTGGA ATATAACTTA ACGACTACAG AAGTAGTGAT GGAGAATGTA ACAGCCTTCT 421 GGGAGGAGgt cagaattttt aaaaaattgt ttgctctaaa cacctaactg ttttcttctt 481 tgtgaatatg gatttcatcc taatggcgaa taaaattaga atgatgatat aactggtaga 541 actggaagga ggatcactca cttattttct agattaagaa gtagaggaat ggccaggtgc 601 tcatggttgt aatcccagca ctttcgggag accaaggcgg gtggatcacc tgaggtcagg 661 agttcaagac cagcctgcca acatggtaaa acccggtctc tactaaaaat acaaaaaatt 721 aactg (SEQ. ID. NO. 234) CF8A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GCACAATGAGAGTATAAAGTAG 3' (SEQ. ID. NO. 235) CF8A-as : 5'CCATCACTACTTCTGTAGTCG 3' (SEQ. ID. NO. 236) CF8B-s2 : 5'CTCTCTTTTATAAATAGGATTTCTTAC 3' (SEQ. ID. NO. 237) CF8B-as2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTCCAGTTCTACCAGTTATATCATC 3' (SEQ. ID. NO. 238) CF8-s-tag : 5'ATGAATCCTAGTGCTTG 3' (SEQ. ID. NO. 239) CF8-as-tag : 5'TCCTTCCAGTTCTACC 3' (SEQ. ID. NO. 240) CF exon 9 181 tgtatgtgta tgtatacatg tatgtattca gtctttactg aaattaaaaa atctttaact 241 tgataatggg caaatatctt agttttagat catgtcctct agaaaccgta tgctatataa 301 ttatgtacta taaagtaata atgtatacag tgtaatggat catgggccat gtgcttttca 361 aactaattgt acataaaaca agcatctatt gaaaatatct gacaaactca tcttttattt 421 ttgatgtgtg tgtgtgtgtg tgtgtgtgtt tttttaacag GGATTTGGGG AATTATTTGA 481 GAAAGCAAAA CAAAACAATA ACAATAGAAA AACTTCTAAT GGTGATGACA GCCTCTTCTT 541 CAGTAATTTC TCACTTCTTG GTACTCCTGT CCTGAAAGAT ATTAATTTCA AGATAGAAAG 601 AGGACAGTTG TTGGCGGTTG CTGGATCCAC TGGAGCAGGC AAGgtagttc ttttgttctt 661 cactattaag aacttaattt ggtgtccatg tctctttttt tttctagttt gtagtgctgg 721 aaggtatttt tggagaaatt cttacatgag cattaggaga atgtatgggt gtagtgtctt 781 gtataataga aattgttcca ctgataattt actctagttt tttatttcct catattattt 841 tcagtggctt tttcttccac atctttatat tttgcaccac attcaacact gtatcttgca 901 catggcgagc attcaataac tttattgaat aaacaaatca tccattttat ccattcttaa 961 ccagaacaga cattttttca gagctggtcc aggaaaatca tgacttacat tttgccttag 1021 taaccacata aacaaaaagt ctccattttt gttgac (SEQ. ID. NO. 241)

CF9C-s : 58 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ACAATAGAAAAACTTCTAATGGTGA 3' (SEQ. ID. NO. 242) CF9C-as : 5'AAAAAAGAGACATGGACACCAA 3' (SEQ. ID. NO. 243) CF9-s-tag : 5'AGAAACCGTATGCTAT 3' (SEQ. ID. NO. 244) CF9-as-tag : 5'CCCATACATTCTCCTA 3' (SEQ. ID. NO. 245) CF9-as2-tag : 5'TAAAGATGTGGAAGAAA 3' (SEQ. ID. NO. 246) CF exon 10 1 cactgtagct gtactacctt ccatctcctc aacctattcc aactatctga atcatgtgcc 61 cttctctgtg aacctctatc ataatacttg tcacactgta ttgtaattgt ctcttttact 121 ttcccttgta tcttttgtgc atagcagagt acctgaaaca ggaagtattt taaatatttt 181 gaatcaaatg agttaataga atctttacaa ataagaatat acacttctgc ttaggatgat 241 aattggaggc aagtgaatcc tgagcgtgat ttgataatga cctaataatg atgggtttta 301 tttccagACT TCACTTCTAA TGATGATTAT GGGAGAACTG GAGCCTTCAG AGGGTAAAAT 361 TAAGCACAGT GGAAGAATTT CATTCTGTTC TCAGTTTTCC TGGATTATGC CTGGCACCAT 421 TAAAGAAAAT ATCATCTTTG GTGTTTCCTA TGATGAATAT AGATACAGAA GCGTCATCAA 481 AGCATGCCAA CTAGAAGAGg taagaaacta tgtgaaaact ttttgattat gcatatgaac 541 ccttcacact acccaaatta tatatttggc tccatattca atcggttagt ctacatatat 601 ttatgtttcc tctatgggta agctactgtg aatggatcaa ttaataaaac acatgaccta 661 tgctttaaga agcttgcaaa cacatgaaat aaatgcaatt tattttttaa ataatgggtt 721 catttgatca caataaatgc attttatgaa atggtgagaa ttttgttcac tcattagtga 781 gacaaacgtc tcaatggtta tttatatggc atgcatatag tgatatgtgg t (SEQ. ID. NO. 247) CF10-s : 5'CCTGAGCGTGATTTGATA 3' (SEQ. ID. NO. 248) CF10-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ATGTAGACTAACCGATTGAA 3' (SEQ. ID. NO. 249) CFlOC-s : 5'GGGAGAACTGGAGCCT 3' (SEQ. ID. NO. 250) CFlOC-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AACCGATTGAATATGGAG 3' (SEQ. ID. NO. 251) CF10-s2-tag : 5'CCTTGTATCTTTTGTGC 3' (SEQ. ID. NO. 252) CF10-as2-tag : 5'CCGATTGAATATGGAG 3' (SEQ. ID. NO. 253) CF exon 11 1 atatacccat aaatatacac atattttaat ttttggtatt ttataattat tatttaatga 61 tcattcatga cattttaaaa attacaggaa aaatttacat ctaaaatttc agcaatgttg 121 tttttgacca actaaataaa ttgcatttga aataatggag atgcaatgtt caaaatttca 181 actgtggtta aagcaatagt gtgatatatg attacattag aaggaagatg tgcctttcaa 241 attcagattg agcatactaa aagtgactct ctaattttct atttttggta atagGACATC 301 TCCAAGTTTG CAGAGAAAGA CAATATAGTT CTTGGAGAAG GTGGAATCAC ACTGAGTGGA 361 GGTCAACGAG CAAGAATTTC TTTAGCAAGg tgaataacta attattggtc tagcaagcat 421 ttgctgtaaa tgtcattcat gtaaaaaaat tacagacatt tctctattgc tttatattct 481 gtttctggaa ttgaaaaaat cctggggttt tatggctagt gggttaagaa tcacatttaa 541 gaactataaa taatggtata gtatccagat ttggtagaga ttatggttac tcagaatctg 601 tgcccgtatc ttgg (SEQ. ID. NO. 254) CFllA-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GATATATGATTACATTAGAAG 3' (SEQ. ID. NO. 255) CFllA-as : 5'ACCTTCTCCAAGAACTA 3' (SEQ. ID. NO. 256) CFllB-s : 5'ATAGGACATCTCCAAGTT 3' (SEQ. ID. NO. 257) CFllB-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GCAATAGAGAAATGTCTGT 3' (SEQ. ID. NO. 258)

CFll-s-tag : 5'CAGATTGAGCATACTAAAAG 3' (SEQ. ID. NO. 259) CFll-as-tag : 5'AAGATACGGGCACAGA 3' (SEQ. ID. NO. 260) CF exon 12 1 cttacagtta gcaaaatcac ttcagcagtt cttggaatgt tgtgaaaagt gataaaaatc 61 ttctgcaact tattccttta ttcctcattt aaaataatct accatagtaa aaacatgtat 121 aaaagtgcta cttctgcacc acttttgaga atagtgttat ttcagtgaat cgatgtggtg 181 accatattgt aatgcatgta gtgaactgtt taaggcaaat catctacact agatgaccag 241 gaaatagaga ggaaatgtaa tttaatttcc attttctttt tagAGCAGTA TACAAAGATG 301 CTGATTTGTA TTTATTAGAC TCTCCTTTTG GATACCTAGA TGTTTTAACA GAAAAAGAAA 361 TATTTGAAAG gtatgttctt tgaatacctt acttataatg ctcatgctaa aataaaagaa 421 agacagactg tcccatcata gattgcattt tacctcttga gaaatatgtt caccattgtt 481 ggtatggcag aatgtagcat ggtattaact caaatctgat ctgccctact gggccaggat 541 tcaagattac ttccattaaa accttttctc accgcctcat gctaaaccag tttctctcat 601 tgctatactg ttatagcaat tgctatctat gtagtttttg cagtatcatt gccttgtgat 661 atatattact ttaatt (SEQ. ID. NO. 261) CF12-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GTGAACTGTTTAAGGCAAATCAT 3' (SEQ. ID. NO. 262) CF12-as : 5'TGATGGGACAGTCTGTCTTTC 3' (SEQ. ID. NO. 263) CF12-s-tag : 5'TCACTTCAGCAGTTCTT 3' (SEQ. ID. NO. 264) CF12-as-tag : 5'CAATCTATGATGGGACA 3' (SEQ. ID. NO. 265) CF exon 13 1 gaattcacaa ggtaccaatt taattactac agagtactta tagaatcatt taaaatataa 61 taaaattgta tgatagagat tatatgcaat aaaacattaa caaaatgcta aaatacgaga 121 catattgcaa taaagtattt ataaaattga tatttatatg tttttatatc ttaaagCTGT 181 GTCTGTAAAC TGATGGCTAA CAAAACTAGG ATTTTGGTCA CTTCTAAAAT GGAACATTTA 241 AAGAAAGCTG ACAAAATATT AATTTTGCAT GAAGGTAGCA GCTATTTTTA TGGGACATTT 301 TCAGAACTCC AAAATCTACA GCCAGACTTT AGCTCAAAAC TCATGGGATG TGATTCTTTC 361 GACCAATTTA GTGCAGAAAG AAGAAATTCA ATCCTAACTG AGACCTTACA CCGTTTCTCA 421 TTAGAAGGAG ATGCTCCTGT CTCCTGGACA GAAACAAAAA AACAATCTTT TAAACAGACT 481 GGAGAGTTTG GGGAAAAAAG GAAGAATTCT ATTCTCAATC CAATCAACTC TATACGAAAA 541 TTTTCCATTG TGCAAAAGAC TCCCTTACAA ATGAATGGCA TCGAAGAGGA TTCTGATGAG 601 CCTTTAGAGA GAAGGCTGTC CTTAGTACCA GATTCTGAGC AGGGAGAGGC GATACTGCCT 661 CGCATCAGCG TGATCAGCAC TGGCCCCACG CTTCAGGCAC GAAGGAGGCA GTCTGTCCTG 721 AACCTGATGA CACACTCAGT TAACCAAGGT CAGAACATTC ACCGAAAGAC AACAGCATCC 781 ACACGAAAAG TGTCACTGGC CCCTCAGGCA AACTTGACTG AACTGGATAT ATATTCAAGA 841 AGGTTATCTC AAGAAACTGG CTTGGAAATA AGTGAAGAAA TTAACGAAGA AGACTTAAAG 901 gtaggtatac atcgcttggg ggtatttcac cccacagaat gcaattgagt agaatgcaat 961 atgtagcatg taacaaaatt tactaaaatc ataggattag gataaggtgt atcttaaaac 1021 tcagaaagta tgaagttcat taattataca agcaacgtta aaatgtaaaa taacaaatga 1081 tttctttttg caatggacat atctcttccc ataaaatggg aaaggattta gtttttggtc 1141 ctctactaag ccagtgataa ctgtgactat agttagaaag catttgcttt attaccatct (SEQ. ID. NO. 266) CFTR13A-s : 5'AATACGAGACATATTGCAATAAAGT 3' (SEQ. ID. NO. 267) CFTR13A-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CTGGCTGTAGATTTTGGAGTTC 3' (SEQ. ID. NO. 268) CF13B-s3 : 5'AGGTAGCAGCTATTTTT 3' (SEQ. ID. NO. 269) CF13B-as3 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GGACAGCCTTCTCTCTA 3' (SEQ. ID. NO. 270) CFTR13C-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGGGACATTTTC- AGAACTCC 3' (SEQ. ID. NO. 271) CFTR13C-as : 5'CCTCTTCGATGCCATTCAT 3' (SEQ. ID. NO. 272)

CFTR13D-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAATCCAATCAAC- TCTATACGAA 3' (SEQ. ID. NO. 273) CFTR13D-as : 5'CTGATCACGCTGATGCGA 3' (SEQ. ID. NO. 274) 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCG CFTR13E-s : CCCGTGATGAGCCTTTAGAGAGAA 3' (SEQ. ID. NO. 275) CFTR13E-as : 5'CCAGTTCAGTCAAGTTTGC 3' (SEQ. ID. NO. 276) 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGCGTGAT CF13F-s2 : CAGCA 3' (SEQ. ID. NO. 277) CF13F-as2 : 5'TTTGTTACATGCTACATA 3' (SEQ. ID. NO. 278) CF exon 14A 1 ggaaacttca tttagatggt atcattcatt tgataaaagg tatgccactg ttaagccttt 61 aatggtaaaa ttgtccaata ataatacagt tatataatca gtgatacatt tttagaattt 121 tgaaaaatta cgatgtttct catttttaat aaagctgtgt tgctccagta gacattattc 181 tggctataga atgacatcat acatggcatt tataatgatt tatatttgtt aaaatacact 241 tagattcaag taatactatt cttttatttt catatattaa aaataaaacc acaatggtgg 301 catgaaactg tactgtctta ttgtaatagc cataattctt TTATTCAGGA GTGCTTTTTT 361 GATGATATGG AGAGCATACC AGCAGTGACT ACATGGAACA CATACCTTCG ATATATTACT 421 GTCCACAAGA GCTTAATTTT TGTGCTAATT TGGTGCTTAG TAATTTTTCT GGCAGAGgta 481 agaatgttct attgtaaagt attactggat ttaaagttaa attaagatag tttggggatg 541 tatacatata tatgcacaca cataaatatg tatatataca catgtataca tgtataagta 601 tgcatatata cacacatata tcactatatg tatatatgta tatattacat atatttgtga 661 ttttacagta tataatggta tagattcata tagttcttag cttctgaaaa atcaacaagt 721 agaaccacta ctga (SEQ. ID. NO. 279) CFTR14A-1-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTCATATATTAAAAATAAAACC 3' (SEQ. ID. NO. 280) CFTR14A-l-as : 5'TAATATATCGAAGGTATGTGT 3' (SEQ. ID. NO. 281) CFTR14A-2-s : 5'GAGCATACCAGCAGTGACTACA 3' (SEQ. ID. NO. 282) CFTR14A-2-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GTAATACTTTACAATAGAACATTCTTACC 3' (SEQ. ID. NO. 283) CFTR14A-3-s : 5'ACCAGCAGTGACTACATGGA 3' (SEQ. ID. NO. 284) CFTR14A-3-as : 5'ATATTTATGTGTGTGCATATATATGTAT 3' (SEQ. ID. NO. 285) CF14A-s-tag : 5'TGTTGCTCCAGTAGACA 3' (SEQ. ID. NO. 286) CF14A-as-tag : 5'CATCCCCAAACTATCT 3' (SEQ. ID. NO. 287) CF exon 14B 1 gaattccatt aacttaatgt ggtctcatca caaataatag tacttagaac acctagtaca 61 gctgctggac ccaggaacac aaagcaaagg aagatgaaat tgtgtgtacc ttgatattgg 121 tacacacatc aaatggtgtg atgtgaattt agatgtgggc atgggaggaa taggtgaaga 181 tgttagaaaa aaaatcaact gtgtcttgtt ccattccagG TGGCTGCTTC TTTGGTTGTG 241 CTGTGGCTCC TTGGAAAgtg agtattccat gtcctattgt gtagattgtg ttttatttct 301 gttgattaaa tattgtaatc cactatgttt gtatgtattg taatccactt tgtttcattt 361 ctcccaagca ttatggtagt ggaaagataa ggttttttgt ttaaatgatg accattagtt 421 gggtgaggtg acacattcct gtagtcctag ctcctccaca ggctgacgca ggaggatcac 481 ttgagcccag gagttcaggg ctgtagtgtt gtatcattgt gagtagccac caccgcactc 541 cagcctggac aatatagtga gatcctatat ctaaaataaa ataaaataaa atgaataaat 601 tgtgagcatg tgcagctcct g (SEQ. ID. NO. 288)

CFTR14B-1-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GTGTACCTTGATATTGG 3' (SEQ. ID. NO. 289) CFTR14B-l-as : 5'CTCACTTTCCAAGGAG 3' (SEQ. ID. NO. 290) CF14B-3-s : 5'GCTGTGGCTCCTTGG 3' (SEQ. ID. NO. 291) CF14B-3-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- ACTACAGCCCTGAACTCC 3' (SEQ. ID. NO. 292) CF14B-s-tag : 5'GGAACACAAAGCAAAG 3' (SEQ. ID. NO. 293) CF14B-as-tag : 5'TGGGAGAAATGAAACA 3' (SEQ. ID. NO. 294) CF exon 15 1 tcctatatct aaataaataa ataaatgaat aaattgtgag catgtgcagc tcctgcagtt 61 tctaaagaat atagttctgt tcagtttctg tgaaacacaa taaaaatatt tgaaataaca 121 ttacatattt agggttttct tcaaattttt taatttaata aagaacaact caatctctat 181 caatagtgag aaaacatatc tattttcttg caataatagt atgattttga ggttaagggt 241 gcatgctctt ctaatgcaaa atattgtatt tatttagact caagtttagt tccatttaca 301 tgtattggaa attcagtaag taactttggc tgccaaataa cgatttccta tttgctttac 361 agCACTCCTC TTCAAGACAA AGGGAATAGT ACTCATAGTA GAAATAACAG CTATGCAGTG 421 ATTATCACCA GCACCAGTTC GTATTATGTG TTTTACATTT ACGTGGGAGT AGCCGACACT 481 TTGCTTGCTA TGGGATTCTT CAGAGGTCTA CCACTGGTGC ATACTCTAAT CACAGTGTCG 541 AAAATTTTAC ACCACAAAAT GTTACATTCT GTTCTTCAAG CACCTATGTC AACCCTCAAC 601 ACGTTGAAAG CAGgtacttt actaggtcta agaaatgaaa ctgctgatcc accatcaata 661 gggcctgtgg ttttgttggt tttctaatgg cagtgctggc ttttgcacag aggcatgtgc 721 ctttgtt (SEQ. ID. NO. 295) 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATGTATTGGAA CFTR15A-s : ATTCAGTAAGTAAC 3' (SEQ. ID. NO. 296) CFTR15A-as : 5'TTCGACACTGTGATTAGAGTATGC 3' (SEQ. ID. NO. 297) CFTR15B-s : 5'GTGGGAGTAGCCGACA 3' (SEQ. ID. NO. 298) CFTR15B-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CAGGCCCTATTGATGGT 3' (SEQ. ID. NO. 299) CF15B-s2 : 5'CGTGGGAGTAGCCGAC 3' (SEQ. ID. NO. 300) CF15B-as2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CATTAGAAAACCAACAAA 3' (SEQ. ID. NO. 301) CF15-s-tag : 5'AGACTCAAGTTTAGTTCCA 3' (SEQ. ID. NO. 302) CF15-as-tag : 5'CCAACAAAACCACAGG 3' (SEQ. ID. NO. 303) CF exon 16 1 gtaagattgt aagcaggatg agtacccacc tattcctgac ataatttata gtaaaagcta 61 tttcagagaa attggtcgtt acttgaatct tacaagaatc tgaaactttt aaaaaggttt 121 aaaagtaaaa gacaataact tgaacacata attatttaga atgtttggaa agaaacaaaa 181 atttctaagt ctatctgatt ctatttgcta attcttattt gggttctgaa tgcgtctact 241 gtgatccaaa cttagtattg aatatattga tatatcttta aaaaattagt gttttttgag 301 gaatttgtca tcttgtatat tatagGTGGG ATTCTTAATA GATTCTCCAA AGATATAGCA 361 ATTTTGGATG ACCTTCTGCC TCTTACCATA TTTGACTTCA TCCAGgtatg taaaaataag 421 taccgttaag tatgtctgta ttattaaaaa aacaataaca aaagcaaatg tgattttgtt 481 ttcatttttt atttgattga gggttgaagt cctgtctatt gcattaattt tgtaattatc 541 caaagccttc aaaatagaca taagtttagt aaattcaata ataagtcaga actgcttacc 601 tggcccaaac ctgaggcaat cccacattta gatgtaatag ctgtctactt gggagtgatt 661 tgagaggcac aaaggaccat ctttcccaaa atcactggca c (SEQ. ID. NO. 304)

5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGAATGCGTCT- CF16A-s5 ACTG 3' (SEQ. ID. NO. 305) CF16A-as5 5'CATCCAAAATTGCTATA 3' (SEQ. ID. NO. 306) CFTR16B-s : 5'TTGAGGAATTTGTCATCTTGTAT 3' (SEQ. ID. NO. 307) CFTR16B-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CAAAATCACATTTGCTTTTGTTA 3' (SEQ. ID. NO. 308) CF16-s-tag : 5'ATGCGTCTACTGTGATC 3' (SEQ. ID. NO. 309) CF16-as-tag : 5'CTTCAACCCTCAATCA 3' (SEQ. ID. NO. 310) CF exon 17A 1 agtgcaccag catggcacat gtatacatat gtaactaacc tcgacaatgt gcacatgtac 61 cctaaaactt aaagtataat aaaaaaaata aaaaaaagtt tgaggtgttt aaagtatgca 121 aaaaaaaaaa aagaaataaa tcactgacac actttgtcca ctttgcaatg tgaaaatgtt 181 tactcaccaa catgttttct ttgatcttac agTTGTTATT AATTGTGATT GGAGCTATAG 241 CAGTTGTCGC AGTTTTACAA CCCTACATCT TTGTTGCAAC AGTGCCAGTG ATAGTGGCTT 301 TTATTATGTT GAGAGCATAT TTCCTCCAAA CCTCACAGCA ACTCAAACAA CTGGAATCTG 361 AAGgtatgac agtgaatgtg cgatactcat cttgtaaaaa agctataaga gctatttgag 421 attctttatt gttaatctac ttaaaaaaaa ttctgctttt aaacttttac atcatataac 481 aataattttt ttctacatgc atgtgtatat aaaaggaaac tatattacaa agtacacatg 541 gatttttttt cttaattaat gaccatgtga cttcattttg gttttaaaat aggtatatag 601 aatcttacca cagttggtgt acaggacatt catttat (SEQ. ID. NO. 311) CF17A-1-s6 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AAAGAAATAAATCACTGA 3' (SEQ. ID. NO. 312) CF17A-l-as6 : 5'GTAAAACTGCGACAAC 3' (SEQ. ID. NO. 313) CFTR17A-2-s : 5'CCAACATGTTTTCTTTGATCTTACAG 3' (SEQ. ID. NO. 314) CFTR17A-2-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AGAATCTCAAATAGCTCTTATAGCTTT 3' (SEQ. ID. NO. 315) CF17A-s-tag : 5'AAATAAATCACTGACACAC 3' (SEQ. ID. NO. 316) CF17A-as-tag : 5'AATGAAGTCACATGGTC 3' (SEQ. ID. NO. 317) CF exon 17B 1 ttcaaagaat ggcaccagtg tgaaaaaaag ctttttaacc aatgacattt gtgatatgat 61 tattctaatt tagtcttttt caggtacaag atattatgaa aattacattt tgtgtttatg 121 ttatttgcaa tgttttctat ggaaatattt cacagGCAGG AGTCCAATTT TCACTCATCT 181 TGTTACAAGC TTAAAAGGAC TATGGACACT TCGTGCCTTC GGACGGCAGC CTTACTTTGA 241 AACTCTGTTC CACAAAGCTC TGAATTTACA TACTGCCAAC TGGTTCTTGT ACCTGTCAAC 301 ACTGCGCTGG TTCCAAATGA GAATAGAAAT GATTTTTGTC ATCTTCTTCA TTGCTGTTAC 361 CTTCATTTCC ATTTTAACAA CAGgtactat gaactcatta actttagcta agcatttaag 421 taaaaaattt tcaatgaata aaatgctgca ttctataggt tatcaatttt tgatatcttt 481 agagtttagt aattaacaaa tttgttggtt tattattgaa caagtgattt ctttgaaatt 541 tccattgttt tattgttaaa caaataattt ccttgaaatc ggtatatata tatatatagt (SEQ. ID. NO. 318) CFTR17B-1-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTAACCAATGACATTTGTGATA 3' (SEQ. ID. NO. 319) CFTR17B-l-as : 5'GTGTCCATAGTCCTTTTAAGC 3' (SEQ. ID. NO. 320) CF17B-2-s2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AATATTTCACAGGCAG 3' (SEQ. ID. NO. 321) CF17B-2-as2 : 5'TGAAGGTAACAGCAAT 3' (SEQ. ID. NO. 322)

CFTR17B-3-s : 5'ACTTCGTGCCTTCGGAC 3' (SEQ. ID. NO. 323) CFTR17B-3-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CAGCAATGAAGAAGATGACAAA 3' (SEQ. ID. NO. 324) CFTR17B-4-s : 5'CTGGTTCCAAATGAGAA 3' (SEQ. ID. NO. 325) CFTR17B-4-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TAACCTATAGAATGCAGCA 3' (SEQ. ID. NO. 326) CF exon 18 1 ttattactta tagaataata gtagaagaga caaatatggt acctacccat taccaacaac 61 acctccaata ccagtaacat tttttaaaaa gggcaacact ttcctaatat tcaatcgctc 121 tttgatttaa aatcctggtt gaatacttac tatatgcaga gcattattct attagtagat 181 gctgtgatga actgagattt aaaaattgtt aaaattagca taaaattgaa atgtaaattt 241 aatgtgatat gtgccctagg agaagtgtga ataaagtcgt tcacagaaga gagaaataac 301 atgaggttca tttacgtctt ttgtgcatct atagGAGAAG GAGAAGGAAG AGTTGGTATT 361 ATCCTGACTT TAGCCATGAA TATCATGAGT ACATTGCAGT GGGCTGTAAA CTCCAGCATA 421 GATGTGGATA GCTTGgtaag tcttatcatc tttttaactt ttatgaaaaa aattcagaca 481 agtaacaaag tatgagtaat agcatgagga agaactatat accgtatatt gagcttaaga 541 aataaaacat tacagataaa ttgagggtca ctgtgtatct gtcattaaat ccttatctct 601 tctttccttc tcatagatag ccactatgaa gatctaatac tgcagtgagc attctttcac 661 ctgtttcctt attcaggatt ttctaggaga aatacctagg ggttgtattg ctgggtcata 721 ggattcaccc atgcttaac (SEQ. ID. NO. 327) CFTR18A-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTAATGTGATATGTGCCCTA 3' (SEQ. ID. NO. 328) CFTR18A-as : 5'AGATGATAAGACTTACCAAGC 3' (SEQ. ID. NO. 329) CFTR18B-s : 5'GAGAAGGAGAAGGAAGAGTTG 3' (SEQ. ID. NO. 330) CFTR18B-as : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CTTCCTCATGCTATTACTCATAC 3' (SEQ. ID. NO. 331) CF18-s-tag : 5'CCTGGTTGAATACTTACT 3' (SEQ. ID. NO. 332) CF18-as-tag : 5'CTCATACTTTGTTACTTGTC 3' (SEQ. ID. NO. 333) CF exon 19 1 ttctcttcag ttaaactttt aattatatcc aattatttcc tgttagttca ttgaaaagcc 61 cgacaaataa ccaagtgaca aatagcaagt gttgcatttt acaagttatt ttttaggaag 121 catcaaacta attgtgaaat tgtctgccat tcttaaaaac aaaaatgttg ttatttttat 181 ttcagATGCG ATCTGTGAGC CGAGTCTTTA AGTTCATTGA CATGCCAACA GAAGGTAAAC 241 CTACCAAGTC AACCAAACCA TACAAGAATG GCCAACTCTC GAAAGTTATG ATTATTGAGA 301 ATTCACACGT GAAGAAAGAT GACATCTGGC CCTCAGGGGG CCAAATGACT GTCAAAGATC 361 TCACAGCAAA ATACACAGAA GGTGGAAATG CCATATTAGA GAACATTTCC TTCTCAATAA 421 GTCCTGGCCA GAGGgtgaga tttgaacact gcttgctttg ttagactgtg ttcagtaagt 481 gaatcccagt agcctgaagc aatgtgttag cagaatctat ttgtaacatt attattgtac 541 agtagaatca atattaaaca cacatgtttt attatatgga gtcattattt ttaatatgaa 601 atttaatttg cagagtctga actatatat (SEQ. ID. NO. 334) CF19A-s2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- (SEQ. ID. NO. 335) CF19A-as : 5'GAACTTAAAGACTCGGCTC 3' (SEQ. ID. NO. 336) CF19B-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GAAATTGTCTGCCATTCTTAA 3' (SEQ. ID. NO. 337) CF19B-as : 5'GAGTTGGCCATTCTTGTATG 3' (SEQ. ID. NO. 338)

CF19C-s3 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TGTGAGCCGAGTCTTT 3' (SEQ. ID. NO. 339) CF19C-as2 : 5'ATGGCATTTCCACCTT 3' (SEQ. ID. NO. 340) CF19D-s2 : 5'CGTGAAGAAAGATGAC 3' (SEQ. ID. NO. 341) CF19D-as2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TAATGTTACAAATAGATTC 3' (SEQ. ID. NO. 342) CF19-s-tag : 5 GACAhATAACCAAGTGAC 3' (SEQ. ID. NO. 343) CF19-as-tag : 5 AACACATTGCTTCAGG 3' (SEQ. ID. NO. 344) CF intron 19 29941 acttaactgc tttctccatt tgtagtctct tgaaaataca gaaatttcag aaataattta 30001 taagaatatc aaggattcaa atcatatcag cacaaacacc taaatacttg tttgctttgt 30061 taaacacata tcccattttc tatcttgata aacattggtg taaagtagtt gaatcattca 30121 gtgggtataa gcagcatatt ctcaatacta tgtttcatta ataattaata gagatatatg 30181 aacacataaa agattcaatt ataatcacct tgtggatcta aatttcagtt gacttgtcat 30241 cttgatttct ggagaccaca aggtaatgaa aaataattac aagagtcttc catctgttgc 30301 agtattaaaa tggCgagtaa gacaccctga aaggaaatgt tctattcatg gtacaatgca 30361 attacagcta gcaccaaatt caacactgtt taactttcaa catattattt tgatttatct 30421 tgatccaaca ttctcaggga ggaggtgcat tgaagttatt agaaaacact gacttagatt 30481 tagggtatgt cttaaaagct tatttgcggg aagtactcta gccttattca acagatcact 30541 gagaagcctg gaaaaacaaa tcccggaaac taattattat gtgccagtta tataaacaag 30601 aagactttgt tgggtacaaa ccagtgattc cttgcctttg aaaaatgtgt cagatatcat (SEQ. ID. NO. 345) 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTTGATTTCTG- CF19i-s2 : GAGAC 3' (SEQ. ID. NO. 346) CF19i-as2 : 5'CTAGCTGTAATTGCAT 3' (SEQ. ID. NO. 347) CF19i-sl tag : 5'tagAGTGGGTATAAGCAGC 3' (SEQ. ID. NO. 348) CF19i-asl tag : 5'tagGTTGAATAAGGCTAGAGTA 3' (SEQ. ID. NO. 349) CF exon 20 1 aaaggtcagt gataaaggaa gtctgcatca ggggtccaat tccttatggc cagtttctct 61 attctgttcc aaggttgttt gtctccatat atcaacattg gtcaggattg aaagtgtgca 121 acaaggtttg aatgaataag tgaaaatctt ccactggtga caggataaaa tattccaatg 181 gtttttattg aagtacaata ctgaattatg tttatggcat ggtacctata tgtcacagaa 241 gtgatcccat cacttttacc ttatagGTGG GCCTCTTGGG AAGAACTGGA TCAGGGAAGA 301 GTACTTTGTT ATCAGCTTTT TTGAGACTAC TGAACACTGA AGGAGAAATC CAGATCGATG 361 GTGTGTCTTG GGATTCAATA ACTTTGCAAC AGTGGAGGAA AGCCTTTGGA GTGATACCAC 421 AGgtgagcaa aaggacttag ccagaaaaaa ggcaactaaa ttatattttt tactgctatt 481 tgatacttgt actcaagaaa ttcatattac tctgcaaaat atatttgtta tgcattgctg 541 tctttttttt ctccagtgca gttttctcat aggcagaaaa gatgtctcta aaagtttggg (SEQ. ID. NO. 350) CFTR20-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GAATTATGTTTATGGCATGGT 3' (SEQ. ID. NO. 351) CFTR20-as : 5'GAGTACAAGTATCAAATAGCAGTAA 3' (SEQ. ID. NO. 352) CF20-s-tag : 5 ARATCTTCCACTGGTGA 3' (SEQ. ID. NO. 353) CF20-as-tag : 5 GACATCTTTTCTGCCTAT 3' (SEQ. ID. NO. 354) 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGAATTAT- new 20-s : GTTTATGGCA3' (SEQ. ID. NO. 355) new 20-as : 5'CCTTTTTTCTGGCTAAGT3' (SEQ. ID. NO. 356)

CF exon 21 1 tttttaatat tctacaatta acaattatct caatttcttt attctaaaga cattggatta 61 gaaaaatgtt cacaagggac tccaaatatt gctgtagtat ttgtttctta aaagaatgat 121 acaaagcaga catgataaaa tattaaaatt tgagagaact tgatggtaag tacatgggtg 181 tttcttattt taaaataatt tttctacttg aaatatttta caatacaata agggaaaaat 241 aaaaagttat ttaagttatt catactttct tcttcttttc ttttttgcta tagAAAGTAT 301 TTATTTTTTC TGGAACATTT AGAAAAAACT TGGATCCCTA TGAACAGTGG AGTGATCAAG 361 AAATATGGAA AGTTGCAGAT GAGgtaaggc tgctaactga aatgattttg aaaggggtaa 421 ctcataccaa cacaaatggc tgatatagct gacatcattc tacacacttt gtgtgcatgt 481 atgtgtgtgc acaactttaa aatggagtac cctaacatac ctggagcaac aggtactttt 541 gactggacct acccctaact gaaatgattt tgaaagaggt aactcatacc aacacaaatg 601 gttgatatgg ctaagatcat tctacacact ttgtgtgcat gtatttctgt gcacaacttc 661 aaaatggagt accctaaaat acctggcgcg acaagtactt ttgactgagc ctactt (SEQ. ID. NO. 357) CF21A-s2 : 5'ATGGTAAGTACATGGGTGTT 3' (SEQ. ID. NO. 358) CF21A-as2 : 5'CCACTGTTCATAGGGATCCAAG 3' (SEQ. ID. NO. 359) CF21B-s3 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTTCTGGAACATTTAG 3' (SEQ. ID. NO. 360) CF21B-as3 : 5'GAATGATGTCAGCTATAT 3' (SEQ. ID. NO. 361) CF21-s-tag : 5'TGTTCACAAGGGACTC 3' (SEQ. ID. NO. 362) CF21-as-tag : 5'CAGTTAGGGGTAGGTC 3' (SEQ. ID. NO. 363) CF 21A-s3 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- AGTTATTCATACTTTCTTCT 3' (SEQ. ID. NO. 364) CF21A-as3 : 5'AGCCTTACCTCATCTG 3' (SEQ. ID. NO. 365) CF exon 22 1 cacagttgac tattttatgc tatcttttgt cctcagtcat gacagagtag aagatgggag 61 gtagcaccaa ggatgatgtc atacctccat cctttatgct acattctatc ttctgtctac 121 ataagatgtc atactagagg gcatatctgc aatgtataca tattatcttt tccagcatgc 181 attcagttgt gttggaataa tttatgtaca cctttataaa cgctgagcct cacaagagcc 241 atgtgccacg tattgtttct tactactttt ggatacctgg cacgtaatag acactcattg 301 aaagtttcct aatgaatgaa gtacaaagat aaaacaagtt atagactgat tcttttgagc 361 tgtcaaggtt gtaaatagac ttttgctcaa tcaattcaaa tggtggcagg tagtgggggt 421 agagggattg gtatgaaaaa cataagcttt cagaactcct gtgtttattt ttagaatgtc 481 aactgcttga gtgtttttaa ctctgtggta tctgaactat cttctctaac tgcagGTTGG 541 GCTCAGATCT GTGATAGAAC AGTTTCCTGG GAAGCTTGAC TTTGTCCTTG TGGATGGGGG 601 CTGTGTCCTA AGCCATGGCC ACAAGCAGTT GATGTGCTTG GCTAGATCTG TTCTCAGTAA 661 GGCGAAGATC TTGCTGCTTG ATGAACCCAG TGCTCATTTG GATCCAGTgt gagtttcaga 721 tgttctgtta cttaatagca cagtgggaac agaatcatta tgcctgcttc atggtgacac 781 atatttctat taggctgtca tgtctgcgtg tgggggtctc ccaagatatg aaataattgc 841 ccagtggaaa tgagcataaa tgcatatttc cttgctaaga gttcttgtgt tttcttccga 901 agatagtttt (SEQ. ID. NO. 366) CFTR22A-s2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TGAGCTGTCAAGGTTGTA 3' (SEQ. ID. NO. 367) CFTR22A-as2 : 5'CAGGAAACTGTTCTATCAC 3' (SEQ. ID. NO. 368) CFTR22B-s : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- GAATGTCAACTGCTTGAGTGTTTT 3' (SEQ. ID. NO. 369) CFTR22B-as : 5'AAGTAACAGAACATCTGAAACTCACAC 3' (SEQ. ID. NO. 370) CF22C-s : 5'CTTGCTGCTTGATGAAC 3' (SEQ. ID. NO. 371) CF22C-as : 5'GCAATTATTTCATATCTTGG 3' (SEQ. ID. NO. 372)

CF22-s-tag : 5'AGGGATTGGTATGAAAA 3' (SEQ. ID. NO. 373) CF22-as-tag : 5'GGAAGAAAACACAAGAAC 3' (SEQ. ID. NO. 374) CF exon 23 1 gcatgtttat agccccaaat aaaagaagta ctggtgattc tacataatga aaatgtactc 61 atttattaaa gtttctttga aatatttgtc ctgtttattt atggatactt agagtctacc 121 ccatggttga aaagctgatt gtgcgtaacg ctatatcaac attatgtgaa aagaacttaa 181 agaaataagt aatttaaaga gataatagaa caatagacat attatcaagg taaatacaga 241 tcattactgt tctgtgatat tatgtgtggt attttctttc ttttctagAA CATACCAAAT 301 AATTAGAAGA ACTCTAAAAC AAGCATTTGC TGATTGCACA GTAATTCTCT GTGAACACAG 361 GATAGAAGCA ATGCTGGAAT GCCAACAATT TTTGgtgagt ctttataact ttacttaaga 421 tctcattgcc cttgtaattc ttgataacaa tctcacatgt gatagttcct gcaaattgca 481 acaatgtaca agttcttttc aaaaatatgt atcatacagc catccagctt tactcaaaat 541 agctgcacaa gtttttcact ttgatctgag ccatgtggtg aggttgaaat atagtaaatc 601 taaaatggca gcatattact aagttatgtt tataaatagg atatatatac ttttgagccc 661 tttatttggg accaagtcat acaaaatact ctactgttta agattttaaa aaaggtccct 721 gtgattcttt caataactaa atgtcccatg gatgtggtct ggacaggcct agttgtctta 781 cagtctgatt tatggtatta atgacaaagt tgagaggcac atttcatttt tctagccatg (SEQ. ID. NO. 375) CF23A-s3 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TATCAAGGTAAATACAGA 3' (SEQ. ID. NO. 376) CF23A-as3 : 5'GCTTCTATCCTGTGTTC 3' (SEQ. ID. NO. 377) CF23B-s2 : 5'GATATTATGTGTGGTATTTTC 3' (SEQ. ID. NO. 378 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAACTTGTACA CF23B-as2 : TTGTTGCA 3' (SEQ. ID. NO. 379) CF exon 24 1 agatggtaga acctccttag agcaaaagga cacagcagtt aaatgtgaca tacctgattg 61 ttcaaaatgc aaggctctgg acattgcatt ctttgacttt tattttcctt tgagcctgtg 121 ccagtttctg tccctgctct ggtctgacct gccttctgtc ccagatctca ctaacagcca 181 tttccctagG TCATAGAAGA GAACAAAGTG CGGCAGTACG ATTCCATCCA GAAACTGCTG 241 AACGAGAGGA GCCTCTTCCG GCAAGCCATC AGCCCCTCCG ACAGGGTGAA GCTCTTTCCC 301 CACCGGAACT CAAGCAAGTG CAAGTCTAAG CCCCAGATTG CTGCTCTGAA AGAGGAGACA 361 GAAGAAGAGG TGCAAGATAC AAGGCTTTAG agagcagcat aaatgttgac atgggacatt 421 tgctcatgga attggagctc gtgggacagt cacctcatgg aattggagct cgtggaacag 481 ttacctctgc ctcagaaaac aaggatgaat taagtttttt tttaaaaaag aaacatttgg 541 taaggggaat tgaggacact gatatgggtc ttgataaatg gcttcctggc aatagtcaaa 601 ttgtgtgaaa ggtacttcaa atccttgaag atttaccact tgtgttttgc aagccagatt 661 ttcctgaaaa cccttgccat gtgctagtaa ttggaaaggc agctctaaat gtcaatcagc (SEQ. ID. NO. 380) CF24A-s2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- CCTTTGAGCCTGTGCC 3' (SEQ. ID. NO. 381) CF24A-as2 : 5'GCTTGAGTTCCGGTGG 3' (SEQ. ID. NO. 382) CF24B-s2 : 5'CATCAGCCCCTCCGAC 3' (SEQ. ID. NO. 383) CF24B-s2 : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG- TTTCTGAGGCAGAGGTA 3' (SEQ. ID. NO. 384) CF24-s-tag : 5'GCAGTTAAATGTGACATACC 3' (SEQ. ID. NO. 385) CF24-as-tag : 5'TCCTTGTTTTCTGAGGC 3' (SEQ. ID. NO. 386) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment Primer sequences 51-31 on AH006034 upstream downstr. start end 50 bp 50 bp HUMCFTRA1 CFTRlA-s 701 722 651 772 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGAAGCCAAATGACATCACA GC (Seq Id No. 387) CFTRlA-as 857 880 807 930 TGAAAAAAAGTTTGGAGACAACGC (Seq Id No. 388) CFTRlB-s 782 828 732 878 CCCAGCGCCCAGAGACC (Seq Id No. 389) CFTR1B-as 955 976 905 1026 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTGCTTATTCCTTTACCCC AA (Seq Id No 390) HUMCFTRA2 CFTR2A-s2 167 189 117 239 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCAGAAAAGTTGAATAGTAT CAG (Seq Id No. 391) CFTR2A-as2 325 343 275 393 AGATTGTCAGCAGAATCAA (Seq Id No. 392) CF2B-s5 : 308 324 258 374 ATACCAAATCCCTTCTG (Seq Id No. 393) CF2B-as5 : 413 431 363 481 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGCTTTCTCTTCTCTAAAT (Seq Id No. 394)' CFTR2B-s2 292 312 242 362 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCSCCCGTGGAATTGTCAGACATATAC C (Seq Id No. 395) CFTR2B-as2 470 486 420 536 AGCCACCATACTTGGCT (Seq Id No. 396) (Seq Id No. 396) HUMCFTRA3 CF3A-s2 31 46-19 96 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGGTGTTGTATGGTCT (Seq Id No. 397) CF3A-as2 252 268 202 318 AACATAAATCTCCAGAA (Seq Id No. 398) (Seq Id No. 398) CFTR3A-s 58 77 8 127 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGTCTCTATAATACTTGGGT (Seq Id No. 399) CFTR3A-as 266 287 216 337 ATATAAAAAGATTCCATAGAAC (Seq Id No. 400) CFTR3B-s 200 220 150 270 GCTGGCTTCAAAGAAAAATCC (Seq Id No. 401) CFTR3B-as 354 376 304 426 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCACCAGATTTCGTAGTCTTT TCA (Seq Id No. 402) HUMCFTRA4 CFTR4A-s 226 246 176 296 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAATTTCTCTGTTTTTCCCCT T (Seq Id No. 403) CPTR4A-as 423 444 373 494 AGCTATTCTCATCTGCATTCCA (Seq Id No. 404) CFTR4B-s 381 397 331 447 GACACTGCTCCTACACC (Seq Id No. 405) (Seq Id No. 405) CFTR4B-as 557 574 507 624 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTCAGCATTTATCCCTTA (Seq Id No. 406) HUMCFTRA5 CFTRSA-s 187 212 137 262 CSCCCSCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATAATATATTTGTATTTTGT TTGTTG (Seq Id No. 407) CFTRSA-as 306 325 256 375 AATTTGTTCAGGTTGTTGGA (Seq Id No. 408) CFTR5B-s 250 267 200 317 AGCTGTCAAGCCGTGTTC (Seq Id No. 409) CFTR5B-as 396 414 346 464 CGCCCGCCGCGCCCCGCGCCCGCCCCOCCOCCCCCGCCCGATCTGACCCAGGAAAACTC (Seq Id No. 410) HUMCFTRA6 CFTR6A-1-s 223 242 173 292 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTGTTAGTTTCTAGGGGTGG (Seq Id No 411) CFTR6A-1-as 385 405 335 455 AAGGACTATCAGGAAACCAAG (Seq Id No. 412) (Seq 2d No. 412) CFTR6A-2-s 345 364 295 414 GCTAATCTGGGAGTTGTTAC (Seq Id No. 413) CFTR6A-2-as 450 471 400 521 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGTTATGAAAATAGGTTGCT AC (Seq Id No. 414) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment on AH006034 upstream downstr. start end 50 bp 50 bp CF6A-3-s2 427 444 377 494 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGGAGAATGATGATGAAG (Seq Id No. 415) CF6A-3-as2 536 556 486 606 ACACTGAAGATCACTGTTCTA (Seq Id No. 416) CFTR6A-3-s 401 418 351 468 TCCTTGCCCTTTTTCAGG (Seq Id No. 417) CFTR6A-3-as 539 563 489 613 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTAATGACACTGAAGATCA CTGTT (Seq Id No. 418) CFTR6B-1-s2 1504 1526 1454 1576 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCOCCTTGAGCAGTTCTTAATAG ATA (Seq Id No 419) CFTR6B-l-as2 1641 1661 1591 1711 ATSCCTTAACAGATTGGATAT (Seq Id No. 420) CFTR6B-2-s2 1637 1657 1587 1707 GAAAATATCCAATCTGTTAAG (Seq Id No. 421) CFTR6B-2-as2 1777 1794 1727 1844 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGAGGTGGAASTCTACCA (Seq Id No. 422) CFTR6B-2-s 1637 1652 1587 1702 GAAAATATCCAATCTG (Seq Id No. 423) (Seq Id No. 423) CFTR6B-2-as 1780 1795 1730 1845 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGAGGTGGAAGTCTA (Seq Id No. 424) HUMCFTRA7 CFTR7A-s 152 174 102 224 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGACCATGCTCAGATCTTCC ATT (Seq Id No. 425) CFTR7A-as 246 269 196 319 GCTGCCTTCCGAGTCAGTTTCAGT (Seq Id No. 426) CFTR7C-s 246 265 196 315 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTGAAACTGACTCGGAAGG (Seq Id No. 427) CFTR7C-as 476 498 426 548 ATGGTACATTACCTGTATTTTGTTTA (Seq Id No 428) CFTR7D-s 440 465 390 515 CTGTACAAACATGGTATGACTCTCTT (Seq Id No. 429) CFTR7D-as 576 600 526 650 CGCCCGCCGGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGAAGGAAATTTCTTTTTCT ATCT (Seq Id No. 430) CFTR7B-s 152 175 102 225 AGACCATGCTCAGATCTTCCATTC (Seq Id No. 431) CFTR7B-as 246 267 196 317 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCCf2T(CCTTCCGAGTCAGTTT CAGT (Seq Id No. 432) HUMCFTRA8 CFTRBA-s 251 272 201 322 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGC ! ACAATGAGAGTATAAAGTAG (Seq Id No. 433) CFTR8A-as 382 402 332 452 CCATCACTACTTCTGTAGTCG (Seq Id No 434) CFBB-s2 : 319 345 269 395 CTCTCTTTTATAAATAGGATTTCTTAC [Seq Id No. 435) CF8B-as2= 523 547 473 597 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCOCCCGCCCGTTCCAGTTCTACCAGTTATA Tr-ATC (Seq Id No. 436) CFTRBB-s 319 345 269 395 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTCTCTTTTATAAATAGGAT TTCTTAC (Seq Id No. 437) CFTRBB-as 523 547 473 597 TTCCAGTTCTACCAGTTATATCATC (Seq Id No 438) HUMCFTRA9 CFTR9C-s 501 525 4S1 575 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACAATAGAAAAACTTCTAAT GGTGA (Seq Id No. 439) CFTR9C-as 679 700 629 750 AAAAAAGAGACATGGACACCAA (Seq Id No. 440) HUMCFTRA10 CFTR10-s 259 276 209 326 CCTGAGCGTGATTTGATA (Seq Id No. 441) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp CFTR10-as 331 346 281 396 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATSTAGACTAACCGATTGAA (Seq Id No. 442) CF10C-s3 333 346 283 396 GGGAGAACTGGAGCCT (Seq Id No. 443) CF10C-as3 570 587 520 637 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAACCGATTGAATATGGAG (Seq Id No. 444) HUMCFTRA CFTR11A-s2 203 223 153 273 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGATATATGATTACATTAGAA G (Seq Id No. 445) (Seq Id No_ 446) CFTR11A-as2 326 342 276 392 ACCTTCTCCAAGAACTA CFTRllB-s 291 308 241 358 ATAGGACATCTCCAAGTT (Seq Id No. 447) CFTRllB-as 452 470 402 520 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGCAATAGAGAAATGTCTGT (Seq Id No. 448) HUMCFTRA12 CFTR12-s 201 223 151 273 CGCCCCSCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGAACTGTTTAAGGCAAA TCAT (Seq Id No. 449) CFTR12-as 418 438 368 488 TGATGGGACAGTCTGTCTTTC (Seq Id No. 450) HUMCFTRA13 CFTR13A-s 112 136 62 186 AATACGAGACATATTGCAATAAAGT (Seq Id No. 451) CFTR13A-as 304 325 254 375 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGGCTGTAGATTTTGGAGT TC (Seq Id No. 452) CFTR13A-s 112 136 62 186 AATACGAGACATATTGCAATAAAGT (Seq Id No. 453) CFTR13A-as 304 325 254 375 CTGGCTGTAGATTTTGGAGTTC (Seq Id No. 454) CF13B-s3 273 289 223 339 AGGTAGCAGCTATTTTT (Seq Id No. 455) CF13B-as3 605 621 555 671 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGACAOCCTTCTCTCTA (Seq Id No. 456) CFTR13B-s 219 243 169 293 CACTTCTAAAATGGAACATTTAAAG (Seq Id No. 457) CFTR13B-as 641 658 591 708 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGCAGTATCGCCTCTCCCT (Seq Id No. 458) CFTR13C-s 290 310 240 360 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGGGACATTTTCAGAACTC C (Seq Id No. 459) CFTR13C-as 571 589 521 639 CCTCTTCGATGCCATTCAT (Seq Id No. 460) CFTR13D-s 516 538 466 588 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCCSCCCGCAATCCAATCAACTCTATA CGAA (Seq Id No. 461) CFTR13D-as 660 677 610 727 CTGATCACGCTGATGCGA (Seq Id No. 462) CFTR13E-s 594 613 544 663 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGATGAGCCTTTAGAGAGAA (Seq Id No. 463) CFTR13E-as 808 826 758 876 CCAGTTCAGTCAAGTTTGC (Seq Id No. 464) CF13F-s2 666 679 616 729 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGCGTGATCAGCA (Seq Id No. 465) CF13F-as2 960 977 910 1027 TTTGTTACATGCTACATA (Seq Id No. 466) CFTR13F-s 663 680 613 730 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATCAGCGTGATCAGCAC (Seq Id No. 467) CFTR13F-as 960 985 910 1035 TAGTAAATTTTGTTACATGCTACATA (Seq Id No. 468) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp HUMCFTRA14 CFTR14A-1-s 260 290 210 340 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTCATATATTAAAAATAAAA CC (Seq Id No. 469) CFTR14A-1-as 398 418 348 468 TAATATATCGAAGGTATGTGT (Seq Id No. 470) CFTR14A-2-s 372 393 322 443 GAGCATACCAGCAGTGACTACA (Seq Id No. 471) CFTR14A-2-as 477 505 427 555 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTAATACTTTACAATAGAAC ATTCTTACC (Seq Id No. 472) CFTR14A-3-s 379 397 329 447 ACCAGCAGTGACTACATGGA (Seq Id No. 473) CFTR14A-3-as 542 569 492 619 CGCCCaCCCiCQCCCCCCC+CCCaCCCCCGCCGCCCCCGCCCGATATTTATGTGTGTGCA TATATATGTAT (Seq Id No. 474) HUMCFTRA15 CFTR14B-1-s 104 120 54 170 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGTACCTTGATATTGG (Seq Id No 475) CFTR14B-1-as 247 262 197 312 CTCACTTTCCAAGGAG (Seq Id No. 476) CF14B-3-s 240 254 190 304 GCTSTGGCTCCTTGG (Seq Id No. 477) CF14B-3-as 490 507 440 557 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTACAGCCCTGAACTCC (Seq Id No. 478) CFTR14B-2-s 220 238 170 288 GTGGCTGCTTCTTTGGTTG (Seq Id No. 479) CFTR14B-2-as 305 333 255 383 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTACAAACATAGTGGATTACA ATATTTAAT (Seq Id No. 480) HUMCFTRA16 CFTR15A-s 299 324 249 374 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATGTATTGGAAATTCAGTA AGTAAC (Seq Id No. 481) CFTR15A-as 519 542 469 592 TTCGACACTGTGATTAGAGTATGC (Seq Id No. 482) 50 CFTR15B-s 463 478 413 528 GTGGGAGTAGCCGACA (Seq Id No. 483) CFTR15B-as 651 667 601 717 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGGCCCTATTGATGGT (Seq Id No. 484) CF15B-s2 : 462 477 412 527 CGTGGSSAGTAGCCGAC (Seq Id No. 485) CF15B-as2 : 672 689 622 739 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATTAGAAAACCAACAAA (Seq Id No. 486) HUMCFTRA17 CF16A-s5 226 241 176 291 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTSAATGCGTCTACTG (Seq Id No. 487) CF16A-as5 354 370 304 420 CATCCAAAATTGCTATA (Seq Id No. 488) (Seq Id No. 488j CFTR16A-s 233 258 183 308 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCGTCTACTGTGATCCAAACT TAGTAT (Seq Id No. 489-1 CFTR16A-as 387 410 337 460 CATACCTGGATGAAGTCAAATATG (Seq Id No. 490) CFTR16B-s 296 318 246 368 TTGAGGAATTTGTCATCTTGTAT (Seq Id No. 491) CFTR16B-as 456 478 406 528 CGCCCGCCGCGCCCCGCCCCSCCCCGCCGCCCCCGCCCGCAAAATCACATTTGCTTTTGT TA (Seq Id No-492) HUMCFTRA18 CF17A-1-s6 : 130 147 BO 197 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAAAGAAATAAATCACTGA (Seq Id No. 493) CF17A-l-as6 : 243 258 193 308 GTAAAACTGCGACAAC (Seq Id No. 494) (Seq Id No. 494) CFTR17A-2-s 187 212 137 262 CCAACATSTTTTCTTTGATCTTACAG (Seq Id No. 495) CFTR17A-2-as 399 425 349 475 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGAATCTCAAATAGCTCTTA TAGCTTT (Seq Id No. 496) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp HUMCFTRA19 CFTR17B-1-s 35 56-15 106 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTAACCAATGACATTTGTGA TA (Seq Id No. 497) CFTR17B-1-as 189 209 139 259 GTGTCCATAGTCCTTTTAAGC (Seq Id No. 498) CFTR17B-2-s 145 165 95 215 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATATTTCACAGGCAGGAGTC C (Seq Id No. 499) CFTR17B-2-as 312 336 262 386 AAAATCATTTCTATTCTCATTTGGA (Seq Id No. 500) CFTR17B-3-s 208 224 158 274 ACTTCGTGCCTTCGGAC (Seq Id No_ 501) CFTR17B-3-as 335 356 285 406 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGCAATGAAGAAGATGACA AA (Seq Id No. 502) CFTR17B-4-s 307 323 257 373 CTGGTTCCAAATGAGAA (Seq Id No. 503) CFTR17B-4-as 444 462 394 512 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTAACCTATAGAATGCA. GCA (Seq Id No. 504) HUMCFTRA20 CFTR18A-s 239 258 189 308 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTAATGTGATATGTGCCCTA (Seq Id No. 505) CFTR18A-as 431 451 381 501 ASATSATAAGACTTACCAAGC (Seq Id No. 506) (Seq Id No. 506) cFTRlsB-s 335 355 285 405 GAGAAGGAGAAGGAAGAGTTG (Seq Id No. 507) cFTRlsB-as 490 512 440 562 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTTCCTCATGCTATTACTCA TAC (Seq Id No. SOB) HUMCFTRA21 CFTR19A-s2 103 123 53 173 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAAGTTATTTTTTAGGAAGCA T (Seq Id No. 509) CFTR19A-as 197 215 147 265 GAACTTAAAGACTCGGCTC (Seq Id No. 510) CFTR19B-s 136 156 86 206 CGCCCGCCGCGCCCCGCGCCCGCCCCP. CCGCCCCCGCCCGGAAATTGTCTGCCATTCTTAA (Seq Id No. 511) CFTR19B-as 259 278 209 328 GAGTTGGCCATTCTTGTATG (Seq Id No. 512) CF19C-s3 194 209 144 259 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGTGAGCCGAGTCTTT (Seq Id No. 513) CF19C-as2 379 394 329 444 ATGGCATTTCCACCTT (Seq Id No. 514) CF19C-s2 169 189 119 239 CGCCCGCCGCGCCCCGCGCCCGCCCCSCCGCCCCCGCCCGTGTTATTTTTATTTCAGATG C (Seq Id No. 515) CF19C-as2 380 398 330 448 TAATATGGCATTTCCACCT (Seq Id No. 516) CF19D-s2 308 323 258 373 CGTGAAGAAAGATGAC (Seq Id No. 517) CF19D-as2 513 531 463 581 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCSCCCCCGCCCGTAATGTTACAAATAGATTC (Seq Id No. pela) CFTR19D-s 304 324 254 374 CACACGTGAAGAAAGATGACA (Seq Id No. 519) (Seq Id No. 519) CFTR19D-as 506 531 456 581 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTAATGTTACAAATAGATTCT GCTAAC (Seq Id No 520) deep intronic : no alignment CF19i-s2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTTGATTTCTGGAGAC (Seq Id No. 521) to AH006034 CF19i-aa2 CTASCTSTAATTSCAT (Seq Id No. 522) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp HUMCFTRA22 CFTR20-s 203 223 153 273 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAATTATGTTTATGGCATGG T (Seq Id No. 523) CFTR20-as 470 494 420 544 GAGTACAAGTATCAAATAGCAGTAA (Seq Id No. 524) new 20-s : 201 219 151 269 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGAATTATGTTTATGGCA (Seq Id No. 525) new 20-as 435 452 385 502 CCTTTTTTCTSSCTAAST (Seq Id No. 526) HUMCFTRA23 CFTR21A-s 162 182 112 232 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGATGGTAAGTACATGGGTGT T (Seq Id No. 527) CFTR21A-as 333 353 283 403 ACTCCACTGTTCATAGGGATC (Seq Id No. 528) CF 21A-s3 : 254 273 204 323 CBCCC9CCSC8CCCCGCaCCCaCCCCaCC9CCCCCGCCCGAGTTATTCATACTTTCTTCT (Seq Id No. 529) CF 21A-as3 : 376 391 326 441 ASCCTTACCTCATCTG (Seq Id No. 530) (Seq Id No. 530) CF21B-s3 307 322 257 372 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGGAACATTTAG (Seq Id No 531) CF21B-as3 443 460 393 510 GAATGATGTCAGCTATAT (Seq Id No. 532) CFTR21B-s2 307 329 257 379 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGGAACATTTAGAAAA AAC (Seq Id No. 533) CFTR21B-as2 544 562 494 612 TCAGTTAGGGGTAGGTCCA (Seq Id No. 534) HUMCFTRA24 CFTR22A-s2 356 373 306 423 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGAGCTGTCAAGGTTGTA (Seq Id No. 535) CFTR22A-as2 551 569 501 619 CAGGAAACTGTTCTATCAC (Seq Id No 536) CFTR22B-s 474 497 424 547 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAATGTCAACTGCTTGAGTG TTTT (Seq Id No. 537) CFTR22B-as 707 733 657 783 AAGTAACAGAACATCTGAAACTCACAC (Seq Id No. 538) CFTR22C-s2 670 686 620 736 CTTGCTGCTTGATGAAC (Seq Id No. 539) CFTR22C-as 821 843 771 893 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGGGCAATTATTTCATATCT TGG (Seq Id No. 540) HUMCFTRA25 CF23A-s3 223 240 173 290 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTATCAAGGTAAATACAGA (Seq Id No 541) CF23A-as3 353 369 303 419 GCTTCTATCCTGTGTTC (Seq Id No. 542) CF23B-s2 256 276 206 326 GATATTATGTGTGGTATTTTC (Seq id No. 543) CF23B-as2 477 495 427 545 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAACTTGTACATTGTTGCA (Seq Id No. 544) CFTR23-s 218 244 168 294 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATATTATCAAGGTAAATAC AGATCAT (Seq Id No. 545) CFTR23-as 445 469 395 519 GGAACTATCACATGTSASATTGTTA (Seq Id No. 546) HUMCFTRA26 CF24A-s2 107 122 57 172 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCTTTGAGCCTGTGCC (Seq Id No. 547) CF24A-as2 300 315 250 365 GCTTGAGTTCCGGTGG (Seq Id No. 548) CF24B-s2 267 282 217 332 CATCAGCCCCTCCGAC (Seq Id No. 549) CF24B-s2 482 498 432 548 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGAGGCASAGGTA (Seq Id No. 550) TABLE B<BR> Alignment to GenBank Accession Number AH006034 locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp CFTR24A-s 82 99 32 149 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGtCCCCGCCCGCATTGCATTCTTTGACTT (Seq Id No. 551) CFTR24A-as 280 296 230 346 AAGAGCTTCACCCTGTC (Seq Id No. 552) (Seq Id No. 552) CFTR24B-s 213 229 163 279 GCAGTACGATTCCATCC (Seq Id No. 553) CFTR24B-as 489 504 439 554 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCTTGTTTTCTGAGGC (Seq Id No. 554) PCR Plate Set Up Plate 49 Position 1 2 3 4 5 6 Fragment 16B 6B2 1784 14A1 6A2 11A Malti G 3A 3B9 3B2 5A2 1082 5F Plate 52 Position 1 2 3 4 5 6 7. 8 Fragment 17B9 94R3 3A 11B 7B 21B 22C 22A 17E31 l4-A3 3A IIB 7B 21B 220 , Plate 54 Plate 54 Fragment. 5A 38 19A-19C 1461 22B. 17B2 BBI Multi 0 4A 4B2 582 SA3 7B 882 8B4 90A1 f 10A2 4G Plate 59 A Position 9 2 3 4 5 6 7 8B 13F 10 188 196 18A 14B2 MulEi G 5B 5C 5E 5F 6A lA SA Prate 59 B Position 1'2 3 4 5 6 7 Fragment 45B 13D 24B 24A 13E 1A 1B Mufti G SB-9A 1'fR'I'lA 12A 13A 13A Plate 62_4A Position 1 2 3 4 5 6 7 8 9 10 11 12 Fragment Multi SA 13A 7D 23 14A2 13B' (3G i5A 9G ZB 5B MuMG 1A 2A 4A 4B 5A. 50 6A 7A 7A 7B 18 4C Plate 6248 Position 1 2 3 4 6 6 7 8 9 10 Fragment I Z1A | 8A | 13A | 7D | 23 | 14AZ |_ 13B 1 13C 1 t5R | gC | 2B f 7 5B MUlti G} 1A | 2A | 4A I 4B | 5A | SD | 6A I 7A | 7A I 1B} 1B 2 4C I Plate 62 4B I Fragment 42 6A3 17A2 19D 20 4A 7B3 7C SA1 96A 7A | Fragment | 12 | 6A3 1 1JAZ} 19D 20 | 4A <17B3 | 7C | SA1 1 t6A 1 7A 61 total fragments<BR> TABLE C Group T7'GE'Sft 77'EE4d celslGroup DcQdes 144. 5 ! 48. 02,, 1 48. 0 ; 5 . 1 3 0S1. 021 449. 052. 532 550. 5 53. 5 6 3 6 52. 5 05. 5 1 753. 5S6. 521 855. 058. 02t 9 56. 0 ; 58. 5 2. 10 57. 0 09. 5 2- 11SS. 52. 011 12 58. 5'62. 0 1 13 62. 0 64. 0 1 Totals : 26 f6 TABLE D TABLE E Gene Extension PCR Rating App Length Length_GC Min Max Min Max Min Max Group Position Product Temp Tm PCR PCR Melt Melt Actual Actual CFTR 21A 55 81 52 192 242 45 65 60 62 46 48 1 A1 CFTR 2B 60 60 57 199 249 45 56.7 61 62 47 48 1 B1 CFTR 8A 55 60 48 152 202 50 62 62 64 48 50 2 A1 CFTR 16A 55 80 56 178 228 45 65 62 64 48 50 2 A2 CFTR 7A 55 78 63 118 168 50 65 62 64 48 50 2 A3 CFTR 12 50 80 55 238 288 45 65 63 65 49 51 3 A1 CFTR 16B 50 78 54 183 233 45 65 63 65 49 51 3 A2 CFTR 17B-1 53 83 51 175 225 45 59.6 63 65 49 51 3 A3 CFTR 6B-2 50 86 36 159 209 48 59 63 65 49 51 3 B1 CFTR 17B-4 50 78 45 156 206 45 56.7 63 65 49 51 3 B2 CFTR 13A 50 73 38.5 209 259 45 65 63.5 66.5 49.5 52.5 4 A1 CFTR 5A 53 77 52 139 189 45 59.6 65 66 51 52 4 A2 CFTR 7D 62 64 56 161 211 45 65 64 66 50 52 4 B1 CFTR 3B 55 87 57 177 227 45 65 65 66 51 52 4 B2 CFTR 14A-3 53 63 53 192 242 45 65 65 66 51 52 4 B3 CFTR 6B-1 -- 88 33 148 198 46.5 65 64 66 50 52 4 C1 CFTR 5B -- 92 44 163 213 59.6 65 64 66 50 52 4 C2 CFTR 23 53 64 55 252 302 65 67 51 53 5 A1 CFTR 14A-1 55 50 45 65 66 68 52 54 5 A2 CFTR 9A -- 60 46 171 221 45 63.4 66 67 52 53 5 CFTR 8B 53 57 49 227 277 45 65 65 67 51 53 5 B1 CFTR 19A 50 84 49 166 216 45 65 65 67 51 53 5 B2 CFTR 17A-1 55 66 54 181 231 50.5 65 66 67 52 53 5 CFTR 11A 50 67 52 144 194 48.2 65 65 67 51 53 5 F1 CFTR 18B 62 68 52 178 228 45 64.6 66 68 52 54 5 F2 CFTR 13F 50 66 42 312 362 45 65 67 68 53 54 5 C1 CFTR 6A-3 50 70 56 183 233 53.4 63 66 68 52 54 5 C2 CFTR 3A 50 72 44 230 280 45 56.7 66 68 52 54 5 D1 CFTR 14A-2 50 80 55 134 184 53.4 65 67 68 53 54 5 D2 CFTR 9B 60 68 53 157 207 45 65 65 67 51 53 5 CFTR 10 60 92 50 356 406 20.5 65 65 68 51 54 5 E2 CFTR 13B 55 64 55 440 490 45 61.8 66.5 68.5 52.5 54.5 6 A1 CFTR 11B 45 74 43 180 230 59.6 65 67 69 53 55 6 A2 CFTR 4B 55 92 43 194 244 45 59 67 69 53 55 6 A3 Gene Extension PCR Rating App Length Length_GC Min Max Min Max Min Max Group Position Product Temp Tm PCR PCR Melt Melt Actual Actual CFTR 19B 60 48 53 143 193 50 65 67 69 53 55 6 A4 CFTR 9D 60 53 56 132 182 45 63.4 67 69 53 55 6 CFTR 13C 45 81 55 300 350 45 61.8 68 70 54 56 7 A1 CFTR 18A 62 92 49 213 263 50.5 63.4 68 70 54 56 7 A2 CFTR 17A-2 55 59 58 239 289 45 65 68 70 54 56 7 A3 CFTR 15A 50 82 56 244 294 45 65 69 70 55 56 7 A4 CFTR 9C 60 65 56 200 250 63.4 65 69 70 55 56 7 B1 CFTR 22A 55 76 53 217 257 45 65 67.5 70 53.5 56 7 B2 CFTR 2A 53 80 52 166 216 45 61.8 68 70 54 56 7 B3 CFTR 21B -- 76 38 256 306 45 65 68 70 54 56 7 B4 CFTR 7B 55 93 61 116 166 45 65 70 71 56 57 8 A1 CFTR 14B-2 50 69 56 114 164 45 65 69 71 55 57 8 A2 CFTR 22C 50 76 47 167 217 45 65 69 71 55 57 8 A3 CFTR 19D 50 50 45 65 69.5 71.5 55.5 57.5 8 A4 CFTR 20 50 71 53 228 278 45 65 69 71 55 57 8 B1 CFTR 19C 53 84 50 226 276 45 65 69 71 55 57 8 B2 CFTR 15B 45 82 49 205 255 45 53.4 69 71 55 57 8 B3 CFTR 14B-1 45 75 40 159 209 45 65 70 71 56 57 8 B4 CFTR 4A 50 79 55 219 269 45 63.4 70 72 56 58 9 A1 CFTR 13D 50 78 55 162 212 48.2 56.7 70 73 56 59 9 A2 CFTR 17B-3 45 89 54 149 199 45 56.7 71 72 57 58 9 B1 CFTR 22B 55 66 58 260 310 45 65 71 73 57 59 10 A1 CFTR 17B-2 45 80 56 192 242 45 59.6 71 73 57 59 10 A2 CFTR 7C 55 85 55 253 303 45 65 71 73 57 59 10 B1 CFTR 6A-2 50 93 49 127 177 45 65 71 73 57 59 10 B2 CFTR 6A-1 50 86 46 292 342 45 65 73 75 59 61 11 A1 CFTR 24B 50 88 53 183 233 73 74 59 -60 11 A2 CFTR 24A 50 81 46 215 265 73 75 59 61 11 A3 CFTR 13E 50 50 45 65 73 76.5 59 62.5 12 A1 CFTR 1A 60 84 62 180 230 56.7 65 76 78 62 64 13 A1 CFTR 1B 60 85 60 165 215 56.7 64.6 76 77 62 63 13 A2 TABLE W CFTR SEQ Primers Fragment Type Exon Anneal Oligo stock final uM CF 1 1 58. 6 5 uM 0. 5 CF-2 T 2 49 5 uM 0. 5 CF-3 T 3 49 5 uM 0. 5 CF-44 58. 6 5uM 0. 5 CF 5 5 58. 6 5 uM 0. 5 CF-6A 6A 58. 6 10 uM CF-6B 6B 58. 6 10 uM CF-7 7 51. 1 5 uM 0. 5 CF-8 8 58. 6 10 uM CF-9 9 49 5 uM 0. 5 CF-10 10 58. 6 10 uM CF-11 T 11 49 5 uM 0. 5 CF-12 12 58. 6 5 uM 0. 5 CF-13 Full ** see below CF-13A 13A 58. 6 5 uM 0. 5 CF-13B 13B 58. 6 5 uM 0. 5 CF 14A 14A 58. 6 5 uM 0. 5 CF-14B T 14B 49 5 uM 0. 5 CF-15 15 58. 6 5 uM 0. 5 CF-16 16 58. 6 5 uM 0. 5 CF-17A 17A 51. 1 5 uM 0. 5 CF-17B T 17B 49 5 uM 0. 5 CF-18 T 18 49 5 uM 0. 5 CF-19 19 58. 6 10 uM CF-inl9 T inl9 49 5 uM 0. 5 CF-20 T 20 49 5 uM 0. 5 CF-21 21 58. 6 5 uM 0.5 CF-22 22 58. 6 5 uM 0. 5 CF-23 23 51. 1 10 uM CF 24 T 24 49 5 uM 0. 5 PCR Volumes Add 5 ul TaqMM 0. 5 ul gDNA 1. 0 ul primer mix at 5 or 10 uM S and AS primer 3. 5 ul water 10 ul total PCR Conditions 1 95C 5 minutes 2 94C 30 seconds 3 **C 30 seconds 4 72C 30 seconds 4 links to 2 35x 5 72C 10 minutes 6 4C forever **C = annealing temperature listed in chart above EXO SAP IT Volumes Exo (uL) PCR Prod (uL) Add 1 to 2. 5 2 5 EXO SAP IT Conditions 1 37C 60 minutes 2 72C 15 minutes DTCS Volumes Add 4. 0-4. 5 uL of dH20 0. 5-1. 0 uL of Exo Sap It Product 1. 0 uL of 1. 6 uM Primer (sense or anti-sense) 4. 0 uL DTCS solution 10 uL Total DTCS Conditions 1 96C 20 seconds 2 50C 20 seconds 3 60C 4 minutes 3 links to 1 35x 4 4C forever Primer stock 5 uM mixed : 10 ul 50 uM sense primer 10 ul 50 uM antisense primer 80 ul water 100 ul total Primer stock 10 uM mixed : 20 ul 50 uM sense primer 20 ul 50 uM antisense primer 60 ul water 100 ul total CEQ 2000 Run Conditions Injection Time : 20 seconds Run Time : 65 minutes these times are exceptio7ls to the defaultparameters ** Exon 13 full length sequencing Exon 13 PCR table Fragment Type Exon Anneal Oligo stock final uM 13 T 13 59 S uM 0. 5 uM 13 full (PCR) CFTR13-seq-tag-s CFTR13-seq-tag-as PCR Conditions 1 95C 5 minutes 2 94C 30 seconds 3 59C 30 seconds 4 72C 75 seconds 4 links to 2 35x 5 72C 10 minutes 6 4C forever CEQ 2000 Run Conditions Injection Time : 20 seconds Run Time : 85 minutes tlaese times are exceptions to the default parameters MM-seq-tag-s DCTS primers CFTR13-seq-s2 CFTR13-seq-as2 MM-seq-tag-as CFTR Sequencing Primers Alignment to AH006034 (nucleotide labeling for each exon) primer alignment locus on SEQ ID AH006034 Exon Primer start end Sequence NO : HUMCFTRA1 CFTR1-seq-s 647 664 GGAAAGAGCAAAAGGAAG 831 CFTR1-seq-as 941 957 CAAACCCAACCCATACA 832 HUMCFTRA2 2 CFTR2-s-tag : 41 59 TCTGCCTTTTTCTTCCATCTGACAGTCACATTAGTTCAG 833 CFTR2-as-tag : 419 435 TCCCCAACCCCCTAAAGCTGTTTGCTTTCTCTTCT 834 HUMCFTRA3 3 CFTR-3-s-tag : 31 47 TCTGCCTTTTTCTTCCATCTTGGTGTTGTATGGTCTC 835 CFTR-3-as-tag : 416 433 TCCCCAACCCCCTAAAGCTTAGGTGGTTTCTTAGTG 836 HUMCFTRA4 4 CFTR4-seq-s 42 61 TTGTCTCCCACTGTTGCTAT 837 CFTR4-seq-as 536 558 ACTTGTACCAGCTCACTACCTAA 838 HUMCFTRA5 5 CFTR5-seq-s 82 103 TGAACCTGAGAAGATAGTAAGC 839 CFTR5-seq-as 424 425 GCTGAGCAAGACTTAACCACTA 840 HUMCFTRA6 6a CFTR6a-seq-s3 154 173 TTAGTGTGCTCAGAACCACG 841 CFTR6a-seq-as3 519 538 CTATGCATAGAGCAGTCCTG 842 6b CFTR6b-seq-s 1408 1427 GGAGGCATTTACCAAACAGT 843 CFTR6b-seq-as 1775 1794 TGAGGTGGAAGTCTACCATG 844 HUMCFTRA7 7 CFTR7-seq-s4 192 213 TGAAAAATAAAATAACATCCTG 845 CFTR7-seq-as4 540 560 CAAAGTTCATTAGAACTGATC 846 HUMCFTRA8 8 CFTR8-seq-s 1 21 GCACATTAGTGGGTAATTCAG 847 CFTR8-seq-as 533 552 CCTCCTTCCAGTTCTACCAG 848 HUMCFTRA9 9 CFTR9-seq-s 133 155 GCTTATAGGAGAAGAGGGTGTGT 849 CFTR9-seq-as 676 697 AAAGAGACATGGACACCAAATT 850 HUMCFTRA10 10 CFTR10-seq-s 878 897 TTCCCTTGTATCTTTTGTGC 851 CFTR10-seq-as 1365 1386 ACAGTAGCTTACCCATAGAGGA 852 primer alignment locus on SEQ ID AH006034 Exon Primer start end Sequence NO : HUMCFTRAll 11 CFTR11-s-tag : 244 263 TCTGCCTTTTTCTTCCATCTCAGATTGAGCATACTAAAAG 853 CFTRll-as-tag : 597 612 TCCCCAACCCCCTAAAGCAAGATACGGGCACAGA 854 HUMCFTRA12 12 CFTR12-seq-s3 164 185 GTGAATCGATGTGGTGACCA 855 CFTR12-seq-as3 571 590 CTGGTTTAGCATGAGGCGGT 856 Use these primer sets for full exon 13 coverage (PCR and DTCS reactions) HUMCFTRA13 13 full CFTR13-seq-tag-s 98 122 TCTGCCTTTTTCTTCCATCGGGTAACAAAATGCTAAAATACGAGACA 857 (PCR) CFTR13-seq-tag-as 1087 1108 TCCCCAACCCCCTAAAGCGAGAAGAGATATGTCCATTGCAAA 858 DCTS primers MM-seq-tag-s TCTGCCTTTTTCTTCCATCGGGT 859 CFTR13-seq-s2 597 620 CAGAACTCCAAAATCTACAGCCAGA 860 CFTR13-seq-as2 302 326 GACAGCCTTCTCTCTAAAGGCTCA 861 MM-seq-tag-as TCCCCAACCCCCTAAAGCGA 862 Use these primer sets for partial sequencing (5'or 3'proximal) 13a CFTR13a-seq-s 177 200 CTGTGTCTGTAAACTGATGGCTAA 863 CFTR13a-seq-as 477 496 TTTCCCCAAACTCTCCAGTC 864 13b CFTR13b-seq-s 486 504 GTTTGGGGAAAAAAGGAAG 865 CFTR13b-seq-as 1142 1165 CACAGTTATCACTGGCTTAGTAGA 866 HUMCFTRA14 14a CFTR14a-seq-s2 40 57 GTATGCCACTGTTAAGCC 867 CFTR14a-seq-as 526 544 TATACATCCCCAAACTATC 868 CFTR14-s2-tag TCTGCCTTTTTCTTCCATCGGGGTTGCTCCAGTAGACATTATTC 869 CFTR14-as 2-tag TCCCCAACCCCCTAAAGCGAGTGGTTCTACTTGTTGATTTTTC 870 DCTS primers MM-seq-tag-s TCTGCCTTTTTCTTCCATCGGG 871 CFTR14a-seq-as TATACATCCCCAAACTATC 872 primer alignment locus on SEQ ID AH006034 Exon Primer start end Sequence NO : HUMCFTRA15 14b CFTR14B-s-tag : 74 89 TCTGCCTTTTTCTTCCATCTGGAACACAAAGCAAAG 873 CFTR14B-as-tag : 351 366 TCCCCAACCCCCTAAAGCTGGGAGAAATGAAACA 874 HUMCFTRA16 15 CFTR15-seq-s 223 242 GATTTTGAGGTTAAGGGTGC 875 CFTR15-seq-as 664 682 AAACCAACAAAACCACAGG 876 HUMCFTRA17 16 CFTR16-seq-s4 64 83 CAGAGAAATTGGTCGTTACT 877 CFTR16-seq-as4 614 633 ATCTAAATGTGGGATTGCCT 878 HUMCFTRA18 17a CFTR17a-seq-s3 132 151 AGAAATAAATCACTGACACA 879 CFTR17a-seq-as3 567 584 AAACCAAAATGAAGTCAC 880 HUMCFTRA19 17b CFTR17b-s-tag : 41 58 TCTGCCTTTTTCTTCCATCTAATGACATTTGTGATATG 881 CFTR17b-as-tag : 507 524 TCCCCAACCCCCTAAAGCCTTGTTCAATAATAAACC 882 HUMCFTRA20 18 CFTR18-s-tag : 134 151 TCTGCCTTTTTCTTCCATCTCCTGGTTGAATACTTACT 883 CFTR18-as-tag : 477 496 TCCCCAACCCCCTAAAGCCTCATACTTTGTTACTTGTC 884 HUMCFTRA21 19 CFTR19-seq-s 49 66 CATTGAAAAGCCCGACAA 885 CFTR19-seq-as 479 496 CAGGCTACTGGGATTCACTTA 886 deep intronic : no alignment inl9 CFTRinl9-seq-s TCTGCCTTTTTCTTCCATCTAGTGGGTATAAGCAGC 887 to AH006034 CFTRinl9-seq-as TCCCCAACCCCCTAAAGCGTTGAATAAGGCTAGAGTA 888 HUMCFTRA22 20 CFTR20-s-tag : 144 160 TCTGCCTTTTTCTTCCATCTAAATCTTCCACTGGTGA 889 CFTR20-as-tag : 569 586 TCCCCAACCCCCTAAAGCGACATCTTTTCTGCCTAT 890 HUMCFTRA23 21 CFTR21-seq-s 69 87 TTCACAAGGGACTCCAAAT 891 CFTR21-seq-as 540 558 TTAGGGGTAGGTCCAGTCA 892 HUMCFTRA24 22 CFTR22-seq-s 418 439 GGTAGAGGGATTGGTATGAAAA 893 CFTR22-seq-as2 868 889 CACAAGAACTCTTAGCAAGGAA 894 primer alignment locus on SEQ ID AH006034 Exon Primer start end Sequence NO : gHUMCFTRA2 5 2 3 CFTR2 3-s eq-s 141 161 GTGCGTAACGCTATATCAACA 895 CFTR23-seq-as 708 727 GAATCACAGGGACCTTTTTT 896 HUMCFTRA26 24 CFTR24-s-tag : 35 54 TCTGCCTTTTTCTTCCATCTGCAGTTAAATGTGACATACC 897 CFTR24-as-tag : 498 505 TCCCCAACCCCCTAAAGCTCCTTGTTTTCTGAGGC 898 TAGGED SEQUENCING PRIMERS : TO BE TCTGCCTTTTTCTTCCATCT 899 USED FOR DTCS oligo tag for CF primer (Sense) pah 10 s oligo tag for CF primer (AS) pah TCCCCAACCCCCTAAAGC 900 las oligo tag for CF primer exon 13 TCTGCCTTTTTCTTCCATCGGG 901 sense (MM-seq-tag-s) oligo tag for CF primer exon 13 TCCCCAACCCCCTAAAGCGA 902 antisense (MM seq-tag-as) Exon 9 : This exon is being sequenced in the AS direction for all patients. This is because adequate coverage of the TTGE assay in not sufficient and and the failure rate of analyzing in the sense direction is high because of polymorphisms in the 5 end TABLE X<BR> Alignment to AH006034 (nuclcotide labeling for each exon) seq ID# locus primer name primer alignment Primer sequences 5'-3' on SI006034 upstream downstr- start end 50 bp 50 bp 627 HiJMCFTRAl CFTR1A-5 701 722 651 772 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGAAGCCAAATGACATCACA GC 628 CFTRlA-as 857 880 807 930 TGAAAAAAAGTTTGGAGACAACGC 629 CFTR1B-s 782 828 732 878 CCCAGCGCCCAGAGACC 630 CFTR1B-as 955 976 905 1026 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTGCTTATTCCTTTACCCC AA 631 HUMCFTRA2 CFTR2A-S2 167 189 117 239 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCAGAAAAGTTGAATAGTAT CAQ 632 CFTR2A-as2 325 343 275 393 AGATTGTCAGCAGAATCAA 633 CF2B-s5 : 308 324 258 374 ATACCAAATCCCTTCTG 3' 634 CF2B-as5 : 413 431 363 481 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGCTTTCTCTTCTCTAAAT 3' 635 CFTR2B-s2 292 312 242 362 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGGAATTGTCAGACATATAC C 636 CFTR2B-as2 470 486 420 536 AGCCACCATACTTGGCT 637 HUMCFTRA3 CF3A-s2 31 46-19 96 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGGTGTTGTATGGTCT 638 CF3A-as2 252 268 202 318 AACATAAATCTCCAGAA 639 CFTR3A-s 58 77 8 127 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGTCTCTATAATACTTGGGT 640 CFTR3A-as 266 287 216 337 ATATAAAAAGATTCCATAGAAC 641 CFTR3B-s 200 220 150 270 GCTGGCTTCAAAGAAAAATCC 642 CFTR3B-as 354 376 304 426 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCACCAGATTTCGTAGTCTTT TCA 643 HUMCFTRA4 CFTR4A-s 226 246 176 296 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAATTTCTCTGTTTTTCCCCT T 644 CFTR4A-as 423 444 373 494 AGCTATTCTCATCTGCATTCCA 645 CFTR4B-S 381 397 331 447 GACACTGCTCCTACRCC 646 CFTR4B-as 557 574 507 624 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTCAGCATTTATCCCTTA 803 CFTR 4A-s2 226 246 176 296 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAATTTCTCTGTTTTTCCCCT T 804 CFTR 4A-as2 423 444 373 494 CGCCCCCGCCCGAGCTATTCTCATCTGCATTCCA 647 HUMCFTRAS CFTR5A-s 187 212 137 262 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATAATATATTTGTATTTTGT TTGTTG 648 CFTRSA-as 306 325 256 375 AATTTGTTCAGGTTGTTGGA 649 CFTRSB-s 250 267 200 317 AGCTGTCAAGCCGTGTTC sag ID# locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp 650 CFTRSB-as 396 414 346 464 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATCTGACCCAGGAAAACTC 651 HUMCFTRA6 CFTR6A-1-s 223 242 173 292 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTGTTAGTTTCTAGGGGTGG 652 CFTR6A-1-as 385 405 335 455 AAGGACTATCAGGAAACCAAG 653 CFTR6A-2-5 345 364 295 414 GCTAATCTGGGAGTTGTTAC 654 CFTR6A-2-as 450 471 400 521 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGTTATGAAAATAGGTTGCT AC 655 CF6A-3-s2 427 444 377 494 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGGAGAATGATGATGAAG 656 CF6A-3-as2 536 556 486 606 ACACTGAAGATCACTGTTCTA 657 CFTR6A-3-s 401 418 351 468 TCCTTGCCCTTTTTCAGG 658 CFTR6A-3-as 539 563 489 613 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTAATGACACTGAAGATCA CTGTT 659 CFTR6B-1-s2 1504 1526 1454 1576 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCTTGAGCAGTTCTTAATAG ATA 660 CFTR6B-1-as2 1641 1661 1591 1711 ATGCCTTAACAGATTGGATAT 661 CFTR6B-2-s2 1637 1657 1587 1707 GAAAATATCCAATCTGTTAAG 662 CFTR6B-2-as2 1777 1794 1727 1844 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGAGGTGGAAGTCTACCA 663 CFTR6B-2-s 1637 1652 1587 1702 GAAAATATCCAATCTG 664 CFTR6B-2-as 1780 1795 1730 1845 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGAGGTGGAAGTCTA 665 HUMCFTRA7 CFTR7A-s 152 174 102 224 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGACCATGCTCAGATCTTCC ATT 666 CFTR7A-as 246 269 196 319 GCTGCCTTCCGAGTCAGTTTCAGT 667 CFTR7C-s 246 265 196 315 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTGAAACTGACTCGGAAGG 668 CFTR7C-as 476 498 426 548 ATGGTACATTACCTGTATTTTGTTTA 669 CFTR7D-s 440 465 390 515 CTGTACAAACATGGTATGACTCTCTT 670 CFTR7D-as 576 600 526 650 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGAAGGAAATTTCTTTTTC TATCT 671 CFTR7B-s 152 175 102 225 AGACCATGCTCAGATCTTCCATTC 672 CFTR7B-as 246 267 196 317 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGCCTTCCGAGTCAGTTTCA GT CFTR 7A-4-s use CF 7A3-s primer 805 CFTR 7A-3-s 151 171 101 221 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAGACCATGCTCAGATCTTC C 806 CFTR 7A4-as 243 264 193 314 CTTCCGAGTCAGTTTCAGTTCT 807 CFTR 7B2-S 223 245 173 295 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTTATTGTTTTTTATAGAAC AGA 808 CFTR 7B2-as 421 435 371 485 GGGAAATTGCCGAGT seq ID# locus primer name primer alignment Primer sequences 5 1-3' on AH006034 upstream downstr. start end 50 bp 50 bp' 809 CFTR 7D3-s 428 447 378 497 AATTTCCCTGGGCTGTACAA 810 CFTR 7D3-as 499 522 449 572 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAATCATAGTATATAATGCAG CATT 673 HUMCFTRA8 CFTR8A-s 251 272 201 322 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGCACAATGAGAGTATAAAGT AG 674 CFTR8A-as 382 402 332 452 CCATCACTACTTCTGTAGTCG 675 CF8B-52 : 319 345 269 395 CTCTCTTTTATAAATAGGATTTCTTAC 676 CF8B-as2 : 523 547 473 597 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTCCAGTTCTACCAGTTATA TCATC 6 7 7 CFTR8B-s 319 345 269 395 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTCTCTTTTATAAATAGGAT TTCTTAC 678 CFTRSB-as 523 547 473 597 TTCCAGTTCTACCAGTTATATCATC 811 CFTR 8B-s3 368 389 318 439 GGAATATAACTTAACGACTACA 812 CFTR 8B-as3 526 547 476 597 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTCCAGTTCTACCAGTTATA TC 679 HUMCFTRA9 CFTR9C-s 501 525 451 575 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACAATAGAAAAACTTCTAAT GGTGA 680 CFTR9C-as 679 700 629 750 AAAAAAGAGACATGGACACCAA 681 CF9Tsui2-s 333 352 283 402 TAATGGATCATGGGCCATGT 682 CF9Tsui 2-as 677 696 627 746 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAAGAGACATGGACACCAAAT 683 HUMCFTRA10 GFTR10-S 259 276 209 326 CCTGASCGTGATTTGATA 684 CFTR10-as 331 346 281 396 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGTAGACTAACCGATTGAA 685 CF10C-s3 333 346 283 396 GGGAGAACTGGAGCCT 686 CF10C-as3 570 587 520 637 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAACCCATTGAATATGGAG 687 HUMCFTRA11 CFTR11A-s2 203 223 153 273 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGATATATGATTACATTAGAA G 688 CFTR11A-as2 326 342 276 392 ACCTTCTCCAAGAACTA 689 CFTR11B-s 291 308 241 358 ATAGGACATCTCCAAGTT 690 CFTRllB-as 452 470 402 520 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGCAATAGAGAAATGTCTGT 691 HUMCFTRA12 CFTR12-s 201 223 151 273 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGAACTGTTTAAGGCAAAT CAT 692 CFTR12-as 418 438 368 488 TGATGGGACAGTCTGTCTTTC 693 HUMCFTRA13 CFTR13A-S 112 136 62 186 AATACGAGACATATTGCAATAAAGT 694 CFTR13A-as 304 325 254 375 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGGCTGTAGATTTTGGAGT TC 697 CF13B-s3 273 289 223 339 AGGTAGCAGCTATTTTT seg ID# locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp 698 CF13B-as3 605 621 555 671 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGGACAGCCTTCTCTCTA 699 CFTR13B-s 219 243 169 293 CACTTCTAAAATGGAACATTTAAAG 700 CFTR13B-as 641 658 591 708 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGCAGTATCGCCTCTCCCT 701 CFTR13C-s 290 310 240 360 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGGGACATTTTCAGAACTC C 702 CFTR13C-as 571 589 521 639 CCTCTTCGATGCCATTCAT 703 CFTR13D-s 516 538 466 588 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAATCCAATCAACTCTATAC GAA 704 CFTR13D-as 660 677 610 727 CTGATCACGCTGATGCGA 705 CFTR13E-s 594 613 544 663 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGATGAGCCTTTAGAGAGAA 706 CFTR13E-as 808 826 758 876 CCAGTTCAGTCAAGTTTGC 707 CF13F-s2 666 679 616 729 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGCGTGATCAGCA 708 CF13F-as2 960 977 910 1027 TTTGTTACATGCTACATA 709 CF-13F-s3 763 780 713 830 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCGAAAGACAACAGCATCC 710 CF-13F-as3 956 977 906 1027 CGCCCGTTTGTTACATGCTACATATTGC 711 CFTR13F-S 663 680 613 730 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATCAGCGTGATCAGCAC 712 CFTR13F-as 960 985 910 1035 TAGTAAATTTTGTTACATGCTACATA 813 CFTR 13A-2-s 151 179 101 229 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTATTTATATGTTTTTATATC TTAAAGCTG 814 CFTR 13A-2-a 331 350 281 400 CATCCCATGAGTTTTGAGCT 815 CFTR 13C-s2 551 569 501 619 TGCAAAAGACTCCCTTACA 816 CFTR 13C-as2 65B 674 608 724 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATCACGCTGATGCGAGG 817 CFTR 13D-s2 651 669 601 719 GATACTGCCTCGCATCAGC 818 CFTR 13D-as2 741 762 691 812 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGAATGTTCTGACCTTGGT TA 819 CFTR 13E-s3 693 710 643 760 TCAGGCACGAAGGAGGCA 820 CFTR 13E-as3 821 843 771 893 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCTTCTTGAATATATATCCA GTT 821 CFTR 13G-s 790 807 740 857 GTGTCACTGGCCCCTCAG 822 CFTR 13G-as 872 894 822 944 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCGTCTTCTTCGTTAATTTCT TCAC 713 HUMCFTRA14 CFTR14A-1-5 260 290 210 340 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTCATATATTAAAAATAAAA CC 714 CFTR14A-1-as 398 418 348 468 TAATATATCGAAGGTATGTGT seq IM locus primer name primer alignment Primer sequences on AH006034 upstream downstr. start end 50 bp 50 bp 715 CFTR14A-2-s 372 393 322 443 GAGCATACCAGCAGTGACTACA 716 CFTR14A-2-as 477 505 427 555 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTAATACTTTACAATAGAAC ATTCTTACC 717 CFTR14A-3-s 379 397 329 447 ACCAGCAGTGACTACATGGA 718 CFTR14A-3-as 542 569 492 619 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATATTTATGTGTGTGCATAT ATATGTAT 719 HUMCFTRA15 CFTR14B-1-s 104 120 54 170 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGTGTACCTTGATATTGG 720 CFTR14B-1-as 247 262 197 312 CTCACTTTCCAAGGAG 721 CF14B-3-s 240 254 190 304 GCTGTGGCTCCTTGG 722 CF14B-3-as 490 507 440 557 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTACAGCCCTGAACTCC 723 CFTR14B-2-s 220 238 170 288 GTGGCTGCTTCTTTGGTTG 724 CFTR14B-2-as 305 333 255 383 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTACAAACATAGTGGATTACA ATATTTAAT 725 HUMCFTRA16 CFTR15A-s 299 324 249 374 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATGTATTGGAAATTCAGTA AGTAAC 726 CETR15A-as 519 542 469 592 TTCGACACTGTGATTAGAGTATGC so 727 CFTR15B-s 463 478 413 528 GTGGGAGTAGCCGACA 728 CFTR15B-as 651 667 601 717 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGGCCCTATTGATGGT 72 9 CF15B-s2 : 462 477 412 527 CGTGGGAGTAGCCGAC 730 CFISD-as2 : 672 689 622 739 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATTAGAAAACCAACAAA 731 HUMCFTRA17 CFIGA-SS 226 241 176 291 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGAATGCGTCTACTG 732 CF16A-as5 354 370 304 420 CATCCAAAATTGCTATA 733 CFTR16A-s 233 258 183 308 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCGTCTACTGTGATCCAAACT TAGTAT 734 CFTR16A-as 387 410 337 460 CATACCTGGATGAAGTCAAATATG 735 CFTR16B-s 296 318 246 368 TTGAGGAATTTGTCATCTTGTAT 736 CFTR16B-as 456 478 406 528 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAAAATCACATTTGCTTTTG TTA 823 CFTR 16B-s2 296 318 246 368 CCCGCCCGTTGAGGAATTTGTCATCTTGTAT 824 CFTR 16B-as2 456 478 406 528 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAAAATCACATTTGCTTTTG TTA 737 HTJMCFTRA18 CF17A-1-s6 : 130 147 80 197 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAAAGAAATAAATCACTGA 738 CF17A-1-as6 : 243 258 193 308 GTAAAACTGCGACAAC 739 CFTR17A-2-s 187 212 137 262 CCAACATGTTTTCTTTGATCTTACAG 740 CFTR17A-2-as 399 425 349 475 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGAATCTCAAATAGCTCTTA TAGCTTT seq ID# locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp 825 HUMCFTRA18 CFTR 17A-s3 220 240 170 290 CCCCGCCCGATTGTGATTGGAGCTATAG 826 CFTR 17A-as3 406 424 356 474 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAATCTCAAATAGCTCTTA 741 HUMCFTRA19 CFTR17B-1-s 35 56-15 106 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTAACCAATGACATTTGTGA TA 742 CFTR17B-1-as 189 209 139 259 GTGTCCATAGTCCTTTTAAGC 743 CFTR17B-2-s 145 165 95 215 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATATTTCACAGGCAGGAGTC C 744 CFTR17B-2-as 312 336 262 386 AAAATCATTTCTATTCTCATTTGGA 745 CFTR17B-3-s 208 224 158 274 ACTTCGTGCCTTCGGAC 746 CFTR17B-3-as 335 356 285 406 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGCAATGAAGAAGATGACA AA 747 CFTR17B-4-s 307 323 257 373 CTGGTTCCAAATGAGAA 748 CFTR17B-4-as 444 462 394 512 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTAACCTATAGAATGCAGCA 749 CF 17B5-s 208 223 158 273 ACTTCGTGCCTTCGGA 750 CF 17B5-as 308 328 258 378 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTCTATTCTCATTTGGAACC A 751 CF 17B6-s 218 234 168 284 TTCGGACGGCAGCCTTA 752 CF 17B6-as 334 356 284 406 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCAGCAATGAAGAAGATGACA AAA 753 HUMCFTRA20 CFTR18A-s 239 258 189 308 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTAATGTGATATGTGCCCTA 754 CFTR18A-as 431 451 381 501 AGATGATAAGACTTACCAAGC 755 CFTR18B-s 335 355 285 405 GAGAAGGAGAAGGAAGAGTTG 756 CFTR18B-as 490 512 440 562 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTTCCTCATGCTATTACTCA TAC 757 HUMCFTRA21 CFTR19A-S2 103 123 53 173 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAAGTTATTTTTTAGGAAGCA T 758 CFTR19A-as 197 215 147 265 GAACTTAAAGACTCGGCTC 759 CFTR19B-s 136 156 86 206 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAAATTGTCTGCCATTCTTA A 760 CFTR19B-as 259 278 209 328 GAGTTGGCCATTCTTGTATG 761 CF19C-s3 194 209 144 259 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGTGAGCCGAGTCTTT 762 CF19C-as2 379 394 329 444 ATGGCATTTCCACCTT 763 CF19C-s2 169 189 119 239 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGTTATTTTTATTTCAGATG C 764 CF19C-as2 380 398 330 448 TAATATGGCATTTCCACCT 765 CF19D-s2 308 323 258 373 CGTGAAGAAAGATGAC sag ID# locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp 766 CF19D-as2 513 531 463 581 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTAATGTTACAAATAGATTC 767 CFTR19D-s 304 324 254 374 CACACGTGAAGAAAGATGACA 768 CFTR19D-as 506 531 456 581 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTAATGTTACAAATAGATTCT GCTAAC 827 CFTR 19B-s2 178 197 128 247 TATTTCAGATGCGATCTGTG 828 CFTR 19B-as2 335 350 285 400 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGTCATTTGGCCCCCT deep intronic : 769 no alignment CF19i-s2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTTGATTTCTGGAGAC 770 to AH006034 CF19i-as2 CTAGCTGTAATTGCAT 771 HUMCFTRA22 CFTR20-s 203 223 153 273 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAATTATGTTTATGGCATGG T 772 CFTR20-as 470 494 420 544 GAGTACAAGTATCAAATAGCAGTAA 773 new 20-s : 201 219 151 269 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCTGAATTATGTTTATGGCA 774 new 20-as 435 452 385 502 CCTTTTTTCTGGCTAAGT 775 HUMCFTRA23 CFTR21A-s 162 182 112 232 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGATGGTAAGTACATGGGTGT T 776 CFTR21A-as 333 353 283 403 ACTCCACTGTTCATAGGGATC 777 CF 21A-s3 : 254 273 204 323 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGAGTTATTCATACTTTCTTCT 778 CF 21A-as3 : 376 391 326 441 AGCCTTACCTCATCTG 779 CF21B-s3 307 322 257 372 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGGAACATTTAG 780 CF21B-as3 443 460 393 510 GAATGATGTCAGCTATAT 781 CFTR21B-s2 307 329 257 379 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGGAACATTTAGAAAA AAC 782 CFTR21B-as2 544 562 494 612 TCAGTTAGGGGTAGGTCCA 783 HUMCFTRA24 CFTR22A-s2 356 373 306 423 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGAGCTGTCAAGGTTGTA 784 CFTR22A-as2 551 569 501 619 CAGGAAACTGTTCTATCAC 785 CFTR22B-s 474 497 424 547 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAATGTCAACTGCTTGAGTG TTTT 786 CFTR22B-as 707 733 657 783 AAGTAACAGAACATCTGAAACTCACAC 787 CFTR22C-s2 670 686 620 736 CTTGCTGCTTGATGAAC 788 CFTR22C-as 821 843 771 893 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGGGCAATTATTTCATATCT TGG 789 HUMCFTRA25 CF23A-s3 223 240 173 290 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTATCAAGGTAAATACAGA 790 CF23A-as3 353 369 303 419 GCTTCTATCCTGTGTTC seg ID# locus primer name primer alignment Primer sequences 5'-3' on AH006034 upstream downstr. start end 50 bp 50 bp 791 CF23B-s2 256 276 206 326 GATATTATGTGTGGTATTTTC 792 CF23B-as2 477 495 427 545 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAACTTGTACATTGTTGCA 793 CFTR23-s 218 244 168 294 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATATTATCAAGGTAAATAC AGATCAT 794 CFTR23-as 445 469 395 519 GGAACTATCACATGTGAGATTGTTA 829 CFTR 23B-s3 287 308 237 358 GCCCCCGCCCGAGAACATACCAAATAATTAGAA 830 CFTR 23B-as3 477 495 427 545 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGGAACTTGTACATTGTTGCA 79 HUMCFTRA26 CF24A-s2 107 122 57 172 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCTTTGAGCCTGTGCC 796 CF24A-as2 300 315 250 365 GCTTGAGTTCCGGTGG 797 CF24B-s2 267 282 217 332 CATCAGCCCCTCCGAC 798 CF24B-s2 482 498 432 548 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGAGGCAGAGGTA 799 CFTR24A-s 82 99 32 149 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCATTGCATTCTTTGACTT 800 CFTR24A-as 280 296 230 346 AAGAGCTTCACCCTGTC 801 CFTR24B-s 213 229 163 279 GCAGTACGATTCCATCC 802 CFTR24B-as 489 504 439 554 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCCTTGTTTTCTGAGGC Table Y TTGE Group Listing for CFTR Gene Extension GeneProduct Group Position run group PCRtemp CFTR 16A-5 1 A 45. 5-52. 5 49 CFTR 6B2 1 B 125 V 49 CFTR 17B1 1 C 1. 5 rr 52 CFTR 21A3 1 D run time 4. 67 hours 52 CFTR 12 2 A 60 CFTR 7A4 2 B 52 CFTR 5A 2 C 52 CFTR 5B 2 D 62 CFTR 8A 3 A 60 CFTR 2B5 3 B 49 CFTR 17B4 4 A 49 CFTR 6B1 4 B 54 CFTR 6A3-2 4 C 52 CFTR 8B3 5 A 50. 5-56. 5 52 CFTR 23B3 5 B 125V 49 CFTR 13G 5 C 1. 5 rr 59 CFTR 16B-2 6 A run time 4 hours 46 CFTR 7D3 6 B 59 CFTR 11A 7 A 49 CFTR 19A 7 B 54 CFTR 13F3 7 C 54 CFTR 14B2-3 8 A 60 CFTR 13A2 8 B 54 CFTR 13B3 8 C 49 CFTR 21 B3 8 D 46 CFTR 14A3 9 A 54 CFTR 17A2 9 B 60 CFTR 4B 9 C 52 CFTR 23A3 10 A 46 CFTR 19in 10 B 49 CFTR 14A2 10 C 59 CFTR 3A2 11 A 50. 5-56. 5 46 CFTR 18A 11 B 125 V 60 CFTR 2A 11 C 1. 2 rr 54 CFTR 10 12 A run time 5 hours 59 CFTR 14A1 12 B 46 CFTR 22A2 12 C 52 CFTR 13C 13 A 50. 5-56. 5 60 CFTR 10C3 13 B 125 V 54 CFTR 11B 13 C 1. 5 rr 52 CFTR 3B 14 A run time 4 hours 54 CFTR 18B 14 B 60 CFTR 17A16 14 C 52 -101- Extension <BR> <BR> Gene Product Group Position run group PCR temp CFTR 19B2 15 A 54. 5-61 59 CFTR 7B2 15 B 125 V 46 CFTR 4A2 15 C 1. 5 rr 54 CFTR 20 16 A run time 4 hours 49 CFTR 17A-3 16 B 46 CFTR 13-E3 16 C 49 CFTR 22C 17 A 59 CFTR 22B 17 B 59 CFTR 6A2 17 C 49 CFTR 15A 18 A 54 CFTR 19D2 18 B 46 CFTR 14B1 18 C 54 CFTR 15B2 19 A 54 CFTR 13C2 19 B 62 CFTR 17B3 19 C 60 CFTR 6A1 19 D 62 CFTR 17B2 20 A 49 CFTR 19C3 20 B 52 CFTR 24B2 20 C 52 CFTR 20 again 21 A 55-60 49 CFTR 7C 21 B 150 V, 1 rr, run time 5 hours 60 CFTR 13E 22 A 59-64 59 CFTR 1A 22 B 125 V 59 CFTR 13D2 22 C 1. 5 rr 62 CFTR 24A2 23 A run time 3. 3 hours 62 CFTR 1 B 23 B 59 CFTR 17B6 24 A 55. 5-59. 5 46 CFTR 17B5 24 B 125 V, 1. 5 rr 46 -102- TABLE Z<BR> Novel mutations detected to date in relation to total tested Sample what Other Mutations Novel Variant Nucleotide Change Catrier Tested Test Fragment Seen ? Other Polys Seen ? CF typ or atyp ? Sweat Test History (if avail) 1525-2 Ato G AtoG D No-10 (old) G551D no unknown unknown Y1424X TACtoTAG D Yes-24a dF508 no typica) positive 602 del 14 del D No-4b (old) dF50S M470V typical posiiive FTT R1162Q CGAtoCAA D No-19d no no unknown borderline 3272-11 CtoG CtoG D No-17M. dF508 M470V typical unknown R3M AGG to ATG C No-1a (old) no M470V/M470V NIA N/A S341P TCAtoCCA D Yes-7c (o) d) dFSOS M470V typical positive FTT, recurrent resp. problems Y1424X TAC to TAG D Yes-24a no no N/A N/A family history is indication (see case F191V TTTtoGTT-D Yes-5b (old) dF508 no atypical borderline nasal polyps 3539de1 16 CCATGAATATCATGA D Yes-18a, 18b dF508 M470V typical unknown 1717-4 AtoS A'toG D No-11a (o) d) 5T variant no N/A N/A '19b (old) V5201 no NIA NIA CBAVD 3601-3 AGTtoACT D No-4b no M470V typical borderline bronchiectasis, sputum production, enzymes for absorpfion S158T AGTtoACT D No- 2789+3insA insA D No-14b2 dFSOS no typica) positive R1128G AGAtoGGA D No-1Sa, 18b 5T variant no unknown unknown 1341+1G to T G to T. D No-8b dFS08 M470V unknown unknown V456A GTTtoGCT D No-9c 6T variant M470V N/A unknown malewithCBAVD V4S5A GTTto GGT D Yes 87 9c dF508 M470V typical N/A fetus with echogenic bowel, choroid plexus cysts, 51159Y TCTto TAT D No-19d no M470V typical positive chronic cough. elevated sweat choloride, FTT 4374+7 C to T CtoT D No-23b Y122C M470V unknown unknown TAT to TGT 1) No-4a 4374+7 CtoT M470V unknown unknown Y122C GTTtoGCT D No-9c no M470V/M470V unknown unknown E815A GAAtoGCA D No-13f no M470V/M470V typical borderline recurrent pancreati6s, seattest50&A7, whipple procedure 4375-Sderr detT D No-24a dF508 M470V unknown unknown bronchiectasis, pseudomonas, nasal polyps, pancreatic D993A GACto GCC D No-16b dFS08. M470V typical unknown steatonhea F575Y TTT toTAT C Yes 87 12 no M470V/M470V N/A NtA canrierscreen 1285F ATTtoTTT D Yes-6b2 ReferA no unknown unknown L137P CTCto CCC D No-4a E585X no unknown unknown 367insC ins C D No-3b ST variant no unknown unknown 2752-6TtoC TtoC D No"14b1 no M470V unknown unknown 296*28AtoG. AtoG D No-Zb no no unknown unknown V431 GTTto ATr D No-2a no M470V unknown unknown 1429dey7 del TTCTCAC D Yes ? 9c G542X no 1ypicai unknown intestinal blockage, sweats unsuccessful too young 1898+33CtoA CtoA D No-12 no M470V t unknown positive meconium ileus at birth, bowel resections, feeding c D Yes-igd no M470V/M470V typicai unknown intolerance 3499+26 C to G CtoG D No-17b4 no no N/A N/A CBAVD CCATGAATATCATGA D Yes ? 18b, 18b no M470V typical positive sweats 76 and 88 N432D AAT to GAT D No-9c no no atypical unknown recurrent pneumonia, chronic cough and weight toss 4209TGTTtoAA TGTTtoAA D No-22b dF508 no typicat unknown 4209TGTT to M TGTT to M D No-22b dF5O8 no typical unknown 2585dent dsl T D Na-13f dF508 M470V typical unknown 2585deiT del T D Yes ? 13f no M470V typical positive bronchieotasis, pancreatilis insufflent L1335F CTTtu TTT D No-22b no M470V typical unknown D806G GATto GGT C No-13f no M470V N/A N/A carrier screen G817V GGCtoGTC D No-13f G576A/R668C no atypical unknown 548insTAC ins TAC D No-4a dF508 M470V typical unknown TABLE Z<BR> Novel mutations detected to date In relation to total tested Sample Dxor Previously What OtherMutations Novel Variant NucleoUde Change Carrier Tested Test Fragment seen ? Other Polys Seen ? CF typ or atyp ? Sweat Test History (fi avail) 2585de) T de) T D No-13 3849+10KbCioT M470V/M470V attical unknown 210SdelG del G D Yes 87 13b, 13c R1066C M470V typical unknown pneumonia, V456A GTTto GCT D No-9c dFS08 M41W atypical unknown Y913X TAT to TAA D Yes 87 15a dF608/11027T M470V typical borderline jejunal atresia, meconium ileus at birth S459F TCCtoTTC D No-9 seq no M470V unknown unknown family history is indication s459F TCCtoTTC D No-9seq no M470V unknown unknown family history is indication E588V GAA to GTA D No-12 dF508/R1438W no unknown unknown R1438W CGG to TGG D No-24a dF508/ES88V no unknown unknown L15P to CCT D No-1b no M470V typical unknown E823D GAA to GAT D No-13f S459F no typical positive S459F TCC to TTC D No-9 seq E823D no typical positive 836insT Ins T D No-6a2 no M470VM470V N/A NfA Daughter had CF, dF508/unknown (Family Hx) 1716+21 dens >30 dens 73D D No-10 no M470V/M470V unknown unknown F650L TTCtoTTA D No-13b 5T variant M470V atypical unknown bronchiectasis 1454 ins AGAT ins AGAT D No-9 seq dF508 no typical unknown 4015de14 ACT D No-21a dF508 no E588V GAAtoGTA D No-12 no M470V N/A N/A R1438W CGG to TGG D No-24a dF508 M470V alypical unknown F1099L TTCtoTTA D No-17b1, 17b2 G542X no atypical unknown R785Q CGA to GAA P No-13e 5T variant no typical unknown R117G CGCto GGC D No-4a no F508C/M470V/M470V typicat unknown i1051V ATT to GTT D No-17b1 no M470V atypical unknown IBS study V456A GrT to GCT 1) No-Sc R709X M470V atypical positive 186-11 C to T C to T D no-2a no M470V atypical unknown GAAtoTAA D No-3a dF508 no typical unknown meconium eus K536E AAAtoGAA D No-11a, 11b dFSD8, M470V typical positive R1097P CGCto CCC D No-17b2, 17b3 no M470V typical unknown obligate carrier 2751+3 A to C A to C D No-14a3 dF508 unknown unknown unknown obligate carrier R1097P CGC to CCC D No-17b2, 17b3 no no typical unknown R785Q CGA to CAA. D No-13e 5T variant no typical unknown F1099L TTCtoTTA D No-17b1, 17b2 dF508 no atypical unknown P439S CCTtoTCT D No-9 R668C no atypical unknown 0237SCAG to TAG D No-6a2 dF5D8 M470V typical unknown Novels Indicationfortesting Total Detected % fit % Novel CSI Novel Dx 3. 9 JK Ambry Genetics 711+62 CtoT ReferA 1525-73 AtoT SMS Types of Novels 63 I FTT Failure to Thrive Total Novels Found 79, TABLE AA<BR> AMBRY GENETICS-NOVEL MUTATION LIST CFTR AS estCode CR : u . C E T P N cleofide Novel-Variant N= =a Aditivnal-. Indication # Fra. IExon Chan e novel o =. o : Clinical Data-- I=mutations _ 1 CFTR 9 SEQ 1501 ins3 (TTG) 1501 ins3 (TTG) N 5T/9T variant Dx : Typical deltaF508 Symptomatic 2 CFTR 15B2 2951 del5 2951 del5 N 5T/9T variant Dx : Atypical Symptomatic 3 CFTR 3A2 297-1 G to A 297-1 G to A N M470V/M470V Dx : Typical Bronchiectosis 7T/7T variant Symptomatic Pneumonia : recurrent Q98BR 4 CFTR 7D3 TAT/TAA Y362X N M470V Dx : Typical Failure to thrive 7T/7T variant Symptomatic Stool : Malodorious W 1282X Sweat Test : positive Genetics positive-1 mutation found Malabsorption No detectable lung disease 5 CFTR 19D2 3849+72 G to A 3849+72 G to A N 9T/9T variant Dx : Typical CF-known affected Q98X Symptomatic deltaF508 6 CFTR 19D2 3849+72 G to A 3849+72 G to A N 9T/9T variant Dx : Typical Q98X Symptomatic deltaF508 7 CFTR 22B CCC/CTC P1372L N 7T/7T variant Dx : Atypical CF-R/O Symptomatic 8 CFTR 14B2-3 2789+17 C to T 2789+17 C to T N M470V Dx : Typical Pancreatitis : recurrent 7T/7T variant Symptomatic N/A-Elevated Amylase and Lipose, and Trypsin Level CASE TestCode PCR Nucleotide Novel Variant °'N= Additional Indication # Frag./Exon Change f novet potymorphisrns CUnica) Data mutation's 9 CFTR 8B3 1341+80 G to A 1341+80 G to A N M470V Dx : Typical Sinusitis : recurrent 7T/7T variant Symptomatic 10 CFTR : SMA 12 1898+44 del4 1898+44 del4 N Family History 11 CFTR 17A2, A3 3271+8 A to G 3271+8 A to G N 7T/7T variant Dx : Typical Sweat Test : borderline Symptomatic 12 CFTR 10 CTT/CCT L467P N M470V Dx : Typical Sinusitis : recurrent 7T/9T variant Symptomatic Malabsorption deltaF508 CF Cough : chronic 13 CFTR 4B 603delT 603delT N L467F Dx : Atypical Sweat Test : positive 9T/9T variant Symptomatic deltaF508 14 CFTR 6A1 GGG/GAG G213E N M470V Family Fam Hx : sibling with CF-Memphis 7T/7T variant History Horton (sister) R668C 15 CFTR 24A2 4375-5 C to T 4375-5 C to T N 7T/9T variant Dx : Atypical Symptomatic 16 CFTR 7B2, C TCA>CCA S341P N M470V Dx : Typical Genetics positive-DF508 7T/9T variant Symptomatic deltaF508 17 CFTR 11 B 1811 +1 G to A 1811 +1 G to A N 7T/9T variant Dx : Typical Sweat Test : positive M470V Symptomatic 18 CFTR 19D2 3849+72 G to A 3849+72 G to A N 9T/9T variant Dx : Typical CF Q98X Symptomatic deltaF508 19 CFTR 22A2 4165deIGT 4165deIGT N M470V Dx : Typical CF 7T/7T variant Symptomatic R553X CASE TestCode PCR Nucleotide,----Navel _Varianf-. N= Additional (ndication. novel polymorphisms Clinical Data I mutations 20 CFTR 14A1 2751+86de) TA 2751+86de) TA N M470V Carrier 7T/7T variant Screening 21 CFTR 10 1525-42 G to A 1525-42 G to A N 7T/9T variant Dx : Atypical Failure to thrive Symptomatic 22 CFTR 14A1 2751+86deITA 2751+86deITA N M470V Dx : Atypical Failure to thrive 7T/7T variant Symptomatic CF-R/O CF variant 23 CFTR 8A GAA/TAA E384X N M470V Family Fam Hx : parent positive mutation- 7T/7T variant History E384X 24 CFTR 14A1 2751+86delTA 2751+86delTA N M470V Dx : Atypical N/A-pseudomonas 7T/7T variant Symptomatic 25 CFTR 4A2 CGC/GGC R117G N M470V Dx : Atypical Sweat Test : positive-CF 7T/7T variant Symptomatic 26 CFTR 24A2 4375-30 C to T 4375-30 C to T N Family Fam Hx : cousin-1st cousin History 27 CFTR 11B GGA>AGA G545R N M470V/M470V Dx : Atypical 7T/7T variant Symptomatic L1065P 28 CFTR 12 1898+44 del4 1898+44 del4 N 7T/9T variant Dx : Atypical R668C Symptomatic G576A 29 CFTR 5A ACT/ATT T1641 N M470V/M470V Dx : Atypical 5T/9T variant Symptomatic L997F 30 CFTR 4A2 CtoG R117G N M470V Carrier Screening 31 CFTR 10 1525-42 G to A 1525-42 G to A N 7T/9T variant Dx : Atypical N/A-Hypoxia, Pulmonary Symptomatic Hypertension Respiratory Infection-chronic lung disease CASE TestCode PCR NucteotjdeNoveJ Variant N= Addjttona) ; ! indication # Frag./Exon Change novet polyrvrphisms Clinical Data I mutafiont'"" 32 CFTR 7C ACT/ATT T3511 N M470V Dx : Typical 7T/9T variant Symptomatic deltaF508 33 CFTR 2A GTT/ATT V431 N M470V Family 7T/7T variant History R1162L 34 CFTR 7C, b TCA>CCA S341 P N M470V Dx : Typical 7T/9T variant Symptomatic deltaF508 35 CFTR 14A1 2751+86deiTA 2751+86de ! TA N M470V Dx : Typical Sweat Test : positive 7T/7T variant Symptomatic Genetics positive-known 3849+40 A to G 3120+1 GoA 3120+1 G to A Respiratory Disorders : chronic 36 CFTR 2A Y38C Y38C N Dx : Typical Symptomatic 37 CFTR 17A2 3271+25 C to T 3271+25 C to T N M470V Dx : Typical Bronchiectosis-bilateral 7T/7T variant Symptomatic N/A-saturations with erucise Mucous : excessive-plugging Pneumonia : recurrent-bilateral 38 CFTR 7D3 1248+61 T to A 1248+61 T to A N 7T/7T variant Dx : Atypical N/A-see pedigree M470V/M470V Symptomatic R75Q 39 CFTR 8A GAA/TAA E384X N M470V Dx : Atypical Family History-sibling of Maggie 7T/7T variant Symptomatic Talbot-look for R1162Q and R1162Q E384X 40 CFTR 8A GAA/TAA E384X N M470V Dx : Atypical Family History-sibling is Maggie 5T/7T variant Symptomatic Talbot-look for R11629 and E384X CASE TestCode PCR Nucleotide_ Novel Varian,-N= Ailciitiomal In. dication # Frag./Exon Change novet, polymorphisms Clinical Data I mutations 41 CFTR 19D2 GAG>AAG E1228K N M470V/M470V Dx : Atypical N/A-GERD 7T/7T variant Symptomatic Respiratory Infection-pulmonary infection Stool : bowel obstruction-problems 42 CFTR 6A1 GGG>GAG G213E N M470V Dx : Atypical Genetics positive-R1162Q 7T/7T variant Symptomatic Family History-see Maisey Talbot R668C 43 CFTR 8A GAA>TAA E384X N M470V Dx : Atypical Genetics positive-R1162Q 7T/7T variant Symptomatic Family History-see Maisey Talbot R668C 44 CFTR 14B2-3 2789+23 T to A 2789+23 T to A N 7T/7T variant Dx : Typical Asthma Symptomatic Sinusitis : recurrent 45 CFTR 18A 3516del5 3516del5 N M470V Unknown 7T/7T variant 46 CFTR 2B GCT>GTT A46V N 7T/7T variant Dx : Atypical Pancreatitis : acute-but apparently Symptomatic w/no Sx of pancreatic insufficiency-lungs Sweat Test : positive-admitted in DKA 47 CFTR 22B 4209TGTT to AA 4209TGTT to AA N 7T/9T variant Dx : Typical Genetics negative-1 copy of deltaF508 Symptomatic DF508 by genzyme Sweat Test : positive-1995 = 85 48 CFTR 13F3 2622+19 G to C 2622+19 G to C N 7T/9T variant Dx : Typical Sweat Test : positive Symptomatic 49 CFTR 9 SEQ 1343deIG 1343deIG N M470V Dx : Typical Sweat Test : borderline 7T/9T variant Symptomatic Respiratory Disorders : chronic 3849+10 C to T GI Reflux 50 CFTR 16B-2 3041-49 T to C 3041-49 T to C N M470V Dx : Atypical Bronchiectosis-Hx of (history of) 7T/7T variant Symptomatic CASE TestCode PCR Nucleotide Novel Variant N= Additional :,.. lndication' Frag./txon Change'novei,, iooj' 4 :'t , :. - ! inutations 51 CFTR 13B3 TTC/TTA F650L N M470V/M470V Echogenic Echogenic Bowel-of fetus in 2nd 7T/7T variant Bowel on US trimester 52 CFTR 8A 1249-1 G to A 1249-1 G to A N M470V Dx : Typical Sweat Test : positive 7T/9T variant Symptomatic deltaF508 53 CFTR 15B2 2951 insA 2951 insA N 7T/7T variant Family N/A-see chart History 54 CFTR 14A1 TTG>TTC F834L N M470V Dx : Typical 7T/9T variant Symptomatic L997F 55 CFTR 10 1525-3 C to A 1525-3 C to A N M470V Carrier N/A-patient's wife is pregnant 7T/7T variant Screening 56 CFTR 9 SEQ 1342-1delG 1342-1delG N M470V Dx : Typical 7T/9T variant Symptomatic 11027 deltaF508T 57 CFTR 14A1 2751+51 T to C 2751+51 T to C N M470V Dx : Typical Asthma-unspecified allergic 7T/7T variant Symptomatic Rhinitis Nec. 58 CFTR 14A1 2751+86delTA 2751+86delTA N M470V Dx : Typical Asthma-unspecified allergic 7T/7T variant Symptomatic Rhinitis Nec. 59 CFTR 18A 3500-1 G to A 3500-1 G to A N 7T/7T variant Family History 60 CFTR 18A 3500-1 G to A 3500-1 G to A N 7T/9T variant Family Sweat Test : positive deltaF508 History 61 CFTR 8B3 GCC>GGC A399G N M470V/M470V Family 7T/7T variant History 62 CFTR 17B1 ATT/GTT 11051V N M470V Dx : Typical 7T/7T variant Symptomatic CASE TestCode PCR-Nucleotide w Novel Variant N=rv. Additionai : indication FragJExon Change novel-, ms Clinical Data 63 CFTR 6A3-2 875insTACA 875insTACA N 7T/9T variant Dx : Typical Meconium lleus-Term IUGR deltaF508 Symptomatic 64 CFTR 5A CTC/ATC L1831 N M470V Dx : Atypical Sinusitis : recurrent 7T/7T variant Symptomatic Bronchiectosis 65 CFTR 22 TGT/TCT C1344S N M470V/M470V Dx : Atypical 7T/7T variant Symptomatic 66 CFTR 4 TGC/TGA C128X N M470V Family Fam Hx : child with CF-+ mutations 7T/7T variant History DF508 and novel variant mutation C128X 67 CFTR 8A GAA/TAA E384X N 7T/7T variant Family Weight Loss R1162Q History Respiratory Disorders : chronic Family History 68 CFTR 22A2 del AC 4119delAC N M470V/M470V Dx : Atypical CBAVD : self-male with CBAVD 7T/7T variant Symptomatic G622D 69 CFTR 4B AGT/AAT S158N N 5T/7T variant Dx : Atypical CBAVD : self-male with infertility, Symptomatic CBAVD found at surgery 70 CFTR 12 TTTITAT F575Y N M470V Family Fam Hx : sibling with CF 7T/9T variant History 71 CFTR 24A2 TCC/TTC S1444F N 7T/9T variant Family Fam Hx : sibling with CF V11 I History deltaF508 72 CFTR 24A2 TCC/TTC S1444F N 7T/9T variant Family Fam Hx : sibling with CF Vill History 73 CFTR 13A2 2585deIT 2585delT N M470V Dx : Typical Genetics negative 87 mutations- 7T/9T variant Symptomatic one copy of DF508 11027T CF-known deltaF508 CASE TestCode PCR Nucieotide ? Nove ! Vacant N= Additional-indication # Frag. lExon hange novet polymorphisms Clinical Data I mutafio' 74 CFTR 21 B3 GCA/GAA A1319E/A1319E N M470V/M470V Dx : Typical 7T/7T variant Symptomatic 75 CFTR 7D3 CAG/CAA Q372Q N M470V Dx : Atypical 7T/9T variant Symptomatic deltaF508 76 CFTR 23B3 ATT/ATG 1982M N 4374+13 A to G Dx : Atypical 7T/7T variant Symptomatic 77 CFTR 24A2 4479delC 4479delC N M470V Dx : Typical Failure to thrive 7T/7T variant Symptomatic 78 CFTR 17A3 3271+25 C to T 3271+25 C to T N 5T/7T variant Dx : Atypical Genetics negative 87 mutations- Symptomatic minimal Sx Sweat Test : borderline-3x Sweat Test : positive-2x CF 79 CFTR 6A1 TTC/GTC F200V N M470V Dx : Atypical 7T/9T variant Symptomatic V754M 80 CFTR 8B3 GCC/GGC A399G N M470V Family Fam Hx : cousin-pt's mothers first 7T/7T variant History cousin 81 CFTR 3B 405+11 C to T 405+11 C to T N 7T/9T variant Dx : Atypical Genetics negative 87 mutations Symptomatic Bronchiectosis-+ staph and pseudomonas 82 CFTR 6B2 ATT/TTT 1285F N A455A Dx : Typical Respiratory Disorders : chronic Symptomatic 83 CFTR 22A2, B 4096-29 G to A 4096-29 G to A N Family Fam Hx : sibling with CF-died at 2 History weeks 84 CFTR 22A2, B 4096-29 G to A 4096-29 G to A N M470V Family Fam Hx : sibling with CF 7T/9T variant History G542X CASE TestCode PCR Nucieotide ov tndjcatibn Frag./Exon Change-° nove lymorphisms Clinicaf DaEa v., r-, inutaions . °_. :, 85 CFTR 16A-5 AAA/TAA K978X N 7T/7T variant Dx : Typical Sweat Test : positive 3272-26 A to G Symptomatic 86 CFTR 2lA3 4006-11 T to C 4006-11 T to C N M470V Carrier 7T/9T variant Screening 87 CFTR 4A2 TGC/TGA C128X N M470V Dx : Typical 7T/9T variant Symptomatic deltaF508 88 CFTR 15B2 2957deIT 2957delT N M470V Dx : Typical 7T/9T variant Symptomatic G542X 89 CFTR 17A3, A2 ACC/ATC T10361 N 7T/9T variant Dx : Atypical deltaF508 Symptomatic 90 CFTR 15B2 CACICTC H949L N M470V Dx : Typical 7T/9T variant Symptomatic H939R deltaF508 91 CFTR 7C ACT/ATT T3511 N M470V Dx : Atypical 7T/9T variant Symptomatic N1303K 92 CFTR 14B2-3 2789+22 G to A 2789+22 G to A N M470V/M470V Carrier 7T/7T variant Screening 93 CFTR 10 TGC/CGC C524R N 7T/7T variant Dx : Typical Genetics positive-one mutation 3120+1 G to A Symptomatic found, 3120+1G-A 94 CFTR 22B CAC/TAC H1350Y n 4374+13 A to G Dx : Atypical Failure to thrive 7T/7T varianT Symptomatic Sweat Test : positive-x2 Congestion-congested chest blood test positive 1993-Oregon CASE TestCode PCR Nucleotide Novel Variarit N= Additional Indication-- Frag. lEoon : Change. novel. :' polymorphisms. Clinical Data Clinical Data . utafons 95 CFTR 20 GAAITAA E1266X N 7T/9T variant Dx : Typical Sweat Test : borderline-sweat cl > deltaF508 Symptomatic 100 x 2 Genetics positive-DF508 CF 96 CFTR 24A2 4375-5 C to T 4375-5 C to T N 7T/7T variant Dx : Typical Asthma Symptomatic Sweat Test positive-2 x 54/52 chest pain abdominal pain 97 CFTR 18B TTG/TTT L1156F N M470V/M470V Carrier Fam Hx : spouse with positive 7T/7T variant Screening mutations-husband has DF508 98 CFTR IA 124 C to T 124 C to T N M470V Carrier 7T/7T variant Screening 99 CFTR 3A, B TGT/TGG C76W N M470V/M470V Carrier 7T/7T variant Screening 100 CFTR 18B 3600+37 A to T 3600+37 A to T N M470V Dx : Typical 7T/7T variant Symptomatic R668C G576A 101 CFTR 9 SEQ GCT/CCT A457P N M470V Dx : Typical Genetics negative-one copy of 7T/9T variant Symptomatic DF508/unknown deltaF508 Sweat Test : positive CF : mild 102 CFTR 12 GAA/GTA E588V N 9T/9T variant Dx : Typical Sweat Test : borderline-sweats 59 G542XSymptomatic pneumonia : recurrent 103 CFTR 21 B3 GCA/GAA A1319E N M470V Dx : Typical CF 7T/7T variant Symptomatic CASE TestCode PCR Nucteotide NovetVanaht N= Additiona ! indication # Frag./Exon Chnge ntvel p, ymarphisms Gtinical Data . I mutations 104 CFTR 13A2 AAA/GAA K598E N M470V Dx : Atypical Pancreatitis : recurrent 7T/9T variant Symptomatic Fam Hx : sibling with CF-sister + deltaF508 for DF508 Respiratory Disorders : chronic- chronic airway disease 105 CFTR 5B TTT/GTT F191V N M470V Dx : Typical 7T/9T variant Symptomatic 106 CFTR 2B 296+28 A to G 296+28 A to G N 7T/9T variant Dx : Atypical R170H Symptomatic 107 CFTR 10C CTT/CCT L467P N M470V/M470V Dx : Typical 7T/7T variant Symptomatic K710X 108 CFTR 24A2 GAG/AAG E1433K N 7T/9T variant Dx : Typical Genetics positive-IRT and had one deltaF508 Symptomatic DF508 Pt. screened + VE 109 CFTR 12 GTA//GCA V562A N 7T/7T variant Dx : Atypical Asthma-QNS sweat test 4X Symptomatic 110 CFTR 6B2 GAA/GAT E282D N M470V Dx : Typical Pneumonia : recurrent-airway Symptomatic blocking 111 CFTR : SMA 17B CGC/TGC R1097C N M470V Family 1556V History 112 CFTR 13A2 ACT/AGT T604S N 7T/9T variant Dx : Typical Sweat Test : negative deltaF508 Symptomatic 113 CFTR 13A2 CTG/CCG L594P N M470V Dx : Typical Sweat Test : positive R1158X Symptomatic Pancreatic : insufficiency 114 CFTR 21A3, B3 4076del 4076del8 N M470V Dx : Atypical Infertility-pt with azoospermia TATGGAAA 5T/7T variant Symptomatic 115 CFTR 9 SEQ GTC/GCC V440A N M470V Dx : Atypical Infertility-pt with azoospermia 5T/7T variant Symptomatic CASE TestCode PCR fucleotide Novel Variant N= Additional Indication #-Frag./Exon Change novet polymorphisms i, Clinical Data mutations 116 CFTR 12 TTT/TAT F575Y N M470V Dx : Typical Pancreatitis : recurrent 7T/9T variant Symptomatic deltaF508 117 CFTR 10C CTT/CCT L467P N M470V Dx : Typical Failure to thrive 7T/9T variant Symptomatic Sweat Test : positive deltaF508 Malabsorption 118 CFTR 4B ATG/TTG M152L N 7T/9T variant Dx : Typical Sweat Test : borderline M470V Symptomatic Cough : chronic R75Q 119 CFTR 15A TAT/TAA Y913X N Dx : Typical Stool : diarrhea Symptomatic Weight Loss Vomiting 120 CFTR 3B GGA/CGA G85R N deltaF508 Dx : Typical Genetics negative 87 mutations- Symptomatic DF508 Sweat Test : positive 121 CFTR 2A TAC/TGC Y38C N Dx : Atypical Failure to thrive Symptomatic Stool : Malodorious Stool : diarrhea 122 CFTR : SMA 9 SEQ GTT/GCT V456A N M470WM470V Family Previously reported mutation- History R709X, V456A, M470V 123 CFTR 12 TCT/TGT S573C N Dx : Typical Symptomatic TABLE BB EXTENSION PRODUCTS GENERATED FOR TTGE ASSAY All exons and clamps are in capital letters. Clamp region sense corresponds to : 5'CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCG (SEQ ID NO : 555) Clamp region rev. complement 5'CGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 556) CF1A CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGggaagccaaatgacatcaca gca ggtcagagaaaaagggttgagcggcaggcacccagagtagtaggtctttggcattaggag cttgagcccagacggccctagca gggaccccagcgcccagagaccATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTC CAAA CTTTTTTTCA (SEQ ID NO : 557) CF1B cccagcgcccagagaccATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAAC TTTT TTTCAGgtgagaaggtggccaaccgagcttcggaaagacacgtgcccacgaaagaggagg gcgtgtgtatgggttgggttt ggggtaaaggaataagcagtCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 558) CF2A-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGccagaaaagttgaatagtat cagat tccaaatctgtatggagaccaaatcaagtgaatatctgttcctcctctctttattttagC TGGACCAGACCAATTTTGAGG AAAGGATACAGACAGCGCCTGGAATTGTCAGACATATACCAAATCCCTTCTGTTGATTCT GCTGACAATCT (SEQ ID NO : 559) CF2B-5 ATACCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAGgtatgt tcatgt acattgtttagttgaagagagaaattcatattattaattatttagagaagagaaagcaCG GGCGGGGGCGGCGGGGC GGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 560) CF3A2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGtggtgttgtatggtctccat gagatttt gtctctataatacttgggttaatctccttggatatacttgtgtgaatcaaactatgttaa gggaaataggacaactaaaatatttgcacat gcaacttattggtcccactttttattcttttgcagAGAATGGGATAGAGAGCTGGCTTCA AAGAAAAATCCTAA ACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAGATTTATGTT (SEQ ID NO : 561) CF3B GCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCGATGTTTTTTCTGGAG ATTTATGTTCTATGGAATCTTTTTATATTTAGGGgtaaggatctcatttgtacattcatt atgtatcacataactat atgcatttttgtgattatgaaaagactacgaaatctggtgCGGGCGGGGGCGGCGGGGCG GGCGCGGGGC GCGGCGGGCG (SEQ ID NO : 562) CF4A-2 (also has 12 bp miniclamp) CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGaatttctctgtttttcccct tttgtagGA AGTCACCAAAGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCGGA TAACAAGGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTTAT T GTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATG AGAATAGCTCGGGCGGGGGCG (SEQ ID NO : 563) CF4B GACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAGATGAGAAT AGCTATGTTTAGTTTGATTTATAAGAAGgtaatacttccttgcacaggccccatggcaca tatattctgtatcgtaca tgttttaatgtcataaattaggtagtgagctggtacaagtaagggataaatgctgaCGGG CGGGGGCGGCGGGGCG GGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 564) CF5A CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGataatatatttgtattttgt ttgttgaaat tatctaactttccatttttcttttagACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAA TAAGTATTGGAC AACTTGTTAGTCTCCTTTCCAACAACCTGAACAAATT (SEQ ID NO : 565) CF5B AGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTGTTAGTCTCCTTTCCA A CAACCTGAACAAATTTGATGAAgtatgtacctattgatttaatcttttaggcactattgt tataaattatacaactggaaag gcggagttttcctgggtcagatCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGG CG (SEQ ID NO : 566) CF6A-1 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGttgttagtttctaggggtgg aagatac aatgacacctgtttttgctgtgcttttattttccagGGACTTGCATTGGCACATTTCGTG TGGATCGCTCCTTT GCAAGTGGCACTCCTCATGGGGCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCTGTG GACTTGGTTTCCTGATAGTCCTT (SEQ ID NO : 567) CF6A-2 GCTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCT TGCCCTTTTTCAGGCTGGGCTAGGGAGAATGATGATGAAGTACAGgtagcaacctatttt cataact CGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 568) CF6A-3-2 GGGAGAATGATGATGAAGTACAGgtagcaacctatfttcataacttgaaagtfttaaaaa ttatgttttcaaaaagccc actttagtaaaaccaggactgctctatgcatagaacagtgatcttcagtgtCGGGCGGGG GCGGCGGGGCGGGC GCGGGGCGCGGCGGGCG (SEQ ID NO : 569) CF6B-1 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGccttgagcagttcttaatag ataattt gacttgtttttactattagattgattgattgattgattgattgatttacagAGATCAGAG AGCTGGGAAGATCAGTGAA AGACTTGTGATTACCTCAGAAATGATTGAAAATATCCAATCTGTTAAGGCATA (SEQ ID NO : 570) CF6B-2 GAAAATATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAA AACTTAAGACAgtaagttgttccaataatttcaatattgttagtaattctgtccttaatt ttttaaaaatatgtttatcatggtagacttc cacctcaCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 571) CF7A-4 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgagaccatgctcagatcttc cattcc aagatccctgatatttgaaaaataaaataacatcctgaattttattgttattgtttttta tagAACAGAACTGAAACTGACTC GGAAG (SEQ ID NO : 572) CF7B2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgttattgttttttatagAAC AGAAC TGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCT CAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCC T CCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCA ATTTCCC (SEQ ID NO : 573) CF7C CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGACTGAAACTGACTCGGA AGGCAGCCTATGTGAGATACTTCAATAGCTCAGCCTTCTTCTTCTCAGGGTTCTTTGTGG TGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGGAATCATCCTCCGGAAAATATTCA C CACCATCTCATTCTGCATTGTTCTGCGCATGGCGGTCACTCGGCAATTTCCCTGGGCTGT ACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGgtaatgtaccat (SEQ ID NO : 574) CF7D-3 aatttcCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAAAATACAGg taat gtaccataatgctgcattatatactatgattCGGGCGGGGGCGGCGGGGCGGGCGCGGGG CGCGGCG GGCG (SEQ ID NO : 575) CF8A CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgcacaatgagagtataaagt agat gtaataatgcattaatgctattctgattctataatatgtttttgctctcttttataaata gGATTTCTTACAAAAGCAAGAATAT AAGACATTGGAATATAACTTAACGACTACAGAAGTAGTGATGG (SEQ ID NO : 576) CF8B-3 GGAATATAACTTAACGACTACAGAAGTAGTGATGGAGAATGTAACAGCCTTCTGGGAGGA Ggtcagaatttttaaaaaattgtttgctctaaacacctaactgttttcttctttgtgaat atggatttcatcctaatggcgaataaaattaga atgatgatataactggtagaactggaaCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCG GCGG GCG (SEQ ID NO : 577) CF10 cctgagcgtgatttgataatgacctaataatgatgggttttatttccagACTTCACTTCT AATGATGATTATGGGAGA ACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTT TTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTATGATGA A TATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGgtaagaaactatgtgaaa actttttga ttatgcatatgaacccttcacactacccaaattatatatttggctccatattcaatcggt tagtctacatCGGGCGGGGGCGG CGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 578) CF1 OC-3 GGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTC TCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTTTGGTGTTTCCTA T GATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGgtaagaaactat gtgaa aactttttgattatgcatatgaacccttcacactacccaaattatatatttggctccata ttcaatcggttCGGGCGGGGGCGG CGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 579) CF11A-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgatatatgattacattagaa ggaag atgtgcctttcaaattcagattgagcatactaaaagtgactctctaattttctatttttg gtaatagGACATCTCCAAGTTTGCA GAGAAAGACAATATAGTTCTTGGAGAAGGT (SEQ ID NO : 580) CF11B atagGACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCAC A CTGAGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAGgtgaataactaattattggtct agcaagcattt gctgtaaatgtcattcatgtaaaaaaattacagacatttctctattgcCGGGCGGGGGCG GCGGGGCGGGCGCG GGGCGCGGCGGGCG (SEQ ID NO : 581) CF12 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgtgaactgtttaaggcaaat catcta cactagatgaccaggaaatagagaggaaatgtaatttaatttccattttctttttagAGC AGTATACAAAGATGCTGATT TGTATTTATTAGACTCTCCTTTTGGATACCTAGATGTTTTAACAGAAAAAGAAATATTTG AA AGgtatgttctttgaataccttacttataatgctcatgctaaaataaaagaaagacagac tgtcccatca (SEQ ID NO : 582) CF13A-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGtatttatatgtttttatatc ttaaagCT GTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATGGAACATT T AAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGACATT T TCAGAACTCCAAAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATG (SEQ ID NO : 583) CF13C-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGCAAAAGACTCCCTTA CAAATGAATGGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCTTAGTA CCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGCGTGAT (SEQ ID NO : 584) CF13D-2 GATACTGCCTCGCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGG CAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCACCGGGC GGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 585) CF13E-3 tcaggcacGAAGGAGGCAGTCTGTCCTGAACCTGATGACACACTCAGTTAACCAAGGTCA G AACATTCACCGAAAGACAACAGCATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAAA CTTGACTGAACTGGATATATATTCAAGAAGGCGGGCGGGGGCGGCGGGGCGGGCGCG GGGCGCGGCGGGCG (SEQ ID NO : 586) CF13-G GTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGGATATATATTCAAGAAGGTTATCT CAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACGCGGGCGGGGGCG GCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 587) CF13B-3 AGGTAGCAGCTATTTTTATGGGACATTTTCAGAACTCCAAAATCTACAGCCAGACTTTAG C TCAAAACTCATGGGATGTGATTCTTTCGACCAATTTAGTGCAGAAAGAAGAAATTCAATC C TAACTGAGACCTTACACCGTTTCTCATTAGAAGGAGATGCTCCTGTCTCCTGGACAGAAA CAAAAAAACAATCTTTTAAACAGACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTC T CAATCCAATCAACTCTATACGAAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAA T GGCATCGAAGAGGATTCTGATGAGCCTTTAGAGAGAAGGCTGTCCCGGGCGGGGGCGG CGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 588) CF13C CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGATGGGACATTTTCAGAA CTCCAAAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTCTTTCGACCAA T TTAGTGCAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACACCGTTTCTCATTAGAAG GAGATGCTCCTGTCTCCTGGACAGAAACAAAAAAACAATCTTTTAAACAGACTGGAGAGT TTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAATCAACTCTATACGAAAATTTTCCA T TGTGCAAAAGACTCCCTTACAAATGAATGGCATCGAAGAGG (SEQ ID NO : 589) CF13E CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGATGAGCCTTTAGAGA GAAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACTGCCTCGCATCAGC GTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGTCCTGAACCTGAT GACACACTCAGTTAACCAAGGTCAGAACATTCACCGAAAGACAACAGCATCCACACGAAA AGTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGG (SEQ ID NO : 590) CF13F-3 (also has 6 bp miniclamp) CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGCGAAAGACAACAGCATC CACACGAAAAGTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGGATATATATTCAAG AAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTTAAA Ggtaggtatacatcgcttgggggtatttcaccccacagaatgcaattgagtagaatgcaa tatgtagcatgtaacaaaCGGGC G (SEQ ID NO : 591) CF14A-1 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGttcatatattaaaaataaaa ccaca atggtggcatgaaactgtactgtcttattgtaatagccataattcttTTATTCAGGAGTG CTTTTTTGATGATATGGA GAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTA (SEQ ID NO : 592) CF14A-2 GAGCATACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAG CTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGgtaagaatgttcta ttgtaaagta ttacCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 593) CF14A-3 ACCAGCAGTGACTACATGGAACACATACCTTCGATATATTACTGTCCACAAGAGCTTAAT T TTTGTGCTAATTTGGTGCTTAGTAATTTTTCTGGCAGAGgtaagaatgttctattgtaaa gtattactggattt aaagttaaattaagatagtttggggatgtatacatatatatgcacacacataaatatCGG GCGGGGGCGGCGGGGC GGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 594) CF14B-1 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgtgtaccttgatattggtac acacat caaatggtgtgatgtgaatttagatgtgggcatgggaggaataggtgaagatgttagaaa aaaaatcaactgtgtcttgttccattcc agGTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAAgtgag (SEQ ID NO : 595) CF14B-3 GCTGTGGCTCCTTGGAAAgtgagtattccatgtcctattgtgtagattgtgttttatttc tgttgattaaatattgtaatccactat gtttgtatgtattgtaatccactttgtttcatttctcccaagcattatggtagtggaaag ataaggttttttgtttaaatgatgaccattagttgg gtgaggtgacacattcctgtagtcctagctcctccacaggctgacgcaggaggatcactt gagcccaggagttcagggctgtagtC GGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 596) CF15A CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGcatgtattggaaattcagta agtaac tttggctgccaaataacgatttcctatttgctttacagCACTCCTCTTCAAGACAAAGGG AATAGTACTCATAG TAGAAATAACAGCTATGCAGTGATTATCACCAGCACCAGTTCGTATTATGTGTTTTACAT T TACGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGT GCATACTCTAATCACAGTGTCGAA (SEQ ID NO : 597) CF15B-2 CGTGGGAGTAGCCGACACTTTGCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGC ATACTCTAATCACAGTGTCGAAAATTTTACACCACAAAATGTTACATTCTGTTCTTCAAG C ACCTATGTCAACCCTCAACACGTTGAAAGCAGgtactttactaggtctaagaaatgaaac tgctgatccaccat caatagggcctgtggttttgttggttttctaatgCGGGCGGGGGCGGCGGGGCGGGCGCG GGGCGCGGC GGGCG (SEQ ID NO : 598) CF16A-5 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGctgaatgcgtctactgtgat ccaaac ttagtattgaatatattgatatatctttaaaaaattagtgttttttgaggaatttgtcat cttgtatattatagGTGGGATTCTTAATA GATTCTCCAAAGATATAGCAATTTTGGATG (SEQ ID NO : 599) CF16B-2 (also has 8 bp miniclamp) CCCGCCCGttgaggaatttgtcatcttgtatattatagGTGGGATTCTTAATAGATTCTC CAAAGATATAG CAATTTTGGATGACCTTCTGCCTCTTACCATATTTGACTTCATCCAGgtatgtaaaaata agtaccgt taagtatgtctgtattattaaaaaaacaataacaaaagcaaatgtgattttgCGGGCGGG GGCGGCGGGGCGGGC GCGGGGCGCGGCGGGCG (SEQ ID NO : 600) CF17A1-6 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGaaagaaataaatcactgaca cact ttgtccactttgcaatgtgaaaatgtttactcaccaacatgttttctttgatcttacagT TGTTATTAATTGTGATTGGAGCT ATAGCAGTTGTCGCAGTTTTAC (SEQ ID NO : 601) CF1 7A-2 ccaacatgttttctttgatcttacagTTGTTATTAATTGTGATTGGAGCTATAGCAGTTG TCGCAGTTTTA CAACCCTACATCTTTGTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCA T ATTTCCTCCAAACCTCACAGCAACTCAAACAACTGGAATCTGAAGgtatgacagtgaatg tgcgata ctcatcttgtaaaaaagctataagagctatttgagattctCGGGCGGGGGCGGCGGGGCG GGCGCGGGGC GCGGCGGGCG (SEQ ID NO : 602) CF17A-3 (also has 9 bp miniclamp) CCCCGCCCGATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTT GTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACC T CACAGCAACTCAAACAACTGGAATCTGAAGgtatgacagtgaatgtgcgatactcatctt gtaaaaaagctata agagctatttgagattcCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 603) CF17B-1 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGttaaccaatgacatttgtga tatgatt attctaatttagtctttttcaggtacaagatattatgaaaattacattttgtgtttatgt tatttgcaatgttttctatggaaatatttcacagGC AGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACAC (SEQ ID NO : 604) CF1 7B2-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGaatatttcacagGCAGGAGT C CAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCGTGCCTTCGGAC GGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTGCCAACTGGT T CTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAAATGATTTTTGTCATCTT C TTCATTGCTGTTACCTTCA (SEQ ID NO : 605) CF17B-3 ACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTT ACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGA AATGATTTTTGTCATCTTCTTCATTGCTGCGGGCGGGGGCGGCGGGGCGGGCGCGGGG CGCGGCGGGCG (SEQ ID NO : 606) CF17B-4 CTGGTTCCAAATGAGAATAGAAATGATTTTTGTCATCTTCTTCATTGCTGTTACCTTCAT TT CCATTTTAACAACAGgtactatgaactcattaactttagctaagcatttaagtaaaaaat tttcaatgaataaaatgctgcatt ctataggttaCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 607) CF17B-5 ACTTCGTGCCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTT ACATACTGCCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGA ACGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 608) CF17B6-6 TTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTGCC AACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAAATGATTTTT G TCATCTTCTTCATTGCTGCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGG CG (SEQ ID NO : 609) CF18A CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGttaatgtgatatgtgcccta ggagaa gtgtgaataaagtcgttcacagaagagagaaataacatgaggttcatttacgtcttttgt gcatctatagGAGAAGGAGAAG GAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATGAGTACATTGCAGTGGGCTG TAAACTCCAGCATAGATGTGGATAGCTTGgtaagtcttatcatct (SEQ ID NO : 610) CF18B GAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATGAGTACAT TGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTGgtaagtcttatcatctttt taacttttatga aaaaaattcagacaagtaacaaagtatgagtaatagcatgaggaagCGGGCGGGGGCGGC GGGGCGGGCG CGGGGCGCGGCGGGCG (SEQ ID NO : 611) CF19A-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGaagttattttttaggaagca tcaaact aattgtgaaattgtctgccattcttaaaaacaaaaatgttgttatttttatttcagATGC GATCTGTGAGCCGAGTCTTTA AGTTC (SEQ ID NO : 612) CF19B-2 tatttcagATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTA AAC CTACCAAGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGA ATTCACACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTCGGGCGGG GGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 613) CF19C-3 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTGTGAGCCGAGTCTTTA AGTTCATTGACATGCCAACAGAAGGTAAACCTACCAAGTCAACCAAACCATACAAGAATG GCCAACTCTCGAAAGTTATGATTATTGAGAATTCACACGTGAAGAAAGATGACATCTGGC CCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAGCAAAATACACAGAAGGTGGAAAT GCCAT (SEQ ID NO : 614) CF19D-2 CGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACAG CAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCTG GCCAGAGGgtgagatttgaacactgcttgctttgttagactgtgttcagtaagtgaatcc cagtagcctgaagcaatgtgttagca gaatctatttgtaacattaCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 615) CF19-in CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGcttgatttctggagaccaca aggta atgaaaaataattacaagagtcttccatctgttgcagtattaaaatggCgagtaagacac cctgaaaggaaatgttctattcatggta caatgcaattacagctag (SEQ ID NO : 616) CF20 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGctgaattatgtttatggcat ggtacct atatgtcacagaagtgatcccatcacttttaccttatagGTGGGCCTCTTGGGAAGAACT GGATCAGGGAAG AGTACTTTGTTATCAGCTTTTTTGAGACTACTGAACACTGAAGGAGAAATCCAGATCGAT G GTGTGTCTTGGGATTCAATAACTTTGCAACAGTGGAGGAAAGCCTTTGGAGTGATACCAC AGgtgagcaaaaggacttagccagaaaaaagg (SEQ ID NO : 617) CF21A-3 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGagttattcatactttcttct tcttttctttttt gctatagAAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACA GTG GAGTGATCAAGAAATATGGAAAGTTGCAGATGAGGTAAGGCT (SEQ ID NO : 618) CF21 B-3 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGTTTCTGGAACATTTAGAA AAAACTTGGATCCCTATGAACAGTGGAGTGATCAAGAAATATGGAAAGTTGCAGATGAGg t aaggctgctaactgaaatgattttgaaaggggtaactcataccaacacaaatggctgata tagctgacatcattc (SEQ ID NO : 619) CF22A-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGtgagctgtcaaggttgtaaa tagact tttgctcaatcaattcaaatggtggcaggtagtgggggtagagggattggtatgaaaaac ataagctttcagaactcctgtgtttattttt agaatgtcaactgcttgagtgtttttaactctgtggtatctgaactatcttctctaactg cagGTTGGGCTCAGATCTGTGAT AGAACAGTTTCCTG (SEQ ID NO : 620) CF22B- CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGgaatgtcaactgcttgagtg tttttaa ctctgtggtatctgaactatcttctctaactgcagGTTGGGCTCAGATCTGTGATAGAAC AGTTTCCTGGGA AGCTTGACTTTGTCCTTGTGGATGGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTG ATGTGCTTGGCTAGATCTGTTCTCAGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGT GCTCATTTGGATCCAGTgtgagtttcagatgttctgttactt (SEQ ID NO : 621) CF22C-2 CTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGTgtgagtttcagatgttctgtt acttaatagcac agtgggaacagaatcattatgcctgcttcatggtgacacatatttctattaggctgtcat gtctgcgtgtgggggtctcccaagatatga aataattgcccaCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 622) CF23A-3 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGtatcaaggtaaatacagatc attact gttctgtgatattatgtgtggtattttctttcttttctagAACATACCAAATAATTAGAA GAACTCTAAAACAAGCAT TTGCTGATTGCACAGTAATTCTCTGTGAACACAGGATAGAAGC (SEQ ID NO : 623) CF23B-3 (also has 11 bp miniclamp) GCCCCCGCCCGagAACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATT GCACAGTAATTCTCTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTGg t gagtctttataactttacttaagatctcattgcccttgtaattcttgataacaatctcac atgtgatagttcctgcaaattgcaacaatgtac aagttcCGGGCGGGGGCGGCGGGGCGGGCGCGGGGCGCGGCGGGCG (SEQ ID NO : 624) CF24A-2 CGCCCGCCGCGCCCCGCGCCCGCCCCGCCGCCCCCGCCCGcctttgagcctgtgccagtt tctgtcc ctgctctggtctgacctgccttctgtcccagatctcactaacagccatttccctagGTCA TAGAAGAGAACAAAGTGCG GCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGGAGCCTCTTCCGGCAAGCCATCA GCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGc (SEQ ID NO : 625) CF24B-2 CATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAACTCAAGCAAGTGCAAGT CTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAGGTGCAAGATACAAGG CTTTAGagagcagcataaatgttgacatgggacatttgctcatggaattggagctcgtgg gacagtcacctcatggaattggag ctcgtggaacagttacctctgcctcagaaaCGGGCGGGGGCGGCGGGGCGGGCGCGGGGC GCGGC GGGCG (SEQ ID NO : 626)