NOVEL COMPOUND AS AGONIST FOR PPARγ AND PPARα,

METHOD FOR PREPARATION OF THE SAME, AND PHARMACEUTICAL COMPOSITION CONTAINING THE SAME

FIELD OF THE INVENTION

The present invention relates to a novel compound as an agonist for peroxisome proliferator-activated receptor gamma (PPARγ) and alpha (PPARα), processes of preparing the same, and pharmaceutical compositions containing the same as an active agent.

BACKGROUND OF THE INVENTION

Diabetes mellitus has serious effects on people's health and accompanies various complications. Type II diabetes mellitus accounts for 90% or more of total patients with diabetes mellitus. Representative examples of complications accompanying diabetes include hyperlipidemia, obesity, hypertension, retinopathy and renal insufficiency (Paul Zimmer, et al., Nature, 2001, 414, 782). Sulfonylureas (stimulating insulin secretion in pancreatic cells), biguanides (inhibiting glucose production in the liver), α-glucosidase inhibitors (inhibiting glucose absorption in the intestines), etc. have been used as agents to treat diabetes. Recently, peroxisome proliferator-activated receptor gamma (PPARy) accelerators (Thiazolidinediones, increasing insulin sensitivity) have drawn attention as therapeutic agents for diabetes. However, these drugs have side effects such as hypoglycemia, weight gain and the like

(David E. Moller, Nature, 2001, 414, 821). Furthermore, these agents raise concerns of inducing hypoglycemia. Accordingly, there is a strong need to develop therapeutic agents which can treat hyperglycemia and reduce complications of diabetes mellitus with decreased side effects, without inducing hypoglycemia and weight gain. Recently, it has been found through in vivo testing that PPARγ accelerators

(agonists) increase insulin sensitivity and also decrease serum levels of glucose and insulin, which suggest the possibility of such compounds being used as therapeutic agents for treatment of diabetes (Ricote M., Nature 1998, 391, 79-82). Accordingly, fibrates which activate PPARα were used as agents functioning to decrease blood triglyceride (TG) levels by 20 ~ 50%, decrease LDLc by 10 ~ 15% and increase HDLc by 10 ~ 15%, as observed through various experiments (Isseman, I., et al, Nature 1990, 347, 645-650; Linton, M. R, Curr. Atheroscler. Rep. 2000, 2, 29-35). This fact is supported by reports that the activation of PPARα activates the transcription of enzymes which break down fatty acids to decrease the de novo synthesis of fatty acids in liver, thereby resulting in the decreased production and secretion of TG and VLDL.

Recently, accelerators for human PPARγ and PPARα showed positive effects in various arteriosclerosis animal models, which also suggested the possibility of these compounds being used to treat arteriosclerosis (Li, A.C., et al, J. Clin. Invest. 2000, 106 523, Collins, A., Arterioscler., Thromb., Vase. Biol. 2002, 21, 365-367, Bernadette P. Neve, et al. Biochemical Pharmacology 2000, 60, 1245). Further, since it was reported that PPARγ accelerators inhibit factors inducing inflammation, the possibility of PPARγ accelerators being used as therapeutic agents for treatment of inflammation was also suggested.

Therefore, the possibility was suggested that compounds activating both

PP ARa and PPARγ can be used in treating diabetes mellitus and hyperlipidemia caused by diabetes mellitus (Auwerx, J., Insulin Resistance, Metabolic Disease Diabetic Complications 1999, 167-172). Recently, many researchers have also confirmed in animal models that the compounds activating both PPARγ and PP ARa modulate the blood glucose and lipid levels (Koji Murakami, et al, Diabetes, 1998, 47, 1841, Dawn A. Brooks, et al., J. Med. Chem. 2001, 44, 2061).

Because of excellent pharmaceutical effects in various fields as described above, many pharmaceutical companies have been trying to find compounds activating both PPARγ and PPARα. Among these compounds, tesaglitazar (AZ-242) and muraglitazar (BMS-298585) are under clinical phase III trial as of year 2004 (Brad R. Henke, J. Med. Chem. 2004, 47, 4118-4127). In particular, the animal test result (ob/ob mouse) of tesaglitazar showed the excellent effects thereof on treatment of hyperglycemia, hyperinsulinism, and hypertriglyceridmia (B.Bjung et al., J. Lipid Res. 2002, 43, 1855-1863). Meanwhile, side effects such as weight gain and edema may occur along with the excellent effects. These side effects are clearly found in the case of rosiglitazone and pioglitazone as accelators of PPARγ. More specifically, weight gain (3~5kg) has been ascertained in most of patients, and edema has been accompanied in some patients (S. Mudaliar et al, Curr. Opin. Endocrinol. Diabetes 2002, 9, 285-302). The occurrence of edema may be a burden on the heart; therefore, it is important to develop the compounds which activate both PPARγ and PPARα, but not causing these side effects. The weight gain by the action of PPAR accelator is mainly caused by an increse of subcutaneous fat in which secretion of metabolic regulators occurs actively. While such weight gain is accompanied with a decrease of abdominal fat, weight loss is generally

recommended for treatment of diabetes, whereby the development of compounds not causing the weight gain is required. In this connection, the accelerator activating both PPARγ and PPARα without weight gain has also been reported (R. K. Virkramadithyan et al., Obesity Res. 2003, 11, 292-303).

SUMMARY OF THE INVENTION

It is therefore an object of the present invention to provide a novel compound of Formula 1 activating both human PPARγ and PPARα with excellent efficacy.

It is a further object of the present invention to provide processes for preparation of such novel compounds. It is another object of the present invention to provide pharmaceutical compositions for acceleratrating PPARγ and PPARα activity comprising a therapeutically effective amount of the novel compound as an active agent.

It is another object of the present invention to provide methods for treating or preventing PPARγ and PPARα-related diseases, such as diabetes mellitus, its complications, inflammation and the like, by the use of the novel compound of the present invention as an active agent.

Other objects and advantages of the present invention will become apparent to those skilled in the art from the following detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. L is a diagram showing the processing of vector pZeo-GAL in Example

57(1).

FIG. 2. is a diagram showing the processing of vector pZeo-GAL-PPARγLBD

in Example 57(2).

FIG. 3. is a diagram showing the processing of vector pZeo-GAL-PPARαLBD in Example 57(3).

DETAILED DESCRIPTION OF THE INVENTION

According to the present invention, there is provided a compound as represented by Formula 1 below, or pharmaceutically acceptable salts or isomers thereof: Formula 1

wherein

A is substituted or unsubstituted alkyl, heteroalkyl, aromatic or heteroaromatic group;

D is hydrogen, lower alkyl, phenyl or benzyl group; E and G are each independently hydrogen or lower alkyl group; n is i or 2.

The compound of Formula 1 as an active agent for treatment of diseases, even when a separate explanation is not added thereto, is intended to include pharmaceutically acceptable salts, or isomers thereof. For the convenience of explanation, they are briefly illustrated as the compound of Formula lin the present disclosure.

The compound of Formula 1 according to the present invention has the

structure quite different from well-known PPARγ and PPARα accelerators and also an excellent activation effect as to human PPARγ and PPARα associated with prevention and treatment of diabetes mellitus, and complications accompanying diabetes such as hyperlipidemia and arteriosclerosis, and inflammation, as can be seen in the below Experimental Examples,

As used herein, the term "pharmaceutically acceptable salt" means a formulation of a compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the compound. The pharmaceutical salts includes salts of acids that form non-toxic acid adduct containing pharmaceutically acceptable anion, for example, acid adducts of inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrobromic acid, iodic acid and the like; acid adducts of organic carbonic acids such as tartaric acid, formic acid, citric acid, acetic acid, trichloroacetic acid, trifiuoroacetic acid, gluconic acid, benzoic acid, lactic acid, fumaric acid, maleic acid, salicylic acid and the like; acid adducts of sulfonic acids such as methanesulfonic acid, ethanesulfonic acid, bezenesulfonic acid or p-toluenesulfonic and the like. The examples of pharmaceutically acceptable salts of carboxylic acid include metal salts or alkaline earth metal salts of lithium, sodium, potassium, calcium magnesium and the like; and salts of amino acids such as lysine, arginine, guanidine and the like; organic salts of dicyclohexylamine, N-methyl-D-glucarmine, tris(hydroxymethyl)rnethylamine, diethanolamine, choline, tirethylamine and the like. The compound of Formula 1 according to the present invention can be converted to its salts by known methods.

As used herein, the term "isomer" means a compound of the present invention or a salt thereof, that has the same chemical formula or molecular formula but is

optically or stereochemically different therefrom. Since a variety of compounds according to the present invention have an asymmetric carbon center, they can be present in the form of R or S isomers, and/or oxime geometric isomers (trans, cis). All of these isomers and mixtures thereof are of course included in the range of the present invention.

'A' in Formula 1 above is preferably selected from the below substitutents: (i) lower alkyl substituted or unsubstituted by alkoxy, halogen or CF ₃ ; (ii) phenyl or benzyl substituted or unsubstituted by lower alkyl, alkoxy, halogen or CF ₃ ;

wherein,

X is N or C;

Rl is each independently one of the below substituents;

wherein, R2, R3 and R4 are each independently hydrogen, halogen or lower alkyl group.

As used herein, lower alkyl is preferably alkyl having carbon atoms less than 7, more preferably, alkyl OfC ₁ -C ₄ , for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, and the like.

In a particularly preferred embodiment, the compounds of Formula 1 are compounds as defined below:

(+) 3 -(4- { 2- [(E)-benzyloxyimino] -propoxy } -phenyl)-2-ethoxy-propionic acid (±) 2-ethoxy-3-(4-{2-[(Z)-ethoxyimino]-2-phenyl-ethoxy}-phenyl)- propionic acid (±) 2-ethoxy-3-(4-{2-[(Z)-benzyloxyimino]-2-phenyl-ethoxy}-pheny l)-propionic acid (±) 2-ethoxy-3-(4-{2-[(Z)-hexyloxyimino]-2-phenyl-ethoxy}-phenyl )-propionic acid (±) 2-ethoxy-3-(4-{2-[(Z)-ethoxyimino]-2-naphthalene-2-yl-ethoxy }-phenyl)-propionic acid

(+) 3-(4-{2-biphenyl-4-yl-2-[(Z)-ethoxyimino]-ethoxy}-phenyl)-2- ethoxy-propionic acid

(±) 2-ethoxy-3-(4-{2-[(E/Z)-ethoxyimino]-3-phenyl-propoxy}-pheny l)-propionic acid methyl ester

(±) 3-(4-{2-benzothiazole-2-yl-2-[(E/Z)-ethoxyimino]-ethoxy}-ρh enyl)-2-ethoxy- propionic acid 3-(4-{2-(4-chlorophenyl)-2-[(Z)-ethoxyimino]-ethoxy}-phenyl) -2-ethoxy-propionic acid

(±) 2-ethoxy-3-{4-[2-[(Z)-ethoxyimino]-2-(4-trifluoromethyl-phen yl)-ethoxy]-phenyl}- propionic acid (±) 3-(4-{2-(3,4-dimethyl-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}-ph enyl)-2-ethoxy-

propionic acid

(±) 3-(4-{2-(2,4-dichloro-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}-ph enyl)-2-ethoxy- propionicacid

(±) 3-(4-{2-(3-methyl-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}-phenyl )-2-ethoxy- propionicacid

(±) 3-(4-{2-(2-methoxy-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}-pheny l)-2-ethoxy- propionic acid

(+) 2-ethoxy-3 - { 4- [2- [(Z)-ethoxyimino] -2-(4-methanesulfonyloxy-phenyl)-ethoxy] - phenyl} -propionic acid (±) 2-ethoxy-3-{4-[2-[(E)-ethoxyimino]-2-(3-phenyl-isooxazole-5- yl)-ethoxy]-phenyl}- propionic acid

(±) 2-ethoxy-3-{4-[2-[(Z)-ethoxyimino]-2-(5-methyl-2-thiophene-2 -yl-oxazole-4-yl)- ethoxy] -phenyl} -propionic acid

(±) 2-ethoxy-3 - {4- [2- [(Z)-methoxyimino]-2-(5 -methyl-2-thiophene-2-yl-oxazole-4-yl)- ethoxy] -phenyl} -propionic acid

(±) 2-ethoxy-3-{4-[2— [(E)-ethoxyimino]-2-(5-phenyl-[l,3,4]oxadiazole-2-yl)-ethoxy ]- phenyl} -propionic acid

(+) 2-ethoxy-3 -(4- { 3 - [(E)-benzyloxyimino] -butoxy } -phenyl)-propionic acid

(+) 2-ethoxy-3-(4-{3-[(E)-penoxyimino]-butoxy}-phenyl)-propionic acid 2-ethoxy-3-(4-{2-(5-phenyl-[l,3,4]oxadiazole-2-yl)-2-(propox yimino)-ethoxy}- phenyl)-propionic acid

2-ethoxy-3-(4-{2-(5-phenyl-[l,3,4]oxadiazole-2-yl)-2-(pro poxyimino)-ethoxy}- phenyl)-propionix acid

2-ethoxy-3-(3-{2-(ethoxyimino)-2-phenyl-ethoxy}-phenyl)-p ropionic acid

3-(3- {2-(benzyloxyimino)-propoxy} -phenyl)-2-ethoxy-propionic acid

3 -(4- { 2-(benzyloxyimino)-propoxy } -phenyl)-2-(2-propoxy)-propionic acid

2-ethoxy-3-(3-{2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)- ethoxy}-phenyl)-propionic aicd 2-ethoxy-3-(4-{2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-eth oxy}-phenyl)-propionic acid

2-ethoxy-3 -(3 - { 2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-ethoxy } -phenyl)-propionic acid

2-ethoxy-3 -(3 - [2-(ethoxyimino)-2- { 5 -(4-fluoro-phenyl)- [ 1,3,4] oxadiazole-2-yl } -ethoxy- phenyl] -propionic acid

2-ethoxy-3-(4-[2-(ethoxyimino)-2-{5-(4-fluoro-phenyl)-[l, 3,4]oxadiazole-2-yl}-ethoxy- phenyl] -propionic acid

2-ethoxy-3-(3-{2-[5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2 -yl]-2-(propoxyimino)- ethoxy}-phenyl)-propionic acid 2-ethoxy-3 -(4- { 2- [5 -(4-fluoro-phenyl)- [ 1 ,3 ,4] oxadiazole-2-yl] -2-(propoxyimino)- ethoxy}-phenyl)-propionic acid

2-ethoxy-3 -(4- { 2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-ethoxy } -phenyl)-propionic acid

2-ethoxy-3-(4-{2-[3-(4-fluoro-phenyl)-[l,2,4]oxadiazole-5 -yl]-2-propoxyimino- ethoxy}-phenyl)-propionic acid ethyl ester

2-ethoxy-3-(3-{2-[3-(4-fluoro-phenyl)-[l,2,4]oxadiazole-5 -yl]-2-propoxyimino- ethoxy}-phenyl)-propionic acid ethyl ester

(±) 3-(4-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-

(ethoxyimino)ethyl]oxy}phenyl)-2-ethoxy propionic acid

(±) 3-(3-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-

(ethoxyimino)ethyl]oxy}phenyl)-2-ethoxy propionic acid

(±) 3-(4-{[(2E)-2-[5-(3-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-( ethoxy imino)ethyl]oxy}phenyl)-2-ethoxy propionic acid (±) 3-(3-{[(2E)-2-[5-(3-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-

(ethoxyimino)ethyl]oxy}phenyl)-2-ethoxy propionic acid

(±) 3-(4-{[(2E)-2-[3-(4-chlorophenyl)-l,2,4-oxadiazole-5-yl]-2-

(propoxyimino)ethyl]oxy}phenyl)-2-ethoxy propionic acid

(±) 3-(3-{[(2E)-2-[3-(4-chlorophenyl)-l,2,4-oxadiazole-5-yl]-2- (propoxyimino)ethy 1] oxy } phenyl)-2-ethoxy propionic acid

(±) 3-(4-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-

(propoxyimino)ethyl]oxy}phenyl)-2-ethoxy propionic acid

(±) 3-(3-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-

(propoxyimino)ethyl]oxy}phenyl)-2-ethoxy propionic acid (+) 3-(4-{ [(2E)-2-(butoxyimino)-2-[5-(4-fluorophenyl)-l ,3,4-oxadiazole-2- yl]ethyl]oxy}phenyl)-2-ethoxy propionic acid

(±) 3-(3-{[(2E)-2-(butoxyimino)-2-[5-(4-fluorophenyl)-l,3,4-oxad iazole-2- yl] ethyl] oxy }phenyl)-2-ethoxy propionic acid

(±) 2-ethoxy-3-(3-{[(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2 - (propoxyimino)ethyl]oxy}phenyl)propionic acid

(±) 2-ethoxy-3-(3-{[(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2 -

(ethoxyimino)ethyl]oxy}phenyl)propionic acid

(±) 2-ethoxy-3-(4-{[(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2 -

(ethxoyimino)ethyl]oxy}phenyl)propionic acid

(±) 2-ethoxy-3-(4-{ [(2Z)-2-(4-phenoxyphenyl)-

2(propoxyimino)ethyl] oxy } phenyl)propionic acid

(±) 2-ethoxy-3-(3-{[(2Z)-2-(4-phenoxyphenyl)-

2(propoxyimino)ethyl] oxy } phenyl)propionic acid (±) 2-ethoxy-3-(4-{[(2Z)-2-(4-phenoxyphenyl)-

2(ethoxyimino)ethyl]oxy}phenyl)propionic acid

(±) 2-ethoxy-3-(3-{ [(2Z)-2-(4-phenoxyphenyl)-

2(ethoxyimino)ethyl]oxy}phenyl)propionic acid

(±) 2-ethoxy-3-(4-{[(2Z)-2-(2-phenyl-l,3-thiazole-4-yl)-2- (propoxyimino)ethyl]oxy}phenyl)propionic acid

(±)2-ethoxy-3-(3-{[(2Z)-2-(2-phenyl-l,3-thiazole-4-yl)-2 - (propoxyimino)ethyl] oxy } phenyl)propionic acid

The present invention also relates to processes for preparation of the compounds of Formula 1. A person skilled in the art could easily manufacture the compound of Formula 1 on the basis of the chemical structure thereof by various processes. In other words, it will be possible to prepare the compound of Formula 1, within the scope of the present invention, by the process described in the present disclosure or by combining some of processes known in the prior art. So the scope of the present invention is not limited to the below processes.

As an illustrative process for such preparation, the compound of Formula 1 can be prepared by reacting the compound of Formula 2 with the compound of Formula 3 in the presence of base, as shwon in Reaction Scheme 1 below.

Reaction Scheme 1

(2) (3) (1 ) wherein A, D, E, G and n are the same as defined in Formula 1, and X means Cl, Br, I or

Oms (methanesulfonyloxy group). The reaction can be conducted in the presence of organic solvent, such as dimethylformamide, dimethylacetamide and acetonitrile and the like, and in some cases, two or more kinds of them can be used. The typical examples of the base includes sodium hydroxide, potassium t-butoxide, cesium carbonate, potassium carbonate, sodium carbonate, potassium bis (trimethylsilyl) amide and the like, and in some cases, two or more kinds of them can be used. The desired compound of Formula 1 can be prepared by hydrolyzing condensed compounds.

The compound of Formula 3 above can be prepared by the known method (Ansersson, Kj ell: WO99/62872). The compound of Formula 2 above can also be

prepared by various methods; for example, the compound in which A is can be prepared with referecen to Reaction Scheme 2 below.

Reaction Scheme 2

wherein A, D, E, G, and n are the same as defined in Formula 1, and X means Cl, Br, I or Oms (methanesulfonyloxy group). The oximation 'a' in the reaction scheme can be conducted with oxime in the presence of organic solvent, such as methanol, ethanol or propanol, or even water, and in some cases, two or more mixtures of them can be used. The typical examples of the base include sodium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate and the like, and in some cases, two or more kinds of them can be used. The reaction 'b' can be conducted with hydrazide 6 in the presence of organic solvent, such as dimethylformamide, dichloromethane, acetonitrile or dimethylsulfoxide, and in some cases, 2-chloro-l,3-dimethylimidazolium chloride can be used in the presence of two or more kinds of the organic solvents to prepare the compound of Formula 8 via the compound of Formula 7 The typical examples of the base include triethylamine, diisopropylethylamine, potassium carbonate and the like, and in some cases, two or more kinds of them can be used.

The compounds of Formula 8 above can also be prepared by a person skilled in the art on the basis of the chemical structure by various methods.

The compound in which A is can be prepared, for example, with reference to Reaction Scheme 3 below. Reaction Scheme 3

1)

(12) (13)

wherein D, X and R ₁ are the same as defined in Formula 8, and PG means general functional groups which can serve as protector(s) of alchol, such as TBS(t- butyldimethylsiyl), TBDPS(t-butyldiphenylsilyl), Tr(triphenylmethyl), benzyl and the like.

The reation 'a' in the reaction scheme can be conducted with oxime in the presence of organic solvent, such as methanol, ethanol or propanol, or even water, and in some cases, two or more kinds of them can be used. The typical examples of the base include sodium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate and the like, and in some cases, two or more kinds of them can be used.

The reaction 'b' can be conducted with the compound of Formula 11 in the presence of organic solvent, such as dimethylformamide, dichloromethane, acetonitrile or dimethylsulfoxide using 1,1-carbonyldiimide to obtain the compound of Formula 12.

Disprotectation for PG in the compound of Formula 12 is conducted, followed by bromination, indolization, or reaction using methanesulfonylchloride, to synthesize the compound of Formula.

The compounds of Formula 13 above can also be prepared by a person skilled in the art on the basis of the chemical structure by various methods.

The compound of Formula 1 according to the present invention can also be prepared by a process in which the compound of Formula 14 reacts with the compound of Formula 3 to synthesize the compound of Formula 15, followed by oximation, as shown in Reaction Scheme 4 below. Reaction Scheme 4

(1) wherein A, D, E, G and n are the same as defined in Formula 1 , and X meana Cl, Br, I or Oms (methanesulfonyloxy group).

The reation 'a' in the reaction scheme can be conducted in the presence of organic solvent, such as dimethyformamide, dimethylacetamide, acetonitrile, etc., and in some cases, two or more kinds of them can be used. The typical examples of the base include sodium hydroxide, potassium t-butoxide, cesiumcarbonate, potassiumcarbonate, sodium carbonate, potassium bis(tremethylsilyl) amide and the like, and in some cases,

two or more kinds of them can be used.

The oximation 'b' can be conducted with oxime in the presence of organic solvent, such as methanol, ethanol or propanol, or water, and in some cases, two or more kinds of them can be used. The typical examples of the base include sodium hydroxide, potassium carbonate, sodium carbonate, sodium bicarbonate and the like, and in some cases, two or more kinds of them can be used.

The compounds of Formula 15 above can also be prepared by a person skilled in the art on the basis of the chemical structure by various methods.

A person skilled in the art to which the present invention pertains can easily understand the detailed reaction conditions for preparation of the compound of the present invention, based upon many PREPARATIONS and EXAMPLES to be illustrated later, thus explanations thereof are omitted herein in the interest of brevity.

Also, the present invention provides a pharmaceutical composition for accelerating PPARγ and PPARα comprising (a) a therapeutically effective amount of the compound of Formula 1, and (b) a physiologically acceptable carrier, diluent, or excipient, or a combination thereof.

The term "pharmaceutical composition" as used herein means a mixture of a compound of the invention with other chemical components, such as diluents or carriers. The pharmaceutical composition facilitates administration of the compound to an organism. Multiple techniques of administering a compound exist in the art including, but not limited to oral, injection, aerosol, parenteral, and topical administrations. Pharmaceutical compositions can also be obtained by reacting compounds with acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, methanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.

The term "therapeutically effective amount" means an amount of active ingredients effective to alleviate, ameliorate or prevent symptoms of disease or decrease or delay the onset of clinical markers or symptoms of disease. Thus, a therapeutically effective amount refers to that amount which has the effect of (1) reversing the rate of progress of a disease; (2) inhibiting to some extent progress of the disease; and/or, (3) alleviating to some extent (or, preferably, eliminating) one or more symptoms associated with the disease. The therapeutically effective amount may be determined by experiments on the efficacy of compound as an active agent via in vivo and in vitro known model systems for diseases to be treated. The term "carrier" means a chemical compound that facilitates the incorporation of a compound into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a commonly utilized carrier as it facilitates the uptake of many organic compounds into the cells or tissues of an organism.

The term "diluent" defines chemical compounds diluted in water that will dissolve the compound of interest as well as stabilize the biologically active form of the compound. Salts dissolved in buffered solutions are utilized as diluents in the art. One commonly used buffered solution is phosphate buffered saline because it mimics the ionic strength conditions of human blood. Since buffer salts can control the pH of a solution at low concentrations, a buffered diluent rarely modifies the biological activity of a compound.

The compounds described herein can be administered to a human patient per se, or in pharmaceutical compositions in which they are mixed with other active ingredients, as in combination therapy, or suitable carriers or excipient(s). Techniques for

formulation and administration of the compounds may be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, PA, 18th edition, 1990.

The pharmaceutical composition of the present invention may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in a conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. Any of the well- known techniques, carriers, and excipients may be used as suitable and as understood in the art; e.g., in Remington's Pharmaceutical Sciences, above. The compound of Formula 1 according to the present invention can be formulated into dasage forms suitable for injection or oral admimistration in accordance with intended use.

For injection, the agents of the present invention may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks's solution,

Ringer's solution, or physiological saline buffer. For transmucosal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

For oral administration, the compounds can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compound of the present invention to be formulated as tablet, pill, powder, granule, dragee, capsule, liquid, gel, syrup, slurry, suspension and the like,

for oral ingestion by a patient. Preferable dosage forms are capsule and tablet. It is preferable that tablets and pills be coated. Pharmaceutical preparations for oral use can be obtained by mixing one or more solid excipient with one or more compounds of the present invention, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethyl cellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. All formulations for oral administration should be in dosages suitable for such administration.

The compounds may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an

added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Alternatively, the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

The compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

Pharmaceutical compositions suitable for use in the present invention include compositions in which the active ingredients are contained in an amount effective to achieve its intended purpose. More specifically, a therapeutically effective amount means an amount of compound effective to prevent, alleviate or ameliorate symptoms of disease or prolong the survival of the subject being treated. Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

When the formulation is presented in unit dosage form, the compound of Formula 1 as an active agent can be preferably contained in an amount of about 0.1 ~ 1,000 mg unit dosage. The dosage amount of the compound of Formula 1 will be dependent on the subject's weight and age, the nature and severity of the affliction and the judgment of the prescribing physician. For adult administration, the dosage amount required will be in the range of about 1 to 1000 mg a day depending on the frequency and strength of the dosage. For intramuscular or intravenous administration to adults, a total dosage amount of about 1 ~ 500 mg a day will be sufficient. In some patients, the dosage amount in a day will be higher than that.

The present invention provides the use of the compound of Formula 1 for manufacture of a medicament for the treatment or prevention of diseases involving human PPARγ and PP ARa. "Diseases involving human PPARγ and PP ARa" mean the diseases which can be treated and prevented by activating human PPARγ and PP ARa, and include, for example, but are in no way limited to diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc. Representative examples of the complications associated with diabetes mellitus are hyperlipidemia, arteriorasclerosis, obesity, hypertension, retinopathy, kidney inefficiency, etc. The term "treating" means ceasing or delaying progress of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting symptoms of diseases. The term "preventing" means ceasing or delaying symptoms of diseases when the compound of Formula 1 or composition comprising the same is administered to subjects exhibiting no symptoms of diseases, but having high risk of developing symptoms of diseases.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention will now be illustrated in more detail by the following PREPARATIONS and EXAMPLES; however, the scope of the present invention is not limited thereto. In below, processes for synthesis of intermediates for preparing final compounds are illustrated in PREPARATIONS, whereas processes for synthesis of the final compounds using the compound of PREPARATIONS are illustrated in EXAMPLES.

Preparation Example 1: hydro xypropane-2-one O-benzyloxime

Acetole(0.5 g, 6.7 mmol), O-benzylhyroxyamine hydrochloride salt(1.2 g, 7.4 mmol) and sodiumacetate(1.2 g, 15 mmol) were dissovled in 20 ml of methanol and then were stirred at room themperature for 3 hours. Solvent was removed and ethylacetate was added thereto, followed by washing with water. An organic layer was separated and dried over magnesium sulfate, then the residue was purified by column chromatography to obtain 0.3 mg of the title compound in a yield of 25%. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.36~7.26(5H, m), 5.11(2H, s), 4.16(2H, d, J=8Hz), 1.87(3H,

s) Mass(EI) 180(M ⁺ +l)

Preparation Example 2: (+) 3-(4-{2-[(E)-benzyloxyimino]-propoxy}-phenyl)-2- ethoxy-propionic acid ethylester

Hydroxyporpane-2-one O-benzyloxime(0.3 g, 1.7 mmol) was dissolved in 5 ml of dichloromethane, then triethylamine(0.46 ml, 303 mmol) was added. Methylchloride(0.19 ml, 2.5 mmol) was added thereto and the resulting solution was reacted for 1 hour. After the reaction, 10 ml of ethylacetate was added, and an organic layer was washed twice with 5 ml of water. The organic layer was dried over anhydrous sodium sulfate and filtered off to remove solvent. And then, Acetenitrile(2 ml), cesiumcarbonate(21 mg, 0.063 mmol) and (+) 2-ethoxy-3-(4-hydroxyphenyl)propionic acid ethylester(synthesized by WO 99/62872 K. Andersson)(10 mg, 0.042 mmol) were added to the reaction product(13 mg, 0.050 mmol) and reacted for 3 hours under reflux. After the reaction, 10 ml of ethylacetate was added thereto, and an organic layer was washed with saturated ammonium chloride solution. The organic layer was dried over

anhydrous magnesium sulfate and filtered off, then the residue was purified by the column chromatography (eluent: ethylacetate/hexane = 1/3) to obtain 15 mg of the title compound in a yield of 89%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.38~7.30(5H, m), 7.14~7.05(2H, m), 6.83~6.81(2H, m), 5.13(2H, s), 4.51(2H, s), 4.16(2H, q, J=8Hz), 3.96(1H, t, J=6Hz), 3.62~3.58(1H, m), 3.37~3.33(1H, m), 2.95(2H, d, J=6Hz), 1.98(3H, s), 1.22(3H, t, J=6Hz), 1.16(3H, t, J=8Hz) Mass(EI) 400(M ⁺ +l)

Example 1: (±) 3-(4-{2-[(E)-benzyloxyimino]-propoxy}-phenyl)-2-ethoxy-propi onic acid

12 mg (0.030 mmol) of the compound obtained in Perparation Example 2 was dissolved in 2 ml of tetrahydrofuran/methanol solution (1/1, v/v), and ImI of 1 N NaOH was added thereto, and the resulting solution was reacted for 3 hours. After the reaction, 5 ml of saturated ammonium chloride and 5 ml of ethylacetate were added to separate an organic layer. The organic layer was dried over anhydrous magnesium sulfate and filtered off, and then the solvent was removed. The residue was purified by column chromatography to give 8 mg of the title compound in a yield of 72%. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.38~7.30(5H, m), 7.14~7.11(2H, m), 6.85~6.78(2H, m), 5.13(2H, s), 4.51(2H, s), 4.05(1H, dd, J=6Hz, 4Hz), 3.61~3.57(1H, m), 3.48~3.44(1H, m), 3.08(1H, dd, J=16Hz, 4Hz), 2.94(1H, dd, J=16Hz, 6Hz), 1.98(3H, s), 1.18(3H, t, J=6Hz) Mass(EI) 372(M ⁺ +1)

Preparation Example 3: (±) 2-ethoxy-3-[4-(2-oxo-2-phenyl-ethoxy)-phenyl]- propionic acid ethylester

(+) 2-ethoxy-3-(4-hydroxyphenyl)propionic acid ethylester(synthesized by WO 99/62872 K. Andersson)(53 mg, 0.22 mmol), 2'-bromoacetophenone(49 mg, 0.24 mmol) and cesiumcarbonate(110 mg, 0.33 mmol) were added to 10 ml of acetonitrile, and the resulting solution was reacted for 1 hour under reflux. After the reaction, 10 ml of ethylacetate was added thereto, and an organic layer was washed with saturated ammonium chloride solution. The organic layer was dried over anhydrous magnesium sulfate and filtered off, then the residue was purified by the column chromatography (eluent: ethylacetate/hexane = 1/3) to obtain 70 mg of the title compound in a yield of 89%

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.01~7.99(2H, m), 7.64~7.6O(1H, m), 7.52~7.48(2H, m), 7.17~7.15(2H, m), 6.88~6.85(2H, m), 5.25(2H, s), 4.16(2H, q, J=6Hz), 3.96(1H, t, J=8Hz), 3.62~3.58(1H, m), 3.36~3.32(1H, m), 2.95~2.94(2H, m), 1.23(3H, t, J=6Hz), 1.16(3H, t, J=6Hz)

Preparation Example 4: (±) 2-ethoxy-3-(4-{2-[(Z)-ethoxyimino]-2-phenyl-ethoxy}- phenyl)-propionic acid ethylester

(±) 2- ethoxy-3-[4-(2-oxo-2-phenyl-ethoxy)-phenyl] -propionic acid ethylester (14 mg, 0.039 mmol), ethoxyamine hydrochloride salt (42 mg, 0.043 mmol) and sodiumacetate (7.1 g, 0.086 mmol) were dissolved in 2 ml of methanol and then were stirred at room temperature for 12 hours. Solvent was removed and ethylacetate was added thereto, followed by washing with water. An organic layer was dried over magnesium sulfate, and then the residue was purified by column chromatography to

obtain 13 mg of the title compound in a yield of 83%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.68~7.65(2H, m), 7.34-7.31(3H, m), 7.13~7.11(2H, m), 6.84~6.82(2H, m), 5.18(2H, s), 4.32(2H, q, J=8Hz), 4.16(2H, q, J=6Hz), 3.95(1H, t, J=8Hz), 3.61~3.57(1H, m), 3.36~3.32(1H, m), 2.95~2.92(2H, m), 1.36(3H, t, 8Hz), 1.23(3H, t, J=6Hz), 1.16(3H, t, J=6Hz) Mass(EI) 400(M ⁺ +l)

Example 2: (+) 2-ethoxy-3-(4-{2-[(Z)-ethoxyimino]-2-phenyl-ethoxy}-phenyl)- propionic acid 10 mg (yield: 83%) of the title compound was obtained from 13 mg of the compound obtained in Perparation Example 4 in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.68~7.65(2H, m), 7.34-7.31(3H, m), 7.13~7.11(2H, m), 6.85~6.83(2H, m), 5.19(2H, s), 4.32(2H, q, J=8Hz), 3.95(1H, dd, J=6Hz, 4Hz), 3.6O~3.56(1H, m), 3.45-3.41(1H, m), 3.07(1H, dd, J=14Hz, 4Hz), 2.95(1H, dd, J=HHz, 6Hz), 1.36(3H, t, 8Hz), 1.16(3H, t, J=6Hz) Mass(EI) 372(M ⁺ +1)

Preparation Example 5: (±) 2-ethoxy-3-(4-{2-[(Z)-benzyloxyimino]-2-phenyl- ethoxy}-phenyl)-propionic acid methylester 8 mg (yield: 69%) of the title compound was obtained from the compound obtained in Preparation Example 3 (9 mg, 0.025 mmol), 0-benzylhydroxyamine hydrochloride salt (6 mg, 0.038 mmol) and sodiumacetate (6 mg, 0.076 mmol) in the same manner as in Preparation Example 4. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.64(2H, m), 7.44~7.32(8H, m), 7.08~7.06(2H, m),

6.79~6.77(2H, m), 5.29(2H, s), 5.21 (2H, s), 4.14(2H, q, J=8Hz), 3.93(1H, t, J=6Hz),

3.6O~3.56(1H, m), 3.35~3.31(1H, m), 2.93~2.91(2H, m), 1.21(3H, t, J=6Hz), 1.15(3H, t,

J=8Hz)

Mass(EI) 462(M ⁺ +1)

Example 3: (±) 2-ethoxy-3-(4-{2-[(Z)-benzyloxyimino]-2-phenyl-ethoxy}-pheny l)- propionic acid

6 mg (yield: 80%) of the title compound was obtained from the compound obtained in Preparation Example 5 (8 mg, 0.017 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.64(2H, m), 7.44~7.32(8H, m), 7.08~7.05(2H, m),

6.79~6.77(2H, m), 5.29(2H, s), 5.21 (2H, s), 4.03(1H, dd, J=8Hz, 4Hz), 3.57~3.53(1H, m), 3.46~3.43(1H, m), 3.07(1H, dd, J=HHz, 4Hz), 2.93(1H, dd, J=14Hz, 6Hz),

1.16(3H, t, J=8Hz) Mass(EI) 434(M ⁺ +l)

Preparation Example 6: (±) 2-ethoxy-3-(4-{2-[(Z)-hexyloxyimino]-2-phenyl- ethoxy}-phenyl)-propionic acid methylester

The compound obtained in Preparation Example 3 (20 mg, 0.056 mmol) and O- hexyl-hydroxyamine (13 mg, 0.11 mmol) were added to 5 ml of ethanol, and the resulting solution was reacted for 5 hours under reflux. After the reaction, solvent was removed, then the residue was purified by column chromatography to obtain 18 mg of the title compound in a yield of 71%. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.67~7.64(2H, m), 7.37~7.32(3H, m), 7.14~7.11(2H, m),

6.87~6.81(2H, m), 5.18(2H, s), 4.24(2H, t, J=8Hz), 3.95(1H, q, J=6Hz), 3.61~3.55(1H, m), 3.38~3.29(1H, m), 2.94~2.92(2H, m), 1.78-1.73(2H, m), 1.42-1.38(2H, m), 1.35~1.30(4H, m), 1.21(3H, t, J=GHz), 1.16(3H, t, J=8Hz) 0.92~0.88(3H, m)

Mass(EI) 456(M ⁺ +1)

Example 4: (+) 2-ethoxy-3-(4-{2-[(Z)-hexyloxyimino]-2-phenyl-ethoxy}-phenyl )- propionic acid

12 mg (yield: 71%) of the title compound was obtained from the compound obtained in Preparation Example 6 (15 mg, 0.033 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.67~7.64(2H, m), 7.37~7.32(3H, m), 7.15~7.11(2H, m), 6.87~6.81(2H, m), 5.18(2H, s), 4.24(2H, t, J=8Hz), 4.01(1H, dd, J=8Hz, 6Hz), 3.57~3.53(1H, m), 3.46~3.43(1H, m), 3.07(1H, dd, J=14Hz, 6Hz), 2.92(1H, dd, J=14Hz, 8Hz), 1.77~1.73(2H, m), 1.42~1.38(2H, m), 1.35~1.30(4H, m), 1.16(3H, t, J=8Hz) 0.92~0.88(3H, m) Mass(EI) 428(M ⁺ + 1)

Example 5: (±) 2-ethoxy-3-(4-{2-[(Z)-ethoxyimino]-2-naphthalene-2-yl-ethoxy }- phenyl)-propionic acid 14 mg (yield: 85%) of the title compound was obtained from 2-bromo-l- naphthalene-2-yl-ethanone (6 mg, 0.015 mmol) in the same manner as in Preparation Example 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.11(1H, s), 7.87~7.77(4H, m), 7.48~7.45(2H, m), 7.14~7.11(2H, m), 6.89~6.86(2H, m), 5.30(2H, s), 4.35(2H, q, J=8Hz), 4.03(1H, dd, J=6Hz, 4Hz), 3.58~3.52(1H, m), 3.44~3.4O(1H, m), 3.07(1H, dd, J=HHz, 4Hz),

2.92(1H, dd, J=14Hz, 6Hz), 1.39(3H, t, J=8Hz) 1.14(3H, t, J=8Hz) Mass(EI) 422(M ⁺ +l)

Example 6: (±) 3-(4-{2-biphenyl-4-yl-2-[(Z)-ethoxyimino]-ethoxy}-phenyl)-2- ethoxy-propionic acid

68 mg (yield: 69%) of the title compound was obtained from (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (50 mg, 0.22 mmol) and 4-phenyl-2'-bromo acetophenone (61 mg, 0.22 mmol) in the same manner as in Preparation Example 3, Preparation Example 4 and Example 2. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.77~7.74(2H, m), 7.63~7.56(4H, m), 7.45~7.42(2H, m), 7.36~7.33(1H, m), 7.14~7.11(2H, m), 6.89~6.86(2H, m), 5.22(2H, s), 4.33(2H, q, J=8Hz), 4.05(1H, dd, J=6Hz, 4Hz), 3.59~3.54(1H, m), 3.48~3.44(1H, m), 3.08(1H, dd, J=HHz ₅ 4Hz), 2.94(1H, dd, J=14Hz, 6Hz), 1.37(3H, t, J=8Hz), 1.16(3H, t, J=8Hz) Mass(EI) 448(M ⁺ +l)

Preparation Example 7: l-hydroxy-3-phenyl-propane-2-one O-ethyl-oxime (1) l-trityloxy-3-phenyl-propane-2-one

Magnesium (67 mg, 2.8 mmol) was added to 30 ml of anhydrous tetrahydrofuran, and benzylbromide (0.33 ml, 2.8 mmol) was slowly added dropwise thereto while being stirred under nitrogen atmosphere at room temperature. A catalytic amount of 1 ,2-dibromoethane was added, followed by stirring for 1 hour, then the reaction solution was slowly added dropwise to 30 ml of N-methoxy-methyl-2- trityloxy aceteamide (500 mg, 1.4 mmol) anhydrous tetrahydrofuran solution using a cannular. After stirring at room temperature for 1 hour, 20 ml of saturated ammonium chloride

solution was slowly added thereto, and an organic layer was extracted and dried over anhydrous magnesium sulfate, then the residue was purified by column chromatography to obtain 470 mg of the title compound in a yield of 86%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.43~7.41(4H, m), 7.32~7.25(12H, m), 7.19~7.14(4H, m), 3.83(2H, s), 2.92(2H, s) Mass(EI) 393(M ⁺ +1)

(2) l-hydroxy-3-phenyl-propane-2-one

The compound obtained in Preparation Example 7(1) (470 mg, 1.2 mmol) was dissolved in 10 ml of methylenechloride and 10 ml of trifluoroacetic acid, followed by stirring at room temperature for 2 hours, and solvent was removed, then the residue was purified by column chromatography to obtain 140 mg of the title compound in a yield of

79%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.37~7.29(3H, m), 7.24~7.21(2H, m), 4.29(2H, d, J=4Hz), 3.73(2H, s), 2.99(1H, t, J=4Hz)

Mass(EI) 151(M ⁺ +1)

(3) l-hydroxy-3-phenyl-propane-2-one O-ethyl-oxime

35 mg (yield: 90%) of the title compound was obtained from the compound obtained in Preparation Example 7(2) (15 mg, 0.033 mmol) and ethoxyamine hydrochloride salt (23 mg, 0.24 mmol) in the same manner as in Preparation Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.34~7.29(3H, m), 7.25~7.20(2H, m), 4.27(2H, d, J=8Hz), 4.17(2H, q, J=6Hz), 4.12(1H, d, J=4Hz), 3.7O(1H, s), 3.61(1H, s), 2.46(0.5H, t, J=4Hz), 2.31(0.5H, t, J=8Hz), 1.31(1.5H, t, J=6Hz), 1.28(t, J=6Hz)

Mass(EI) 151(M ⁺ +1)

Example 7: <±) 2-ethoxy-3-(4-{2-[(E/Z)-ethoxyimmo]-3-phenyI-propoxy}-phenyI )- propionic acid methylester 18 mg (yield: 26%) of the title compound was obtained from the compound obtained in Preparation Example 7 (35 mg, 0.18 mmol) in the same manner as in Preparation Example 2 and Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) & 7,60-7.29(3H, m) _. , 7.25-7.20(2H, m), 7,15-7.12(2H, m), 6.85~6.78(2H, m), 4.74(1.1H, s), 4.45(0.9H, s), 4.21-4.16(2H, m), 4.06(1H, dd, J=6Hz, 4Hz), 3.82(0.9H, s), 3.62(1 , 1H, s), 3.61-3.57(1H, m), 3,50-3.44(1H, m), 3.09(1H, dd, J=14Hz, 4Hz), 2.94(1H, dd, J=14Hz, 6Hz), 1.32~1.26(3H, m), 1.17(3H, t, J=8Hz) Mass(EI) 386(M ⁺ +1)

Preparation Example 8: l-benzothiazole-2-yl-2-hydroxy-ethanone Benzothiazole (110 mg, 0.83 mmol) was dissolved in 30 ml of anhydrous tetrahydrofuran, and butyllithium (2,5 M, 0.33 ml) was slowly added thereto while stirring at -78°C. After 30 minutes., 10ml of N-methoxy-N-methyl-2-trityloxy acetamide (300 mg, 0.83 mmol) anhydrous tetrahydrofuran solution was slowly added to the reaction solution at -78°C. After heating to O°C for 1 hour, 20 ml of saturated ammonium chloride solution was slowly added thereto, and an organic layer was extracted and dried over anhydrous magnesium sulfate, then the residue was purified by column chromatography to obtain l-benzothiazole-2-yl-trityloxy-etlianone (300 mg, yield: 83%). 70 mg (yield: 53%) of the title compound was obtained from this compound in the same manner as in Preparation Example 7(2).

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.21~8.19(1H, m), 8.04~8.01(lH, m), 7.64~7.56(2H, m), 5.16(2H, s) Mass(EI) 194(M ⁺ +1)

Example 8: (+) 3-(4-{2-benzothiazole-2-yl-2-[(E/Z)-ethoxyimino]-ethoxy}-phe nyl)- 2-ethoxy-propionic acid

12 mg (yield: 18%) of the title compound was obtained from the compound obtained in Preparation Example 8 (30 mg, 0.16 mmol) in the same manner as in Preparation Example 1, 2 and Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14(0.67H, d, J=8Hz), 8.04(0.33H, d, J=8Hz), 7.97(0.67H, d, J=8Hz), 7.88(0.33H, d, J=8Hz), 7.55~7.44(2H, m), 7.17~7.14(2H, m), 7.01~6.96(2H, m), 5.38(1.3H, s), 5.30(0.7H, s), 4.49(1.3H, q, J=8Hz), 4.40(0.7H, q, J=8Hz), 4.07~4.04(lH, m), 3.6O~3.56(1H, m), 3.48~3.44(1H, m), 3.10(1H, dd, J=I 4Hz, 4Hz), 2.96(1H, dd, J=14Hz, 6Hz), 1.46(2H, t, J=8Hz), 1.37(1H, t, J=8Hz), 1.16(3H, t, J=8Hz) Mass(EI) 429(M ⁺ +1)

Example 9: 3-(4-{2-(4-chlorophenyl)-2-[(Z)-ethoxyimino]-ethoxy}-phenyl) -2- ethoxy-propionic acid

20 mg (yield: 49%) of the title compound was obtained from (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (22 mg, 0.1 mmol) and 2-bromo-l-(4- chlorophenyl)-ethanone (19 mg, 0.1 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.63~7.60(2H, m), 7.32~7.28(2H, m), 7.14~7.11(2H, m), 6.83~6.81(2H, m), 5.17(2H, s), 4.30(2H, q, J=8Hz), 4.05(1H, dd, J=6Hz, 4Hz),

3.59~3.55(1H, m), 3.48~3.44(1H, m), 3.07(1H, dd, J=14Hz, 4Hz), 2.93(1H, dd, J=14Hz,

6Hz), 1.35(3H, t, 8Hz), 1.16(3H, t, J=6Hz)

Mass(EI) 406(M ⁺ +l)

Example 10: (±) 2-ethoxy-3-{4-[2-[(Z)-ethoxyimino]-2-(4-trifluoromethyl-phen yl)- ethoxy]-phenyl}-propionic acid

5 mg (yield: 6%) of the title compound was obtained from (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (60 mg, 0.27 mmol) and 2-bromo-l-(4- trifluoromethyl-phenyl)-ethanone (50 mg, 0.19 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.79(2H, d, J=8Hz), 7.58(2H, d, J=8Hz), 7.14~7.10(2H, m), 6.84~6.81(2H, m), 5.21 (2H, s), 4.33(2H, q, J=8Hz), 4.04(1H, dd, J=6Hz, 4Hz), 3.6O~3.54(1H, m), 3.48~3.42(1H, m), 3.07(1H, dd, J=12Hz, 4Hz), 2.94(1H, dd, J=12Hz, 6Hz), 1.37(3H, t, 8Hz), 1.16(3H, t, J=8Hz) Mass(EI) 440(M ⁺ +l)

Example 11: (±) 3-(4-{2-(3,4-dimethyl-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}- phenyl)-2-ethoxy-propionic acid

8.8 mg (yield: 10%) of the title compound was obtained from (±) 2-ethoxy-3- (4-hydroxyphenyl)propionic acid methylester (60 mg, 0.27 mmol) and 2-bromo-l-(3,5- dimethyl-phenyl)-ethanone (50 mg, 0.22 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.10~7.07(3H, m), 6.97(1 H, s), 6.94-6.92(1 H, m), 6.75~6.72(2H, m), 5.12(2H, s), 4.25(2H, q, J=8Hz), 4.01(1H, dd, J=8Hz, 4Hz),

3.59~3.53(1H, m), 3.44~3.38(1H, m), 3.05(1H, dd, J=12Hz, 4Hz), 2.93(1H, dd, J=12Hz, 8Hz), 2.29(3H, s), 2.27(3H, s), 1.34(3H, t, 8Hz), 1.15(3H, t, J=6Hz) Mass(EI) 400(M ⁺ +l)

Example 12: (±) 3-(4-{2-(2,4-dichloro-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}- phenyl)-2-ethoxy-propionic acid

11 mg (yield: 24%) of the title compound was obtained from (+) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (22 mg, 0.1 mmol) and 2-bromo-l-(2,4- dimethyl-phenyl)-ethanone (22 mg, 0.1 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.39(1H, s), 7.19~7.14(2H, m), 7.14~7.11(2H, m), 6.83~6.69(2H, m), 5.18(2H, s), 4.28(2H, q, J=8Hz), 4.04(1H, dd, J=6Hz, 4Hz), 3.59~3.55(1H, m), 3.47~3.43(1H, m), 2.92(1H, dd, J=14Hz, 4Hz), 2.93(1H, dd, J=HHz, 6Hz), 1.35(3H, t, 8Hz), 1.16(3H, t, J=6Hz) Mass(EI) 440(M ⁺ +l)

Example 13: (±) 3-(4-{2-(3-methyl-phenyl)-2-[(Z)-ethoxyimino]-ethoxy}-phenyl )-2- ethoxy-propionic acid

12.5 mg (yield: 17%) of the title compound was obtained from (±) 2-ethoxy-3- (4-hydroxyphenyl)propionic acid methylester (60 mg, 0.19 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.48(1H, s), 7.45~7.43(1H, s), 7.26~7.22(1H, m), 7.16~7.12(3H, m), 6.89~6.83(2H, m), 5.17(2H, s), 4.30(2H, q, J=8Hz), 4.02(1H, dd, J=8Hz, 4Hz), 3.61~3.57(1H, m), 3.43~3.39(1H, m), 3.06(1H, dd, JM12Hz, 4Hz),

2.93(1H, dd, J=12Hz, 8Hz), 2.34(3H, s), 1.35(3H, t, 8Hz), 1.16(3H, t, J=6Hz) Mass(EI) 386(M ⁺ +l)

Example 14: (+) 3-(4-{2-(2-methoxy-phenyI)-2-[(Z)-ethoxyimino]-ethoxy}-pheny l)- 2-ethoxy-propionic acid

12 mg (yield: 34%) of the title compound was obtained from (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (20 mg, 0.087 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.32~7.28(1H, m), 7.17~7.15(1H, m), 7.07~7.05(2H, m), 6.87~6.84(2H, m), 6.70~6.68(2H, m), 5.19(2H, s), 4.27(2H, q, J=8Hz), 4.03(1H, dd, J=6Hz, 4Hz), 3.75(3H, s), 3.57~3.53(1H, m), 3.46~3.42(1H, m), 3.07(1H, dd, J=14Hz, 4Hz), 2.9O(1H, dd, J=14Hz, 6Hz), 1.35(3H, t, 8Hz), 1.15(3H, t, J=6Hz) Mass(EI) 402(M ⁺ +l)

Preparation Example 9: methanesulfonic acid 4-acetyl-phenyl ester

300 mg of l-(4-hydroxy-phenyl)-ethanone was dissolved in 2 ml of methylenechloride, then 0.46 ml of triethylamine and 0.188 ml (2.4 mmol) of methylchloride were slowly added thereto at 0 ⁰ C. The resulting solution was heated to room temperauter and stirred for 15 minutes. After the stirring, 10 ml of ethylacetate was added thereto, and an organic layer was washed with water. The organic layer was dried over anhydrous magnesium sulfate and filtered off to remove solvent, then the residue was purified by the column chromatography to obtain 450 mg of the title compound in a yield of 95% Mass(EI) 215(M ⁺ +l)

Example 15: (±) 2-ethoxy-3-{4-[2-[(Z)-ethoxyimino]-2-(4-methanesulfonyloxy- phenyl)-ethoxy]-phenyl}-propoinic acid

59 mg (0.28 mmol) of the compound obtained in Preparation Example 9 was dissolved in 2 ml of methylenechloride, and 0.024 ml of bromine (0.5 M of methylenechloride solution) was slowly added thereto at O ⁰ C. After it was ascertained that initial material was exhausted, 5% of sodiumthiosulfate was added thereto. An organic layer was extracted by the use of metylenechloride (10 ml), and dried over anhydrous magnesium sulfate and filtered off to remove solvent, then the residue was purified by the column chromatography . to obtain (±) 2-ethoxy-3-(4- hydroxyphenyl)propoinic acid methylester (61 mg, 0.27 mmol). 3 mg (yield: 2.3%) of the title compound was obtained from this compound in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.75-7.71(2H, m), 7.26~7.23(2H, m), 7.13-7.11(2H, m), 6.85~6.79(2H, m), 5.19(2H, s), 4.31(2H, q, J=8Hz), 4.05(1H, dd, J=6Hz, 4Hz), 3.60~3.56(lH, m), 3.49~3.45(1H, m), 3.13(3H, s), 3.07(1H, dd, J=14Hz, 4Hz), 2.94(1H, dd, J=14Hz, 8Hz), 1.36(3H, t, 8Hz), 1.18(3H, t, J=8Hz) Mass(EI) 466(M ⁺ +1)

Example 16: (±) 2-ethoxy-3-{4-[2-[(E)-ethoxyimino]-2-(3-phenyl-isooxazole-5- yl)- ethoxy]-phenyl}-propoinic acid

18 mg (yield: 41%) of the title compound was obtained from 26 mg (0.1 mmol) of 2-bromo-l-(3-phenyl-isooxazole-5-yl)-ethanone in the same manner as in Preparation Example 1, 3, Example 1 and 2. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.84~7.80(2H, m), 7.48~7.44(3H, m), 7.17~7.15(2H, m),

6.97(1H, s), 6.92~6.89(2H, m), 5.15(2H, s), 4.41 (2H, q, J=8Hz), 4.06(1H, dd, J=6Hz, 4Hz), 3.6O~3.56(1H, m), 3.49~3.45(1H, m), 3.09(1H, dd, J=14Hz, 4Hz), 2.95(1H, dd, J=14Hz, 6Hz), 1.39(3H, t, 8Hz), 1.17(3H, t, J=6Hz) Mass(EI) 439(M ⁺ +1)

Preparation Example 10: 2-bromo-l-(5-methyl-2-thiophene-2-yl-oxazole-4-yl)- ethanone

(1) l-(5-methyl-3-oxo-2-thiophene-2-yl-oxazole-4-yl)-ethanone

Ig of Pentane-2,3,4-trione-3-oxime (7.2 mmol) and thiophene-2-carbaldehyde were dissolved in 10 ml of acetic acid, and hydrogen chloride gas was bubbling for 15 minutes while stirring at 0°C, then further stirred at room temperature for 2 hours. The resulting solution was deluted and crystallized by diethylether, then it was filtered off and dried to obtaine 1.45 g (yield: 90%) of the title compound.

Mass(EI) 224(M ⁺ +1)

(2) l-(5-methyl-2-thiophene-2-yl-oxazole-4-yl)-ethanone

1.45 g (6.5 mmol) of the compound obtained in Preparation Example 10(1) was dissolved in 40 ml of acetic acid, and 1.3 g (19.5 mmol) of zinc powder was slowly added thereto at O ⁰ C. After heating to room temperature over 30 minutes, the reaction was filtered off, and zinc powder was removed. Solvent was removed, then the residue was purified by column chromatography to obtain 100 mg of the title compound in a yield of 7.4%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.68~7.66(1H, m), 7.46~7.44(1H, m), 7.13~7.11(1H, m), 2.68(3H, s), 2.58(3H, s)

Mass(EI) 208(M ⁺ +l)

(3) 2-bromo-l-(5-methyl-2-thiophene-2-yl-oxazole-4-yl)-ethanone

100 mg (0.48 mmol) of the compound obtained in Preparation Example 10(2) was dissolved in 10 ml of chloroform, and 3 ml of chloroform in which 0.025 ml (0.48 mmol) of bromine was dissolved was slowly added dropwise at 50°C. The reaction was stirred at 55°C for 30 minutes, and solvent was removed, then the residue was purified by column chromatography to obtain 70 mg of the title compound in a yield of 51%. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.71~7.68(1H, m), 7.5O~7.47(1H, m), 7.15~7.12(1H, m), 4.58(2H, s), 2.69(3H, s) Mass(EI) 287(M ⁺ +l)

Example 17: (±) 2-ethoxy-3-{4-[2-[(Z)-ethoxyimino]-2-(5-methyl-2-thiophene-2 -Iy- oxazole-4-yl)-phenyl] -propionic acid 10 mg (yield: 20%) of the title compound was obtained from (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (24 mg, 0.11 mmol) and the compound obtained in Preparation Example 10 (31 mg, 0.11 mmol) in the same manner as in Preparation Example 3, 4 and Example 2. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.62~7.6O(1H, m), 7.39~7.37(1H, m), 7.14~7.11(1H, m), 7.09~7.06(2H, m), 6.92~6.89(2H, m), 5.15(2H, s), 4.28(2H, q, J=8Hz), 4.05(1H, dd, J=6Hz, 4Hz), 3.58~3.54(1H, m), 3.48~3.44(1H, m), 3.08(1H, dd, J=14Hz, 4Hz), 2.93(1H, dd, J=14Hz, 6Hz), 2.46(3H, s), 1.31(3H, t, 8Hz), 1.17(3H, t, J=6Hz) Mass(EI) 459(M ⁺ +l)

Example 18: (±) 2-ethoxy-3-{4-[2-[(Z)-methoxyimino]-2-(5-methyl-2-thiophene- 2- yl-oxazole-4-yl)-ethoxy]-phenyl}-propoinic acid

12 mg (yield: 43%) of the title compound was obtained from (+) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid methylester (18 mg, 0.063 mmol) and the compound obtained in Preparation Example 10 (23 mg, 0.063 mmol) in the same manner as in Preparation Example 3, 4 and Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.62~7.6O(1H, m), 7.39~7.37(1H, m), 7.14~7.11(1H, m), 7.09~7.07(2H, m), 6.92~6.88(2H, m), 5.13(2H, s), 4.05(1H, dd, J=6Hz, 4Hz), 4.03(3H, s), 3.58~3.54(1H, m), 3.48~3.44(1H, m), 3.09(1H, dd, J=14Hz, 4Hz), 2.93(1H, dd, J=14Hz, 6Hz), 2.48(3H, s), 1.16(3H, t, J=6Hz) Mass(EI) 445(M ⁺ +l)

Preparation Example 11: 2-hydroxy-l-(5-phenyl-[l,3,4]oxadiazole-2-yl)-ethanone O-ethyl-oxime (1) 2-(t-butyl-dimethylsilanyloxy)-l-(5-phenyl-[l,3,4]oxadiazole -2-yl)-ethanone

400 mg (2.7 mmol) of 2-phenyl-[l,3,4]oxadiazole (Jour. Med. Chem., 2001, 44,

1268-1285) was dissolved in 30 ml of anhydrous tetrahydrofuran, and 1.1 ml (2.5 M) of butyllithium was slowly added thereto while stirring at -78°C. After 1 hour, 250 mg (1.2 mmol) of (t-butyl-dimethylsilanyloxy)-acetic acid(or nitric acid)methylester which dissolved in 10 ml of anhydrous tetrahydrofuran was slowly added thereto at -78°C, and the temperature of the reaction was slowly heated to -30°C. When it was ascertained by TLC that initial material was exhausted, then 20 ml of saturated sodiumthiosulfate was added thereto. An organic layer was extracted and dried over anhydrous magnesium sulfate, and then the residue was purified by column chromatography to obtain 150 mg

of the title compound in a yield of 38%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.19~8.16(2H, m), 7.62~7.53(3H, m), 5.15(2H, s), 0.97(9H, s), 0.17(6H, s) Mass(EI) 319(M ⁺ +1)

(2) 2-(t-butyl-dimethylsilanyloxy)-l-(5-phenyl-[l,3,4]oxadiazole -2-yl)-ethanone O-ethyl-oxime

30 mg (yield: 59%) of the title compound was obtained from 45 mg (0.14 mmol) of the compound in Preparation Example 11(1) in the same manner as in Preparation Example 1. Mass(EI) 361(M ⁺ +1)

(3) 2-hydroxy-l-(5-phenyl-[l,3,4]oxadiazole-2-yl)-ethanone O-ethyl-oxime

30 mg (0.083 mmol) of the compound in Preparation 11(2) was dissolved in 10 ml of anhydrous tetrahydrofuran, and 0.24 ml of tetrabutylammoniumfluoride was slowly added dropwise thereto while stirring at 0°C. After 1 hour, 10 ml of saturated ammoniumchloride was added to the reaction solution. An organic layer was extrated in the presence of 20 ml of ethylacetate and dried over anhydrous magnesium sulfate, then the residue was purified by column chromatography to obtain 15 mg of the title compound in a yield of 73%. Mass(EI) 248(M ⁺ H-I)

Example 19: (±) 2-ethoxy-3-{4-[2-[(E)-ethoxyimino]-2-(5-phenyl-[l,3,4]oxadia zole- 2-yl)-ethoxy] -phenyl} -propionic acid

4 mg (yield: 38%) of the title compound was obtained from 5 mg (0.024 mmol) of the compound in the Preparation Example 11 in the same manner as in Preparation Example 2 and Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.12(2H, m), 7.56~7.50(3H, m), 7.11~7.09(2H, m), 6.77~6.75(2H, m), 5.23(2H, s), 4.44(2H, q, J=7Hz), 4.05(1H, dd, J=6Hz, 4Hz), 3.62~3.58(1H, m), 3.49~3.45(1H, m), 3.08(1H, dd, J=HHz, 4Hz), 2.94(1H, dd, J=HHz, 6Hz), 2.48(3H, s), 1.41(3H, t, J=7Hz), 1.17(3H, t, J=6Hz) Mass(EI) 440(M ⁺ +l)

Preparation Example 12: (±) 2-ethoxy-3-[4-(3-oxo-butoxy)-phenyl]-propionic acid methylester

(1) (±) 2-ethoxy-3-[4-(3-methyl-but-3-enyloxy)-phenyl] -propionic acid methylester

228 mg (yield: 52%) of the title compound was obtained from 0.13 mg (1.5 mmol) of 3-methyl-but-3-ene-l -ol in the same manner as in Preparation Example 2.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.15~7.13(2H, m), 6.84~6.81(2H, m), 4.84(1H, s), 4.8O(1H, s), 4.05(2H, t, J=6Hz), 3.99(1H, dd, J=8Hz, 6Hz), 3.70(3H, s), 3.63~3.55(1H, m), 3.38~3.31(1H, m), 2.96~2.93(2H, m), 2.49(2H, t, J=6Hz), 1.80(3H, s), 1.16(3H, t, J=6Hz) Mass(EI) 293(M ⁺ +l)

(2) (±) 2-ethoxy-3-[4-(3-oxo-butoxy)-phenyl]-propionic acid methylester

228 mg (0.78 mmol) of the compound in Preparation Example 12(1) was dissolved in 4 ml of methylenechloride, followed by bubbing of ozone at -78 ⁰ C for 10

minutes, then 225 mg (0.86 mmol) of triphenylphosphine was added thereto. Sovent was removed, and then the residue was purified by column chromatography to obtain 108 mg of the title compound in a yield of 47%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.15~7.12(2H, m), 6.83~6.80(2H, m), 4.21(2H, t, J=8Hz), 3.99(1H, dd, J=8Hz, 6Hz), 3.70(3H, s), 3.63~3.55(1H, m), 3.38~3.32(1H, m), 2.96~2.93(2H, m), 2.89(2H, t, J=8Hz), 2.24(3H, s), 1.16(3H, t, J=8Hz) Mass(EI) 295(M ⁺ +1)

Example 20: (±) 2-ethoxy-3-(4-{3-[(E)-benzyloxyimino]-butoxy}-phenyl)-propio nic acid

12 mg (yield: 46%) of the title compound was obtained from 20 mg (0.068 mmol) of the compound in the Preparation Example 12 in the same manner as in Preparation Example 5 and Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.37~7.26(5H, m), 7.16~7.11(2H, m), 6.83~6.78(2H, m), 5.09(2H, s), 4.11(2H, t, J=8Hz), 4.03(1H, dd, J=6Hz, 4Hz), 3.62~3.58(1H, m), 3.46~3.42(1H, m), 3.07(1H, dd, J=14Hz, 4Hz), 2.94(1H, dd, J=14Hz, 6Hz), 2.65(2H, t, J=8Hz), 1.95(3H, s), 1.17(3H, t, J=6Hz) Mass(EI) 386(M ⁺ +1)

Example 21: (±) 2-ethoxy-3-(4-{3-[(E)-phenoxyimmo]-butoxy}-phenyl)-propionic acid

8 mg (yield: 58%) of the title compound was obtained from 11 mg (0.037 mmol) of the compound in the Preparation Example 12 and 8 mg (0.055 mmol) of O- phenylhydroxyamine hydrochloride salt in the same manner as in Preparation Example

5 and Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.33~7.29(2H, m), 7.20~7.12(4H, m), 7.01~7.98(lH, m), 6.86~6.73(2H, m), 4.23(2H, t, J=8Hz), 4.05(1H, dd, J=6Hz, 4Hz), 3.6O~3.55(1H, m), 3.49~3.45(1H, m), 3.1O(1H, dd, J=14Hz, 4Hz), 2.96(1H, dd, J=14Hz, 6Hz), 2.81(2H, t, J=8Hz), 2.12(3H, s), 1.18(3H, t, J=6Hz) Mass(EI) 372(M ⁺ +1)

Preparation Example 13: Preparation of methanesulfonic acid 2-(5-phenyI- [l,3 _> 4]oxadiazole-2-yl)-2-propoxyimino-ethyl ester 2-hydroxy-l-(5-phenyl-[l,3,4]oxadiazole-2-yl)-propanone O-ethyl-oxime was obtained from 2-(t-butyl-dimethylsilanyloxy)-l-(5-phenyl-[l,3,4]oxadiazole -2-yl)- ethanone in the same manner as in Preparation Example 11(2) and 11(3). The alcohol (5 mg, 0.023 mmol) was dissolved in 1 ml of dichloromethane, and triethylamine (5 mg, 0.049 mmol) was added thereto. Methylchloride (4 mg, 0.034 mmol) was added to the resulting solution and reacted for 1 hour. After the reaction, 10 ml of ethylacetate was added to thereto, and an organic layer was washed twice with 5 ml of water. The organic layer was dried over anhydrous magnesium sulfate, and filtered off, then solvent was removed. Mass(EI) 340(M ⁺ +l)

Preparation Example 14: Preparation of 2-ethoxy-3-(4-{2-(5-phenyl-

[l,3)4]oxadiazole-2-yl)-2-(propoxyimino)-ethoxy}-phenyl)- propionic acid ethylester

12 mg (yield: 85%) of the title compound was obtained from methanesulfonic acid 2-(5-phenyl-[l,3,4]oxadiazole-2-yl)-2-propoxyimino-ethyleste r (10 mg, 0.029

mmol) and 2-ethoxy-3-(4-hydroxy-phenyl)-propionic acid methylester (7 mg, 0.031 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.13~8.08(2H, m), 7.57~7.40(3H, m), 7.14(2H, d, J=8.8Hz), 6.92(2H, d, J=8.8Hz), 5.22(2H, s), 4.35(2H, t, J=6.4Hz), 4.12(2H, q, J=7.2Hz), 3.99~3.96(1H, m), 3.70(3H, s), 3.6O~3.56(1H, m), 3.35-3.31(1H, m), 2.95~2.93(2H, m), 1.82~1.78(2H, m), 1.25(3H, t, J=7.2Hz), 1.15(3H, t, J=7.2Hz), 1.01(3H, t, J=7.2Hz) Mass(EI) 482(M ⁺ +l)

Example 22: 2-ethoxy-3-(4-{2-(5-phenyl-[l,3,4]oxadiazole-2-yl)-2-(propox yimino)- ethoxy}-phenyl)-propionic acid

8 mg (yield: 72%) of the title compound was obtained from 2-ethoxy-3-(4-{2-

(5-phenyl-[l,3,4]oxadiazole-2-yl)-2-(propoxyimino)-ethoxy }-phenyl)-propionic acid ethylester (12 mg, 0.025 mmol) in the same manner as in Example 1.

NMR: Conformation of Na 1H-NMR(MeOH-d4) δ 7.98~7.92(2H, m), 7.53~7.45(3H, m), 7.13~7.10(2H, m), 6.82~6.78(2H, m), 5.12(2H, s), 4.26(2H, t, J=6.8Hz),

3.68~3.65(2H, m), 3.68~3.65(1H, m), 3.5O~3.46(1H, m), 3.13~3.09(lH, m),

2.86~2.82(1H, m), 2.71~2.65(1H, m), 1.76-1.67(2H, m), 0.98(3H, t, J=5.6Hz), 0.91(3H, t, J=7.6Hz)

Mass(EI) 440(M ⁺ + 1)

Preparation Example 15: 2-bromo-l-(5-methyl-2-phenyl-oxazole-4-yl)-ethanone O- ethyl-oxime

30 mg (yield: 18%) of the title compound was obtained from l-(5-methyl-2- phenyl-oxazole-4-yl)-ethanone O-ethyl-oxime (100 mg, 0.49 mmol) in the same manner

as in Preparation Example 10(3). Mass(EI) 324(M ⁺ +1)

Preparation Example 16: Preparation of 2-ethoxy-3-(4-{2-(ethoxyimino)-2-(5- methyl-2-phenyl-oxazole-4-yl)-ethoxy}-phenyl)-propionic acid methylester

68 mg (yield: 65%) of the title compound was obtained from 2-bromo-l-(5- methyl-2-phenyl-oxazole-4-yl)-ethanone O-ethyl-oxime (70 mg, 0.216 mmol) and 2- ethxoy-3-(4-hydroxy-phenyl)-propionic acid methylester (48 mg, 0.21 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.00~7.97(2H, m), 7.43~7.41(3H, m), 7.12(2H, d, J=8.0Hz), 6.89(2H, d, J=8.0Hz), 5.18(2H, s), 4.28(2H, q, J=8Hz), 3.99~3.96(1H, m), 3.69(3H, s), 3.6O~3.56(1H, m), 3.35~3.31(1H, m), 2.94~2.93(2H, m), 2.49(3H, s), 1.34(3H, t, J=8Hz), 1.15(3H, t, J=8Hz) Mass(EI) 467(M ⁺ +l)

Example 23: 2-ethoxy-3-(4-{2-(5-phenyl-[l,3,4]oxadiazole-2-yl)-2-(propox yimino)- ethoxy}-phenyl)-propionic acid

4 mg (yield: 70%) of the title compound was obtained from 2-ethoxy-3-(4-{2- (ethoxyimino)-2-(5-methyl-2-phenyl-oxazole-4-yl)-ethoxy}-phe nyl)-propionic acid methylester (6 mg, 0.012 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.00~7.97(2H, m), 7.43~7.40(3H, m), 7.12(2H, d, J=8.0Hz), 6.92~6.89(2H, m), 5.18(2H, s), 4.28(2H, q, J=8Hz), 4.06~4.03(lH, m), 3.58~3.54(1H, m), 3.49~3.45(1H, m), 3.11~3.O6(1H, m), 2.96~2.91(1H, m), 2.49(3H, s), 1.34(3H, t, J=8Hz), 1.15(3H, t, J=8Hz)

Mass(EI) 453(M ⁺ +1)

Preparation Example 17: Preparation of 2-ethoxy-3-(3-{2oxo-2-phenyl-ethoxy}- phenyl)-propionic acid ethylester 45 mg (yield: 97%) of the title compound was obtained from 2-bromo-l- phenyl-ethanone (26 mg, 0.13 mmol) and 2-ethoxy-3-(3-hydroxy-phenyl)-propionic acid ethylester (30 mg, 0.13 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.02~7.99(2H, m), 7.64~7.6O(1H, m), 7.52~7.49(2H, m), 7.22~7.18(1H, m), 6.89~6.80(3H, m), 5.26(2H, s), 4.18(2H, q, J=8Hz), 3.99~3.98(1H, m), 3.61~3.57(1H, m), 3.36~3.32(1H, m), 2.98~2.96(2H, m), 1.22(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 357(M ⁺ +1)

Preparation Example 18: Preparation of 2-ethoxy-3-(3-{2-(ethoxyimino)-2-phenyl- ethoxy}-phenyl)-propionic acid ethylester

12 mg (yield: 100%) of the title compound was obtained from O-ethyl hydroxylamine hydrochloride salt (3 mg, 0.03 mmol) and 2-ethoxy-3-(3-{2oxo-2- phenyl-ethoxy}-phenyl)-propionic acid ethylester (11 mg, 0.03 mmol) in the same manner as in Preparation Example 4. Mass(EI) 400(M ⁺ +l)

Example 24: 2-ethoxy-3-(3-{2-(ethoxyimino)-2-phenyl}-propionic acid

10 mg (yield: 89%) of the title compound was obtained from 2-ethoxy-3-(3-{2- (ethoxyimino)-2-phenyl}-propionic acid ethylester (12 mg, 0.03 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.68~7.65(2H, m), 7.35~7.32(3H, m), 7.20-7.16(1 H, m), 6.84~6.80(3H, m), 5.21 (2H, s), 4.31(2H, q, J=8Hz), 4.07~4.04(lH, m), 3.56~3.52(1H, m), 3.42~3.38(1H, m), 3.12~3.O8(1H, m), 2.95~2.9O(1H, m), 1.39(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 372(M ⁺ +1)

Preparation Example 19: Methanesulfonic acid 2-(benzyloxyimino)-proply ester (1) l-hydroxy-propane-2-one O-benzyl-oxime

2.5 g (yield: 100%) of the title compound was obtained from hydroxyl-propane- 2-one (1 g, 13.4 mmol) and O-benzylhydroxyamine hydrochloride salt (2.2 g, 13.7 mmol).

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.36~7.27(5H, m), 5.11(2H, s), 4.26(2H, s), 1.87(3H, s) Mass(EI) 180(M ⁺ +l)

(2) Methanesulfonic acid 2-(benzyloxyimino)-propyl ester l-hydroxy-propane-2-one O-benzyl-oxime (200 mg, 1.11 mmol) was dissolved in 2 ml of dichloromethane, and triethylamine (0.13 ml, 1.7 mmol) was added thereto. To the reaction solution, methylchloride (0.31 ml, 2.2 mmol) was added and the resulting solution was reacted for 1 hour. After the reaction, 10 ml of ethylacetate was added and then an organic layer was washed twice with 5 ml of water. The organic layer was dried over anhydrous magnesium sulfate and filtered off to remove solvent, then 210 mg (yield: 73%) of the title compound was obtained. Mass(EI) 258(M ⁺ +1)

Preparation Example 20: Preparation of 3-(3-{2-(benzyloxyimino)-propoxy}- phenyl)-2-ethoxy-propionic acid

20 mg (yield: 80%) of the title compound was obtained from methanesulfonic acid 2-(benzyloxyimino)-propyl ester (16 mg, 0.062 mmol) and 2-ethoxy-3-)3-hydroxy- phenyl)-propionic acid ethylester (15 mg, 0.06 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.38~7.30(5H, m), 7.18~7.14(1H, m), 6.85~6.77(3H, m), 5.14(2H, s), 4.52(2H, s), 4.18(2H, q, J=8Hz), 4.01~3.98(lH, m), 3.62~3.58(1H, m), 3.37~3.33(1H, m), 2.97~2.95(2H, m), 1.98(3H, s), 1.24(3H, t, J=8Hz), 1.14(3H, t, J=8Hz)

Mass(EI) 400(M ⁺ +l)

Example 25: 3-(3-{2-(benzyloxyimino)-propoxy}-phenyl)-2-ethoxy-propionic acid

15 mg (yield: 80%) of the title compound was obtained from 3-(3-{2- (benzyloxyimino)-propoxy}-phenyl)-2-ethoxy-propionic acid ethylester (20 mg, 0.05 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.37~7.30(5H, m), 7.19~7.15(1H, m), 6.86~6.78(3H, m), 5.13(2H, s), 4.52(2H, s), 4.05(2H, q, J=8Hz), 3.61~3.57(1H, m), 3.44~3.4O(1H, m), 3.10~3.05(lH, m), 2.97~2.92(2H, m), 1.98(3H, s), 1.14(3H, t, J=8Hz) Mass(EI) 372(M ⁺ +1)

Preparation Example 21: Preparation of 3-(4-{2-(benzyloxyimino)-propoxy}- phenyl)-2-(2-propoxy)-propionic acid methylester

15 mg (yield: 86%) of the title compound was obtained from methanesulfonic

acid 2-(benzyloxyimino)-propyl ester (11 mg, 0.042 mmol) and 2-(2-propoxy)-3-(4- hydroxy-phenyl)-propionic acid methylester (10 mg, 0.04 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.38~7.30(5H, m), 7.13~7.06(2H, m), 6.84~6.76(2H, m), 5.13(2H, s), 4.51(2H, s), 4.03~4.00(lH, m), 3.71(3H, s), 3.52~3.47(1H, m), 2.96~2.84(1H, m), 2.61~2.59(1H, m), 1.98(3H, s), 1.24(3H, t, J=6Hz), 1.14(3H, t, J=6Hz) Mass(EI) 400(M ⁺ +l)

Example 26: 3-(4-{2-(benzyloxyimino)-propoxy}-phenyl)-2-(2-propoxy)-prop ionic acid

13 mg (yield: 93%) of the title compound was obtained from 3-(4-{2- (benzyloxyimino)-propoxy}-phenyl)-2-(2-propoxy)-propionic acid methylester (15 mg, 0.03 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.38~7.29(5H, m), 7.14~7.07(2H, m), 6.85~6.77(2H, m), 5.13(2H, s), 4.51(2H, s), 4.1O~4.O7(1H, m), 3.56~3.50(lH, m), 2.92~2.85(1H, m), 2.67~2.63(1H, m), 1.98(3H, s), 1.16(3H, d, J=8Hz), 1.01(3H, d, J=8Hz) Mass(EI) 386(M ⁺ +1)

Preparation Example 22: Preparation of 2-ethoxy-3-(3-{2-(ethoxyimino)-2-(4- phenyl-oxazole-2-yl)-ethoxy}-phenyl)-propionic acid ethylester

646 mg (yield: 88%) of the title compound was obtained from 2-bromo-l-(3- phenyl-isooxazole-5-yl)-ethanone O-ethyl-oxime (484 mg, 1.56 mmol) and 2-ethoxy-3- (3-hydroxy-phenyl)-propionic acid ethylester (373 mg, 1.56 mmol) in the same manner

as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.83~7.80(2H, m), 7.48~7.40(3H, m), 7.22-7.18(1 H, m), 6.97(1H, s), 6.89~6.82(2H, m), 5.15(2H, s), 4.41 (2H, q, J=7.2Hz), 4.15(2H, q, J=7.2Hz), 4.00~3.97(lH, m), 3.61~3.57(1H, m), 3.34~3.3O(1H, m), 2.97(2H, d, H=5.6Hz), 1.41(3H, t, J=6.8Hz), 1.20(3H, t, J=7.2Hz), 1.13(3H, t, J=6.8Hz) Mass(EI) 467(M ⁺ +1)

Example 27: 2-ethoxy-3-(3-{2-(ethoxyimino)-2-(4-phenyl-oxazoIe-2-yl)-eth oxy}- phenyl)-propionic acid 270 mg (yield: 44%) of the title compound was obtained from 2-ethoxy-3-(3-

{2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-ethoxy} -phenyl)-propionic acid ethylester (646 mg, 1.38 mmol) in the same manner as in Example 1.

NMR: Conformation of Na ¹ H-NMR(CDCl ₃ ) δ 7.70~7.66(2H, m), 7.40~7.30(2H, m), 7.00~6.97(2H, m), 6.84(1H, s), 6.80~6.75(2H, m), 6.64(1H, d, J=7.5Hz), 4.93(2H, s), 4.26(2H, q, J=7.5Hz), 3.79~3.77(1H, m), 3.33~3.3O(1H, m), 3.01(2H, d, J=12Hz), 2.75~2.7O(1H, m), 1.25(3H, t, J=6.5Hz), 0.83(3H, t, J=7.0Hz) Mass(EI) 439(M ⁺ +l)

Preparation Example 23: Preparation of 2-ethoxy-3-(4-{2-(ethoxyimino)-2-(4- phenyl-oxazoIe-2-yI)-ethoxy}-phenyl)-propionic acid ethylester

231 mg (yield: 69%) of the title compound was obtained from 2-bormo-l-(3- phenyl-isooxazole-5-yl)-ethanone O-ethyl-oxime (220 mg, 0.71 mmol) and 2-ethoxy-3- (4-hydroxy-phenyl)-propionic acid ethylester (170 mg, 0.71 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.81~7.80(2H, m), 7.45~7.40(3H, m), 7.15(2H, d, J=8Hz), 6.97(1H, s), 6.87(2H, d, J=8.5Hz), 5.14(2H, s), 4.41(2H, q, J=7.0Hz), 4.15(2H, q, J=7.0Hz), 3.96~3.93(1H, m), 3.58~3.57(1H, m), 3.34-3.31(1H, m), 2.94(2H, d, J=7Hz), 1.38(3H, t, J=7.0Hz), 1.19(3H, t, J=7Hz), 1.16(3H, t, J=7.0Hz) Mass(EI) 467(M ⁺ +1)

Example 28: 2-ethoxy-3-(4-{2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-eth oxy}- phenyl)-propionic acid

152 mg (yield: 70%) of the title compound was obtained from 2-ethoxy-3-(4- {2-ethoxyimino}-2-(4-phenyl-oxazole-2-yl)-ethoxy)-phenyl)-pr opionic acid ethylester (231 mg, 0.49 mmol) in the same manner as in Example 1.

NMR: 1H-NMR(DMSO-d6) δ 7.93~7.91(2H, m), 7.53~7.51(3H, m), 7.48(1H, s), 7.13(2H, d, J=8Hz), 6.87(2H, d, J=8Hz), 5.12(2H, s), 4.33(2H, q, J=8.0Hz), 3.59~3.55(1H, m), 3.53~3.46(1H, m), 3.12~3.O4(1H, m), 2.84~2.8O(1H, m), 2.61~2.55(1H, m), 1.32(3H, t, J=8.0Hz), 0.95(3H, t, J=8Hz) Mass(EI) 439(M ⁺ +1)

Preparation Example 24: Preparation of 2-ethoxy-3-(3-{2-(ethoxyimino)-2-(4- trifluoromethyl-phenyl)-ethoxy}-phenyl)-propionic acid ethylester 53 mg (yield: 70%) of the title compound was obtained from 2-bromo-l-(4- trifluoromethyl-phenyl)-ethanone O-ethyl-oxime (50 mg, 0.16 mmol) and 2-ethoxy-3- (3-hydroxy-phenyl)-propionic acid ethylester (39 mg, 0.16 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.80(2H, d, J=8Hz), 7.59(2H, d, J=8.4Hz), 7.18~7.15(1H, m), 6.84(1H, d, J-7.6Hz), 6.80~6.75(2H, m), 5.21(2H, s), 4.33(2H, q, J=7.2Hz), 4.15(2H, q,

J=7.2Hz), 3.98~3.95(1H, m), 3.6O~3.56(1H, m), 3.34~3.29(1H, m), 2.94(2H, d, J=8Hz), 1.37(3H, t, J=7.2Hz), 1.24(3H, t, J=8Hz), 1.13(3H, t, J=7.2Hz) Mass(EI) 468(M ⁺ +1)

Example 29: 2-ethoxy-3-(3-{2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-eth oxy}- phenyl)-propionic acid

33 mg (yield: 68%) of the title compound was obtained from 2-ethoxy-3-(3-{2-

(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-ethoxy}-phenyl)-p ropionic acid ethylester (53 mg, 0.11 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.79(2H, d, J=8.4Hz), 7.59(2H, d, J=8.4Hz), 7.2O~7.16(1H, m), 6.85(1H, d, J=8Hz), 6.79~6.78(2H, m), 5.22(2H, s), 4.32(2H, q, J=8Hz),

4.06~4.03(lH, m), 3.58~3.54(1H, m), 3.42~3.37(1H, m), 3.11~3.07(lH, m),

2.96~2.91(1H, m), 1.38(3H, t, J=8Hz), 1.13(3H, t, J=8Hz)

Mass(EI) 440(M ⁺ +l)

Preparation Example 25: 2-bromo-l-(5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl)- ethanone O-ethyl-oxime

(1) Preparation of 3-bromo-2-ethoxyimino-propionic acid

3.4 mg (yield: 81%) of the title compound was obtained from 3-bromo-2-oxo- propionic acid (3.33 g, 19.9 mmol) and O-ethylhydroxyamine hydrochloride salt (1.95 g,

19.9 mmol) in the same manner as in Preparation Example 4.

NMR: ¹ H-NMR(CDCl ₃ ) δ 4.45(2H, q, J=6.8Hz), 4.19(2H, s), 1.39(3H, 7.2Hz)

Mass(EI) 211(M ⁺ +l)

(2) Preparation of 4-fluoro-benzoic acid N-(3-bromo-2-ethoxyimino- propionyl)-hydrazide

4-fluorobenzhydrazide hydrochloride salt (950 mg, 5.0 mmol) and 3-bromo-2- ethoxyimino-propionic acid (1.05 g, 4.99 mmol) were dissolved in 30 ml of dichloromethane, and triethylamine (2.1 ml, 15 mmol) and 2-chloro-l,3- dimethylimidazolium chloride (850 mg, 5.0 mmol) were added thereto at 0 ⁰ C, followed by stirring for 10 minutes. The resulting solution was allowed to warm to room temperature, then further stirred for 3 hours. 100 ml of ethylacetate was added to thereto, and an organic layer was washed twice with water. The organic layer was dried over anhydrous magnesium sulfate, and filtered off to remove solvent. The residue solution was purified by column chromatography to obtain 900 g of the title compound in a yield of 52%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.88~7.84(2H, m), 7.17~7.13(2H, m), 4.42~4.35(4H, m), 1.39(3H, 7.2Hz) Mass(EI) 347(M ⁺ +l)

(3) Preparation of 2-bromo-l-(5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl)- ethanone O-ethyl-oxime

4-fluoro-benzoic acid N-(3-bromo-2-ethoxyimino-propionyl)-hydrazide (610 mg, 1.76 mmol) was dissolved in 10 ml of dichloromethane, and triethylamine (0.49 ml, 3.5 mmol) and 2-chloro-l,3-dimethylimidazolium chloride (300 mg, 1.77 mmol) were added thereto at 0°C, followed by stirring for 10 minutes. The resulting solution was allowed to warm to room temperature, then further stirred for 3 hours. 100 ml of ethyacetate was added to thereto, and an organic layer was washed twice with water.

The organic layer was dried over anhydrous magnesium sulfate, and filtered off to remove solvent. The residue solution was purified by column chromatography to obtain 452 g of the title compound in a yield of 77%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.18~8.14(2H, m), 7.24~7.20(2H, m), 4.67(2H, s), 4.48(2H, q, J=8Hz), 1.43(3H, 8Hz) Mass(EI) 329(M ⁺ +1)

Preparation Example 26: 2-bromo-l-(5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl)- ethanone O-propyl-oxime (1) Preparation of 3-bromo-2-propoxyimino-propionic acid

1.4 mg (yield: 67%) of the title compound was obtained from 3-bromo-2-oxo- propionic acid (1.67 g, 10 mmol) and O-propylhydroxyamine hydrochloride salt (1.1 g, 9.86 mmol) in the same manner as in Preparation Example 4.

NMR: ¹ H-NMR(CDCl ₃ ) δ 4.14(4H, m), 4.19(2H, s), 1.69~1.64(2H, m), 0.93(3H, 8Hz) Mass(EI) 225(M ⁺ +l)

(2) Preparation of 4-fluoro-benzoic acid N-(3-bromo-2-propoxyimino- propionyl)-hydrazide

4-fluorobenzhydrazide hydrochloride salt (765 mg, 4.0 mmol) and 3-bromo-2- propoxyimino-propionic acid (900 mg, 4.01 mmol) was dissolved in 30 ml of dichloromethane, then triethylamine (1.67 ml, 11.9 mmol) and 2-chloro-l,3- dimethylimidazolium chloride (680 mg, 4.0 mmol) were added thereto at 0°C, followed by stirring for 10 minutes. The resulting solution was allowed to warm to room temperature, then further stirred for 3 hours. 100 ml of ethylacetate was added to thereto,

and an organic layer was washed twice with water. The organic layer was dried over anhydrous magnesium sulfate, and filtered off to remove solvent. The residue solution was purified by column chromatography to obtain 900 g of the title compound in a yield of 62%. Mass(EI) 361(M ⁺ +1)

(3) Preparation of 2-bromo-l-(5-(4-fluoro-phenyl)-[l,3,4]oxadiazoIe-2-yl)- ethanone O-propyl-oxim

4-fluoro-benzoic acid N-(3-bromo-2-propoxyimino-propionyl)-hydrazide (900 mg, 2.5 mmol) was dissolved in 30 ml of dichloromethane, then triethylamine (0.7 ml, 5.02 mmol) and 2-chloro-l,3-dimethylimidazolium chloride (420 mg, 2.48 mmol) were added thereto at O ⁰ C, followed by stirring for 10 minutes. The resulting solution was allowed to warm to room temperature, then further stirred for 3 hours. 100 ml of ethylacetate was added to thereto, and an organic layer was washed twice with water. The organic layer was dried over anhydrous magnesium sulfate, and filtered off to remove solvent, then the residue solution was purified by column chromatography to obtain 823 mg of the title compound in a yield of 97%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.18~8.14(2H, m), 7.24~7.20(2H, m), 4.68(2H, s), 4.38(2H, t, J=8Hz), 1.86~1.80(2H, m), 1.03(3H, 8Hz) Mass(EI) 343(M ⁺ +l)

Preparation Example 27: Preparation of 2-ethoxy-3-(3-[2-(ethoxyimino)-2-{5-(4- fluoro-phenyl)-[l,3 _> 4]oxadiazole-2-yl}-ethoxy-phenyl]-propionic acid ethylester

260 mg (yield: 86%) of the title compound was obtained from 2-bromo-l-(5-(4-

fluoro-phenyl)-[l,3,4]oxadiazole-2-yl)-ethanone O-ethyl-oxime (210 mg, 0.63 mmol) and 2-ethoxy-3-(3-hydroxy-phenyl)-propionic acid ethylester (150 mg, 0.62 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15-8.11(2H, m), 7.26-7.17(3H, m), 6.90~6.86(3H, m), 5.22(2H, s), 4.44(2H, q, J=7.2Hz), 4.19~4.13(2H, m), 4.00~3.97(lH, m), 3.63~3.55(1H, m), 3.38~3.3O(1H, m), 2.97(2H, d, J=6Hz), 1.40(3H, t, J=7.2Hz), 1.21(3H, t, J=7.2Hz), 1.15(3H, t, J=7.2Hz) Mass(EI) 486(M ⁺ +1)

Example 30: 2-ethoxy-3-(3-[2-(ethoxyimino)-2-{5-(4-fluoro-phenyl)-

[l,3,4]oxadiazole-2-yl}-ethoxy-phenyl]-propionic acid

240 mg (yield: 99%) of the title compound was obtained from 2-ethoxy-3-(3- [2-(ethoxyimino)-2-{5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2- yl}-ethoxy-phenyl]- propionic acid ethylester (260 mg, 0.53 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.11(2H, m), 7.24-7.19(3H, m), 6.89~6.87(3H, m), 5.23(2H, s), 4.46(2H, q, J=7.2Hz), 4.13~4.O6(1H, m), 3.62~3.54(1H, m), 3.48~3.37(1H, m), 3.12~3.08(lH, m), 2.99~2.94(1H, m), 1.40(3H, t, J=7.2Hz), 1.16(3H, t, J=6.8Hz) Mass(EI) 458(M ⁺ +l)

Preparation Example 28: Preparation of 2-ethoxy-3-(4-[2-(ethoxyimino)-2-{5-(4- fluoro-phenyl)- [1,3,4] oxadiazole-2-yl}-ethoxy-phenyl]-propionic acid ethylester

260 mg (yield: 85%) of the title compound was obtained from 2-bromo-l-(5-(4- fluoro-phenyl)-[l,3,4]oxadiazole-yl)-ethanone O-ethyl-oxime (210 mg, 0.63 mmol) and 2-ethoxy-3-(4-hydroxy-phenyl)-propionic acid ethylester (150 mg, 0.62 mmol) in the

same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.11(2H, m), 7.26-7.15(4H, m), 6.93~6.90(2H, m), 5.22(2H, s), 4.45(2H, q, J=6.8Hz), 4.16(2H, q, J=7.2Hz), 3.97~3.94(1H, m), 3.61~3.55(1H, m), 3.38~3.3O(1H, m), 2.95(2H, d, J=8Hz), 1.39(3H, t, J=6.8Hz), 1.22(3H, t, J=7.2Hz), 1.15(3H, t, J=6.8Hz) Mass(EI) 486(M ⁺ +!)

Example 31 : 2-ethoxy-3-(4-[2-(ethoxyimino)-2-{5-(4-fluoro-phenyl)-

[l,3,4]oxadiazole-2-yl}-ethoxy-phenyl]-propionic acid 240 mg (yield: 99%) of the title compound was obtained from 2-ethoxy-3-(4-

[2-(ethoxyimino)-2-{5-(4-fluoro-phenyl)-[l,3,4]oxadiazole -2-yl}-ethoxy-phenyl]- propionic acid ethylester (260 mg, 0.53 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.12(2H, m), 7.26~7.15(4H, m), 6.94~6.92(2H, m), 5.22(2H, s), 4.46(2H, t, J=8Hz), 4.13~4.O3(1H, m), 3.62~3.55(1H, m), 3.49~3.42(1H, m), 3.10~3.06(lH, m), 2.98~2.92(1H, m), 1.39(3H, t, J=7.2Hz), 1.17(3H, t, J=7.2Hz) Mass(EI) 458(M ⁺ +1)

Preparation Example 29: Preparation of 2-ethoxy-3-(3-{2-[5-(4-fraoro-phenyl)- [1 ,3 _» 4] oxadiazole-2-yl] -2-(propoxyimino)-ethoxy}-pheny)-propionic acid ethylester 230 mg (yield: 46%) of the title compound was obtained from 2-bromo-l-(5-(4- fluoro-phenyl)-[l,3,4]oxadiazole-2-yl)-ethanone O-ethyl-oxime (215 mg, 0.62 mmol) and 2-ethoxy-3-(3-hydroxy-phenyl)-propionic acid ethylester (150 mg, 0.62 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.12(2H, m), 7.23~7.17(3H, m), 6.89~6.86(3H, m),

5.22(2H, s), 4.36(2H, t, J=6.8Hz), 4.19~4.13(2H, m), 4.00~3.97(lH, m), 3.63~3.55(1H, m), 3.38~3.3O(1H, m), 2.96(2H, d, J=8Hz), 1.81(2H, q, J=6.8Hz), 1.23(3H, t, J=7.2Hz),

1.15(3H, t, J=7.2Hz), 1.00(3H, t, J=7.8Hz)

Mass(EI) 500(M ⁺ +l)

Example 32: 2-ethoxy-3-(3-{2-[5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl ]-2-

(propoxyimino)-ethoxy}-phenyl)-propionic acid

220 mg (yield: 100%) of the title compound was obtained from 2-ethoxy-3-(3-

{2-[5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl]-2-(propox yimino)-ethoxy}-phenyl)- propionic acid ethylester (230 mg, 0.46 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.11(2H, m), 7.23~7.19(3H, m), 6.89~6.87(3H, m),

5.23(2H, s), 4.36(2H, t, J=8Hz), 4.11~4.O6(1H, m), 3.6O~3.56(1H, m), 3.47~3.43(1H, m), 3.10~3.09(lH, m), 3.00~2.94(lH, m), 1.81(2H, q, J=8Hz), 1.15(3H, t, J=8Hz),

1.00(3H, t, J=8Hz) Mass(EI) 472(M ⁺ H-I)

Preparation Example 30: Preparation of 2-ethoxy-3-(4-{2-[5-(4-fluoro-phenyl)- [1 ,3,4] oxadiazole-2-yl] -2-(propoxyimino)-ethoxy}-phenyl)-propionic acid ethylester

260 mg (yield: 84%) of the title compound was obtained from 2-bromo-l-(5-(4- fluoro-phenyl)-[l,3,4]oxadiazole-2-yl)-ethanone O-ethyl-oxime (215 mg, 0.62 mmol) and 2-ethoxy-3-(4-hydroxy-phenyl)-propionic acid ethylester (150 mg, 0.63 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.11(2H, m), 7.23~7.15(4H, m), 6.93~6.90(2H, m), 5.22(2H, s), 4.45(2H, t, J=8Hz), 4.16(2H, q, J=8Hz), 3.61~3.57(1H, m), 3.36~3.32(1H,

m), 2.95~2.94(2H, m), 1.39(3H, t, 8Hz), 1.22(3H, t, J=8Hz), 1.16(3H, t, J=8Hz) Mass(EI) 500(M ⁺ +l)

Example 33: 2-ethoxy-3-(4-{2-[5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl ]-2- (propoxyimino)-ethoxy}-phenyl)-propionic acid

240 mg (yield: 97%) of the title compound was obtained from 2-ethoxy-3-(4- {2-[5-(4-fluoro-phenyl)-[l,3,4]oxadiazole-2-yl]-2-(propoxyim ino)-ethoxy}-phenyl)- propionic acid ethylester (260 mg, 0.52 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.15~8.12(2H, m), 7.23~7.14(4H, m), 6.95~6.92(2H, m), 5.22(2H, s), 4.36(2H, t, J=6.4Hz), 4.06~4.04(lH, m), 3.6O~3.54(1H, m), 3.49~3.45(1H, m), 3.11~3.06(lH, m), 2.97~2.92(1H, m), 1.80(2H, m, 7.2Hz), 1.21(3H, t, J=6.8Hz), 1.00(3H, t, J=7.6Hz) Mass(EI) 472(M ⁺ +l)

Preparation Example 31: Preparation of 2-ethoxy-3-(4-{2-(ethoxyimino)-2-(4- trifluoromethyl-phenyl)-ethoxy}-phenyl)-propionic acid ethylester

53 mg (yield: 70%) of the title compound was obtained from 2-bromo-l-(4- trifluoromethyl-phenyl)-ethanone O-ethyl-oxime (50 mg, 0.16 mmol) and 2-ethoxy-3- (4-hydroxy-phenyl)-propionic acid ethylester (39 mg, 0.16 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.79(2H, d, J=8Hz), 7.58(2H, d, J=8.4Hz), 7.12(2H, d, J=8.8Hz), 6.84(2H, d, J=8.4Hz), 5.21(2H, s), 4.33(2H, q, J=6.8Hz), 4.14(2H, q, J=7.2Hz), 3.96~3.93(1H, m), 3.61~3.57(1H, m), 3.35~3.31(1H, m), 2.93(2H, d, J=6.4Hz), 1.36(3H, t, J=6.8Hz), 1.21(3H, t, J=6.8Hz), 1.14(3H, t, J=7.2Hz) Mass(EI) 468(M ⁺ +l)

Example 34: 2-ethoxy-3-(4-{2-(ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-eth oxy}- phenyl)-propionic acid

33 mg (yield: 68%) of the title compound was obtained from 2-ethoxy-3-(4-{2- (ethoxyimino)-2-(4-phenyl-oxazole-2-yl)-ethoxy}-phenyl)-prop ionic acid ethylester (53 mg, 0.11 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.78(2H, d, J=8.0Hz), 7.58(2H, d, J=9Hz), 7.12(2H, d, J=8.5Hz), 6.82(2H, d, J=6.5Hz), 5.20(2H, s), 4.31(2H, q, J=7.5Hz), 4.04~4.03(lH, m), 3.58~3.55(1H, m), 3.46~3.44(1H, m), 3.08~3.04(lH, m), 2.95~2.9O(1H, m), 1.36(3H, t, J=7Hz), 1.15(3H, t, J=7Hz) Mass(EI) 440(M ⁺ +l)

Preparation Example 32: Preparation of 3-bromo-2-(propoxyimino)-propionic acid ethylester 440 mg (yield: 34%) of the title compound was obtained from 3-bromo-2-oxo- propionic acid ethylester (971 mg, 4.97 mmol) in the same manner as in Preparation

Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 4.40-4.31(4H, m), 4.23(2H, s), 2.06-1.72(2H, m), 1.35(3H, t,

J=8Hz), 0.97(3H, t, J=8Hz) Mass(EI) 253(M ⁺ +1)

Preparation Example 33: Preparation of 3-acetoxy-2-(propoxyimino)-propionic acid ethylester

3-bromo-2-(propoxyimino)-propionic acid ethylester (420 mg, 1.66 mmol) was dissolved in 5 ml of dimethylformamide, and sodium acetate was added thereto. After

heating at 80°C for 5 hours, extraction was conducted with ethylacetate. The extracted solution was dried over anhydrous magnesium sulfate and concentrated then purified by column chromatography to obtain 257 g of the title compound in a yield of 67% yield. NMR: ¹ H-NMR(CDCl ₃ ) δ 4.98(2H, s), 4.35(2H, q, 8Hz), 4.28(2H, t, 8Hz), 2.06(3H, s), 1.76-1.60(2H, m), 1.35(3H, t, J=8Hz), 0.95(3H, t, J=8Hz) Mass(EI) 232(M ⁺ +1)

Preparation Example 34: Preparation of 3-hydroxy-2-(propoxyimino)-propionic acid ethylester 163 mg (yield: 91%) of the title compound was obtained from 3-acetoxy-2-

(propoxyimino)-propionic acid ethylester in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 4.58(2H, s), 4.26(2H, t, 6.5Hz), 1.77-1.72(2H, m), 0.96(3H, t, J=8Hz)

Mass(EI) 162(M ⁺ +1)

Preparation Example 35: Preparation of 3-(t-butyl-dimethyl-silanyloxy)-2-

(propoxyimino)-propionic acid

3-hydroxy-2-(propoxyimino)-propionic acid ethylester (110 mg, 0.67 mmol) was dissolved in 3 ml of dimethylformamide, and imidazole (232 mg, 3.40 mmol) was added thereto, then the reaction was cooled to -30°C. t-butyldimethylsilyl chloride (257 mg, 1.70 mmol) was added thereto and stirred for 1 hour, then water was added thereto. The product was extracted with ethylacetate and dried over anhydrous magnesium sulfate to be concentrated. The resulting solution was dissolved in 2 ml of methanol, and potassiumcarbonate (20 mg, 0.14 mmol) was added thereto, then stirred for 2 hours. After the stirring, ethylacetate was added thereto, followed by washing with IN

hydrochloride solution. An organic layer was dried over, and concentrated, then the residue was purified by column chromatography to obtain 69 mg of the title compound in a yield of 39%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 4.46(2H, s), 4.13(2H, t, 8Hz), 1.65-1.60(2H, m), 0.84(3H, t, J=8Hz), 0.78(9H, s), 0.01(6H, s) Mass(EI) 261(M ⁺ +l)

Preparation Example 36: Preparation of 2-(t-butyl-dimethyl-silanyloxy)-l-[3-(4- fluoro-phenyl)- [1 ,2,4] oxadiazole-5-yl] -ethanone O-propyl-oxime 3-(t-butyl-dimethyl-silanyloxy)-2-(propoxyimino)-propionic acid (69 mg, 0.25 mmol) and 4-fluoro-N-hydroxy-benzamidine (39 mg, 0.25 mmol) were dissolved in 1 ml of dimethylformamide and then stirred for 6 hours at 100°C. After the stirring, ethylacetate was added thereto, and the reaction was washed with water, then dried over anhydrous magnesium sulfate to concentrate. The resulting solution was purified by column chromatography to obtain 40 mg of the title compound in a yield of 40%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.04~8.00(2H, m), 7.07~7.03(2H, m), 4.71(2H, s), 4.21(2H, t, 8Hz), 1.70~1.65(2H, m), 0.87(3H, t, J=8Hz), 0.75(9H, s), 0.01(6H, s) Mass(EI) 394(M ⁺ +l)

Preparation Example 38: Preparation of l-[3-(4-fluoro-phenyl)-[l,2,4]oxadiazole- 5-yl]-2-hydroxy-ethanone O-propyl-oxime

2-(t-butyl-dimethyl-silanyloxy)-l-[3-(4-fluoro-phenyl)-[l ,2,4]oxadiazole-5-yl]- ethanone O-propyl-oxime (40 mg, 0.1 mmol) was dissolved in 1 ml of tetrahydrofuran, and tetrabutylammonium fluoride (0.3 ml, 0.3 mmol) was added thereto at room

temperature, followed by stirring for 3 hours. After the stirring, ethylacetate was added to the reactant solution and washed with water then dride over anhydrous magnesium sulfate to concentrate. The resulting solution was purified by column chromatography to obtain 30 mg of the title compound in a yield of 100%. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.11~8.09(2H, m), 7.19~7.15(2H, m), 4.84(2H, s), 4.35(2H, t, 7Hz), 1.82-1.79(2H, m), 0.99(3H, t, J=9Hz) Mass(EI) 280(M ⁺ +l)

Preparation Example 39: Preparation of methanesulfonic acid 2-[3-(4-fluoro- phenyl)-[l,2,4]oxadiazole-5-yl]-2-propoxyimino-ethyl ester

30 mg (yield: 84%) of the title compound was obtained from l-[3-(4-fluoro- phenyl)-[l,2,4]oxadiazole-5-yl]-hydroxy-ethanone 0-propyl-oxime (30 mg, 0.1 mmol) in the same manner as in Preparation Example 1.

Mass(EI) 358(M ⁺ +l)

Preparation Example 40: Preparation of 2-ethoxy-3-(4-{2-[3-(4-fluoro-phenyl)-

[l,2,4]oxadiazole-5-yl]-2-propoxyimino-ethoxy}-phenyl)-pr opionic acid ethylester

11 mg (yield: 52%) of the title compound was obtained from methanesulfonic acid 2-[3-(4-fluoro-phenyl)-[l,2,4]oxadiazole-5-yl]-2-propoxyimin o-ethyl ester (15 mg, 0.042 mmol) and 2-ethoxy-3-(4-hydroxy-phenyl)-propionic acid ethylester (13 mg, 0.054 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.86~7.80(2H, m), 7.47~7.44(2H, m), 7.16(2H, d, J=8.4Hz), 6.88(2H, d, J=8.8Hz), 5.14(2H, s), 4.40(2H, t, J=6.8Hz), 4.17~4.09(2H, q, J=6.0Hz), 3.97~3.94(1H, m), 3.61~3.57(1H, m), 3.36~3.32(1H, m), 2.95(2H, d, J=6Hz), 1.39(3H, t, J=7.2Hz), 1.20(3H, t, J=6.8Hz), 1.15(3H, t, J=6.4Hz)

Mass(EI) 500(M ⁺ +l)

Example 35: Preparation of 2-ethoxy-3-(4-{2-[3-(4-fluoro-phenyl)- [l,2,4]oxadiazole-5-yl]-2-propoxyimino-ethoxy}-phenyl)-propi onic acid ethylester 11 mg (yield: 100%) of the title compound was obtained from 2-ethoxy-3-(4-

{ 2- [3 -(4-fluoro-phenyl)- [ 1 ,2,4] oxadiazole-5 -yl] -2-propoxyimino-ethoxy } -phenyl- propionic acid ethylester (11 mg, 0.022 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.10(2H, m), 7.24~7.14(4H, m), 6.93~6.90(2H, m), 5.20(2H, s), 4.39(2H, t, J=8Hz), 4.07~4.04(lH, m), 3.62~3.56(1H, m), 3.50~3.43(lH, m), 3.11~3.06(lH, m), 2.99~2.93(1H, m), 1.86~1.77(2H, m), 1.16(3H, t, J=8Hz), 1.00(3H, t, J=8Hz) Mass(EI) 472(M ⁺ +l)

Preparation Example 41: Preparation of 2-ethoxy-3-(3-{2-[3-(4-fluoro-phenyl)- [1 ,2,4] oxadiazole-5-yl] -2-propoxyimino-ethoxy }-phenyl)-propionic acid ethylester

15 mg (yield: 71%) of the title compound was obtained from methanesulfonic acid 2-[3-(4-fluoro-phenyl)-[l,2,4]oxadiazole-5-yl]-2-propoxyimin o-ethylester (15 mg, 0.042 mmol) and 2-ethoxy-3-(3-hydroxy-phenyl)-propionic acid ethylester (13 mg, 0.054 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.11(2H, m), 7.26-7.14(3H, m), 6.90~6.84(3H, m), 5.20(2H, s), 4.40(2H, t, J=6.8Hz), 4.19~4.13(2H, m), 4.00~3.97(lH, m), 3.61~3.57(1H, m), 3.35~3.31(1H, m), 2.98~2.96(2H, m), 1.81(2H, m, J=7.2Hz), 1.21(3H, t, J-7.2Hz), 1.15(3H, t, J=6.8Hz), 0.99(3H, t, J=7.6Hz) Mass(EI) 500(M ⁺ H-I)

Example 36: Preparation of 2-ethoxy-3-(3-{2-[3-(4-fluoro-phenyl)- [l,2,4]oxadiazole-5-yl]-2-propoxyimino-ethoxy}-phenyl)-propi onic acid ethylester

2.4 mg (yield: 23%) of the title compound was obtained from 2-ethoxy-3-(3-{2- [3-(4-fluoro-phenyl)-[ 1 ,2,4]oxadiazole-5-yl]-2-propoxyimino-ethoxy} -phenyl- propionic acid ethylester (15 mg, 0.022 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.10(2H, m), 7.24-7.14(3H, m), 6.90~6.88(3H, m), 5.21(2H, s), 4.41 (2H, q, J=8Hz), 4.09~4.06(lH, m), 3.6O~3.54(1H, m), 3.47~3.42(1H, m), 3.14~3.O9(1H, m), 2.99~2.94(1H, m), 1.87~1.78(2H, m), 1.14(3 H, t, J=8Hz), 1.00(3H, t, J=8Hz) Mass(EI) 472(M ⁺ +1)

Preparation Example 42: (lZ)-2-bromo-l-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2- yljethanone O-ethyloxime 60 mg (yield: 17%) of the title compound was obtained from 4- chlorobenzhydrazide hydrochloride salt (207 mg, 1.0 mmol) and 3-bromo-2- ethoxyimino-propionic acid (272 mg, 1.0 mmol) in the same manner as in Preparation Example 25. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.10~8.18(2H, m), 7.53~7.51(2H, m), 4.67(2H, s), 4.48(2H, q, J=8Hz), 1.42(3H, J=8Hz) Mass(EI) 344, 346(M ⁺ +l)

Preparation Example 43: (±) 3-(4-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2- y 1] -2-(ethoxy imino)ethy 1] oxy } phenyl)-2-ethoxy propionic acid ethy lester

20 mg (yield: 91%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-ethyloxime (15 mg, 0.044 mmol) and (±) 2-ethoxy-3-(4-hydroxyphenyl)-propionic acid ethylester (10 mg, 0.044 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.07~8.05(2H, m), 7.50~7.48(2H, m), 7.16~7.14(2H, m), 6.92~6.90(2H, m), 5.21(2H, s), 4.44(2H, q, J=7.3Hz), 4.16(2H, q, J=7.4Hz), 3.97~3.94(1H, m), 3.62~3.56(1H, m), 3.37~3.31(1H, m), 2.95~2.93(2H, m), 1.39(3H, t, J=9.3Hz), 1.21(3H, t, J=7.4Hz), 1.15(3H, t, J=6.7Hz) Mass(EI) 502(M ⁺ +l)

Example 37: (±) 3-(4-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2- (ethoxyinιino)ethyl] oxy }phenyl)-2-ethoxypropionic acid 15 mg (yield: 79%) of the title compound was obtained from (±) 3-(4-{ [(2E)-2-

[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-(ethoxyimino )ethyl]oxy}phenyl)-2- ethoxypropionic acid ethylester (20 mg, 0.040 mmol) in the same manner as in Example

1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.07~8.02(2H, m), 7.51~7.47(2H, m), 7.17~7.14(2H, m), 6.90~6.87(2H, m), 5.18(2H, s), 4.41(2H, t, J=7.3Hz), 3.94~3.91(1H, m), 3.51~3.47(1H, m), 3.33~3.27(1H, m), 3.07~3.01(lH, m), 2.87~2.82(1H, m), 1.37(3H, t, J=7.3Hz),

1.07(3H, t, J=6.7Hz)

Mass(EI) 474(M ⁺ +1)

Preparation Example 44: (±) 3-(3-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2- yl]-2-(ethoxyimino)ethyl]oxy}phenyl)-2-ethoxypropionic acid ethylester

20 mg (yield: 91%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-ethyloxime (15 mg, 0.044 mmol) and (±) 2-ethoxy-3-(3-hydroxyphenyl)propionic acid ethylester (10 mg, 0.044 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.07~8.05(2H, m), 7.50~7.48(2H, m), 7.2O~7.17(1H, m), 6.90~6.85(3H, m), 5.21 (2H, s), 4.45(2H, q, J=7.3Hz), 4.19~4.13(2H, m), 4.00~3.97(lH, m), 3.62~3.56(1H, m), 3.37~3.31(1H, m), 2.98~2.95(2H, m), 1.40(3H, t, J=6.7Hz), 1.21(3H, t, J=7.3Hz), 1.15(3H, t, J=6.7Hz) Mass(EI) 502(M ⁺ +l)

Example 38: (±) 3-(3-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2- (ethoxyimino)ethyI]oxy}phenyl)-2-ethoxypropionic acid

15 mg (yield: 79%) of the title compound was obtained from (±) 3-(3-{[(2E)-2-

[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-(ethoxyimino )ethyl]oxy}phenyl)-2- ethoxypropionic acid ethylester (20 mg, 0.040 mmol) in the same manner as in Example

1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.08~8.04(2H, m), 7.52~7.48(2H, m), 7.22~7.18(1H, m), 6.90~6.86(3H, m), 5.23(2H, s), 4.46(2H, q, J=7.3Hz), 4.1O~4.O7(1H, m), 3.59~3.54(1H, m), 3.5O~3.44(1H, m), 3.16~3.10(lH, m), 3.00~2.94(lH, m), 1.40(3H, t, J=7.3Hz),

1.16(3H, t, J=6.7Hz)

Mass(EI) 474(M ⁺ +l)

Preparation Example 45: (lZ)-2-bromo-l-[5-(3-chlorophenyl)-l,3,4-oxadiazole-2-

yl]ethanone O-ethyloxime

80 mg (yield: 23%) of the title compound was obtained from 4- chlorobenzhydrazide hydrochloride salt (207 mg, 1.0 mmol) and 3-bromo-2- ethoxyimino-propionic acid (272 mg, 1.0 mmol) in the same manner as in Preparation Example 25.

Mass(EI) 344, 346(M ⁺ +1)

Preparation Example 46: (+) 3-(4-{[(2E)-2-[5-(3-chlorophenyl)-l,3,4-oxadiazole-2- yl]-2-(ethoxyimino)ethyl]oxy}phenyl)-2-ethoxypropionic acid ethylester 23 mg (yield: 79%) of the title compound was obtained from (lZ)-2-bromo-l-

[5-(3-chlorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-ethyloxime (20 mg, 0.058 mmol) and (±) 2-ethoxy-3-(4-hydroxyphenyl)-propionic acid ethylester (14 mg, 0.058 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.10(1H, brs), 8.02(1H, d, J=8.6Hz), 7.53(1H, dd, J=8.0, 1.2Hz), 7.46(1H, t, J=7.7Hz), 7.15(2H, d, J=8.6Hz), 6.91(2H, d, J=8.6Hz), 5.21(2H, s),

4.46(2H, q, J=7.3Hz), 4.15(2H, q, J=7.2Hz), 3.96(1H, t, J=6.1Hz), 3.62~3.56(1H, m),

3.38~3.30(lH, m), 2.95~2.93(2H, m), 1.40(3H, t, J=7.3Hz), 1.21(3H, t, J=7.2Hz),

1.15(3H, t, J=6.8Hz)

Mass(EI) 502(M ⁺ +l)

Example 39: (±) 3-(4-{[(2E)-2-[5-(3-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-

(ethoxy imino)ethy 1] oxy } pheny l)-2-ethoxy propionic acid

11 mg (yield: 50%) of the title compound was obtained from (+) 3-(4-{[(2E)-2-

[5 -(3 -chlorophenyl)- 1 ,3 ,4-oxadiazole-2-yl] -2-(ethoxyimino)ethy 1] oxy } pheny l)-2-

ethoxypropionic acid ethylester (23 mg, 0.046 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.1O(1H, t, J=LlHz), 8.02(1H, dd, J=8.0, UHz), 7.53(1H, dd, J=8.0, 1.1Hz), 7.46(1H, t, J=8.0Hz), 7.15(2H, d, J=8.6Hz), 6.92(2H, d, J=8.6Hz), 5.22(2H, s), 4.46(2H, q, J=7.3Hz), 4.05(1H, dd, J=7.4, 4.3Hz), 3.6O~3.54(1H, m), 3.50-3.44(1H, m), 3.09(1H, abx, J=I 4, 4.3Hz), 3.09(1H, abx, J=14, 7.4Hz), 1.40(3H, t, J=7.3Hz), 1.18(3H, t, J=7.4Hz) Mass(EI) 474(M ⁺ +1)

Preparation Example 47: (±) 3-(3-{[(2E)-2-[5-(3-chlorophenyl)-l,3,4,-oxadiazole-2- yl]-2-(ethoxyimino)ethyl]oxy}phenyl)-2-ethoxypropionic acid ethyl ether

23 mg (yield: 79%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(3-chlorophenyl)-l,3,4-oxadiazole-2-yl]-ethanone O-ethyloxime (20 mg, 0.058 mmol) and (±) 2-ethoxy-3-(3-hydroxyphenyl)-propionic acid ethylester (14 mg, 0.058 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.1O(1H, t, J=LlHz), 8.03~8.01(lH, m), 7.55~7.51(1H, m), 7.48~7.44(1H, m), 7.19(1H, t, J=8.0Hz), 6.90~6.85(3H, m), 5.22(2H, s), 4.46(2H, q, J=7.4Hz), 4.20~4.12(2H, m), 3.99(1H, dd, J=7.4, 4.3Hz), 3.64~3.56(1H, m),

3.38~3.31(1H, m), 2.98~2.94(2H, m), 1.25(3H, t, J=7.4Hz), 1.15(3H, t, J=7.4Hz) Mass(EI) 502(M ⁺ +l)

Example 40: (±) 3-(3-{[(2E)-2-[5-(3-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2- (ethoxyimino)ethyl] oxy}phenyl)-2-ethoxypropionic acid

16 mg (yield: 73%) of the title compound was obtained from (±) 3-(3-{[(2E)-2- [5-(3-chlorophenyl)- 1 ,3,4-oxadiazole-2-yl]-2-(ethoxyimino)ethyl]oxy}phenyl)-2-

ethoxypropionic acid ethylester (23 mg, 0.046 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.1O(1H, t, J=LlHz), 8.03~8.01(lH, m), 7.55~7.51(1H, m), 7.47~7.44(1H, m), 7.21(1H, t, J=8.0Hz), 6.90~6.87(3H, m), 5.23(2H, s), 4.47(2H, q, J=7.3Hz), 4.08(1H, dd, J=7.4, 4.3Hz), 3.6O~3.54(1H, m), 3.50-3.42(1H, m), 3.12(1H, abx, J=14, 4.3Hz), 2.97(1H, abx, J=14, 7.4Hz), 1.41(3H, t, J=7.3Hz), 1.16(3H, t, J=7.4Hz) Mass(EI) 474(M ⁺ +1)

Preparation Example 48: Preparation of 2-(t-butyl-dimethyl-silanyloxy)-l-[3-(4- chloro-phenyl)- [1 ,2,4] oxadiazole-5-yl]-ethanone O-propyl-oxime

150 mg (yield: 25%) of the title compound was obtained from 3-(t-butyl- dimethyl-silanyloxy)-2-(propoxyimino)-propionic acid (400 mg, 1.5 mmol) and 4- chloro-N-hydroxy-benzamidine (250 mg, 0.15 mmol) in the same manner as in Preparation Example 36. Mass(EI) 410(M ⁺ +l)

Preparation Example 49: Preparation of l-[3-(4-chloro-phenyl)-[l,2,4]oxadiazole- 5-yl]-2-hydroxy-ethanone O-propyl-oxime 100 mg (yield: 92%) of the title compound was obtained from 2-(t-butyl- dimethyl-silanyloxy)-l-[3-(4-chloro-phenyl)-[l,2,4]oxadiazol e-5-yl]-ethanone O- propyl-oxime (150 mg, 0.37 mmol) in the same manner as in Preparation Example 38. Mass(EI) 296(M ⁺ +l)

Preparation Example 50: Preparation of methanesulfonic acid 2-[3-(4-fluoro-

phenyl)-[l,2,4]oxadiazole-5-yI]-2-propoxyimino-ethyl ester

86 mg (yield: 68%) of the title compound was obtained from l-[3-(4-chloro- phenyl)-[l,2,4]oxadiazole-5-yl]-2-hydorxy-ethanone O-propyl-oxime (100 mg, 0.34 mmol) in the same manner as in Preparation Example 1. Mass(EI) 374(M ⁺ +1)

Preparation Example 51: Preparation of (±) 3-(4-{[(2E)-2-[3-(4-chlorophenyl)- l,2,4-oxadiazole-5-yl]-2-(propoxyimino)ethyl]oxy}phenyl)-2-e thoxypropionic aicd ethyl ether 8 mg (yield: 82%) of the title compound was obtained from methanesulfonic 2-

[3-(4-chloro-phenyl)-[l,2,4]oxadiazole-5-yl]-2-propoxyimi no-ethyl ester (7.0 mg, 0.019 mmol) and (±) 2-ethoxy-3-(4-hydoxyphenyl)propionic acid ethylester (4.5 mg, 0.019 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.06~8.04(2H, m), 7.46~7.44(2H, m), 7.17~7.15(2H, m), 6.91~6.88(2H, m), 5.19(2H, s), 4.39(2H, t, J=6.7Hz), 4.16(2H, q, J=7.4Hz), 3.97~3.94(1H, m), 3.62~3.56(1H, m), 3.37~3.31(1H, m), 2.95~2.93(2H, m), 1.84~1.77(2H, m), 1.21(3H, t, J=7.6Hz), 1.16(3H, t, J=7.3Hz), 0.98(3H, t, J=7.4Hz) Mass(EI) 516(M ⁺ +1)

Example 41: (±) 3-(4-{[(2E)-2-[3-(4-chlorophenyl)-l,2,4-oxadiazole-5-yl]-2- (propoxyimino)ethyl] oxy }phenyl)-2-ethoxypropionic acid

7.1 mg (yield: 94%) of the title compound was obtained from (+) 3-(4-{[(2E)-2- [3-(4-chlorophenyl)-l,2,4-oxadiazole-5-yl]-2-(propoxyimino)e thyl]oxy}phenyl)-2- ethoxypropionic acid ethyl ether (8.0 mg, 0.016 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.06~8.04(2H, m), 7.46~7.44(2H, m), 7.17~7.15(2H, m), 6.91~6.89(2H, m), 5.22(2H, s), 4.39(2H, t, J=6.7Hz), 4.05~4.03(lH, m), 3.6O~3.55(1H, m), 3.49~3.43(1H, m), 3.08(1H, abx, J=14, 4.3Hz), 2.95(1H, abx, J=14, 7.4Hz), 1.84-1.78(2H, m), 1.16(3H, t, J=7.4Hz), 0.99(3H, t, J=7.4Hz) Mass(EI) 488(M ⁺ +l)

Preparation Example 52: Preparation of (±) 3-(3-{[(2E)-2-[3-(4-chlorophenyl)- l,2,4-oxadiazole-5-yl]-2-(propoxyimino)ethyl]oxy}phenyl)-2-e thoxypropionic acid ethylester 9.0 mg (yield: 65%) of the title compound was obtained from methanesulfonic acid 2-[3-(4-chloro-phenyl)-[l,2,4]oxadiazole-5-yl]-2-propoxyimin o-ethyl ester (10 mg, 0.027 mmol) and (±) 2-ethoxy-3-(3-hydroxyphenyl)propionic acid ethylester (6.4 mg, 0.027 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.07~8.04(2H, m), 7.46~7.44(2H, m), 7.21~7.18(1H, m), 6.89~6.87(2H, m), 6.86~6.83(1H, m), 5.19(2H, s), 4.40(2H, t, J=6.7Hz), 4.19~4.13(2H, m), 4.00~3.97(lH, m), 3.61~3.57(1H, m), 3.35~3.30(lH, m), 2.98~2.96(2H, m), 1.83~1.78(2H, m), 1.21(3H, t, J=8.0Hz), 1.14(3H, t, J=7.3Hz), 0.99(3H, t, J=8.0Hz) Mass(EI) 516(M ⁺ +l)

Example 42: (±) 3-(3-{[(2E)-2-[3-(4-chlorophenyl)-l,2,4-oxadiazole-5-yl]-2- (propoxyimino)ethyl]oxy}phenyl)-2-ethoxypropionic acid

8.0 mg (yield: 94%) of the title compound was obtained from (±) 3-(3-{[(2E)-2- [3-(4-chlorophenyl)-l,2,4-oxadiazole-5-yl]-2-(propoxyimino)e thyl]oxy}phenyl)-2- ethoxypropionic acid ethylester (9.0 mg, 0.017 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.06~8.04(2H, m), 7.46~7.44(2H, m), 7.22~7.19(1H, m), 6.89~6.85(3H, m), 5.20(2H, s), 4.40(2H, t, J=6.7Hz), 4.08~4.05(lH, m), 3.6O~3.54(1H, m), 3.47~3.42(1H, m), 3.11(1H, abx, J=14, 4.3Hz), 2.96(1H, abx, J=I 4, 7.4Hz), 1.84~1.78(2H, m), 1.15(3H, t, J=7.4Hz), 0.99(3H, t, J=7.4Hz) Mass(EI) 488(M ⁺ +l)

Preparation Example 53: Preparation of (lZ)-2-bromo-l-[5-(4-chlorophenyl)-l,3,4- oxadiazole-2-yl] ethanone O-propyloxime

80 mg (yield: 11%) of the title compound was obtained from 4- chlorobenzhydrazide hydrochloride salt (414 mg, 2.0 mmol) in the same manner as in Preparation Example 25.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.10~8.08(2H, m), 7.52~7.50(2H, m), 4.68(2H, s), 4.39(2H, t, J=6Hz), 1.86~1.80(2H, m), 1.03(3H, 8Hz)

Mass(EI) 358, 360(M ⁺ +l)

Preparation Example 54: Preparation of (±) 3-(4-{[(2E)-2-[5-(4-chlorophenyl)- l,3,4-oxadiazole-2-yl]-2-(propoxyimino)ethyl]oxy}phenyl)-2-e thoxypropionic acid ethylester

9.0 mg (yield: 89%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-ethyloxime (7.0 mg, 0.020 mmol) and (+) 2-ethoxy-3-(4-hydoxyphenyl)-propionic acid ethylester (4.7 mg, 0.020 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.10~8.05(2H, m), 7.52~7.49(2H, m), 7.17~7.14(1H, m),

6.92~6.90(3H, m), 5.22(2H, s), 4.36(2H, t, J=6.7Hz), 4.19~4.13(2H, m), 3.96~3.94(1H, m), 3.61~3.57(1H, m), 3.36~3.32(1H, m), 2.96~2.94(2H, m), 1.84~1.78(2H, m),

1.22(3H, t, J=8.0Hz), 1.16(3H, t, J=8.0Hz), 1.00(3H, t, J=8.0Hz) Mass(EI) 516(M ⁺ +l)

Example 43: (±) 3-(4-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazoIe-2-yl]-2- (propoxyimino)ethyl]oxy}phenyl)-2-ethoxypropionic acid

7.0 nig (yield: 82%) of the title compound was obtained from (±) 3-(4-{[(2E)-2- [5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2-(propoxyimino)e thyl]oxy}phenyl)-2- ethoxypropionic acid ethylester (9.0 mg, 0.017 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.07~8.05(2H, m), 7.50~7.48(2H, m), 7.16~7.14(2H, m), 6.93~6.91(2H, m), 5.22(2H, s), 4.35(2H, t, J=6.8Hz), 4.05~4.03(lH, m), 3.6O~3.55(1H, m), 3.48~3.43(1H, m), 3.07(1H, abx, J=14, 4.3Hz), 2.94(1H, abx, J=14, 7.4Hz), 1.84~1.78(2H, m), 1.17(3H, t, J=7.4Hz), 0.99(3H, t, J=7.4Hz) Mass(EI) 488(M ⁺ +l)

Preparation Example 55: Preparation of (±) 3-(3-{[(2E)-2-[5-(4-chlorophenyl)- l,3,4-oxadiazole-2-yl]-2-(propoxyimino)ethyl]oxy}phenyl)-2-e thoxypropionic acid ethylester

8.0 mg (yield: 80%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-ethyloxime (7.0 mg, 0.020 mmol) and (±) 2-ethoxy-3-(3-hydoxyphenyl)-propionic acid ethylester (4.7 mg, 0.020 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.08~8.05(2H, m), 7.51~7.49(2H, m), 7.21~7.17(1H, m), 6.89~6.86(3H, m), 5.22(2H, s), 4.36(2H, t, J=6.7Hz), 4.19~4.14(2H, m), 4.01~3.99(lH,

m), 3.61~3.57(1H, m), 3.36~3.32(1H, m), 2.98~2.96(2H, m), 1.84~1.78(2H, m), 1.22(3H, t, J=8.0Hz), 1.17(3H, t, J=8.0Hz), 1.00(3H, t, J=8.0Hz) Mass(EI) 516(M ⁺ +l)

Example 44: (±) 3-(3-{[(2E)-2-[5-(4-chlorophenyl)-l,3,4-oxadiazole-2-yl]-2- (propoxyimino)ethyl] oxy}phenyl)-2-ethoxypropionic acid

6.0 mg (yield: 79%) of the title compound was obtained from (±) 3-(3-{[(2E)-2- [5-(4-chlorophenyl)- 1 ,3 ,4-oxadiazole-2-yl]-2-(propoxyimino)ethyl]oxy}phenyl)-2- ethoxypropionic acid ethylester (8.0 mg, 0.016 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.07~8.04(2H, m), 7.50~7.48(2H, m), 7.22~7.19(1H, m), 6.89~6.85(3H, m), 5.23(2H, s), 4.36(2H, t, J=6.7Hz), 4.09~4.07(lH, m), 3.6O~3.54(1H, m), 3.47~3.42(1H, m), 3.11(1H, abx, J=14, 4.3Hz), 2.96(1H, abx, J=14, 7.4Hz), 1.84~1.78(2H, m), 1.16(3H, t, J=7.4Hz), 1.00(3H, t, J=7.4Hz) Mass(EI) 488(M ⁺ +l)

Preparation Example 56: Preparation of (lZ)-2-bromo-l-[5-(4-fluorophenyl)-l,3,4- oxadiazole-2-y 1] ethanone O-buty loxime

7 mg (yield: 9.8%) of the title compound was obtained from 4- fluorobenzhydrazide hydrochloride salt (381 mg, 2.0 mmol) in the same manner as in

Preparation Example 25.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.18~8.14(2H, m), 7.24~7.20(2H, m), 4.67(2H, s), 4.43(2H, t,

J=8Hz), 1.82-1.77(2H, m), 1.52~1.46(2H, m), 0.99(3H, 8Hz)

Mass(EI) 356, 358(M ⁺ +l)

Preparation Example 57: Preparation of (±) 3-(4-{[(2E)-2-(butoxyimino)-2-[5-(4- fluorophenyl)-l,3,4-oxadiazole-2-yl]ethyl]oxy}phenyl)-2-etho xypropionic acid ethylester

8.0 mg (yield: 79%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(4-fluorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-butyloxime (7.0 mg, 0.020 mmol) and (±) 2-ethoxy-3-(4-hydroxyphenyl)-propionic acid ethylester (4.7 mg, 0.020 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.13~8.11(2H, m), 7.22~7.18(2H, m), 7.16~7.14(2H, m), 6.91~6.89(2H, m), 5.20(2H, s), 4.39(2H, t, J=6.7Hz), 4.15(2H, q, J=7.4Hz), 3.96~3.95(1H, m), 3.62~3.56(1H, m), 3.37-3.31(1H, m), 2.95~2.92(2H, m), 1.79~1.73(2H, m), 1.47~1.41(2H, m), 1.21(3H, t, J=7.3Hz), 1.15(3H, t, J=7.4Hz), 0.96(3H, t, J=7.4Hz) Mass(EI) 514(M ⁺ +l)

Example 45: (±) 3-(4-{[(2E)-2-(butoxyimino)-2-[5-(4-fluorophenyl)-l,3,4- oxadiazole-2-yl]ethyl]oxy}phenyl)-2-ethoxypropionic acid

6.0 mg (yield: 79%) of the title compound was obtained from (±) 3-(4-{[(2E)-2- (butoxyimino)-2-[5-(4-fluorophenyl)-l,3,4-oxadiazole-2-yl]et hyl]oxy}pheyl)-2- ethoxypropionic acid ethylester (8.0 mg, 0.016 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.11(2H, m), 7.22~7.18(2H, m), 7.16~7.14(2H, m), 6.93~6.91(2H, m), 5.21 (2H, s), 4.40(2H, t, J=6.7Hz), 4.06~4.04(lH, m), 3.6O~3.54(1H, m), 3.49~3.44(1H, m), 3.08(1H, abx, J=I 4, 4.3Hz), 2.95(1H, abx, J=I 4, 7.4Hz), 1.78~1.73(2H, m), 1.49-1.43(2H, m), 1.17(3H, t, J=7.4Hz), 0.97(3H, t, J=7.4Hz)

Mass(EI) 486(M ⁺ +1)

Preparation Example 58: Preparation of (±) 3-(3-{[(2E)-2-(butoxyimino)-2-[5-(4- fluorophenyl)-l,3,4-oxadiazole-2-yl]ethyl]oxy}phenyl)-2-etho xypropionic acid ethylester

7.0 mg (yield: 70%) of the title compound was obtained from (lZ)-2-bromo-l- [5-(4-fluorophenyl)-l,3,4-oxadiazole-2-yl]ethanone O-butyloxime (7.0 mg, 0.020 mmol) and (±) 2-ethoxy-3-(4-hydroxyphenyl)-propionic acid ethylester (4.7 mg, 0.020 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.11(2H, m), 7.11~7.16(3H, m), 6.89~6.86(3H, m), 5.21 (2H, s), 4.40(2H, t, J=6.7Hz), 4.19~4.13(2H, m), 3.99~3.97(1H, m), 3.61~3.55(1H, m), 3.37~3.31(1H, m), 2.97~2.95(2H, m), 1.77~1.73(2H, m), 1.46~1.40(2H, m),

1.21(3H, t, J=7.4Hz), 1.15(3H, t, J=7.4Hz), 0.96(3H, t, J=7.4Hz)

Mass(EI) 514(M ⁺ +l)

Example 46: (+) 3-(3-{[(2E)-2-(butoxyimino)-2-[5-(4-fluorophenyl)-l,3,4- oxadiazole-2-y 1] ethyl] oxy } pheny l)-2-ethoxy propionic acid

6.0 mg (yield: 91%) of the title compound was obtained from 3-(4-{[(2E)-2- (butoxyimino)-2-[5-(4-fluorophenyl)- 1 ,3 ,4-oxadiazole-2-yl] ethyl] oxy }pheyl)-2- ethoxypropionic acid ethylester (7.0 mg, 0.014 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 8.14~8.11(2H, m), 7.22~7.18(3H, m), 6.88~6.86(3H, m), 5.22(2H, s), 4.40(2H, t, J=6.7Hz), 4.09~4.06(lH, m), 3.6O~3.54(1H, m), 3.48~3.44(1H, m), 3.10(1H, abx, J=14, 4.3Hz), 2.96(1H, abx, J=14, 7.4Hz), 1.79~1.73(2H, m), 1.48-1.43(2H, m), 1.16(3H, t, J=7.4Hz), 0.97(3H, t, J=7.4Hz)

Mass(EI) 486(M ⁺ +l)

Preparation Example 59: Preparation of (lZ)-2-bromo-l-[3-(4- fluorophenyl)isooxazole-5-yI] ethanone O-propyloxime (1) Preparation of 2-bromo-l-[3-(4-fluorophenyl)isooxazole-5-yl] ethanone

1 g of the title compound was obtained from 5 g (40 mmol) of 4- fluorobenzaldehyde in the same manner as in Heterocydes, 1993, 35 (2), 591-598 and J. Med. Chem., 1991, 34 (2), 600-605.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.86~7.77(2H, m), 7.32(1H, s), 7.24-7.18(2H, m), 4.48(2H, s)

Mass(EI) 284, 286(M ⁺ +l)

(2) Preparation of (lZ)-2-bromo-l-[3-(4-fluorophenyl)isooxazole-5- yl] ethanone O-propyloxime 100 mg (0.35 mmol) of 2-bromo-l-[3-(4-fluorophenyl)isooxazole-5- yl]ethanone was dissolved in methanol, and 39 mg (0.35 mmol) of propyloxyamine hydrochloride was added thereto. The reaction was stirred at room temperature for 10 hours then purified by column chromatography to obtain 90 mg of the title compound in a yield of 75%. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.86~7.81(2H, m), 7.28~7.14(2H, m), 6.89(1H, s), 4.37(2H, s), 4.31(2H, t, J=8Hz), 1.85-1.76(2H, m), 1.01(3H, t, J=8Hz) Mass(EI) 341, 343(M ⁺ +l)

Preparation Example 60: Preparation of (lZ)-2-bromo-l-[3-(4-

fluorophenyl)isooxazole-5-yI] ethanone O-ethyloxime

82 mg (yield: 14%) of the title compound was obtained from 2-bromo-l-[3-(4- fluorophenyl)isooxazole-5-yl]ethanone (480 mg, 1.68 mmol) in the same manner as in Preparation Example 59-(2). NMR: ¹ H-NMR(CDCl ₃ ) . 7.87~7.80(2H, m), 7.19~7.13(2H, m), 6.89(1 H, s), 4.40(2H, t, J=8Hz), 4.37(2H, s), 1.39(3H, t, J=8Hz) Mass(EI) 327, 329(M ⁺ +1)

Preparation Example 61: Preparation of (±) 2-ethoxy-3-(3-{[(2Z)-2-[3-(4- fluorophenyl)isooxazole-5-yl]-2-(propoxyimino)ethyl]oxy}phen yl)propionic acid ethylester

132 mg (yield: 63%) of the title compound was obtained from (lZ)-2-bromo-l-

[3 -(4-fluorophenyl)isooxazole-5-yl] ethanone O-propyloxime (145 mg, 0.42 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.82~7.79(2H, m), 7.26~7.12(3H, m), 6.93(1H, s),

6.89~6.83(3H, m), 5.15(2H, s), 4.33(2H, t, J=4Hz), 4.16(2H, q, J=8Hz), 4.01~3.97(lH, m), 3.61~3.57(1H, m), 3.35~3.31(1H, m), 2.97(2H, d, J=4Hz), 1.84~1.78(2H, m),

1.24(3H, t, J=8Hz), 1.14(3H, t, J=8Hz), 1.12(3H, t, J=8Hz)

Mass(EI) 499(M ⁺ + 1)

Example 47: (±) 2-ethoxy-3-(3-{[(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2 -

(propoxyimino)ethyl] oxy}phenyl)propionic acid

51 mg (yield: 41%) of the title compound was obtained from (±) 2-ethoxy-3-(3-

{[(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2-

(propoxyimino)ethyl]oxy}phenyl)propionic acid ethylester (132 mg, 0.26 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.84~7.78(2H, m), 7.23~7.12(3H, m), 6.92(1H, s), 6.89~6.84(3H, m), 5.19(2H, s), 4.32(2H, t, J=6.4Hz), 4.08~4.05(lH, m), 3.61~3.53(1H, m), 3.46~3.38(1H, m), 3.13~3.O9(1H, m), 2.99~2.94(1H, m), 1.85-1.76(2H, m), 1.15(3H, t, J=7.2Hz), 1.00(3H, t, J=7.6Hz) Mass(EI) 471(M ⁺ +l)

Preparation Example 62: Preparation of (±) 2-ethoxy-3-(3-{[(2Z)-2-[3-(4- fluorophenyl)isooxazole-5-yl]-2-(ethoxyimino)ethyl]oxy}pheny l)propionic acid ethylester

46 mg (yield: 86%) of the title compound was obtained from 2-bromo-l-[5- methyl-2-(4-fluorophenyl)oxazole-4-yl]-ethanone O-ethyloxime (39 mg, 0.11 mmol) and (±) 2-ethoxy-3-(3-hydroxyphenyl)propionic acid ethylester (28 mg, 0.11 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.83~7.79(2H, m), 7.26(1H, s), 7.23~7.12(2H, m), 6.94(1H, s), 6.89~6.82(3H, m), 5.15(2H, s), 4.41(2H, q, J=8Hz), 4.16(2H, q, J=8Hz), 4.01~3.97(lH, m), 3.61~3.56(1H, m), 3.37~3.29(1H, m), 2.97(2H, d, J=4Hz), 1.40(3H, t, J=8Hz), 1.24(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 485(M ⁺ +1)

Example 48: (±) 2-ethoxy-3-(3-{[(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yI]-2 - (ethoxyimino)ethyl]oxy}phenyl)propionic acid

39 mg (yield: 95%) of the title compound was obtained from (±) 2-ethoxy-3-(3- { [(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2-

(ethoxyimino)ethyl]oxy}phenyl)propionic acid ethylester (46 mg, 0.09 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.82~7.79(2H, m), 7.23-7.12(3H, m), 6.93(1H, s), 6.90~6.84(3H, m), 5.16(2H, s), 4.42(2H, q, J=8Hz), 4.09~4.06(lH, m), 3.6O~3.56(1H, m), 3.46~3.38(1H, m), 3.13~3.O9(1H, m), 2.98~2.94(1H, m), 1.42(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 457(M ⁺ +l)

Preparation Example 63: Preparation of (±) 2-ethoxy-3-(4-{[(2Z)-2-[3-(4- fluorophenyl)isooxazole-S-yl]-2-(ethoxyimino)ethyl]oxy}pheny l)propionic acid ethylester

20 mg (yield: 68%) of the title compound was obtained from 2-bromo-l-[5- methyl-2-(4-fluorophenyl)oxazole-4-yl]-ethanone O-ethyloxime (20 mg, 0.06 mmol) and (±) 2-ethoxy-3-(4-hydroxyphenyl)propionic acid ethylester (15 mg, 0.06 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.82~7.79(2H, m), 7.27~7.12(3H, m), 6.94(1H, s), 6.89~6.82(3H, m), 5.15(2H, s), 4.41(2H, q, J=8Hz), 4.16(2H, q, J=8Hz), 3.99~3.98(1H, m), 3.61~3.57(1H, m), 3.35~3.31(1H, m), 2.98(2H, d, J=4Hz), 1.40(3H, t, J=8Hz), 1.24(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 485(M ⁺ +1)

Example 49: (±) 2-ethoxy-3-(4-{[(2Z)-2-[3-(4-fiuorophenyl)isooxazole-5-yl]-2 - (ethoxyimino)ethyl] oxy }phenyl)propionic acid

12 mg (yield: 65%) of the title compound was obtained from (±) 2-ethoxy-3-(4- { [(2Z)-2-[3-(4-fluorophenyl)isooxazole-5-yl]-2-

(ethoxyimino)ethyl]oxy}phenyl)propionic acid ethylester (20 mg, 0.04 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.81~7.77(2H, m), 7.18~7.11(4H, m), 6.98(1H, s), 6.95~6.84(2H, m), 5.13(2H, s), 4.38(2H, q, J=8Hz), 4.13~4.OO(1H, m), 3.6O~3.54(1H, m), 3.08~3.03(lH, m), 2.96~2.91(2H, m), 1.40(3H, t, J=8Hz), 1.12(3H, t, J=8Hz) Mass(EI) 457(M ⁺ +1)

Preparation Example 64: Preparation of 2-bromo-l-[4-phenoxyphenyl]ethanone l-[4-phenoxyphenyl]ethanone (500 mg, 2.35 mmol) was dissolved in 10 ml of chloroform and 3 ml of methanol, and 1.16 g (2.40 mmol) of tetrabutylammonium tribromide was slowly added dropwise thereto. After stirring for 9 hours, 50 ml of ethylacetate was added thereto, and the reaction was washed with 5% Na ₂ S ₂ O ₃ solution.

After the washing, an organic layer was dried over anhydrous magnesium sulfate and filtered off to remove solvent, then the residue was purified by column chromatography to obtain 689 mg of the title compound in a yield of 100%.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.98~7.95(2H, m), 7.44~7.40(2H, m), 7.25~7.21(1H, m),

7.10~7.08(2H, m), 7.03~7.00(2H, m), 4.40(2H, s)

Mass(EI) 291, 293(M ⁺ +l)

Preparation Example 65: Preparation of 2-bromo-l-[4-phenoxyphenyl]ethanone O-propyloxime

136 mg (yield: 33%) of the title compound was obtained from 2-bromo-l-[4- phenoxyphenyl]ethanone (340 mg, 1.16 mmol) in the same manner as in Preparation Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.69~7.67(2H, m), 7.38~7.34(2H, m), 7.16~7.12(1H, m),

7.05~7.00(4H, m), 4.33(2H, s), 4.23(2H, t, J=8Hz), 1.82-1.73(2H, m), 1.00(3H, t,

J=8Hz)

Mass(EI) 348, 350(M ⁺ +l)

Preparation Example 66: Preparation of 2-bromo-l-[4-phenoxyphenyl]ethanone O-ethyloxime

179 tng (yield: 46%) of the title compound was obtained from 2-bromo-l-[4- phenoxyphenyljethanone (340 mg, 1.16 mmol) in the same manner as in Preparation Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.69~7.67(2H, m), 7.38~7.34(2H, m), 7.16-7.12(1H, m), 7.05~7.00(4H, m), 4.36(2H, s), 4.30(2H, q, J=8Hz), 1.35(3H, t, J=8Hz) Mass(EI) 334, 336(M ⁺ +1)

Preparation Example 67: Preparation of (±) 2-ethoxy-3-(4-{[(2Z)-2-(4- phenoxyphenyl)-2(propoxyimino)ethyl]oxy}phenyl)propionic acid ethylester

20 mg (yield: 69%) of the title compound was obtained from 2-bromo-l-[4- phenoxyphenyljethanone O-propyloxime (20 mg, 0.057 mmol) and (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid ethylester (13.7 mg, 0.057 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.63(2H, m), 7.35~7.31(2H, m), 7.13~7.11(3H, m), 7.02~6.94(4H, m), 6.86~6.82(2H, m), 5.18(2H, s), 4.19(2H, t, J=8Hz), 4.14(2H, q, J=8Hz), 3.96~3.93(1H, m), 3.62~3.55(1H, m), 3.37~3.29(1H, m), 2.93(2H, d, J=8Hz), 1.81-1.72(2H, m), 1.20(3H, t, J=8Hz), 1.15(3H, t, J=8Hz), 0.99(3H, t, J=8Hz)

Mass(EI) 506(M ⁺ +l)

Example 50: (±) 2-ethoxy-3-(4-{[(2Z)-2-(4-phenoxyphenyl)-

2(propoxyimino)ethyl]oxy}phenyl)propionic acid

14 mg (yield: 75%) of the title compound was obtained from (+) 2-ethoxy-3-(4- { [(2Z)-2-(4-phenoxyphenyl)-2(propoxyimino)ethyl] oxy } phenyl)propionic acid ethylester ( 20 mg, 0.039 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.65~7.63(2H, m), 7.35~7.31(2H, m), 7.14~7.09(3H, m), 7.01~6.93(4H, m), 6.89~6.83(2H, m), 5.18(2H, s), 4.20(2H, t, J=8Hz), 4.04~4.01(lH, m), 3.62~3.54(1H, m), 3.45~3.4O(1H, m), 3.08~3.03(lH, m), 2.95~2.9O(1H, m), 1.81-1.72(2H, m), 1.18(3H, t, J=8Hz), 0.99(3H, t, J=8Hz) Mass(EI) 478(M ⁺ +l)

Preparation Example 68: Preparation of (±) 2-ethoxy-3-(3-{[(2Z)-2-(4- phenoxypheny l)-2(propoxyimino)ethyl] oxy}phenyl)propionic acid ethylester

28 mg (yield: 97%) of the title compound was obtained from 2-bromo-l-[4- phenoxyphenyljethanone O-propyloxime (20 mg, 0.057 mmol) and (±) 2-ethoxy-3-(3- hydroxyphenyl)propionic acid ethylester (13.7 mg, 0.057 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.64(2H, m), 7.35-7.31(2H, m), 7.18~7.09(2H, m),

7.02~6.93(4H, m), 6.84~6.78(3H, m), 5.18(2H, s), 4.20(2H, t, J=8Hz), 4.14(2H, q, J=8Hz), 3.98~3.96(1H, m), 3.61~3.57(1H, m), 3.35~3.31(1H, m), 2.95(2H, d, J=4Hz),

1.85~1.75(2H, m), 1.21(3H, t, J=8Hz), 1.14(3H, t, J=8Hz), 1.00(3H, t, J=8Hz)

Mass(EI) 506(M ⁺ +l)

Example 51: (±) 2-ethoxy-3-(3-{[(2Z)-2-(4-phenoxyphenyl)-

2(propoxyimino)ethyl] oxy }phenyl)propionic acid

6.6 mg (yield: 25%) of the title compound was obtained from (±) 2-ethoxy-3- (3- { [(2Z)-2-(4-phenoxyphenyl)-2(propoxyimino)ethyl]oxy}phenyl)pr opionic acid ethylester (28 mg, 0.055 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.65~7.63(2H, m), 7.34-7.31(2H, m), 7.17~7.11(2H, m), 7.01~6.94(4H, m), 6.84~6.80(3H, m), 5.18(2H, s), 4.19(2H, t, J=6.5Hz), 4.05~4.03(lH, m), 3.56~3.54(1H, m), 3.4O~3.36(1H, m), 3.1O~3.O6(1H, m), 2.95~2.92(1H, m), 1.85-1.75(2H, m), 1.13(3H, t, J=6.5Hz), 0.99(3H, t, J=7Hz)

Mass(EI) 478(M ⁺ +1)

Preparation Example 69: Preparation of (±) 2-ethoxy-3-(4-{[(2Z)-2-(4- phenoxyphenyl)-2(ethoxyimino)ethyl] oxy}phenyl)propionic acid ethylester

24 mg of the title compound was obtained from 2-bromo-l-[4- phenoxyphenyljethanone O-ethyloxime (20 mg, 0.059 mmol) and (±) 2-ethoxy-3-(4- hydroxyphenyl)propionic acid ethylester (14.3 mg, 0.060 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.64(2H, m), 7.35-7.31(2H, m), 7.13~7.09(3H, m), 7.02~6.93(4H, m), 6.84-6.81(2H, m), 5.17(2H, s), 4.29(2H, q, J=8Hz), 4.15(2H, q, J=8Hz), 3.95~3.94(1H, m), 3.63~3.57(1H, m), 3.37~3.30(lH, m), 2.93(2H, d, J=8Hz), 1.34(3H, t, J=8Hz), 1.20(3H, t, J=8Hz), 1.15(3H, t, J=8Hz) Mass(EI) 492(M ⁺ +l)

Example 52: (+) 2-ethoxy-3-(4-{[(2Z)-2-(4-phenoxyphenyl)-

2(ethoxyimino)ethyl]oxy}phenyl)propionic acid 16 mg (yield: 71%) of the title compound was obtained from (+) 2-ethoxy-3-(4-

{ [(2Z)-2-(4-phenoxyphenyl)-2(ethoxyimino)ethyl]oxy}phenyl)pro pionic acid ethylester (24 mg, 0.048 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.65~7.62(2H, m), 7.35-7.31(2H, m), 7.15~7.09(3H, m), 7.02~6.93(4H, m), 6.83(2H, d, J=8.8Hz), 5.16(2H, s), 4.28(2H, q, J=8Hz), 4.01~3.98(lH, m), 3.61~3.53(1H, m), 3.42~3.35(1H, m), 3.06~3.01(lH, m), 2.94~2.89(1H, m), 1.34(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 464(M ⁺ +1)

Preparation Example 70: Preparation of (±) 2-ethoxy-3-(3-{[(2Z)-2-(4- phenoxyphenyl)-2(ethoxyimino)ethyl]oxy}phenyl)propionic acid ethylester

24 mg (yield: 82%) of the title compound was obtained from 2-bromo-l-[4- phenoxyphenyljethanone O-ethyloxime (20 mg, 0.059 mmol) and (±) 2-ethoxy-3-(3- hydroxyphenyl)propionic acid ethylester (14.3 mg, 0.060 mmol) in the same manner as in Preparation Example 3. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.64(2H, m), 7.36-7.31(2H, m), 7.17~7.09(2H, m),

7.02-6.94(4H, m), 6.84~6.77(3H, m), 5.18(2H, s), 4.30(2H, q, J=8Hz), 4.16(2H, q,

J=8Hz), 4.00~3.96(lH, m), 3.61~3.55(1H, m), 3.37~3.29(1H, m), 2.95(2H, d, J=4Hz),

1.36(3H, t, J=8Hz), 1.21(3H, t, J=8Hz), 1.14(3H, t, J=8Hz)

Mass(EI) 492(M ⁺ +l)

Example 53: (±) 2-ethoxy-3-(3-{[(2Z)-2-(4-phenoxyphenyl)-

2(ethoxyimino)ethyl]oxy}phenyl)propionic acid

13 mg (yield: 70%) of the title compound was obtained from (±) 2-ethoxy-3-(3-

{ [(2Z)-2-(4-phenoxyphenyl)-2(ethoxyimino)ethyl]oxy}phenyl)pro pionic acid ethylester

(20 mg, 0.04 mmol) in the same manner as in Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.66~7.64(2H, m), 7.36~7.32(2H, m), 7.18~7.12(2H, m), 7.02~6.94(4H, m), 6.85~6.80(3H, m), 5.19(2H, s), 4.32(2H, q, J=8Hz), 4.06~4.03(lH, m), 3.6O~3.54(1H, m), 3.43~3.37(1H, m), 3.11~3.O6(1H, m), 2.97~2.91(1H, m), 1.34(3H, t, J=8Hz), 1.14(3H, t, J=8Hz) Mass(EI) 464(M ⁺ +1)

Preparation Example 71: Preparation of 2-bromo-l-[2-phenyl-l,3-thiazole-4- yljethanone Phenylthioamide (680 mg, 4.95 mmol) and l,4-dibromo-2,3-butanedione (1.2 g,

4.92 mmol) were heated in 10 ml of dioxane for 2 hours. After the heating, solvent was distilled off, then the residue was purified by column chromatography to give 610 mg (yield: 43%) of the title compound. NMR: ¹ H-NMR(CDCl ₃ ) δ 8.04(1H, s), 8.01~7.91(2H, m), 7.52~7.46(3H, m), 4.57(2H, s)

Mass(EI) 282, 284(M ⁺ +1)

Preparation Example 72: Preparation of 2-bromo-l-[2-phenyl-l,3-thiazole-4- yljethanone O-propyloxime 430 mg (yield: 63%) of the title compound was obtained from 2-bromo-l-[2- phenyl-l,3-thiazole-4-yl]ethanone (564 mg, 1.99 mmol) in the same manner as in

Preparation Example 1.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.98~7.97(2H, m), 7.67(1H, s), 7.44~7.42(3H, m), 4.60(2H, s), 4.25(2H, t, J=6.5Hz), 1.80-1.77(2H, m), 1.01(3H, t, J=7Hz) Mass(EI) 339, 341(M ⁺ +1)

Preparation Example 73: Preparation of (±) 2-ethoxy-3-(4-{[(2Z)-2-(2-phenyl-l,3- thiazole-4-yI)-2-(propoxyimino)ethyI] oxy}phenyl)propionic acid methylester

5 mg (yield: 38%) of the title compound was obtained from 2-bromo-l-[2- phenyl- l,3-thiazole-4-yl]ethanone O-propyloxime (8 mg, 0.023 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.95~7.93(2H, m), 7.66(1H, s), 7.42~7.39(3H, m), 7.12(2H, d, J=9.5Hz), 6.90(2H, d, J=8.5Hz), 5.27(2H, s), 4.26(2H, t, J=6.5Hz), 4.14(2H, q, J=7.5Hz), 3.96~3.93(1H, m), 3.59~3.56(1H, m), 3.34-3.31(1H, m), 2.93(2H, d, J=7Hz), 1.82-1.72(2H, m), 1.20(3H, t, J=6.5Hz), 1.14(3H, t, J=6.5Hz), 0.99(3H, t, J=7Hz) Mass(EI) 497(M ⁺ +l)

Example 54: (±) 2-ethoxy-3-(4-{[(2Z)-2-(2-phenyl-l,3-thiazole-4-yl)-2- (propoxyimino)ethyl]oxy}phenyl)propionic acid 4.5 mg (yield: 95%) of the title compound was obtained from (±) 2-ethoxy-3-

(4-{[(2Z)-2-(2-phenyl-l,3-thiazole-4-yl)-2-(propoxyimino) ethyl]oxy}phenyl)propionic acid methylester (5 mg, 0.01 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.95~7.93(2H, m), 7.66(1H, s), 7.42~7.39(3H, m), 7.12(2H, d, J=8.5Hz), 6.91(2H, d, J=8.5Hz), 5.27(2H, s), 4.25(2H, t, J=6.5Hz), 4.03~4.01(lH, m), 3.58~3.54(1H, m), 3.45~3.41(1H, m), 3.08~3.04(lH, m), 2.94~2.9O(1H, m), 1.82-1.72(2H, m), 1.16(3H, t, J=7Hz), 0.99(3H, t, J=7Hz) Mass(EI) 469(M ⁺ +1)

Preparation Example 74: Preparation of (±) 2-ethoxy-3-(3-{[(2Z)-2-(2-phenyl-l,3-

thiazole-4-yl)-2-(propoxyimino)ethyl]oxy}phenyl)propionic acid methylester

10 mg (yield: 87%) of the title compound was obtained from 2-bromo-l-[2- phenyl-l,3-thiazole-4-yl]ethanone O-propyloxime (8 mg, 0.023 mmol) and (+) 2- ethoxy-3-(3-hydroxyphenyl)propionic acid ethylester (12 mg, 0.036 mmol) in the same manner as in Preparation Example 3.

NMR: ¹ H-NMR(CDCl ₃ ) δ 7.95~7.93(2H, m), 7.67(1H, s), 7.41~7.40(3H, m), 7.18~7.15(1H, m), 6.88~6.83(3H, m), 5.27(2H, s), 4.26(2H, t, J=6.5Hz), 4.14(2H, q, J=6.5Hz), 3.98~3.96(1H, m), 3.6O~3.54(1H, m), 3.34~3.3O(1H, m), 2.95(2H, d, J=6Hz), 1.78-1.75(2H, m), 1.19(3H, t, J=7.5Hz), 1.13(3H, t, J=7.5Hz), 0.99(3H, t, J=7.5Hz) Mass(EI) 497(M ⁺ +l)

Example 55: (±) 2-ethoxy-3-(3-{[(2Z)-2-(2-phenyl-l,3-thiazole-4-yl)-2- (propoxyimino)ethyl]oxy}phenyl)propionic acid

7 mg (yield: 74%) of the title compound was obtained from (+) 2-ethoxy-3-(3- {[(2Z)-2-(2-phenyl-l,3-thiazole-4-yl)-2-(propoxyimino)ethyl] oxy}phenyl)propionic acid methylester (10 mg, 0.02 mmol) in the same manner as in Example 1. NMR: ¹ H-NMR(CDCl ₃ ) δ 7.93~7.92(2H, m), 7.67(1H, s), 7.42~7.39(3H, m), 7.19~7.16(1H, m), 6.87~6.83(3H, m), 5.27(2H, dd, J=12.5Hz, 8,5Hz), 4.27(2H, t, J=6.5Hz), 4.03~4.01(lH, m), 3.55~3.52(1H, m), 3.4O~3.37(1H, m), 3.09~3.06(lH, m), 2.95~2.91(1H, m), 1.81~1.75(2H, m), 1.12(3H, t, J=7Hz), 0.99(3H, t, J=7Hz) Mass(EI) 469(M ⁺ +l)

Example 56: Construction of reporter vector containing lucif erase structural gene in GAL4 transcription gene sequence

A GAL4 response sequence containing 8 repeats of the basic subunit (UAS), containing an MIuI site at the 5' end and HindIII site at 3' end, as follows: 5'- GTGCAGGTGCCAGAACATTT CTCTATCGAT AGG

TA(CTCGGAGGACAGTACTCCG) TA(CTCGGAGGACAGTACTCCG) TA(CTCGGAGGACAGTACTCCG) TA(CTCGGAGGACAGTACTCCG)

TA(CCTCGGAGGACAGTACTCCG)

(CTCGGAGGACAGTACTCCG)(CTCGGAGGACAGTACTCCG)(CTCGGAGGACA GTACTCCG) TA CCGTCGACTT TAGAGGGTAT AT-3' (parentheses indicatethe basic subunit UAS), was synthesized by a DNA synthesizer and then subcloned into the multiple cloning site of pGL3-Basic vector (Promega, Cat. No. E1751). As a result, pGL3-GAL4 vector containing 8xUAS, followed by luciferase structural gene, was constructed.

Example 57: Construction of vector expressing fusion protein of GAL4 and ligand- binding domain of PPAR protein

A vector, expressing a protein in which the DNA-binding domain of GAL4 is fused with the ligand-binding domain of PPAR under control of SV40 promoter, was constructed using pZeoSV (Invitrogen, Cat. No. V85001) being a mammalian cell expression vector as a basic vector.

(1) Amplification of cDNA encoding DNA-binding domain of GAL4 transcription factor, and insertion thereof into expression vector.

To amplify the DNA-binding domain of GAL4 protein, a basal transcription activator in yeast, the following primer was synthesized using a DNA synthesizer:

primer GAL4-HIII (5'-GC AAGCTT GAAGCAAGCCTCCTGAAAG ATG AAG CTA CTG TCT TCT ATC GAA C-3') contains the sequence encoding amino acids 1 to 8 of the N-terminal of the GAL4 DNA-binding domain, and also the restriction enzyme HindIII recognition domain. Another primer GAL4-KI (5'-AA GGTACC GGT AAA TTC CGG CGA TAC AGT CAA CTG TCT TTG A-3 ¹ ) contains the sequence encoding amino acids 141 to 147 of the C-terminal of the DNA-binding domain of GAL4, and also the restriction enzyme Kpnl recognition domain. 2 μg of the primer GAL4-HIII and 2 μg of the primer GAL4-KI were added into a reaction tube, then 10 ng of plasmid pGBT9 (Clonetech, Cat. No. K1605-A) as a template, and 10 μl of 10 x polymerization buffer (50 mM KCl, 100 mM Tris-HCl, pH 9.0, 1% Triton X-100, 2.5 mM MgCl ₂ ), 10 μl of 2 mM dNTP (2 mM dGTP, 2 mM dATP, 2 mM dCTP and 2 mM dTTP), 2.5 units of Taq polymerase, and distilled water were further added to a total volume of 100 μl, and PCR was carried out for 25 cycles with denaturation at 95°C for 40 seconds, annealing at 55 ⁰ C for 30 seconds, and polymerization at 72°C for 1 minute. When the PCR product was separated in 2% agarose gel, it was confirmed that a sequence of about 488 base pairs was amplified, then the product was seperated and purified from the agarose gel. The DNA fragment thus seperated and purified (hereinafter, referred to as 'fragment GAL4-H/K') was fully restricted with HindIII and Kpnl in NEB buffer 2 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgC12, 1 mM dithiothreitol (pH 7.9)), and extracted with phenol/chloroform, then eluted with 20 μl of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) solution.

Meanwhile, 2 μg of plasmid pZeoSV was fully restricted with restriction enzymes HindIII and Kpnl in NEB buffer 2, and a nucleic acid fragment of about 3.5 kb was seperated and purified in 1% agarose gel. Hereinafter this fragment is referred to as

"fragment pZeoSV-H/K".

100 ng of the fragment GAL4-H/K obtained above and 100 ng of the fragment pZeoSV-H/K obtained above were added into a ligation reaction tube, then 2 μl of 10 x ligation reaction solution (50 mM Tris-HCl(pH 7.8), 10 mM MgCl ₂ , 10 mM dithiothreitol, 1 mM ATP, 25 μg /ml BSA) and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 ml, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain plasmid pZeo-GAL containing the DNA- binding domain of GAL4 (refer to Fig. 1).

(2) Preparation of DNA fragment encoding human PPARγ ligand-binding domain and construction of expression vector of GAL4 - Human PPARγ chimeric receptor protein

The below primers were synthesized from the gene sequence data of human PPARγ gene (Genebank NM_015869). Primer GLBD-f (5'-GG GGTACC TCT CAT AAT GCC ATC AGG TTT GGG CGG ATG C -3') contains the sequence encoding from Ser ¹⁷⁶ to Met ¹⁸⁵ of human PPARγ gene and also the restriction enzyme Kpnl - recognition domain. Primer GLBD-r (5'-CC ACGCGT CTA GTA CAA GTC CTT GTA GAT CTC C -3') contains the sequence encoding from GIu ⁴⁷² to Tyr ⁴⁷⁸ of human PPARγ gene and the termination codon, allowing the termination of translation at the 478 ^th amino acid, and also the restriction enzyme MIuI - recognition domain. A DNA fragment encoding from Ser ¹⁷⁶ to Tyr ⁴⁷⁸ containing the human PPARγ ligand-binding domain was amplified by PCR using the above described primer and also using the full- length cDNA of human PPARγ, isolated from human liver cDNA library, as a template.

When the PCR product was separated in 1% agarose gel, it was confirmed that a DNA fragment of about 900 base pairs was amplified, then the product was seperated and purified from the agarose gel. The fragment thus seperated and purified (hereinafter, referred to as 'fragment GLBD-K/M') was fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and extracted with phenol/chloroform, then eluted with 20 μl of TE solution.

Meanwhile, 2 μg of plasmid pZeo-GAL obtained above was fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and a nucleic acid fragment of 4.0 kb was seperated and purified in 1% agarose gel. Hereinafter this fragment is referred to as "fragment pZeoGAL-K/M".

100 ng of the fragment GLBD-K/M obtained above and 100 ng of the fragment pZeoGAL-K/M obtained above were added into a ligation reaction tube, then 2 μl of 1OX ligation reaction solution and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 μl, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain the expression vector as desired in which the DNA fragment encoding human PPARγ ligand-binding domain is inserted into DNA encoding the GAL4 DNA-binding domain of pZeoGAL (hereinafter, referred to as "pZeo-GAL-

PPARγLBD").

(3) Preparation of DNA fragment encoding human PPARα ligand-binding domain and construction of expression vector of GAL4-human PPARα chimeric receptor protein

The below primers were synthesized from the gene sequence information of

human PPARα gene. Primer ALBD-f (5'-GG GGTACC TCA CAC AAC GCG ATT CGT T-3') contains the sequence encoding from Ser ¹⁶⁷ to Arg ¹⁷⁵ of human PPARα and also the restriction enzyme Kpnl - recognition domain. Primer ALBD-r (5'-CC ACGCGT TCA GTA CAT GTC CCT GTA GAT CTC CTG C-3 ¹ ) contains the sequence encoding from GIn ⁴⁶¹ to Tyr ⁴⁶⁸ including the human PPARα ligand-binding domain and the termination codon, allowing the termination of translation at the 468 ^th amino acid, and also the restriction enzyme MIuI - recognition domain. A DNA fragment, encoding from Ser ¹⁶⁷ to Tyr ⁴⁶⁸ containing the human PPARα ligand-binding domain, was amplified by PCR using the above described primer and also using the full length cDNA of human PPARα, isolated from human liver cDNA library, as a template. When the PCR product was separated in 1% agarose gel, it was confirmed that a DNA fragment of about 900 base pairs was amplified, then the product was seperated and purified from the agarose gel. The nucleic acids thus seperated and purified (hereinafter, referred to as 'fragment ALBD-K/M') were fully restricted with restriction enzymes Kpnl and MIuI in NEB buffer 2, and extracted with phenol/chloroform, then eluted with 20 μl of TE solution.

100 ng of the fragment ALBD-K/M obtained above and 100 ng of the fragment pZeoGAL-K/M obtained above were added into a ligation reaction tube, then 2 μl of 1OX ligation reaction solution and 10 units of T4 DNA ligase were added thereto, then distilled water was added to a total volume of 20 μl, followed by incubation for 12 hours. After completion of the reaction, the product was transformed into E.coli HBlOl (ATCC 33694) to obtain the expression vector as desired in which the DNA fragment encoding human PPARα ligand-binding domain is inserted into DNA encoding the GAL4 DNA-binding domain of pZeoGAL (hereinafter, referred to as "pZeo-GAL-

PPARaLBD").

Example 58: Transformation

CV-I cells derived from monkey kidney were aliquoted into each well of 24- well plate at a density of 6.OxIO ⁴ per/well, suspended in DMEM medium (Life Technologies Inc) supplemented with 10% FBS, and cultured for 24 hours at 37°C in 5% CO ₂ atmosphere. After culturing, the growth medium was replaced with 200 μl of OptiMEM™ medium (Life Technologies Inc) and the cells were used for transformation. The amount of DNA was 480 ng of pGL3-GAL4, 48 ng of pZeo-GAL-PPARγLBD or pZeo-GAL-PPARαLBD and 128 ng of pCHllO (Amersham, Cat.No. 27-4508-01) per well. 29 μl of DNA was suspended in OptiMEM™ medium, and 1 μl of PLUS reagent (Invitrogen) was added thereto and stirred, followed by incubation for 15 minutes at room temperature. To a mixture of DNA and PLUS reagent, 1 μl of LIPOFECTAMINE (Invitrogen) diluted with OptiMEM™ medium was added and stirred, followed by incubation for 15 minutes at room temperature. A solution containing the complex of DNA and LIPOFECTAMINE thus prepared was added dropwise to CV-I cells being cultured in 24-well plate and then gently stirred, followed by culturing for 3 hours at 37°C in 5% CO ₂ atmosphere. After the culturing, 260 μl of DMEM™ medium supplemented with 20% FBS was added to each well and cultured at 37°C in 5% CO ₂ atmosphere for 24 hours, and the resulting culture was used for analysis.

Example 59: Determination of accelerating activity for human PPARα or PPARγ (1) Measurement of degree of expression of Luciferase

The growth medium was removed from the transformed cells of Experimental

Example 39, and the compounds of Examples 1 to 55 were suspended in DMSO and added in DMEM medium supplemented with 5% FBS, then the resulting mixture was added to each well, followed by culturing at 37 ⁰ C in 5% CO ₂ atmosphere for 24 hours. After the culturing, the culture media was removed and cells were washed twice with PBS (Life Technologies Inc). To each well, 100 μl of Passive Lysis Buffer (PLB) solution (Promega Corporation) was added and then gently stirred for 20 minutes at room temperature. 20 μl of cell lysate taken from each well was removed to a Costar 96-well Luminometer and luciferase activity was determined using Luciferase Assay System™ kit (Promega Corporation) following the instructions of the manufacturer.

(2) Measurement of β-galactosidase activity

20 μl of cell lysate as obtained above was moved to 96-well plate (Falcon,

Cat.No. 353911) and added with 100 μl of ONPG (O-nitrophenyl β-galacti-pyranoside) solution to each well, followed by incubation at 37°C for 2 hours. Then, 50 μl of 1 M sodium carbonate (Na ₂ COs) was added to each well and the absorbance was measured at 415 nm by a spectrophotometer.

(3) Degree of activity of ligand

The efficacy of transformation in cell lysis buffer was represented by the activity of beta-galactosidase measured in the above, and the comparative activity of luciferase was measured, thereby comparing the degree of the activity of each compound. The experimental results were expressed as an increasing multiple on the basis of the value of the control, in which only 5% DMSO without compound was added. On the basis of this, EC _5O being the efficacy of the compounds obtained in

Examples 1 to 55, was presented in Table 1 and 2 below. EC _5O (Effective concentration fifty) expresses the concentration of a compound which shows 50% of the maximum possible response of the compound. TABLE 1

TABLE 2

As seen in the above table 1 and 2, it is clear that the compound of Formula 1

according to the present invention is very effective for accelerating the activity of PPARγ and PPARα. Accordingly, the compound according to the present invention can be used as a drug for treatment or prevention of diseases involving human PPARα and PPARγ, for example, diabetes mellitus, complications associated with diabetes mellitus, inflammation, etc.

Other embodiments and uses of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with the scope of particular embodiments of the invention indicated by the following claims.