NEW BACTERIUM FOR PRODUCTION OF CHEMICALS AND RECOMBINANTS

THEREOF

CROSS-REFERENCE

[0001] This application claims the benefit of U.S. Provisional Application No. 61/327,051, filed April 22, 2010, which application is incorporated herein by reference in its entirety.

REFERENCE TO A SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on April 22, 2011, is named 37836726.txt and is 7.953 kB in size.

BACKGROUND

[0003] Increasing cost of petroleum-based transportation fuels, dwindling petroleum reserves and concerns over the environmental impact of petroleum-fuel combustion are driving a strong demand for viable alternatives to replace petroleum-based fuels. In particular, recent years have highlighted the promise of producing biofuels through bio-conversion of a variety of pretreated biomass material, such as lignocellulosic material, starch, or agriculture waste/byproducts, in combination with enzymes and yeast/bacterial systems. A particular challenge is developing technology with the potential to economically convert polysaccharide containing materials such as woody or non- woody plant material, as well as waste materials and side products from the processing of plant matter into high value transportation fuels and other energy forms or chemical feedstocks. Various examples of these polysaccharide containing materials include cellulosic, lignocellulosic, and hemicellulosic material; pectin containing material; starch; wood; corn stover; switchgrass; paper; and paper pulp sludge.

[0004] Ethanol fermentation from biomass including cellulosic, lignocellulosic, pectin, polyglucose and/or polyfructose containing biomass can provide much needed solutions for the world energy problem. Species of yeast, fungi and bacteria have been reported to be able to convert cellulosic biomass of its monomeric sugars to ethanol. However, many of these microorganisms grow slowly and/or produce ethanol only to low concentrations. This limitation can be due to a general lack of tolerance to ethanol by the organism, or a feedback inhibition or suppression mechanism present in the organism, or to some other mechanism as well as some combination of these mechanisms. Such ethanol production limitations can, in addition to affecting the ethanol titer, can also affect the ethanol productivity.

[0005] A number of wild type and genetically improved microorganisms have been described for alcohol production by fermentation. Among these are Clostridium phytofermentans,

Thermoanaerobacter ethanolicus, Clostridium thermocellum, Clostridium beijerinickii, Clostridium acetobutylicum, Clostridium tyrobutyricum, Clostridium thermobutyricum, Thermoanaerobacterium saccharolyticum, Thermoanaerobacter thermohydrosulfuricus , and Saccharomyces cerevisiae, Clostridium acetobutylicum, Moorella ssp., Carboxydocella ssp., Zymomonas mobilis, recombinant E. Coli, Klebsiella oxytoca and Clostridium beijerickii as well as other microorganisms. Difficulties in using these or other microorganisms for industrial scale alcohol production can include undesired products and slow fermentation. An organism that can hydrolyze polysaccharides and grow rapidly during the fermentation process while producing ethanol or other desirable products from various feedstocks with high yield and productivity is a highly sought after organism.

[0006] Further, the control of solventogenesis in Clostridium sp. is genetically linked to the control of sporulation (Ravagnani, et al. 2000 Mol. Microbiol. 37:1172-85); Harris, et al. 2002 J. Bact.184:3586- 97 and control of solventogenesis and sporulation can be genetically uncoupled in at least one species, C acetobutylicum (U.S. Patent No. 7,432,090 B2). Sporulation often leads to the termination of solvent production in bacterial fermentations as the cell goes into a dormant state. Therefore, strains of microorganisms that do not sporulate can be useful for increased production of fermentation end products in large-scale continuous fermentations.

SUMMARY

[0007] Provided is an isolated novel Gram-positive Clostridium bacterium, wherein the bacterium is an anaerobic, cellulolytic and xylanolytic mesophile that produces colonies that are beige pigmented, wherein the bacterium can use carbonaceous biomass as a carbon source and can ferment sugars into ethanol, biofuels, and other chemicals. Also provided are recombinant strains of several Clostridium species wherein sporulation is disrupted. Further provided are methods of using the bacterium and strains to degrade organic material and for use in industrial processes.

[0008] In one embodiment, an isolated Clostridium bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In another embodiment, an isolated Clostridium bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Clostridium bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated Clostridium bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13; and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium is deposited under NRRL Accession Numbers NRRL B-50361, NRRL B-50362, or NRRL B-50363.

[0009] In some embodiments, an isolated Clostridium bacterium is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated Clostridium bacterium can hydrolyze hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment cellulosic and/or lignocellulosic material. In another embodiment, an isolated Clostridium bacterium can utilize cellulose or xylose as its sole carbon source.

[0010] Also provided herein is a method of producing a fermentation end-product involving the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 %> identity to SEQ ID NO: 13; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product. In another embodiment, a method of producing a fermentation end- product involves the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product. In another embodiment, a method of producing a fermentation end-product involves the steps of:

contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product. In another embodiment, a method of producing a fermentation end-product involves the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product. In another embodiment, a method of producing a fermentation end-product involves the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises: a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13, and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product. In another embodiment, a method of producing a fermentation end-product involves the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises: a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13, and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%) identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product. In yet another embodiment, a method of producing a fermentation end-product involves the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium is deposited under NRRL Accession Numbers NRRL B-50361, NRRL B-50362, or NRRL B-50363; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the fermentation end-product.

[0011] In some embodiments, an isolated Clostridium bacterium, used in the methods of production disclosed herein, is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated Clostridium bacterium can hydrolyze hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment cellulosic and/or lignocellulosic material. In another embodiment, an isolated Clostridium bacterium can utilize cellulose or xylose as its sole carbon source.

[0012] In some embodiments, a carbonaceous biomass, used in the methods disclosed herein, comprises woody plant matter, non-woody plant matter, cellulosic material, lignocellulosic material, hemicellulosic material, carbohydrates, pectin, starch, inulin, fructans, glucans, corn, corn stover, sugar cane, grasses, switch grass, sorghum, bamboo, distillers grains, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), peels, citrus peels, bagasse, poplar, or algae. [0013] In another embodiment, a carbonaceous biomass contains cellulosic or lignocellulosic materials. In another embodiment, a carbonaceous biomass is pretreated to make the polysaccharides more available to the bacterium. In another embodiment, ac arbonaceous biomass is pretreated by acid, steam explosion, hot water treatment, alkali, catalase, or a detoxifying or chelating agent. In some embodiments, a fermentation end-product is a chemical. In some embodiments, a fermentation end- product is a fuel. In some embodiments, a fermentation end-product is an alcohol. In some

embodiments, a fermentation end product comprises 1,4 diacid (succinic, fumaric or malic), 2,5 furan dicarboxylic acid, 3 hydroxy propionic acid, aspartic acid, aspartate, glucaric acid, glutamic acid, glutamate, malate, itaconic acid, levulinic acid, 3 -hydroxybutyro lactone, glycerol, sorbitol, xylitol/arabinitol, butanediol, an isoprenoid, a terpene, ethanol, propanol, isopropanol, n-butanol, hydrogen, formic acid, lactic acid acetic acid, formate, lactate or acetate. In some embodiments, a fermentation end-product is ethanol.

[0014] Also provided herein are methods for the production of a fermentation end product involving the steps of: culturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13; and, harvesting the fermentation end-product from the medium. In some embodiments, a method of producing a fermentation end-product involves the steps ofculturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13; and, harvesting the fermentation end-product from the medium. In some embodiments, a method of producing a fermentation end-product involves the steps of: culturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment; and, harvesting the fermentation end-product from the medium. In some embodiments, a method of producing a fermentation end-product involves the steps of: culturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment; and, harvesting the fermentation end-product from the medium. In some embodiments, a method of producing a fermentation end-product involves the steps of: culturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises: a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13, and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment; and, harvesting the fermentation end-product from the medium. In some embodiments, a method of producing a fermentation end-product involves the steps of: culturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises: a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13, and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment; and, harvesting the fermentation end-product from the medium. In some embodiments, a method of producing a fermentation end-product involves the steps of: culturing a medium comprising an isolated Clostridium bacterium for a period of time under conditions suitable for production of the fermentation end-product by said isolated Clostridium bacterium, wherein said isolated Clostridium bacterium is deposited under NRRL Accession Numbers NRRL B-50361, NRRL B-50362, or NRRL B-50363; and, harvesting the fermentation end-product from the medium.

[0015] In some embodiments, an isolated Clostridium bacterium, used in the methods of production disclosed herein, is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated Clostridium bacterium can hydrolyze hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment cellulosic and/or lignocellulosic material. In another embodiment, an isolated Clostridium bacterium can utilize cellulose or xylose as its sole carbon source.

[0016] In some embodiments, a carbonaceous biomass, used in the methods disclosed herein, comprises woody plant matter, non-woody plant matter, cellulosic material, lignocellulosic material, hemicellulosic material, carbohydrates, pectin, starch, inulin, fructans, glucans, corn, corn stover, sugar cane, grasses, switch grass, sorghum, bamboo, distillers grains, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), peels, citrus peels, bagasse, poplar, or algae.

[0017] In another embodiment, a carbonaceous biomass contains cellulosic or lignocellulosic materials. In another embodiment, a carbonaceous biomass is pretreated to make the polysaccharides more available to the bacterium. In another embodiment, ac arbonaceous biomass is pretreated by acid, steam explosion, hot water treatment, alkali, catalase, or a detoxifying or chelating agent. In some embodiments, a fermentation end-product is a chemical. In some embodiments, a fermentation end- product is a fuel. In some embodiments, a fermentation end-product is an alcohol. In some

embodiments, a fermentation end product comprises 1 ,4 diacid (succinic, fumaric or malic), 2,5 furan dicarboxylic acid, 3 hydroxy propionic acid, aspartic acid, aspartate, glucaric acid, glutamic acid, glutamate, malate, itaconic acid, levulinic acid, 3 -hydroxybutyro lactone, glycerol, sorbitol, xylitol/arabinitol, butanediol, an isoprenoid, a terpene, ethanol, propanol, isopropanol, n-butanol, hydrogen, formic acid, lactic acid acetic acid, formate, lactate or acetate. In some embodiments, a fermentation end-product is ethanol.

[0018] Also provided herein are methods of producing ethanol, involving the steps of: contacting a carbonaceous biomass with an isolated Clostridium bacterium in a medium, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13; and, incubating the carbonaceous biomass, medium, and Clostridium bacterium for a sufficient amount of time to produce the ethanol. In one embodiment, an isolated Clostridium bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In another embodiment, an isolated Clostridium bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Clostridium bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated

Clostridium bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13; and,one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%) identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium is deposited under NRRL Accession Numbers NRRL B-50361 , NRRL B-50362, or NRRL B-50363. In some embodiments, an isolated Clostridium bacterium is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated Clostridium bacterium can hydrolyze hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment cellulosic and/or lignocellulosic material. In another

embodiment, an isolated Clostridium bacterium can utilize cellulose or xylose as its sole carbon source.

[0019] Also provide herein is a fermentation end-product produced by any of the methods disclosed herein.

[0020] Also disclosed herein is a a system for producing a fermentation end-product involving: a fermentation vessel; a carbonaceous biomass; an isolated Clostridium bacterium, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13; and, a medium. In one embodiment, an isolated Clostridium bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In another embodiment, an isolated Clostridium bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Clostridium bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated Clostridium bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 %> identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13; and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium is deposited under NRRL Accession Numbers NRRL B-50361, NRRL B-50362, or NRRL B-50363. In some embodiments, an isolated Clostridium bacterium is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated Clostridium bacterium can hydrolyze hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated Clostridium bacterium can hydrolyze and ferment cellulosic and/or lignocellulosic material. In another embodiment, an isolated Clostridium bacterium can utilize cellulose or xylose as its sole carbon source. In one embodiment, a fermentation vessel is configured to house said medium and said microorganism, and wherein said carbonaceous biomass comprises a cellulosic and/or lignocellulosic material. In some embodiments, a carbonaceous biomass, used in the methods disclosed herein, comprises woody plant matter, non-woody plant matter, cellulosic material, lignocellulosic material, hemicellulosic material, carbohydrates, pectin, starch, inulin, fructans, glucans, corn, corn stover, sugar cane, grasses, switch grass, sorghum, bamboo, distillers grains, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), peels, citrus peels, bagasse, poplar, or algae. In another embodiment, a carbonaceous biomass contains cellulosic or lignocellulosic materials. In another embodiment, a carbonaceous biomass is pretreated to make the polysaccharides more available to the bacterium. In another embodiment, ac arbonaceous biomass is pretreated by acid, steam explosion, hot water treatment, alkali, catalase, or a detoxifying or chelating agent. In some embodiments, a fermentation end-product is a chemical. In some

embodiments, a fermentation end-product is a fuel. In some embodiments, a fermentation end-product is an alcohol. In some embodiments, a fermentation end product comprises 1 ,4 diacid (succinic, fumaric or malic), 2,5 furan dicarboxylic acid, 3 hydroxy propionic acid, aspartic acid, aspartate, glucaric acid, glutamic acid, glutamate, malate, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, xylitol/arabinitol, butanediol, an isoprenoid, a terpene, ethanol, propanol, isopropanol, n- butanol, hydrogen, formic acid, lactic acid acetic acid, formate, lactate or acetate. In some

embodiments, a fermentation end-product is ethanol.

[0021] Also provided herein is a fuel plant containing a fermentation vessel configured to house a medium and an isolated Clostridium bacterium, wherein said fermentation vessel comprises a cellulosic and/or lignocellulosic material, wherein said isolated Clostridium bacterium comprises a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In some embodiments, a cellulosic and/or lignocellulosic material is pretreated In one embodiment, an isolated Clostridium bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In another embodiment, an isolated Clostridium bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Clostridium bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated

Clostridium bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Clostridium bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90% identity to SEQ ID NO: 13; and,one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%) identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Clostridium bacterium is deposited under NRRL Accession Numbers NRRL B-50361 , NRRL B-50362, or NRRL B-50363.

[0022] Also provided herein is a composition comprising an isolated gram-positive bacterium, wherein the bacterium is an anaerobic, obligate mesophile that produces beige-pigmented colonies, wherein the bacterium can use hexose or pentose sugars as a carbon source and can ferment said sugars into ethanol, organic acids, biofuels and other chemical products. In one embodiment, an isolated Gram-positive bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 %> identity to SEQ ID NO: 13. In another embodiment, an isolated Gram-positive bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Gram-positive bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated Gram-positive bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Gram-positive bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 %> identity to SEQ ID NO: 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Gram-positive bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13; and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Gram-positive bacterium is deposited under NRRL Accession Numbers NRRL B-50361 , NRRL B-50362, or NRRL B-50363. In some embodiments, an isolated Gram- positive bacterium is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, the bacterium is recombinant. In another embodiment, the bacterium can utilize cellulose or xylose as its sole carbon source. In some embodiments, the bacterium produces alcohol dehydrogenase, wherein the alcohol dehydrogenase reduces acetaldehyde into ethanol. In another embodiment, the bacterium produces ethanol at greater than 90% theoretical yield from biomass. In yet another embodiment, the bacterium does not sporulate.

[0023] Also provided herein are methods for growing an isolated gram-positive bacterium, designated Clostridium sp. Q.D, wherein the bacterium is an anaerobic, obligate mesophile that produces beige- pigmented colonies, wherein the bacterium can ferment C5 and C6 carbohydrates into ethanol, organic acids, biofuels and other chemicals, comprising culturing the bacterium at a temperature and in a medium effective to promote growth of the bacterium. In one embodiment, an isolated Gram-positive bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In another embodiment, an isolated Gram-positive bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Gram-positive bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated Gram-positive bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Gram-positive bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Gram-positive bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13; and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1, wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Gram-positive bacterium is deposited under NRRL Accession Numbers NRRL B-50361, NRRL B-50362, or NRRL B-50363. In one embodiment, the temperature is from about 30°C to about 40° C; in another embodiment, the temperature is from about 35°C to about 39°C. In one embodiment, culturing is at a pH from about 6.0 to about 7.5. In another embodiment, the bacterium uses a carbonaceous biomass as a major carbon source.

[0024] Also provided herein is a method of converting an organic material into chemical energy comprising contacting the organic material with an effective amount of a bacterial catalyst comprising an isolated gram-positive bacterium, wherein the bacterium is an anaerobic, obligate mesophile that produces colonies that are beige pigmented, wherein the bacterium can use cellulose or xylose as a sole carbon source and can reduce acetaldehyde into ethanol. In one embodiment, an isolated Gram-positive bacterium (e.g. Clostridium sp. Q.D.) contains a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 99.8 % identity to SEQ ID NO: 13. In another embodiment, an isolated Gram-positive bacterium contains a 16S rRNA nucleotide sequence encoded in part by SEQ ID NO: 13. An isolated Gram-positive bacterium can also contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. An isolated Gram-positive bacterium can contain one or more nucleotide sequences comprising at least 400 nucleotides with at least 90% identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Gram-positive bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13 and one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 %> identity to SEQ ID NO: 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , or 42, wherein said nucleotide sequence encodes for a protein or protein fragment. In yet another embodiment, an isolated Gram-positive bacterium can contain both a 16S rRNA nucleotide sequence encoded in part by a nucleotide sequence with greater than 90%> identity to SEQ ID NO: 13; and, one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%> identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In another embodiment, an isolated Gram-positive bacterium is deposited under NRRL Accession Numbers NRRL B-50361 , NRRL B-50362, or NRRL B-50363.

[0025] Also provided herein is an isolated microorganism comprising one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 %> identity to SEQ ID NO: 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. In one embodiment, an isolated microorganism contains one or more nucleotide sequences comprising at least 400 nucleotides with at least 90%) identity to SEQ ID NO: 1 , wherein said nucleotide sequences encode for a protein or protein fragment. In some embodiments, an isolated microorganism is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated

microorganism can hydrolyze hexose or pentose sugars. In another embodiment, an isolated microorganism can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated microorganism can hydrolyze and ferment cellulosic and/or lignocellulosic material. In another embodiment, an isolated microorganism can utilize cellulose or xylose as its sole carbon source. In one embodiment, an isolated microorganism is a Clostridium bacterium.

[0026] Also provided herein are methods of producing a fermentation end-product, involving the steps of: contacting a carbonaceous biomass with an isolated microorganism in a medium, wherein said isolated microorganism comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment; and, incubating the carbonaceous biomass, medium, and said

microorganism for a sufficient amount of time to produce the fermentation end-product. In some embodiments, an isolated microorganism is genetically modified, for example to express one or more heterologous genes, to enhance the activity of one or more endogenous enzymes, or to inhibit expression of one or more endogenous genes. In one embodiment, an isolated microorganism can hydrolyze hexose or pentose sugars. In another embodiment, an isolated microorganism can hydrolyze and ferment hexose or pentose sugars. In another embodiment, an isolated microorganism can hydrolyze and ferment cellulosic and/or hgnocellulosic material. In another embodiment, an isolated microorganism can utilize cellulose or xylose as its sole carbon source. In some embodiments, carbonaceous biomass comprises woody plant matter, non-woody plant matter, cellulosic material, hgnocellulosic material, hemicellulosic material, carbohydrates, pectin, starch, inulin, fructans, glucans, corn, corn stover, sugar cane, grasses, switch grass, sorghum, bamboo, distillers grains, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), peels, citrus peels, bagasse, poplar, or algae. In some embodiments, a carbonaceous biomass comprises hemicellulosic or hgnocellulosic materials. In one embodiment, a carbonaceous biomass is pretreated to make the polysaccharides more available to the bacterium. In one embodiment, a carbonaceous biomass is pretreated by acid, steam explosion, hot water treatment, alkali, catalase, or a detoxifying or chelating agent. In one embodiment, a fermentation end-product is a chemical. In one embodiment, a fermentation end-product is a fuel. In one embodiment, a fermentation end-product is an alcohol. In one embodiment, a fermentation end product comprises 1,4 diacid (succinic, fumaric or malic), 2,5 furan dicarboxylic acid, 3 hydroxy propionic acid, aspartic acid, aspartate, glucaric acid, glutamic acid, glutamate, malate, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, xylitol/arabinitol, butanediol, an isoprenoid, a terpene, ethanol, propanol, isopropanol, n-butanol, hydrogen, formic acid, lactic acid acetic acid, formate, lactate or acetate. In one embodiment, a microoraganism is a Clostridium bacterium. In one embodiment, the fermentation end-product is ethanol.

[0027] Also provided herein is a system for producing a fermentation end-product containing: a fermentation vessel; a carbonaceous biomass; an isolated microorganism, wherein said isolated microorganism comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment; and, a medium. In one embodiment, an isolated microorganism is genetically modified. In another embodiment, a microorganism is a Clostridium bacterium.

[0028] Also provided herein is a fuel plant comprising a fermentation vessel configured to house a medium and isolated microorganism wherein said fermentation vessel comprises a cellulosic and/or lignocellulosic material, wherein said isolated microorganism comprises one or more nucleotide sequences comprising at least 400 nucleotides with at least 90 % identity to SEQ ID NO: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42, wherein said nucleotide sequences encode for a protein or protein fragment. In one embodiment, a microorganism is genetically modified. In another embodiment, a microorganism is a Clostridium bacterium.

INCORPORATION BY REFERENCE

[0029] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The novel features disclosed herein are set forth with particularity in the appended claims. A better understanding of the features and advantages will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0031] Figure 1 shows a phylogram of the 16S rRNA gene sequences of members of the Clostridiaceae.

[0032] Figure 2 depicts Clostridium sp. Q.D BLAST comparisons of 16 rRNA sequences to that of three other Clostridia (SEQ ID NOS 11-16, respectively, in order of appearance).

[0033] Figure 3 (FIGS. 3A-3C) shows the morphology of Clostridium sp. Q.D at different growth phases.

[0034] Figure 4 shows growth curves for Clostridium sp. Q.D.

[0035] Figure 5 shows Clostridium sp. Q.D ethanol and acetic acid production on crystalline cellulose over time.

[0036] Figure 6 shows Clostridium sp. Q.D (D) colony morphology compared to strains of C.

phytofermentans .

[0037] Figure 7 shows Clostridium sp. Q.D (D) colony morphology on high levels of glucose.

[0038] Figure 8 shows hydrolysis of different sugars by Clostridium sp. Q.D.

[0039] Figure 9 is a map of the plasmid pGEMspo2DS12EmJoriT used to transform Clostridium sp. Q.D. [0040] Figure 10 shows sequences comprising SpoIID and the promoter incorporated in the vector in FIG. 9.

[0041] Figure 11 shows sequences comprising the EMR gene incorporated in the vector in FIG. 9.

[0042] Figure 12 shows the morphology of Clostridium sp. Q.D compared to Clostridium sp. Q.D-5 and Clostridium sp. Q.D-7.

[0043] Figure 13 compares the growth of the sporulation mutants to that of non-recombinant

Clostridium sp. Q.D.

[0044] Figure 14 compares ethanol and acetic acid production of the sporulation mutants to that of non- recombinant Clostridium sp. Q.D.

[0045] Figure 15 illustrates a method for producing fermentation end products from biomass by first treating biomass with an acid at elevated temperature and pressure in a hydrolysis unit.

[0046] Figure 16 illustrates a method for producing fermentation end products from biomass by using solvent extraction or separation methods.

[0047] Figure 17 illustrates a method for producing fermentation end products from biomass by charging biomass to a fermentation vessel.

[0048] Figure 18 (FIGS. 18A-C) illustrates pretreatments that produce hexose or pentose saccharides or oligomers that are then unprocessed or processed further and either fermented separately or together.

[0049] Figure 19 illustrates results from fermentation of cellobiose with Clostridium sp. Q.D while maintaining a pH of 6.5 for 48 hours.

[0050] Figure 20 illustrates results from fermentation of cellobiose with Clostridium sp. Q.D while maintaining a pH of 5.5.

[0051] Figure 21 illustrates results from fermentation of cellobiose with Clostridium sp. Q.D while not adjusting pH.

[0052] Figure 22 (FIGS. 22A-C) illustrates synergistic characteristics of Clostridium sp. Q.D.

[0053] Figure 23 illustrates a plasmid map for pIMPl .

[0054] Figure 24 illustrates a plasmid map for pIMCphy.

[0055] Figure 25 illustrates a plasmid map for pCphyP3510.

[0056] Figure 26 illustrates a plasmid map for pCphyP3510-l 163.

[0057] Figure 27 illustrates the plasmid pQInt.

[0058] Figure 28 illustrates the plasmid pQIntl .

[0059] Figure 29 illustrates the plasmid pQInt2.

DETAILED DESCRIPTION

[0060] The present disclosure may be understood more readily by reference to the following detailed description, the Examples included therein and to the Figures and their previous and following description. [0061] Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that this disclosure is not limited to specific synthetic methods, specific purified proteins, or to particular nucleic acids, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0062] As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a purified polypeptide" includes mixtures of two or more purified polypeptides.

[0063] In one embodiment, provided herein is an isolated Gram-positive bacterium, wherein the bacterium is an obligate anaerobic, mesophilic, cellulolytic organism that produces colonies that are beige pigmented, wherein the bacterium can use polysaccharides as a sole carbon source and can oxidize glucose into ethanol or one or more organic acid as its fermentation product. An example of the bacterium is designated Clostridium sp. Q.D, having the NRRL patent deposit designation NRRL B- 50361. As used herein, "obligate" means required or compulsory. As used herein, a "mesophilic" is a bacterium that preferentially ferments a carbon source at about 30-40° C. Clostridium sp. Q.D consists of motile rods that form slightly subterminal spores.

[0064] These Gram-positive rods were isolated from a 0.3% Maltose, 5% Azo-CM-Cellulose, QM plate comprising a mutated pool of Clostridium phytofermentans and were cultured in liquid QM media. Endoglucases activity was noted on the plate after four days' incubation at 35° C. The Clostridium sp. Q.D bacterium was distinguishable from Clostridium phytofermentans in that Q.D is a faster-growing colony of larger size having a larger clearing zone in the presence of glucose and 5% Azo-CM- Cellulose plates. It also displays a color modification in the presence of higher concentrations of glucose (2-3% glucose), changing to an orange color.

[0065] The 16S rRNA gene sequence from Clostridium sp. Q.D was used to search against 99097 isolated bacterial 16S rRNA sequences from Ribosomal Database Project Release 10 (Cole J.R., et al. 2008 Nucleic Acids Res. 37:D141 -D145). See FIG. 2, SEQ ID NO: 13. The blast result showed that Q.D only shared 90% similarity to Clostridium phytofermentans ISDg, but was closer to Clostridium algidixylanolyticum strain SPL73 (99%), Clostridium sp. U201 (99%), and swine fecal bacterium strain RF3G-Cel2 (99%). From the blast result, 100 species with at least 90% similarity were selected. These 101 16S rRNA gene sequences were aligned by CLUSTAL W (Thompson J.D., et al. 1994 Nucleic Acids Res. 22:4673-4680). Based on its 16S rRNA sequence, the phylogenetic tree in FIG. 1 was constructed using neighbor-joining method with bootstrap support of 100 replicates.

[0066] Percent identity values for Q.D bacterium compared with representative members of the Clostridium sp. ranged from 99.8% with Clostridium xylanolyticum to 99.7% with Clostridium algidixylanolyticum. While C. algidixylanolyticum is described as making ethanol as a fermentation end product, C. xylanolyticum is not. Also C. xylanolyticum has terminal endospores whereas C. algidixylanolyticum has subterminal endospores.

[0067] In one aspect, the bacterium comprises a 16S rRNA nucleic acid sequence which is unique as compared to a parental strain. In another aspect, the bacterium comprises a 16S rRNA nucleic acid that is greater than about 98% similar to the nucleic acid identified as Clostridium algidixylanolyticum strain SPL73. In another aspect, the bacterium comprises a 16S rRNA nucleic acid that is greater than about 99% similar to the nucleic acid identified as Clostridium algidixylanolyticum strain SPL73. In yet another aspect, the bacterium comprises a 16S rRNA nucleic acid identified in FIG. 2 (SEQ ID NO: 13).

[0068] Further, in one embodiment, the bacterium is an obligate anaerobic mesophile that can ferment biomass or carbonaceous material into ethanol, organic acids and other fermentation end products. For example, the bacterium can degrade cellulose and/or xylose into ethanol and acetic or lactic acid.

[0069]

Definitions

[0070] Unless characterized differently, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0071] The term "about" as used herein refers to a range that is 15%> plus or minus from a stated numerical value within the context of the particular usage. For example, about 10 would include a range from 8.5 to 1 1.5.

[0072] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not. For example, the phrase "the medium can optionally contain glucose" means that the medium may or may not contain glucose as an ingredient and that the description includes both media containing glucose and media not containing glucose.

[0073] The term "enzyme reactive conditions" as used herein refers to environmental conditions {i.e. , such factors as temperature, pH, or lack of inhibiting substances) which will permit the enzyme to function. Enzyme reactive conditions can be either in vitro, such as in a test tube, or in vivo, such as within a cell.

[0074] The terms "function" and "functional" and the like as used herein refer to a biological or enzymatic function.

[0075] The term "gene" as used herein, refers to a unit of inheritance that occupies a specific locus on a chromosome and consists of transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (i.e. , introns, 5' and 3' untranslated sequences).

[0076] The term "host cell" includes an individual cell or cell culture which can be or has been a recipient of any recombinant vector(s) or isolated polynucleotide of the invention. Host cells include progeny of a single host cell, and the progeny can not necessarily be completely identical (in morphology or in total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and/or change. A host cell includes cells transfected, transformed, or infected in vivo or in vitro with a recombinant vector or a polynucleotide of the invention. A host cell which comprises a recombinant vector of the invention is a recombinant host cell, recombinant cell, or recombinant microorganism.

[0077] The term "isolated" as used herein, refers to material that is substantially or essentially free from components that normally accompany it in its native state. For example, an "isolated

polynucleotide", as used herein, refers to a polynucleotide, which has been purified from the sequences which flank it in a naturally-occurring state, e.g., a DNA fragment which has been removed from the sequences that are normally adjacent to the fragment. Alternatively, an "isolated peptide" or an

"isolated polypeptide" and the like, as used herein, refer to in vitro isolation and/or purification of a peptide or polypeptide molecule from its natural cellular environment, and from association with other components of the cell, i.e., it is not associated with in vivo substances.

[0078] The terms "increased" or "increasing" as used herein, refers to the ability of one or more recombinant microorganisms to produce a greater amount of a given product or molecule (e.g., commodity chemical, biofuel, or intermediate product thereof) as compared to a control microorganism, such as an unmodified microorganism or a differently modified microorganism. An "increased" amount is typically a "statistically significant" amount, and can include an increase that is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30 or more times (including all integers and decimal points in between, e.g., 1.5, 1.6, 1.7. 1.8, etc.) the amount produced by an unmodified microorganism or a differently modified

microorganism.

[0079] The term "operably linked" as used herein means placing a gene under the regulatory control of a promoter, which then controls the transcription and optionally the translation of the gene. In one example for the construction of promoter/structural gene combinations, the genetic sequence or promoter is positioned at a distance from the gene transcription start site that is approximately the same as the distance between that genetic sequence or promoter and the gene it controls in its natural setting; i.e. the gene from which the genetic sequence or promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function. Similarly, a regulatory sequence element can be positioned with respect to a gene to be placed under its control in the same position as the element is situated in its in its natural setting with respect to the native gene it controls.

[0080] The term "constitutive promoter" refers to a polynucleotide sequence that induces transcription or is typically active, (i.e., promotes transcription), under most conditions, such as those that occur in a host cell. A constitutive promoter is generally active in a host cell through a variety of different environmental conditions.

[0081] The term "inducible promoter" refers to a polynucleotide sequence that induces transcription or is typically active only under certain conditions, such as in the presence of a specific transcription factor or transcription factor complex, a given molecule factor (e.g., IPTG) or a given environmental condition (e.g., CO ₂ concentration, nutrient levels, light, heat). In the absence of that condition, inducible promoters typically do not allow significant or measurable levels of transcriptional activity.

[0082] The term "low temperature-adapted" refers to an enzyme that has been adapted to have optimal activity at a temperature below about 20°C, such as 19 °C, 18 °C, 17 °C, 16 °C, 15 °C, 14°C, 13°C, 12°C, 11°C, 10°C, 9°C, 8°C, 7°C, 6°C, 5°C, 4°C, 3°C, 2°C, 1°C -1°C, -2°C, -3°C, -4°C, -5°C, -6°C, - 7°C, -8°C, -9°C, -10°C, -11°C, -12°C, -13°C, -14°C, or -15°C.

[0083] The terms "polynucleotide" or "nucleic acid" as used herein designates mRNA, RNA, cRNA, rRNA, cDNA or DNA. The term typically refers to polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA.

[0084] As will be understood by those skilled in the art, a polynucleotide sequence can include genomic sequence, extra-genomic and plasmid-encoded sequence and a smaller engineered gene segment that express, or can be adapted to express, proteins, polypeptides, peptides and the like. Such segments can be naturally isolated, or modified synthetically by the hand of man.

[0085] Polynucleotides can be single-stranded (coding or antisense) or double-stranded, and can be DNA (genomic, cDNA or synthetic) or RNA molecules. In one embodiment, additional coding or non- coding sequences can, but need not, be present within a polynucleotide of the present invention, and a polynucleotide can, but need not, be linked to other molecules and/or support materials.

[0086] Polynucleotides can comprise a native sequence (i.e., an endogenous sequence) or can comprise a variant, or a biological functional equivalent of such a sequence. Polynucleotide variants can contain one or more base substitutions, additions, deletions and/or insertions, as further described below. In one embodiment a polynucleotide variant encodes a polypeptide with the same sequence as the native protein. In another embodiment a polynucleotide variant encodes a polypeptide with substantially similar enzymatic activity as the native protein. In another embodiment a polynucleotide variant encodes a protein with increased enzymatic activity relative to the native polypeptide. The effect on the enzymatic activity of the encoded polypeptide can generally be assessed as described herein.

[0087] A polynucleotide, can be combined with other DNA sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length can vary considerably. In one embodiment, the maximum length of a polynucleotide sequence which can be used to transform a microorganism is governed only by the nature of the recombinant protocol employed.

[0088] The terms "polynucleotide variant" and "variant" and the like refer to polynucleotides that display substantial sequence identity with any of the reference polynucleotide sequences or genes described herein, and to polynucleotides that hybridize with any polynucleotide reference sequence described herein, or any polynucleotide coding sequence of any gene or protein referred to herein, under low stringency, medium stringency, high stringency, or very high stringency conditions that are defined hereinafter and known in the art. These terms also encompass polynucleotides that are distinguished from a reference polynucleotide by the addition, deletion or substitution of at least one nucleotide. Accordingly, the terms "polynucleotide variant" and "variant" include polynucleotides in which one or more nucleotides have been added or deleted, or replaced with different nucleotides. In this regard, it is well understood in the art that certain alterations inclusive of mutations, additions, deletions and substitutions can be made to a reference polynucleotide whereby the altered

polynucleotide retains the biological function or activity of the reference polynucleotide, or has increased activity in relation to the reference polynucleotide (i.e., optimized). Polynucleotide variants include, for example, polynucleotides having at least 50% (and at least 51%> to at least 99% and all integer percentages in between) sequence identity with a reference polynucleotide described herein.

[0089] The terms "polynucleotide variant" and "variant" also include naturally- occurring allelic variants that encode these enzymes. Examples of naturally- occurring variants include allelic variants (same locus), homologs (different locus), and orthologs (different organism). Naturally occurring variants such as these can be identified and isolated using well-known molecular biology techniques including, for example, various polymerase chain reaction (PCR) and hybridization-based techniques as known in the art. Naturally occurring variants can be isolated from any organism that encodes one or more genes having a suitable enzymatic activity described herein (e.g., C-C ligase, diol

dehydrogenase, pectate lyase, alginate lyase, diol dehydratase, transporter, etc.).

[0090] Non-naturally occurring variants can be made by mutagenesis techniques, including those applied to polynucleotides, cells, or microorganisms. The variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions. In certain aspects, non-naturally occurring variants can have been optimized for use in a given microorganism (e.g., E. coli), such as by engineering and screening the enzymes for increased activity, stability, or any other desirable feature. The variations can produce both conservative and non- conservative amino acid substitutions (as compared to the originally encoded product). For polynucleotide sequences, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of a reference polypeptide. Variant polynucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis but which still encode a biologically active polypeptide. Generally, variants of a reference polynucleotide sequence will have at least about 30%, 40% 50%, 55%, 60%, 65%, 70%, generally at least about 75%, 80%, 85%, 90% to 95% or more, and even about 97% or 98% or more sequence identity to that particular nucleotide sequence as determined by sequence alignment programs described elsewhere herein using default parameters. In one embodiment a variant polynucleotide sequence encodes a protein with substantially similar activity compared to a protein encoded by the respective reference polynucleotide sequence. Substantially similar activity means variant protein activity that is within +/- 15% of the activity of a protein encoded by the respective reference polynucleotide sequence. In another embodiment a variant polynucleotide sequence encodes a protein with greater activity compared to a protein encoded by the respective reference polynucleotide sequence.

[0091] The nucleic acid can be detected with a probe capable of hybridizing to the nucleic acid of a cell or a sample. This probe can be a nucleic acid comprising the nucleotide sequence of a coding strand or its complementary strand or the nucleotide sequence of a sense strand or antisense strand, or a fragment thereof. The nucleic acid can comprise the nucleic acid comprising nucleotide sequence of the bacterium, for example the nucleic acid of SEQ ID NO: l , or fragments thereof. In one embodiment, the probe can be either DNA or RNA and can bind either DNA or RNA, or both, in the biological sample.

[0092] The nucleic acid can be SEQ ID NO: l , or any of the other disclosed nucleic acids, and fragments thereof, can be utilized as probes or primers to detect nucleic acids of the disclosed bacterium

(Sequences of the Clostridium sp. Q.D). A polynucleotide probe or primer comprising at least 15 contiguous nucleotides can be utilized to detect a nucleic acid of the disclosed bacterium. In one embodiment, the polynucleotide probe or primer can be at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 1 10, 1 15, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195 or at least 200 nucleotides in length.

[0093] As used herein, the term "nucleic acid probe" refers to a nucleic acid fragment that selectively hybridizes under stringent conditions with a nucleic acid comprising a nucleic acid set forth in a sequence listed herein. This hybridization must be specific. The degree of complementarity between the hybridizing nucleic acid and the sequence to which it hybridizes should be at least enough to exclude hybridization with a nucleic acid encoding an unrelated protein.

[0094] "Stringent conditions" refers to the washing conditions used in a hybridization protocol. In general, the washing conditions should be a combination of temperature and salt concentration chosen so that the denaturation temperature is approximately 5° C. to 20° C. below the calculated Tm of the nucleic acid hybrid under study. In one embodiment, the denaturation temperature is approximately 5° C, 6° C, 7° C, 8° C, 9° C, 10° C, 1 1 ° C, 12° C, 13° C, 14° C, 15° C, 16° C, 17° C, 18° C, 19° C, or 20° C. below the calculated Tm of the nucleic acid hybrid under study. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to the probe or polypeptide-coding nucleic acid of interest and then washed under conditions of different stringencies. The Tm of such an oligonucleotide can be estimated by allowing 20° C for each A or T nucleotide, and 4 °C. for each G or C. For example, an 18 nucleotide probe of 50% G+C would, therefore, have an approximate Tm of 54° C. Stringent conditions are known to one of skill in the art. See, for example, Sambrook et al. (2001). The following is an exemplary set of hybridization conditions and is not limiting: [0095] Very High Stringency

[0096] Hybridization: 5XSSC at 65° C. for 16 hours. Wash twice: 2XSSC at room temperature (RT) for 15 minutes each. Wash twice: 0.5XSSC at 65° C. for 20 minutes each.

[0097] High Stringency

[0098] Hybridization: 5X-6XSSC at 65°C.-70° C. for 16-20 hours. Wash twice: 2XSSC at RT for 5-20 minutes each. Wash twice: 1XSSC at 55° C.-70° C. for 30 minutes each.

[0099] Low Stringency

[00100] Hybridization: 6XSSC at RT to 55° C. for 16-20 hours. Wash at least twice: 2X-3XSSC at RT to 55° C. for 20-30 minutes each.

[00101] It is understood that as discussed herein, the terms "similar" or "similarity" mean the same thing as "homology" and "identity." Thus, for example, if the use of the word homology is used to refer to two non-natural sequences, it is understood that this is not necessarily indicating an evolutionary relationship between these two sequences, but rather is looking at the similarity or relatedness between their nucleic acid or amino acid sequences. Many of the methods for determining similarity between two evolutionarily related molecules are routinely applied to any two or more nucleic acids or polypeptides for the purpose of measuring sequence similarity regardless of whether they are evolutionarily related.

[00102] In general, it is understood that one way to define any known variants and derivatives or those that might arise, of the disclosed nucleic acids and polypeptides herein, is through defining the variants and derivatives in terms of similarity, or homology, to specific known sequences. In general, variants of nucleic acids and polypeptides herein disclosed can typically have at least, about 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent similarity, or homology, to the stated sequence or the native sequence. Those of skill in the art readily understand how to determine the similarity of two polypeptides or nucleic acids. For example, the similarity can be calculated after aligning the two sequences so that the similarity is at its highest level.

[00103] Another way of calculating similarity, or homology, can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment, algorithm of Needleman and Wunsch, J. Mol. Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.; the BLAST algorithm of Tatusova and Madden FEMS Microbiol. Lett. 174: 247-250 (1999) available from the National Center for

Biotechnology Information (www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html)), or by inspection.

[00104] The same types of similarity, or homology, can be obtained for nucleic acids by, for example, the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment. It is understood that any of the methods typically can be used and that in certain instances the results of these various methods may differ, but the skilled artisan understands if similarity is found with at least one of these methods, the sequences would be said to have the stated similarity.

[00105] For example, as used herein, a sequence recited as having a particular percent similarity to another sequence refers to sequences that have the recited similarity as calculated by any one or more of the calculation methods described above. For example, a first sequence has 80 percent similarity, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent similarity to the second sequence using the Zuker calculation method even if the first sequence does not have 80 percent similarity to the second sequence as calculated by any of the other calculation methods. As another example, a first sequence has 80 percent similarity, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent similarity to the second sequence using both the Zuker calculation method and the Pearson and Lipman calculation method even if the first sequence does not have 80 percent similarity to the second sequence as calculated by the Smith and Waterman calculation method, the Needleman and Wunsch calculation method, the Jaeger calculation methods, or any of the other calculation methods. As yet another example, a first sequence has 80 percent similarity, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent similarity to the second sequence using each of the calculation methods (although, in practice, the different calculation methods will often result in different calculated similarity percentages).

[00106] Due to the degeneracy of the genetic code, amino acids can be substituted for other amino acids in a protein sequence without appreciable loss of the desired activity. It is thus contemplated that various changes can be made in the peptide sequences of the disclosed protein sequences, or their corresponding nucleic acid sequences without appreciable loss of the biological activity.

[00107] In making such changes, the hydropathic index of amino acids can be considered. The importance of the hydropathic amino acid index in conferring interactive biological function on a protein is generally understood in the art (Kyte and Doolittle, J. Mol. Biol., 157: 105-132, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[00108] Amino acids have been assigned a hydropathic index on the basis of their hydrophobicity and charge characteristics. These are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (- 0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2);

glutamate/glutamine/aspartate/asparagine (-3.5); lysine (-3.9); and arginine (-4.5). [00109] It is known in the art that certain amino acids can be substituted by other amino acids having a similar hydropathic index or score and result in a protein with similar biological activity, i.e., still obtain a biologically-functional protein. In one embodiment, the substitution of amino acids whose hydropathic indices are within +/-0.2 is preferred, those within +/-0.1 are more preferred, and those within +/-0.5 are most preferred.

[00110] It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101 (Hopp, which is herein incorporated by reference in its entirety) states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. The following hydrophilicity values have been assigned to amino acids: arginine/lysine (+3.0);

aspartate/glutamate (+3.0.+-.1); serine (+0.3); asparagine/glutamine (+0.2); glycine (0); threonine (- 0.4); proline (-0.5.+-.1); alanine/histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5);

leucine/isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4).

[00111] It is understood that an amino acid can be substituted by another amino acid having a similar hydrophilicity score and still result in a protein with similar biological activity, i.e., still obtain a biologically functional protein. In one embodiment the substitution of amino acids whose hydropathic indices are within +/-0.2 is preferred, those within +/-0.1 are more preferred, and those within. +/-.0.5 are most preferred.

[00112] As outlined above, amino acid substitutions can be based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions which take any of the foregoing characteristics into consideration are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Changes which are not expected to be advantageous can also be used if these resulting proteins have the same or improved characteristics, relative to the unmodified polypeptide from which they are engineered.

[00113] In one embodiment, a polynucleotide comprises codons in its coding sequence that are optimized to increase the thermostability of an mRNA transcribed from the polynucleotide. In one embodiment this optimization does not change the amino acid sequence encoded by the polynucleotide. In another embodiment a polynucleotide comprises codons in its protein coding sequence that are optimized to increase translation efficiency of an mRNA from the polynucleotide in a host cell. In one embodiment this optimization does not change the amino acid sequence encoded by the polynucleotide.

[00114] In one embodiment, a method is provided for which uses variants of full-length polypeptides having any of the enzymatic activities described herein, truncated fragments of these full-length polypeptides, variants of truncated fragments, as well as their related biologically active fragments. Typically, biologically active fragments of a polypeptide can participate in an interaction, for example, an intra-molecular or an inter-molecular interaction. An inter-molecular interaction can be a specific binding interaction or an enzymatic interaction (e.g., the interaction can be transient and a covalent bond is formed or broken). Biologically active fragments of a polypeptide/enzyme an enzymatic activity described herein include peptides comprising amino acid sequences sufficiently similar to, or derived from, the amino acid sequences of a (putative) full-length reference polypeptide sequence. Typically, biologically active fragments comprise a domain or motif with at least one enzymatic activity, and can include one or more (and in some cases all) of the various active domains. A biologically active fragment of a an enzyme can be a polypeptide fragment which is, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 450, 500, 600 or more contiguous amino acids, including all integers in between, of a reference polypeptide sequence. In certain embodiments, a biologically active fragment comprises a conserved enzymatic sequence, domain, or motif, as described elsewhere herein and known in the art. Suitably, the biologically-active fragment has no less than about 1%, 10%, 25%, or 50%> of an activity of the wild-type polypeptide from which it is derived.

[00115] The term "exogenous" as used herein, refers to a polynucleotide sequence or polypeptide that does not naturally occur in a given wild-type cell or microorganism, but is typically introduced into the cell by a molecular biological technique, i.e., engineering to produce a recombinant microorganism. Examples of "exogenous" polynucleotides include vectors, plasmids, and/or man-made nucleic acid constructs encoding a desired protein or enzyme.

[00116] The term "endogenous" as used herein, refers to naturally- occurring polynucleotide sequences or polypeptides that can be found in a given wild-type cell or microorganism. For example, certain naturally- occurring bacterial or yeast species do not typically contain a benzaldehyde lyase gene, and, therefore, do not comprise an "endogenous" polynucleotide sequence that encodes a benzaldehyde lyase. In this regard, it is also noted that even though a microorganism can comprise an endogenous copy of a given polynucleotide sequence or gene, the introduction of a plasmid or vector encoding that sequence, such as to over-express or otherwise regulate the expression of the encoded protein, represents an "exogenous" copy of that gene or polynucleotide sequence. Any of the of pathways, genes, or enzymes described herein can utilize or rely on an "endogenous" sequence, or can be provided as one or more "exogenous" polynucleotide sequences, and/or can be used according to the endogenous sequences already contained within a given microorganism.

[00117] The term "sequence identity" for example, comprising a "sequence 50%> identical to," as used herein, refers to the extent that sequences are identical on a nucleotide-by-nucleotide basis or an amino acid-by-amino acid basis over a window of comparison. Thus, a "percentage of sequence identity" can be calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, I) or the identical amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.

[00118] The terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity" and "substantial identity". A "reference sequence" is at least 12 but frequently 15 to 18 and often at least 25 monomer units, inclusive of nucleotides and amino acid residues, in length. Because two polynucleotides can each comprise (1) a sequence (i.e., only a portion of the complete polynucleotide sequence) that is similar between the two polynucleotides, and (2) a sequence that is divergent between the two polynucleotides, sequence comparisons between two (or more)

polynucleotides are typically performed by comparing sequences of the two polynucleotides over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window" refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150 in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. The comparison window can comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window can be conducted by computerized implementations of algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA) or by inspection and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected. Reference also can be made to the BLAST family of programs as for example disclosed by Altschul et ah, 1997, Nucl. Acids Res. 25:3389, which is herein incorporated by reference in its entirety. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et ah, "Current Protocols in Molecular Biology", John Wiley & Sons Inc, 1994-1998, Chapter 15, which is herein incorporated by reference in its entirety.

[00119] The term "transformation" as used herein, refers to the permanent, heritable alteration in a cell resulting from the uptake and incorporation of foreign DNA into the host-cell genome. This includes the transfer of an exogenous gene from one microorganism into the genome of another microorganism as well as the addition of additional copies of an endogenous gene into a microorganism.

[00120] The term "recombinant" as used herein, refers to an organism that genetically modified to comprise one or more heterologous or endogenous nucleic acid molecules, such as in a plasmid or vector. Such nucleic acid molecules can be comprised extrachromosomally or integrated into the chromosome of an organism. The term "non-recombinant" means an organism is not genetically modified. For example, a recombinant organism can be modified to overexpress an endogenous gene encoding an enzyme through modification of promoter elements (e.g., replacing an endogenous promoter element with a constitutive or highly active promoter). Alternatively, a recombinant organism can be modified by introducing a heterologous nucleic acid molecule encoding a protein that is not otherwise expressed in the host organism.

[00121] The term "vector" as used herein, refers to a polynucleotide molecule, such as a DNA molecule. It can be derived, from a plasmid, bacteriophage, yeast or virus, into which a polynucleotide can be inserted or cloned. A vector can contain one or more unique restriction sites and can be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or be integrable with the genome of the defined host such that the cloned sequence is reproducible. Accordingly, the vector can be an autonomously replicating vector, i.e., a vector that exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extra-chromosomal element, a mini- chromosome, or an artificial chromosome. The vector can contain any means for assuring self- replication. Alternatively, the vector can be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Such a vector can comprise specific sequences that allow recombination into a particular, desired site of the host chromosome. A vector system can comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. A vector can be one which is operably functional in a bacterial cell, such as a cyanobacterial cell. The vector can include a reporter gene, such as a green fluorescent protein (GFP), which can be either fused in frame to one or more of the encoded polypeptides, or expressed separately. The vector can also include a selection marker such as an antibiotic resistance gene that can be used for selection of suitable transformants.

[00122] The terms "inactivate" or "inactivating" as used herein for a gene, refer to a reduction in expression and/or activity of the gene. The terms "inactivate" or "inactivating" as used herein for a biological pathway, refer to a reduction in the activity of an enzyme in a the pathway. For example, inactivating an enzyme of the lactic acid pathway would lead to the production of less lactic acid.

[00123] The terms "wild-type" and "naturally- occurring" as used herein are used interchangeably to refer to a gene or gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild type gene or gene product (e.g., a polypeptide) is that which is most frequently observed in a population and is thus arbitrarily designed the "normal" or "wild-type" form of the gene.

[00124] The term "fuel" or "biofuel" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more compounds suitable as liquid fuels, gaseous fuels, biodiesel fuels (long-chain alkyl (methyl, propyl or ethyl) esters), heating oils (hydrocarbons in the 14-20 carbon range), reagents, chemical feedstocks and includes, but is not limited to, hydrocarbons (both light and heavy), hydrogen, methane, hydroxy compounds such as alcohols (e.g. ethanol, butanol, propanol, methanol, etc.), and carbonyl compounds such as aldehydes and ketones (e.g. acetone, formaldehyde, 1 - propanal, etc.).

[00125] The terms "fermentation end-product" or "end-product" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more biofuels, chemical additives, processing aids, food additives, organic acids (e.g. acetic, lactic, formic, citric acid etc.), derivatives of organic acids such as esters (e.g. wax esters, glycerides, etc.) or other functional compounds. These end-products include, but are not limited to, an alcohol, ethanol, butanol, methanol, 1 , 2-propanediol, 1 , 3 -propanediol, lactic acid, formic acid, acetic acid, succinic acid, pyruvic acid, enzymes such as cellulases, polysaccharases, lipases, proteases, ligninases, and hemicellulases and can be present as a pure compound, a mixture, or an impure or diluted form.

[00126] The terms "fermentation end-product" or "end-product" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more biofuels, chemical additives, processing aids, food additives, organic acids (e.g. acetic, lactic, formic, citric acid etc.), derivatives of organic acids such as esters (e.g. wax esters, glycerides, etc.) or other functional compounds. These end-products include, but are not limited to, an alcohol, ethanol, butanol, methanol, 1 , 2-propanediol, 1 , 3 -propanediol, lactic acid, formic acid, acetic acid, succinic acid, pyruvic acid, enzymes such as cellulases, polysaccharases, lipases, proteases, ligninases, and hemicellulases and can be present as a pure compound, a mixture, or an impure or diluted form.

[00127] Various end-products can be produced through saccharification and fermentation using enzyme- enhancing products and processes. These end-products include, but are not limited to, an alcohol, ethanol, butanol, methanol, 1 , 2-propanediol, 1 , 3 -propanediol, lactic acid, formic acid, acetic acid, succinic acid, pyruvic acid, enzymes such as cellulases, polysaccharases, lipases, proteases, ligninases, and hemicellulases and can be present as a pure compound, a mixture, or an impure or diluted form.

[00128] The term "external source" as it relates to a quantity of an enzyme or enzymes provided to a product or a process means that the quantity of the enzyme or enzymes is not produced by a microorganism in the product or process. An external source of an enzyme can include, but is not limited to an enzyme provided in purified form, cell extracts, culture medium or an enzyme obtained from a commercially available source.

[00129] The term "plant polysaccharide" as used herein has its ordinary meaning as known to those skilled in the art and can comprise one or more carbohydrate polymers of sugars and sugar derivatives as well as derivatives of sugar polymers and/or other polymeric materials that occur in plant matter. Exemplary plant polysaccharides include lignin, cellulose, starch, pectin, and hemicellulose. Others are chitin, sulfonated polysaccharides such as alginic acid, agarose, carrageenan, porphyran, furcelleran and funoran. Generally, the polysaccharide can have two or more sugar units or derivatives of sugar units. The sugar units and/or derivatives of sugar units can repeat in a regular pattern, or non-regular pattern. The sugar units can be hexose units or pentose units, or combinations of these. The derivatives of sugar units can be sugar alcohols, sugar acids, amino sugars, etc. The polysaccharides can be linear, branched, cross-linked, or a mixture thereof. One type or class of polysaccharide can be cross-linked to another type or class of polysaccharide.

[00130] The term "fermentable sugars" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more sugars and/or sugar derivatives that can be used as a carbon source by the microorganism, including monomers, dimers, and polymers of these compounds including two or more of these compounds. In some cases, the microorganism can break down these polymers, such as by hydrolysis, prior to incorporating the broken down material. Exemplary fermentable sugars include, but are not limited to glucose, xylose, arabinose, galactose, mannose, rhamnose, cellobiose, lactose, sucrose, maltose, and fructose.

[00131] The term "saccharification" as used herein has its ordinary meaning as known to those skilled in the art and can include conversion of plant polysaccharides to lower molecular weight species that can be used by the microorganism at hand. For some microorganisms, this would include conversion to monosaccharides, disaccharides, trisaccharides, and oligosaccharides of up to about seven monomer units, as well as similar sized chains of sugar derivatives and combinations of sugars and sugar derivatives. For some microorganisms, the allowable chain-length can be longer (e.g. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer units or more) and for some microorganisms the allowable chain-length can be shorter (e.g. 1, 2, 3, 4, 5, 6, or 7 monomer units).

[00132] The term "biomass" comprises organic material derived from living organisms, including any member from the kingdoms: Monera, Protista, Fungi, Plantae, or Animalia. Organic material that comprises oligosaccharides (e.g., pentose saccharides, hexose saccharides, or longer saccharides) is of particular use in the processes disclosed herein. Organic material includes organisms or material derived therefrom. Organic material includes cellulosic, hemicellulosic, and/or lignocellulosic material. In one embodiment biomass comprises genetically-modified organisms or parts of organisms, such as genetically-modified plant matter, algal matter, animal matter. In another embodiment biomass comprises non-genetically modified organisms or parts of organisms, such as non-genetically modified plant matter, algal matter, animal matter The term "feedstock" is also used to refer to biomass being used in a process, such as those described herein.

[00133] Plant matter comprises members of the kingdom Plantae, such as terrestrial plants and aquatic or marine plants. In one embodiment terrestrial plants comprise crop plants (such as fruit, vegetable or grain plants). In one embodiment aquatic or marine plants include, but are not limited to, sea grass, salt marsh grasses (such as Spartina sp. or Phragmites sp.) or the like. In one embodiment a crop plant comprises a plant that is cultivated or harvested for oral consumption, or for utilization in an industrial, pharmaceutical, or commercial process. In one embodiment, crop plants include but are not limited to corn, wheat, rice, barley, soybeans, bamboo, cotton, crambe, jute, sorghum, high biomass sorghum, oats, tobacco, grasses, (e.g., Miscanthus grass or switch grass), trees (softwoods and hardwoods) or tree leaves, beans rape/canola, alfalfa, flax, sunflowers, safflowers, millet, rye, sugarcane, sugar beets, cocoa, tea, Brassica sp. , cotton, coffee, sweet potatoes, flax, peanuts, clover; lettuce, tomatoes, cucurbits, cassava, potatoes, carrots, radishes, peas, lentils, cabbages, cauliflower, broccoli, brussels sprouts, grapes, peppers, or pineapples; tree fruits or nuts such as citrus, apples, pears, peaches, apricots, walnuts, almonds, olives, avocadoes, bananas, or coconuts; flowers such as orchids, carnations and roses; nonvascular plants such as ferns; oil producing plants (such as castor beans, jatropha, or olives); or gymnosperms such as palms. Plant matter also comprises material derived from a member of the kingdom Plantae, such as woody plant matter, non- woody plant matter, cellulosic material, lignocellulosic material, or hemicellulosic material. Plant matter includes carbohydrates (such as pectin, starch, inulin, fructans, glucans, lignin, cellulose, or xylan). Plant matter also includes sugar alcohols, such as glycerol. In one embodiment plant matter comprises a corn product, (e.g. corn stover, corn cobs, corn grain, corn steep liquor, corn steep solids, or corn grind), stillage, bagasse, leaves, pomace, or material derived therefrom. In another embodiment plant matter comprises distillers grains, Distillers Dried Solubles (DDS), Distillers Dried Grains (DDG), Condensed Distillers Solubles (CDS), Distillers Wet Grains (DWG), Distillers Dried Grains with Solubles (DDGS), peels, pits, fermentation waste, skins, straw, seeds, shells, beancake, sawdust, wood flour, wood pulp, paper pulp, paper pulp waste streams, rice or oat hulls, bagasse, grass clippings, lumber, or food leftovers. These materials can come from farms, forestry, industrial sources, households, etc. In another embodiment plant matter comprises an agricultural waste byproduct or side stream. In another embodiment plant matter comprises a source of pectin such as citrus fruit (e.g., orange, grapefruit, lemon, or limes), potato, tomato, grape, mango, gooseberry, carrot, sugar-beet, and apple, among others. In another embodiment plant matter comprises plant peel (e.g., citrus peels) and/or pomace (e.g., grape pomace). In one embodiment plant matter is characterized by the chemical species present, such as proteins, polysaccharides or oils. In one embodiment plant matter is from a genetically modified plant. In one embodiment a genetically-modified plant produces hydrolytic enzymes (such as a cellulase, hemicellulase, or pectinase etc.) at or near the end of its life cycles. In another embodiment a genetically-modified plant encompasses a mutated species or a species that can initiate the breakdown of cell wall components. In another embodiment plant matter is from a non-genetically modified plant.

[00134] Animal matter comprises material derived from a member of the kingdom Animaliae (e.g., bone meal, hair, heads, tails, beaks, eyes, feathers, entrails, skin, shells, scales, meat trimmings, hooves or feet) or animal excrement (e.g., manure). In one embodiment animal matter comprises animal carcasses, milk, meat, fat, animal processing waste, or animal waste (manure from cattle, poultry, and hogs). [00135] Algal matter comprises material derived from a member of the kingdoms Monera (e.g.

Cyanobacteria) or Protista {e.g. algae (such as green algae, red algae, glaucophytes, cyanobacteria,) or fungus-like members of Protista (such as slime molds, water molds, etc). Algal matter includes seaweed (such as kelp or red macroalgae), or marine microflora, including plankton.

[00136] Organic material comprises waste from farms, forestry, industrial sources, households or municipalities. In one embodiment organic material comprises sewage, garbage, food waste {e.g., restaurant waste), waste paper, toilet paper, yard clippings, or cardboard.

[00137] The term "carbonaceous biomass" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more biological materials that can be converted into a biofuel, chemical or other product. Carbonaceous biomass can comprise municipal waste (waste paper, recycled toilet papers, yard clippings, etc.), wood, plant material, plant matter, plant extract, bacterial matter {e.g. bacterial cellulose), distillers' grains, a natural or synthetic polymer, or a combination thereof.

[00138] In one embodiment, biomass does not include fossilized sources of carbon, such as

hydrocarbons that are typically found within the top layer of the Earth's crust {e.g., natural gas, nonvolatile materials composed of almost pure carbon, like anthracite coal, etc.).

[00139] Examples of polysaccharides, oligosaccharides, monosaccharides or other sugar components of biomass include, but are not limited to, alginate, agar, carrageenan, fucoidan, floridean starch, pectin, gluronate, mannuronate, mannitol, lyxose, cellulose, hemicellulose, glycerol, xylitol, glucose, mannose, galactose, xylose, xylan, mannan, arabinan, arabinose, glucuronate, galacturonate (including di- and tri- galacturonates), rhamnose, and the like.

[00140] The term "broth" as used herein has its ordinary meaning as known to those skilled in the art and can include the entire contents of the combination of soluble and insoluble matter, suspended matter, cells and medium, such as for example the entire contents of a fermentation reaction can be referred to as a fermentation broth.

[00141] The term "productivity" as used herein has its ordinary meaning as known to those skilled in the art and can include the mass of a material of interest produced in a given time in a given volume. Units can be, for example, grams per liter-hour, or some other combination of mass, volume, and time. In fermentation, productivity is frequently used to characterize how fast a product can be made within a given fermentation volume. The volume can be referenced to the total volume of the fermentation vessel, the working volume of the fermentation vessel, or the actual volume of broth being fermented. The context of the phrase will indicate the meaning intended to one of skill in the art. Productivity {e.g. g/L/d) is different from "titer" {e.g. g/L) in that productivity includes a time term, and titer is analogous to concentration.

[00142] The terms "conversion efficiency" or "yield" as used herein have their ordinary meaning as known to those skilled in the art and can include the mass of product made from a mass of substrate. The term can be expressed as a percentage yield of the product from a starting mass of substrate. For the production of ethanol from glucose, the net reaction is generally accepted as:

C ₆ H ₁₂ 0 ₆ -» 2C ₂ H ₅ OH + 2CO ₂

and the theoretical maximum conversion efficiency or yield is 51% (wt). Frequently, the conversion efficiency will be referenced to the theoretical maximum, for example, "80% of the theoretical maximum." In the case of conversion of glucose to ethanol, this statement would indicate a conversion efficiency of 41% (wt.). The context of the phrase will indicate the substrate and product intended to one of skill in the art. For substrates comprising a mixture of different carbon sources such as found in biomass (xylan, xylose, glucose, cellobiose, arabinose cellulose, hemicellulose etc.), the theoretical maximum conversion efficiency of the biomass to ethanol is an average of the maximum conversion efficiencies of the individual carbon source constituents weighted by the relative concentration of each carbon source. In some cases, the theoretical maximum conversion efficiency is calculated based on an assumed saccharification yield. In one embodiment, given carbon source comprising lOg of cellulose, the theoretical maximum conversion efficiency can be calculated by assuming saccharification of the cellulose to the assimilable carbon source glucose of about 75% by weight. In this embodiment, lOg of cellulose can provide 7.5g of glucose which can provide a maximum theoretical conversion efficiency of about 7.5g _* 51% or 3.8g of ethanol. In other cases, the efficiency of the saccharification step can be calculated or determined, i.e., saccharification yield. Saccharification yields can include between about 10-100%, about 20-90%, about 30-80%, about 40-70% or about 50-60%, such as about 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%), 99%) or about 100% for any carbohydrate carbon sources larger than a single monosaccharide subunit.

[00143] The saccharification yield takes into account the amount of ethanol, and acidic products produced plus the amount of residual monomeric sugars detected in the media. The ethanol figures resulting from media components are not adjusted in this experiment. These can account for up to 3 g/1 ethanol production or equivalent of up to 6g/l sugar as much as +/- 10%- 15% saccharification yield (or saccharification efficiency). For this reason the saccharification yield % can be greater than 100% for some plots.

[00144] A term "phytate" as used herein has its ordinary meaning as known to those skilled in the art can be include phytic acid, its salts, and its combined forms as well as combinations of these.

[00145] The terms "pretreatment" or "pretreated" as used herein refer to any mechanical, chemical, thermal, biochemical process or combination of these processes whether in a combined step or performed sequentially, that achieves disruption or expansion of a biomass so as to render the biomass more susceptible to attack by enzymes and/or microorganisms. In some embodiments, pretreatment can include removal or disruption of lignin so as to make the cellulose and hemicellulose polymers in the plant biomass more available to cellulolytic enzymes and/or microorganisms, for example, by treatment with acid or base. In some embodiments, pretreatment can include the use of a microorganism of one type to render plant polysaccharides more accessible to microorganisms of another type. In some embodiments, pretreatment can also include disruption or expansion of cellulosic and/or hemicellulosic material. Steam explosion, and ammonia fiber expansion (or explosion) (AFEX) are well known thermal/chemical techniques. Hydrolysis, including methods that utilize acids and/or enzymes can be used. Other thermal, chemical, biochemical, enzymatic techniques can also be used.

[00146] The terms "fed-batch" or "fed-batch fermentation" as used herein has its ordinary meaning as known to those skilled in the art and can include a method of culturing microorganisms where nutrients, other medium components, or biocatalysts (including, for example, enzymes, fresh microorganisms, extracellular broth, etc.) are supplied to the fermentor during cultivation, but culture broth is not harvested from the fermentor until the end of the fermentation, although it can also include "self seeding" or "partial harvest" techniques where a portion of the fermentor volume is harvested and then fresh medium is added to the remaining broth in the fermentor, with at least a portion of the inoculum being the broth that was left in the fermentor. In some embodiments, a fed-batch process might be referred to with a phrase such as, "fed-batch with cell augmentation." This phrase can include an operation where nutrients and microbial cells are added or one where microbial cells with no substantial amount of nutrients are added. The more general phrase "fed-batch" encompasses these operations as well. The context where any of these phrases is used will indicate to one of skill in the art the techniques being considered.

[00147] The term "sugar compounds" as used herein has its ordinary meaning as known to those skilled in the art and can include monosaccharide sugars, including but not limited to hexoses and pentoses; sugar alcohols; sugar acids; sugar amines; compounds containing two or more of these linked together directly or indirectly through covalent or ionic bonds; and mixtures thereof. Included within this description are disaccharides; trisaccharides; oligosaccharides; polysaccharides; and sugar chains, branched and/or linear, of any length.

[00148] The term "xylano lytic" as used herein refers to any substance capable of breaking down xylan. The term "cellulolytic" as used herein refers to any substance capable of breaking down cellulose.

[00149] Generally, compositions and methods are provided for enzyme conditioning of feedstock or biomass to allow saccharification and fermentation to one or more industrially useful fermentation end- products.

[00150] The term "biocatalyst" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more enzymes and microorganisms, including solutions, suspensions, and mixtures of enzymes and microorganisms. In some contexts this word will refer to the possible use of either enzymes or microorganisms to serve a particular function, in other contexts the word will refer to the combined use of the two, and in other contexts the word will refer to only one of the two. The context of the phrase will indicate the meaning intended to one of skill in the art.

[00151] The term "fatty acid comprising material" as used herein has its ordinary meaning as known to those skilled in the art and can comprise one or more chemical compounds that include one or more fatty acid moieties as well as derivatives of these compounds and materials that comprise one or more of these compounds. Common examples of compounds that include one or more fatty acid moieties include triacylglycerides, diacylglycerides, monoacylglycerides, phospholipids, lysophospholipids, free fatty acids, fatty acid salts, soaps, fatty acid comprising amides, esters of fatty acids and monohydric alcohols, esters of fatty acids and polyhydric alcohols including glycols (e.g. ethylene glycol, propylene glycol, etc.), esters of fatty acids and polyethylene glycol, esters of fatty acids and polyethers, esters of fatty acids and polyglycol, esters of fatty acids and saccharides, esters of fatty acids with other hydroxyl-containing compounds, etc. A fatty acid comprising material can be one or more of these compounds in an isolated or purified form. It can be a material that includes one or more of these compounds that is combined or blended with other similar or different materials. It can be a material where the fatty acid comprising material occurs with or is provided with other similar or different materials, such as vegetable and animal oils; mixtures of vegetable and animal oils; vegetable and animal oil byproducts; mixtures of vegetable and animal oil byproducts; vegetable and animal wax esters; mixtures, derivatives and byproducts of vegetable and animal wax esters; seeds; processed seeds; seed byproducts; nuts; processed nuts; nut byproducts; animal matter; processed animal matter; byproducts of animal matter; corn; processed corn; corn byproducts; distiller's grains; beans; processed beans; bean byproducts; soy products; lipid containing plant, fish or animal matter; processed lipid containing plant or animal matter; byproducts of lipid containing plant, fish or animal matter; lipid containing microbial material; processed lipid containing microbial material; and byproducts of lipid containing microbial matter. Such materials can be utilized in liquid or solid forms. Solid forms include whole forms, such as cells, beans, and seeds; ground, chopped, slurried, extracted, flaked, milled, etc. The fatty acid portion of the fatty acid comprising compound can be a simple fatty acid, such as one that includes a carboxyl group attached to a substituted or un-substituted alkyl group. The substituted or unsubstituted alkyl group can be straight or branched, saturated or unsaturated.

Substitutions on the alkyl group can include hydroxyls, phosphates, halogens, alkoxy, or aryl groups. The substituted or unsubstituted alkyl group can have 7 to 29 carbons and preferably 1 1 to 23 carbons (e.g., 8 to 30 carbons and preferably 12 to 24 carbons counting the carboxyl group) arranged in a linear chain with or without side chains and/or substitutions. Addition of the fatty acid comprising compound can be by way of adding a material comprising the fatty acid comprising compound. [00152] The term "pH modifier" as used herein has its ordinary meaning as known to those skilled in the art and can include any material that will tend to increase, decrease or hold steady the pH of the broth or medium. A pH modifier can be an acid, a base, a buffer, or a material that reacts with other materials present to serve to raise, lower, or hold steady the pH. In one embodiment, more than one pH modifier can be used, such as more than one acid, more than one base, one or more acid with one or more bases, one or more acids with one or more buffers, one or more bases with one or more buffers, or one or more acids with one or more bases with one or more buffers. In one embodiment, a buffer can be produced in the broth or medium or separately and used as an ingredient by at least partially reacting in acid or base with a base or an acid, respectively. When more than one pH modifiers are utilized, they can be added at the same time or at different times. In one embodiment, one or more acids and one or more bases is combined, resulting in a buffer. In one embodiment, media components, such as a carbon source or a nitrogen source serve as a pH modifier; suitable media components include those with high or low pH or those with buffering capacity. Exemplary media components include acid- or base- hydrolyzed plant polysaccharides having residual acid or base, ammonia fiber explosion (AFEX) treated plant material with residual ammonia, lactic acid, corn steep solids or liquor.

[00153] Generally, compositions and methods are provided for enzyme conditioning of feedstock or biomass to allow saccharification and fermentation to one or more industrially useful fermentation end- products.

Microorganisms

[00154] Microorganisms useful in compositions and methods of the invention include, but are not limited to bacteria, or yeast. Examples of bacteria include, but are not limited to, any bacterium found in the genus of Clostridium, such as C. acetobutylicum, C. aerotolerans, C. beijerinckii, C.

bifermentans, C. botulinum, C. butyricum, C. cadaveris, C. cellulolyticum, C. chauvoei, C.

clostridioforme, C. colicanis, C. difficile, C. fallax, C. formicaceticum, C. histolyticum, C. innocuum, C. Ijungdahlii, C. laramie, C. lavalense, C. novyi, C. oedematiens, C. paraputrificum, C. perfringens, C. phytofermentans (including NRRL B-50364 or NRRL B-50351), C. piliforme, C. ramosum, C.

saccharolyticum, C. scatologenes, C. septicum, C. sordellii, C. sporogenes, C. sp. Q.D (such as NRRL B-50361, NRRL B-50362, or NRRL B-50363), C tertium, C. tetani, C. tyrobutyricum, or variants thereof (e.g. C. phytofermentans Q.12 or C. phytofermentans Q.13).

[00155] Examples of yeast that can be utilized in co-culture methods of the invention include but are not limited to, species found in Cryptococcaceae, Sporobolomycetaceae with the genera Cryptococcus, Torulopsis, Pityrosporum, Brettanomyces, Candida, Kloeckera, Trigonopsis, Trichosporon,

Rhodotorula and Sporobolomyces and Bullera, the families Endo- and Saccharomycetaceae, with the genera Saccharomyces, Debaromyces, Lipomyces, Hansenula, Endomycopsis, Pichia, Hanseniaspora, Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Zygosaccharomyces rouxii, Yarrowia lipolitica, Emericella nidulans, Aspergillus nidulans, Deparymyces hansenii and Torulaspora hansenii.

[00156] In another embodiment a microorganism can be wild type, or a genetically modified strain. In one embodiment a microorganism can be genetically modified to express one or more polypeptides capable of neutralizing a toxic by-product or inhibitor, which can result in enhanced end-product production in yield and/or rate of production. Examples of modifications include chemical or physical mutagenesis, directed evolution, or genetic alteration to enhance enzyme activity of endogenous proteins, introducing one or more heterogeneous nucleic acid molecules into a host microorganism to express a polypeptide not otherwise expressed in the host, modifying physical and chemical conditions to enhance enzyme function {e.g., modifying and/or maintaining a certain temperature, pH, nutrient concentration, or biomass concentration), or a combination of one or more such modifications.

Pretreatment of Biomass

[00157] Described herein are also methods and compositions for pre-treating biomass prior to extraction of industrially useful end-products. In some embodiments, more complete saccharification of biomass and fermentation of the saccharification products results in higher fuel yields.

[00158] In some embodiments, a Clostridium species, for example Clostridium sp. Q.D or a variant thereof is contacted with pretreated or non-pretreated feedstock containing cellulosic, hemicellulosic, and/or lignocellulosic material. Additional nutrients can be present or added to the biomass material to be processed by the microorganism including nitrogen-containing compounds such as amino acids, proteins, hydrolyzed proteins, ammonia, urea, nitrate, nitrite, soy, soy derivatives, casein, casein derivatives, milk powder, milk derivatives, whey, yeast extract, hydrolyze yeast, autolyzed yeast, corn steep liquor, corn steep solids, monosodium glutamate, and/or other fermentation nitrogen sources, vitamins, and/or mineral supplements. In some embodiments, one or more additional lower molecular weight carbon sources can be added or be present such as glucose, sucrose, maltose, corn syrup, lactic acid, etc. Such lower molecular weight carbon sources can serve multiple functions including providing an initial carbon source at the start of the fermentation period, help build cell count, control the carbon/nitrogen ratio, remove excess nitrogen, or some other function.

[00159] In some embodiments aerobic/anaerobic cycling is employed for the bioconversion of cellulosic/lignocellulosic material to fuels and chemicals. In some embodiments, the anaerobic microorganism can ferment biomass directly without the need of a pretreatment. In some embodiments, the anaerobic microorganism can hydrolyze and ferment a biomass without the need of a pretreatment. In certain embodiments, feedstocks are contacted with biocatalysts capable of breaking down plant- derived polymeric material into lower molecular weight products that can subsequently be transformed by biocatalysts to fuels and/or other desirable chemicals. In some embodiments pretreatment methods can include treatment under conditions of high or low pH. High or low pH treatment includes, but is not limited to, treatment using concentrated acids or concentrated alkali, or treatment using dilute acids or dilute alkali. Alkaline compositions useful for treatment of biomass in the methods of the present invention include, but are not limited to, caustic, such as caustic lime, caustic soda, caustic potash, sodium, potassium, or calcium hydroxide, or calcium oxide. In some embodiments suitable amounts of alkaline useful for the treatment of biomass ranges from O.Olg to 3g of alkaline (e.g. caustic) for every gram of biomass to be treated. In some embodiments suitable amounts of alkaline useful for the treatment of biomass include, but are not limited to, about O.Olg of alkaline (e.g. caustic), 0.02g, 0.03g, 0.04g, 0.05g, 0.075g, O. lg, 0.2g, 0.3g, 0.4g, 0.5g, 0.75g, lg, 2g, or about 3g of alkaline (e.g. caustic) for every gram of biomass to be treated.

[00160] In another embodiment, pretreatment of biomass comprises dilute acid hydrolysis. Example of dilute acid hydrolysis treatment are disclosed in T. A. Lloyd and C. E Wyman, Bioresource

Technology, (2005) 96, 1967), incorporated by reference herein in its entirety. In other embodiments, pretreatment of biomass comprises pH controlled liquid hot water treatment. Examples of pH controlled liquid hot water treatments are disclosed in N. Mosier et al, Bioresource Technology, (2005) 96, 1986, incorporated by reference herein in its entirety. In other embodiments, pretreatment of biomass comprises aqueous ammonia recycle process (ARP). Examples of aqueous ammonia recycle process are described in T. H. Kim and Y. Y. Lee, Bioresource Technology, (2005)96, incorporated by reference herein in its entirety.

[00161] In another embodiment, the above-mentioned methods have two steps: a pretreatment step that leads to a wash stream, and an enzymatic hydrolysis step of pretreated-biomass that produces a hydrolyzate stream. In the above methods, the pH at which the pretreatment step is carried out increases progressively from dilute acid hydrolysis to hot water pretreatment to alkaline reagent based methods (AFEX, ARP, and lime pretreatments). Dilute acid and hot water treatment methods solubilize mostly hemicellulose, whereas methods employing alkaline reagents remove most lignin during the pretreatment step. As a result, the wash stream from the pretreatment step in the former methods contains mostly hemicellulose-based sugars, whereas this stream has mostly lignin for the high-pH methods. The subsequent enzymatic hydrolysis of the residual feedstock leads to mixed carbohydrates (C5 and C6) in the alkali-based pretreatment methods, while glucose is the major product in the hydrolysate from the low and neutral pH methods. The enzymatic digestibility of the residual biomass is somewhat better for the high-pH methods due to the removal of lignin that can interfere with the accessibility of cellulase enzyme to cellulose. In some embodiments, pretreatment results in removal of about 20%, 30%, 40%, 50%, 60%, 70% or more of the lignin component of the feedstock. In other embodiments, more than 40%>, 50%>, 60%>, 70%>, 80%> or more of the hemicellulose component of the feedstock remains after pretreatment. In some embodiments, the microorganism (e.g., Clostridium phytofermentans, Clostridium, sp. Q.D or a variant thereof) is capable of fermenting both five-carbon and six-carbon sugars, which can be present in the feedstock, or can result from the enzymatic degradation of components of the feedstock. [00162] In another embodiment, a two-step pretreatment is used to partially or entirely remove C5 polysaccharides and other components. After washing, the second step consists of an alkali treatment to remove lignin components. The pretreated biomass is then washed prior to saccharification and fermentation. One such pretreatment consists of a dilute acid treatment at room temperature or an elevated temperature, followed by a washing or neutralization step, and then an alkaline contact to remove lignin. For example, one such pretreatment can consist of a mild acid treatment with an acid that is organic (such as acetic acid, citric acid, malic acid, or oxalic acid) or inorganic (such as nitric, hydrochloric, or sulfuric acid), followed by washing and an alkaline treatment in 0.5 to 2.0% NaOH. This type of pretreatment results in a higher percentage of oligomeric to monomeric saccharides, is preferentially fermented by an microorganism such as Clostridium, sp. Q.D or a variant thereof.

[00163] In another embodiment, pretreatment of biomass comprises ionic liquid pretreatment. Biomass can be pretreated by incubation with an ionic liquid, followed by extraction with a wash solvent such as alcohol or water. The treated biomass can then be separated from the ionic liquid/wash-solvent solution by centrifugation or filtration, and sent to the saccharification reactor or vessel. Examples of ionic liquid pretreatment are disclosed in US publication No. 2008/0227162, incorporated herein by reference in its entirety.

[00164] Examples of pretreatment methods are disclosed in U.S. Patent No. 4600590 to Dale, U.S. Patent No. 4644060 to Chou, U.S. Patent No. 5037663 to Dale. U.S. Patent No. 5171592 to Holtzapple, et al, et al, U.S. Patent No. 5939544 to Karstens, et al, U.S. Patent No. 5473061 to Bredereck, et al, U.S. Patent No. 6416621 to Karstens., U.S. Patent No. 6106888 to Dale, et al, U.S. Patent No. 6176176 to Dale, et al, PCT publication WO2008/020901 to Dale, et al, Felix, A., et al, Anim. Prod. 51, 47-61 (1990)., Wais, A.C., Jr., et al, Journal of Animal Science, 35, No. 1,109-112 (1972), which are incorporated herein by reference in their entireties.

[00165] In some embodiments, after pretreatment by any of the above methods the feedstock contains cellulose, hemicellulose, soluble oligomers, simple sugars, lignins, volatiles and/or ash. The parameters of the pretreatment can be changed to vary the concentration of the components of the pretreated feedstock. For example, in some embodiments a pretreatment is chosen so that the concentration of hemicellulose and/or soluble oligomers is high and the concentration of lignins is low after

pretreatment. Examples of parameters of the pretreatment include temperature, pressure, time, and pH.

[00166] In some embodiments, the parameters of the pretreatment are changed to vary the concentration of the components of the pretreated feedstock such that concentration of the components in the pretreated stock is optimal for fermentation with a microorganism, e.g. Clostridium sp. Q.D or a variant thereof.

[00167] In some embodiments, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is about l%-99%, such as about 1-10%, 1-20%, 1- 30%, 1-40%, 1-50%, 1-60%, 1-70%, 1-80%, 1-90% 1-99%, 5-10%, 5-20%, 5-30%, 5-40%, 5-50%, 5- 60%, 5-70%, 5-80%, 5-90% 5-99%, 10-10%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90% 10-99%, 15-10%, 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15- 90% 15-99%, 20-10%, 20-20%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90% 20- 99%, 25-10%, 25-20%, 25-30%, 25-40%, 25-50%, 25-60%, 25-70%, 25-80%, 25-90% 25-99%, 30- 10%, 30-20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90% 30-99%, 35-10%, 35- 20%, 35-30%, 35-40%, 35-50%, 35-60%, 35-70%, 35-80%, 35-90% 35-99%, 40-10%, 40-20%, 40- 30%, 40-40%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90% 40-99%, 45-10%, 45-20%, 45-30%, 45- 40%, 45-50%, 45-60%, 45-70%, 45-80%, 45-90% 45-99%, 50-10%, 50-20%, 50-30%, 50-40%, 50- 50%, 50-60%, 50-70%, 50-80%, 50-90% 50-99%, 55-10%, 55-20%, 55-30%, 55-40%, 55-50%, 55- 60%, 55-70%, 55-80%, 55-90% 55-99%, 60-10%, 60-20%, 60-30%, 60-40%, 60-50%, 60-60%, 60- 70%, 60-80%, 60-90% 60-99%, 65-10%, 65-20%, 65-30%, 65-40%, 65-50%, 65-60%, 65-70%, 65- 80%, 65-90% 65-99%, 70-10%, 70-20%, 70-30%, 70-40%, 70-50%, 70-60%, 70-70%, 70-80%, 70- 90% 70-99%, 75-10%, 75-20%, 75-30%, 75-40%, 75-50%, 75-60%, 75-70%, 75-80%, 75-90% 75- 99%, 80-10%, 80-20%, 80-30%, 80-40%, 80-50%, 80-60%, 80-70%, 80-80%, 80-90% 80-99%, 85- 10%, 85-20%, 85-30%, 85-40%, 85-50%, 85-60%, 85-70%, 85-80%, 85-90% 85-99%, 90-10%, 90- 20%, 90-30%, 90-40%, 90-50%, 90-60%, 90-70%, 90-80%, 90-90% 90-99%, 95-10%, 95-20%, 95- 30%, 95-40%, 95-50%, 95-60%, 95-70%, 95-80%, 95-90% 95-99%30%, 20-40%, 20-50%, 30-40% or 30-50%). In some embodiments, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is about 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is 5% to 30%. In some embodiments, the parameters of the pretreatment are changed such that concentration of accessible cellulose in the pretreated feedstock is 10% to 20%.

[00168] In some embodiments, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is about l%-99%, such as about 1-10%, 1-20%, 1-30%, 1- 40%, 1-50%, 1-60%, 1-70%, 1-80%, 1-90% 1-99%, 5-10%, 5-20%, 5-30%, 5-40%, 5-50%, 5-60%, 5- 70%, 5-80%, 5-90% 5-99%, 10-10%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90% 10-99%, 15-10%, 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90% 15- 99%, 20-10%, 20-20%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90% 20-99%, 25- 10%, 25-20%, 25-30%, 25-40%, 25-50%, 25-60%, 25-70%, 25-80%, 25-90% 25-99%, 30-10%, 30- 20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90% 30-99%, 35-10%, 35-20%, 35- 30%, 35-40%, 35-50%, 35-60%, 35-70%, 35-80%, 35-90% 35-99%, 40-10%, 40-20%, 40-30%, 40- 40%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90% 40-99%, 45-10%, 45-20%, 45-30%, 45-40%, 45- 50%, 45-60%, 45-70%, 45-80%, 45-90% 45-99%, 50-10%, 50-20%, 50-30%, 50-40%, 50-50%, 50- 60%, 50-70%, 50-80%, 50-90% 50-99%, 55-10%, 55-20%, 55-30%, 55-40%, 55-50%, 55-60%, 55- 70%, 55-80%, 55-90% 55-99%, 60-10%, 60-20%, 60-30%, 60-40%, 60-50%, 60-60%, 60-70%, 60- 80%, 60-90% 60-99%, 65-10%, 65-20%, 65-30%, 65-40%, 65-50%, 65-60%, 65-70%, 65-80%, 65- 90% 65-99%, 70-10%, 70-20%, 70-30%, 70-40%, 70-50%, 70-60%, 70-70%, 70-80%, 70-90% 70- 99%, 75-10%, 75-20%, 75-30%, 75-40%, 75-50%, 75-60%, 75-70%, 75-80%, 75-90% 75-99%, 80- 10%, 80-20%, 80-30%, 80-40%, 80-50%, 80-60%, 80-70%, 80-80%, 80-90% 80-99%, 85-10%, 85- 20%, 85-30%, 85-40%, 85-50%, 85-60%, 85-70%, 85-80%, 85-90% 85-99%, 90-10%, 90-20%, 90- 30%, 90-40%, 90-50%, 90-60%, 90-70%, 90-80%, 90-90% 90-99%, 95-10%, 95-20%, 95-30%, 95- 40%, 95-50%, 95-60%, 95-70%, 95-80%, 95-90% 95-99%. In some embodiments, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is about 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%), 95%), or 99%. In some embodiments, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is 5% to 40%>. In some embodiments, the parameters of the pretreatment are changed such that concentration of hemicellulose in the pretreated feedstock is 10% to 30%.

[00169] In some embodiments, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is about l%>-99%>, such as about 1 -10%, 1 -20%, 1 -30%, 1 -40%, 1 -50%, 1 -60%, 1 -70%, 1 -80%, 1 -90% 1 -99%, 5-10%, 5-20%, 5-30%, 5-40%, 5-50%, 5-60%, 5-70%, 5-80%, 5-90% 5-99%, 10-10%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90% 10-99%, 15-10%, 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90% 15- 99%, 20-10%, 20-20%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90% 20-99%, 25- 10%, 25-20%, 25-30%, 25-40%, 25-50%, 25-60%, 25-70%, 25-80%, 25-90% 25-99%, 30-10%, 30- 20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90% 30-99%, 35-10%, 35-20%, 35- 30%, 35-40%, 35-50%, 35-60%, 35-70%, 35-80%, 35-90% 35-99%, 40-10%, 40-20%, 40-30%, 40- 40%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90% 40-99%, 45-10%, 45-20%, 45-30%, 45-40%, 45- 50%, 45-60%, 45-70%, 45-80%, 45-90% 45-99%, 50-10%, 50-20%, 50-30%, 50-40%, 50-50%, 50- 60%, 50-70%, 50-80%, 50-90% 50-99%, 55-10%, 55-20%, 55-30%, 55-40%, 55-50%, 55-60%, 55- 70%, 55-80%, 55-90% 55-99%, 60-10%, 60-20%, 60-30%, 60-40%, 60-50%, 60-60%, 60-70%, 60- 80%, 60-90% 60-99%, 65-10%, 65-20%, 65-30%, 65-40%, 65-50%, 65-60%, 65-70%, 65-80%, 65- 90% 65-99%, 70-10%, 70-20%, 70-30%, 70-40%, 70-50%, 70-60%, 70-70%, 70-80%, 70-90% 70- 99%, 75-10%, 75-20%, 75-30%, 75-40%, 75-50%, 75-60%, 75-70%, 75-80%, 75-90% 75-99%, 80- 10%, 80-20%, 80-30%, 80-40%, 80-50%, 80-60%, 80-70%, 80-80%, 80-90% 80-99%, 85-10%, 85- 20%, 85-30%, 85-40%, 85-50%, 85-60%, 85-70%, 85-80%, 85-90% 85-99%, 90-10%, 90-20%, 90- 30%, 90-40%, 90-50%, 90-60%, 90-70%, 90-80%, 90-90% 90-99%, 95-10%, 95-20%, 95-30%, 95- 40%, 95-50%, 95-60%, 95-70%, 95-80%, 95-90% 95-99%. In some embodiments, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is about 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%), 95%), or 99%). Examples of soluble oligomers include, but are not limited to, cellobiose and xylobiose. In some embodiments, the parameters of the pretreatment are changed such that

concentration of soluble oligomers in the pretreated feedstock is 30% to 90%>. In some embodiments, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is 45% to 80%. In some embodiments, the parameters of the pretreatment are changed such that concentration of soluble oligomers in the pretreated feedstock is 45% to 80% and the soluble oligomers are primarily cellobiose and xylobiose.

[00170] In some embodiments, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is about l%-99%, such as about 1-10%, 1-20%, 1-30%, 1- 40%, 1-50%, 1-60%, 1-70%, 1-80%, 1-90% 1-99%, 5-10%, 5-20%, 5-30%, 5-40%, 5-50%, 5-60%, 5- 70%, 5-80%, 5-90% 5-99%, 10-10%, 10-20%, 10-30%, 10-40%, 10-50%, 10-60%, 10-70%, 10-80%, 10-90% 10-99%, 15-10%, 15-20%, 15-30%, 15-40%, 15-50%, 15-60%, 15-70%, 15-80%, 15-90% 15- 99%, 20-10%, 20-20%, 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90% 20-99%, 25- 10%, 25-20%, 25-30%, 25-40%, 25-50%, 25-60%, 25-70%, 25-80%, 25-90% 25-99%, 30-10%, 30- 20%, 30-30%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90% 30-99%, 35-10%, 35-20%, 35- 30%, 35-40%, 35-50%, 35-60%, 35-70%, 35-80%, 35-90% 35-99%, 40-10%, 40-20%, 40-30%, 40- 40%, 40-50%, 40-60%, 40-70%, 40-80%, 40-90% 40-99%, 45-10%, 45-20%, 45-30%, 45-40%, 45- 50%, 45-60%, 45-70%, 45-80%, 45-90% 45-99%, 50-10%, 50-20%, 50-30%, 50-40%, 50-50%, 50- 60%, 50-70%, 50-80%, 50-90% 50-99%, 55-10%, 55-20%, 55-30%, 55-40%, 55-50%, 55-60%, 55- 70%, 55-80%, 55-90% 55-99%, 60-10%, 60-20%, 60-30%, 60-40%, 60-50%, 60-60%, 60-70%, 60- 80%, 60-90% 60-99%, 65-10%, 65-20%, 65-30%, 65-40%, 65-50%, 65-60%, 65-70%, 65-80%, 65- 90% 65-99%, 70-10%, 70-20%, 70-30%, 70-40%, 70-50%, 70-60%, 70-70%, 70-80%, 70-90% 70- 99%, 75-10%, 75-20%, 75-30%, 75-40%, 75-50%, 75-60%, 75-70%, 75-80%, 75-90% 75-99%, 80- 10%, 80-20%, 80-30%, 80-40%, 80-50%, 80-60%, 80-70%, 80-80%, 80-90% 80-99%, 85-10%, 85- 20%, 85-30%, 85-40%, 85-50%, 85-60%, 85-70%, 85-80%, 85-90% 85-99%, 90-10%, 90-20%, 90- 30%, 90-40%, 90-50%, 90-60%, 90-70%, 90-80%, 90-90% 90-99%, 95-10%, 95-20%, 95-30%, 95- 40%, 95-50%, 95-60%, 95-70%, 95-80%, 95-90% 95-99%. In some embodiments, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is about 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%). In some embodiments, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is 0% to 20%. In some embodiments, the parameters of the pretreatment are changed such that concentration of simple sugars in the pretreated feedstock is 0% to 5%. Examples of simple sugars include, but are not limited to monomers and dimers.

[00171] In some embodiments, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is about 1%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. In some embodiments, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is 0% to 20%. In some embodiments, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is 0%> to 5%>. In some embodiments, the parameters of the pretreatment are changed such that concentration of lignins in the pretreated feedstock is less than 1%> to 2%). In some embodiments, the parameters of the pretreatment are changed such that the concentration of phenolics is minimized.

[00172] In some embodiments, the parameters of the pretreatment are changed such that concentration of furfural and low molecular weight lignins in the pretreated feedstock is less than 10%>, 9%, 8%, 7%>, 6%), 5%), 4%), 3%), 2%), or 1%>. In some embodiments, the parameters of the pretreatment are changed such that concentration of furfural and low molecular weight lignins in the pretreated feedstock is less than l% to 2%.

[00173] In some embodiments, the parameters of the pretreatment are changed such that concentration of accessible cellulose is 10%> to 20 %>, the concentration of hemicellulose is 10%> to 30%>, the concentration of soluble oligomers is 45%> to 80%>, the concentration of simple sugars is 0%> to 5%>, and the concentration of lignins is 0%> to 5% and the concentration of furfural and low molecular weight lignins in the pretreated feedstock is less than 1%> to 2%>.

[00174] In some embodiments, the parameters of the pretreatment are changed to obtain a high concentration of hemicellulose (e.g., 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or higher) and a low concentration of lignins (e.g., 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, or 30%). In some embodiments, the parameters of the pretreatment are changed to obtain a high concentration of hemicellulose and a low concentration of lignins such that concentration of the components in the pretreated stock is optimal for fermentation with a microorganism such as a member of the genus Clostridium, for example Clostridium sp. Q.D or variants thereof.

[00175] Certain conditions of pretreatment can be modified prior to, or concurrently with, introduction of a fermentative microorganism into the feedstock. For example, pretreated feedstock can be cooled to a temperature which allows for growth of the microorganism(s). As another example, pH can be altered prior to, or concurrently with, addition of one or more microorganisms.

[00176] Alteration of the pH of a pretreated feedstock can be accomplished by washing the feedstock (e.g., with water) one or more times to remove an alkaline or acidic substance, or other substance used or produced during pretreatment. Washing can comprise exposing the pretreated feedstock to an equal volume of water 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more times. In another embodiment, a pH modifier can be added. For example, an acid, a buffer, or a material that reacts with other materials present can be added to modulate the pH of the feedstock. In some embodiments, more than one pH modifier can be used, such as one or more bases, one or more bases with one or more buffers, one or more acids, one or more acids with one or more buffers, or one or more buffers. When more than one pH modifiers are utilized, they can be added at the same time or at different times. Other non-limiting exemplary methods for neutralizing feedstocks treated with alkaline substances have been described, for example in U.S. Patent Nos. 4,048,341 ; 4, 182,780; and 5,693,296.

[00177] In some embodiments, one or more acids can be combined, resulting in a buffer. Suitable acids and buffers that can be used as pH modifiers include any liquid or gaseous acid that is compatible with the microorganism. Non- limiting examples include peroxyacetic acid, sulfuric acid, lactic acid, citric acid, phosphoric acid, and hydrochloric acid. In some instances, the pH can be lowered to neutral pH or acidic pH, for example a pH of 7.0, 6.5, 6.0, 5.5, 5.0, 4.5, 4.0, or lower. In some embodiments, the pH is lowered and/or maintained within a range of about pH 4.5 to about 7.1, or about 4.5 to about 6.9, or about pH 5.0 to about 6.3, or about pH 5.5 to about 6.3, or about pH 6.0 to about 6.5, or about pH 5.5 to about 6.9 or about pH 6.2 to about 6.7.

[00178] In another embodiment, biomass can be pre-treated at an elevated temperature and/or pressure. In one embodiment biomass is pre treated at a temperature range of 20°C to 400°C. In another embodiment biomass is pretreated at a temperature of about 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 80°C, 90°C, 100°C, 120°C, 150°C, 200°C, 250°C, 300°C, 350°C, 400°C or higher. In another embodiment, elevated temperatures are provided by the use of steam, hot water, or hot gases. In one embodiment steam can be injected into a biomass containing vessel. In another embodiment the steam, hot water, or hot gas can be injected into a vessel jacket such that it heats, but does not directly contact the biomass.

[00179] In another embodiment, a biomass can be treated at an elevated pressure. In one embodiment biomass is pre treated at a pressure range of about lpsi to about 30psi. In another embodiment biomass is pre treated at a pressure or about lpsi, 2psi, 3psi, 4psi, 5psi, 6psi, 7psi, 8psi, 9psi, l Opsi, 12psi, 15psi, 18psi, 20psi, 22psi, 24psi, 26psi, 28psi, 30psi or more. In some embodiments, biomass can be treated with elevated pressures by the injection of steam into a biomass containing vessel. In other

embodiments, the biomass can be treated to vacuum conditions prior or subsequent to alkaline or acid treatment or any other treatment methods provided herein.

[00180] In one embodiment alkaline or acid pretreated biomass is washed (e.g. with water (hot or cold) or other solvent such as alcohol (e.g. ethanol)), pH neutralized with an acid, base, or buffering agent (e.g. phosphate, citrate, borate, or carbonate salt) or dried prior to fermentation. In one embodiment, the drying step can be performed under vacuum to increase the rate of evaporation of water or other solvents. Alternatively, or additionally, the drying step can be performed at elevated temperatures such as about 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 80°C, 90°C, 100°C, 120°C, 150°C, 200°C, 250°C, 300°C or more.

[00181] In some embodiments of the present invention, the pretreatment step includes a step of solids recovery. The solids recovery step can be during or after pretreatment (e.g., acid or alkali

pretreatment), or before the drying step. In some embodiments, the solids recovery step provided by the methods of the present invention includes the use of a sieve, filter, screen, or a membrane for separating the liquid and solids fractions. In one embodiment a suitable sieve pore diameter size ranges from about 0.001 microns to 8mm, such as about 0.005 microns to 3mm or about 0.01 microns to 1mm. In one embodiment a sieve pore size has a pore diameter of about O.Olmicrons, 0.02 microns, 0.05 microns, 0.1 microns, 0.5 microns, 1 micron, 2 microns, 4 microns, 5 microns, 10 microns, 20 microns, 25 microns, 50 microns, 75 microns, 100 microns, 125 microns, 150 microns, 200 microns, 250 microns, 300 microns, 400 microns, 500 microns, 750 microns, 1mm or more.

[00182] In some embodiments, biomass (e.g. corn stover) is processed or pretreated prior to fermentation. In one embodiment a method of pre-treatment includes but is not limited to, biomass particle size reduction, such as for example shredding, milling, chipping, crushing, grinding, or pulverizing. In some embodiments, biomass particle size reduction can include size separation methods such as sieving, or other suitable methods known in the art to separate materials based on size. In one embodiment size separation can provide for enhanced yields. In some embodiments, separation of finely shredded biomass (e.g. particles smaller than about 8 mm in diameter, such as, 8, 7.9, 7.7, 7.5, 7.3, 7, 6.9, 6.7, 6.5, 6.3, 6, 5.9, 5.7, 5.5, 5.3, 5, 4.9, 4.7, 4.5, 4.3, 4, 3.9, 3.7, 3.5, 3.3, 3, 2.9, 2.7, 2.5, 2.3, 2, 1.9, 1.7, 1.5, 1.3, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, or 0.1 mm) from larger particles allows the recycling of the larger particles back into the size reduction process, thereby increasing the final yield of processed biomass. In one embodiment, a fermentative mixture is provided which comprises a pretreated lignocellulosic feedstock comprising less than about 50% of a lignin component present in the feedstock prior to pretreatment and comprising more than about 60% of a hemicellulose component present in the feedstock prior to pretreatment; and a microorganism capable of fermenting a five-carbon sugar, such as xylose, arabinose or a combination thereof, and a six-carbon sugar, such as glucose, galactose, mannose or a combination thereof. In some instances, pretreatment of the lignocellulosic feedstock comprises adding an alkaline substance which raises the pH to an alkaline level, for example NaOH. In some embodiments, NaOH is added at a concentration of about 0.5%> to about 2%> by weight of the feedstock. In other embodiments, pretreatment also comprises addition of a chelating agent. In some embodiments, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium sp. Q.D or a variant thereof.

[00183] The present disclosure also provides a fermentative mixture comprising: a cellulosic feedstock pre-treated with an alkaline substance which maintains an alkaline pH, and at a temperature of from about 80°C to about 120°C; and a microorganism capable of fermenting a five-carbon sugar and a six- carbon sugar. In some instances, the five-carbon sugar is xylose, arabinose, or a combination thereof. In other instances, the six-carbon sugar is glucose, galactose, mannose, or a combination thereof. In some embodiments, the alkaline substance is NaOH. In some embodiments, NaOH is added at a

concentration of about 0.5%> to about 2%> by weight of the feedstock. In some embodiments, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium sp. Q.D or a variant thereof. In still other embodiments, the microorganism is genetically modified to enhance activity of one or more hydrolytic enzymes.

[00184] Further provided herein is a fermentative mixture comprising a cellulosic feedstock pre-treated with an alkaline substance which increases the pH to an alkaline level, at a temperature of from about 80°C to about 120°C; and a microorganism capable of uptake and fermentation of an oligosaccharide. In some embodiments the alkaline substance is NaOH. In some embodiments, NaOH is added at a concentration of about 0.5% to about 2% by weight of the feedstock. In some embodiments, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium sp. Q.D or a variant thereof. In other embodiments, the microorganism is genetically modified to express or increase expression of an enzyme capable of hydro lyzing the oligosaccharide, a transporter capable of transporting the oligosaccharide, or a combination thereof.

[00185] Another aspect of the present disclosure provides a fermentative mixture comprising a cellulosic feedstock comprising cellulosic material from one or more sources, wherein the feedstock is pre-treated with a substance which increases the pH to an alkaline level, at a temperature of from about 80°C to about 120°C; and a microorganism capable of fermenting the cellulosic material from at least two different sources to produce a fermentation end-product at substantially a same yield coefficient. In some instances, the sources of cellulosic material are corn stover, bagasse, switchgrass or poplar. In some embodiments the alkaline substance is NaOH. In some embodiments, NaOH is added at a concentration of about 0.5% to about 2% by weight of the feedstock. In some embodiments, the microorganism is a bacterium, such as a member of the genus Clostridium, for example Clostridium sp. Q.D or a variant thereof.

[00186] In some embodiments, a process for simultaneous saccharification and fermentation of cellulosic solids from biomass into biofuel or another end-product is provided. In one embodiment the process comprises treating the biomass in a closed container with a microorganism under conditions where the microorganism produces saccharolytic enzymes sufficient to substantially convert the biomass into oligomers, monosaccharides and disaccharides. In one embodiment the microorganism subsequently converts the oligomers, monosaccharides and disaccharides into ethanol and/or another biofuel or product.

[00187] In an another embodiment, a process for saccharification and fermentation comprises treating the biomass in a container with the microorganism, and adding one or more enzymes before, concurrent or after contacting the biomass with the microorganism, wherein the enzymes added aid in the breakdown or detoxification of carbohydrates or lignocellulosic material.

[00188] In one embodiment, the bioconversion process comprises a separate hydrolysis and fermentation (SHF) process. In an SHF embodiment, the enzymes can be used under their optimal conditions regardless of the fermentation conditions and the microorganism is only required to ferment released sugars. In this embodiment, hydrolysis enzymes are externally added. [00189] In another embodiment, the bioconversion process comprises a saccharification and fermentation (SSF) process. In an SSF embodiment, hydrolysis and fermentation take place in the same reactor under the same conditions.

[00190] In another embodiment, the bioconversion process comprises a consolidated bioprocess (CBP). In essence, CBP is a variation of SSF in which the enzymes are produced by the microorganism that carries out the fermentation. In this embodiment, enzymes can be both externally added enzymes and enzymes produced by the fermentative microorganism. In this embodiment, biomass is partially hydrolyzed with externally added enzymes at their optimal condition, the slurry is then transferred to a separate tank in which the fermentative microorganism (e.g. Clostridium sp. Q.D or a variant thereof) converts the hydrolyzed sugar into the desired product (e.g. fuel or chemical) and completes the hydrolysis of the residual cellulose and hemicellulose.

[00191] In one embodiment, pretreated biomass is partially hydrolyzed by externally added enzymes to reduce the viscosity. Hydrolysis occurs at the optimal pH and temperature conditions (e.g. pH 5.5, 50°C for fungal cellulases). Hydrolysis time and enzyme loading can be adjusted such that conversion is limited to cellodextrins (soluble and insoluble) and hemicellulose oligomers. At the conclusion of the hydrolysis time, the resultant mixture can be subjected to fermentation conditions. For example, the resultant mixture can be pumped over time (fed batch) into a reactor containing a microorganism (e.g. Clostridium sp. Q.D or a variant thereof) and media. The microorganism can then produce endogenous enzymes to complete the hydrolysis into fermentable sugars (soluble oligomers) and convert those sugars into ethanol and/or other products in a production tank. The production tank can then be operated under fermentation optimal conditions (e.g. pH 6.5, 35°C). In this way externally added enzyme is minimized due to operation under the enzyme's optimal conditions and due to a portion of the enzyme coming from the microorganism (e.g. Clostridium sp. Q.D or a variant thereof).

[00192] In some embodiments, exogenous enzymes added include a xylanase, a hemicellulase, a glucanase or a glucosidase. In some embodiments, exogenous enzymes added do not include a xylanase, a hemicellulase, a glucanase or a glucosidase. In other embodiments, the amount of exogenous cellulase is greatly reduced, one-quarter or less of the amount normally added to a fermentation by a microorganism that cannot saccharify the biomass. In some embodiments, an exogenous enzyme added is a cellulase. In one example, the cellulase is

NS50013, Novozymes, A/S, Krogshoejvej, 36, 2880, Bagsvaerd, Denmark). In another example, exogenous enzymes include a β-glucanase/xylanase mix that contains cellulase and hemicellulase activity.

In one embodiment a second microorganism can be used to convert residual carbohydrates into a fermentation end-product. In one embodiment the second microorganism is a yeast such as

Saccharomyces cerevisiae; a Clostridia species such as C. thermocellum, C. acetobutylicum, or C. cellovorans; or Zymomonas mobilis. [00193] In one embodiment, a process of producing a biofuel or chemical product from a lignin- containing biomass is provided. In one embodiment the process comprises: 1) contacting the lignin- containing biomass with an aqueous alkaline solution at a concentration sufficient to hydrolyze at least a portion of the lignin-containing biomass; 2) neutralizing the treated biomass to a pH between 5 to 9 (e.g. 5.5, 6, 6.5, 7, 7.5, 8, 8.5, or 9); 3) treating the biomass in a closed container with a Clostridium microorganism, (such as Clostridium sp. Q.D or variants thereof.) under conditions wherein the Clostridium microorganism, optionally with the addition of one or more hydrolytic enzymes to the container, substantially converts the treated biomass into oligomers, monosaccharides and

disaccharides, and/or biofuel or other fermentation end-product; and 4) optionally, introducing a culture of a second microorganism wherein the second microorganism is capable of substantially converting the oligomers, monosaccharides and disaccharides into biofuel.

[00194] Of various molecules typically found in biomass, cellulose is useful as a starting material for the production of fermentation end-products in methods and compositions described herein. Cellulose is one of the major components in plant cell wall. Cellulose is a linear condensation polymer consisting of D-anhydro glucopyranose joined together by -l ,4-linkage. The degree of polymerization ranges from 100 to 20,000. Adjacent cellulose molecules are coupled by extensive hydrogen bonds and van der Waals forces, resulting in a parallel alignment. The parallel sheet-like structure renders cellulose very stable.

[00195] Pretreatment can also include utilization of one or more strong cellulose swelling agents that facilitate disruption of the fiber structure and thus rendering the cellulosic material more amendable to saccharification and fermentation. Some considerations have been given in selecting an efficient method of swelling for various cellulosic material: 1) the hydrogen bonding fraction; 2) solvent molar volume; 3) the cellulose structure. The width and distribution of voids (between the chains of linear cellulosic polymer) are important as well. It is known that the swelling is more pronounced in the presence of electrostatic repulsion, provided by alkali solution or ionic surfactants. Of course, with respect to utilization of any of the methods disclosed herein, conditioning of a biomass can be concurrent to contact with a microorganism that is capable of saccharification and fermentation. In addition, other examples describing the pretreatment of lignocellulosic biomass have been published as U.S. Pat. Nos. 4,304,649, 5,366,558, 5,41 1,603, and 5,705,369.

[00196] In one embodiment, pretreatment of biomass comprises enzyme hydrolysis with one or more enzymes from Clostridium sp. Q.D. In one embodiment, pretreatment of biomass comprises enzyme hydrolysis with one or more enzymes from Clostridium sp. Q.D, wherein the one or more enzyme is selected from the group consisting of endonucleases, exonucleases, cellobiohydrolases, beta- glucosidases, glycoside hydrolases, glycosyltransferases, lyases, esterases and proteins containing carbohydrate-binding modules. In one embodiment, biomass can be pretreated with a hydrolase identified in C. phytofermentans. [00197] In one embodiment, pretreatment of biomass comprises enzyme hydrolysis with one or more of enzymes listed in Table 1. Table 1 show examples of known activities of some of the glycoside hydrolases, lyases, esterases, and proteins containing carbohydrate-binding modules family members predicted to be present in Clostridia, for example, C. phytofermentans. Known activities are listed by activity and corresponding PC number as determined by the International Union of Biochemistry and Molecular Biology.

[00198] TABLE 1: Known activities of glycoside hydrolase family members

[00199] In one embodiment, enzymes that degrade polysaccharides are used for the pretreatment of biomass and can include enzymes that degrade cellulose, namely, cellulases. Examples of some cellulases include endocellulases (EC 3.2.1.4) and exo-cellulases (EC 3.2.1.91), and hydrolyze beta-1,4- glucosidic bonds. Members of the GH5, GH9 and GH48 families can have both exo- and endo- cellulase activity.

[00200] In one embodiment, enzymes that degrade polysaccharides are used for the pretreatment of biomass and can include enzymes that have the ability to degrade hemicellulose, namely,

hemicellulases. Hemicellulose can be a major component of plant biomass and can contain a mixture of pentoses and hexoses, for example, D-xylopyranose, L-arabinofuranose, D-mannopyranose, D- glucopyranose, D-galactopyranose, D-glucopyranosyluronic acid and other sugars. In one embodiment, predicted hemicellulases identified in C. phytofermentans used in the pretreatment of biomass include enzymes active on the linear backbone of hemicellulose, for example, endo-beta- 1,4-D-xylanase (EC 3.2.1.8), such as GH5, GH10, GH1 1 , and GH43 family members; 1 ,4-beta-D-xyloside xylohydrolase (EC 3.2.1.37), such as GH30, GH43, and GH3 family members; and beta-mannanase (EC 3.2.1.78), such as GH26 family members.

[00201] In one embodiment, enzymes that degrade polysaccharides are used for the pretreatment of biomass and can include enzymes that have the ability to degrade pectin, namely, pectinases. In plant cell walls, the cross-linked cellulose network can be embedded in a matrix of pectins that can be covalently cross-linked to xyloglucans and certain structural proteins. Pectin can comprise

homogalacturonan (HG) or rhamnogalacturonan (RH).

[00202] In one embodiment, the parameters of the pretreatment are changed to obtain a high

concentration of hemicellulose and a low concentration of lignins. In one embodiment, the parameters of the pretreatment are changed to obtain a high concentration of hemicellulose and a low concentration of lignins such that concentration of the components in the pretreated stock is optimal for fermentation with a microbe such as Clostridium sp. Q.D.

Biomass Processing

[00203] Described herein are compositions and methods allowing saccharification and fermentation to one or more industrially useful fermentation end-products. Saccharification includes conversion of long-chain sugar polymers, such as cellulose, to monosaccharides, disaccharides, trisaccharides, and oligosaccharides of up to about seven monomer units, as well as similar sized chains of sugar derivatives and combinations of sugars and sugar derivatives. The chain-length for saccharides can be longer {e.g. 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, or 20 monomer units or more) and or shorter {e.g. 1, 2, 3, 4, 5, 6 monomer units). As used herein, "directly processing" means that a microorganism is capable of both hydro lyzing biomass and fermenting without the need for conditioning the biomass, such as subjecting the biomass to chemical, heat, enzymatic treatment or combinations thereof.

[00204] Methods and compositions described herein contemplate utilizing fermentation process for extracting industrially useful fermentation end-products from biomass. The term "fermentation" as used herein has its ordinary meaning as known to those skilled in the art and can include culturing of a microorganism or group of microorganisms in or on a suitable medium for the microorganisms. The microorganisms can be aerobes, anaerobes, facultative anaerobes, heterotrophs, autotrophs, photoautotrophs, photoheterotrophs, chemoautotrophs, and/or chemoheterotrophs. The cellular activity, including cell growth can be growing aerobic, microaerophilic, or anaerobic. The cells can be in any phase of growth, including lag (or conduction), exponential, transition, stationary, death, dormant, vegetative, sporulating, etc.

[00205] Organisms disclosed herein can be incorporated into methods and compositions of the invention so as to enhance fermentation end-product yield and/or rate of production. One example of such a microorganism is Clostridium sp. Q.D, which can simultaneously hydrolyze and ferment lignocellulosic biomass. Furthermore, Clostridium sp. Q.D is capable of hydro lyzing and fermenting hexose (C6) and pentose (C5) polysaccharides (e.g. carbohydrates). In addition, Clostridium sp. Q.D is capable of acting directly on lignocellulosic biomass without any pretreatment. Additionally,

Clostridium sp. Q.D can produce hemicellulases, pectinases, xylansases, or chitinases.

[00206] In one embodiment, the invention provides for modified microorganisms which ferment hexose and pentose polysaccharides which are part of a biomass. In some embodiments, a Clostridium hydrolyzes and ferment hexose and pentose polysaccharides which are part of a biomass. In a further embodiment, Clostridium sp. Q.D or variants thereof hydro lyze and ferment hexose and pentose polysaccharides which are part of a biomass. In some embodiments, the biomass comprises lignocellulose. In some embodiments, the biomass comprises hemicellulose.

Co-Culture Methods and Compositions

[00207] Methods of the invention can also included co-culture with an microorganism that naturally produces or is genetically modified to produce one or more enzymes, such as hydrolytic enzymes (such as cellulase(s), hemicellulase(s), or pectinases etc.) or antioxidants (such as catalase, superoxide dismutase or glutathione peroxidase). A culture medium containing such a microorganism can be contacted with biomass (e.g., in a bioreactor) prior to, concurrent with, or subsequent to contact with a second microorganism. In one embodiment a first microorganism produces saccharifying enzyme while a second microorganism ferments C5 and C6 sugars. In one embodiment, the first

microorganism is C. sp. Q.D. Mixtures of microorganisms can be provided as solid mixtures (e.g., freeze-dried mixtures), or as liquid dispersions of the microorganisms, and grown in co-culture with a second microorganism. Co-culture methods capable of use with the present invention are known, such as those disclosed in U.S. Patent Application Publication No. 20070178569, which is hereby incorporated by reference in its entirety.

Fermentation end-product

[00208] The term "fuel" or "biofuel" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more compounds suitable as liquid fuels, gaseous fuels, biodiesel fuels (long-chain alkyl (methyl, propyl or ethyl) esters), heating oils (hydrocarbons in the 14-20 carbon range), reagents, chemical feedstocks and includes, but is not limited to, hydrocarbons (both light and heavy), hydrogen, methane, hydroxy compounds such as alcohols (e.g. ethanol, butanol, propanol, methanol, etc.), and carbonyl compounds such as aldehydes and ketones (e.g. acetone, formaldehyde, 1- propanal, etc.).

[00209] The term "fermentation end-product" or "end-product" as used herein has its ordinary meaning as known to those skilled in the art and can include one or more biofuels,or chemicals,(such as additives, processing aids, food additives, organic acids (e.g. acetic, lactic, formic, citric acid etc.), derivatives of organic acids such as esters (e.g. wax esters, glycerides, etc.) or other compounds). These end-products include, but are not limited to, an alcohol (such as ethanol, butanol, methanol, 1 , 2- propanediol, or 1, 3 -propanediol), an acid (such as lactic acid, formic acid, acetic acid, succinic acid, or pyruvic acid), enzymes such as cellulases, polysaccharases, lipases, proteases, ligninases, and hemicellulases and can be present as a pure compound, a mixture, or an impure or diluted form. In one embodiment a fermentation end-product is made using a process or microorganism disclosed herein. In another embodiment production of a fermentation end-product is enhanced through saccharification and fermentation using enzyme- enhancing products or processes.

[00210] In one embodiment a fermentation end-product is a 1,4 diacid (succinic, fumaric and malic), 2,5 furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3 -hydroxybutyro lactone, glycerol, sorbitol, xylitol/arabitol, butanediol, butanol, isopentenyl diphosphate, methane, methanol, ethane, ethene, ethanol, n-propane, 1-propene, 1- propanol, propanal, acetone, propionate, n-butane, 1 -butene, 1 -butanol, butanal, butanoate, isobutanal, isobutanol, 2-methylbutanal, 2-methylbutanol, 3-methylbutanal, 3-methylbutanol, 2-butene, 2-butanol, 2-butanone, 2,3-butanediol, 3-hydroxy-2-butanone, 2,3-butanedione, ethylbenzene, ethenylbenzene, 2- phenylethanol, phenylacetaldehyde, 1 -phenylbutane, 4-phenyl-l -butene, 4-phenyl-2-butene, 1-phenyl-

2- butene, l-phenyl-2-butanol, 4-phenyl-2-butanol, 1 -phenyl-2-butanone, 4-phenyl-2-butanone, 1- phenyl-2,3-butandiol, 1 -phenyl-3-hydroxy-2-butanone, 4-phenyl-3-hydroxy-2-butanone, 1 -phenyl-2,3- butanedione, n-pentane, ethylphenol, ethenylphenol, 2-(4-hydroxyphenyl)ethanol, 4- hydroxyphenylacetaldehyde, 1 -(4-hydroxyphenyl) butane, 4-(4-hydroxyphenyl)-l -butene, 4-(4- hydroxyphenyl)-2-butene, 1 -(4-hydroxyphenyl)- 1 -butene, l-(4-hydroxyphenyl)-2-butanol, 4-(4- hydroxyphenyl)-2-butanol, l-(4-hydroxyphenyl)-2-butanone, 4-(4-hydroxyphenyl)-2-butanone, l-(4- hydroxyphenyl)-2,3-butandiol, 1 -(4-hydroxyphenyl)-3-hydroxy-2-butanone, 4-(4-hydroxyphenyl)-3- hydroxy-2-butanone, l-(4-hydroxyphenyl)-2,3-butanonedione, indolylethane, indolylethene, 2-(indole-

3- )ethanol, n-pentane, 1-pentene, 1-pentanol, pentanal, pentanoate, 2-pentene, 2-pentanol, 3-pentanol, 2-pentanone, 3-pentanone, 4-methylpentanal, 4-methylpentanol, 2,3-pentanediol, 2-hydroxy-3- pentanone, 3 -hydroxy-2 -pentanone, 2,3-pentanedione, 2-methylpentane, 4-methyl-l-pentene, 4-methyl- 2-pentene, 4-methyl-3-pentene, 4-methyl-2-pentanol, 2-methyl-3-pentanol, 4-methyl-2-pentanone, 2- methyl-3-pentanone, 4-methyl-2,3-pentanediol, 4-methyl-2-hydroxy-3-pentanone, 4-methyl-3-hydroxy- 2-pentanone, 4-methyl-2,3-pentanedione, 1-phenylpentane, 1 -phenyl- 1-pentene, l-phenyl-2-pentene, 1- phenyl-3-pentene, l-phenyl-2-pentanol, l-phenyl-3-pentanol, l-phenyl-2-pentanone, l-phenyl-3- pentanone, l-phenyl-2,3-pentanediol, l-phenyl-2-hydroxy-3-pentanone, l-phenyl-3-hydroxy-2- pentanone, l-phenyl-2,3-pentanedione, 4-methyl- 1-phenylpentane, 4-methyl-l-phenyl-l-pentene, 4- methyl- 1 -phenyl-2-pentene, 4-methyl- 1 -phenyl-3-pentene, 4-methyl- 1 -phenyl-3-pentanol, 4-methyl- 1 - phenyl-2-pentanol, 4-methyl-l-phenyl-3-pentanone, 4-methyl- l-phenyl-2-pentanone, 4-methyl-l- phenyl-2,3-pentanediol, 4-methyl-l-phenyl-2,3-pentanedione, 4-methyl- l -phenyl-3-hy droxy-2- pentanone, 4-methyl-l-phenyl-2-hydroxy-3-pentanone, 1 -(4-hydroxyphenyl) pentane, l-(4- hydroxyphenyl)- 1-pentene, l-(4-hydroxyphenyl)-2-pentene, l-(4-hydroxyphenyl)-3-pentene, l-(4- hydroxyphenyl)-2-pentanol, l-(4-hydroxyphenyl)-3-pentanol, l-(4-hydroxyphenyl)-2-pentanone, l-(4- hydroxyphenyl)-3-pentanone, 1 -(4-hydroxyphenyl)-2,3-pentanediol, 1 -(4-hydroxyphenyl)-2-hydroxy-3- pentanone, l-(4-hydroxyphenyl)-3-hydroxy-2-pentanone, l-(4-hydroxyphenyl)-2,3-pentanedione, 4- methyl-l-(4-hydroxyphenyl) pentane, 4-methyl-l -(4-hydroxyphenyl)-2-pentene, 4-methyl-l -(4- hydroxyphenyl)-3-pentene, 4-methyl- 1 -(4-hydroxyphenyl)- 1 -pentene, 4-methyl- 1 -(4-hydroxyphenyl)-

3- pentanol, 4-methyl- 1 -(4-hydroxyphenyl)-2-pentanol, 4-methyl- 1 -(4-hydroxyphenyl)-3-pentanone, 4- methyl- 1 -(4-hydroxyphenyl)-2-pentanone, 4-methyl- 1 -(4-hydroxyphenyl)-2,3-pentanediol, 4-methyl- 1 - (4-hydroxyphenyl)-2,3-pentanedione, 4-methyl-l-(4-hydroxyphenyl)-3-hydroxy-2-pentanone, 4- methyl-l-(4-hydroxyphenyl)-2-hydroxy-3-pentanone, l -indole-3-pentane, l-(indole-3)-l -pentene, 1- (indole-3)-2-pentene, l-(indole-3)-3-pentene, l-(indole-3)-2-pentanol, l-(indole-3)-3-pentanol, 1- (indole-3)-2-pentanone, l-(indole-3)-3-pentanone, l-(indole-3)-2,3-pentanediol, l-(indole-3)-2- hydroxy-3-pentanone, 1 -(indole-3)-3-hydroxy-2-pentanone, 1 -(indole-3)-2,3-pentanedione, 4-methyl-l - (indole-3-)pentane, 4-methyl-l -(indole-3)-2-pentene, 4-methyl-l -(indole-3)-3-pentene, 4-methyl-l - (indole-3)-l -pentene, 4-methyl-2-(indole-3)-3-pentanol, 4-methyl- l-(indole-3)-2-pentanol, 4-methyl- 1- (indole-3)-3-pentanone, 4-methyl- l-(indole-3)-2-pentanone, 4-methyl-l -(indole-3)-2,3-pentanediol, 4- methyl-l-(indole-3)-2,3-pentanedione, 4-methyl-l -(indole-3)-3-hydroxy-2-pentanone, 4-methyl-l - (indole-3)-2-hydroxy-3-pentanone, n-hexane, 1-hexene, 1-hexanol, hexanal, hexanoate, 2-hexene, 3- hexene, 2-hexanol, 3-hexanol, 2-hexanone, 3-hexanone, 2,3-hexanediol, 2,3-hexanedione, 3,4- hexanediol, 3,4-hexanedione, 2-hydroxy-3-hexanone, 3-hydroxy-2-hexanone, 3-hydroxy-4-hexanone,

4- hydroxy-3-hexanone, 2-methylhexane, 3-methylhexane, 2-methyl-2-hexene, 2-methyl-3-hexene, 5- methyl- 1-hexene, 5-methyl-2-hexene, 4-methyl- 1-hexene, 4-methyl-2-hexene, 3-methyl-3-hexene, 3- methyl-2-hexene, 3 -methyl- 1-hexene, 2-methyl-3-hexanol, 5-methyl-2-hexanol, 5-methyl-3-hexanol, 2- methyl-3-hexanone, 5-methyl-2-hexanone, 5-methyl-3-hexanone, 2-methyl-3,4-hexanediol, 2-methyl- 3,4-hexanedione, 5-methyl-2,3-hexanediol, 5-methyl-2,3-hexanedione, 4-methyl-2,3-hexanediol, 4- methyl-2,3-hexanedione, 2-methyl-3-hydroxy-4-hexanone, 2-methyl-4-hydroxy-3-hexanone, 5-methyl- 2-hydroxy-3-hexanone, 5-methyl-3-hydroxy-2-hexanone, 4-methyl-2-hydroxy-3-hexanone, 4-methyl-3- hydroxy-2-hexanone, 2,5-dimethylhexane, 2,5-dimethyl-2-hexene, 2,5-dimethyl-3-hexene, 2,5- dimethyl-3-hexanol, 2,5-dimethyl-3-hexanone, 2,5-dimethyl-3,4-hexanediol, 2,5-dimethyl-3,4- hexanedione, 2,5-dimethyl-3-hydroxy-4-hexanone, 5-methyl-l-phenylhexane, 4-methyl- 1- phenylhexane, 5-methyl-l -phenyl- 1-hexene, 5-methyl-l-phenyl-2-hexene, 5-methyl-l-phenyl-3- hexene, 4-methyl-l -phenyl- 1-hexene, 4-methyl- 1 -phenyl-2-hex ene, 4-methyl-l -phenyl-3 -hex ene, 5- methyl- 1 -phenyl-2-hexanol, 5-methyl- 1 -phenyl-3 -hexanol, 4-methyl- 1 -phenyl-2-hexanol, 4-methyl- 1 - phenyl-3 -hexanol, 5-methyl- l-phenyl-2-hexanone, 5-methyl-l -phenyl-3 -hexanone, 4-methyl- 1 -phenyl- 2-hexanone, 4-methyl-l -phenyl-3 -hexanone, 5-methyl- l-phenyl-2,3-hexanediol, 4-methyl-l -phenyl- 2,3-hexanediol, 5-methyl-l -phenyl-3 -hydroxy-2-hexanone, 5-methyl-l -phenyl-2-hydroxy-3 -hexanone, 4-methyl- 1 -phenyl-3 -hydroxy-2-hexanone, 4-methyl- 1 -phenyl-2-hydroxy-3 -hexanone, 5-methyl- 1 - phenyl-2,3-hexanedione, 4-methyl-l -phenyl-2,3-hexanedione, 4-methyl-l -(4-hydroxyphenyl) hexane, 5- methyl- 1 -(4-hydroxyphenyl)- 1 -hexene, 5-methyl- 1 -(4-hydroxyphenyl)-2-hexene, 5-methyl- 1 -(4- hydroxyphenyl)-3 -hexene, 4-methyl- 1 -(4-hydroxyphenyl)- 1 -hexene, 4-methyl- 1 -(4-hydroxyphenyl)-2- hexene, 4-methyl- l -(4-hydroxyphenyl)-3 -hexene, 5-methyl- l-(4-hydroxyphenyl)-2-hexanol, 5-methyl- 1 -(4-hydroxyphenyl)-3-hexanol, 4-methyl- 1 -(4-hydroxyphenyl)-2-hexanol, 4-methyl- 1 -(4- hydroxyphenyl)-3-hexanol, 5-methyl- l-(4-hydroxyphenyl)-2-hexanone, 5-methyl- 1 -(4- hydroxyphenyl)-3-hexanone, 4-methyl- l -(4-hydroxyphenyl)-2-hexanone, 4-methyl- 1 -(4- hydroxyphenyl)-3-hexanone, 5-methyl-l -(4-hydroxyphenyl)-2,3-hexanediol, 4-methyl- 1 -(4- hydroxyphenyl)-2,3-hexanediol, 5-methyl-l-(4-hydroxyphenyl)-3-hydroxy-2-hexanone, 5-methyl- 1 -(4- hydroxyphenyl)-2-hydroxy-3-hexanone, 4-methyl- l-(4-hydroxyphenyl)-3-hydroxy-2-hexanone, 4- methyl-l-(4-hydroxyphenyl)-2-hydroxy-3-hexanone, 5-methyl- l-(4-hydroxyphenyl)-2,3-hexanedione, 4-methyl-l-(4-hydroxyphenyl)-2,3-hexanedione, 4-methyl- l-(indole-3-)hexane, 5-methyl- l-(indole-3)-

1 - hexene, 5-methyl- l-(indole-3)-2-hexene, 5-methyl- l-(indole-3)-3 -hexene, 4-methyl-l-(indole-3)-l- hexene, 4-methyl- l -(indole-3)-2-hexene, 4-methyl-l-(indole-3)-3-hexene, 5-methyl- l-(indole-3)-2- hexanol, 5-methyl- l-(indole-3)-3-hexanol, 4-methyl- l-(indole-3)-2-hexanol, 4-methyl-l-(indole-3)-3- hexanol, 5-methyl- l-(indole-3)-2-hexanone, 5-methyl- l-(indole-3)-3-hexanone, 4-methyl- l-(indole-3)-

2- hexanone, 4-methyl-l -(indole-3)-3-hexanone, 5-methyl-l-(indole-3)-2,3-hexanediol, 4-methyl-l- (indole-3)-2,3-hexanediol, 5-methyl- l-(indole-3)-3-hydroxy-2-hexanone, 5-methyl- l-(indole-3)-2- hydroxy-3-hexanone, 4-methyl-l -(indole-3)-3-hydroxy-2-hexanone, 4-methyl- l-(indole-3)-2-hy droxy-

3- hexanone, 5-methyl-l -(indole-3)-2,3-hexanedione, 4-methyl-l-(indole-3)-2,3-hexanedione, n- heptane, 1-heptene, 1 -heptanol, heptanal, heptanoate, 2-heptene, 3-heptene, 2-heptanol, 3 -heptanol, 4- heptanol, 2-heptanone, 3-heptanone, 4-heptanone, 2,3-heptanediol, 2,3-heptanedione, 3,4-heptanediol, 3,4-heptanedione, 2-hydroxy-3-heptanone, 3-hydroxy-2-heptanone, 3-hydroxy-4-heptanone, 4- hydroxy-3-heptanone, 2-methylheptane, 3-methylheptane, 6-methyl-2-heptene, 6-methyl-3-heptene, 2- methyl-3-heptene, 2-methyl-2-heptene, 5-methyl-2-heptene, 5-methyl-3-heptene, 3-methyl-3-heptene,

2- methyl-3 -heptanol, 2-methyl-4-heptanol, 6-methyl-3 -heptanol, 5-methyl-3 -heptanol, 3-methyl-4- heptanol, 2-methyl-3-heptanone, 2-methyl-4-heptanone, 6-methyl-3-heptanone, 5-methyl-3-heptanone,

3- methyl-4-heptanone, 2-methyl-3,4-heptanediol, 2-methyl-3,4-heptanedione, 6-methyl-3,4- heptanediol, 6-methyl-3,4-heptanedione, 5-methyl-3,4-heptanediol, 5-methyl-3,4-heptanedione, 2- methyl-3-hydroxy-4-heptanone, 2-methyl-4-hydroxy-3-heptanone, 6-methyl-3-hydroxy-4-heptanone, 6- methyl-4-hydroxy-3-heptanone, 5-methyl-3-hydroxy-4-heptanone, 5-methyl-4-hydroxy-3-heptanone, 2,6-dimethylheptane, 2,5-dimethylheptane, 2,6-dimethyl-2-heptene, 2,6-dimethyl-3-heptene, 2,5- dimethyl-2-heptene, 2,5-dimethyl-3-heptene, 3,6-dimethyl-3-heptene, 2,6-dimethyl-3-heptanol, 2,6- dimethyl-4-heptanol, 2,5-dimethyl-3-heptanol, 2,5-dimethyl-4-heptanol, 2,6-dimethyl-3,4-heptanediol, 2,6-dimethyl-3,4-heptanedione, 2,5-dimethyl-3,4-heptanediol, 2,5-dimethyl-3,4-heptanedione, 2,6- dimethyl-3-hydroxy-4-heptanone, 2,6-dimethyl-4-hydroxy-3-heptanone, 2,5-dimethyl-3-hydroxy-4- heptanone, 2,5-dimethyl-4-hydroxy-3-heptanone, n-octane, 1-octene, 2-octene, 1-octanol, octanal, octanoate, 3-octene, 4-octene, 4-octanol, 4-octanone, 4,5-octanediol, 4,5-octanedione, 4-hydroxy-5- octanone, 2-methyloctane, 2-methyl-3-octene, 2-methyl-4-octene, 7-methyl-3-octene, 3-methyl-3- octene, 3-methyl-4-octene, 6-methyl-3-octene, 2-methyl-4-octanol, 7-methyl-4-octanol, 3-methyl-4- octanol, 6-methyl-4-octanol, 2-methyl-4-octanone, 7-methyl-4-octanone, 3-methyl-4-octanone, 6- methyl-4-octanone, 2-methyl-4,5-octanediol, 2-methyl-4,5-octanedione, 3-methyl-4,5-octanediol, 3- methyl-4,5-octanedione, 2-methyl-4-hydroxy-5-octanone, 2-methyl-5-hydroxy-4-octanone, 3-methyl-4- hydroxy-5-octanone, 3-methyl-5-hydroxy-4-octanone, 2,7-dimethyloctane, 2,7-dimethyl-3-octene, 2,7- dimethyl-4-octene, 2,7-dimethyl-4-octanol, 2,7-dimethyl-4-octanone, 2,7-dimethyl-4,5-octanediol, 2,7- dimethyl-4,5-octanedione, 2,7-dimethyl-4-hydroxy-5-octanone, 2,6-dimethyloctane, 2,6-dimethyl-3- octene, 2,6-dimethyl-4-octene, 3,7-dimethyl-3-octene, 2,6-dimethyl-4-octanol, 3,7-dimethyl-4-octanol, 2,6-dimethyl-4-octanone, 3,7-dimethyl-4-octanone, 2,6-dimethyl-4,5-octanediol, 2,6-dimethyl-4,5- octanedione, 2,6-dimethyl-4-hydroxy-5-octanone, 2,6-dimethyl-5-hydroxy-4-octanone, 3,6- dimethyloctane, 3,6-dimethyl-3-octene, 3,6-dimethyl-4-octene, 3,6-dimethyl-4-octanol, 3,6-dimethyl-4- octanone, 3,6-dimethyl-4,5-octanediol, 3,6-dimethyl-4,5-octanedione, 3,6-dimethyl-4-hydroxy-5- octanone, n-nonane, 1 -nonene, 1 -nonanol, nonanal, nonanoate, 2-methylnonane, 2-methyl-4-nonene, 2- methyl-5-nonene, 8-methyl-4-nonene, 2-methyl-5-nonanol, 8-methyl-4-nonanol, 2-methyl-5-nonanone, 8-methyl-4-nonanone, 8-methyl-4,5-nonanediol, 8-methyl-4,5-nonanedione, 8-methyl-4-hydroxy-5- nonanone, 8-methyl-5-hydroxy-4-nonanone, 2,8-dimethylnonane, 2,8-dimethyl-3-nonene, 2,8- dimethyl-4-nonene, 2,8-dimethyl-5-nonene, 2,8-dimethyl-4-nonanol, 2,8-dimethyl-5-nonanol, 2,8- dimethyl-4-nonanone, 2,8-dimethyl-5-nonanone, 2,8-dimethyl-4,5-nonanediol, 2,8-dimethyl-4,5- nonanedione, 2,8-dimethyl-4-hydroxy-5-nonanone, 2,8-dimethyl-5-hydroxy-4-nonanone, 2,7- dimethylnonane, 3,8-dimethyl-3-nonene, 3,8-dimethyl-4-nonene, 3,8-dimethyl-5-nonene, 3,8-dimethyl- 4-nonanol, 3,8-dimethyl-5-nonanol, 3,8-dimethyl-4-nonanone, 3,8-dimethyl-5-nonanone, 3,8-dimethyl- 4,5-nonanediol, 3,8-dimethyl-4,5-nonanedione, 3,8-dimethyl-4-hydroxy-5-nonanone, 3,8-dimethyl-5- hydroxy-4-nonanone, n-decane, 1-decene, 1-decanol, decanoate, 2,9-dimethyldecane, 2,9-dimethyl-3- decene, 2,9-dimethyl-4-decene, 2,9-dimethyl-5-decanol, 2,9-dimethyl-5-decanone, 2,9-dimethyl-5,6- decanediol, 2,9-dimethyl-6-hydroxy-5-decanone, 2,9-dimethyl-5,6-decanedionen-undecane, 1- undecene, 1-undecanol, undecanal. undecanoate, n-dodecane, 1-dodecene, 1-dodecanol, dodecanal, dodecanoate, n-dodecane, 1 -decadecene, n-tridecane, 1-tridecene, 1-tridecanol, tridecanal, tridecanoate, n-tetradecane, 1 -tetradecene, 1 -tetradecanol, tetradecanal, tetradecanoate, n-pentadecane, 1- pentadecene, 1-pentadecanol, pentadecanal, pentadecanoate, n-hexadecane, 1 -hexadecene, 1- hexadecanol, hexadecanal, hexadecanoate, n-heptadecane, 1 -heptadecene, 1 -heptadecanol,

heptadecanal, heptadecanoate, n-octadecane, 1 -octadecene, 1-octadecanol, octadecanal, octadecanoate, n-nonadecane, 1 -nonadecene, 1 -nonadecanol, nonadecanal, nonadecanoate, eicosane, 1-eicosene, 1- eicosanol, eicosanal, eicosanoate, 3 -hydroxy propanal, 1,3-propanediol, 4-hydroxybutanal, 1,4- butanediol, 3-hydroxy-2-butanone, 2,3-butandiol, 1,5-pentane diol, homocitrate, homoisocitorate, b- hydroxy adipate, glutarate, glutarsemialdehyde, glutaraldehyde, 2-hydroxy-l -cyclopentanone, 1 ,2- cyclopentanediol, cyclop entanone, cyclopentanol, (S)-2-acetolactate, (R)-2,3-Dihydroxy-isovalerate, 2- oxoisovalerate, isobutyryl-CoA, isobutyrate, isobutyraldehyde, 5-amino pentaldehyde, 1 , 10- diaminodecane, l , 10-diamino-5-decene, l , 10-diamino-5-hydroxydecane, l , 10-diamino-5-decanone, l , 10-diamino-5,6-decanediol, l , 10-diamino-6-hydroxy-5-decanone, phenylacetoaldehyde, 1 ,4- diphenylbutane, 1 ,4-diphenyl-l -butene, 1 ,4-diphenyl-2-butene, 1 ,4-diphenyl-2-butanol, 1 ,4-diphenyl-2- butanone, 1 ,4-diphenyl-2,3-butanediol, 1 ,4-diphenyl-3-hydroxy-2-butanone, 1 -(4-hydeoxyphenyl)-4- phenylbutane, 1 -(4-hydeoxyphenyl)-4-phenyl- 1 -butene, 1 -(4-hydeoxyphenyl)-4-phenyl-2-butene, 1 -(4- hydeoxyphenyl)-4-phenyl-2-butanol, 1 -(4-hydeoxyphenyl)-4-phenyl-2-butanone, 1 -(4-hydeoxyphenyl)- 4-phenyl-2,3-butanediol, 1 -(4-hydeoxyphenyl)-4-phenyl-3-hydroxy-2-butanone, 1 -(indole-3)-4- phenylbutane, 1 -(indole-3)-4-phenyl- 1 -butene, 1 -(indole-3)-4-phenyl-2-butene, 1 -(indole-3)-4-phenyl- 2-butanol, 1 -(indole-3)-4-phenyl-2-butanone, 1 -(indole-3)-4-phenyl-2,3-butanediol, 1 -(indole-3)-4- phenyl-3-hydroxy-2-butanone, 4-hydroxyphenylacetoaldehyde, 1 ,4-di(4-hydroxyphenyl)butane, 1 ,4- di(4-hydroxyphenyl)- 1 -butene, 1 ,4-di(4-hydroxyphenyl)-2-butene, 1 ,4-di(4-hydroxyphenyl)-2-butanol, 1 ,4-di(4-hydroxyphenyl)-2-butanone, 1 ,4-di(4-hydroxyphenyl)-2,3-butanediol, 1 ,4-di(4- hydroxyphenyl)-3-hydroxy-2-butanone, 1 -(4-hydroxyphenyl)-4-(indole-3-)butane, 1 -(4- hydroxyphenyl)-4-(indole-3)- 1 -butene, 1 -di(4-hydroxyphenyl)-4-(indole-3)-2-butene, 1 -(4- hydroxyphenyl)-4-(indole-3)-2-butanol, 1 -(4-hydroxyphenyl)-4-(indole-3)-2-butanone, 1 -(4- hydroxyphenyl)-4-(indole-3)-2,3-butanediol, l -(4-hydroxyphenyl-4-(indole-3)-3-hydroxy-2-butanone, indole-3-acetoaldehyde, 1 ,4-di(indole-3-)butane, 1 ,4-di(indole-3)-l -butene, 1 ,4-di(indole-3)-2-butene, l ,4-di(indole-3)-2-butanol, l,4-di(indole-3)-2-butanone, l,4-di(indole-3)-2,3-butanediol, 1 ,4-di(indole- 3)-3-hydroxy-2-butanone, succinate semialdehyde, hexane-l ,8-dicarboxylic acid, 3-hexene-l ,8- dicarboxylic acid, 3-hydroxy-hexane-l ,8-dicarboxylic acid, 3-hexanone-l ,8-dicarboxylic acid, 3,4- hexanediol-l ,8-dicarboxylic acid, 4-hydroxy-3-hexanone-l ,8-dicarboxylic acid, fucoidan, iodine, chlorophyll, carotenoid, calcium, magnesium, iron, sodium, potassium, phosphate, lactic acid, acetic acid, formic acid, or isoprenoids and terpenes. Additional fermentation end products, and methods of production thereof, can be found in U.S. Patent Application US 12/969,582, which is herein

incorporated by reference in its entirety.

Modification to Introduce or Enhance Enzyme Activity

[00211] In various embodiments of the invention, one or more modification of conditions for hydrolysis and/or fermentation is implemented to enhance end-product production. Examples of such

modifications include genetic modification to enhance enzyme activity in a microorganism that already comprises genes for encoding one or more target enzymes, introducing one or more heterogeneous nucleic acid molecules into a host microorganism to express and enhance activity of an enzyme not otherwise expressed in the host, modifying physical and chemical conditions to enhance enzyme function (e.g., modifying and/or maintaining a certain temperature, pH, nutrient concentration, temporal), or a combination of one or more such modifications. Other embodiments include overexpression of an endogenous nucleic acid molecule into the host microorganism to express and enhance activity of an enzyme already expressed in the host or to express activity of an enzyme in the host when the enzyme would not normally be expressed in the naturally- occurring host microorganism. Genetic Modification

[00212] In one embodiment, a microorganism can be genetically modified to enhance enzyme activity of one or more enzymes, including but not limited to hydrolytic enzymes (such as cellulase(s), hemicellulase(s), or pectinase(s) etc.). In one embodiment a method is used to genetically modify a microorganism (such as a Clostridium species) that is disclosed in US 20100086981 or

PCT/US2010/40494, which are herein incorporated by reference in their entirety. In another embodiment, an enzyme can be selected from the annotated genome of C. phytofermentans, another bacterial species, such as B. subtilis, E. coli, various Clostridium species, or yeasts such as S. cerevisiae for utilization in products and processes described herein. Examples include enzymes such as L- butanediol dehydrogenase, acetoin reductase, 3-hydroxyacyl-CoA dehydrogenase, cis-aconitate decarboxylase or the like, to create pathways for new products from biomass.

[00213] Examples of such modifications include modifying endogenous nucleic acid regulatory elements to increase expression of one or more enzymes {e.g., operably linking a gene encoding a target enzyme to a strong promoter), introducing into a microorganism additional copies of endogenous nucleic acid molecules to provide enhanced activity of an enzyme by increasing its production, and operably linking genes encoding one or more enzymes to an inducible promoter or a combination thereof.

[00214] In another embodiment a microorganism can be modified to enhance an activity of one or more hydrolytic enzymes (such as cellulase(s), hemicellulase(s), or pectinases etc.) or antioxidants (such as catalase), or other enzymes associated with cellulose processing. For example, in the case of cellulases, various microorganisms of the invention can be modified to enhance activity of one or more cellulases, or enzymes associated with cellulose processing.

[00215] In one embodiment a hydrolytic enzyme is selected from the annotated genome of C.

phytofermentans for utilization in a product or process disclosed herein. In another embodiment the hydrolytic enzyme is an endoglucanase, chitinase, cellobiohydrolase or endo-processive cellulases (either on reducing or non-reducing end).

[00216] In another embodiment a microorganism, such as C. phytofermentans, can be modified to enhance production of one or more hydrolytic enzymes (such as cellulase(s), hemicellulase(s), or pectinases etc.) or antioxidants (such as catalase), or other enzymes associated with cellulose processing such as one disclosed in U.S. Patent Application Serial No. 12/510,994, which is herein incorporated by reference in its entirety. In another embodiment one or more enzymes can be heterologous expressed in a host {e.g., a bacteria or yeast). For heterologous expression bacteria or yeast can be modified through recombinant technology (e.g., Brat ei al. Appl. Env. Microbio. 2009; 75(8):2304-2311, disclosing expression of xylose isomerase in S. cerevisiae and which is herein incorporated by reference in its entirety).

[00217] Due to inherent cellular mechanisms, it is a challenge to express many forms of heterolgous genetic material in Clostridium due to the presence of the restriction and modification (RM) systems. RM systems in bacteria serve as a defense mechanism against foreign nucleic acids. In order to prevent genetic manipulation, bacterial RM systems are capable of attacking heterologous DNA through the use of enzymes such as DNA methyltransferase (MTase) and restriction endonuclease (REase). For example, bacterial MTases methylate DNA, creating a "self signal, whereas bacterial REases are restriction enzyme that enymatically cleave DNA that is not methylated, "foreign" DNA. (Dong H. et al. (2010) PLOS One 5(2): e9038). Therefore, one method to achieve effective gene transfer to Clostridium, and avoid Clostridium RM systems, is to methylate a vector comprising heterologous DNA (Mermelstein and Papoutsakis. Appl. Environ. Microbiol. 59: 1077-1081 (1993); Mermelstein et al, Biotechnol. 10: 190-195 (1992)). In some embodiments, a vector comprising a heterologous DNA sequence is methylated prior to transformation into a Clostridium species. In some embodiments, methylation can be accomplished by the phi3TI methyltransferase. In further embodiments, plasmid DNA can be transformed into DI-ΠΟβ E. coli harboring vector pDHKM (Zhao, et al. Appl. Environ. Microbiol. 69: 2831-41 (2003)) carrying an active copy of the phi3TI methyltransferase gene.

[00218] Additionally, variance exists amongst RM systems between different bacterial species.

Therefore, another means to enhance heterologous DNA survival is to modify a vector to comprise enzyme restriction sites that are not recognized by a microorganism. In some embodiments, the invention provides for a DNA sequence comprising genetic material from a first microorganism, wherein the DNA sequence comprises restriction enzyme sites that are not recognized by a second microorganism. In further embodiments, the DNA sequence encodes for a gene, or genetically modified variant of the gene, from a Clostridium species, for example C. sp. Q.D. In further embodiments, the DNA sequence encodes for an expression product that is a protein, or fragment thereof, from a Clostridium species, for example C. sp. Q.D. In further embodiments, the first microorganism is a Clostridium species and the second microorganism is bacteria or yeast, e.g. E. coli.

[00219] In another embodiment other modifications can be made to enhance end-product {e.g., ethanol) production in a recombinant microorganism. For example, the host microorganism can further comprise an additional heterologous DNA segment, the expression product of which is a protein involved in the transport of mono- and/or oligosaccharides into the recombinant host. Likewise, additional genes from the glycolytic pathway can be incorporated into the host. In such ways, an enhanced rate of ethanol production can be achieved.

[00220] A variety of promoters (e.g., constitutive promoters, inducible promoters) can be used to drive expression of the heterologous genes in a recombinant host microorganism. [00221] Promoter elements can be selected and mobilized in a vector (e.g., pIMPCphy). For example, a transcription regulatory sequence is operably linked to gene(s) of interest (e.g., in a expression construct). The promoter can be any array of DNA sequences that interact specifically with cellular transcription factors to regulate transcription of the downstream gene. The selection of a particular promoter depends on what cell type is to be used to express the protein of interest. In one embodiment a transcription regulatory sequences can be derived from the host microorganism. In various

embodiments, constitutive or inducible promoters are selected for use in a host cell. Depending on the host cell, there are potentially hundreds of constitutive and inducible promoters which are known and that can be engineered to function in the host cell.

[00222] A map of the plasmid pIMPCphy is shown in FIG. 24, and the DNA sequence of this plasmid is provided as SEQ ID NO: 2.

[00223] SEQ ID NO: 2:

[00224] gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggca cgacaggtttcccgactggaaagcgggca gtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacact ttatgcttccggctcgtatgttgtgtggaattgtgagcggat aacaatttcacacaggaaacagctatgaccatgattacgccaaagctttggctaacacac acgccattccaaccaatagttttctcggcataaagccatg ctctgacgcttaaatgcactaatgccttaaaaaaacattaaagtctaacacactagactt atttacttcgtaattaagtcgttaaaccgtgtgctctacgacc aaaagtataaaacctttaagaactttcttttttcttgtaaaaaaagaaactagataaatc tctcatatcttttattcaataatcgcatcagattgcagtataaattt aacgatcactcatcatgttcatatttatcagagctccttatattttattte

gttaattgtttacaaataatctacgatacatagaaggaggaaaaactagtatactag tatgaacgagaaaaatataaaacacagtcaaaactttattacttc aaaacataatatagataaaataatgacaaatataagattaaatgaacatgataatatctt tgaaatcggctcaggaaaagggcattttacccttgaattagt acagaggtgtaatttcgtaactgccattgaaatagaccataaattatgcaaaactacaga aaataaacttgttgatcacgataatttccaagttttaaacaa ggatatattgcagtttaaatttcctaaaaaccaatcctataaaatatttggtaatatacc ttataacataagtacggatataatacgcaaaattgtttttgatagt atagctgatgagatttatttaatcgtggaatacgggtttgctaaaagattattaaataca aaacgctcattggcattatttttaatggcagaagttgatatttct atattaagtatggttccaagagaatattttcatcctaaacctaaagtgaatagctcactt atcagattaaatagaaaaaaatcaagaatatcacacaaagat aaacagaagtataattatttcgttatgaaatgggttaacaaagaatacaagaaaatattt acaaaaaatcaatttaacaattccttaaaacatgcaggaattg acgatttaaacaatattagctttgaacaattcttatctcttttcaatagctataaattat ttaataagtaagttaagggatgcataaactgcatcccttaacttgttt ttcgtgtacctattttttgtgaatcgatccggccagcctcgcagagcaggattcccgttg agcaccgccaggtgcgaataagggacagtgaagaagga acacccgctcgcgggtgggcctacttcacctatcctgcccggatcgattatgtcttttgc gcattcacttcttttctatataaatatgagcgaagcgaataa gcgtcggaaaagcagcaaaaagtttcctttttgctgttggagcatgggggttcagggggt gcagtatctgacgtcaatgccgagcgaaagcgagccg aagggtagcatttacgttagataaccccctgatatgctccgacgctttatatagaaaaga agattcaactaggtaaaatcttaatataggttgagatgataa ggtttataaggaatttgtttgttctaatttttcactcatttt

aaggagtgagaaaaagatgaaagaaagatatggaacagtctataaaggctctcagag gctcatagacgaagaaagtggagaagtcatagaggtag acaagttataccgtaaacaaacgtctggtaacttcgtaaaggcatatatagtgcaattaa taagtatgttagatatgattggcggaaaaaaacttaaaatcg ttaactatatcctagataatgtccacttaagtaacaatacaatgatagctacaacaagag aaatagcaaaagctacaggaacaagtctacaaacagtaat aacaacacttaaaatcttagaagaaggaaatattataaaaagaaaaactggagtattaat gttaaaccctgaactactaatgagaggcgacgaccaaaa acaaaaatacctcttactcgaatttgggaactttgagcaagaggcaaatgaaatagattg acctcccaataacaccacgtagttattgggaggtcaatct atgaaatgcgattaagcttagcttggctgcaggtcgacggatccccgggaattcactggc cgtcgttttacaacgtcgtgactgggaaaaccctggcgt tacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaaga ggcccgcaccgatcgcccttcccaacagttgcgcagcc tgaatggcgaatggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcac accgcatatggtgcactctcagtacaatctgctctgatgccg catagttaagccagccccgacacccgccaacacccgctgacgcgccctgacgggcttgtc tgctcccggcatccgcttacagacaagctgtgaccgt ctccgggagctgcatgtgtcagaggttttcaccgtcatcaccgaaacgcgcgagacgaaa gggcctcgtgatacgcctatttttataggttaatgtcatg ataataatggtttcttagacgtcaggtggcacttttcggggaaatgtgcgcggaacccct atttgtttatttttctaaatacattcaaatatgtatccgctcatg agacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtattcaa catttccgtgtcgcccttattcccttttttgcggcattttgcctt cctgtttttgctcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggt gcacgagtgggttacatcgaactggatctcaacagcggt aagatccttgagagttttcgccccgaagaacgttttccaatgatgagcacttttaaagtt ctgctatgtggcgcggtattatcccgtattgacgccgggca agagcaactcggtcgccgcatacactattctcagaatgacttggttgagtactcaccagt cacagaaaagcatcttacggatggcatgacagtaagag aattatgcagtgctgccataaccatgagtgataacactgcggccaacttacttctgacaa cgatcggaggaccgaaggagctaaccgcttttttgcaca acatgggggatcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccatac caaacgacgagcgtgacaccacgatgcctgtagcaat ggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaaca attaatagactggatggaggcggataaagttgcaggac cacttctgcgctcggcccttccggctggctggtttattgctgataaatctggagccggtg agcgtgggtctcgcggtatcattgcagcactggggccag atggtaagccctcccgtatcgtagttatctacacgacggggagtcaggcaactatggatg aacgaaatagacagatcgctgagataggtgcctcactg attaagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaa cttcatttttaatttaaaaggatctaggtgaagatcctttttgataat ctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaa aagatcaaaggatcttcttgagatcctttttttctgcgcgtaa tctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaag agctaccaactctttttccgaaggtaactggcttcagcag agcgcagataccaaatactgtccttctagtgtagccgtagttaggccaccacttcaagaa ctctgtagcaccgcctacatacctcgctctgctaatcctgt taccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgat agttaccggataaggcgcagcggtcgggctgaacgg ggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctac agcgtgagctatgagaaagcgccacgcttcccgaa gggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg gagcttccagggggaaacgcctggtatctttat agtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggg gggcggagcctatggaaaaacgccagcaacgcggccttt ttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccct gattctgtggataaccgtattaccgcctttgagtgagctgatacc gctcgccgcagccgaacgccgagcgcagcgagtcagtgagcgaggaagcggaaga

[00225] The vector pIMPCphy was constructed as a shuttle vector for C. phytofermentans and is further described in U.S. Patent Application Publication US20100086981, which is herein incorporated by reference in its entirety. It has an Ampicillin-resistance cassette and an Origin of Replication (ori) for selection and replication in E.coli. It contains a Gram-positive origin of replication that allows the replication of the plasmid in C. phytofermentans. In order to select for the presence of the plasmid, the pIMPCphy carries an erythromycin resistance gene under the control of the C. phytofermentans promoter of the gene Cphyl029. This plasmid can be transferred to C. phytofermentans by

electroporation or by transconjugation with an E.coli strain that has a mobilizing plasmid, for example pRK2030. pIMPCphy is an effective replicative vector system for all microorganisms, including all gram ⁺ and gram ^" bacteria, and fungi (including yeasts). A further discussion of promoters, regulation of gene expression products, and additional genetic modifications can be found in U.S. Patent Application Publication US 20100086981A1, which is herein incorporated by reference in its entirety.

[00226] In another embodiment, a microorganism can be modified to enhance an activity of one or more cellulases, or enzymes associated with cellulose processing. The classification of cellulases is usually based on grouping enzymes together that forms a family with similar or identical activity, but not necessary the same substrate specificity. One of these classifications is the CAZy system (CAZy stands for Carbohydrate- Active enZymes), for example, where there are 115 different Glycoside Hydrolases (GH) listed, named GH1 to GH155. Each of the different protein families usually has a corresponding enzyme activity. This database includes both cellulose and hemicellulase active enzymes. Furthermore, the entire annotated genome of C phytofermentans is available on the worldwideweb at www.ncbi.nlm.nih.gov/sites/entrez.

[00227] Several examples of cellulase enzymes whose function can be enhanced for expression endogenously or for expression heterologously in a microorganism include one or more of the genes disclosed in Table 2.

[00228] Table 2

Directed Evolution

[00229] Various methods can be used to produce and select mutants that differ from wild-type cells. In some instances, bacterial populations are treated with a mutagenic agent, for example, nitrosoguanidine (N-methyl-N'-nitro-N-nitrosoguanidine) or the like, to increase the mutation frequency above that of spontaneous mutagenesis. This is induced mutagenesis. Techniques for inducing mutagenesis include, but are not limited to, exposure of the bacteria to a mutagenic agent, such as x-rays or chemical mutagenic agents. More sophisticated procedures involve isolating the gene of interest and making a change in the desired location, then reinserting the gene into bacterial cells. This is site-directed mutagenesis.

[00230] Directed evolution is usually performed as three steps which can be repeated more than once. First, the gene encoding a protein of interest is mutated and/or recombined at random to create a large library of gene variants. The library is then screened or selected for the presence of mutants or variants that show the desired property. Screens enable the identification and isolation of high-performing mutants by hand; selections automatically eliminate all non functional mutants. Then the variants identified in the selection or screen are replicated , enabling DNA sequencing to determine what mutations occurred. Directed evolution can be carried out in vivo or in vitro. See, for example, Otten, L.G.; Quax, W.J. (2005). Biomolecular Engineering 22 (1 -3): 1 -9; Yuan, L., et al. (2005) Microbiol. Mol. Biol. Rev. 69 (3): 373-392.

[00231] In one embodiment, methods and compositions of the invention comprise genetically modifying a microorganism to enhance enzyme activity of one or more enzymes, including but not limited to a metabolic intermediate. Examples of such modifications include modifying endogenous nucleic acid regulatory elements to increase expression of one or more enzymes (e.g. , operably linking a gene encoding a target enzyme to a strong promoter), introducing into a microorganism additional copies of nucleic acid molecules to provide enhanced activity of an enzyme, operably linking genes encoding one or more enzymes to an inducible promoter or a combination thereof.

[00232] Various microorganisms of the invention can be modified to enhance activity of one or more enzymes to produce novel chemicals. Furthermore, a microorganism other than Clostridium species can be modified to express and/or overexpress any of these enzymes. For example, other bacteria or yeast can be modified through conventional recombinant technology to express enzymes.

[00233] Other modifications can be made to enhance end-product production of a recombinant microorganism of the subject invention. For example, the host can further comprise an additional heterologous DNA segment, the expression product of which is a protein involved in the transport of mono- and/or oligosaccharides into the recombinant host. Likewise, additional genes from the glycolytic pathway can be incorporated into the host. In such ways, an enhanced rate of chemical production can be achieved.

[00234] In other embodiments, a microorganism can be obtained without the use of recombinant DNA techniques that exhibit desirable properties such as increased productivity, increased yield, or increased titer. For example, mutagenesis, or random mutagenesis can be performed by chemical means or by irradiation of the microorganism. The population of mutagenized microorganisms can then be screened for beneficial mutations that exhibit one or more desirable properties. Screening can be performed by growing the mutagenized microorganisms on substrates that comprise carbon sources that will be utilized during the generation of end-products by fermentation. Screening can also include measuring the production of end-products during growth of the microorganism, or measuring the digestion or assimilation of the carbon source(s). The isolates so obtained can further be transformed with recombinant polynucleotides or used in combination with any of the methods and compositions provided herein to further enhance biofuel production.

[00235] In one embodiment, production of a fermentation end-product comprises: a carbonaceous biomass, a microorganism that is capable of direct hydrolysis and fermentation of the biomass to a fermentation end-product disclosed herein.

[00236] In another embodiment, a product for production of a biofuel comprises: a carbonaceous biomass, a microorganism that is capable of hydrolysis and fermentation of the biomass, wherein the microorganism is modified to provide enhanced production of a fermentation end-product disclosed herein.

[00237] In yet a further embodiment, a product for production of fermentation end-products comprises: (a) a fermentation vessel comprising a carbonaceous biomass; (b) and a modified microorganism that is capable of hydrolysis and fermentation of the biomass; wherein the fermentation vessel is adapted to provide suitable conditions for fermentation of one or more carbohydrates into fermentation end- products.

[00238] In one embodiment a microorganism utilized in products or processes of the invention can be one that is capable of hydrolysis and fermentation of C5 and C6 carbohydrates (such as lignocellulose or hemicelluloses). In one embodiment, such a capability is achieved through modifying the microorganism to express one or more genes encoding proteins associated with C5 and C6

carbohydrate metabolism.

[00239] Microorganisms useful in compositions and methods of the invention include but are not limited to bacteria, yeast or fungi that can hydrolyze and ferment feedstock or biomass. In some embodiments, two or more different microorganisms can be utilized during saccharification and/or fermentation processes to produce an end-product. Microorganisms utilized in methods and compositions described herein can be recombinant.

[00240] In one embodiment, a microorganism utilized in compositions or methods of the invention is a strain of Clostridia. In a further embodiment, the microorganism is C. sp. Q.D, or genetically modified variant thereof.

[00241] Organisms of the invention can be modified to comprise one or more heterologous or exogenous polynucleotides that enhance enzyme function. In one embodiment, enzymatic function is increased for one or more cellulase enzymes.

[00242] A microorganism used in products and processes of the invention can be capable of uptake of one or more complex carbohydrates from biomass (e.g., biomass comprises a higher concentration of oligomeric carbohydrates relative to monomeric carbohydrates). [00243] In some embodiments, one or more enzymes are utilized in products and processes of the invention, which are added externally (e.g., enzymes provided in purified form, cell extracts, culture medium or commercially available source).

[00244] Enzyme activity can also be enhanced by modifying conditions in a reaction vessel, including but not limited to time, pH of a culture medium, temperature, concentration of nutrients and/or catalyst, or a combination thereof. A reaction vessel can also be configured to separate one or more desired end- products.

[00245] Products or processes of the invention provide for hydrolysis of biomass resulting in a greater concentration of cellobiose relative to monomeric carbohydrates. Such monomeric carbohydrates can comprise xylose and arabinose.

[00246] In some embodiments of the present invention, batch fermentation with a microorganism of the invention and of a mixture of hexose and pentose saccharides using processes of the present invention provides uptake rates of about 0.1, 0.2, 0.4, 0.5, 0.6, 0.7, 0.8, 1, 2, 3, 4, 5, or about 6 g/L/h or more of hexose (e.g. glucose, cellulose, cellobiose etc.), and about 0.1, 0.2, 0.4, 0.5, 0.6 0.7, 0.8, 1, 2, 3, 4, 5, or about 6 g/L/h or more of pentose (xylose, xylan, hemicellulose etc.). For example, Clostridium sp. Q.D. or variants thereof are capable of hydrolysis and fermentation of C5 and C6 sugars.

Biofuel plant and process of producing biofuel

[00247] In one aspect, provided herein is a fuel plant that includes a hydrolysis unit configured to hydrolyze a biomass material comprising a high molecular weight carbohydrate, and a fermentor configured to house a medium and one or more species of microorganisms. In one embodiment, the microorganism is Clostridium sp. Q.D.

[00248] In another aspect, provided herein are methods of making a fuel or chemical end-product that includes combining a microorganism (such ^Clostridium sp. Q.D or a similar species of Clostridium that hydro lyzes and ferments C5/C6 carbohydrates) and a lignocellulosic material (and/or other biomass material) in a medium, and fermenting the lignocellulosic material under conditions and for a time sufficient to produce a fermentation end-product, {e.g., ethanol, propanol, methane, or hydrogen).

[00249] In some embodiments, a process is provided for producing a fermentation end-product from biomass using acid hydrolysis pretreatment. In some embodiments, a process is provided for producing a fermentation end-product from biomass using enzymatic hydrolysis pretreatment. In another embodiment a process is provided for producing a fermentation end-product from biomass using biomass that has not been enzymatically pretreated. In another embodiment a process is provided for producing a fermentation end-product from biomass using biomass that has not been chemically or enzymatically pretreated, but is optionally steam treated.

[00250] In another aspect, provided herein are end-products made by any of the processes described herein. Those skilled in the art will appreciate that a number of genetic modifications can be made to the methods exemplified herein. For example, a variety of promoters can be utilized to drive expression of the heterologous genes in a recombinant microorganism (such as Clostridium sp. Q.D). The skilled artisan, having the benefit of the instant disclosure, will be able to readily choose and utilize any one of the various promoters available for this purpose. Similarly, skilled artisans, as a matter of routine preference, can utilize a higher copy number plasmid. In another embodiment, constructs can be prepared for chromosomal integration of the desired genes. Chromosomal integration of foreign genes can offer several advantages over plasmid-based constructions, the latter having certain limitations for commercial processes. Ethanologenic genes have been integrated chromosomally in E. coli B; see Ohta et al. (1991) Appl. Environ. Microbiol. 57:893-900. In general, this is accomplished by purification of a DNA fragment containing (1) the desired genes upstream from an antibiotic resistance gene and (2) a fragment of homologous DNA from the target microorganism. This DNA can be ligated to form circles without replicons and used for transformation. Thus, the gene of interest can be introduced in a heterologous host such as E. coli, and short, random fragments can be isolated and ligated in

Clostridium sp. Q.D or variants thereof, to promote homologous recombination.

Large Scale Fermentation End-Product Production from Biomass

[00251] In one aspect a fermentation end-product {e.g., ethanol) from biomass is produced on a large scale utilizing a microorganism, such as Clostridium sp. Q.D or variants thereof. In one embodiment, a biomass that includes high molecular weight carbohydrates is hydrolyzed to lower molecular weight carbohydrates, which are then fermented using a microorganism to produce ethanol. In another embodiment, the biomass is fermented without chemical and/or enzymatic pretreatment. In one embodiment, hydrolysis can be accomplished using acids, e.g., Bronsted acids {e.g., sulfuric or hydrochloric acid), bases, e.g., sodium hydroxide, hydrothermal processes, steam explosion, ammonia fiber explosion processes ("AFEX"), lime processes, enzymes, or combination of these. Hydrogen, and other products of the fermentation can be captured and purified if desired, or disposed of, e.g., by burning. For example, the hydrogen gas can be flared, or used as an energy source in the process, e.g., to drive a steam boiler, e.g., by burning. Hydrolysis and/or steam treatment of the biomass can,increase porosity and/or surface area of the biomass, often leaving the cellulosic materials more exposed to the microorganismal cells, which can increase fermentation rate and yield. In another embodiment removal of lignin can provide a combustible fuel for driving a boiler, and can also increase porosity and/or surface area of the biomass, often increasing fermentation rate and yield. In some embodiments, the initial concentration of the carbohydrates in the medium is greater than 20 mM, e.g., greater than 30 mM, 50 mM, 75 mM, 100 mM, 150 mM, 200 mM, or even greater than 500 mM.

[00252] In one aspect, the invention features a fuel plant that comprises a hydrolysis unit configured to hydrolyze a biomass material that includes a high molecular weight carbohydrate; a fermentor configured to house a medium with a C5/C6 hydrolyzing and fermenting microorganism {e.g., Clostridium sp. Q.D or variants thereof); and one or more product recovery system(s) to isolate a fermentation end- product or end- products and associated by-products and co-products. [00253] In another aspect, the invention features methods of making a fermentation end-product or end- products that include combining a C5/C6 hydrolyzing and fermenting microorganism (e.g., Clostridium sp. Q.D or variants thereof) and a carbonaceous biomass in a medium, and fermenting the biomass material under conditions and for a time sufficient to produce a fermentation end-products (e.g. ethanol, propanol, hydrogen, lignin, terpenoids, and the like). In one embodiment the fermentation end-product is a biofuel or chemical product.

[00254] In another aspect, the invention features one or more fermentation end-products made by any of the processes described herein. In one embodiment one or more fermentation end-products can be produced from biomass on a large scale utilizing a C5/C6 hydrolyzing and fermenting microorganism (e.g., Clostridium sp. Q.D or variants thereof). In one embodiment depending on the type of biomass and its physical manifestation, the process can comprise a milling of the carbonaceous material, via wet or dry milling, to reduce the material in size and increase the surface to volume ratio (physical modification).

[00255] In some embodiments, the treatment includes treatment of a biomass with acid. In some embodiments, the acid is dilute. In some embodiments, the acid treatment is carried out at elevated temperatures of between about 85 and 140°C. In some embodiments, the method further comprises the recovery of the acid treated biomass solids, for example by use of a sieve. In some embodiments, the sieve comprises openings of approximately 150-250 microns in diameter. In some embodiments, the method further comprises washing the acid treated biomass with water or other solvents. In some embodiments, the method further comprises neutralizing the acid with alkali. In some embodiments, the method further comprises drying the acid treated biomass. In some embodiments, the drying step is carried out at elevated temperatures between about 15-45°C. In some embodiments, the liquid portion of the separated material is further treated to remove toxic materials. In some embodiments, the liquid portion is separated from the solid and then fermented separately. In some embodiments, a slurry of solids and liquids are formed from acid treatment and then fermented together.

[00256] FIG. 15 illustrates an example of a method for producing a fermentation end-product from biomass by first treating biomass with an acid at elevated temperature and pressure in a hydrolysis unit. The biomass can first be heated by addition of hot water or steam. The biomass can be acidified by bubbling gaseous sulfur dioxide through the biomass that is suspended in water, or by adding a strong acid, e.g., sulfuric, hydrochloric, or nitric acid with or without preheating/presteaming/water addition. A weak organic acid can also be used. During the acidification, the pH is maintained at a low level, e.g., below about 5. The temperature and pressure can be elevated after acid addition. In addition to the acid already in the acidification unit, optionally, a metal salt such as ferrous sulfate, ferric sulfate, ferric chloride, aluminum sulfate, aluminum chloride, magnesium sulfate, or mixtures of these can be added to aid in the hydrolysis of the biomass. The acid-impregnated biomass is fed into the hydrolysis section of the pretreatment unit. Steam is injected into the hydrolysis portion of the pretreatment unit to directly contact and heat the biomass to the desired temperature. The temperature of the biomass after steam addition is, e.g., between about 130° C and 220° C. The hydrolysate is then discharged into the flash tank portion of the pretreatment unit, and is held in the tank for a period of time to further hydrolyze the biomass, e.g., into oligosaccharides and monomeric sugars. Steam explosion can also be used to further break down biomass. Alternatively, the biomass can be subject to discharge through a pressure lock for any high-pressure pretreatment process. Hydrolysate is then discharged from the pretreatment reactor, with or without the addition of water, e.g., at solids concentrations between about 15% and 60%.

[00257] In some embodiments, after pretreatment, the biomass can be dewatered and/or washed with a quantity of water, e.g. by squeezing or by centrifugation, or by filtration using, e.g. a countercurrent extractor, wash press, filter press, pressure filter, a screw conveyor extractor, or a vacuum belt extractor to remove acidified fluid. The acidified fluid, with or without further treatment, e.g. addition of alkali (e.g. lime) and or ammonia (e.g. ammonium phosphate), can be re-used, e.g., in the acidification portion of the pretreatment unit, or added to the fermentation, or collected for other use/treatment. Products can be derived from treatment of the acidified fluid, e.g., gypsum or ammonium phosphate. Enzymes or a mixture of enzymes can be added during pretreatment to assist, e.g. endoglucanases, exoglucanases, cellobiohydrolases (CBH), beta-glucosidases, glycoside hydrolases,

glycosyltransferases, lyases, and esterases active against components of cellulose, hemicelluloses, pectin, and starch, in the hydrolysis of high molecular weight components.

[00258] In one embodiment the fermentor is fed with hydrolyzed biomass; any liquid fraction from biomass pretreatment; an active seed culture of Clostridium sp. Q.D or a mutagenized or genetically- modified variant thereof, optionally a co-fermenting microorganism (e.g., yeast or E. coli) and, as needed, nutrients to promote growth of the Clostridium cells or other microorganisms. In another embodiment the pretreated biomass or liquid fraction can be split into multiple fermentors, each containing a different strain of Clostridium sp. Q.D, or a mutagenized or genetically-modified variant thereof and/or other microorganisms; with each fermentor operating under specific physical conditions. Fermentation is allowed to proceed for a period of time, e.g., between about 15 and 150 hours, while maintaining a temperature of, e.g., between about 25° C and 50° C. Gas produced during the fermentation is swept from fermentor and is discharged, collected, or flared with or without additional processing, e.g. hydrogen gas can be collected and used as a power source or purified as a co-product.

[00259] After fermentation, the contents of the fermentor are transferred to product recovery. Products are extracted, e.g., ethanol is recovered through distillation and rectification. Methods and compositions described herein can include extracting or separating fermentation end-products, such as ethanol, from biomass. Depending on the product formed, different methods and processes of recovery can be provided.

[00260] In one embodiment, a method for extraction of lactic acid from a fermentation broth uses freezing and thawing of the broth followed by centrifugation, filtration, and evaporation. (Omar, et al. 2009 African J. Biotech. 8:5807-5813) Other methods that can be utilized are membrane filtration, resin adsorption, and crystallization. (See, e.g., Huh, et al. 2006 Process Biochemistry).

[00261] In another embodiment for solvent extraction of a variety of organic acids (such as ethyl lactate, ethyl acetate, formic, butyric, lactic, acetic, malic, succinic), the process can take advantage of preferential partitioning of the product into one phase or the other. In some cases the product might be carried in the aqueous phase rather than the solvent phase. In other embodiments, the pH is manipulated to produce more or less acid from the salt synthesized from the microorganism. The acid phase is then extracted by vaporization, distillation, or other methods. (See FIG. 16.)

[00262] In yet a further embodiment, a system for production of fermentation end-products comprises:

(a) a fermentation vessel comprising a carbonaceous biomass; (b) and a microorganism that is capable of hydrolysis and fermentation of the biomass; wherein the fermentation vessel is adapted to provide suitable conditions for fermentation of one or more carbohydrates into fermentation end-products. In one embodiment the microorganism is genetically modified. In another embodiment the microorganism is not genetically modified.

[00263] Chemical Production From Biomass

[00264] FIG. 17 depicts a method for producing chemicals from biomass by charging biomass to a fermentation vessel. The biomass can be allowed to soak for a period of time, with or without addition of heat, water, enzymes, or acid/alkali. The pressure in the processing vessel can be maintained at or above atmospheric pressure. Acid or alkali can be added at the end of the pretreatment period for neutralization. At the end of the pretreatment period, or at the same time as pretreatment begins, an active seed culture of a C5/C6 hydrolyzing and fermenting microorganism (e.g., Clostridium sp. Q.D or variant thereof) and, if desired, a co-fermenting microorganism, e.g., yeast or E. coli, and, if required, nutrients to promote growth of a C5/C6 hydrolyzing and fermenting microorganism. Fermentation is allowed to proceed as described above. After fermentation, the contents of the fermentor are transferred to product recovery as described above. Any combination of the chemical production methods and/or features can be utilized to make a hybrid production method. In any of the methods described herein, products can be removed, added, or combined at any step. A C5/C6 hydrolyzing and fermenting microorganism {e.g. , Clostridium sp. Q.D or variant thereof) can be used alone or

synergistically in combination with one or more other microorganisms {e.g. yeasts, fungi, or other bacteria). In some embodiments different methods can be used within a single plant to produce different end-products.

[00265] In another aspect, the invention features a fuel plant that includes a hydrolysis unit configured to hydrolyze a biomass material that includes a high molecular weight carbohydrate, a fermentor configured to house a medium and contains a C5/C6 hydrolyzing and fermenting microorganism {e.g., Clostridium sp. Q.D or mutagenized or genetically-modified cells thereof). [00266] In another aspect, the invention features a chemical production plant that includes a hydrolysis unit configured to hydrolyze a biomass material that includes a high molecular weight carbohydrate, a fermentor configured to house a medium and contains a C5/C6 hydrolyzing and fermenting microorganism (e.g., Clostridiu sp. Q.D or mutagenized or genetically-modified cells thereof).

[00267] In another aspect, the invention features methods of making a chemical(s) or fuel(s) that include combining a C5/C6 hydrolyzing and fermenting microorganism (e.g., Clostridium sp. Q.D or mutagenized or genetically-modified cells thereof ), and a lignocellulosic material (and/or other biomass material) in a medium, and fermenting the lignocellulosic material under conditions and for a time sufficient to produce a chemical(s) or fuel(s), e.g., ethanol, propanol and/or hydrogen or another chemical compound.

[00268] In some embodiments, the present invention provides a process for producing ethanol and hydrogen from biomass using acid hydrolysis pretreatment. In some embodiments, the present invention provides a process for producing ethanol and hydrogen from biomass using enzymatic hydrolysis pretreatment. Other embodiments provide a process for producing ethanol and hydrogen from biomass using biomass that has not been enzymatically pretreated. Still other embodiments disclose a process for producing ethanol and hydrogen from biomass using biomass that has not been chemically or enzymatically pretreated, but is optionally steam treated.

[00269] FIG. 18 discloses pretreatments that produce hexose or pentose saccharides or oligomers that are then unprocessed or processed further and either, fermented separately or together. FIG. 18A depicts a process (e.g., acid pretreatment) that produces a solids phase and a liquid phase which are then fermented separately. FIG. 18B depicts a similar pretreatment that produces a solids phase and liquids phase. The liquids phase is separated from the solids and elements that are toxic to the fermenting microorganism are removed prior to fermentation. At initiation of fermentation, the two phases are recombined and cofermented together. This is a more cost-effective process than fermenting the phases separately. The third process (FIG. 18C) is the least costly. The pretreatment results in a slurry of liquids or solids that are then cofermented. There is little loss of saccharides component and minimal equipment required.

[00270] Attributes of Clostridium sp. Q.D

[00271] Clostridium sp. Q.D includes all strains, mutants and recombinants, and can in some embodiments be defined based on the phenotypic and genotypic characteristics of the cultured strain as described infra. Aspects described herein generally include systems, methods, and compositions for producing fuels, such as ethanol, and/or other useful organic products involving, for example,

Clostridium sp. Q.D and/or any other strain of the species, including those which can be derived from Clostridium sp. Q.D, including genetically modified strains, or strains separately isolated. Some exemplary species can be defined using standard taxonomic considerations (Stackebrandt and Goebel, International Journal of Systematic Bacteriology, 44:846-9, 1994): Strains with 16S rRNA sequence homology values of 97% and higher as compared to the type Clostridium sp. Q.D, and strains with DNA re-association values of at least about 70% can be considered Clostridium sp. Q.D. For example, strains with 16S rRNA sequence homology values of at least 97.1 , 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5,

99.6, 99.7, 99.8, 99.9% can be considered Clostridium sp. Q.D. In one embodiment, strains with DNA re-association values of at least about 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99% can be considered Clostridium sp. Q.D. Considerable evidence exists to indicate that many microorganisms which have 70% or greater DNA re-association values also have at least 96% DNA sequence identity and share phenotypic traits defining a species. Analyses of assembled contigs from the sequence of Clostridium sp. Q.D indicate the presence of large numbers of genes and genetic loci that are likely to be involved in mechanisms and pathways for plant polysaccharide fermentation, giving rise to the unusual fermentation properties of this microorganism which can be found in all or nearly all strains of the species Clostridium sp. Q.D and can be natural isolates, or genetically modified strains.

[00272] In one embodiment, an isolated Clostridium bacterium disclosed herein (e.g. Clostridium sp. Q.D or variants thereof) can comprise a 16S rRNA nucleotide sequence that is encoded in part by a nucleotide sequence with greater than at least 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 97.1 , 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6,

98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% identity to SEQ ID NO: 13.

[00273] The Clostridium sp. Q.D genome was sequenced using the short-read (50mers) sequencing technology. These 20672042 short reads were then assembled by velvet, and produced 727 contigs (or nodes) that are longer than 2000 bases. The 727 contigs are collectively disclosed as SEQ ID NO: 1. Velvet is a de novo genomic assembler, designed for short read sequencing technologies, developed at the European Bioinformatics Institue (EMBL-EBI). The velvet algorithm was published in the journal article "Velvet: algorithms for de novo short read assembly using de Bruijn graphs. D.R. Zerbino and E. Birney, Genome Research 18:821 -829", which is hereby incorporated by reference. The genes in Table 3 were searched using tblastn in the genome assembly. Tblastn is a Basic Local Alignment Search Tool (BLAST®) family program, which is public domain software. It compares a protein query to all six reading frames of a target nucleotide sequence and is useful for finding protein homologs in unannotated nucleotide data. The BLAST algorithm was published in the article "Altschul, Stephen F., et al. (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucleic Acids Res. 25:3389-3402", which is hereby incorporated by reference. In one embodiment, compositions of the invention comprise genes encoded by any of the nodes listed in Table 3 : [00274] Table 3

27 Phosphate acetyltransferase (pta: Cphy_1326) 13169 to 12198*

28 Acetate kinase (ackA: Cphy 1327) 42386 to 41 193*

29 Cohesin 3213 to 5039*

30 GH 5 (Cphy_3202) (fragments)

GH 9: Cellulose 1 ,4-beta-cellobiosidase 38713 to 40617*

31

(Cphy_3367)

32 GH 10: endo-l ,4-beta-xylanase 1 to 564

33 GH 10: endo-l ,4-beta-xylanase 437 to 3

34 GH 1 1 : endo-l ,4-beta-xylanase 2448 to 1912

34 GH 39 52093 to 53604*

35 GH 27 4071 to 6209*

36 GH 27 4593 to 6803*

37 GH 27 26798 to 28903*

38 GH 32 6093 to 9977*

39 GH 42 5595 to 3565*

40 GH 57 18530 to 21577*

41 GH 59 1312 to 6765*

42 GH 78 13124 to 15688*

* ORF sequence was confirmed by blastx with NCBI protein database.

[00275] In one embodiment, an isolated Clostridium bacterium disclosed herein (e.g. Clostridium sp. Q.D or variants thereof) can comprise a 16S rRNA nucleotide sequence that is encoded in part by a nucleotide sequence with greater than at least 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 97.1 , 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% identity to SEQ ID NO: 13.

[00276] In another embodiment, an isolated Clostridium bacterium disclosed herein (e.g. Clostridium sp. Q.D or variants thereof) can comprise one or more nucleotide sequences comprising at a significant level of identity to SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42. In this context, a significant amount can be at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 97.1 , 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1 , 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% identity to a region of SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 ,41 , or 42. A nucleotide sequence, in this context, can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or more nucleotides in length. An isolated Clostridium bacterium disclosed herein (e.g. Clostridium sp. Q.D or variants thereof) can comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleotide sequences with significant identity to a region of SEQ ID NOs: 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40 ,41 , or 42. In some embodiments, a nucleotide sequence can encode a protein or protein fragment.

[00277] In another embodiment, an isolated Clostridium bacterium disclosed herein (e.g. Clostridium sp. Q.D or variants thereof) can comprise one or more nucleotide sequences comprising at a significant level of identity to SEQ ID NO: 1. In this context, a significant amount can be at least 80, 81, 82, 83,

84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 97.1 , 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1 , 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% identity to a region of SEQ ID NOs: 1. A nucleotide sequence, in this context, can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or more nucleotides in length. An isolated Clostridium bacterium disclosed herein can comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleotide sequences with significant identity to a region of SEQ ID NO: 1. In some embodiments, a nucleotide sequence can encode a protein or protein fragment.

[00278] In one embodiment, an isolated Clostridium bacterium disclosed herein (e.g. Clostridium sp. Q.D or variants thereof) can comprise a 16S rRNA nucleotide sequence that is encoded in part by a nucleotide sequence with greater than at least 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 97.1 , 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% identity to SEQ ID NO: 13 and 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleotide sequences comprising at a significant level of identity to SEQ ID NOs: 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , or 42. In another embodiment, an isolated Clostridium bacterium disclosed herein can comprise a 16S rRNA nucleotide sequence that is encoded in part by a nucleotide sequence with greater than at least 80, 81, 82, 83, 84,

85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 97.1, 97.2, 97.3, 97.4, 97.5, 97.6, 97.7, 97.8, 97.9, 98.0, 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, 99.9, or 100% identity to SEQ ID NO: 13 and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more nucleotide sequences comprising at a significant level of identity to SEQ ID NOs: 1. A nucleotide sequence, in any embodiment, can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or more nucleotides in length. In some embodiments, a nucleotide sequence can encode a protein or protein fragment. An isolated Clostridium bacterium disclosed herein can be genetically modified. In one embodiment, an isolated Clostridium bacterium (e.g. Clostridium sp. Q.D or variants thereof) can be genetically modified to express one or more heterologous genes. In another embodiment, an isolated Clostridium bacterium disclosed herein can be genecially modified to inhibit the expression of one or more endogenous genes. In yet another embodiment, an isolated Clostridium bacterium disclosed herein can be genetically modified to enhance the activity of one or more endogenous enzymes.

[00279] The microorganism, Clostridium sp. Q.D, provides useful advantages for the conversion of biomass to ethanol and other products. One advantage of this microorganism is its ability to produce enzymes capable of hydrolyzing polysaccharides and higher molecular weight saccharides to lower molecular weight saccharides, such as oligosaccharides, disaccharides, and monosaccharides.

Clostridium sp. Q.D can produce a wide spectrum of hydrolytic enzymes, which can facilitate fermenting of various biomass materials, including cellulosic, hemicellulosic, lignocellulosic materials; pectins; starches; wood; paper; agricultural products; forest waste; tree waste; tree bark; leaves; grasses; sawgrass; woody plant matter; non-woody plant matter; carbohydrates; pectin; starch; inulin; fructans; glucans; corn; sugar cane; grasses; bamboo, algae, and material derived from these materials. The organism can usually produce these enzymes as needed, frequently without excessive production of unnecessary hydrolytic enzymes, or in one embodiment, one or more enzymes is added to further improve the organism's production capability. This ability to produce a very wide range of hydrolytic enzymes gives Clostridium sp. Q.D and the associated technology distinct advantages in biomass fermentation, especially those fermentations not utilizing simple sugars as the feedstock. Various fermentation conditions can enhance the activities of the organism, resulting in higher yields, higher productivity, greater product selectivity, and/or greater conversion efficiency. In one embodiment, fermentation conditions include fed batch operation and fed batch operation with cell augmentation; addition of complex nitrogen sources such as corn steep powder or yeast extract; addition of specific amino acids including proline, glycine, isoleucine, and/or histidine; addition of a complex material containing one or more of these amino acids; addition of other nutrients or other compounds such as phytate, proteases enzymes, or polysaccharase enzymes. In one embodiment, fermentation conditions can include supplementation of a medium with an organic nitrogen source. In another embodiment, fermentation conditions can include supplementation of a medium with an inorganic nitrogen source. In one embodiment, the addition of one material provides supplements that fit into more than one category, such as providing amino acids and phytate.

[00280] In one embodiment, the Clostridium sp. Q.D organism is used to hydrolyze various higher saccharides (higher molecular weight) present in biomass to lower saccharides (lower molecular weight), such as in preparation for fermentation to produce ethanol, hydrogen, or other chemicals such as organic acids including formic acid, acetic acid, and lactic acid. Another advantage of Clostridium sp. Q.D is its ability to hydrolyze polysaccharides and higher saccharides that contain hexose sugar units or that contain pentose sugar units, and that contain both, into lower saccharides and in some cases monosaccharides. These enzymes and/or the hydrolysate can be used in fermentations to produce various products including fuels, and other chemicals. Another advantage of Clostridium sp. Q.D is its ability to produce ethanol, hydrogen, and other fuels or compounds such as organic acids including acetic acid, formic acid, and lactic acid from lower sugars (lower molecular weight) such as monosaccharides. Another advantage of Clostridium sp. Q.D is its ability to perform the combined steps of hydrolyzing a higher molecular weight biomass containing sugars and/or higher saccharides or polysaccharides to lower sugars and fermenting these lower sugars into desirable products including ethanol, hydrogen, and other compounds such as organic acids including formic acid, acetic acid, and lactic acid.

[00281] Another advantage of Clostridium sp. Q.D is its ability to grow under conditions that include elevated ethanol concentration, high sugar concentration, low sugar concentration, utilize insoluble carbon sources, and/or operate under anaerobic conditions. These characteristics, in various combinations, can be used to achieve operation with long fermentation cycles and can be used in combination with batch fermentations, fed batch fermentations, self-seeding/partial harvest fermentations, and recycle of cells from the final fermentation as inoculum.

[00282] In one embodiment, the enzymes of the method are produced by Clostridium sp. Q.D, including a range of hydrolytic enzymes suitable for the biomass materials used in the fermentation methods. In one embodiment, Clostridium sp. Q.D is grown under conditions appropriate to induce and/or promote production of the enzymes needed for the saccharification of the polysaccharide present. The production of these enzymes can occur in a separate vessel, such as a seed fermentation vessel or other fermentation vessel, or in the production fermentation vessel where ethanol production occurs. When the enzymes are produced in a separate vessel, they can, for example, be transferred to the production fermentation vessel along with the cells, or as a relatively cell free solution liquid containing the intercellular medium with the enzymes. When the enzymes are produced in a separate vessel, they can also be dried and/or purified prior to adding them to the production fermentation vessel. The conditions appropriate for production of the enzymes are frequently managed by growing the cells in a medium that includes the biomass that the cells will be expected to hydrolyze in subsequent fermentation steps. Additional medium components, such as salt supplements, growth factors, and cofactors including, but not limited to phytate, amino acids, and peptides can also assist in the production of the enzymes utilized by the microorganism in the production of the desired products.

[00283] In another aspect, provided is a method of fermenting a carbonaceous material, comprising contacting the carbonaceous material with an effective, fermenting amount of an isolated Gram- positive bacterium, wherein the bacterium is an anaerobic, obligate mesophile that produces colonies that are beige or orange pigmented, wherein the bacterium can use polysaccharides as a sole carbon source and can reduce acetaldehyde into ethanol, whereby contacting the carbonaceous material with the bacterium ferments the carbonaceous material. As used herein, an "effective amount" is within the knowledge of one skilled in the art. Various methods are known by which a person of skill can determine the amount of bacteria required to effectively ferment a carbonaceous material, e.g., biomass, of interest. The carbonaceous materials can be any one or more of the materials disclosed herein. In one aspect, the bacterium comprises a 16S rRNA nucleic acid identified in FIG. 2. In another aspect, the bacterium comprises a 16S rRNA nucleic acid that is greater than about 98% similar to the nucleic acid identified in FIG. 2. In yet another aspect, the bacterium comprises a 16S rRNA nucleic acid that is greater than about 99% similar to the nucleic acid identified in FIG. 2. In one aspect, the bacterium comprises a 16S rRNA nucleic acid identified as in FIG. 2.

[00284] The contacting step of the disclosed method can occur at a pH of from about 5.0 to about 7.5. In one aspect, the contacting step occurs at a pH of from about 6.0 to about 6.5. The method disclosed can be carried out at a temperature from about 30° C. to about 40° C. In another aspect, the disclosed method can be carried out at a temperature from about 35° C. to about 37° C.

[00285] Further provided is a method of growing an isolated Gram-positive bacterium, designated Q.D and deposited under NRRL Accession No. B-50361. In another embodiment, the bacterium, designated Q.D and deposited under NRRL Accession No. B-50362, NRRL Accession No. B-50363, or designated C. phytofermentans and deposited under NRRL Accession No. B-50364. In one embodiment, the bacterium is an anaerobic, obligate mesophile that produces colonies that are beige-pigmented, wherein the bacterium can use cellulose as a sole carbon source and can oxidize acetaldehyde into ethanol, comprising culturing the bacterium at a temperature and on a medium effective to promote growth of the bacterium. The bacterium can grow at a temperature from about 30° C. to about 40° C. In one aspect, the bacterium can grow at a temperature from about 35° C. to about 37° C. Further, the bacterium can grow on medium wherein the pH is from about 5.0 to about 7.5. In one aspect, the pH of the medium can be from about 6.0 to about 6.5. Media are currently known that are effective in promoting growth of the disclosed bacterium.

[00286] In another aspect, methods are provided for the recovery of the fermentation end products, such as an alcohol {e.g. ethanol, propanol, methanol, butanol, etc.) another biofuel or chemical product. In one embodiment, broth will be harvested at some point during of the fermentation, and fermentation end product or products will be recovered. The broth with ethanol to be recovered will include both ethanol and impurities. The impurities include materials such as water, cell bodies, cellular debris, excess carbon substrate, excess nitrogen substrate, other remaining nutrients, non-ethanol metabolites, and other medium components or digested medium components. During the course of processing the broth, the broth can be heated and/or reacted with various reagents, resulting in additional impurities in the broth.

[00287] In one embodiment, the processing steps to recover ethanol frequently includes several separation steps, including, for example, distillation of a high concentration ethanol material from a less pure ethanol-containing material. In one embodiment, the high concentration ethanol material can be further concentrated to achieve very high concentration ethanol, such as 98% or 99% or 99.5% (wt.) or even higher. Other separation steps, such as filtration, centrifugation, extraction, adsorption, etc. can also be a part of some recovery processes for ethanol as a product or biofuel, or other biofuels or chemical products.

[00288] In one embodiment a process can be scaled to produce commercially useful biofuels. In another embodiment Clostridium sp. Q.D is used to produce an alcohol, e.g., ethanol, butanol, propanol, methanol, or a fuel such as hydrocarbons hydrogen, methane, and hydroxy compounds. In another embodiment Clostridium sp. Q.D is used to produce a carbonyl compound such as an aldehyde or ketone {e.g. acetone, formaldehyde, 1 -propanal, etc.), an organic acid, a derivative of an organic acid such as an ester {e.g. wax ester, glyceride, etc.), 1 , 2-propanediol, 1 , 3 -propanediol, lactic acid, formic acid, acetic acid, succinic acid, pyruvic acid, or an enzyme such as a cellulase, polysaccharase, lipases, protease, ligninase, and hemicellulase.

[00289] In one embodiment, a fed-batch fermentation for production of fermentation end product is described. In another embodiment, a fed-batch fermentation for production of ethanol is described. Fed-batch culture is a kind of microbial process in which medium components, such as carbon substrate, nitrogen substrate, vitamins, minerals, growth factors, cofactors, etc. or biocatalysts

(including, for example, fresh organisms, enzymes prepared by Clostridium sp. Q.D in a separate fermentation, enzymes prepared by other organisms, or a combination of these) are supplied to the fermentor during cultivation, but culture broth is not harvested at the same time and volume. To improve bioconversion from soluble and insoluble substrates, such as those that can be used in biofuels production, various feeding strategies can be utilized to improve yields and/or productivity. This technique can be used to achieve a high cell density within a given time. It can also be used to maintain a good supply of nutrients and substrates for the bioconversion process. It can also be used to achieve higher titer and productivity of desirable products that might otherwise be achieved more slowly or not at all.

[00290] While Clostridium sp. Q.D can be used in long or short fermentation cycles, it is particularly well-suited for long fermentation cycles and for use in fermentations with partial harvest, self-seeding, and broth recycle operations due to the anaerobic conditions of the fermentation, the presence of alcohol, the very fast growth rate of the organism compared to other Clostridia, and, in one embodiment, the use of a solid carbon substrate, whether or not resulting in low sugar concentrations in the broth.

[00291] In another embodiment, a fermentation to produce ethanol is performed by culturing a strain of Clostridium sp. Q.D in a medium having a high concentration of one or more carbon sources, and/or augmenting the culture with addition of fresh cells of Clostridium sp. Q.D during the course of the fermentation. The resulting production of ethanol can be up to 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6- fold, 7-fold, 8-fold, 9-fold, and in some cases up to 10-fold and higher in volumetric productivity than a batch process and achieve a carbon conversion efficiency approaching the theoretical maximum. The theoretical maximum can vary with the substrate and product. For example, the generally accepted maximum efficiency for conversion of glucose to ethanol is 0.51 g ethanol/g glucose. In one embodiment Clostridium sp. Q.D can produce about 40-100% of a theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce up to about 40% of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce up to about 50%> of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce about 70%) of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce about 90%> of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce about 95% of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce about 95% of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce about 99% of the theoretical maximum yield of ethanol. In another embodiment, Clostridium sp. Q.D can produce about 100% of the theoretical maximum yield of ethanol. In one embodiment Clostridium sp. Q.D can produce up to about 1 %>, 2 %>, 3 %, 4 %, 5 %, 6 %, 7 %, 8 %, 9 %, 10 %, 11 %, 12 %, 13 %, 14 %, 15 %, 16 %, 17 %, 18 %, 19 %, 20 %, 21 %, 22 %, 23 %, 24 %, 25 %, 26 %, 27 %, 28 %, 29 %, 30 %, 31 %, 32 %, 33 %, 34 %, 35 %, 36 %, 37 %, 38 %, 39 %, 40 %, 41 %, 42 %, 43 %, 44 %, 45 %, 46 %, 47 %, 48 %, 49 %, 50 %, 51 %, 52 %, 53 %, 54 %, 55 %, 56 %, 57 %, 58 %, 59 %, 60 %, 61 %, 62 %, 63 %, 64 %, 65 %, 66 %, 67 %, 68 %, 69 %, 70 %, 71 %, 72 %, 73 %, 74 %, 75 %, 76 %, 77 %, 78 %, 79 %, 80 %, 81 %, 82 %, 83 %, 84 %, 85 %, 86 %, 87 %, 88 %, 89 %, 90 %, 91 %, 92 %, 93 %, 94 %, 95 %, 96 %, 97 %, 98 %, 99 %, 99.99 %>, orlOO % of a theoretical maximum yield of ethanol.

[00292] Clostridium sp. Q.D cells used for the seed inoculum or for cell augmentation can be prepared or treated in ways that relate to their ability to produce enzymes useful for hydrolyzing the components of the production medium. For example, in one embodiment, the cells can produce useful enzymes after they are transferred to the production medium or production fermentor. In another embodiment, Clostridium sp. Q.D cells can have already produced useful enzymes prior to transfer to the production medium or the production fermentor. In another embodiment, Clostridium sp. Q.D cells can be ready to produce useful enzymes once transferred to the production medium or the production fermentor, or Clostridium sp. Q.D cells can have some combination of these enzyme production characteristics. In one embodiment, the seed can be grown initially in a medium containing a simple sugar source, such as corn syrup, and then transitioned to the production medium carbon source prior to transfer to the production medium. In another embodiment, the seed is grown on a combination of simple sugars and production medium carbon source prior to transfer to the production medium. In another embodiment, the seed is grown on the production medium carbon source from the start. In another embodiment, the seed is grown on one production medium carbon source and then transitioned to another production medium carbon source prior to transfer to the production medium. In another embodiment, the seed is grown on a combination of production medium carbon sources prior to transfer to the production medium. In another embodiment, the seed is grown on a carbon source that favors production of hydrolytic enzymes with activity toward the components of the production medium.

[00293] In another embodiment, a fermentation to produce ethanol is performed by culturing a strain of Clostridium sp. Q.D microorganism and adding fresh medium components and fresh Clostridium sp. Q.D cells while the cells in the fermentor are growing. Medium components, such as carbon, nitrogen, and combinations of these, can be added as disclosed herein, as well as other nutrients, including vitamins, factors, cofactors, enzymes, minerals, salts, and such, sufficient to maintain an effective level of these nutrients in the medium. The medium and Clostridium sp. Q.D can be added simultaneously, or one at a time. In another embodiment, fresh Clostridium sp. Q.D cells can be added when hydrolytic enzyme activity decreases, especially when the activity of those hydrolytic enzymes that are more sensitive to the presence of alcohol decreases. After the addition of fresh Clostridium sp. Q.D cells, a nitrogen feed or a combination of nitrogen and carbon feed and/or other medium components can be fed, prolonging the enzymatic production or other activity of the cells. In another embodiment, the cells can be added with sufficient carbon and nitrogen to prolong the enzymatic production or other activity of the cells sufficiently until the next addition of fresh cells. In another embodiment, fresh Clostridium sp. Q.D cells can be added when both the nitrogen level and carbon level present in the fermentor increase. In another embodiment, Clostridium sp. Q.D cells can be added when the viable cell count decreases, especially when the nitrogen level is relatively stable or increasing. In another embodiment, fresh cells can be added when a significant portion of the viable cells are in the process of sporulation, or have sporulated. Appropriate times for adding fresh Clostridium sp. Q.D cells can be when the portion of cells in the process of sporulation or have sporulated is about 2% to about 100%, about 10% to about 75%, about 20% to about 50%, or about 25% to about 30% of the cells are in the process of sporulation or have sporulated.

[00294] In another embodiment, Clostridium sp. Q.D-5 or Clostridium sp. Q.D-7 cells or another sporulation mutant can be used in fermentation to continue the production of fermentation end products without the cells entering a resting state. In this instance, cells will continue to grow and divide, or just continue to metabolize without reproduction.

[00295] In another embodiment, a fermentation to produce ethanol is performed by culturing a strain of Clostridium sp. Q.D microorganism and adding recycled Clostridium sp. Q.D cells while the cells in the fermentor are cell expansion stage {e.g. seed stage) and/or the final fermentation stage of a

fermentation. Without intending to be limited to any theory the results described herein indicate that the recycled cells have a tolerance of higher ethanol concentrations and the ability to grow in such an environment. Thus, such a tolerance and ability can be useful for situations such as the cell expansion stage {e.g. seed stage) and the final fermentation stage of a fermentation where these concentrations of ethanol are present, including ethanol production fermentations, or for the production of other products in the presence of these concentrations of ethanol.

Medium Compositions

[00296] In various embodiments, particular medium components can have beneficial effects on the performance of the fermentation, such as increasing the titer of desired products, or increasing the rate that the desired products are produced. Specific compounds can be supplied as a specific, pure ingredient, such as a particular amino acid, or it can be supplied as a component of a more complex ingredient, such as using a microbial, plant or animal product as a medium ingredient to provide a particular amino acid, promoter, cofactor, or other beneficial compound. In some cases, the particular compound supplied in the medium ingredient can be combined with other compounds by the organism resulting in a fermentation-beneficial compound. One example of this situation would be where a medium ingredient provides a specific amino acid which the organism uses to make an enzyme beneficial to the fermentation. Other examples can include medium components that are used to generate growth or product promoters, etc. In such cases, it can be possible to obtain a fermentation- beneficial result by supplementing the enzyme, promoter, growth factor, etc. or by adding the precursor. In some situations, the specific mechanism whereby the medium component benefits the fermentation is not known, only that a beneficial result is achieved.

[00297] In one embodiment, beneficial fermentation results can be achieved by adding yeast extract. The addition of the yeast extract can result in increased ethanol titer in batch fermentation, improved productivity and reduced production of side products such as organic acids. In one embodiment beneficial results with yeast extract can be achieved at usage levels of about 0.5 to about 50 g/L, about 5 to about 30 g/L, or about 10 to about 30 g/L. In another embodiment the yeast extract is used at level about 0.5 g/L, 0.6 g/L, 0.7 g/L, 0.8 g/L, 0.9 g/L, 1 g/L, 1.1 g/L, 1.2 g/L, 1.3 g/L, 1.4 g/L, 1.5 g/L, 1.6 g/L, 1.7 g/L, 1.8 g/L, 1.9 g/L, 2 g/L, 2.1 g/L, 2.2 g/L, 2.3 g/L, 2.4 g/L, 2.5 g/L, 2.6 g/L, 2.7 g/L, 2.8 g/L, 2.9 g/L, 3 g/L, 3.1 g/L, 3.2 g/L, 3.3 g/L, 3.4 g/L, 3.5 g/L, 3.6 g/L, 3.7 g/L, 3.8 g/L, 3.9 g/L, 4 g/L, 4.1 g/L, 4.2 g/L, 4.3 g/L, 4.4 g/L, 4.5 g/L, 4.6 g/L, 4.7 g/L, 4.8 g/L, 4.9 g/L, 5 g/L, 5.1 g/L, 5.2 g/L, 5.3 g/L, 5.4 g/L, 5.5 g/L, 5.6 g/L, 5.7 g/L, 5.8 g/L, 5.9 g/L, 6 g/L, 6.1 g/L, 6.2 g/L, 6.3 g/L, 6.4 g/L, 6.5 g/L, 6.6 g/L, 6.7 g/L, 6.8 g/L, 6.9 g/L, 7 g/L, 7.1 g/L, 7.2 g/L, 7.3 g/L, 7.4 g/L, 7.5 g/L, 7.6 g/L, 7.7 g/L, 7.8 g/L, 7.9 g/L, 8 g/L, 8.1 g/L, 8.2 g/L, 8.3 g/L, 8.4 g/L, 8.5 g/L, 8.6 g/L, 8.7 g/L, 8.8 g/L, 8.9 g/L, 9 g/L, 9.1 g/L, 9.2 g/L, 9.3 g/L, 9.4 g/L, 9.5 g/L, 9.6 g/L, 9.7 g/L, 9.8 g/L, 9.9 g/L, 10 g/L, 10.1 g/L, 10.2 g/L, 10.3 g/L, 10.4 g/L, 10.5 g/L, 10.6 g/L, 10.7 g/L, 10.8 g/L, 10.9 g/L, 11 g/L, 11.1 g/L, 11.2 g/L, 11.3 g/L,

11.4 g/L, 11.5 g/L, 11.6 g/L, 11.7 g/L, 11.8 g/L, 11.9 g/L, 12 g/L, 12.1 g/L, 12.2 g/L, 12.3 g/L, 12.4 g/L, 12.5 g/L, 12.6 g/L, 12.7 g/L, 12.8 g/L, 12.9 g/L, 13 g/L, 13.1 g/L, 13.2 g/L, 13.3 g/L, 13.4 g/L,

13.5 g/L, 13.6 g/L, 13.7 g/L, 13.8 g/L, 13.9 g/L, 14 g/L, 14.1 g/L, 14.2 g/L, 14.3 g/L, 14.4 g/L, 14.5 g/L, 14.6 g/L, 14.7 g/L, 14.8 g/L, 14.9 g/L, 15 g/L, 15.1 g/L, 15.2 g/L, 15.3 g/L, 15.4 g/L, 15.5 g/L,

15.6 g/L, 15.7 g/L, 15.8 g/L, 15.9 g/L, 16 g/L, 16.1 g/L, 16.2 g/L, 16.3 g/L, 16.4 g/L, 16.5 g/L, 16.6 g/L, 16.7 g/L, 16.8 g/L, 16.9 g/L, 17 g/L, 17.1 g/L, 17.2 g/L, 17.3 g/L, 17.4 g/L, 17.5 g/L, 17.6 g/L,

17.7 g/L, 17.8 g/L, 17.9 g/L, 18 g/L, 18.1 g/L, 18.2 g/L, 18.3 g/L, 18.4 g/L, 18.5 g/L, 18.6 g/L, 18.7 g/L, 18.8 g/L, 18.9 g/L, 19 g/L, 19.1 g/L, 19.2 g/L, 19.3 g/L, 19.4 g/L, 19.5 g/L, 19.6 g/L, 19.7 g/L,

19.8 g/L, 19.9 g/L, 20 g/L, 20.1 g/L, 20.2 g/L, 20.3 g/L, 20.4 g/L, 20.5 g/L, 20.6 g/L, 20.7 g/L, 20.8 g/L, 20.9 g/L, 21 g/L, 21.1 g/L, 21.2 g/L, 21.3 g/L, 21.4 g/L, 21.5 g/L, 21.6 g/L, 21.7 g/L, 21.8 g/L,

21.9 g/L, 22 g/L, 22.1 g/L, 22.2 g/L, 22.3 g/L, 22.4 g/L, 22.5 g/L, 22.6 g/L, 22.7 g/L, 22.8 g/L, 22.9 g/L, 23 g/L, 23.1 g/L, 23.2 g/L, 23.3 g/L, 23.4 g/L, 23.5 g/L, 23.6 g/L, 23.7 g/L, 23.8 g/L, 23.9 g/L, 24 g/L, 24.1 g/L, 24.2 g/L, 24.3 g/L, 24.4 g/L, 24.5 g/L, 24.6 g/L, 24.7 g/L, 24.8 g/L, 24.9 g/L, 25 g/L,

25.1 g/L, 25.2 g/L, 25.3 g/L, 25.4 g/L, 25.5 g/L, 25.6 g/L, 25.7 g/L, 25.8 g/L, 25.9 g/L, 26 g/L, 26.1 g/L, 26.2 g/L, 26.3 g/L, 26.4 g/L, 26.5 g/L, 26.6 g/L, 26.7 g/L, 26.8 g/L, 26.9 g/L, 27 g/L, 27.1 g/L,

27.2 g/L, 27.3 g/L, 27.4 g/L, 27.5 g/L, 27.6 g/L, 27.7 g/L, 27.8 g/L, 27.9 g/L, 28 g/L, 28.1 g/L, 28.2 g/L, 28.3 g/L, 28.4 g/L, 28.5 g/L, 28.6 g/L, 28.7 g/L, 28.8 g/L, 28.9 g/L, 29 g/L, 29.1 g/L, 29.2 g/L,

29.3 g/L, 29.4 g/L, 29.5 g/L, 29.6 g/L, 29.7 g/L, 29.8 g/L, 29.9 g/L, 30 g/L, 30.1 g/L, 30.2 g/L, 30.3 g/L, 30.4 g/L, 30.5 g/L, 30.6 g/L, 30.7 g/L, 30.8 g/L, 30.9 g/L, 31 g/L, 31.1 g/L, 31.2 g/L, 31.3 g/L,

31.4 g/L, 31.5 g/L, 31.6 g/L, 31.7 g/L, 31.8 g/L, 31.9 g/L, 32 g/L, 32.1 g/L, 32.2 g/L, 32.3 g/L, 32.4 g/L, 32.5 g/L, 32.6 g/L, 32.7 g/L, 32.8 g/L, 32.9 g/L, 33 g/L, 33.1 g/L, 33.2 g/L, 33.3 g/L, 33.4 g/L,

33.5 g/L, 33.6 g/L, 33.7 g/L, 33.8 g/L, 33.9 g/L, 34 g/L, 34.1 g/L, 34.2 g/L, 34.3 g/L, 34.4 g/L, 34.5 g/L, 34.6 g/L, 34.7 g/L, 34.8 g/L, 34.9 g/L, 35 g/L, 35.1 g/L, 35.2 g/L, 35.3 g/L, 35.4 g/L, 35.5 g/L,

35.6 g/L, 35.7 g/L, 35.8 g/L, 35.9 g/L, 36 g/L, 36.1 g/L, 36.2 g/L, 36.3 g/L, 36.4 g/L, 36.5 g/L, 36.6 g/L, 36.7 g/L, 36.8 g/L, 36.9 g/L, 37 g/L, 37.1 g/L, 37.2 g/L, 37.3 g/L, 37.4 g/L, 37.5 g/L, 37.6 g/L,

37.7 g/L, 37.8 g/L, 37.9 g/L, 38 g/L, 38.1 g/L, 38.2 g/L, 38.3 g/L, 38.4 g/L, 38.5 g/L, 38.6 g/L, 38.7 g/L, 38.8 g/L, 38.9 g/L, 39 g/L, 39.1 g/L, 39.2 g/L, 39.3 g/L, 39.4 g/L, 39.5 g/L, 39.6 g/L, 39.7 g/L,

39.8 g/L, 39.9 g/L, 40 g/L, 40.1 g/L, 40.2 g/L, 40.3 g/L, 40.4 g/L, 40.5 g/L, 40.6 g/L, 40.7 g/L, 40.8 g/L, 40.9 g/L, 41 g/L, 41.1 g/L, 41.2 g/L, 41.3 g/L, 41.4 g/L, 41.5 g/L, 41.6 g/L, 41.7 g/L, 41.8 g/L,

41.9 g/L, 42 g/L, 42.1 g/L, 42.2 g/L, 42.3 g/L, 42.4 g/L, 42.5 g/L, 42.6 g/L, 42.7 g/L, 42.8 g/L, 42.9 g/L, 43 g/L, 43.1 g/L, 43.2 g/L, 43.3 g/L, 43.4 g/L, 43.5 g/L, 43.6 g/L, 43.7 g/L, 43.8 g/L, 43.9 g/L, 44 g/L, 44.1 g/L, 44.2 g/L, 44.3 g/L, 44.4 g/L, 44.5 g/L, 44.6 g/L, 44.7 g/L, 44.8 g/L, 44.9 g/L, 45 g/L, 45.1 g/L, 45.2 g/L, 45.3 g/L, 45.4 g/L, 45.5 g/L, 45.6 g/L, 45.7 g/L, 45.8 g/L, 45.9 g/L, 46 g/L, 46.1 g/L, 46.2 g/L, 46.3 g/L, 46.4 g/L, 46.5 g/L, 46.6 g/L, 46.7 g/L, 46.8 g/L, 46.9 g/L, 47 g/L, 47.1 g/L,

47.2 g/L, 47.3 g/L, 47.4 g/L, 47.5 g/L, 47.6 g/L, 47.7 g/L, 47.8 g/L, 47.9 g/L, 48 g/L, 48.1 g/L, 48.2 g/L, 48.3 g/L, 48.4 g/L, 48.5 g/L, 48.6 g/L, 48.7 g/L, 48.8 g/L, 48.9 g/L, 49 g/L, 49.1 g/L, 49.2 g/L,

49.3 g/L, 49.4 g/L, 49.5 g/L, 49.6 g/L, 49.7 g/L, 49.8 g/L, 49.9 g/L or 50 g/L.

[00298] The yeast extract can also be fed throughout the course of the entire fermentation or a portion of the fermentation, continuously or delivered at intervals. In one embodiment usage levels include maintaining a nitrogen concentration of about 0.05 g/L to about 3g/L (as nitrogen), where at least a portion of the nitrogen is supplied from corn steep powder; or about 0.3g/L to 1.3g/L; or 0.4 g/L to about 0.9 g/L. In another embodiment the nitrogen concentration is about 0.05 g/L, 0.06 g/L, 0.07 g/L, 0.08 g/L, 0.09 g/L, 0.1 g/L, 0.1 1 g/L, 0.12 g/L, 0.13 g/L, 0.14 g/L, 0.15 g/L, 0.16 g/L, 0.17 g/L, 0.18 g/L, 0.19 g/L, 0.2 g/L, 0.21 g/L, 0.22 g/L, 0.23 g/L, 0.24 g/L, 0.25 g/L, 0.26 g/L, 0.27 g/L, 0.28 g/L, 0.29 g/L, 0.3 g/L, 0.31 g/L, 0.32 g/L, 0.33 g/L, 0.34 g/L, 0.35 g/L, 0.36 g/L, 0.37 g/L, 0.38 g/L, 0.39 g/L, 0.4 g/L, 0.41 g/L, 0.42 g/L, 0.43 g/L, 0.44 g/L, 0.45 g/L, 0.46 g/L, 0.47 g/L, 0.48 g/L, 0.49 g/L, 0.5 g/L, 0.51 g/L, 0.52 g/L, 0.53 g/L, 0.54 g/L, 0.55 g/L, 0.56 g/L, 0.57 g/L, 0.58 g/L, 0.59 g/L, 0.6 g/L, 0.61 g/L, 0.62 g/L, 0.63 g/L, 0.64 g/L, 0.65 g/L, 0.66 g/L, 0.67 g/L, 0.68 g/L, 0.69 g/L, 0.7 g/L, 0.71 g/L, 0.72 g/L, 0.73 g/L, 0.74 g/L, 0.75 g/L, 0.76 g/L, 0.77 g/L, 0.78 g/L, 0.79 g/L, 0.8 g/L, 0.81 g/L, 0.82 g/L, 0.83 g/L, 0.84 g/L, 0.85 g/L, 0.86 g/L, 0.87 g/L, 0.88 g/L, 0.89 g/L, 0.9 g/L, 0.91 g/L, 0.92 g/L, 0.93 g/L, 0.94 g/L, 0.95 g/L, 0.96 g/L, 0.97 g/L, 0.98 g/L, 0.99 g/L, 1 g/L, 1.01 g/L, 1.02 g/L, 1.03 g/L, 1.04 g/L, 1.05 g/L, 1.06 g/L, 1.07 g/L, 1.08 g/L, 1.09 g/L, 1.1 g/L, 1.1 1 g/L, 1.12 g/L, 1.13 g/L, 1.14 g/L, 1.15 g/L, 1.16 g/L, 1.17 g/L, 1.18 g/L, 1.19 g/L, 1.2 g/L, 1.21 g/L, 1.22 g/L, 1.23 g/L, 1.24 g/L, 1.25 g/L, 1.26 g/L, 1.27 g/L, 1.28 g/L, 1.29 g/L, 1.3 g/L, 1.31 g/L, 1.32 g/L, 1.33 g/L, 1.34 g/L, 1.35 g/L, 1.36 g/L, 1.37 g/L, 1.38 g/L, 1.39 g/L, 1.4 g/L, 1.41 g/L, 1.42 g/L, 1.43 g/L, 1.44 g/L, 1.45 g/L, 1.46 g/L, 1.47 g/L, 1.48 g/L, 1.49 g/L, 1.5 g/L, 1.51 g/L, 1.52 g/L, 1.53 g/L, 1.54 g/L, 1.55 g/L, 1.56 g/L, 1.57 g/L, 1.58 g/L, 1.59 g/L, 1.6 g/L, 1.61 g/L, 1.62 g/L, 1.63 g/L, 1.64 g/L, 1.65 g/L, 1.66 g/L, 1.67 g/L, 1.68 g/L, 1.69 g/L, 1.7 g/L, 1.71 g/L, 1.72 g/L, 1.73 g/L, 1.74 g/L, 1.75 g/L, 1.76 g/L, 1.77 g/L, 1.78 g/L, 1.79 g/L, 1.8 g/L, 1.81 g/L, 1.82 g/L, 1.83 g/L, 1.84 g/L, 1.85 g/L, 1.86 g/L, 1.87 g/L, 1.88 g/L, 1.89 g/L, 1.9 g/L, 1.91 g/L, 1.92 g/L, 1.93 g/L, 1.94 g/L, 1.95 g/L, 1.96 g/L, 1.97 g/L, 1.98 g/L, 1.99 g/L, 2 g/L, 2.01 g/L, 2.02 g/L, 2.03 g/L, 2.04 g/L, 2.05 g/L, 2.06 g/L, 2.07 g/L, 2.08 g/L, 2.09 g/L, 2.1 g/L, 2.1 1 g/L, 2.12 g/L, 2.13 g/L, 2.14 g/L, 2.15 g/L, 2.16 g/L, 2.17 g/L, 2.18 g/L, 2.19 g/L, 2.2 g/L, 2.21 g/L, 2.22 g/L, 2.23 g/L, 2.24 g/L, 2.25 g/L, 2.26 g/L, 2.27 g/L, 2.28 g/L, 2.29 g/L, 2.3 g/L, 2.31 g/L, 2.32 g/L, 2.33 g/L, 2.34 g/L, 2.35 g/L, 2.36 g/L, 2.37 g/L, 2.38 g/L, 2.39 g/L, 2.4 g/L, 2.41 g/L, 2.42 g/L, 2.43 g/L, 2.44 g/L, 2.45 g/L, 2.46 g/L, 2.47 g/L, 2.48 g/L, 2.49 g/L, 2.5 g/L, 2.51 g/L, 2.52 g/L, 2.53 g/L, 2.54 g/L, 2.55 g/L, 2.56 g/L, 2.57 g/L, 2.58 g/L, 2.59 g/L, 2.6 g/L, 2.61 g/L, 2.62 g/L, 2.63 g/L, 2.64 g/L, 2.65 g/L, 2.66 g/L, 2.67 g/L, 2.68 g/L, 2.69 g/L, 2.7 g/L, 2.71 g/L, 2.72 g/L, 2.73 g/L, 2.74 g/L, 2.75 g/L, 2.76 g/L, 2.77 g/L, 2.78 g/L, 2.79 g/L, 2.8 g/L, 2.81 g/L, 2.82 g/L, 2.83 g/L, 2.84 g/L, 2.85 g/L, 2.86 g/L, 2.87 g/L, 2.88 g/L, 2.89 g/L, 2.9 g/L, 2.91 g/L, 2.92 g/L, 2.93 g/L, 2.94 g/L, 2.95 g/L, 2.96 g/L, 2.97 g/L, 2.98 g/L, 2.99 g/L, or 3 g/L.

[00299] In one embodiment, beneficial fermentation results can be achieved by adding corn steep powder to the fermentation. The addition of the corn steep powder can result in increased ethanol titer in batch fermentation, improved productivity and reduced production of side products such as organic acids. In another embodiment beneficial results with corn steep powder can be achieved at usage levels of about 3 to about 20 g/L, about 5 to about 15 g/L, or about 8 to about 12 g/L. In another embodiment beneficial results with steep powder can be achieved at a level of about 3 g/L, 3.1 g/L, 3.2 g/L, 3.3 g/L, 3.4 g/L, 3.5 g/L, 3.6 g/L, 3.7 g/L, 3.8 g/L, 3.9 g/L, 4 g/L, 4.1 g/L, 4.2 g/L, 4.3 g/L, 4.4 g/L, 4.5 g/L, 4.6 g/L, 4.7 g/L, 4.8 g/L, 4.9 g/L, 5 g/L, 5.1 g/L, 5.2 g/L, 5.3 g/L, 5.4 g/L, 5.5 g/L, 5.6 g/L, 5.7 g/L, 5.8 g/L, 5.9 g/L, 6 g/L, 6.1 g/L, 6.2 g/L, 6.3 g/L, 6.4 g/L, 6.5 g/L, 6.6 g/L, 6.7 g/L, 6.8 g/L, 6.9 g/L, 7 g/L, 7.1 g/L, 7.2 g/L, 7.3 g/L, 7.4 g/L, 7.5 g/L, 7.6 g/L, 7.7 g/L, 7.8 g/L, 7.9 g/L, 8 g/L, 8.1 g/L, 8.2 g/L, 8.3 g/L, 8.4 g/L, 8.5 g/L, 8.6 g/L, 8.7 g/L, 8.8 g/L, 8.9 g/L, 9 g/L, 9.1 g/L, 9.2 g/L, 9.3 g/L, 9.4 g/L, 9.5 g/L, 9.6 g/L, 9.7 g/L, 9.8 g/L, 9.9 g/L, 10 g/L, 10.1 g/L, 10.2 g/L, 10.3 g/L, 10.4 g/L, 10.5 g/L, 10.6 g/L, 10.7 g/L, 10.8 g/L, 10.9 g/L, 1 1 g/L, 1 1.1 g/L, 1 1.2 g/L, 1 1.3 g/L, 1 1.4 g/L, 1 1.5 g/L, 1 1.6 g/L, 11.7 g/L,

1 1.8 g/L, 1 1.9 g/L, 12 g/L, 12.1 g/L, 12.2 g/L, 12.3 g/L, 12.4 g/L, 12.5 g/L, 12.6 g/L, 12.7 g/L, 12.8 g/L, 12.9 g/L, 13 g/L, 13.1 g/L, 13.2 g/L, 13.3 g/L, 13.4 g/L, 13.5 g/L, 13.6 g/L, 13.7 g/L, 13.8 g/L,

13.9 g/L, 14 g/L, 14.1 g/L, 14.2 g/L, 14.3 g/L, 14.4 g/L, 14.5 g/L, 14.6 g/L, 14.7 g/L, 14.8 g/L, 14.9 g/L, 15 g/L, 15.1 g/L, 15.2 g/L, 15.3 g/L, 15.4 g/L, 15.5 g/L, 15.6 g/L, 15.7 g/L, 15.8 g/L, 15.9 g/L, 16 g/L, 16.1 g/L, 16.2 g/L, 16.3 g/L, 16.4 g/L, 16.5 g/L, 16.6 g/L, 16.7 g/L, 16.8 g/L, 16.9 g/L, 17 g/L,

17.1 g/L, 17.2 g/L, 17.3 g/L, 17.4 g/L, 17.5 g/L, 17.6 g/L, 17.7 g/L, 17.8 g/L, 17.9 g/L, 18 g/L, 18.1 g/L, 18.2 g/L, 18.3 g/L, 18.4 g/L, 18.5 g/L, 18.6 g/L, 18.7 g/L, 18.8 g/L, 18.9 g/L, 19 g/L, 19.1 g/L,

19.2 g/L, 19.3 g/L, 19.4 g/L, 19.5 g/L, 19.6 g/L, 19.7 g/L, 19.8 g/L, 19.9 g/L, or 20 g/L.

[00300] In one embodiment corn steep powder can also be fed throughout the course of the entire fermentation or a portion of the fermentation, continuously or delivered at intervals. In another embodiment usage levels include maintaining a nitrogen concentration of about 0.05 g/L to about 3g/L (as nitrogen), where at least a portion of the nitrogen is supplied from corn steep powder; about 0.3g/L to 1.3g/L; or about 0.4 g/L to about 0.9 g/L. In another embodiment the nitrogen level is about 0.05 g/L, 0.06 g/L, 0.07 g/L, 0.08 g/L, 0.09 g/L, 0.1 g/L, 0.1 1 g/L, 0.12 g/L, 0.13 g/L, 0.14 g/L, 0.15 g/L, 0.16 g/L, 0.17 g/L, 0.18 g/L, 0.19 g/L, 0.2 g/L, 0.21 g/L, 0.22 g/L, 0.23 g/L, 0.24 g/L, 0.25 g/L, 0.26 g/L, 0.27 g/L, 0.28 g/L, 0.29 g/L, 0.3 g/L, 0.31 g/L, 0.32 g/L, 0.33 g/L, 0.34 g/L, 0.35 g/L, 0.36 g/L, 0.37 g/L, 0.38 g/L, 0.39 g/L, 0.4 g/L, 0.41 g/L, 0.42 g/L, 0.43 g/L, 0.44 g/L, 0.45 g/L, 0.46 g/L, 0.47 g/L, 0.48 g/L, 0.49 g/L, 0.5 g/L, 0.51 g/L, 0.52 g/L, 0.53 g/L, 0.54 g/L, 0.55 g/L, 0.56 g/L, 0.57 g/L, 0.58 g/L, 0.59 g/L, 0.6 g/L, 0.61 g/L, 0.62 g/L, 0.63 g/L, 0.64 g/L, 0.65 g/L, 0.66 g/L, 0.67 g/L, 0.68 g/L, 0.69 g/L, 0.7 g/L, 0.71 g/L, 0.72 g/L, 0.73 g/L, 0.74 g/L, 0.75 g/L, 0.76 g/L, 0.77 g/L, 0.78 g/L, 0.79 g/L, 0.8 g/L, 0.81 g/L, 0.82 g/L, 0.83 g/L, 0.84 g/L, 0.85 g/L, 0.86 g/L, 0.87 g/L, 0.88 g/L, 0.89 g/L, 0.9 g/L, 0.91 g/L, 0.92 g/L, 0.93 g/L, 0.94 g/L, 0.95 g/L, 0.96 g/L, 0.97 g/L, 0.98 g/L, 0.99 g/L, 1 g/L, 1.01 g/L, 1.02 g/L, 1.03 g/L, 1.04 g/L, 1.05 g/L, 1.06 g/L, 1.07 g/L, 1.08 g/L, 1.09 g/L, 1.1 g/L, 1.1 1 g/L, 1.12 g/L, 1.13 g/L, 1.14 g/L, 1.15 g/L, 1.16 g/L, 1.17 g/L, 1.18 g/L, 1.19 g/L, 1.2 g/L, 1.21 g/L, 1.22 g/L, 1.23 g/L, 1.24 g/L, 1.25 g/L, 1.26 g/L, 1.27 g/L, 1.28 g/L, 1.29 g/L, 1.3 g/L, 1.31 g/L, 1.32 g/L, 1.33 g/L, 1.34 g/L, 1.35 g/L, 1.36 g/L, 1.37 g/L, 1.38 g/L, 1.39 g/L, 1.4 g/L, 1.41 g/L, 1.42 g/L, 1.43 g/L, 1.44 g/L, 1.45 g/L, 1.46 g/L, 1.47 g/L, 1.48 g/L, 1.49 g/L, 1.5 g/L, 1.51 g/L, 1.52 g/L, 1.53 g/L, 1.54 g/L, 1.55 g/L, 1.56 g/L, 1.57 g/L, 1.58 g/L, 1.59 g/L, 1.6 g/L, 1.61 g/L, 1.62 g/L, 1.63 g/L, 1.64 g/L, 1.65 g/L, 1.66 g/L, 1.67 g/L, 1.68 g/L, 1.69 g/L, 1.7 g/L, 1.71 g/L, 1.72 g/L, 1.73 g/L, 1.74 g/L, 1.75 g/L, 1.76 g/L, 1.77 g/L, 1.78 g/L, 1.79 g/L, 1.8 g/L, 1.81 g/L, 1.82 g/L, 1.83 g/L, 1.84 g/L, 1.85 g/L, 1.86 g/L, 1.87 g/L, 1.88 g/L, 1.89 g/L, 1.9 g/L, 1.91 g/L, 1.92 g/L, 1.93 g/L, 1.94 g/L, 1.95 g/L, 1.96 g/L, 1.97 g/L, 1.98 g/L, 1.99 g/L, 2 g/L, 2.01 g/L, 2.02 g/L, 2.03 g/L, 2.04 g/L, 2.05 g/L, 2.06 g/L, 2.07 g/L, 2.08 g/L, 2.09 g/L, 2.1 g/L, 2.1 1 g/L, 2.12 g/L, 2.13 g/L, 2.14 g/L, 2.15 g/L, 2.16 g/L, 2.17 g/L, 2.18 g/L, 2.19 g/L, 2.2 g/L, 2.21 g/L, 2.22 g/L, 2.23 g/L, 2.24 g/L, 2.25 g/L, 2.26 g/L, 2.27 g/L, 2.28 g/L, 2.29 g/L, 2.3 g/L, 2.31 g/L, 2.32 g/L, 2.33 g/L, 2.34 g/L, 2.35 g/L, 2.36 g/L, 2.37 g/L, 2.38 g/L, 2.39 g/L, 2.4 g/L, 2.41 g/L, 2.42 g/L, 2.43 g/L, 2.44 g/L, 2.45 g/L, 2.46 g/L, 2.47 g/L, 2.48 g/L, 2.49 g/L, 2.5 g/L, 2.51 g/L, 2.52 g/L, 2.53 g/L, 2.54 g/L, 2.55 g/L, 2.56 g/L, 2.57 g/L, 2.58 g/L, 2.59 g/L, 2.6 g/L, 2.61 g/L, 2.62 g/L, 2.63 g/L, 2.64 g/L, 2.65 g/L, 2.66 g/L, 2.67 g/L, 2.68 g/L, 2.69 g/L, 2.7 g/L, 2.71 g/L, 2.72 g/L, 2.73 g/L, 2.74 g/L, 2.75 g/L, 2.76 g/L, 2.77 g/L, 2.78 g/L, 2.79 g/L, 2.8 g/L, 2.81 g/L, 2.82 g/L, 2.83 g/L, 2.84 g/L, 2.85 g/L, 2.86 g/L, 2.87 g/L, 2.88 g/L, 2.89 g/L, 2.9 g/L, 2.91 g/L, 2.92 g/L, 2.93 g/L, 2.94 g/L, 2.95 g/L, 2.96 g/L, 2.97 g/L, 2.98 g/L, 2.99 g/L, or 3 g/L.

[00301] In another embodiment, other related products can be used, such as corn steep liquor or corn steep solids. When corn steep liquor is used, the usage rate would be approximately the same as for corn steep solids on a solids basis. In another embodiment, the corn steep powder (or solids or liquor) is added in relation to the amount of carbon substrate that is present or that will be added. When added in this way, beneficial amounts of corn steep powder (or liquor or solids) can include about 1 : 1 to about 1 :6 g/g carbon, about 1 : 1 to about 1 :5 g/g carbon, or about 1 :2 to about 1 :4 g/g carbon. In another embodiment ratios as high as about 1.5: 1 g/g carbon or about 3 : 1 g/g carbon or as low as about 1 : 8 g/g carbon or about 1 : 10 g/g carbon are used. In another embodiment the ratio is 2: 1 g/g carbon, 1.9: 1 g/g carbon, 1.8: 1 g/g carbon, 1.7:1 g/g carbon, 1.6: 1 g/g carbon, 1.5: 1 g/g carbon, 1.4: 1 g/g carbon, 1.3 : 1 g/g carbon, 1.2: 1 g/g carbon, 1.1 : 1 g/g carbon, 1 : 1 g/g carbon, 1 : 1.1 g/g carbon, 1 : 1.2 g/g carbon, 1 : 1.3 g/g carbon, 1 : 1.4 g/g carbon, 1 : 1.5 g/g carbon, 1 : 1.6 g/g carbon, 1 : 1.7 g/g carbon, 1 : 1.8 g/g carbon, 1 : 1.9 g/g carbon, 1 :2 g/g carbon, 1 :2.1 g/g carbon, 1 :2.2 g/g carbon, 1 :2.3 g/g carbon, 1 :2.4 g/g carbon, 1 :2.5 g/g carbon, 1 :2.6 g/g carbon, 1 :2.7 g/g carbon, 1 :2.8 g/g carbon, 1 :2.9 g/g carbon, 1 :3 g/g carbon, 1 :3.1 g/g carbon, 1 :3.2 g/g carbon, 1 :3.3 g/g carbon, 1 :3.4 g/g carbon, 1 :3.5 g/g carbon, 1 :3.6 g/g carbon, 1 :3.7 g/g carbon, 1 :3.8 g/g carbon, 1 :3.9 g/g carbon, 1 :4 g/g carbon, 1 :4.1 g/g carbon, 1 :4.2 g/g carbon, 1 :4.3 g/g carbon, 1 :4.4 g/g carbon, 1 :4.5 g/g carbon, 1 :4.6 g/g carbon, 1 :4.7 g/g carbon, 1 :4.8 g/g carbon, 1 :4.9 g/g carbon, 1 :5 g/g carbon, 1 :5.1 g/g carbon, 1 :5.2 g/g carbon, 1 :5.3 g/g carbon, 1 :5.4 g/g carbon, 1 :5.5 g/g carbon, 1 :5.6 g/g carbon, 1 :5.7 g/g carbon, 1 :5.8 g/g carbon, 1 :5.9 g/g carbon, 1 :6 g/g carbon, 1 :6.1 g/g carbon, 1 :6.2 g/g carbon, 1 :6.3 g/g carbon, 1 :6.4 g/g carbon, 1 :6.5 g/g carbon, 1 :6.6 g/g carbon, 1 :6.7 g/g carbon, 1 :6.8 g/g carbon, 1 :6.9 g/g carbon, 1 :7 g/g carbon, 1 :7.1 g/g carbon, 1 :7.2 g/g carbon, 1 :7.3 g/g carbon, 1 :7.4 g/g carbon, 1 :7.5 g/g carbon, 1 :7.6 g/g carbon, 1 :7.7 g/g carbon, 1 :7.8 g/g carbon, 1 :7.9 g/g carbon, 1 :8 g/g carbon, 1 :8.1 g/g carbon, 1 :8.2 g/g carbon, 1 :8.3 g/g carbon, 1 :8.4 g/g carbon, 1 :8.5 g/g carbon, 1 :8.6 g/g carbon, 1 :8.7 g/g carbon, 1 :8.8 g/g carbon, 1 :8.9 g/g carbon, 1 :9 g/g carbon, 1 :9.1 g/g carbon, 1 :9.2 g/g carbon, 1 :9.3 g/g carbon, 1 :9.4 g/g carbon, 1 :9.5 g/g carbon, 1 :9.6 g/g carbon, 1 :9.7 g/g carbon, 1 :9.8 g/g carbon, 1 :9.9 g/g carbon, or 1 : 10 g/g carbon.

[00302] In one embodiment, beneficial fermentation results can be achieved by adding corn steep powder in combination with yeast extract to the fermentation. Beneficial results with corn steep powder in combination with yeast extract can be achieved at corn steep powder usage levels of about 3 to about 20 g/L, about 5 to about 15 g/L, or about 8 to about 12 g/L and yeast extract usage levels of about 3 to 50 g/L, about 5 to about 30 g/L, or about 10 to about 30 g/L. The corn steep powder and yeast extract can also be fed throughout the course of the entire fermentation or a portion of the fermentation, continuously or delivered at intervals.

[00303] In one embodiment, the beneficial compounds from corn steep powder and/or yeast extract, such as glycine, histidine, isoleucine, proline, or phytate as well as combinations of these compounds can be added to the medium or broth to obtain a beneficial effect.

[00304] Various embodiments offer benefits relating to improving the titer and/or productivity of alcohol production by Clostridium sp. Q.D by culturing the organism in a medium comprising one or more compounds comprising particular fatty acid moieties and/or culturing the organism under conditions of controlled pH.

[00305] Production of high levels of alcohol requires both the ability for the organism to thrive generally in the presence of elevated alcohol levels and the ability to continue to produce alcohol without undue inhibition or suppression by the alcohol and/or other components present. Frequently, different metabolic pathways will be implicated for each of these. For example, pathways related to cell growth generally include those related to protein production, membrane production as well as the production of all of the cellular subsystems necessary for the cell to survive. Pathways related to alcohol production will frequently be more specific, such as those pathways related to the metabolism of sugars leading to production of alcohol and the enzymes that are necessary for the production of alcohol and intermediates. The pathway for one alcohol, e.g., ethanol, can share some similar enzymes, etc., but will also have enzymes and substrates unique to that pathway. While there can be some overlap between these sets of pathways, it is not expected that enhancement of one will automatically result in the enhancement of the other. [00306] In some cases, alcohol intolerance or alcohol-induced toxicity can be related to permeabilization of the cell membrane by elevated levels of alcohol, leading to leakage of intracellular enzymes and nutrients. In some other cases, alcohol tolerance and the ability to produce high alcohol titers is related to the ability of intracellular enzymes to withstand denaturing by the alcohol present, e.g., within the cell, whether due to production by the cell itself or from transport across the cell membrane. In some cases, a more robust membrane will allow a higher alcohol gradient to be present across the membrane, thus allowing the cells to grow and/or continue to produce alcohol at higher external alcohol concentrations.

[00307] In one embodiment, Clostridium sp. Q.D is fermented with a substrate at about pH 5-8.5 In one embodiment a Clostridium sp. Q.D is fermented at pH of about 5.1 , 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1 , 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1 , 8.2, 8.3, 8.4, or 8.5.

Acidic Culture Conditions

[00308] In another aspect, methods of producing alcohol; e.g., ethanol, comprising culturing

Clostridium sp. Q.D in a medium under conditions of controlled pH. In one embodiment, a culture of Clostridium sp. Q.D can be grown at an acidic pH are provided herein. The medium that the culture is grown in can include a carbon source such as agricultural crops, crop residues, trees, wood chips, sawdust, paper, cardboard, or other materials containing cellulose, hemicellulosic, lignocellulose, pectin, polyglucose, polyfructose, and/or hydrolyzed forms of these (collectively, "Feedstock").

Additional nutrients can be present including sulfur- and nitrogen-containing compounds such as amino acids, proteins, hydrolyzed proteins, ammonia, urea, nitrate, nitrite, soy, soy derivatives, casein, casein derivatives, milk powder, milk derivatives, whey, yeast extract, hydrolyze yeast, autolyzed yeast, corn steep liquor, corn steep solids, monosodium glutamate, and/or other fermentation nitrogen sources, vitamins, cofactors and/or mineral supplements. The Feedstock can be pretreated or not, such as described in U.S. Provisional Patent Application No. 61/032048, filed February 27, 2008 or U.S. Provisional Application No. 61/158,581 , filed on March 9, 2009, which are herein incorporated by reference in their entireties. . The procedures and techniques for growing the organism to produce a fuel or other desirable chemical such as is described in incorporated U.S. Patent Application No.

12/720,574 which is herein incorporated by reference in its entirety.

[00309] In one embodiment, the pH of the medium is controlled at less than about pH 7.2 for at least a portion of the fermentation. In one embodiment, the pH is controlled within a range of about pH 3.0 to about 7.1 or about pH 4.5 to about 7.1, or about pH 5.0 to about 6.3, or about pH 5.5 to about 6.3, or about pH 6.0 to about 6.5, or about pH 5.5 to about 6.9 or about pH 6.2 to about 6.7. The pH can be controlled by the addition of a pH modifier. In one embodiment, a pH modifier is an acid, a base, a buffer, or a material that reacts with other materials present to serve to raise of lower the pH. In one embodiment, more than one pH modifier can be used, such as more than one acid, more than one base, one or more acid with one or more bases, one or more acids with one or more buffers, one or more bases with one or more buffers, or one or more acids with one or more bases with one or more buffers. When more than one pH modifiers are utilized, they can be added at the same time or at different times. In one embodiment, one or more acids and one or more bases can be combined, resulting in a buffer. In one embodiment, media components, such as a carbon source or a nitrogen source can also serve as a pH modifier; suitable media components include those with high or low pH or those with buffering capacity. Exemplary media components include acid- or base-hydrolyzed plant polysaccharides having with residual acid or base, AFEX treated plant material with residual ammonia, lactic acid, corn steep solids or liquor.

[00310] In one embodiment, the pH modifier can be added as a part of the medium components prior to inoculation with Clostridium sp. Q.D. In one embodiment, the pH modifier can also be added after inoculation with the Clostridium sp. Q.D. In one embodiment, sufficient buffer capacity can be added to the seed fermentation by way of various pH modifiers and/or other medium components and/or metabolites to provide adequate pH control during the final fermentation stage. In other cases, pH modifier can be added only to the final fermentation stage. In still other cases, pH modifier can be added to both the seed stage and the final stage. In one embodiment, the pH is monitored throughout the fermentation and is adjusted in response to changes in the fermentation. In one embodiment, the pH modifier is added whenever the pH of the fermentation changes by a pH value of about 0.005, 0.01 , 0.05, 0.1 , 0.2, 0.3, 0.4, 0.5 or more at any stage of the fermentation. In one embodiment, the pH modifier is added whenever the alcohol content of the fermentation is about 0.5 g/L, 1.0 g/L, 2.0 g/L, or 5.0 g/L or more. In some cases different types of pH modifiers can be utilized at different stages or points in the fermentation, such as a buffer being used at the seed stage, and base and/or acid added in the final fermenter, or an acid being used at one time and a base at another time.

[00311] In one embodiment, a constant pH can be utilized throughout the fermentation. In one embodiment, the timing and/or amount of pH reduction can be related to the growth conditions of the cells, such as in relation to the cell count, the alcohol produced, the alcohol present, or the rate of alcohol production. In one embodiment, the pH reduction can be made in relation to physical or chemical properties of the fermentation, such as viscosity, medium composition, gas production, off gas composition, etc.

[00312] Non-limiting examples of suitable buffers include salts of phosphoric acid, including monobasic, dibasic, and tribasic salts, mixtures of these salts and mixtures with the acid; salts of citric acid, including the various basic forms, mixtures and mixtures with the acid; and salts of carbonate.

[00313] Suitable acids and bases that can be used as pH modifiers include any liquid or gaseous acid or base that is compatible with the organism. Examples include ammonia, ammonium hydroxide, sulfuric acid, lactic acid, citric acid, phosphoric acid, sodium hydroxide, and HC1. In some cases, the selection of the acid or base can be influenced by the compatibility of the acid or base with equipment being used for fermentation. In some cases, both an acid addition, to lower pH or consume base, and a base addition, to raise pH or consume acid, can be used in the same fermentation.

[00314] The timing and amount of pH modifier to add can be determined from a measurement of the pH of the contents of the fermentor, such as by grab sample or by a submerged pH probe, or it can be determined based on other parameters such as the time into the fermentation, gas generation, viscosity, alcohol production, titration, etc. In one embodiment, a combination of these techniques can be used.

[00315] In one embodiment, the pH of the fermentation is initiated at a neutral pH and then is reduced to an acidic pH when the production of alcohol is detected. In another embodiment, the pH of the fermentation is initiated at an acidic pH and is maintained at an acidic pH until the fermentation reaches a stationary phase of growth.

Fatty Acid Medium Component and Acidic Culture Conditions

[00316] In another embodiment, a combination of adding a fatty acid comprising compound to the medium and fermenting at reduced pH can be used. In one embodiment, addition of a fatty acid, such as a free fatty acid fulfills both techniques: adding a fatty acid compound and lowering the pH of the fermentation. In one embodiment, different compounds can be added to accomplish each technique. For example, a vegetable oil can be added to the medium to supply the fatty acid and then a mineral acid or an organic acid can be added during the fermentation to reduce the pH to a suitable level, as described above. When the fermentation includes both operation at reduced pH and addition of fatty acid comprising compounds, the methods and techniques described herein for each type of operation separately can be used together. In one embodiment, the operation at low pH and the presence of the fatty acid comprising compounds will be at the same time. In one embodiment, the presence of fatty acid comprising compounds will precede operation at low pH, and in one embodiment, operation at low pH will precede the addition of fatty acid comprising compounds. In one embodiment, the operation at low pH and the presence of the fatty acid will be prior to inoculation with Clostridium sp. Q.D. In one embodiment, the operation at low pH will be prior to inoculation with Clostridium sp. Q.D and the presence of the fatty acid will occur after or during to inoculation with Clostridium sp. Q.D. In one embodiment, the presence of the fatty acid will be prior to inoculation with Clostridium sp. Q.D and the operation at low pH will occur after or during to inoculation with Clostridium sp. Q.D. In one embodiment, the operation at low pH and the presence of the fatty acid will be after inoculation with Clostridium sp. Q.D. In one embodiment, the operation at low pH and the presence of the fatty acid will be at other stages of fermentation.

Genetic modification of Clostridium sp. Q.D

[00317] In another aspect, compositions and methods to produce a fuel such as one or more alcohols, e.g., ethanol, by the creation and use of a genetically modified Clostridium sp. Q.D are provided. In one embodiment, regulating fermentative biochemical pathways, expression of saccharolytic enzymes, or increasing tolerance of environmental conditions during fermentation of Clostridium sp. Q.D is provided. In one embodiment, Clostridium sp. Q.D is transformed with heterologous polynucleotides encoding one or more genes for the pathway, enzyme, or protein of interest. In another embodiment, Clostridium sp. Q.D is transformed to produce multiple copies of one or more genes for the pathway, enzyme, or protein of interest. In one embodiment, Clostridium sp. Q.D is transformed with heterologous polynucleotides encoding one or more genes encoding enzymes for the hydrolysis and/or fermentation of a hexose, wherein said genes are expressed at sufficient levels to confer upon the Clostridium sp. Q.D transformant the ability to produce ethanol at increased concentrations, productivity levels or yields compared to Clostridium sp. Q.D that is not transformed. In such ways, an enhanced rate of ethanol production can be achieved,

[00318] In another embodiment, Clostridium sp. Q.D is transformed with heterologous polynucleotides encoding one or more genes encoding saccharolytic enzymes for the saccharification of a

polysaccharide, wherein said genes are expressed at sufficient levels to confer upon said Clostridium sp. Q.D transformant the ability to saccharify a polysaccharide to mono-, di- or oligosaccharides at increased concentrations, rates of saccharification or yields of mono-, di- or oligosaccharides compared to Clostridium sp. Q.D that is not transformed. The production of a saccharolytic enzyme by the host, and the subsequent release of that saccharolytic enzyme into the medium, reduces the amount of commercial enzyme necessary to degrade biomass or polysaccharides into fermentable

monosaccharides and oligosaccharides. The saccharolytic DNA can be native to the host, although more often the DNA will be foreign, and heterologous. Advantageous saccharolytic genes include cellulolytic, xylanolytic, and starch-degrading enzymes such as cellulases, xylanases, and amylases. The saccharolytic enzymes can be at least partially secreted by the host, or it can be accumulated substantially intracellularly for subsequent release. Advantageously, intracellularly-accumulated enzymes which are thermostable, can be released when desired by heat-induced lysis. Combinations of enzymes can be encoded by the heterologous DNA, some of which are secreted, and some of which are accumulated. Examples of a host expressing a saccharolytic enzyme can be found in U.S. Pat.

Application No. 12/630,784, and International Application No. PCT/US11/26143, which are each herein incorporated by reference in its entirety.

[00319] Other modifications can be made to enhance the ethanol production of the recombinant bacteria. For example, the host can further comprise an additional heterologous DNA segment, the expression product of which is a protein involved in the transport of mono- and/or oligosaccharides into the recombinant host. Likewise, additional genes from the glycolytic pathway can be incorporated into the host to redirect the bioenergetics of the ethanolic production pathways. In such ways, an enhanced rate of ethanol production can be achieved.

[00320] One such modification, the disruption of sporulation in Clostridium sp. Q.D and also in C. phytofermentans, is described infra. The result was the production of sporulation mutants, Clostridium sp. Q.D-5, Clostridium sp. Q.D-7, and Clostridium phytofermentans Q.7D, through disruption of the SpoIID gene.

[00321] In order to improve the production of biofuels {e.g. ethanol), modifications can be made in transcriptional regulators, genes for the formation of organic acids, carbohydrate transporter genes, sporulation genes, genes that influence the formation/regenerate of enzymatic cofactors, genes that influence ethanol tolerance, genes that influence salt tolerance, genes that influence growth rate, genes that influence oxygen tolerance, genes that influence catabolite repression, genes that influence hydrogen production, genes that influence resistance to heavy metals, genes that influence resistance to acids or genes that influence resistance to aldehydes.

[00322] Those skilled in the art will appreciate that a number of modifications can be made to the methods exemplified herein. For example, a variety of promoters can be utilized to drive expression of the heterologous genes in the recombinant Clostridium sp. host. The skilled artisan, having the benefit of the instant disclosure, will be able to readily choose and utilize any one of the various promoters available for this purpose. Similarly, skilled artisans, as a matter of routine preference, can utilize a higher copy number plasmid. In another embodiment, constructs can be prepared for chromosomal integration of the desired genes. Chromosomal integration of foreign genes can offer several advantages over plasmid-based constructions, the latter having certain limitations for commercial processes. Ethanologenic genes have been integrated chromosomally in E. coli B; see Ohta et al. (1991) Appl. Environ. Microbiol. 57:893-900. In general, this is accomplished by purification of a DNA fragment containing (1) the desired genes upstream from an antibiotic resistance gene and (2) a fragment of homologous DNA from the target organism. This DNA can be ligated to form circles without replicons and used for transformation. Thus, the gene of interest can be introduced in a heterologous host such as E. coli, and short, random fragments can be isolated and ligated in

Clostridium sp. to promote homologous recombination.

[00323] In another aspect, the products made by any of the processes described herein is provided.

EXAMPLES

[00324] The following examples serve to illustrate certain embodiments and aspects and are not to be construed as limiting the scope thereof.

[00325] Example 1. Isolation of Q.D

[00326] Strain Q.D was generated in a screening of anaerobic bacteria for increased cellulase expression in the presence of cellobiose. Cultures were plated onto QM plates with maltose and Azo- Carboxymethyl-cellulose (Azo-CMC). QM medium composition is shown in Table 4. Strains were then tested for their ability to produce ethanol from complex cellulosic material like corn stover. One of the strains derived from these screenings was named "Q.D" (hereinafter Clostridium sp. Q.D).

[00327] Table 4:

[00328] The seed propagation media was prepared according to Table 4 above. Base media, salts and substrates were degassed with nitrogen prior to autoclave sterilization. Following sterilization, 94 ml of base media was combined with 1ml of 100X salts and 5mls of 20X substrate to achieve a final concentrations. All additions were prepared anaerobically and aseptically.

[00329] Example 2. Morphology of Clostridium sp. Q.D

[00330] Clostridium sp. Q.D forms moist, shiny, beige, opaque, irregular or undulate colonies. The cells are entire, small, short rods, diplo or chains, motile, and form subterminal endospores.

[00331] Clostridium sp. Q.D was grown anaerobically in medium containing cellobiose. FIG. 3 illustrates: (A) a picture of Clostridium sp. Q.D cells taken at logarithmic phase; (B) pictures of Clostridium sp. Q.D cells in stationary phase showing endospores; and (C) a photographic enlargement of Clostridium sp. Q.D cells in stationary phase, showing that spores are formed subterminally.

[00332] Clostridium sp. Q.D is able to grow on yeast extract as a sole carbon source and is able to utilize a wide variety of sugars, including cellobiose, glucose, fructose and rhamnose. Azo-CMC plate assays indicates that Clostridium sp. Q.D possesses cellulolytic capability as well as xylanolytic activity and it grows well on pretreated corn stover. Its major fermentation end products of biomass are ethanol and acetic acid in nearly identical quantities. [00333] Clostridium sp. Q.D was tested for growth at 35° C, 39° C and 42° C and in a pH range of 6.0 to 7.5. It grew best at 35° C; growth also occurred at 39° C, albeit slower and cultures did not reach the same cell density compared with those at 35°C. No growth was observed at 42° C.

[00334] Example 3. Growth of Clostridium sp. Q.D

[00335] Growth of Clostridium sp. Q.D was tested on Cellobiose, Starch, Lactose, Xylose, Rhamnose, Fucose, Glucose, Xylan, Maltose as well as on corn stover and Avicel. Clostridium sp. Q.D grows slowly, but to high density on yeast extract.

[00336] In rich media (QM) containinglO g/1 yeast extract and 5 % cellobiose, Q.D grew with a doubling time of ~2 hours (FIG. 4). In comparison, growth on Avicel is slow, but Q.D is able to utilize crystalline cellulose as carbon source, forming ethanol and acetic acid as major end products (see FIG. 5). No other products were formed in significant amount under these growth conditions. Traces of lactic acid and butyric acid could be detected by HPCL analysis.

[00337] Example 4. Growth of Clostridium sp. Q.D compared to strains of Clostridium phytofermentans

[00338] Clostridium sp. Q.D demonstrated endoglucanase activity in the presence of specific carbon substrates, maltose and glucose. Compared to C. phytofermentans (WTQ) and two other strains of C. phytofermentans, Q.8 and Q.I, Clostridium sp. Q.D grows faster, and produces a larger colony and greater zone of clearing (sugar metabolism) than C. phytofermentans (FIG. 6). Higher levels of glucose (FIG. 7) produced a color change in the colony to a more orange hue.

[00339] Example 5. Induction of cellulase activity on CMC agar

[00340] Clostridium sp. Q.D cultures were spotted on QM plates with 1% of the monosaccharides depicted in FIG. 8 and grown anaerobically at 35°C until the colony was between 5- 10mm in size, wherein an overlay of 0.3% CMC agar was poured and the plates incubated for lh at 35°C. The plates were stained with Congo red and destained with 1.0M NaCl to visualize activity of the cellulases expressed and secreted during growth.

[00341] Example 6. Genomics

[00342] As described above, the 16S rRNA gene sequence from Clostridium sp. Q.D was used to search against 99097 isolated bacterial 16S rRNA sequences from Ribosomal Database Project Release 10. The BLAST result showed that Clostridium sp. Q.D only shared 90%> similarity to Clostridium phytofermentans, but was closer to Clostridium algidixylanolyticum starin SPL73 (99%>), Clostridium sp. U201 (99%>), and swine fecal bacterium strain RF3G-Cel2 (99%>). From the blast result, 100 species with at least 90%> similarity were selected. These 101 16S rRNA gene sequences were aligned by CLUSTAL W. The phylogenetic tree in FIG. 1 was constructed using neighbor-joining method with bootstrap support of 100 replicates. 16S rRNA sequencing and phylogenetic analyses revealed that Clostridium sp. Q.D belongs to the Cluster 87 of the Clostridia genera. Chromosomal DNA of Clostridium sp. Q.D was submitted to Agencourt (now Beckman-Coulter, Brea, CA) for genomic analysis and whole genome sequencing. Additional C. Q.D genes identified from the search are summarized in Table 3.

[00343] Example 7. SI. BLAST results with 16S rRNA from Clostridium sp. Q.D

[00344] FIG. 2 shows the BLAST results of the Clostridium sp. Q.D. 16S rRNA sequence (Query) compared to Clostridium sp. U201 gene for 16S rRNA, Clostridium algidixylanolyticum 16S rRNA, and Clostridium sp. Kas401-4 gene for 16S rRNA, as well as calculated percentage similarities for 16S rRNA gene sequences for Clostridium sp. nov. and these three other species of Clostridium. On this basis and the characteristics described supra that distinguish it from other known species of microorganisms, Clostridium sp. Q.D. was determined to be a new cellulolytic species of the genus Clostridium.

[00345] Example 8. Sporulation knock-out in Clostridium sp. Q.D and Clostridium phytofermentans.

[00346] Under environmental stress, Bacillus and Clostridium species undergo asymmetric cell division, or sporulation. Entry into sporulation is governed by the response regulator SpoOA and the alternative sigma factor o ¹¹ . SpoOA is active in the predivisional sporangium but later, after the stage of asymmetric division, becomes active selectively in the mother cell. Subsequent gene expression is governed by the sequential appearance of the sigma factors (f, o ^E , o ^G , and o^, with (f and o ^G being specific to the forespore and o ^E and o ^K to the mother cell.

[00347] While all of the sigma factors are essential for sporulation, i.e, a knockout of these genes prevents either entry or completion of sporulation, most genes expressed under the control of any of these factors are either non-essential, have homologs with redundant function or lead only to a mild sporulation phenotype. For example, in Bacillus subtilis, the sporulation-dependent sigma factor Sigma E governs the expression of more than 120 different genes. Knock-outs of most of these genes have been constructed, and only about a dozen of these genes are essential for sporulation (Eichenberger et al., 2003 J Mol Bio. 327(5):945-72). A similar approach on Sigma G dependent genes showed comparable results (Wang, S.T., et al. 2006 J Mol Bio. 358:16-37). A noteworthy exception are genes in early stages of sporulation. Most genes expressed in stage II of sporulation, and therefore named spoil, are essential for the sporulation process. One of these genes is spoIID, which has been shown to be crucial for the development of a viable spore in Bacillus subtilis (Perez, A.R., et al. 2006 J Bacteriol 188(3): 1159-1164). [00348] Several sporulation knock-outs of the spoIID gene were produced in different Clostridium species and strains, including Clostridium sp. Q.D. To accomplish this, a plasmid was constructed to inactivate the spoIID (Cphy3479) gene of C. phytofermentans and closely related species by integration of an antibiotic marker inside the ORF. The plasmid incorporates an erythromycin resistance gene flanked by the upstream part and downstream sequences of the gene Cphy3479. The knock-out strains produced using this plasmid demonstrate increased product formation and enhanced yield.

[00349] Example 9. Construction of pGEMspo2DS12EmJoriT

[00350] The plasmid was constructed based on the pGEM-T-Easy vector from Promega (Promega Corp., 2800 Woods Hollow Rd., Madison, WI 5371 1). The plasmid (FIG. 9) contains an erythromycin resistance gene under the control of the Clostridium phytofermentans promoter S12 (ribosomal protein). It is flanked by two 500 bp region upstream and downstream of Cphy3479. The plasmid also contains an oriT, which allows transfer to Clostridum phytofermentans by

transconjugation. The sequences necessary for generating the knockout by homologous recombination are shown in FIGS. 10 and 11. They were cloned into the pGEM-T easy plasmid to generate the plasmid pGEMspo2DS12EmJoriT. Specifically, the sequences are:

(1) A 501 bp sequence from the 5"- part of the spoIID gene of Clostridium phytofermentans,

Cphy3479, (bases 24-524 of the gene) (SEQ ID NO:3);

(2) A 142 bp sequence, containing the promoter of the S 12 ribosomal gene from Clostridium

phytofermentans (genome position 291176-291317) (SEQ ID NO:5);

(3) An erythromycin resistance gene: the CDS (738 bp) (SEQ ID NO:7). with the start and stop codon underlined; and

(4) A 526 bp sequence from the 3"- part of the spoIID (spo2D) gene of Clostridium

phytofermentans, Cphy3479, (bases 1058-1584 of the gene) (SEQ ID NO:9).

[00351] Example 10. Electroporation Conditions for Clostridium sp. Q.D

[00352] No electroporation protocol existed for Clostridium Q.D; therefore a new protocol was established to transfer plasmids into this organism. Based on kill curve experiments, it was noted that cell suspensions containing Clostridium sp. Q.D. will arch at the following condition: 3000V, 600 ohms, and 25 uF. However, the ideal electroporation condition was noted at 2000-2250 V, 600 ohms, and 25 uF; the experimental values for time constants range from 3.2 - 5.1 ms (average) over the course of 23 independent electroporation procedures. Additionally, the experimental voltage for 2500 V fluctuates from 2400-2500 V based on the freshness of the electroporation buffer.

[00353] Example 11. Electroporation [00354] The plasmid was transformed into E.coli, purified and then transformed into Clostridium sp. Q.D by electroporation. All procedures were conducted anaerobically except centrifugation wherein the centrifuge tubes were sealed from the atmosphere.

[00355] Innoculated with Clostridium sp. Q.D., 50 mL of culture broth (QM) was grown at 37° C overnight to an The entire culture was transferred to a 50 mL Falcon tube which was spun at 8,500 RPM (~18,000g) for 10 minutes. The supernatant was discarded and the pellet resuspended with 2.0 mL of Electroporation Buffer (EPB: 250 mM sucrose, 5 mM sodium phosphate, 2 mM MgS0 ₄ ). The suspension was again spun at 8,500 RPM (~18,000g) for 10 minutes. The supernatant was discarded and the pellet resuspended with 2.0 mL EPB wherein the sample was placed on ice.

[00356] 575 μΕ of competent Clostridium sp. Q.D. cells were transferred into a 0.4 cm

electrporation cuvette (BioRad, Inc., 1000 Alfred Nobel Drive, Hercules, CA 94547), and the cuvettes kept on ice. 25 μΕ of DNA (~1.0 μg) was added to each cuvette on ice. The solution was mixed by gently circulating the pipette tip. It was not mixed by pipetting or vortexing. The cells were incubated on ice for 4 minutes.

[00357] When ready for electroporation, the metal contacts of the electroporation cuvette were cleaned with a Kimwipe or other adsorbent material to ensure no trace of moisture was present.

Electroporation was conducted using a Gene Pulser Xcell™ apparatus (BioRad, Inc.) at 1500-2500 V, 25 μΡ, and 600 ohms. The ideal time constant was in the interval of 0.8 ms to 1.8 ms.

[00358] Immediately, the contents of the cuvette were diluted with 1 mL of prewarmed (37° C) QM media. The entire solution was poured into a 10 mL QM tube and incubated anaerobically at 35° C. Following 4 hr incubation, 2 μg/mL of erythromycin was added and the cells allowed to grow for two additional generations. A dilution series was then performed on the transformed Clostridium sp. with selective media. The same procedure was followed to produce the sporulation mutants of C. phytofermentans.

[00359] The erythromycin resistant colonies were screened for double homologous recombination events obtained from the electroporation for sporulation-deficient mutants. Three recombinants were selected: two produced from Clostridium sp. Q.D {Clostridium sp. Q.D-5 and Clostridium sp. Q.D-7) and one from Clostridium phytofermentans (Clostridium phytofermentans Q.7D).

[00360] Example 12. Confirmation of Sporulation knockout

[00361] Sporulation deficiency was tested on plates. Compared to Clostridium sp. Q.D, no sporulation was observed in Clostridium sp. Q.D-5 or Clostridium sp. Q.D-7, even at higher densities or under nutrient- deficient conditions (FIG. 12). The same absence of sporulation was observed in Closteridium phytofermentans Q.7D, the sporulation mutant derived from C. phytofermentans. [00362] Example 13. Growth curves of Clostridium sp. Q.D sporulation deficient strains

[00363] Growth of the three recombinant strains Clostridium sp. Q.D-5, Clostridium sp. Q.D-7, and Closteridium phytofermentans Q.7D were compared to Clostridium sp. Q.D on cellobiose as a carbon source (FIG. 13). Closteridium phytofermentans Q.7D is labeled "Q.I". Growth of the sporulation mutants was as good or better than that of the non-recombinant strain as measured by cell density.

[00364] Example 14. C. sp. Q.D Fermentations

[00365] Corn stover as substrate

[00366] Fermentation profiles were measured over five days using 5% corn stover as a biomass substrate (FIG. 14). Both recombinant strains of Clostridium sp. Q.D fermented corn stover well, hydrolyzing the polysaccharide substrate at a rate almost as fast as the parent strain. Slightly more acid (acetic acid) was produced in the knockout strains.

[00367] Cellobiose as substrates

[00368] Fermentation conditions of varying pH were examined with Clostridium sp. Q.D using cellobiose (50 g/L _initia i) as substrate. The pH was maintained at 6.5 for 48 hrs (FIG. 19), or 5.5 (FIG. 20), and without adjustment (FIG. 21). The systems were examined as to the effect on growth and fermentation performance. Fermentations were performed in BM (low -2.5 g/L yeast extract (YE)) with cellobiose, OD660 was monitored throughout, and final time points were analyzed for product.

[00369] C. sp. Q.D demonstrated direct fermentation and use of organic nitrogen at pH 5.5 without pH maintenance, as the overall product yield in g/L exceeded the carbohydrate consumed.

Maintenance at pH 6.5 also provided very effective fermentation conditions for C. sp. Q.D. The lower nutrient medium (BM) supported nearly complete conversion of carbon to ethanol at 50 g/L. Thus, maintaining the pH parameters around pH 6.5 is important for cellulosic ethanol production in C. sp. Q.D. No other products such as butanol, acetone, or butyrate were detected.

[00370] Example 15. Synergistic Characteristics of C. sp. Q.D

[00371] Clostridium sp. Q.D is a Clostridium microorganism capable of fermentation of pentose and hexose polysaccharides. The saccharification yield from NaOH pretreated corn stover solids was observed after contact with Clostridium sp. Q.D, either alone or with the addition of a cellulase mixture that produces a high amount of oligosaccharides.

[00372] The results demonstrated that Clostridium sp. Q.D. and the enzyme mixture acted synergistically to improve overall saccharification yield. The maximum saccharification yield increased almost two-fold (from 40% to 79%) when the cellulase mixture was added with Clostridium sp. Q.D to the fermentation broth (FIG. 22A). This improvement was greater than expected, based on the saccharification yield of Clostridium sp. Q.D alone (FIG. 22A) or activity of the cellulase mixture alone (FIG. 22C). Further, the maximum ethanol titer almost doubled as well (from 5.0g/L to 9.9g/L) when the cellulase mixture and Clostridium sp. Q.D were inoculated into the fermentation broth (FIG. 22B). The maximum acetic acid titer also improved, from 5.8 g/L to 7.8g/L when the cellulase mixture was added with Clostridium sp. Q.D to the fermentation broth (FIG. 22B). Incubation of biomass with the cellulase mixture alone produced minimal amounts of saccharification products, ethanol and acetic acid (FIG. 22C), likely due to contamination of the corn stover.

[00373] Example 16. Propagation and Fermentation Media for C. phytofermentans and other mesophilic Clostridium species

[00374] Seed propagation media (QM1) recipe:

QM Base Media: g/L:

KH ₂ PO ₄ 1.92

K ₂ HPO ₄ 10.60

Ammonium sulfate 4.60

Sodium citrate tribasic * 2H ₂ 0 3.00

Bacto yeast extract 6.00

Cysteine 2.00

20x Substrate Stock g/L:

Maltose 400.00

100X OM Salts solution: g/L

MgCl ₂ 6H ₂ 0 100

CaCl ₂ 2H ₂ 0 15

FeS0 ₄ 7H ₂ 0 0.125

[00375] Seed propagation media (BM) recipe:

BM Base medium: per L:

KH ₂ P0 ₄ 1.60g

K ₂ HP0 ₄ 3.00g

NaCl l .OOg

Ammonium sulfate 2.00g

0.1% (w/v) Resazurin solution 0.500 ml

Bacto yeast extract 2.50

Adjust pH to 7.5 with NaOH

lOx Substrate Stock

20% Cellobiose

100X BM Salts solution: g/L

Tri-Sodium Citrate 10.000

CaC12-2H ₂ 0 0.500

MgSCy7H ₂ 0 6.000

FeSCy7H ₂ 0 0.400

CoSCyH ₂ 0 0.200

ZnSCy7H ₂ 0 0.200

NiCl ₂ 0.200

MnSCyH ₂ 0 0.500 CuSCy5H ₂ 0 0.040 H ₃ BO 0.040

Ammonium Molybdate tetrahydrate (Η ₂₄ Μο ₇ Ν6θ24·4Η ₂ 0) 0.040 Sodium Selenite (Na ₂ Se0 ₃ ) 0.040

[00376] Seed propagation medium was prepared according to the recipe above. Base media, salts and substrates were degassed with nitrogen prior to autoclave sterilization. Following sterilization, 87 ml of base media was combined with 10ml of lOx Substrate stock and 1ml each of 100X salts solution, lOOx amino acids. All additions were prepared anaerobically and aseptically.

[00377]

[00378] Fermentation media: (FM media)

[00379] Base media (g/L) was prepared with: 50g/L NaOH pretreated corn stover, yeast extract 10 g/L, corn steep powder 5 g/L, K ₂ HP0 ₄ 3 g/1, KH ₂ P0 ₄ 1.6 g/L, TriSodium citrate2H ₂ 0 ₂ 2 g/L, Citric acid¾0 1.2 g/L, (NH ₄ ) ₂ S0 ₄ 0.5 g/L, NaCl 1 g/L, Cysteine.HCl 1.0 g/L, dissolved in deionized water to achieve final volume, adjusted to pH to 6.5, degassed with nitrogen and autoclaved 121°C for 30 min.

[00380] 100X Salt Stock (g/L) :

[00381] MgCl ₂ .6H ₂ 0 80 g/L, CaCl ₂ .2H ₂ 0 10 g/L, FeS0 ₄ .7H ₂ 0 0.125 g/L, TriSodium

citrate.2H ₂ O ₂ 3.0 g/L.

[00382] The fermentation media was prepared according to the protocol above. Components of the Base media were degassed with nitrogen prior to sterilization. A 100X salts stock was prepared and sterilized separately. After sterilization base media was supplemented with a 1% v/v dose of 100X salts to achieve a final concentration. All additions were prepared anaerobically and aseptically.

[00383] Example 17. Microorganism Modification and Vector Construction

[00384] Plasmid Construction

[00385] A general illustration of an integrating replicative plasmid, pQInt, is shown in FIG. 27.

Identified elements include a Multi-cloning site (MCS) with a LacZ-a reporter for use in E. coli; a gram-positive replication origin; the homologous integration sequence; an antibiotic-resistance cassette; the ColEl gram-negative replication origin and the traJ origin for conjugal transfer. Several unique restriction sites are indicated but are not meant to be limiting on any embodiment. The arrangement of the elements can be modified.

[00386] Another embodiment, depicted in FIGS. 28 and 29, is a map of the plasmids pQIntl and pQInt2. These plasmids contain gram-negative (ColEl) and gram-positive (repA/Orf2) replication origins; the bi-functional aad9 spectinomycin-resistance gene; traJ origin for conjugal transfer; LacZ- a/MCS and the 1606-1607 region of chromosomal homology. Since the 1606-1607 region of homology is cloned into a single Ascl site, it can be obtained in two different orientations in a single cloning step. Plasmid pQInt2 is identical to pQIntl except the orientation of the homology region is reversed. [00387] These plasmids consist of five key elements. 1) A gram-negative origin of replication for propagation of the plasmid in E. coli or other gram-negative host(s). 2) A gram-positive replication origin for propagation of the plasmid in gram-positive organisms. In C. phytofermentans, this origin allows for suitable levels of replication prior to integration. 3) A selectable marker; typically a gene encoding antibiotic resistance. 4) An integration sequence; a sequence of DNA at least 400 base pairs in length and identical to a locus in the host chromosome. This represents the preferred site of integration. 5) A multi-cloning site ("MCS") with or without a heterologous gene expression cassette cloned. An additional element for conjugal transfer of plasmid DNA is an optional element described in certain embodiments.

[00388] Plasmid Utilization

[00389] The plasmid is digested with suitable restriction enzyme(s) to ligate a heterologous gene expression cassette ("insert") into the MCS. Ligation products are transformed into a suitable cloning host, typically E. coli. Antibiotic resistant transformants are screened to verify the presence of the desired insert. The plasmid is then transformed into C. phytofermentans or other suitable expression host strain. Transformants are selected based on resistance to the appropriate antibiotic. Resistant colonies are propagated in the presence of antibiotic to allow for homologous recombination integration of the plasmid. Integration is verified by a "junction PCR" protocol. This protocol uses either a preparation of host chromosomal DNA or a sample of transformed cells. The junction PCR utilizes one primer that hybridizes to the plasmid backbone flanking the MCS and a second primer that hybridizes to the chromosome flanking the site of integration. The primers must be designed so they are unique. That is, the plasmid primer cannot hybridize to chromosomal sequences and the chromosomal primer cannot hybridize to the plasmid. The ability to amplify a PCR product demonstrates integration at the correct site (see FIGS. 27-29).

[00390] Standard gene expression systems use autonomously replicating plasmids ("episomes" or "episomal plasmids"). Such plasmids are not suitable for use in C. phytofermentans, C. sp. Q.D. and most other Clostridia due to segregational instability. The use of homologous sequences to allow for integration of a replicative gene expression in C. phytofermentans is not usual for transformation.

[00391] Use of a series of plasmids, each containing a different antibiotic resistance gene, allows for versatility in cases where certain antibiotics are not suitable for specific organisms. The system uses an "integration sequence" which is easily cloned from the chromosome by PCR using primers with tails that encode the appropriate restriction enzyme recognition sequences. This allows targeted integration of the entire plasmid at a chosen locus. The inclusion of a gram-negative replication origin allows for cloning and the easy propagation of the plasmid in a host such as E. coli. The gram-positive replication origin permits a level of replication of the plasmid in C. phytofernmentans after transformation and prior to integration. This contrasts with true suicide integration which utilizes non-replicating plasmids. In true suicide integration, the only way to obtain an antibiotic resistant transformant is to have the plasmid integrate immediately after transformation. This is a low probability event. Replication from the gram-positive origin after transformation results in a greater number of transformed cells which makes the integration event statistically more likely.

[00392] The integrated plasmid is stable indefinitely. The transformed strain can be indefinitely propagated without loss of plasmid DNA. The transformant can be evaluated for heterologous gene expression under any suitable conditions. Stability of the integrated DNA can be ensured by continuous culture in the presence of the appropriate antibiotic. It is also possible to remove the antibiotic if so desired.

[00393] Constitutive Expression of Cellulases I

[00394] Plasmids suitable for use in Clostridium phytofermentans were constructed using pQInt with the promoter from the C. phytofermentans pyruvate ferredoxin oxidase reductase gene Cphy_3558 and the C phytofermentans cellulase gene Cphy_3202. The sequence of this vector (pMTL82351-P3558- 3202) inserted DNA (SEQ ID NO: 10) is as follows:

[00395] SEQ ID NO: 10:

CCTGCAGGATAAAAAAATTGTAGATAAATTTTATAAAATAGTTTTATCTACAATTTTTTT AT CAGGAAACAGCTATGACCGCGGGGATTTTACACGTTTCATTAATAATTTCTTATATTTCT TT ATTTGTTTGTAAAATTTACTTAAATTTCGCCAGAAAACAAAAGAAAGCCTTTACTAATTA A

GAAAGTTACAATTACCATTATATAAGGAGGATATTCATATGAAAAGAAAACTGAAAC AAA

GATGTGCTGTTTTAGTGGCAGTTGCAACGATGATAGCTTCGTTGCAATGGGGGAGAG TGCC

AGTACAAGCAGTAACAGCAGACGGTCTTACCTCTCAACAGTATGTTGAGGCAATGGG CGA

AGGCTGGAACTTAGGAAATTCCTTTGATGGTTTTGATTCTGATACTTCAAAACCAGA TCAA

GGCGAGACCGCTTGGGGAAATCCTAAGGTTACAAAAGAGCTAATCCATGCAGTCAAA CAA

AAAGGCTATAGTAGTATCCGCATACCAATGACCCTATATCGTAGATATACGGAGAGC AAT

GGTGTATGCACTATCGATAGCGCATGGATAGCACGTTACAAAGAAGTAGTAGATTAT GCA

GTTGCAGAAGGTTTATACGTTATGATAAACATTCACCATGATTCCTGGATATGGTTA TCTTC

ATGGGATGGAAATAAGAGTTCTGTGCAATATGTAAGATTTACTCAGATGTGGGATCA ACTT

GCGAAGGCATTTAAAGATTATCCGTTACAAGTATGTTTTGAAACGATAAATGAGCCG AACT

TTCAAAACTCTGGAAACGTTACTGCACAGAATAAATTAGATATGCTTAACCAAGCGG CTTA

CAATATAATTCGTGCCTCTGGTGGATCAAATGCAAAGAGAATGATTGTTTTACCATC ACTA

AATACGAACCATGATAATAGTGTACCATTAGCTGATTTCATAACTAAATTGAATGAT TCTA

ATATCATTGCAACCGTTCATTATTATAGTGAATGGGTATTTAGTGCTAACCTTGGTA AGAC

AAGCTTTGATGAAGATTTATGGGGAAATGGTGATTACACTCCTCGTGATGCGGTAAA TAAG

GCGTTTGATACCATTTCCAATGCATTTACAGCAAAAAAAATCGGTGTTGTTATCGGA GAAT

TTGGTCTTTTAGGTTATGACTCTGATTTTGAAAATAATCAACCAGGCGAAGAATTAA AATA

TTATGAGTATATGAATTATGTAGCTAGACAAAAGAAAATGTGCCTTATGTTTTGGGA TAAC GGATCTGGAATTAATCGTAACGACTCTAAGTATAGTTGGAAAAAACCTATAGTTGGAAAG

ATGTTAGAAGTATCTATGACAGGACGTTCCTCTTATGCAACAGGCCTTGATACCATT TACC

TAAACGGCAGCTCATTTAATGATATTAATATCCCGCTTACTCTAAACGGTAACACCT TTGTT

GGAGTTACAGGATTAACCAGTGGTACCGATTTTACGTATAACCAATCCAATGCAACA CTAA

CATTAAAATCATCCTACGTGAAGAAGGTTTATGATGCAATGGGAAGTAATTATGGTA CGGT

AGCTGATTTGGTACTTAAGTTTTCAAGTGGAGCTGATTGGCATGAGTATTTAGTGAA ATAC

AAAGCACCAGTATTTCAAAATGCGAATGGAACTGTTTCCAATGGAATTAATATTCCA GTTC

AATTTAACGGAAGTAAACTCCGTCGTTCTACAGCTTATATAGGTTCTAATCGAGTTG GCCC

GAATCAAAGCTGGTGGATGTATTTAGAGTATGGTGCAACTTTTGTGGCGAACTATAC GAAC

AATATTTTAACCATTAAGCCTGATTTCTTTAAGGATGGTTCTGTTTATGATGGAAAT ATATC

ATTTGAGATGGAGTTTTATGATGGACAAAAGTTAAAATATAATCTTAATAAATCAAA TGGT

AACATAACAGGAACTGCAGCAGCAGTAACCCCTACACCAACACCAACGGCGACACCA ACA

CCAACAGCGACGCCAACACCAACCGTAACACCAAAACCAACAATAACCCCAACAGTA ACG

CCGACACCAACAGTAACGCCAAAACCAACAATAACACCGACAGTAACACCAACTCCT ACT

CCAATCCCAGGAACAGGTCCAGTTACATTAAAATACGAAGTAACGAATACTTGGGAT AAG

CATACACAGGCGAATATTACATTAACCAATACCTCTAATACAGCACTAAAGAATTTT GTTG

TATCATTTACTTATAAAGGGTATATAGACCAAATGTGGAGTGCAGATTTGGTTAGTC AAAA

TTCGGGTACCATTACAGTGAAGGGACCAGCATGGGCTACGAATCTAGATCCAGGGCA AAG

TATAACATTTGGTTTTATTGCTTCACATGATACACCGTCTGTTGATCCACCATCAAA TGTTA

CTTTAGTTAGTTCAAATTAAAATTGTATTCAAATCTCGAGGCCTGCAGACATGCAAG CTTG

GCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTT AATC

GCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCG ATCG

CCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCTAGCATAAAAATAAGAA GCC

TGCATTTGCAGGCTTCTTATTTTTATGGCGCGCCGTTCTGAATCCTTAGCTAATGGT TCAAC

AGGTAACTATGACGAAGATAGCACCCTGGATAAGTCTGTAATGGATTCTAAGGCATT TAAT

GAAGACGTGTATATAAAATGTGCTAATGAAAAAGAAAATGCGTTAAAAGAGCCTAAA ATG

TCGATACCTATAGAATCTTCTGTTCACTTTTGTTTTTGAAATATAAAAAGGGGCTTT TTAGC CCCTTTTTTTTAAAACTCCGGAGGAGTTTCTTCATTCTTGATACTATACGTAACTATTTT CG ATTTGACTTCATTGTCAATTAAGCTAGTAAAATCAATGGTTAAAAAACAAAAAACTTGCA T TTTTCTACCTAGTAATTTATAATTTTAAGTGTCGAGTTTAAAAGTATAATTTACCAGGAA AG

TTATAATCAAAAAAATGAAAATAAACAAGAGGTAAAAACTGCTTTAGAGAAATGTAC TGA TAAAAAAAGAAAAAATCCTAGATTTACGTCATACATAGCACCTTTAACTACTAAGAAAAA TATTGAAAGGACTTCCACTTGTGGAGATTATTTGTTTATGTTGAGTGATGCAGACTTAGA A CATTTTAAATTACATAAAGGTAATTTTTGCGGTAATAGATTTTGTCCAATGTGTAGTTGG CG ACTTGCTTGTAAGGATAGTTTAGAAATATCTATTCTTATGGAGCATTTAAGAAAAGAAGA A

ATTCTATTAAACAATATAATAAATCTTTTAAAAAATTAATGGAGCGTAAGGAAGTTA AGG

ATATAACTAAAGGTTATATAAGAAAATTAGAAGTAACTTACCAAAAGGAAAAATACA TAA

CAAAGGATTTATGGAAAATAAAAAAAGATTATTATCAAAAAAAAGGACTTGAAATTG GTG

ATTTAGAACCTAATTTTGATACTTATAATCCTCATTTTCATGTAGTTATTGCAGTTA ATAAA

AGTTATTTTACAGATAAAAATTATTATATAAATCGAGAAAGATGGTTGGAATTATGG AAGT

TTGCTACTAAGGATGATTCTATAACTCAAGTTGATGTTAGAAAAGCAAAAATTAATG ATTA

ATGAAATTAAATATGTCTATATAGTTTATTATAATTGGTGCAAAAAACAATATGAAAAAA C

TAGAATAAGGGAACTTACGGAAGATGAAAAAGAAGAATTAAATCAAGATTTAATAGA TG

TGAATTGCCTTTTTTCTAACAGACTTAGGAAATATTTTAACAGTATCTTCTTGCGCCGGT GA

TGTAGACAAAATTTTACATAAATATAAAGAAAGGAAGTGTTTGTTTAAATTTTATAGCAA A

TTAACTTTAATAGTTTGTGGTTTATTTACAAATTCGGCCGGCCCAATGAATAGGTTT ACACT

TACTTTAGTTTTATGGAAATGAAAGATCATATCATATATAATCTAGAATAAAATTAA CTAA

AATAATTATTATCTAGATAAAAAATTTAGAAGCCAATGAAATCTATAAATAAACTAA ATTA

AGTTTATTTAATTAACAACTATGGATATAAAATAGGTACTAATCAAAATAGTGAGGA GGA

TATATTTGAATACATACGAACAAATTAATAAAGTGAAAAAAATACTTCGGAAACATT TAA

AAAATAACCTTATTGGTACTTACATGTTTGGATCAGGAGTTGAGAGTGGACTAAAAC CAA

ACTTATACAAAAAATTAGACCTATTTCAAAGAAAATAGGAGATAAAAGCAACTTACG ATA TATTGAATTAACAATTATTATTCAGCAAGAAATGGTACCGTGGAATCATCCTCCCAAACA A GAATTTATTTATGGAGAATGGTTACAAGAGCTTTATGAACAAGGATACATTCCTCAGAAG G AATTAAATTCAGATTTAACCATAATGCTTTACCAAGCAAAACGAAAAAATAAAAGAATAT

ACGGAAATTATGACTTAGAGGAATTACTACCTGATATTCCATTTTCTGATGTGAGAA GAGC

CATTATGGATTCGTCAGAGGAATTAATAGATAATTATCAGGATGATGAAACCAACTC TATA

TTAACTTTATGCCGTATGATTTTAACTATGGACACGGGTAAAATCATACCAAAAGAT ATTG

CGGGAAATGCAGTGGCTGAATCTTCTCCATTAGAACATAGGGAGAGAATTTTGTTAG CAGT

TCGTAGTTATCTTGGAGAGAATATTGAATGGACTAATGAAAATGTAAATTTAACTAT AAAC

TATTTAAATAACAGATTAAAAAAATTATAAAAAAATTGAAAAAATGGTGGAAACACT TTT

TTCAATTTTTTTGTTTTATTATTTAATATTTGGGAAATATTCATTCTAATTGGTAAT CAGATT

TTAGAAGTTTAAACTCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTT TTCGT

TCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTT TTCT

GCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTT GCCG

AATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCA CCGC

CTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGT CGTG

TCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTG AAC

GGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATA CCT

ACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTA TC

CGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACG CC

TGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTG TGATG

CTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTT CCT

GGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGT GGATAA

CCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCG CAG

CGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAGGGCCCCCTGCTTCGG GGT

GGGTTCGTGTAGACTTTCCTTGGTGTATCCAACGGCGTCAGCCGGGCAGGATAGGTG AAGT

AGGCCCACCCGCGAGCGGGTGTTCCTTCTTCACTGTCCCTTATTCGCACCTGGCGGT GCTC

AACGGGAATCCTGCTCTGCGAGGCTGGCCGGCTACCGCCGGCGTAACAGATGAGGGC AAG

CGGATGGCTGATGAAACCAAGCCAACCAGGAAGGGCAGCCCACCTATCAAGGTGTAC TGC

CTTCCAGACGAACGAAGAGCGATTGAGGAAAAGGCGGCGGCGGCCGGCATGAGCCTG TC

GGCCTACCTGCTGGCCGTCGGCCAGGGCTACAAAATCACGGGCGTCGTGGACTATGA GCA

CGTCCGCGAGCTGGCCCGCATCAATGGCGACCTGGGCCGCCTGGGCGGCCTGCTGAA ACT

CTGGCTCACCGACGACCCGCGCACGGCGCGGTTCGGTGATGCCACGATCCTCGCCCT GCTG

GCGAAGATCGAAGAGAAGCAGGACGAGCTTGGCAAGGTCATGATGGGCGTGGTCCGC CC

GAGGGCAGAGCCATGACTTTTTTAGCCGCTAAAACGGCCGGGGGGTGCGCGTGATTG CCA

AGCACGTCCCCATGCGCTCCATCAAGAAGAGCGACTTCGCGGAGCTGGTGAAGTACA TCA

CCGACGAGCAAGGCAAGACCGATCGGGCCC [00396] The successful transfer of pMTL82351-P3558-3202 into C. phytofermentans strain Q.13 via electroporation was demonstrated by its ability to grow in the presence of 10 μg/mL erythromycin. The plasmid has been serially propagated in this transformant for over four months.

[00397] Constitutive Promoter

[00398] Several other promoters from C. phytofermentans were chosen for vector use that show high expression of their corresponding genes in all growth stages as well as on different substrates. A promoter element is selected by selecting key genes that would necessarily be involved in constitutive pathways {e.g., ribosomal genes, or for ethanol production, alcohol dehydrogenase genes). Examples of promoters from such genes include but are not limited to:

[00399] Cphy l 029: iron-containing alcohol dehydrogenase

[00400] Cphy_3510: Ig domain-containing protein

[00401] Cphy_3925: bifunctional acetaldehyde-CoA/alcohol dehydrogenase

[00402] Cloning of Cellulase genes

[00403] One or more genes disclosed (see Table 2), which can include each gene's own ribosome binding sites, were amplified via PCR and subsequently digested with the appropriate enzymes as described previously under Cloning of Promoter. Resulting plasmids were also treated with the corresponding restriction enzymes and the amplified genes are mobilized into plasmids through standard ligation. E.coli were transformed with the plasmids and correct inserts were verified from transformants selected on selection plates.

[00404] Example 18. Transconj ligation

[00405] E. coli DH5a along with the helper plasmid pRK2030, were transformed with the different plasmids discussed above. E.coli colonies with both of the foregoing plasmids were selected on LB plates with 100 μg/ml ampicillin and 50 μg/ml kanamycin after growing overnight at 37°C. Single colonies were obtained after re-streaking on selective plates at 37°C. Growth media for E.coli {e.g. LB or LB supplemented with 1% glucose and 1% cellobiose) was inoculated with a single colony and either grown aerobically at 37°C or anaerobically at 35°C overnight. Fresh growth media was inoculated 1 :100 with the overnight culture and grown until mid log phase. A C. phytofermentans strain was also grown in the same media until mid log.

[00406] The two different cultures, C. phytofermentans and E.coli with pRK2030 and one of the plasmids, were then mixed in different ratios, e. g. 1 :1000, 1 :100, 1 :10, 1 :1, 10:1, 100:1, 1000:1. The mating was performed in either liquid media, on plates or on 25 mm Nucleopore Track-Etch Membrane (Whatman, Inc., 800 Centennial Avenue, Piscataway, NJ 08854 USA) at 35°C. The time was varied between 2h and 24h, and the mating media was the same growth media in which the culture was grown prior to the mating. After the mating procedure, the bacteria mixture was either spread directly onto plates or first grown on liquid media for 6h to 18h and then plated. The plates contain 10μg/ml erythromycin as selective agent for C. phytofermentans and 10 μg/ml Trimethoprim, 150 μg/ml

Cyclosporin and 100 μg/ml Nalidixic acid as counter selectable media for E .coli.

[00407] After 3 to 5 days incubation at 35°C, erythromycin-resistant colonies were picked from the plates and restreaked on fresh selective plates. Single colonies were picked and the presence of the plasmid is confirmed by PCR reaction.

[00408] Cellulase gene expression

[00409] The expression of the cellulase genes on the different plasmids was then tested under conditions where there is little to no expression of the corresponding genes from the chromosomal locus. Positive candidates showed constitutive expression of the cloned cellulases.

[00410] The isolated strains disclosed herein have been deposited in the Agricultural Research Service culture Collection (NRRL), an International Depositary Authority, National Center for Agricultural Utilization Research, Agricultural Research Service, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 61604 U.S.A. on April 9, 2010 in accordance with and under the provisions of the Budapest Treaty for the Deposit of Microorganisms, i.e., they will be stored with all the care necessary to keep them viable and uncontaminated for a period of at least five years after the most recent request for the furnishing of a sample of the deposits, and in any case, for a period of at least 30 (thirty) years after the date of deposit or for the enforceable life of any patent which may issue disclosing the cultures plus five years after the last request for a sample from the deposit. The strains were tested by the NRRL and determined to be viable. The NRRL has assigned the following NRRL deposit accession numbers to strains: Clostridium sp. Q.D (NRRL B-50361), Clostridium sp. Q.D-5 (NRRL B-50362), Clostridium sp. Q.D-7 (NRRL B-50363), Clostridium phytofermentans Q.7D(NRRL B-50364). The depositor acknowledges the duty to replace the deposits should the depository be unable to furnish a sample when requested, due to the condition of the deposits. All restrictions on the availability to the public of the subject culture deposits will be irrevocably removed upon the granting of a patent disclosing them. The deposits are available as required by foreign patent laws in countries wherein counterparts of the subject application, or its progeny, are filed. However, it should be understood that the availability of a deposit does not constitute a license to practice the subject matter disclosed herein in derogation of patent rights granted by governmental action.

[00411] All references cited herein, including but not limited to published and unpublished applications, patents, and literature references, and also including but not limited to the references listed in the Appendix, are incorporated herein by reference in their entirety and are hereby made a part of this specification. To the extent publications and patents or patent applications incorporated by reference contradict the disclosure contained in the specification, the specification is intended to supersede and/or take precedence over any such contradictory material. [00412] The term "comprising" as used herein is synonymous with "including," "containing," or "characterized by," and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps.

[00413] All numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification are to be understood as being modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth herein are approximations that can vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of any claims in any application claiming priority to the present application, each numerical parameter should be construed in light of the number of significant digits and ordinary rounding approaches.

[00414] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure herein. It should be understood that various alternatives to the embodiments of the disclosure described herein can be employed in practicing the described subject matter. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.