The invention refers to a non-invasive method for the diagnosis of adenocarcinoma or their precursor lesions, in particular ovarian (OC) or endometrial cancer (EC), in a female subject by analyzing cells of said subject, a kit for the diagnosis of ovarian or endometrial cancer or their precursor lesions, and a screening method.

Background Epidemiology, Classification, Pathogenesis, Prognosis of OC and EC

OC is the leading cause of death from gynaecologic malignancy in western civilized countries, with an estimated prevalence in Europe and the US of 752,600 in 2007 and 59,828 deaths yearly. Treatment and survival of the patients depend primarily on the stage of the disease. Of all OC patients only 25% are diagnosed at an early stage while the tumor is confined to the pelvis. In these cases the five-year survival rate is 80% to 90% and the disease can often be cured by the combination of surgery and chemotherapy and are increasingly frequently referred to as type I OC. Unfortunately, almost 75% of women affected have advanced stage disease with metastatic spread throughout the abdominal cavity or to retroperitoneal lymph nodes at the time of diagnosis; five-year survival rates fall to 19%-32% for advanced disease, despite maximum surgical effort and combination chemotherapy. This so called type II OC is the deadliest cancer in women, even more aggressive then lung cancer.

(Altekruse S.F. et al., 2007, http://seer.cancer.gov/csr/1975_2007/ (eds). SEER

Cancer Statistics Review, 1975-2007, National Cancer Institute. Bethesda, MD, based on November 2009 SEER data submission, posted on the SEER web site, 2010;

GLOBOCAN 2008, International Agency for Research on Cancer, posted on to the Globocan website, 2010, http://globocan.iarc.fr/factsheets/cancers/prostate.asp. ; Goff B. et al. (2010). www.uptodate.com.)

Pathologists currently employ a morphology-based classification systems to divide OC and EC into major subgroups based on degree of differentiation (tumor grade) and histologic subtype (e.g., serous, endometrioid, clear cell or mucinous).

Cho (Arch Pathol Lab Med. 2009;133(1 1 ):1775-81 ) describes a new model for classifying ovarian tumors, in which the surface epithelial tumors is divided into two broad categories designated type I and type II tumors based on their pattern of tumor progression and molecular genetic changes. Type I tumors include low-grade serous carcinoma, low-grade endometrioid carcinoma, and a subset of clear cell carcinomas and mucinous carcinoma which develop in a stepwise fashion from well-recognized precursors. The type II tumors are highgrade and almost always have spread beyond the ovaries at presentation. Type II carcinomas include high-grade serous carcinoma, high-grade endometrioid carcinoma, undifferentiated carcinoma, probably some clear cell carcinomas and mucinous carcinomas, and malignant mixed mesodermal tumor (carcinosarcoma). Type II carcinomas presumably evolve rapidly, disseminate early in their clinical course, don't progress in a step-wise fashion (stage I to IV) and are highly aggressive. In contrast to type I tumors, type II tumors were thought of not having morphologically recognizable precursor lesions, before they were found in the fallopian tubes.

Gross et al. (Journal of Oncology 2010, Article ID 126295, doi: 10.1 155/2010/ 126295) describe a study to identify precursor lesions of OC and EC and support the notion of an origin for serous OC in the fallopian tube. The precursor lesion of OC in the fallopian tube is called serous tubal intraepithelial carcinoma (STIC). Gross et al. also found very similar precursor lesions in the endometrium and, in analogy to the fallopian tube describe them as serous endometrial intraepithelial carcinoma (SEIC).

Dubeau (Lancet Oncol. 2008, 9(12):1 191 -7) argue that a large proportion of ovarian epithelial tumors, fallopian tube carcinomas and peritoneal carcinomas are of the same nature and could be regarded as single disease entity.

EC - carcinoma of the lining of the uterus - is the most common gynecologic malignancy in western civilized countries; in the USA approximately 42,160 cases are diagnosed annually and 7780 deaths occur. Fortunately, most cases are diagnosed at an early stage when surgery alone may be adequate for cure. Five-year survival rates for localized, regional, and metastatic disease are 96, 66, and 24 percent, respectively (Jemal A. et al. Cancer statistics, 2009. CA Cancer J Clin 2009; 59:225).

Type I EC is estrogen-dependent and associated with conditions that elevate estrogen levels. The precoursor lesion, atypical endometrial hyperplasia, is well described. It is of endometroid histology, well differentiated in most cases, is usually diagnosed at early stage because of irregular bleeding and therefore has a good prognosis. Type II of EC is not estrogen-dependent and of high grade endometroid or serous or clear cell histology. In contrast to type I cancers, the vast majority especially of serous cancers are high grade, affect postmenopausal women, have no early symptoms, are diagnosed at advanced stage, behave more like OC and have a very poor prognosis. Clinical presentation and diagnostic workup of suspected OC and EC

Unfortunately, most patients with epithelial OC or EC, in particular the serous carcinomas or type II carcinomas, experience few or no symptoms until the disease has widely metastasized. The lack of early symptoms and the absence of a reliable screening test to detect the disease early, result in women being diagnosed after the disease has spread beyond the ovary or uterus and has a poor prognosis. For these reasons, there is a clear medical need for earlier diagnosis of high-grade serous type II EC and OC. Furthermore, detection of STICs and SEICs could even result in prevention of high-grade serous type II EC and OC.

Irregular bleeding as the main symptom of EC is conventionally investigated by endometrial sampling and subsequent examination of the sampled tissue under the microscope. Endometrial biopsy can be performed as an office based procedure, when a speculum is inserted into the vagina, and a small flexible plastic tube is inserted through the cervix and into the uterus. A small amount of endometrium can be suctioned through the tube for histologic examination. Alternatively, a woman may undergo a more invasive procedure called "dilation and curettage" involving thorough sampling of the endometrium. This allows for diagnosis of early stage type I and usually endometroid carcinoma. Bleeding from serous type II EC is examined the same way but the disease at the time of diagnosis is usually already advanced stage. Currently there is no method for early diagnosis of type II EC because of the lack of early symptoms.

Stirling (J Clin Oncol. 2005, 23(24) :5588-5596) summarizes on the state-of-the- art diagnostic tests for OC. These include transvaginal ultrasonography and serum cancer antigen (CA-125) measurements. Transvaginal ultrasound involves the insertion of a probe into the vagina that uses ultrasound to create a picture. The specificity of both, ultrasound and serum CA-125 measurements, however is

unacceptably low, and both tests are ineffective at detecting OC early enough to improve clinical outcomes. Definitive diagnosis of OC still relies on histological or cytological confirmation. These findings underline the importance for an effective test for early detection of OC.

WO01/75177A2 describes tumor markers in ovarian cancer and methods of diagnosing and prognosticating ovarian tumors employing samples, e.g. selected from the group consisting of a tissue biopsy, ovarian epithelial scrapings, peritoneal fluid, blood, urine, and serum.

WO99/24620A1 discloses primary screening for cervical dysplasia by

measuring a biochemical marker of apoptosis and/or angiogenesis in each of a population of cells derived from convenient, superficial swabbing, sponging, scraping or lavage of superficial epithelial cells from the cervix.

US20030165831 A1 describes methods for detecting ovarian cancers by determining a variety of markers. Malignant cells are detected in a patient sample, e.g. in an ovary-associated body fluid. Genetic changes in OC and EC

Detailed pathologic studies of prophylactically removed ovaries and fallopian tubes of asymptomatic women with germ-line BRCA 1 or BRCA2 (BRCA+) mutations have led to the discovery of an early malignant change in the fallopian tube referred to as STIC. STICS have linked many peritoneal and ovarian serous carcinomas to the fallopian tube. In over 90% of STICs and high-grade serous carcinomas but also in endometrioid OC and serous EC mutations in the TP53 tumor suppressor gene can be found. These mutations were demonstrated to represent clonal alterations, because the same mutations were found in STICSs of patients with advanced type II serous OC and SEICs in patients with serous EC (Karishma M. et al. 201 1 , Frontiers in Biosciences E3, January 1 , 625-634, Kuhn et al. J. Pathol. 201 1 , doi: 10.1002/path.3023). Analysis of TP53 gene mutations and alterations in the p53 expression include sequence analysis and immunohistochemical staining. TP53 encodes a protein (p53) that acts as a central mediator of the cellular response to both genotoxic and nongenotoxic stress.

The PI3K/Akt pathway is another signalling pathway that is frequently altered in human cancers, including endometrial and ovarian endometrioid adenocarcinomas. This signalling pathway plays important roles in cell cycle progression, cell survival, response to nutrient availability, cell motility, and angiogenesis. Signalling via the PI3K pathway is initiated by interaction of specific ligands with plasma membrane-spanning receptor tyrosine kinases, such as EGFR (epidermal growth factor receptor), c-kit, and insulin-like growth factor receptor 1 . The ligand/receptor interaction leads to the recruitment and activation of PI3K, which converts PIP2 (phosphatidylinositol-4,5 biphosphate) to PIP3 (phosphatidylinositol-3,4,5 triphosphate). PIP3 in turn transmits growth and survival signals by recruiting certain kinases such as the protein kinase B/Akt family of kinases and phosphoinositide-dependent kinase 1 (PDK1 ) to the membrane. In part through phosphorylation by PDK1 , Akt is activated and

phosphorylates specific downstream targets, many of which play key roles in the regulation of important cellular functions such as proliferation, cell size, apoptosis, response to nutrients and DNA damage. The lipid phosphatase Pten removes the D3 phosphate from PIP3, inactivating the signalling cascade and regenerating PIP2. In endometrioid adenocarcinomas, the PI3K/Akt pathway is often deregulated via inactivating mutations of PTEN or through activating mutations of PIK3CA, which encodes the catalytic subunit of PI3K. (see Cho (2009) Arch Pathol Lab Med.

Nov;133(1 775-81 ).

Women with a germline BRCA1 or BRCA2 mutation are described to have a substantial risk of OC (Pruthi et al. Mayo Clin. Proc. 2010, 85(12) 1 1 1 1 -1 120). Saline contrast hysterosonography

The golden standard for the investigation of suspected benign endometrial pathology is transvaginal ultrasound. Differential diagnosis of anormally thickened endometrium can be difficult since the endometrial linings of the anterior and posterior wall of the uterus touch each other. This circumstance makes it difficult to visualize benign endometrial tumors such as polyps. To separate the endometrial linings from each other a method called the saline contrast hysterosonography was developed. During this investigation a thin catheter is introduced into the uterine cavity through the uterine cervix and saline solution is instillated, separating the endometrial linings and allowing for better visualization. Saline contrast hysterosonography is a non-invasive, office based and very well tolerated investigation, and allows for routine application (de Kroon et al. 2003, BJOG: an International Journal of Obstetrics and Gynaecology 1 10, 938-947). During saline contrast hysterosonography approximately 10 ml_ normal saline are gently syringed into the uterine cavity and fallopian tube. The preferred device to perform a rinse and/or lavage of the uterus and fallopian tubes is a catheter, e.g. a three way catheter. It may be inserted into the cervical canal and the balloon is inflated, e.g. with normal saline, to seal the cervical canal. If the cervical canal is too narrow to pass the catheter, it is optionally dilated, e.g. with Hegar dilators after application of Xylocain spray.

According to a specific example, two 10 ml syringes - one of them containing 10 ml of normal saline - are connected to the two canals. With help of the gynecologic chair the patient is put into an upright position (anti Trendellenbur positioning). By pushing on the plunger of the normal saline containing syringe, the fluid is slowly syringed into the uterine cavity and tubes. Simultaneously the plunger of the empty syringe is gently pulled out, sucking the fluid from the uterine cavity and tubes. While one tube slowly empties, the other slowly fills up. After the lavage is finished a cap is put on the filled syringe and syringe is sent into the laboratory.

The development of an alternate and new test to detect OC or EC and their precursor lesions is imperative, in particular serous OC or EC or disease of early stages. Thus, it is the object to provide a technology that overcomes the current lack of a convenient, safe and cost-effective test possibly used for early diagnosis or in a screening program looking for cancer or precancerous lesions in women who have no symptoms of the disease.

Summary of the invention

The object is solved by the subject matter as claimed.

According to the invention there is provided a non-invasive method for the diagnosis of adenocarcinoma or their precursor lesions in a female subject by analyzing cells of said subject, in particular a genetic mutation, comprising

- preparing epithelial cells of a sample of said subject obtained from a rinse of the uterine cavity, and

- performing analysis of said cells to determine an abnormality associated with OC or EC, the abnormality being indicative of adenocarcinoma or their precursor lesions.

Preferably the analysis comprises molecular analysis, e.g. to determine cell or biomarker mutations. Specifically the abnormality is a genetic related abnormality, e.g. differential expression of one or more biomarkers of said cells. Specifically said sample is obtained from the rinse of the fallopian tubes, for example the rinse of the uterine cavity and the fallopian tubes.

According to a specific embodiment, said sample is obtained by non-invasive rinse with normal saline solution (NISR), in particular such as used in saline contrast hysterosonography or sonohysterography. Upon rinsing, a sample may be withdrawn from the rinse or effluent for further analysis.

Specifically said cells may be separated from said sample and/or nucleic acid may be extracted, e.g. employing standard means and buffer.

A specific analysis method may employ an amplification-based method, such as employing PCR, or sequencing method, to determine a nucleic acid sequence, in particular to determine mutations in coding or non-coding regions.

The specifically determined abnormality is indicative of OC or EC, such as serous cancer or Type II carcinoma, or a precursor neoplasia thereof, such as intraepithelial carcinoma of the fallopian tubes and/or the endometrial lining, including serous intraepithelial carcinoma.

According to a specific embodiment, the method according to the invention is provided for the diagnosis of early stage OC and EC.

According to another specific embodiment, the method according to the invention is provided for the differential diagnosis of OC and EC in subjects with suspected OC or EC. The differential diagnosis is particularly understood as the determination of which of two or more diseases (herein OC and EC) with similar symptoms is the one from which the patient is suffering, by a systematic comparison and contrasting of the clinical findings.

The abnormality may be specifically determined by genotyping at least one mutation of a biomarker selected from the group consisting of TP53, EGFR, PDGRFa, KIT, KRAS, BRAF, PIK3CA, PTEN, ARID1 A, PPP2R1 A, RB1 , VHL, DICER, β-catenin (CTNNB1 ), CDKN2A, GATA4, RNASET2, BRCA1 , BRCA2, BRIP1 , PAX2, WT1 , MYC, ERBB2, CSF1 R, ECGF1 , SRC, AKT2, RUNX3, FHIT, FGF3 and MDM2, or

combinations thereof.

In particular, the abnormality is determined by a gene expression profile employing qualitative and/or quantitative analysis.

The abnormality may specifically be determined by detecting loss of

heterozygosity (LOH) or other chromosomal changes (e.g. copy number variations, CNVs) of a biomarker selected from the group consisting of TP53, EGFR, PDGRFa, KIT, KRAS, BRAF, PIK3CA, PTEN, ARID1 A, PPP2R1 A, RB1 , VHL, DICER, β-catenin (CTNNB1 ), CDKN2A, GATA4, RNASET2, BRCA1 , BRCA2, BRIP1 , PAX2, WT1 , MYC, ERBB2, CSF1 R, ECGF1 , SRC, AKT2, RUNX3, FHIT, FGF3 and MDM2, or

combinations thereof, or of regions on chromosomes 1 , 2, 3, 6, 7, 9, 12 and 20 (mostly gains) and chromosomes 4, 8, 1 1 , 13, 14, 15, 17 and 22 (mostly losses). Structural rearrangements primarily involve deletions and unbalanced translocations involving 1 p, 1 q, 3p, 3q, 6q, 7p, 10q, 1 1 p, 1 1 q and 12q.

The abnormality may specifically be determined by detecting aberrant DNA methylation. Aberrant DNA methylation, specifically DNA hypermethylation, is the most common molecular lesion of the cancer cell, e.g. a change of DNA methylation in neoplasms is the silencing of tumor suppressor genes by CpG island promoter hypermethylation, which targets genes such as p16(INK4a), BRCA1 , and hMLH1 . Epigenetic events were also reported in a frequently deleted region on chromosome 8p22 that influence the expression of tumor suppressor candidate 3 (TUSC3), a putative tumor suppressor gene in ovarian cancer (Pils et al. Cancer. 2012 Oct 23. doi: 10.1002/cncr.27850). The results indicated that TUSC3 expression is decreased significantly because of promoter methylation in malignant ovarian tumors compared with benign controls. Methylation status of the TUSC3 promoter had a significant and independent influence on progression-free and overall survival. Thus, the abnormality may specifically be determined by detecting TUSC3 hypermethylation.

Yet, the abnormality may specifically be determined by analysis at the cellular level by employing immunocytochemistry or fluorescence in situ hybridization (FISH).

According to a specific embodiment, the abnormality is determined by at least one of

- genotyping at least one mutation of a biomarker selected from the group consisting of TP53, EGFR, PDGRFa, KIT, KRAS, BRAF, PIK3CA, PTEN, ARID1 A, PPP2R1 A, RB1 , VHL, DICER, β-catenin (CTNNB1 ), CDKN2A, GATA4, RNASET2, BRCA1 , BRCA2, BRIP1 , PAX2, WT1 , MYC, ERBB2, CSF1 R, ECGF1 , SRC, AKT2, RUNX3, FHIT, FGF3 and MDM2, or combinations thereof,

- a gene expression profile employing qualitative and/or quantitative analysis,

- detecting loss of heterozygosity (LOH) or other chromosomal changes (e.g. copy number variations, CNVs) of a biomarker selected from the group consisting of TP53, EGFR, PDGRFa, KIT, KRAS, BRAF, PIK3CA, PTEN, ARID1 A, PPP2R1 A, RB1 , VHL, DICER, β-catenin (CTNNB1 ), CDKN2A, GATA4, RNASET2, BRCA1 , BRCA2, BRIP1 , PAX2, WT1 , MYC, ERBB2, CSF1 R, ECGF1 , SRC, AKT2, RUNX3, FHIT, FGF3 and MDM2, or combinations thereof, or of regions on chromosomes 1 , 2, 3, 6, 7, 9, 12 and 20 (mostly gains) and chromosomes 4, 8, 1 1 , 13, 14, 15, 17 and 22 (mostly losses). Structural rearrangements primarily involve deletions and unbalanced translocations involving 1 p, 1 q, 3p, 3q, 6q, 7p, 10q, 1 1 p, 1 1 q and 12q,

- detecting aberrant DNA methylation, and

- analysis at the cellular level by employing immunocytochemistry or

fluorescence in situ hybridization (FISH), in particular of any of the polypeptide expression products of the relevant genes, such as listed above.

According to a specific aspect of the invention, there is provided a kit for diagnosing adenocarcinoma in a female subject on the basis of an abnormality in a cell sample of said subject, such as used in a method according to the invention, which kit comprises

- an uterine catheter designed for non-invasive rinsing of the uterine cavity and collecting a sample of the rinse,

- means to prepare a fraction of epithelial cells of said sample, and

- reagents for analyzing said cells to determine an abnormality associated with OC or EC.

Specifically, said catheter is designed for use in NISR, in particular such as used in saline contrast hysterosonography or sonohysterography.

The kit may specifically comprise those reagents suitable for carrying out such analysis, preferably all necessary reagents provided in the kit form at the convenience of the operator, e.g. those essential reagents specifically used carrying out the analysis performed according to the invention, such as for

- genotyping at least one mutation of a biomarker selected from the group consisting of TP53, EGFR, PDGRFa, KIT, KRAS, BRAF, PIK3CA, PTEN, ARID1 A, PPP2R1 A, RB1 , VHL, DICER, β-catenin (CTNNB1 ), CDKN2A, GATA4, RNASET2, BRCA1 , BRCA2, BRIP1 , PAX2, WT1 , MYC, ERBB2, CSF1 R, ECGF1 , SRC, AKT2, RUNX3, FHIT, FGF3 and MDM2, or combinations thereof,

- a gene expression profile employing qualitative and/or quantitative analysis,

- detecting loss of heterozygosity (LOH) or other chromosomal changes (e.g. copy number variations, CNVs) of a biomarker selected from the group consisting of TP53, EGFR, PDGRFa, KIT, KRAS, BRAF, PIK3CA, PTEN, ARID1 A, PPP2R1 A, RB1 , VHL, DICER, β-catenin (CTNNB1 ), CDKN2A, GATA4, RNASET2, BRCA1 , BRCA2, BRIP1 , PAX2, WT1 , MYC, ERBB2, CSF1 R, ECGF1 , SRC, AKT2, RUNX3, FHIT, FGF3 and MDM2, or combinations thereof, or of regions on chromosomes 1 , 2, 3, 6, 7, 9, 12 and 20 (mostly gains) and chromosomes 4, 8, 1 1 , 13, 14, 15, 17 and 22 (mostly losses). Structural rearrangements primarily involve deletions and unbalanced translocations involving 1 p, 1 q, 3p, 3q, 6q, 7p, 10q, 1 1 p, 1 1 q and 12q,

- detecting aberrant DNA methylation, and

- analysis at the cellular level by employing immunocytochemistry or

fluorescence in situ hybridization (FISH), in particular of any of the polypeptide expression products of the relevant genes, such as listed above.

According to a specific aspect, the kit according to the invention may be used for screening a female population at risk of OC or EC, in particular including the screening for OC and/or EC.

According to a further aspect of the invention, there is provided a non-invasive method of preparing a sample for ex vivo diagnostic purposes by rinsing the uterine cavity and optionally the fallopian tubes of a subject with a physiologically accepted normal saline solution and retrieving a cell sample of the rinse.

Detailed description of the invention Specific terms as used throughout the specification have the following meaning.

As used herein, "abnormality" with respect to analyzing epithelial cells herein specifically refers to abnormality with respect to the nature and quantity of a biomarker, in particular its (nucleotide or amino acid) sequence and its expression, including the mutations, such as polymorphism in coding and non-coding sequences, or the level of gene expression. It further refers to an abnormality with respect to any of heterozygosity, chromosomal changes (e.g. amplifications, deletions, rearrangements) or cytochemistry.

As used herein, "biomarker" or "marker" refers to a molecule that indicates by its presence or (differential) expression, alone or in combination with other parameters, one or more aspects of an abnormality found in precancerous or cancer cells. The term particularly includes any polynucleotide having a mutation, e.g. a differential expression or any other alteration in expression level or activity that is associated with a disease or disorder. For example, the biomarker may be differentially expressed in precancerous or cancerous cells, at the transcription level or at the translation level. Thus, a biomarker may be any molecule that is a product of a nucleic acid molecule expression. Detection of a biomarker as indicating one or more aspects of an abnormality may be detection of its differential expression as compared to a reference or control.

Suitable biomarkers that may be analyzed for their expression to determine an abnormality according to the invention are of human origin and associated with adenocarcinoma, in particular with OC and/or EC, and are e.g. those listed in Table 1 , including the UniGene accession numbers and gene symbols (HUGO nomenclature).

Table 1 : List of biomarkers

Gene

Name Approved Name HGNC ID Location

Symbol

v-akt murine thymoma viral oncogene

AKT2 AKT2 392 19q13.1 -q13.2 homolog 2

ARID1 A ARID1 A AT rich interactive domain 1 A (SWI-like) 1 1 1 1 0 1 p36.1 -p35 v-raf murine sarcoma viral oncogene

BRAF BRAF 1097 7q34 homolog B1

BRCA1 BRCA1 breast cancer 1 , early onset 1 100 17q21 -q24 cyclin-dependent kinase inhibitor 2A

CDKN2A CDKN2A 1787 9p21

(melanoma, p16, inhibits CDK4)

CSF1 R CSF1 R colony stimulating factor 1 receptor 2433 5q32 catenin (cadherin-associated protein), beta

CTNNB1 CTNNB1 2514 3p21

1 , 88kDa

DICER DICER1 dicer 1 , ribonuclease type I I I 17098 14q32.2

ECGF1 TYMP thymidine phosphorylase 3148 22q13

EGFR EGFR epidermal growth factor receptor 3236 7p12 v-erb-b2 erythroblastic leukemia viral

ERBB2 ERBB2 oncogene homolog 2, neuro/glioblastoma 3430 17q1 1 .2-q12 derived oncogene homolog (avian)

FGF3 FGF3 fibroblast growth factor 3 3681 1 1 q13

GATA4 GATA4 GATA binding protein 4 4173 8p23.1 -p22 v-kit Hardy-Zuckerman 4 feline sarcoma viral

KIT KIT 6342 4q1 1 -q12 oncogene homolog

v-Ki-ras2 Kirsten rat sarcoma viral oncogene

KRAS KRAS 6407 12p12.1 homolog

MDM2 MDM2 Mdm2 p53 binding protein homolog (mouse) 6973 12q13-q14 v-myc myelocytomatosis viral oncogene

MYC MYC 7553 8q24 homolog (avian)

PDGFRA platelet-derived growth factor receptor, alpha

or PDGFRA polypeptide 8803 4q12

PDGRFa

phosphoinositide-3-kinase, catalytic, alpha

PIK3CA PIK3CA 8975 3q26.3 polypeptide

PPP2R1 protein phosphatase 2, regulatory subunit A,

PPP2R1 A 9302 19q13 A alpha

PTEN PTEN phosphatase and tensin homolog 9588 10q23

RB1 RB1 retinoblastoma 1 9884 13q14.2

RNASET ribonuclease T2

RNASET2 21686 6q27 2 Gene

Name Approved Name HGNC ID Location

Symbol

v-src sarcoma (Schmidt-Ruppin A-2) viral

SRC SRC 1 1283 20q12-q13 oncogene homolog (avian)

TP53 TP53 tumor protein p53 1 1998 17p13.1

VHL VHL von Hippel-Lindau tumor suppressor 12687 3p25.3

BRCA1 interacting protein C-terminal

BRIP1 BRIP1 20473 17q22.2 helicase 1

BRCA2 BRCA2 breast cancer 2, early onset 1 101 13q12-q13

PAX2 PAX2 paired box 2 8616 10q24.31

WT1 WT1 Wilms tumor 1 12796 1 1 p13

RUNX3 RUNX3 runt-related transcription factor 3 10473 1 p36

FHIT FH IT fragile histidine triad gene 3701 3p14.2

By "cancer" and "cancerous" is meant the physiological condition in mammals that is typically characterized by abnormal cell growth. Included in this definition are malignant cancers, as well as dormant tumors or micrometastases. Examples of cancer include OC and/or EC, which always include herein the serous adenocarcinoma, Type II disease or precursor lesions. Cancer is typically differentiated from benign neoplasm or tumors, e.g. by differential diagnosis.

By "control" or "control sample" is meant a biological sample representative or obtained from a healthy subject that has not been diagnosed with a cellular

proliferative disorder. A control or control sample may have been previously

established based on measurements from healthy subjects that have not been diagnosed with a cellular proliferative disorder. Further, a control sample can be defined by a specific age, sex, ethnicity, or other demographic parameters.

By "expression" is meant the detection of a product that is expressed or produced by a nucleic acid molecule by standard methods, which product refers to e.g. an unspliced RNA, an mRNA, a splice variant mRNA, a polypeptide, a post- translationally modified polypeptide, a splice variant polypeptide etc., and specifically products made using an RNA gene product as a template, e.g. cDNA of the RNA. Typical diagnostic methods focusing on nucleic acids include amplification techniques such as PCR and RT-PCR (including quantitative variants), hybridization techniques such as in situ hybridization, microarrays, blots, and others, and high throughput sequencing techniques like Next Generation Sequencing (lllumina, Roche Sequencer, Life Technologies SOLID™) , Single Molecule Real Time Sequencing (Pacific

Biosciences), True Single Molecule Sequencing (Helicos), or sequencing methods using no light emitting technologies but other physical methods to detect the sequencing reaction or the sequencing product, like Ion Torrent (Life Technologies). Typical diagnostic methods focusing on proteins or polypeptides include binding techniques such as ELISA, immunohistochemistry, microarray and functional techniques such as enzymatic assays.

A "differential expression" is meant to be detected when determining an abnormality of the cells according to the invention, typically referring to a gene whose expression is activated to a higher or lower level in a subject suffering from a disease, specifically cancer, such as OC or EC, relative to its expression in a normal or control subject. Differential expression includes both quantitative, as well as qualitative, differences in the temporal or cellular expression pattern in a gene or its expression products among, for example, normal and diseased cells, or among cells which have undergone different disease events or disease stages. For the purpose of this invention, a differential gene expression is considered to determine an abnormality when there is at least an about two-fold, preferably at least about four-fold, more preferably at least about six-fold, most preferably at least about ten-fold difference between the expression of a given gene in normal and diseased subjects, or in various stages of disease development in a diseased subject. Furthermore, linear or non-linear models (like regression, neuronal networks, random forests) comprised of expression values of more than one gene indicative for the diseased status.

The terms "diagnostic" and "diagnosis" refer to identifying the presence or type of a pathologic condition and includes identifying subjects who are at risk of developing a specific disease or suffering from a disorder. Diagnostic methods differ in their sensitivity and specificity. While a particular diagnostic method may not provide a definitive diagnosis of a condition, it suffices if the method provides a positive indication that aids in diagnosis.

The terms "detection", "detecting", "determining", "analyzing", and the like are used interchangeably herein to refer to any form of measurement, and are herein specifically used in the context of determining abnormalities, such as biomarkers of cells and their differential expression indicating that the cells are either precancerous or cancerous.

As used herein the term "mutation" refers to alteration of the cell genotype or phenotype, e.g. altered biomarkers including alterations of the polynucleotides, their corresponding gene products and expression products, including nucleic acids and polypeptides or proteins, e.g. molecules with one or more point mutations or single- nucleotide polymorphism (SNP), fragments, variants, such as splice variants or isoforms.

As used herein the term "non-invasive" refers to methods that are non-surgical, e.g. not penetrating the body, as by incision or injection, or not invading tissue. In particular, the lavage of the internal uterus and optionally the tubal area is understood as a non-invasive technique of low strain, specifically used for sampling according to the present invention.

As used herein, "precancerous cells" or "precursor lesions" refer to cells of dysplasias and their precursory stages, as well as disseminated tumor cells.

By "reference" is meant a standard or control condition for comparison purposes. For example, a "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset of or the entirety of a specified sequence, e.g. a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence

The terms "subject", "patient" or "female" generally refer to a human, although the methods of the invention are not limited to humans, and may be useful in other mammals.

Therefore, the present invention provides a novel specific sampling technique and a method of diagnosing adenocarcinoma or its precursor lesions comprising such sampling technique. In particular, the invention provides diagnostic methods and kits useful for determining abnormalities in cells of the origin of adenocarcinoma or their precursor lesions, e.g. identifying a differential expression that identifies a subject as having or having a propensity to develop OC or EC. Such assays are specifically used to perform a molecular analysis or measure a mutation or an alteration in a nucleotide sequence, its activity or its expression level, including nucleotide sequence pattern and arrays, suitably provided in an ordered arrangement of array elements. Microarray- based platforms or high-throughput sequencing technologies may be specifically employed, e.g., SNP arrays.

The kit or devices according to embodiments of the present invention

specifically includes means and in particular one or more devices for sampling and preparing a fraction of the sample including the epithelial cells, e.g. enriched in epithelial cells, eventually in the concentrated form.

In some embodiments, the kit according to the invention contains a device capable of both, rinsing the uterus cavity and sampling the rinse. In some other embodiments the kit according to the invention contains a combination of devices for such purposes. In further embodiments, the kit includes instructions for taking a sample from the subject, and using the kit for the diagnosis of the precancerous or cancerous disease.

Specifically samples are taken upon rinse of the uterine cavity in a suitable manner. A sample may comprise a specific amount of the rinse that is taken from the effluent or in situ when flushing the body cavity. Suitable amounts of the rinse sample are e.g. ranging from 0.5 - 20 ml_, preferably 1 -15 ml_, more preferred 2-10 ml_, such as about 5 ml_ (i.e. +/- 1 ml_). Means of obtaining rinse samples employ e.g. syringes or other containers known to those of skill in the art.

A fraction of the sample may be prepared which comprises epithelial cells, such as a separated cell fraction. Suitably a cell pellet may be produced upon centrifugating the sample, which provides for the concentration of cell density and separation of the medium. Suitable means are e.g, filtration, centrifugation - with or without one or more density gradient media - (flow assisted) magnetic-bead associated cell separation, non-magnetic cell separation (e.g. PluriSelect), cell microarray based cell manipulation (e.g. DEPArray, Silicon Biosystems), FACS, or equivalent technologies.

For example, microfluidic lab-on-a-chip devices provide unique opportunities for cell sorting and rare-cell detection. Microfluidic technology has been successfully used for microfluidic flow cytometry, continuous size-based separation and chromatographic separation.

The sample preparation may employ conventional buffer or other carriers, such as suitable to analyse the cells, in particular to perform molecular analysis of genetic information provided with the cells, or else to store genetic information for testing at a later time. Suitable carriers are e.g, formalin, paraffin, RNAIater (QIAGEN), solutions with 2.5% to 15% DMSO.

In one embodiment, the kit includes reagents containing at least one agent that binds a biomarker, e.g. a polynucleotide or nucleic acid molecule whose sequence or expression is altered in OC or EC, specifically in the serous cancer or Type II cancer.

In specific embodiments, the kit comprises a sterile container which contains the binding agent.

Biomarkers useful for analyzing cells are typically those present in epithelial cells and indicative of OC or EC, in particular the serous carcinoma or Type II of the diseases, or any respective precursor lesion, such as those comprising precancerous cells.

Suitable biomarkers are known in the art, and include, but are not limited to, those listed in Table 1 .

Additional biomarkers may be identified using methods known in the art. For example, biomarkers can be identified by looking at differential expression between normal and cancerous or precancerous cells at the mRNA level, by methods such as nucleic acid-based microarrays, high-throughput sequencing technologies, quantitative PCR based methods, and differential screening methods. Biomarkers can also be identified by looking at differential expression between normal and cancerous or precancerous cells at the protein level, by methods such as mass-spectrometry-based proteomics methods and protein chips or microarrays.

For diagnoses based on differential expression of the biomarkers and in particular relative levels of nucleic acids, a subject with an abnormality such as OC or EC disease will show an alteration, e.g. an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more, in the amount of the molecules expressed or the presence or absence of a mutation, specifically including sequence mutation, variants or polymorphism, such as an SNP, compared to a control or reference.

In certain embodiments, a nucleic acid copy number is increased by at least two-fold fold. In some embodiments, a nucleic acid copy number is determined by hybridization-assays and/or amplification-based assays (e.g., fluorescence in situ hybridization (FISH), comparative genomic hybridization (CGH), or microarray-based CGH).

In some embodiments, the abnormality is determined by detecting an LOH of a biomarker or of a specific chromosomal region. The term "loss of heterozygosity" or "LOH", indicates that a region of a test genome has lost heterozygosity relative to a parent genome or to a diploid reference genome, which LOH may be indicative of proliferative disease.

For some embodiments, cells prepared or separated from the sample or cultured cells derived from the sample may be used for determining cellular

abnormalities.

In some embodiments, cells isolated using the methods and devices of the present invention can be lysed, and one or more properties of the cells, or portions thereof, can be measured. Nonlimiting examples of biological properties that can be measured in lysed cells include mRNA expression, protein expression, and DNA quantification. Additionally, in some embodiments, the cellular DNA can be sequenced, or certain sequence characteristics (e.g., polymorphisms and chromosomal

abnormalities) can be identified using conventional techniques, e.g. FISH or PCR. In some embodiments of the present invention, information that can be obtained from the isolated cells includes identification or enumeration of particular genomic DNA, cDNA, or mRNA sequences.

In some embodiments, cells isolated using the methods and devices of the present invention are subjected to immunocytochemical analysis by flow cytometry or other analytical platforms.

In some specific embodiments, cellular tests may specifically employ visual determination of morphological abnormalities or some other embodiments typically used for detecting biomarkers, particularly polypeptides, e.g. in an immunoassay, an ELISA, immunocytochemistry, immunohistochemistry, flow cytometric analysis, radioimmunoassay, Western blot, etc.

Immunological methods are particularly suitable for detecting the expression of the markers according to the present invention. Therefore, binding agents, such as antibodies or antibody fragments, specific for each marker are used to detect expression. The markers can be detected by direct or indirect labelling of the binding agents, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horse radish peroxidase or alkaline phosphatase.

In some embodiments, the biomarker determined for the purpose of the invention is any known by the skilled person to be specifically expressed in cells at certain malignancy levels. For example, any subgroup of markers particularly relevant for OC/EC or precursor lesions may be determined.

In some embodiments, the method according to the invention comprises a multiparameter analysis of cells in a sample, wherein these multiple parameters, preferably comprise at least TP53.

While individual markers are useful diagnostic markers, in some instances, a combination of markers provides greater predictive value than single markers alone. The detection of a plurality of markers in a sample can increase the percentage of true positive and true negative diagnoses and decrease the percentage of false positive or false negative diagnoses. Thus, preferred methods of the present invention comprise the measurement of more than one marker. The analysis is specifically performed employing conventional techniques (e.g., temperature, pH, protein concentration, and ionic strength) known to the skilled artisan.

Typically, a sample is contacted with one or more probing agents that recognize biomarkers differentially expressed on precancerous or cancerous cells. The probing agents are labelled before or after they are brought into contact with the sample. The stained sample is then analyzed in a detection instrument, wherein measurements of the label, such as fluorescence intensities and light scattering are taken for cells examined. By analyzing one or more parameters, the condition of the examined cells can be assessed, e.g. when compared to a control or reference, and classified as normal or precancerous or cancerous, and the sample can be determined to be negative or positive for one or more cell abnormalities or adenocarcinoma, such as OC or EC.

For some applications, nucleic acid molecule probes are used to determine biomarkers in a sample. For example, the mRNA may be isolated from said sample according to standard methods, and cDNA may be produced and used as a template to make complementary RNA suitable for hybridization with a suitable probe by methods known in the art.

Probes may include nucleic acids, eventually hybridizing to the biomarker sequence to determine or exclude a specific mutation in said sequence. Hybridization and incubation conditions are usually adjusted such that hybridization occurs with precise complementary matches or with various degrees of less complementarity depending on the degree of stringency employed. Specifically bound probes may be detected, for example, using a label, such as for detecting fluorescence, or any other suitable detectable method known to the skilled person.

As an amplification-based method of molecular analysis, a PCR-based assay may be specifically employed. For example, a TaqMan-based assay may be used to quantify polynucleotides. Other suitable amplification methods include, but are not limited to, ligase chain reaction, transcription amplification, self-sustained sequence replication, dot PCR, and linker adapter PCR.

The invention specifically provides methods and kits for diagnosing and eventual monitoring OC or EC, e.g. for recurrence of a disease, the differential diagnosis in subjects suffering from a tumor, or the staging of disease, including early stage, but also later stage and metastatic disease. The present invention specifically relates to methods and kits for screening subjects employing sampling by the non-invasive method according to the invention, e.g. by use of the kit according to the invention, to provide for information supporting the diagnosis of cancer. A population of subjects may be specifically screened that has an increased risk of developing proliferative disease.

Detection of amplification, overexpression, or overproduction of, for example, a biomarker gene or expression product can also be used to provide prognostic information or guide therapeutic treatment. Such prognostic or predictive assays can be used to determine early treatment of a subject prior to the onset of symptoms of cancer.

The diagnostic methods described herein can be used individually or in combination with any other diagnostic method described herein for a more accurate diagnosis of the presence of adenocarcinoma or their precursor lesions. Examples of additional methods for diagnosing such disorders include, e.g. examining a subject's health history, immunohistochemical staining of tissues, computed tomography (CT) scans, or culture growths.

The foregoing description will be more fully understood with reference to the following examples. Such examples are, however, merely representative of methods of practicing one or more embodiments of the present invention and should not be read as limiting the scope of invention.

Examples

1 . Saline Hysterosonography and Sampling

Saline hysterosonography is performed according to de Kroon et al. (2003,

BJOG: an International Journal of Obstetrics and Gynaecology 1 10, 938-947). During saline contrast hysterosonography 10 ml_ normal saline are gently syringed into the uterine cavity and fallopian tube. 5 ml_ is retrieved by sucking it back into the syringe and used as a sampling solution for further cell preparation and molecular analysis.

For non-invasive saline rinse (NISR) routine anesthesia or analgesia is not required. The insertion of the intrauterine catheter is often painless. A minority of women will experience some cramping sensations that can be prevented by

subscribing a nonsteroidal anti-inflammatory drug such as mefenamic acid (500 mg) 30 minutes before the examination. After pregnancy is excluded, the patients need give consent for the procedure. Sterile conditions are secured and the patient is positioned in lithotomy position and a speculum is placed into the vagina.

After povidoneiodine solution or chlorhexidine gluconate is used to clean the cervical os, a 5 or 7 French sonohysterography catheter is inserted through the cervical canal. Before insertion the catheter needs to be flushed with normal saline to evacuate the air. After insertion the balloon in the tip of the catheter is inflated with 1 -2 mL of saline to help hold it in place. Because the catheter is approximately 25 cm long, it will extend beyond the vaginal entrance even after the speculum is carefully removed, which is not invariably necessary. The speculum needs only to be removed if a saline hysterosonographie is done in addition to NISR.

Occasional difficulties to insert the catheter can be overcome by changing the position of the speculum, by dilating the cervical canal or by the use of a guide wire. The use of a balloon catheter is not mandatory because adequate distention and rinse of the uterine cavity and fallopian tube can also be achieved with other type of catheters, though somewhat more difficult.

In circumstances where it is not possible to pass the catheter into the uterine cavity, a rinse is frequently still possible by placing the tip in the cervical canal as far up as possible and then inflating the balloon. If a saline hysterosonographie should be performed in parallel to NISR the vaginal ultrasound probe is inserted. A 10 mL syringe filled with sterile saline is connected to the catheter. The amount of instilled fluid varies, depending upon patient comfort (cramps may occur) but 10 ml saline usually is not a problem. By pulling gently on the plunger the saline is suctioned back into the syringe, representing the rinse. Finally the balloon is collapsed and the catheter is pulled back or passively slips out of the uterus.

2. Cell preparation

Cells from the sampling solution are collected by filtration, centrifugation - with or without one or more density gradient media - (flow assisted) magnetic-bead associated cell separation, non-magnetic cell separation (e.g. PluriSelect), cell microarray based cell manipulation (e.g. DEPArray, Silicon Biosystems), FACS, or equivalent technologies. DNA, protein, and RNA molecules are prepared using known technologies, suitable for subsequent analyses technologies. For immuno- histochemistry or FISH analyses cells can be fixed (e.g. with formalin) and embedded in adequate media like parrafin. 3. Molecular analysis

Mutation analysis, CNV (copy number variation) analysis, SNV (single

nucleotide variants) analysis, or whole transcriptome (expression) analysis are performed using high-throughput sequencing technologies. Brief, for DNA based analysis (mutation, CNV, SNV) DNA are used in total (whole genome DNA-seq) or pre- enriched for exons (exon-seq) or specific target genes or chromosomal regions

(targeted DNA-seq, e.g. Fluidigms Access Array BRCA1 , BRCA2 and TP53 Kit), DNAs sheared, and libraries prepared according to the used brand of the high-throughput sequencing technology and sequenced to an appropriate depth. After quality control, removing of adaptor sequences, PCR-duplicates and low-quality reads and eventually after trimming of three-prime low-quality bases, the reads are mapped to the genome (i.e. to the newest assembled human genome sequence, e.g. hg19 or GRCh37) using indel competent alignment programs like Stampy, Novoalign, or BWA. SNP/SNV calling and interpretation is performed with the Genome analyis toolkit (GATK) essentially following the publication of DePrisot et al. (Nature Genetics Volume: 43, Pages: 491 -498: (201 1 )) and including local realignment around indels.

For CNV detection targeted (favored regions, see below) or exom enriched high throughput sequencing data are analyzed by BreakDancer (Nat Methods. 2009

Sep;6(9):677-81 . Epub 2009 Aug 9.) and/or CNV-seq (BMC Bioinformatics. 2009 Mar 6;10:80.). The most prevalent numerical changes are gains of chromosomes 1 , 2, 3, 6, 7, 9, 12 and 20 losses of chromosomes 4, 8, 1 1 , 13, 14, 15, 17 and 22. Structural rearrangements primarily involve deletions and unbalanced translocations involving 1 p, 1 q, 3p, 3q, 6q, 7p, 10q, 1 1 p, 1 1 q and 12q.

Whole genome expression analysis is performed by RNA-seq of either poly A enriched (oligo-dT based enrichment) or rRNA depleted (RiboMinus (Invitrogen), Ribo- Zero (epicentre)) RNA. RNA or cDNA are sheared enzymatically, chemically, or physically (ultrasound, nebulization) and libraries produced according to the used brand of the high-throughput sequencing technology and sequenced to an appropriate depth. For multiplexing, indices are added to the adaptors. Reads are mapped with an RNA-seq compatible alignment program (e.g. RNA-Seq Unified Mapper (RUM), STAR, TopHat). After counting of aligned reads (cufflinks, HTseq-count) differential or absolut gene expression is determined (cufflinks, cuffdiff, DEGseq, DESeq, SAMseq, edgeR, NOISeq). Using statistical methods for multivariable model building (lasso, elastic net, supervised PCA, neuronal networks, support-vector machines, random forests) discriminative expressed genes, mutations/SNPs, SNVs, CNV and chromosomal aberrations are determined and validated by gold standard methods (e.g. qPCR or digital PCR based, pyrosequencing).

4. Exemplary process to determine a mbiomarker indicative of OC and/or EC, or a precursor malignancy thereof, in a patient sample Sampling

The patient is positioned on the gynecologic chair. The ultrasound examination gives the information about the exact position of the uterus and the cervix. A gynecologic speculum is inserted into the vagina and the cervix is visualized. The cervix is cleaned with an antiseptic lotion. Using a pointed forceps the cervix is grasped at 12.00 o' clock position. A three way catheter is inserted into the cervical canal and the balloon is inflated with normal saline. The canal is now sealed. If the cervical canal is too narrow to pass the catheter, it is dilated with Hegar dilators after application of Xylocain spray.

Two 10 ml syringes one of them containing 10 ml of normal saline are

connected to the two canals. With help of the gynecologic chair the patient is put into an upright position (anti Trendellenbur positioning). By pushing on the plunger of the normal saline containing syringe, the fluid is slowly syringed into the uterine cavity and tubes. Simultaneously the plunger of the empty syringe is gently pulled out, sucking the fluid from the uterine cavity and tubes. While one tube slowly empties, the other slowly fills up. After the lavage is finished a cap is put on the filled syringe and syringe is sent into the laboratory.

The aspirate is centrifuged for 10 minutes at 15000 rpm. Supernatant is removed and the remaining cell pellet frozen at -80 °C.

Subsequently, DNA of the cell pellet re-suspended in 250μΙ is isolated. For DNA isolation the QIAamp MinElute Media Kit (QIAgen) is used according to the

manufacturer's protocol. Determination of TP53 as exemplary tumor marker

For detection of tumor cells the fact that already very early in the progression of ovarian cancer in most of the patients, a mutation of the TP53 gene is likely to occur is used. The mutation is detected for example through digital PCR, using the QX100™ Droplet Digital™ PCR System from Bio-RAD. The type of TP53 mutation present in the primary tumor tissue is verified in the DNA isolated from the lavage. Therefore, an assay targeting this specific TP53 mutation is designed. It uses a forward and a reversed primer, which bind upstream and downstream the targeted region. A PCR product of ~100bp is produced. Probes which are specific for the particular TP53 mutation, respectively wild type are used. These probes must have a melting

temperature Tm 5-10°C higher than the primer Tm. The probes consist of a

fluorophore covalently attached to the 5'-end, for the mutation specific probe FAM (6- carboxyfluorescein), for the wild type VIC and a quencher on the 3'end MGB (minor groove binder). The PCR components (Master mix, primers, probes, DNA) are mixed and 20 μΙ of this mix are used for droplet generation using the QX100™ Droplet

Generator from Bio-RAD, according to manufacturer's protocol. By that the PCR Assay is partitioned into 20,000 water in oil droplets. The emulsion is then transferred to a 96- well PCR plate, heat sealed and PCR is performed. Annealing temperature is adapted to previous optimized temperature, depending on which kind of TP53 mutation is going to be detected. Through the QX100™ Droplet Reader (Bio-RAD) each droplet is counted as negative or positive for the specific target DNA and if a cell carrying a TP53 mutation was present in the lavage, a fluorescent signal is detected.

The TP53 gene expression, specifically the mutation and overexpression of p53, is indicative of a disease, specifically OC and/or EC, or a precursor malignancy thereof.

According to the example, the following p53 mutation is determined employing the primer and probes described herein: Mutation in codon 248 (g.14070G>A, p.Arg248Gln) forward PCR primer: tgtaacagttcctgcatgggc (SEQ ID 1 )

reverse PCR Primer: acagcaggccagtgtgca (SEQ ID 2) probe 1 : 5'-FAM-catgaaccagaggcc-MGB-3' (SEQ ID 3)

probe 2: 5'-VIC-catgaaccggaggcc-MGB-3'(SEQ ID 4)

TP53 gene: UniProtKB: P04637

This gene encodes tumor protein p53, which acts as a tumor suppressor in many tumor types; induces growth arrest or apoptosis depending on the physiological circumstances and cell type. Involved in cell cycle regulation as a trans-activator that acts to negatively regulate cell division by controlling a set of genes required for this process. One of the activated genes is an inhibitor of cyclin-dependent kinases.

Apoptosis induction seems to be mediated either by stimulation of BAX and

FAS antigen expression, or by repression of Bcl-2 expression. Implicated in Notch signaling cross-over. Prevents CDK7 kinase activity when associated to CAK complex in response to DNA damage, thus stopping cell cycle progression. Isoform 2 enhances the transactivation activity of isoform 1 from some but not all TP53-inducible promoters. Isoform 4 suppresses transactivation activity and impairs growth

suppression mediated by isoform 1 . Isoform 7 inhibits isoform 1 -mediated apoptosis.

Alternatively a method of targeted deep sequencing of genetic alterations may be used, e.g. those known to occur in ovarian and endometrial and tubal cancer frequently.