Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
NOVEL ACETYLCHOLINESTERASE GENE RESPONSIBLE FOR INSECTICIDE RESISTANCE AND APPLICATIONS THEREOF
Document Type and Number:
WIPO Patent Application WO/2004/000994
Kind Code:
A2
Abstract:
The invention relates to a novel acetylcholinesterase gene (ace-1) responsible for resistance to organophosphorus and/or carbamates in mosquitoes, which is non-homologous to the D. melanogaster acetylcholinesterase gene (ace-2), products of the ace-1 gene (cDNA, protein AchE1) and the applications thereof, particularly for the screening of novel insecticides and the genetic detection of resistance to organophosphorus and/or carbamates in mosquito populations.

Inventors:
Weill, Mylène (11 rue Belmont, Montpellier, Montpellier, F-34090, FR)
Fort, Philippe (47 avenue Jean Jaurès, Castelnau le Lez, Castelnau le Lez, F-34170, FR)
Raymond, Michel (8 rue St Sépulcre, Montpellier, Montpellier, F-34000, FR)
Pasteur, Nicole (65 avenue du Major de Flandre, Montpellier, Montpellier, F-34090, FR)
Application Number:
PCT/FR2003/001876
Publication Date:
December 31, 2003
Filing Date:
June 19, 2003
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
CENTRE NATIONAL DE LA RECHERCHE SCIENTIFIQUE (3 rue Michel-Ange, Paris Cedex 16, Paris Cedex 16, F-75794, FR)
UNIVERSITE DE MONTPELLIER 2 (2 place Eugène Bataillon, Montpellier Cedex 5, Montpellier Cedex 5, F-34095, FR)
Weill, Mylène (11 rue Belmont, Montpellier, Montpellier, F-34090, FR)
Fort, Philippe (47 avenue Jean Jaurès, Castelnau le Lez, Castelnau le Lez, F-34170, FR)
Raymond, Michel (8 rue St Sépulcre, Montpellier, Montpellier, F-34000, FR)
Pasteur, Nicole (65 avenue du Major de Flandre, Montpellier, Montpellier, F-34090, FR)
International Classes:
C12N9/18; C12N15/55; (IPC1-7): C12N/
Other References:
DATABASE EMBL [Online] 19 février 2001 (2001-02-19), J.R. GAO ET AL: "Schizapis graminum acetylcholinesterase precursor, mRNA, complete cds" XP002234929 extrait de EBI, HINXTON, UK Database accession no. AF321574 -& J.R. GAO ET AL: "Molecular cloning and characterization of a greenbug (Schizaphis graminum) cDNA encoding acetylcholinesterase possibly evolved from a duplicate gene lineage" INSECT BIOCHEMISTRY AND MOLECULAR BIOLOGY, vol. 32, no. 7, juillet 2002 (2002-07), pages 765-775, XP002234922
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Aedes albopictus partial achE1 gene for acetylcholinesterase" XP002234930 extrait de EBI, HINXTON, UK Database accession no. AJ438598 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles albimanus partial achE1 gene for acetylcholinesterase" XP002234938 extrait de EBI, HINXTON, UK Database accession no. AJ438608 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles darlingi partial achE1 gene for acetylcholinesterase" XP002234931 extrait de EBI, HINXTON, UK Database accession no. AJ438599 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles funestus partial achE1 gene for acetylcholinesterase" XP002234933 extrait de EBI, HINXTON, UK Database accession no. AJ438604 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles arabiensis partial achE1 gene for acetylcholinesterase" XP002234934 extrait de EBI, HINXTON, UK Database accession no. AJ438603 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles sundaicus partial achE1 gene for acetylcholinesterase" XP002234932 extrait de EBI, HINXTON, UK Database accession no. AJ438600 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles pseudopunctipennis partial achE1 gene for acetylcholinesterase" XP002234936 extrait de EBI, HINXTON, UK Database accession no. AJ438605 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles moucheti partial achE1 gene for acetylcholinesterase" XP002234937 extrait de EBI, HINXTON, UK Database accession no. AJ438602 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "anopheles sachavori partial achE1 genefor acetylcholinesterase" XP002234939 extrait de EBI, HINXTON, UK Database accession no. AJ438606 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "anopheles stephensi partial achE1 gene for acetylcholinesterase" XP002234940 extrait de EBI, HINXTON , UK Database accession no. AJ438607 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "anopheles minimus partial achE1 gene for acetylcholinesterase" XP002234935 extrait de EBI, HINXTON, UK Database accession no. AJ438601 cité dans la demande
DATABASE EMBL [Online] 30 mai 2002 (2002-05-30), P.P. FORT: "Anopheles nili partial achE1 gene for acetylcholinesterase" XP002234941 extrait de EBI, HINXTON, UK Database accession no. AJ438609 cité dans la demande
MALCOLM C A ET AL: "A sex-linked Ace gene, not linked to insensitive acetylcholinesterase-mediated insecticide resistance in Culex pipiens." INSECT MOLECULAR BIOLOGY, vol. 7, no. 2, mai 1998 (1998-05), pages 107-120, XP002234923 ISSN: 0962-1075
BOURGUET DENIS ET AL: "Determination of Ace: 1. Genotypes in single mosquitoes: Toward an ecumenical biochemical test." PESTICIDE BIOCHEMISTRY AND PHYSIOLOGY, vol. 55, no. 2, 1996, pages 122-128, XP002234924 ISSN: 0048-3575
MUTERO ANNICK ET AL: "Resistance-associated point mutations in insecticide-insensitive acetylcholinesterase." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, vol. 91, no. 13, 1994, pages 5922-5926, XP002234925 1994 ISSN: 0027-8424 cité dans la demande
DATABASE EMBL [Online] 1 mars 2002 (2002-03-01), R.A. HOLT ET AL: "17000687086124 A. gam.ad.cDNA . blood1 Anopheles gambiae cDNA clone 19600449729584 5', mRNA sequence" XP002234942 extrait de EBI, HINXTON,UK Database accession no. BM608195
N. ANTHONY ET AL: "Cloning, sequencing and functional expression of an acetylcholinesterase gene from the yellow fever mosquito Aedes aegypti" FEBS LETTERS, vol. 368, 1995, pages 461-465, XP002234926
BOURGUET DENIS ET AL: "Analysis of molecular forms and pharmacological properties of acetylcholinesterase in several mosquito species." NEUROCHEMISTRY INTERNATIONAL, vol. 31, no. 1, 1997, pages 65-72, XP002234927 ISSN: 0197-0186
BOURGUET D ET AL: "EXISTENCE OF TWO ACETYLCHOLINESTERASES IN THE MOSQUITO CULEX PIPIENS (DIPTERA: CULICIDAE)" JOURNAL OF NEUROCHEMISTRY, NEW YORK, NY, US, vol. 67, no. 5, 1996, pages 2115-2123, XP008013364 ISSN: 0022-3042 cité dans la demande
S.B. WALSH ET AL: "Identification and characterization of mutations in housefly (Musca domestica) acetylcholinesterase involved in insecticide resistance" BIOCHEMICAL JOURNAL, vol. 359, 2001, pages 175-181, XP002234928 cité dans la demande
BOURGUET DENIS ET AL: "Duplication of the Ace.1 locus in Culex pipiens mosquitoes from the Caribbean." BIOCHEMICAL GENETICS, vol. 34, no. 9-10, 1996, pages 351-362, XP008015132 ISSN: 0006-2928
WEILL MYLENE ET AL: "A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and is non-homologous to the ace gene in Drosophila." PROCEEDINGS OF THE ROYAL SOCIETY BIOLOGICAL SCIENCES SERIES B, vol. 269, no. 1504, 7 octobre 2002 (2002-10-07), pages 2007-2016, XP008015105 ISSN: 0962-8452
DATABASE EMBL [Online] 17 mars 2003 (2003-03-17), M. WEILL ET AL: "Culex pipiens mRNA for acetylcholinesterase (achE1 gene), strain SR" XP002248010 extrait de EBI, HINXTON, UK Database accession no. AJ515147 -& M. WEILL ET AL: "comparative genomics Insecticide resistance in mosquito vectors" NATURE, vol. 423, 8 mai 2003 (2003-05-08), pages 136-137, XP0002269568
DATABASE EMBL [Online] 16 août 2002 (2002-08-16), FAI LI ET AL: "Aphis gossipii clone ace 2 acetylcholinesterase mRNA, complete cds" XP002248004 extrait de EBI, HINXTON, UK Database accession no. AF502082 -& FAI LI ET AL: "Two different genes encoding acetylcholinesterase existing in cotton aphid" GENOME, vol. 45, no. 6, 1 novembre 2002 (2002-11-01), pages 1134-1141, XP008013411
DATABASE EMBL [Online] 7 novembre 2002 (2002-11-07), P.P. FORT: "Anopheles gambiae partial achE1 gene for acetylcholinesterase, exons 4-9" XP002234943 extrait de EBI, HINXTON, UK Database accession no. AJ488492
DATABASE EMBL [Online] 15 août 2002 (2002-08-15), P.P. FORT: "Culex pipiens partial achE1 gene for acetylcholinesterase, strain S-LAB" XP002234945 extrait de EBI, HINXTON, UK Database accession no. AJ428047
DATABASE EMBL [Online] 15 août 2002 (2002-08-15), P.P. FORT: "aedes aegypti partial achE1 gene for acetylcholiesterase" XP002234946 extrait de EBI, HINXTON, UK Database accession no. AJ428049
DATABASE EMBL [Online] 15 août 2002 (2002-08-15), P.P. FORT: "Culex pipiens partial achE1 gene for acetylcholinesterase, strain SR" XP002234947 extrait de EBI, HINXTON, UK Database accession no. AJ428048
Attorney, Agent or Firm:
Cabinet, Ores (36 rue de St Pétersbourg, Paris, Paris, F-75008, FR)
Download PDF:
Claims:
REVENDICATIONS
1. 1 °) Acétylcholinestérase d'insecte, caractérisée en ce qu'elle comprend une région catalytique centrale qui présente une séquence en acides aminés sélectionnée dans le groupe constitué par la séquence SEQ ID NO : 1 et les séquences présentant au moins 60 % d'identité ou 70 % de similarité avec la séquence SEQ ID NO : 1, à l'exclusion de l'acétylcholinestérase de séquence NCBI AAK0973. 2°) Acétylcholinestérase d'insecte selon la revendication 1, caractéri sée en ce qu'elle inclut une mutation de la glycine située en position 119, en sérine, en référence à la séquence de l'acétylcholinestérase de Torpedo californica (SWISSPROT P04058). 3°) Acétylcholinestérase selon la revendication 1 ou la revendication 2, caractérisée en ce qu'elle correspond à celle d'un insecte de la famille des Culicidae, choisi parmi les genres Culex, Aedes et Anopheles. 4°) Acétylcholinestérase selon la revendication 3, caractérisée en ce qu'elle est sensible aux insecticides de la classe des organophosphorés et des carba mates et en ce qu'elle présente une séquence sélectionnée dans le groupe constitué par : les séquences SEQ ID NO : 3, SEQ ID NO : 5, SEQ ID NO : 126 d'Anopheles gambiae, la séquence SEQ ID NO : 7 de Culex pipiens (souche SLAB), et les séquences comprenant une région catalytique centrale telle que définie à la revendication 1, lesquelles séquences présentent une glycine en position 119, en réfé rence à la séquence de l'acétylcholinestérase de Torpedo californica (SWISSPROT P04058), incluse dans un fragment de séquence SEQ ID NO : 91,92, 96,102 à 112, 114, 115 et 117 à 119. 5°) Acétylcholinestérase selon la revendication 3, caractérisée en ce que ladite région catalytique centrale comprend une séquence sélectionnée dans le groupe constitué par les séquences SEQ ID NO : 8 à 21.
2. 6°) Acétylcholinestérase selon la revendication.
3. ou la revendication 3, caractérisée en ce qu'elle est résistante aux insecticides et en ce qu'elle présente une séquence sélectionnée dans le groupe constitué par les séquences SEQ ID NO : 57, SEQ ID NO : 12.
4. et les séquences comprenant un fragment de séquence SEQ ID NO : 90,93, 94,95, 97 à 101, 11.
5. t 116 représentant un fragment peptidique d'environ 150 acides aminés codé par le troisième exon codant du gène ace1 d'un insecte résistant tel que défini cidessus, contenant la substitution de type G119S, en référence à la séquence de l'AChE de Torpedo californica (SWISSPROT P04058). 7°) Acétylcholinestérase selon la revendication 3, caractérisée en ce que ladite région catalytique centrale comprend une séquence sélectionnée dans le groupe constitué par les séquences SEQ ID NO : 90,93, 94,95, 97 à 101, 113 et 116. 8°) Peptide, caractérisé en ce qu'il est constitué par un fragment d'au moins 7 acides aminés de l'acétylcholinestérase selon l'une quelconque des revendica tions 1 à 7. 9°) Molécule d'acide nucléique isolée, caractérisée en ce qu'elle présente une séquence sélectionnée dans le groupe constitué par : les séquences codant pour une acétylcholinestérase selon l'une quelconque des revendications 1 à 7 (ADNc et fragment d'ADN génomique corres pondant au gène ace1), les séquences complémentaires des séquences précédentes, sens ou antisens, et les fragments d'au moins 8 pb, de préférence de 15 pb à 500 pb des séquences précédentes. 10°) Molécule d'acide nucléique selon la revendication 9, caractéri sée en ce qu'elle est sélectionnée dans le groupe constitué par : a) les séquences SEQ ID NO : 2, SEQ ID NO : 4, SEQ ID NO : 125, SEQ ID NO : 6, SEQ ID NO : 56 et SEQ ID NO : 121 qui correspondent à l'ADNc de la protéine AChEl de séquence en acides aminés, respectivement SEQ ID NO : 3, SEQ ID NO : 5, SEQ ID NO : 126, SEQ ID NO : 7, SEQ ID NO : 57 et SEQ ID NO : 122, telles que définie cidessus, b) les séquences SEQ ID NO : 22, SEQ ID NO : 23 et SEQ ID NO : 127 qui correspondent au gène ace1 d'Anopheles gambiae codant les AChE1 telles que définies à la revendication 4, et c) les séquences comprenant la séquence SEQ ID NO : 120 qui correspond à la séquence quasicomplète du gène ace1 d'Anopheles gambiae codant l'AChE1 résistante de séquence SEQ ID NO : 122, telle que définie à la revendication 5. 11°) Molécule d'acide nucléique selon la revendication 9, caractéri sée en ce qu'elle est sélectionnée dans le groupe constitué par les amorces de séquence SEQ ID NO : 39 à 50,54, 55,58, 59,123, 124,128 et 129 et les fragments de séquences SEQ ID NO : 24 à 38 et 60 à 89. 12°) Méthode de détection d'insectes porteurs d'une résistance aux insecticides de la classe des organophosphorés et des carbamates, caractérisée en ce qu'elle comprend : la préparation d'un échantillon d'acides nucléiques à partir d'insec tes à tester, et la détection par tout moyen approprié, de la présence dans ledit échantillon d'acides nucléiques, d'une mutation dans le gène ace1 tel que défini à la revendication 9 ou à la revendication 10. 13°) Méthode selon la revendication 12, caractérisée en ce que ladite détection comprend : l'amplification d'un fragment d'environ 320 pb à l'aide du couple d'amorces SEQ ID NO : 39 et 40, la digestion dudit fragment à l'aide d'une enzyme de restriction appropriée, et l'analyse du profil de restriction obtenu. 14°) Méthode selon la revendication 13, caractérisée en ce que ladite enzyme de restriction est EcoRI. 15°) Méthode selon la revendication 12, caractérisée en ce que ladite détection comprend : l'amplification d'un fragment d'environ 520 pb à l'aide du couple d'amorces SEQ ID NO : 58 et 59, la digestion dudit fragment à l'aide d'une enzyme de restriction appropriée, et l'analyse du profil de restriction obtenu. 16°) Méthode selon la revendication 12, caractérisée en ce que ladite détection comprend : l'amplification d'un fragment d'environ 541 pb à l'aide du couple d'amorces SEQ ID NO : 123 et 124, la digestion dudit fragment à l'aide d'une enzyme de restriction appropriée, et l'analyse du profil de restriction obtenu. 17°) Méthode selon la revendication 12, caractérisée en ce que ladite détection comprend : l'amplification d'un fragment d'environ 194 pb à l'aide du couple d'amorces SEQ ID NO : 128 et 129, la digestion dudit fragment à l'aide d'une enzyme de restriction appropriée, et l'analyse du profil de restriction obtenu. 18°) Méthode selon l'une quelconque des revendications 15 à 17, caractérisée en ce que ladite enzyme de restriction est Alu I. 19°) Vecteur recombinant, caractérisé en ce qu'il comprend un insert sélectionné dans le groupe constitué par les molécules d'acides nucléiques selon l'une quelconque des revendications 9 à 11. 20°) Cellules, caractérisées en ce qu'elles sont modifiées par un vecteur recombinant selon la revendication 19. 21°) Anticorps, caractérisés en ce qu'ils sont dirigés contre l'acétyl cholinestérase selon l'une quelconque des revendications 1 à 7 ou le peptide selon la revendication 8. 22°) Réactif de détection d'insectes porteurs d'une résistance aux insecticides de la classe des organophosphorés et des carbamates, caractérisé en ce qu'il est sélectionné dans le groupe constitué par les molécules d'acides nucléiques et leurs fragments selon l'une quelconque des revendications 9 à 11 et les anticorps selon la revendication 21. 23°) Animal invertébré transgénique, caractérisé en ce qu'il contient des cellules transformées par au moins une molécule d'acide nucléique selon la reven dication 9 ou la revendication 10. 24°) Méthode de criblage d'une substance insecticide, caractérisée en ce qu'elle comprend : a) la mise en contact de la substance à tester avec une acétyl cholinestérase selon l'une quelconque des revendications 1 à 7, un extrait de cellules modifiées telles que définies à la revendication 20 ou un échantillon biologique d'un animal transgénique tel que défini à la revendication 23, en présence d'acétylcholine ou de l'un de ses dérivés, b) la mesure par tout moyen approprié, de l'activité acétylcholinesté rase du mélange obtenu en a), et c) la sélection des substances capables d'inhiber ladite activité. 25°) Méthode de criblage de substances insecticides, caractérisée en ce qu'elle comprend : la mise en contact d'une substance à tester avec un animal transgé nique selon la revendication 23, et la mesure de la survie de l'animal. 26°) Réactif de criblage de substances insecticides, caractérisé en ce qu'il est sélectionné dans le groupe constitué par les acétylcholinestérases selon l'une quelconque des revendications 1 à 7, les vecteurs recombinants selon la revendication 18, les cellules modifiées selon la revendication 20 et les animaux transgéniques selon la revendication 23. 27°) Trousse de détection et/ou de criblage, caractérisée en ce qu'elle inclut au moins un réactif selon la revendication 22 ou la revendication 26.
6. 28°) Méthode de criblage d'inhibiteurs d'une AChEl selon l'une quelconque des revendications 1 à 7, caractérisée en ce qu'elle comprend : (a) l'identification de molécules présentant une probabilité de liaison significative à ladite AChEl ; (b) l'isolement des inhibiteurs potentiels identifiés à l'étape (a) ; (c) la mise en contact de la substance isolée à l'étape (b) avec une AChE1 selon l'une quelconque des revendications 1 à 7, un extrait de cellules modi fiées tel que défini à la revendication 20, un échantillon biologique d'un animal transgénique tel que défini à la revendication 23 ou un extrait d'insecte sensible ou résistant aux insecticides de la classe des organophosphorés et des carbamates, en présence d'acétylcholine ou de l'un de ses dérivés ; (d) la mesure par tout moyen approprié, de l'activité acétyl cholinestérase du mélange obtenu en (c) ; et (e) la vérification que les molécules isolées en (b) inhibent l'activité AChE1. 67 94 cel 070 84 _ V VW J"I Y'' V L VLtNT : I1TP NS IVDTV"y''YI Agami pSvVNDKËRIRëlTVDAPSKKDVNLpIYQPSvGPLRHRAEKMTG VNTTPNSavI _ Sgra pPLIIHTtNKg ; KIg4ITQTATTßKLMDAWLg YAKKPIGDk RHaRY, IDRW'. DTTTPETINCTPt, NTgVgIFDTLtGDWPM, ATM M WSPV W. YI ce2 Agam2 tiR) YV IR'ST Ev NPVPF KP, VDS, 0,, K P , AE I G V, L §Pstii, ; lz Aste R, V T's G I ST GE N, VI ? F, KPLAYDSiFK VAEG VL TE"PS'I , A YL : ,,, _ wr rs 'IRV s I ST E N6V. FAKP, VDG't ; p a Dmel 91RhVVS Vß SVT = EV TGI ! f8K2PVED5, RE SnAE 5j kG V ; St JATCV u FwS w Ig wffi YI , A EG V s Dmel 11RLV TS Vi ; v SVT El TI£ ? YTKPPVEDI, ÎtË) AE G VL m SATÉV S Iÿ. 1 YI Lcup ijRiI T : T ViVT 'E1 V TGIpYAKP :'pVDDi. RL ; F ÏAE W G Vy FATV I= S IIIQP V _YM ,,,, ;. ,. ,.. :"_,", Mdom 1HT TT Ca ,., SVT .' DV VTIYjKP ? VDDIRk' 1/PAE , G V7 TR PATVw tS"IW1',, 4 g1. FM Cp p2 ! A.' WIiNV, , iYL 114 121 130 |Acel| O Agami NVVA'ëRPRPK AAVMLF66YSTAQVDHRALASEEIVVSLp Sgra VK PRPC AAVMVFg6YSSAIXDPKILVSEEILVgM, B " c2 Agam2 Ni VM T E L SNDYFQDD DFQRQ EQSK t i A VWi G, tw 58TS, T. LD, IÆ EILAAIX : §M W M@ X LYL YING V V J f Aste j ; VgT T L F SNDYFQDDDFQRQ QSK Wl GûG SGTSIf) 1I EILA NI, MQR LYL YING t4, AIE Aaeg2 I T L NNDYFQD DFQR QSK w ST S vEML I l ; EHPNGKQ TDHLI I I Tsawil DIMA I F""GV., LHL EMPS v lyv E Lcup lA, I Et AE = G EHSS K PDHLI SATPQNTTh lPI Ijff, TS, sAiTwIì2|3DIys>s 0gF » LHLS MPG Mdom Mr t AE lu G EHSS KT QDHLI SATPQNTTh 33PI Iß. T4SAwIs3EIMSAg>I t4F ; <igl, LHLS MPG Cpip2 IP,, T T L NNDYFQDDDFQRQMQS s D, V' !'l EILA1 3 EYLS YLNG F2001 233 254 cel Agami TPEAPëA9 ; LFPQNLLRVRDIHRG ! DSRV (AëAVSSLHLL 9 A Z1, ; _ t :, Sgra TEDVPSNALFDQLMALQM. VHEIKLENMNv !) $E'SRgAVBSLHLL'g |Ace21 Agam2YEEDAPGNMD DQAL, Ro E rD, D L $VSLHLLIP LSK I LQPQ L P, TA ALQIAEGLI LTM AsteYEEDAPIÎMG i7¢AL E" K FtjGDPDLI FG>âSAGG SFSLHLL ; ; PV I ; SK ILQ, L 1 ?, TA ALQIAEGÏiI LTM a Aaeg2 DDDADP'R,, E F, OQDLIDLITLi ?, GE8, AG,' 9... Dme I EFAEEAP6"L 1) R D 3GNiEWt46, as N A Q L M,. F, PLVK 4Q, LcupFEEEAP. GiVG C3ÇAL RW E . GGNï ? ENIMTLFGESAGS SVNAQLASP LVK MMQSG P APTS AVEIGKAT ; IN = SL GN ? EW VNAQLMI. F,, P VK MMQIS AP."TS, VEIGKA ! V ASL Cpip2 REEEAPG,. D SLHLL. P LSE ILQ9 L .. _. 1265 279 288 290 1330 331 334 cel o Agami SKLSDAVEpLRGKDPHVLVNNENGTLGCEFVFVVALDETBQRSLASGRFKKTE. rLTS : SNTEBY Sgca NTIHKTVECLR'KANSSVMVEKEDHVASCFvëvvBALDDHSQKSLSTMNFKKTNI ; LMSSNSEEYYSIFYLTELFKBEEMVMVSgENFIKA ce2. Agam2 KESST QG = D I G, F D". VFMT n MLRENLEGIDILVGSN E FD D S Y n. x3 x Aste KES ST D I G DQVV, MT, MLRE NLEGIDiLVdSN E,,'f I FE"'sF r Aaeg2 KDN N D G'baVFMT MLRE NLEGVELVOSN Dmel KTN'AH S f ? , S D É k ? 17GAiL LMKT DLKDYD. LM< ;, NV E ;' FE S E Lcup PAN QS A i'D r Z : p DGAL n LMKTDMSGYDMIGNVK E ; m EDD Y Mdom PEN Q AC n D S£"la 17GAFLP n LLKT DLSGYDLLIGNV E _y FDE S YL Cpip2KS GS H'G di ; v'M DILV SN E PdirAGSG/ fragmernt. j£ 402 432440 442 T0 Agami VRELNPYVNGAARQIjVFEDKTEPDNPNSNRDALDKMsSYHTgNVFQRYAEESNNYMïLYTHRSKGNPPRT ! g ,. E a. >. Q . ^,.., a . _. , Sgra IGQLNPNADAAVKSEFEYDFSPNDPEKtmNALDKMyEDYQT. qNVNFHKYALTGNNVYMÏYF. KHR g.., _.. M ,..,, . Cpipi'"lEPDNPNSRDALDKMGBYHFTqMVSSFMRYAEESNNVFMÏLYTHpSKGNPPRmSGO Aaegi aeg (ûRDALDKMVGdYHFTNVIEFQRYAEEGNNVYMYLYTlFtSKGNPGPRWTC"ÎNHGp>tIN1'UETLSD |jAce2| 'u v v e 'my _ Agam2 T N SEP I F, TGVI S N H FIic FALG TE SVIH . YFT, " ffr ; 62, m Aste T NvASEP I YTGW S N H VG E ! Iy FIiLG TEG SVH YYFTH, GV HfiD YIF i Y, v v LvC1, W W i v k v Dmel G TQ Z XFSNP i I G'FTÇ PIEYÏïQ AE SEFH YYF'I'H Gi $, rçBFSI YFF 'LN Lcup N N ATQA"Z YTSNP W N VGFJ) TÇ i1EY21 ; QA AE w'QVH YFTiiR G< HCDÈI YFF LÎÿT Mdom N ASQ"Î FYTSNP yQvi 'kTÇ NÉYF1QAAE"Si'H YYFTftRYiç, l HGDI tFF ; HLNDI PrevAGSG 521 521 ce1 Agaml LGYTEDÉKDFSRKIMRYWSNFAKTI : iNPtNPNTASSEFPEWËKHTAHGRHYLELG LNTSFVGRGPRLRQ£AIWKKYLPiQLVAA Sgra KREIEEIELSKKMMRYNTNE'KTSN. SKTLEGSNVTPKKPVHTAYGKEFLTLD TNNTSIGveëRLEQCAFKKNYVDLTAI Cpipl LGÏQDDËKDFSRKI Aaegl LGYMEDBKDFSRKI ce2 Agam2 L1QRÉDLSRMVLS S FÀRTGN LE E HWPLYTR NIYFI PJAEGEDLRG YGRGP TSÇAF FLPRL As te L X QR. E' DLS MV LS S FARTGIsTP LE E HWFLYTR PI I FEI PdAEGE D LRG YGRGPC TSAF FL ? RL Aaeg2 H QRE DLS IVLS S FARSGNP LE E H4PIVYT N IYFI IAEGED LRG YGR6 TACA'F.,, FL,', RL Dme L 1PVE ELG'MLS I FAKTGNP QD E EWP. NFSK DVYYI ST DKI LARGPL ARCS'YLP, : K S Lcup LYAVEELG MLPdS I FAKTGNP VD E E15TE'PIFSK D VYYV ST EKT LQRPL KR_ÇSF YLÏ ? KV S Mdom L Y PV, ELGK LNS I FPxKSFIp E EÇEJPNFSK D YYV ST EKI LQRGPL KRÇSF YLPKV SS FIGURE 1 A 1 80 Ae alb TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPLNSDLGY Ae aeg TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPLDLGY An alb TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPLNtLGY An gam TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPLN » LGY An fun TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPL a LGY An nil TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEP < LGY An sac TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPL GY An pse TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV YMYLYTHRSK GNPWPRWTGV MHGDEINYVF GEPL GLGY Cx Pip TEPDNPNSNR DALDKMVGDY HFTCNVNEFA QRYAEEGNNV MYLYTHRSK GNPWPRWTGV MHGDEINYVF GEP GY 81 91 Ae alb SDEKDFSRK I Ae aeg gSDEKDFSRK I An alb TfDEKdFSRK I An gam TËDEKDFSRK 1 An fun T An nil T0DEKDFSRK R An sac Tr DEKDFSRK I An pse TÉDEKDFSRK I Cx Pip QDDEKDFSRK I B 20 40 * 60 80 AcelSLAB ATEGAACCGGACAACCCGAACAGCAACCGTGACGCGCTGGACAAGATGGTCGGGGATTATCACTTCACCTGCAACGTGAA AcelSR ATEGAACCGGACAACCCGAACAGCAACCGTGACGCGCTCGACAAGATGGTCGGGGATTATCACTTCACCTGCAACGTGAA EcoRI * 100 120 140 160 AcelSLAB CGASTTCGCCCAGCGGTACGCCGAGGAGGGCAACAACGTGTTCATGTACCTGTACACGCACAGAAGCAAAGGAAATCCCT AcelSR CG TCGCCCAGCGGTACGCCGAGGAGGGCAACAATGTGTTCATGTACCTGTACACGCACAGAAGCAAAGGAAATCCCT * 180 200 220 240 AcelSLAB GGCCGAGGTGGACIGGCGTGATGCACGGCGACGAGATCAACTACGTGTTTGGCGAACCGCTGAACTCGGCCCTCGGCTAC AcelSR GGCCGAGGTGGA GTGATGCACGGCGACGAGATCAACTACGTGTTTGGCGAACCGCTGAACTCGGCCCTCGGCTAC 260 * AcelSLAB CAGGACGACGAGAAGGACTTTAGCCGGAAAATT AcelSR CAGGACGACGAGAAGGACTTTAGCCGGAAAATT SLAB SR Croisement en retour ___320 bp 214 bp 106bp 106bp FIGURE 2 FIGURE 3 1 80 SR MEIRGLITRL LGPCHLRHLI LCSLGLYSIL VQSVHCRHHD IGSSVAHQLG SKYSQSSSLS SSSQSSSSLA EEATLNKDSD SLAB MEIRGLITRL LGPCHLRHLI LCSLGLYSIL VQSVHCRHHD IGSSVAHQLG SKYSQSSSLS SSSQSSSSLA EEATLNKDSD 81 160 SR AFFTPYIGHG DSVRIVDAEL GTLEREHIHS TTTRRRGLTR RESSSDATDS DPLVITTDKG KIRGTTLEAP SGKKVDAWMG SLAB AFFTPYIGHG DSVRIVDAEL GTLEREHIHS TTTRRRGLTR RESSSDATDS DPLVITTDKG KIRGTTLEAP SGKKVDAWMG 161 240 SR IPYAQPPLGP LRFRHPRPAE RWTGVLNATK PPNSCVQIVD TVFGDFPGAT MWNPNTPLSE DCLYINVVVP RPRPKNAAVM SLAB IPYAQPPLGP LRFRHPRPAE RWTGVLNATK PPNSCVQIVD TVFGDFPGAT MWNPNTPLSE DCLYINVVVP RPRPKNAAVM 241 320 SR LWIFGGS, FYS GTATLDVYDH RTLASEENVI WSLQYRVAS LGFLFLGTPE APGNAGLFDQ NLALRWVRDN IHRFGGDPSR SLAB LWIFGGGFYS GTATLDVYDH RTLASEENVI VVSLQYRVAS LGFLFLGTPE APGNAGLFDQ NLALRWVRDN IHRFGGDPSR 321 400 SR VTLFGESAGA VSVSLHLLSA LSRDLFQRAI LQSGSPTAPW ALVSREEATL RALRLAEAVN CPHDATKLSD AVECLRTKDP SLAB VTLFGESAGA VSVSLHLLSA LSRDLFQRAI LQSGSPTAPW ALVSREEATL RALRLAEAVN CPHDATKLSD AVECLRTKDP 401 480 SR NELVDNEWGT LGICEFPFVP VVDGAFLDET PQRSLASGRF KKTDILTGSN TEEGYYFIIY YLTELLRKEE GVTVTREEFL SLAB NELVDNEWGT LGICEFPFVP VVDGAFLDET PQRSLASGRF KKTDILTGSN TEEGYYFIIY YLTELLRKEE GVTVTREEFL 481 560 SR QAVRELNPYV NGAARQAIVF EYTDWIEPDN PNSNRDALDK MVGDYHFTCN VNEFAQRYAE EGNNVFMYLY THRSKGNPWP SLAB QAVRELNPYV NGAARQAIVF EYTDWIEPDN PNSNRDALDK MVGDYHFTCN VNEFAQRYAE EGNNVFMYLY THRSKGNPWP 561 640 SR RWTGVMHGDE INYVFGEPLN SALGYQDDEK DFSRKIMRYW SNFAKTGNPN PSTPSVDLPE WPKHTAHGRH YLELGLNTTF SLAB RWTGVMHGDE INYVFGEPLN SALGYQDDEK DFSRKIMRYW SNFAKTGNPN PSTPSVDLPE WPKHTAHGRH YLELGLNTTF 641 702 SR VGRGPRLRQC AFWKKYLPQL VAATSNLQVT PAPSVPCESS STSYRSTLLL IVTLLLVTRF KI SLAB VGRGPRLRQC AFWKKYLPQL VAATSNLQVT PAPSVPCESS STSYRSTLLL IVTLLLVTRF KI Figure 5 1 80 M E I R G L I T R L L G P C H L R H L I L C S L G L Y SLab ATGGAGATCCGAGGCCTAATAACCCGATTACTGGGTCCATGTCACCTGCGACATCTGATACTGTGCAGTTTGGGGCTGTA SR . 160 S I L V Q S V H C R H H D I G S S V A H Q L G S K Y S SLAB CTCCATCCTCGTGCAGTCGGTCCATTGCCGGCATCATGACATCGGTAGTTCGGTGGCACACCAGCTAGGATCGAAATACT SR 240 Q S 5 S L S 5 S S Q S S S S L A E E A T L N K D S D SLAB CACAATCATCCTCGTTATCGTCATCCTCGCAATCGTCATCGTCGTTAGCTGAAGAGGCCACGCTGAATAAAGATTCAGAT 320 320 A F F T P Y I G H G D S V R I V D A E L G T L E R E H SLAB GCATTTTTTACACCATATATAGGTCACGGAGATTCTGTTCGAATTGTAGATGCCGAATTAGGTACATTAGAGCGCGAGCA SR 400 I H S T T T R R R G L T R R E S S S D A T D S D P L V SLAB TATCCATAGCACTACGACCCGGCGGCGTGGCCTGACCCGGAGGGAGTCCAGCTCCGATGCCACCGACTCGGACCCACTGG SR Amorce Ex3dir 480 I T T D K G K I R G T T L E A P S G K K V D A W M G SLAB tiCATAACGACGGACAAGGGCAAAATCCGTGGAACGACACTGGAAGCGCCTAGTGGAAAGAAGGTGGACGCATGGATGGGC .., : SRA_ A 560 I P Y A Q P P L G P L R F R H P R P A E R W T G V L N SLAB ATTCCGTACGCGCAGCCCCCGCTGGGTCCGCTCCGGTTTCGACATCCGCGACCCGCCGAAAGATGGACCGGTGTGCTGAA SR 640 A T K P P N S C V Q I V D T V F G D F P G A T M W N P SLAB CGCGACCAAACCGCCCAACTCCTGCGTCCAGATCGTGGACACCGTGTTCGGTGACTTCCCGGGGGCCACCATGTGGAACC 720 '720 N T P L S E D C L Y I N V V V P R P R P K N A A V M SLAB CGAACACACCGCTCTCGGAGGACTGTCTGTACATCAACGTGGTCGTGCCACGGCCCAGGCCCAAGAATGCCGCCGTCATG SR C A G T 800 L W I F G G G F Y S G T A T L D V Y D H R T L A S E E SLAB CTGTGGATCTTCGGGGGT m TCTACTCCGGGACTGCCACGCTGGACGTGTACGACCATCGGACGCTGGCCTCGGAGGA SR T W T T Si 880 N V I V V S L Q Y R V A S L G F L F L G T P E A P G N SLAB GAACGTGATCGTAGTTTCGCTGCAGTACCGTGTCGCAAGTCTTGGGTTTCTCTTCCTGGGCACACCGGAGGCACCCGGTA SR G T T T 960 A G L F D Q N L A L R W V R D N I H R F G G D P S R SLAB ACGCGGGGCTGTTTGATCAGAACCTGGCACTGAGATGGGTCCGCGACAACATCCACCGGTTCGGCGGTGACCCCTCGCGG SR~~ ~~~~~~ ~~~~ ~~~~~~ ~ ~~ ~~~~~ ~~ ~~ ~~ ~ ~~~~ Amorce Ex3rev 1040 V T L F G E S A G A V S V S L H L L S A L S R D L F Q SLAB GTCACACTGTTCGGCGAGAGCGCCGGAGCGGTCTCGGTTTCGCTGCACCTGCTGTCGGCGCTCTCGCGGGACCTGTTCCA SR Figure 6A 1120 R A I L Q S G S P T A P W A L V S R E E A T L R A L R SLAB GCGGGCCATCCTCCAGAGTGGCTCCCCGACGGCCCCGTGGGCGCTGGTTTCGCGCGAAGAAGCTACGCTTAGAGCTCTTC LAEAVNCPHDATKLSDAVECLRTKDP 1200 L A E A V N C P H D A T K L S D A V E C L R T K D P SLAB GTCTGGCCGAGGCCGTCAACTGTCCGCACGATGCGACCAAGCTGAGCGATGCCGTCGAATGCCTGCGAACCAAGGATCCG SR T 1280 N E L V D N E W G T L G I C E F P F V P V V D G A F L SLAB AACGAGCTGGTCGACAACGAGTGGGGCACGCTGGGGATCTGCGAGTTTCCGTTCGTTCCGGTTGTGGACGGAGCCTTCCT 1360 1360 D E T P Q R S L A S G R F K K T D I L T G S N T E E G SLAB CGATGAGACACCGCAGCGTTCGTTGGCCAGCGGGCGCTTCAAGAAAACGGACATCCTGACCGGCAGCAACACCGAGGAGG YYFIIYYLTELLRKEEGVTVTREEFL 1440 Y Y F I I Y Y L T E L L R K E E G V T V T R E E F L SLAB GTTACTACTTTATCATTTACTATCTAACCGAACTGCTCAGGAAAGAGGAAGGGGTCACGGTAACACGCGAGGAGTTCCTA QAVRELNPYVNGAARQAIVFEYTDWIE 1520 Q A V R E L N P Y V N G A A R Q A I V F E Y T D W I E SLAB CAGGCCGTCCGGGAGTTGAATCCGTACGTGAACGGTGCCGCCCGGCAGGCCATCGTGTTCGAGTACACGGACTGGATTGA SR C 1600 P D N P N S N R D A L D K M V G D Y H F T C N V N E F SLAB ACCGGACAACCCGAACAGCAACCGTGACGCGCTGGACAAGATGGTCGGGGATTATCACTTCACCTGCAACGTGAACGAAT SR C ____________________G 1680 A Q R Y A E E G N N V F M Y L Y T H R S K G N P W P SLAB TCGCCCAGCGGTACGCCGAGGAGGGCAACAACGTGTTCATGTACCTGTACACGCACAGAAGCAAAGGAAATCCCTGGCCG RNTGVMHGDEINYVFGEPLNSALGYQD 1760 R W T G V M H G D E I N Y V F G E P L N S A L G Y Q D SLAB AGGTGGACCGGCGTGATGCACGGCGACGAGATCAACTACGTGTTTGGCGAACCGCTGAACTCGGCCCTCGGCTACCAGGA DEKDFSRKIMRYNSNFAKTGNPNPSTP 1840 D E K D F S R K I M R Y W S N F A K T G N P N P S T P SLAB CGACGAGAAGGACTTTAGCCGGAAAATTATGCGATACTGGTCCAACTTTGCCAAGACTGGCAATCCCAACCCGAGTACGC SR A 1920 S V D L P E W P K H T A H G R H Y L E L G L N T T F SLAB CGAGCGTGGACCTGCCCGAATGGCCCAAGCACACCGCCCACGGACGACACTATCTGGAGCTGGGACTGAACACGACCTTC 2000 2000 V G R G P R L R Q C A F W K K Y L P Q L V A A T S N L SLAB GTGGGACGGGGCCCACGATTGCGGCAGTGCGCTTTCTGGAAGAAATATTTGCCGCAACTAGTAGCAGCTACCTCTAACCT SR 2080 Q V T P A P S V P C E S S S T S Y R S T L L L I V T L SLAB CCAAGTAACTCCCGCGCCTAGCGTACCTTGCGAAAGCAGCTCAACATCTTATCGATCCACTCTACTTCTAATAGTCACAC SR 2109 L L V T R F K I * SLAB TACTTTTAGTAACGCGGTTCAAGATTTAA SR Figure 6B Figure 7 Figure 8 1 80 KISUMU GAATGCGCATTGTTGCGATAGATTGAATTTCCTTGGTTGTTGTTGTTGTTGGTTTTCTTTTGACATGTTTGTGTGTTGTT YAO 160 A F F T P Y I G H G E S KISUMU TTTTCTTTCTCTCTCTCTCTCT CTGTGGTTCCAACATTTCAGACGCATTTTTTACACCATATATAGGTCACGGTGAGT YAO ______________________TT________________________________________________________ 240 g R I I D A E L G T L E H V H S G A T P R R R G L T KI S UMU CCECGAATTATAGATGCCGAGTTGGGCACGCTCGAGCATGTCCACAGTGGAGCAACGCCGCGGCGACGCGGTCTGACG YAO _______________ A_____________ A 320 R R E S N S D KISUMU AGGCGCGAGTCCAACTCGGGTAAGTACGCGATTGGAAGTGGGGGGACGTTTACCCTGCCGTGTACTACAATGCACTTTAC YAO A A C 400 A N D N D P L V V N T D K G R I R G I KISUMU CCCCACGCACACGCACCGGCAGACGCGAACGACAACGATCCGCTGGTGGTCAACACGGATAAGGGGCGCATCCGCGGCAT YAO 480 T V D A P S G K K V D V W L G I P Y A Q P P V G P L R KISUMU TACGGTCGATGCGCCCAGCGGCAAGAAGGTGGACGTGTGGCTCGGCATTCCCTACGCCCAGCCGCCGGTCGGGCCGTTAC YAO C C 560 FRHPRPAEKWTGVLNTTTPPNSCVQI KISUMU GGTTCCGTCATCCGCGGCCGGCCGAAAAGTGGACCGGCGTGCTGAACACGACCACACCGCCCAACAGCTGCGTGCAGATC YAO Amorce Ex3AGdir 640 V D T V F G D F P G A T M W N P N T P L S E D C L Y I KISUMU GTGGACACCGTGTTCGGCGACTTCCCGGGCGCGACCATGTGGAACCCGAACACGCCCCTGTCCGAGGACTGTCTGTACAT YAO Amorce Ex3AGdir 720 N V V A P R P R P K N A A V M L W I F G G G F Y S G T KISUMU TAACGTGGTGGCACCGCGACCCCGGCCCAAGAATGCGGCCGTCATGCTGTGGATCTTCGGCGGCGGCTTCTACTCCGGCA YAO G A 'S 800 A T L D V Y D H R A L A S E E N V I V V S L Q Y R V KISUMU CCGCCACCCTGGACGTGTACGACCACCGGGCGCTTGCGTCGGAGGAGAACGTGATCGTGGTGTCGCTGCAGTACCGCGTG YAO 880 A S L G F L F L G T P E A P G N A G L F D Q N L A L R KISUMU GCCAGTCTGGGCTTCCTGTTTCTCGGCACCCCGGAAGCGCCGGGCAATGCGGGACTGTTCGATCAGAACCTTGCGCTACG YAO 960 KISUMU GTAGGTGTCTTTGCATGGGTGAATGAGGGTATAGTATTCTAACGAGGTGCTCTTCTTCCCATCACTTCTTGGGAGTCAGC 1040 1040 W V R D N I H R F G G D P S R V T L F G E S A G A V S KISUMU TGGGTGCGGGACAACATTCACCGGTTCGGTGGTGATCCGTCGCGTGTGACACTGTTCGGCGAGAGTGCCGGTGCCGTCTC YAO 1120 V S L H L L S A L S R D L F Q R A I L Q S G S P T A P KISUMU GGTGTCGCTGCATCTGCTGTCCGCCCTGTCCCGCGATCTGTTCCAGCGGGCCATCCTGCAGAGCGGCTCGCCGACGGCAC YAO T Amorce Ex3AGrev 1200 W A L V S R E E A T L R KISUMU CGTGGGCATTGGTATCGCGCGAGGAAGCCACGCTAAGGTACGTGCCAGCTGCTGCTTTCCCCAAACCACCAACCCGCGAC YAO A Figure 9A 1280 A L R L A E A V G C P H KISUMU AGCTCACACAACCCTCTTTTCCTTCGCTCTTTTCTCGCTCCAGAGCACTGCGGTTGGCCGAGGCGGTCGGCTGCCCGCAC YAO G 1360 E P S K L S D A V E C L R G K D P H v L V N N E W G T KISUMU GAACCGAGCAAGCTGAGCGATGCGGTCGAGTGTCTGCGCGGCAAGGATCCGCACGTGCTGGTCAACAACGAGTGGGGCAC YAO ______________ 1440 L G I C E F P F V P V V D G A F L D E T P Q R S L A S KISUMU GCTCGGCATTTGCGAGTTCCCGTTCGTGCCGGTGGTCGACGGTGCGTTCCTGGACGAGACGCCGCAGCGTTCGCTCGCCA YAO _________ 1520 G R F K K T E I L T G S N T E E G Y Y F I I Y Y L T KISUMU GCGGGCGCTTCAAGAAGACGGAGATCCTCACCGGCAGCAACACGGAGGAGGGCTACTACTTCATCATCTACTACCTGACC YAO 1600 E L L R K E E G V T V T R E E F L Q A V R E L N P Y V KISUMU GAGCTGCTGCGCAAGGAGGAGGGCGTGACCGTGACGCGCGAGGAGTTCCTGCAGGCGGTGCGCGAGCTCAACCCGTACGT 1680 1680 N G A A R Q A I V F E Y T D W T E P D N P N S N R D A KISUMU GAACGGGGCGGCCCGGCAGGCGATCGTGTTCGAGTACACCGACTGGACCGAGCCGGACAACCCGAACAGCAACCGGGACG YAO 17 60 L D K M V G D Y H F T C N V N E F A Q R Y A E E G N KISUMU CGCTGGACAAGATGGTGGGCGACTATCACTTCACCTGCAACGTGAACGAGTTCGCGCAGCGGTACGCCGAGGAGGGCAAC YAO 1840 N V Y M Y L Y T H R S K G N P W P R W T G V M H G D E KISUMU AACGTCTACATGTATCTGTACACGCACCGCAGCAAAGGCAACCCGTGGCCGCGCTGGACGGGCGTGATGCACGGCGACGA YAO 1920 I N Y V F G E P L N P T L G Y T E D E K D F S R K I M KISUMU GATCAACTACGTGTTCGGCGAACCGCTCAACCCCACCCTCGGCTACACCGAGGACGAGAAAGACTTTAGCCGGAAGATCA YAO 2000 R Y W S N F A K T G KISUMU TGCGATACTGGTCTAACTTTGCCAAAACCGGGTAAGTGTGTGTGTGTGTGTGTGTCAAACAGCAGAGTGTCGATCGCTCT YAO A CA A 2080 N P N P N T A S S E F P E W P K H T KISUMU AACGCC TTCTCTCTTCAACAGCAATCCAAATCCCAACACGGCCAGCAGCGAATTCCCCGAGTGGCCCAAGCACA YAO AAGCGTC T A 2160 A H G R H Y L E L G L N T S F V G R G P R L R Q C A KISUMU CCGCCCACGGACGGCACTATCTGGAGCTGGGCCTCAACACGTCCTTCGTCGGTCGGGGCCCACGGTTGAGGCAGTGTGCC 2240 2240 F W K K Y L P Q L V A A T S KISUMU TTCTGGAAGAAGTACCTTCCCCAGCTAGTTGCAGCTACCTGTAAGTCTCGTGCAGCGCTTGAAATCCTCTCCCGCATCC YAO ________________________________________________A__T__. L__py_GA____C__C_ __T___G___ 2320 N L P G KISUMU TCAACAGGGTCCAGGTTGCAATAACAAATGTATCTCTCTCTCTCTCACGTCTCTTTTCCCCAAAACAGCGAACCTACCAG N L P G YAO C T__________A_A________________________ ____A_____________________________ 2400 P A P P S E P C E S S A F F Y R P D L I V L L V S L KISUMU GGCCAGCACCGCCCAGTGAACCGTGCGAAAGCAGCGCATTTTTTTACCGACCTGATCTGATCGTGCTGCTGGTGTCGCTG YAO 2480 L T A T V R F I Q * KISUMU CTTACGGCGACCGTCAGATTCATACAATAATTACTACCCCATCCATGGCCTAGTTCTTTTAAGCTTTAAGATAGTGAGGA YAO _______________________________________________________G_______________________ KISUMU ACAAATTTTTCCTAACCAATTTCCCAACCCCCTTTAGAGCAGAACCGAGGGAGAGATAGGACT YAO _________________ ____________________________________ Figure 9B Figure 10 FIGURE 11 Test d'inhibition par le propoxur FIGURE 12 FIGURE 13 FIGURE 14.
Description:
NOUVEAU GENE DE L'ACETYLCHOLINESTERASE RESPONSABLE DE LA RESISTANCE AUX INSECTICIDES ET SES APPLICATIONS La présente invention est relative à un nouveau gène de l'acétyl- cholinestérase responsable de la résistance aux insecticides, notamment chez les moustiques, aux produits de ce gène (ADNc, protéine) et à leurs applications, notam- ment pour le criblage de nouveaux insecticides et la détection génétique de la résis- tance aux organophosphorés et/ou aux carbamates dans les populations de moustiques.

L'acétylcholinestérase (AChE, E. C. 3.1. 1.7) est une enzyme essen- tielle qui hydrolyse l'acétylcholine dans les synapses, mettant ainsi fin aux transmis- sions cholinergiques au niveau des jonctions neuronales ou neuromusculaires. L'inhi- bition de l'AChE empêche la désactivation du signal synaptique, conduisant ainsi à une perte de contrôle de la transmission cholinergique. La biologie de l'acétyl- cholinestérase a été très étudiée chez les invertébrés, et en particulier les insectes, car cette enzyme est la cible des principales classes de pesticides utilisés, les organo- phosphorés et les carbamates. Cependant, l'utilisation massive de pesticides au cours des dernières décennies a provoqué l'émergence d'espèces résistantes. Parmi les méca- nismes de résistance, la sélection de mutations rendant l'AChE insensible aux insecticides a été observée dans de nombreux cas (Pour une revue, voir Fournier et al., Comp. Biochem. Physiol., 1994,108, 19-31).

Afin de déterminer avec précision, la nature de l'AChE cible des insecticides, ainsi que les mutations responsables de la résistance à ces derniers, les gènes codant pour des AChE (gènes ace) ont été isolés chez différentes espèces d'arthropodes (insectes et arachnides).

Le premier gène ace a été identifié chez la drosophile (Drosophila melanogaster), par génétique inverse (Hall et al., EMBO J., 1986,5, 2949-2954). La preuve que ce gène était impliqué dans la résistance aux insecticides a été fournie par la mise en évidence de substitutions d'acides aminés dans l'AChE de drosophiles résis- tantes, conférant l'insensibilité aux insecticides cholinergiques (Mutéro et al., P. N. A. S., 1994,91, 5922-5926). Les études chez D. melanogaster semblaient donc indiquer la présence d'un seul gène ace chez les insectes, codant pour l'AChE cible des insecticides cholinergiques.

Toutefois, à l'exception du gène ace de deux autres insectes, Musca domestica (Williamson et al., 1992, In Multidisciplinary approaches to cholinesterase functions, Eds Schafferman A. & Velan B., Plenum Press, New-York, pp 83-86 ; Walsh et al., Biochem. J., 2001,359, 175-181 ; Kozaki et al., Insect. Biochem. Mol.

Biol., 2001,31, 991-997) et Bactrocera oleae (Vontas et al., Insect Molecular Biology, 2002,11, 329-339), l'étude des gènes ace isolés chez d'autres insectes ou bien chez des arachnides, par homologie avec celui de la drosophile, indiquent qu'ils ne sont pas impliqués dans la résistance aux insecticides.

En effet, aucune mutation dans la séquence en acides aminés de l'AChE codée par le gène ace d'Aphis gossypEi, de Nephotettix cincticeps et de Boophilus microplus n'est observée entre les individus résistants et sensibles (Menozzi et al., Thèse de Doctorat de l'université Paul Sabatier, Toulouse, 2000 ; Tomita et al., Insect Biochem. Mol. Biol., 200,30, 325-333 ; Baxter et al., Insect Biochem. Mol.

Biol., 1998,28, 581-589 ; Hernandez et al., J. Med. Entomol., 1999,36, 764-770), et une ségrégation indépendante est observée entre le gène ace de Culex pipiens et C. tritaeniorynchus et la résistance aux insecticides (Malcolm et al., Insect. Mol. Biol., 1998,7, 107-120 ; Mori et al., Insect Mol. Biol., 2001,10, 197-203).

En ce qui concerne les autres gènes ace isolés chez d'autres insectes, leur rôle dans la résistance aux insecticides n'a pas été étudié (Lucilia cuprina : Chen et al., Insect. Biochem. Mol. Biol., 2001,31, 805-816 ; Schizaphis graminum : Gao et al., Insect. Biochem. Mol. Biol., 2001,31, 1095-1104) ou aucune forme d'AChE insensible aux insecticides n'a été décrite (Aedes aegypti, Anopheles gambiae et Anopheles stephensi : Anthony et al., FEBS letters, 1995,368, 461-465 ; Malcolm et al., In Molecular Insect Science, Eds Hageborn et al., Plenum Press, New-York, pp 57- 65).

Deux hypothèses ont été émises pour expliquer la différence dans la résistance aux insecticides, observée entre Drosophila melanogaster ou Musca domestica et les autres insectes ou les arachnides qui ont été étudiés : la présence d'un "gène modificateur"responsable de modifications post-transcriptionnelles ou post- traductionnelles de l'AChE, conduisant à des formes d'AChE possédant des activités catalytiques différentes, et la présence d'un deuxième gène ace.

Toutefois, aucune étude n'a permis de vérifier ces hypothèses et par conséquent de déterminer la nature du gène et celle de la cible (AChE) impliqués dans la résistance aux insecticides chez les insectes autres que Drosophila melanogaster et Musca domestica ou bien chez les arachnides : - La mise en évidence, chez C. pipiens, de deux formes d'AChE possédant des activités catalytiques distinctes supporte les deux hypothèses et l'analyse biochimique de ces AChE n'a pas permis de déterminer la nature de l'AChE impliquée dans la résistance aux insecticides (Bourguet et al., J. Neurochemistry, 1996,67, 2115-2123). En effet, la description d'une activité AChE1 insensible au propoxur dans des extraits d'insectes par Bourguet et al. (Pesticide Biochemistry and Physiology, 1996, 55, 2,122-128) ne fournit aucune donnée sur l'existence effective d'AChE1 chez Culex pipiens, ni sur la séparation de l'activité AChE1, de l'activité AChE2, dans le contexte des deux hypothèses précitées, à la lumière de l'article posté- rieur des mêmes Auteurs (Bourguet D. et al., Neurochemistry Internat., 1997, 31, 1, 65-72), dans lequel l'existence d'un deuxième gène chez de nombreux moustiques n'a pas pu être mis en évidence.

- Un deuxième gène ace a été isolé chez les arachnides ; toutefois ce gène n'est pas impliqué dans la résistance aux insecticides (Hernandez et al., Baxter et al., précités).

- Un deuxième gène ace n'a pu être isolé chez les insectes malgré de nombreuses tentatives dans différentes espèces (Menozzi et al., Tomita et al., Mori et al., précités ; Severson et al., J. Hered., 1997, 88, 520-524).

Il ressort de ce qui précède que la nature du gène et de la cible (AChE), impliqués dans la résistance aux organophosphorés et/ou aux carbamates, n'a pas été identifiée chez la plupart des insectes et chez les arachnides, notamment chez ceux où ils ont été recherchés ; on peut citer les plus importants dans les domaines de la santé humaine ou animale et de l'agriculture comme les vecteurs de pathogènes et les nuisibles, notamment de nombreux moustiques comme Culex pipiens, Aedes aegypti, Anopheles gambiae, Anopheles albimanus, Anopheles stephensi, et des rava- geurs des cultures comme Aphis gossypii, Nephotettix cincticeps et Leptinotarsa decemlineata.

Les Inventeurs ont identifié un nouveau locus du gène ace dans le génome d'Anopheles gambiae et de 15 espèces différentes de moustiques et ils ont montré que ce nouveau locus, non-homologue au locus précédemment décrit chez D. melanogaster, était impliqué dans la résistance aux insecticides chez les moustiques.

Les Inventeurs ont également montré que la résistance aux insecti- cides, au moins chez les moustiques des espèces Culex pipiens et Anopheles gambiae, était liée à une unique mutation dans la séquence de l'acétylcholinestérase codée par ce nouveau gène, située au voisinage du site catalytique de l'enzyme.

Ce nouveau gène représente un outil de diagnostic pour la détection génétique de la résistance aux insecticides (organophosphorés, carbamates) dans les populations de moustiques. L'AChE codée par ce gène représente une cible pour le criblage de nouvelles molécules actives sur les populations de moustiques résistants aux insecticides actuellement utilisés.

La présente invention a, en conséquence, pour objet une protéine, caractérisée en ce qu'elle comprend une région catalytique centrale qui présente une séquence en acides aminés sélectionnée dans le groupe constitué par la séquence SEQ ID NO : 1 et les séquences présentant au moins 60 % d'identité ou 70 % de similarité avec la séquence SEQ ID NO : 1, à l'exclusion de la séquence NCBI AAK0973 corres- pondant à l'acétylcholinestérase de Schizaphis graminu7n.

La protéine selon l'invention représente une nouvelle acétyl- cholinestérase d'insecte, dénommée ci-après AchEl, responsable de la résistance aux organophosphorés et/ou aux carbamates, au moins chez les moustiques, notamment chez C. pipiens ; le locus codant pour ladite AchE1 est dénommée ci-après ace-1 ; ace-2 représente le second locus ace, qui n'est pas impliqué dans la résistance aux insecticides chez les moustiques. L'unique gène ace présent dans Drosophila melano- gaster, qui est homologue à ace-2, est donc également dénommé ace-2.

Conformément à l'invention, ladite région catalytique centrale contient le domaine catalytique de l'AChE et correspond à celle située entre les posi- tions 70 et 593 de la séquence de l'AChEl d'Anopheles gambiae (SEQ ID NO : 3,643 acides aminés) ; elle correspond à celle située respectivement entre les positions 100 et 629 de la séquence d'AChE1 de Schizaphis graminum (NCBI AAK0973), 60 et 582 de la séquence de l'AChE1 de Culex pipiens (SEQ ID NO : 7), 34 et 593 de la séquence

d'AChE2 d'Anopheles gambiae (figure 1, SEQ ID NO : 53), et 41 et 601 de la séquence d'AChE2 de Drosophila melanogaster (NCBI AAF54915). Cette région centrale qui contient le domaine catalytique est conservée chez les vertébrés et les invertébrés alors que les extrémités N-et C-terminales présentent une forte variabilité entre les diffé- rentes espèces.

Conformément à l'invention, l'identité d'une séquence par rapport à une séquence de référence (SEQ ID NO : 1) s'apprécie en fonction du pourcentage de résidus d'acides aminés qui sont identiques, lorsque les séquences correspondant à la région catalytique telle que définie ci-dessus sont alignées, de manière à obtenir le maximum de correspondance entre elles.

Une protéine ayant une séquence en acides aminés ayant au moins X % d'identité avec la séquence de référence SEQ ID NO : 1 est définie, dans la présente invention comme une protéine dont la séquence correspondant à la région catalytique centrale telle que définie ci-dessus peut inclure jusqu'à 100-X altérations pour 100 acides aminés de la séquence SEQ ID NO : 1. Au sens de la présente inven- tion, le terme altération inclut les délétions, les substitutions ou les insertions consécu- tives ou dispersées d'acides aminés dans la séquence de référence. Cette définition s'applique, par analogie, aux molécules d'acide nucléique.

La similarité d'une séquence par rapport à la séquence de référence SEQ ID NO 1 s'apprécie en fonction du pourcentage de résidus d'acides aminés qui sont identiques ou qui différent par des substitutions conservatives, lorsque les séquences correspondant à la région catalytique centrale telle que définie ci-dessus sont alignées de manière à obtenir le maximum de correspondance entre elles. Au sens de la présente invention, on entend par substitution conservative, la substitution d'un acide aminé par un autre qui présente des propriétés chimiques similaires (taille, charge ou polarité), qui généralement ne modifie pas les propriétés fonctionnelles de la protéine.

Une protéine ayant une séquence en acides aminés ayant au moins X % de similarité avec la séquence SEQ ID NO : 1 est définie, dans la présente inven- tion comme une protéine dont la séquence correspondant à la région catalytique centrale telle que définie ci-dessus peut inclure jusqu'à 100-X altérations non-conser- vatives pour 100 acides aminés de la séquence de référence. Au sens de la présente

invention, le terme altérations non-conservatives inclut les délétions, les substitutions non-conservatives ou les insertions consécutives ou dispersées d'acides aminés dans la séquence SEQ ID NO : 1.

La comparaison de l'AChEl selon l'invention avec les AChE d'insecte disponibles sur les bases de données, par alignement des séquences corres- pondant à la région centrale telle que définie ci-dessus, à l'aide du logiciel BLAST (http ://www. ncbi. nlm. nih. gov/gorf/bl2. html, paramètres par défaut, filtre inactivé) montre que : - les séquences d'AChEl et d'AChE2 d'insecte présentent 36-39% d'identité (53-57% similarité) entre elles.

- les séquences d'AChEl d'insecte présentent 65-97% d'identité (79- 98% similarité) entre elles, - les séquences d'AChE2 d'insecte présentent 58-99% d'identité (73- 99% similarité) entre elles, En outre, l'analyse phylogénétique des AChE des différentes espèces animales montre que les séquences protéiques d'AChE1 forment un groupe autonome significatif (bootstrap 795/1000), et que les AChEl d'insecte forment un sous-groupe distinct significatif (bootstrap 856/1000).

L'AChEl selon l'invention comprend des motifs caractéristiques des AChE (figure 1) situés aux positions suivantes, respectivement dans la séquence SEQ ID NO : 3 et dans la séquence de référence de Torpedo californica (SWISSPROT P04058) : un motif canonique du type FGESAG autour de la sérine en position 266 (200), qui est caractéristique du site actif des AchE, un site de liaison à la choline (résidu Tryptophane en position 151 (84)), trois résidus de la triade catalytique (rési- dus sérine, acide glutamique et histidine, respectivement en positions 266 (200), 392 (327) et 506 (440)), six résidus cystéine potentiellement impliqués dans des ponts disulfures conservés (Cl34 (67)-Cl61 (94) ; C320 ()-C333 (265) ; C468 (402)-C589 (J2/)), des résidus aromatiques bordant la gorge du site actif (10 résidus) et un résidu phénylalanine en position 355 (290) mais pas en position 353 (288), qui distingue les AChE d'inverté- brés de celles de vertébrés. Elle possède également un peptide C-terminal hydrophobe correspondant à un signal d'addition d'un glycolipide, indiquant le clivage post- traductionnel d'un fragment C-terminal et l'addition d'une résidu d'ancrage glycolipi-

dique comme chez Drosophila ; le résidu cystéine dans la séquence C-terminale précédant le site potentiel de clivage du peptide hydrophobe pourrait être impliqué dans une liaison disulfure intermoléculaire, liant les deux sous-unités catalytiques du dimère d'AChE.

L'AChE1 selon l'invention se distingue de l'AChE de Drosophila (AChE2) par l'absence d'une insertion hydrophile de 31 acides aminés entre les résidus situés aux positions 174 et 175 de la séquence SEQ ID NO : 3 (figure 1) ; cette inser- tion hydrophile pourrait être caractéristique de l'AChE2, au moins chez les diptères.

L'invention englobe les AChE1 d'insecte sensibles ou résistantes aux organophosphorés et/ou aux carbamates.

Au sens de la présente invention, les séquences d'AChE1 incluent aussi bien les séquences primaires, que les séquences secondaires et les séquences tertiaires desdites AChE1.

Au sens de la présente invention on entend par"AChE sensible", une AChE dont l'activité acétylcholinestérase est inhibée en présence d'organophosphorés ou de carbamates.

Au sens de la présente invention on entend par"AChE résistante", une AChE dont l'activité n'est pas inhibée par des concentrations en organophosphorés ou en carbamates qui inhibent 100 % de l'activité de"l'AChE sensible"correspondante issue d'un individu de la même espèce ; cette"AChE résistante"diffère de la précé- dente par la présence d'une ou plusieurs mutations dans sa séquence en acides aminés (substitutions d'acides aminés) qui modifient sa sensibilité aux inhibiteurs de l'acétyl- cholinestérase ; parmi ces mutations on peut citer les suivantes F78S, I129V, G227A, F288Y, les acides aminés étant numérotés en référence à la séquence de l'AChE de Torpedo californica (SWISSPROT P04058).

L'activité acétylcholinestérase et les paramètres catalytiques des AChE sont mesurés par les techniques enzymatique classiques telles que celles décri- tes dans Bourguet et al., précité.

Les protéines selon l'invention incluent toute protéine naturelle, synthétique, semi-synthétique ou recombinante de n'importe quel organisme proca- ryote ou eucaryote, comprenant ou consistant en une séquence d'acides aminés d'une protéine AChE1 telle que définie ci-dessus. Elles incluent notamment les protéines

naturelles isolées chez n'importe quelle espèce d'insecte, ainsi que les protéines recombinantes produites dans un système d'expression approprié.

Selon un mode de réalisation avantageux de ladite AChEl, elle correspond à celle d'un insecte qui appartient à l'ordre des diptères (Diptera) ; de manière préférée, ledit insecte est choisi dans la famille des Culicidae, parmi les genres Culex, Aedes et Anopheles.

Selon une disposition avantageuse de ce mode de réalisation, ladite AChE1 est constituée par les séquences SEQ ID NO : 3, SEQ ID NO : 5 et SEQ ID NO : 126 d'Anopheles gambiae et la séquence SEQ ID NO : 7 de Culex pipiens (souche S- LAB), sensibles aux organophosphorés et/ou aux carbamates.

Selon une autre disposition avantageuse de ce mode de réalisation, ladite région centrale catalytique de l'AChEl comprend une séquence sélectionnée dans le groupe constitué par les séquences SEQ ID NO : 8 à 21 représentant un frag- ment d'environ 91 acides aminés (fragment K, figure 1), correspondant à celui situé entre les positions 445 et 535 de la séquence SEQ ID NO : 3.

Selon un autre mode de réalisation avantageux de l'invention, ladite AChE1 est une acétylcholinestérase résistante aux insecticides de la classe des organophosphorés et des carbamates incluant une mutation de la glycine située en position 119, en sérine (mutation ou substitution de type G119S) ; ladite position étant indiquée en référence à la séquence de l'AChE de Torpedo californica (SWISSPROT P04058).

En effet, les Inventeurs ont montré que le résidu en position 119 est proche des résidus du site catalytique (sérine 200 et histidine 440) et que le remplace- ment de la glycine de l'AChEl des moustiques sensibles par une sérine, dans l'AChEl des moustiques résistants, réduit l'espace du site catalytique et empêche l'insecticide d'interagir avec la sérine catalytique (S200), du fait de l'encombrement stérique des liaisons de Van der Waals de la chaîne latérale de la sérine en position 119. Le rôle de la mutation G119S dans la résistance aux insecticides a été confirmé par l'analyse de l'activité acétylcholinestérase des protéines AChE1 recombinantes produites à partir de l'ADNc de Culex pipiens sensibles (souche S-LAB possédant une AChE1 incluant une glycine en position 119) ou résistants (souche SR dont l'AchEl diffère de la précé- dente uniquement par la présence d'une sérine en position 119) aux insecticides ; 90 %

de l'activité de l'AChE1 de la souche sensible est inhibée en présence de 10-3 M de propoxur alors que l'AChEl de la souche résistante conserve 75 % de son activité en présence de concentrations 100 fois plus élevées de cet insecticide (10-l M de propoxur).

Selon une disposition avantageuse de ce mode de réalisation de ladite AChE1 résistante, elle correspond à celle d'un insecte (résistant aux insecticides) qui appartient à l'ordre des diptères (Diptera) ; de manière préférée, ledit insecte est choisi dans la famille des Culicidae, parmi les genres Culex, Aedes et Anopheles.

De préférence, ladite AChEl résistante présente une séquence sélec- tionnée dans le groupe constitué par : - la séquence SEQ ID NO : 57, correspondant à la séquence complète de la souche SR de C. pipiens, résistante aux insecticides, - la séquence SEQ ID NO : 122, correspondant à la séquence complète de l'AChE1 de la souche YAO d'An. gambiae (isolée en Côte d'ivoire), résistante aux insecticides, et - les séquences comprenant un fragment de séquence SEQ ID NO : 90,93, 94,95, 97 à 101,113 et 116 représentant un fragment peptidique d'environ 150 acides aminés codé par le troisième exon codant du gène ace-1 d'un insecte résistant tel que défini ci-dessus, contenant la substitution de type G119S, en référence à la séquence de l'AChE de Torpedo californica (SWISSPROT P04058).

Selon encore un autre mode de réalisation avantageux de l'invention, ladite AChE1 est une acétylcholinestérase sensible aux insecticides de la classe des organophosphorés et des carbamates comprenant une séquence sélectionnée dans le groupe constitué par les SEQ ID NO : 91,92, 96,102 à 112,114, 115 et 117 à 119, représentant un fragment d'environ 150 acides aminés du troisième exon codant du gène ace-1 issu d'un insecte tel que défini ci-dessus, sensible aux insecticides, ledit fragment incluant une glycine en position 119 en référence à la séquence de l'AChE de Torpedo californica (SWISSPROT P04058).

La présente invention a également pour objet un peptide, caractérisé en ce qu'il est constitué par un fragment d'au moins 7 acides aminés de la protéine AChE1, telle que définie ci-dessus ; ces fragments sont particulièrement utiles pour la production d'anticorps reconnaissant spécifiquement la protéine AChE1.

La présente invention a également pour objet des anticorps, caracté- risés en ce qu'ils sont dirigés contre la protéine AChE1 ou un fragment de celle-ci, tels que définis ci-dessus.

Conformément à l'invention, lesdits anticorps sont soit des anticorps monoclonaux, soit des anticorps polyclonaux.

Ces anticorps peuvent être obtenus par les méthodes classiques, connues en elles-mêmes, comprenant notamment l'immunisation d'un animal avec une protéine ou un peptide conforme à l'invention, afin de lui faire produire des anti- corps dirigés contre ladite protéine ou ledit peptide.

La présente invention a également pour objet une molécule d'acide nucléique isolée, caractérisée en ce qu'elle présente une séquence sélectionnée dans le groupe constitué par : - les séquences codant pour une protéine AChEl telle que définie ci- dessus (ADNc et fragment d'ADN génomique correspondants au gène ace-1), et - les séquences complémentaires des précédentes, sens ou anti-sens.

- les fragments d'au moins 8 pb, de préférence de 15 pb à 500 pb des séquences précédentes.

L'invention englobe, les séquences des allèles du gène ace-1 issues de n'importe quel insecte, ainsi que les séquences des mutants naturels (allèles sensi- bles et résistants) ou artificiels du gène ace-1 codant pour une protéine AChE1 sensi- ble ou résistante, telle que définie ci-dessus.

Selon un mode de réalisation avantageux de l'invention, ladite séquence codant pour une protéine AChEl est sélectionnée dans le groupe constitué par : a) les séquences SEQ ID NO : 2, SEQ ID NO : 4, SEQ ID NO : 125, SEQ ID NO : 6, SEQ ID NO : 56 et SEQ ID NO : 121 qui correspondent à l'ADNc de la protéine AChEl de séquence en acides aminés, respectivement SEQ ID NO : 3, SEQ ID NO : 5, SEQ ID NO : 126, SEQ ID NO : 7, SEQ ID NO : 57 et SEQ ID NO : 122, telles que définie ci-dessus, b) les séquences SEQ ID NO : 22, SEQ ID NO : 23 et SEQ ID NO : 127 qui correspondent au gène ace-l d'Anopheles gambiae codant les AChE1 telles que définies ci-dessus, lequel gène présente une organisation exon-intron comprenant au moins 9 exons (Tableau I), et c) les séquences comprenant la séquence SEQ ID NO : 120 qui correspond à la séquence quasi-complète du gène ace-l d'Anopheles gambiae codant l'AChE1 résistante de séquence SEQ ID NO : 122, telle que définie ci-dessus.

Tableau I : Organisation Intron-Exon du gène ace-1

Site 5'Site 3' Position Séquence Position Séquence tntroni 301 AGCAA/gtaat 1255 cgcag/CCATT Intron2 1413 CAATG/gtgag 5338 tgtag/CGCTC Intron3 5696 CGCAG/gtcgg 7634 ttcag/ACGCA Intron4 7769 CTCGG/gtaag 7855 ggcag/ACGCG Intron5 8393 CTACG/gtagg 8472 gtcag/CTGGG Intron6 8670 CTAAG/gtacg 8756 tccag/AGCAC Intron7 9464 ACCGG/gtaag 9530 tacag/CAATC Intron8 9703 TACCT/gtaag 9810 aacag/CGAAC Conformément à la présente invention, le troisième exon codant du gène ace-1 correspond à celui qui est situé entre l'intron 4 et l'intron 5 dans la séquence d'An. gambiae (Tableau 1), c'est à dire entre les positions 7854 et 8393 de la séquence SEQ ID NO : 127.

Selon un autre mode de réalisation avantageux de l'invention, ledit fragment est sélectionné dans le groupe constitué par les amorces de séquence SEQ ID NO : 39 à 50,54, 55,58, 59,123, 124,128 et 129 et les fragments de séquences SEQ IDNO : 24à38et60à89.

Les molécules d'acide nucléique selon l'invention sont obtenues par les méthodes classiques, connues en elles-mêmes, en suivant les protocoles standards tels que ceux décrits dans Current Protocols in Molecular Biology (Frederick M.

AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA). Par exemple, elles peuvent être obtenues par amplification d'une séquence nucléique par PCR ou RT- PCR, par criblage de banques d'ADN génomique par hybridation avec une sonde homologue, ou bien par synthèse chimique totale ou partielle.

Les molécules d'acides nucléiques telles que définies ci-dessus peu- vent être utilisées comme sondes ou comme amorces pour isoler le gène ace-1 d'autres espèces ou des allèles de ce gène, notamment par criblage d'une banque d'ADN géno- mique ou d'ADNc, ainsi que pour détecter/amplifier des molécules d'acide nucléique (ARNm ou ADN génomique) codant une protéine AChE1 telle que définie ci-dessus.

Ces différentes molécules d'acides nucléiques permettent de mettre en évidence le gène ace-1, des variants alléliques de ce gène, une altération fonction- nelle de ce gène ace-l (changement substantiel de la sensibilité aux insecticides) résultant d'une mutation (insertion, délétion ou substitution) d'un ou plusieurs nucléo- tides au niveau dudit gène.

La présente invention a également pour objet une méthode de détec- tion d'insectes porteurs d'une résistance aux insecticides de la classe des organo- phosphorés et des carbamates, caractérisée en ce qu'elle comprend : - la préparation d'un échantillon d'acides nucléiques à partir d'insec- tes à tester, et - la détection par tout moyen approprié de la présence, dans ledit échantillon d'acides nucléiques, d'une mutation dans le gène ace-1 tel que défini ci- dessus.

Ladite détection est réalisée par les techniques classiques qui sont connues en elles mêmes, par exemple : (i) par amplification d'une région dudit gène ace-1 susceptible de contenir une mutation, puis détection de ladite mutation par séquençage ou par digestion par une enzyme de restriction appropriée, du produit de PCR obtenu, ou bien (ii) par hybridation avec une sonde marquée spécifique d'une région dudit gène ace-1 susceptible de contenir une mutation, puis détection directe des mésappariements et/ou digestion par une enzyme de restriction appropriée.

Selon un premier mode de mise en oeuvre avantageux dudit procédé, un fragment d'environ 320 pb (fragment K) est amplifié à l'aide des amorces SEQ ID NO : 39 et SEQ ID NO : 40. Par exemple, chez les moustiques on obtient un fragment de séquence SEQ ID NO : 24 à 38 qui présente des mutations entre les moustiques sensibles et résistants aux insecticides. Par exemple, chez C. pipiens on observe 3 substitutions dans la séquence des individus résistants dont l'une introduit un site EcoRI. L'analyse du profil de restriction après amplification PCR du fragment K et digestion des produits obtenus par EcoRI (analyse RFLP), permet de détecter rapide- ment le génotype ace-1 dans une population de C. pipiens ; la présence d'un seul frag- ment correspond aux homozygotes résistants (RR), la présence de 2 fragments d'envi- ron 106 pb et 214 pb correspond aux individus homozygotes sensibles (SS) et la pré-

sence de 3 fragments de 106 pb, 214 pb et 320 pb correspond aux individus hétéro- zygotes résistants (RS).

Selon un second mode de mise en oeuvre avantageux dudit procédé, la mutation G119S dans le troisième exon codant du gène ace-1 qui est responsable de la résistance aux insecticides de la classe des organophosphorés et des carbamates chez les moustiques est détectée selon l'une des alternatives suivantes, respectivement chez les moustiques des espèces C. pipiens et An. gambiae : - chez les moustiques de l'espèce Culex pipiens, un fragment de 520 pb du troisième exon codant est amplifié à partir de l'ADN génomique, par PCR à l'aide du couple d'amorces Ex3dir et Ex3rev (SEQ ID NO : 58 et 59) ; le fragment PCR est digéré par Alu I et le produit de digestion est séparé par électrophorèse en gel d'agarose, puis le profil de restriction ainsi obtenu est analysé : la présence d'un frag- ment de 520 pb correspond aux individus homozygotes sensibles SS, la présence de deux fragments (357 pb et 163 pb) correspond aux individus homozygotes résistants RR et la présence de 3 fragments (520 pb, 357 pb et 163 pb) correspond aux individus hétérozygotes résistants RS, - chez les moustiques de l'espèce Anopheles gambiae, un fragment de 541 pb du troisième exon codant est amplifié à partir de l'ADN génomique, par PCR à l'aide du couple d'amorces Ex3AGdir et Ex3AGrev (SEQ ID NO : 123 et 124) ; le fragment PCR est digéré par Alu I et le produit de digestion est séparé par électro- phorèse en gel d'agarose, puis le profil de restriction ainsi obtenu est analysé : la pré- sence de deux fragments (403 pb et 138 pb) correspond aux individus homozygotes sensibles SS, la présence de 3 fragments (253 pb, 150 pb et 138 pb) correspond aux individus homozygotes résistants RR et la présence de 4 fragments (403 pb, 253 pb, 150 pb et 138 pb) correspond aux individus hétérozygotes résistants RS ; étant donné que les fragments de 150 pb et 138 pb co-migrent, les individus homozygotes et hété- rozygotes résistants sont détectés respectivement par la présence de 2 bandes (253 pb et environ 150 pb) et de 3 bandes (403 pb, 253 pb et environ 150 pb), - chez les moustiques de l'espèce Culex pipiens, Anopheles gambiae ou Anopheles albimanus, un fragment de 194 pb contenant le codon 119 du troisième exon codant est amplifié à partir de l'ADN génomique par PCR à l'aide du couple d'amorces Moustdirl et Moustrevl (SEQ ID NO : 128 et 129) ; le fragment PCR est

digéré par Alu I et le produit de digestion est séparé par électrophorèse en gel d'agarose, puis le profil de restriction ainsi obtenu est analysé : la présence de deux fragments (74 pb et 120 pb) correspond aux individus homozygotes résistants RR, la présence d'un seul fragment (pas de digestion) correspond aux individus homozygotes sensibles SS et la présence de trois fragments (194 pb, 74 pb et 120 pb) correspond aux individus hétérozygotes résistants RS.

La présente invention a également pour objet un réactif de détection d'insectes porteurs d'une résistance aux organophosphorés et/ou aux carbamates, caractérisé en ce qu'il est sélectionné dans le groupe constitué par : les molécules d'acide nucléique et leurs fragments tels que définis ci-dessus (sondes, amorces) et les anticorps tels que définis ci-dessus.

La présente invention a également pour objet un vecteur recombi- nant, caractérisé en ce qu'il comprend un insert sélectionné dans le groupe constitué par les molécules d'acides nucléiques codant une protéine AChE1 et leurs fragments tels que définis ci-dessus.

De préférence, ledit vecteur recombinant est un vecteur d'expression dans lequel ladite molécule d'acide nucléique ou l'un de ses fragments sont placés sous le contrôle d'éléments régulateurs de la transcription et de la traduction appropriés.

Ces vecteurs sont construits et introduits dans des cellules hôtes par les méthodes classiques d'ADN recombinant et de génie génétique, qui sont connues en elles-mêmes. De nombreux vecteurs dans lesquels on peut insérer une molécule d'acide nucléique d'intérêt afin de l'introduire et de la maintenir dans une cellule hôte eucaryote ou procaryote, sont connus en eux-mêmes ; le choix d'un vecteur approprié dépend de l'utilisation envisagée pour ce vecteur (par exemple réplication de la séquence d'intérêt, expression de cette séquence, maintien de la séquence sous forme extrachromosomique ou bien intégration dans le matériel chromosomique de l'hôte), ainsi que de la nature de la cellule hôte. Par exemple, on peut utiliser des vecteurs viraux comme les baculovirus ou non-viraux comme des plasmides. Pour exprimer l'AChEl, l'ADNc d'ace-l peut être placé sous le contrôle d'un promoteur constitutif comme le promoteur de l'actine 5C, dans un vecteur approprié et ledit vecteur recom- binant est introduit dans des cellules d'insecte telles que des cellules de drosophile (cellules de Schneider S2).

La présente invention a également pour objet des cellules procaryo- tes ou eucaryotes, modifiées par un vecteur recombinant tel que défini ci-dessus ; de préférence ces cellules sont des cellules d'insectes.

Les vecteurs recombinants et les cellules modifiées telles que défi- nies ci-dessus, sont utiles notamment pour la production des protéines et des peptides AChEl selon l'invention.

La présente invention a également pour objet un animal invertébré transgénique, caractérisé en ce qu'il contient des cellules modifiées par au moins une molécule d'acide nucléique telle que définie ci-dessus ; de préférence ledit animal est un insecte.

Les animaux transgéniques et les cellules modifiées telles que défi- nis ci-dessus, sont utiles notamment pour le criblage de substances insecticides et pour la lutte biologique contre les vecteurs de pathogènes et les insectes nuisibles.

La présente invention a également pour objet une méthode de criblage d'une substance insecticide, caractérisée en ce qu'elle comprend : a) la mise en contact de la substance à tester avec une protéine AChEl sélectionnée parmi : une protéine AChEl isolée selon l'invention, un extrait de cellules modifiées ou un échantillon biologique d'un animal transgénique contenant ladite protéine AChEl, tels que définis ci-dessus, en présence d'acétylcholine ou de l'un de ses dérivés, b) la mesure par tout moyen approprié, de l'activité acétyl- cholinestérase du mélange obtenu en a), et c) la sélection des substances capables d'inhiber ladite activité.

La présente invention a également pour objet une méthode de criblage d'une substance insecticide, caractérisée en ce qu'elle comprend : - la mise en contact d'un animal transgénique tel que défini ci-dessus, avec la substance à tester, et - la mesure de la survie de l'animal.

Avantageusement, lesdites méthodes de criblage mettent en oeuvre des AChEl résistantes aux organophosphorés ou aux carbamates ou bien des cellules ou des animaux transgéniques les contenant.

La présente invention a également pour objet un réactif de criblage de substances insecticides, caractérisé en ce qu'il est sélectionné dans le groupe cons- titué par les protéines AChEl, les vecteurs recombinants, les cellules modifiées et les animaux transgéniques tels que définis ci-dessus.

Des substances insecticides capables d'inhiber l'activité acétyl- cholinestérase des protéines AChEl résistantes aux insecticides de la classe des organophosphorés et des carbamates couramment utilisés ont des applications : en santé humaine et animale, pour lutter contre les vecteurs de pathogènes (par exemple Aedes aegypti, vecteur d'arboviroses comme la dengue et la fièvre jaune, Culex pipiens vecteur du virus West-Nile, Anopheles gambiae vecteur africain de l'agent du paludisme, etc) et dans le domaine de l'agriculture, pour lutter contre les insectes nuisibles qui dévastent les récoltes (par exemple le doryphore (Leptinotarsa decemlineata) qui s'attaque aux pommes-de-terre, les pucerons ravageurs comme Aphis gossypEi et Myzus persicae, etc. ).

L'invention a en outre pour objet une trousse de détection et/ou de criblage pour la mise en oeuvre des méthodes telles que définies ci-dessus, caractérisée en ce qu'elle inclut au moins un réactif tel que défini ci-dessus.

La présente invention a également pour objet une méthode de criblage d'inhibiteurs d'une AChEl telle que définie ci-dessus, caractérisée en ce qu'elle comprend : (a) l'identification de molécules (peptides ou autres structures chimiques) présentant une probabilité de liaison significative à ladite AChE 1 ; (b) l'isolement des inhibiteurs potentiels identifiés à l'étape (a) ; (c) la mise en contact de la substance isolée à l'étape (b) avec une AChEl telle que définie ci-dessus, un extrait de cellules modifiées, un échantillon biologique d'un animal transgénique tels que définis ci-dessus ou un extrait d'insecte sensible ou résistant aux insecticides précités, en présence d'acétylcholine ou de l'un de ses dérivés ; (d) la mesure par tout moyen approprié, de l'activité acétyl- cholinestérase du mélange obtenu en (c) ; et (e) la vérification que les molécules isolées en (b) inhibent l'activité AChEl.

La structure 3D de l'acétylcholinestérase du poisson torpille a permis de modéliser la structure 3D de l'AChEl de C. pipiens. La mutation G247S [corres- pondant à une substitution G119S chez la protéine de torpille] entraîne une réduction de l'espace du site catalytique due à l'encombrement de la chaîne latérale de la sérine.

La modélisation de la structure de l'AChEl de C. pipiens ou d'An. gambiae permet ainsi le criblage d'inhibiteurs de l'AChEl par criblage virtuel ("Docking"). Le procédé selon l'invention comporte une étape (étape (a)) de simula- tion informatique visant à identifier des structures peptidiques ou chimiques présen- tant une probabilité de liaison significative à une protéine cible. Différents programmes informatiques permettent ainsi de simuler et d'estimer les probabilités d'interactions. On peut notamment citer les algorithmes élaborés pour la recherche d'interactions potentielles décrits dans Schneider et al. (Drug Discovery Today, 2002, 7,1, 64-71). De manière plus précise, les outils les plus couramment utilisés jusqu'à présent sont FlexX (Tripos, StLouis, Missouri, USA), DOCK (UCSF, San Francisco, California, USA) et GOLD (Cambridge Crystallographic Data Centre, Cambridge, Royaume-Uni).

Il est ainsi possible d'isoler des inhibiteurs potentiels de la forme d'AChEl résistante sans disposer biochimiquement de la protéine, puis de tester directement la capacité d'inhibition de chaque candidat sur l'activité AChEl d'un extrait d'insectes sensibles ou résistants (étape (c) du procédé). Cette approche peut donc s'affranchir totalement de la purification et/ou de la production de protéine cible.

Au sens de la présente invention, la significativité d'une probabilité de liaison ne peut être définie de manière absolue : cela peut dépendre du type d'acides aminés impliqués dans l'interaction, ainsi que des logiciels utilisés pour la modélisa- tion. De manière plus précise, les méthodes les plus couramment utilisées sélection- nent, pour un site donné d'une molécule cible, les composés présentant l'énergie de liaison la plus faible. En général, le calcul de l'énergie prend en compte les liaisons « hydrogène », les interactions de van der Waals, électrostatiques et hydrophobes, ainsi que les pénalités d'entropie. Il est donc a priori impossible de donner une limite de significativité en valeur absolue au-delà de laquelle un ligand potentiel sera accepté ou rejeté, puisque l'énergie dépendra des atomes engagés dans la liaison. Cependant, trois critères de sélection peuvent être appliqués :

1. une sélection arbitraire des composés de moindre énergie de liaison. En général, la limite est fixée entre 1 % et 5 % du nombre de composés testés.

2. une estimation de l'affinité de la liaison, en fonction des calculs d'énergie. Une valeur acceptable comme base de départ pourrait être comprise entre 1 et 300 micromolaires. A titre d'exemple, l'onchidal, un inhibiteur d'AChE, présente une affinité apparente de 300 uM (Abramson et al., Mol. Phar77ßacol., 1989, 36,349).

3. une sélection statistique des composés, en estimant la probabilité qu'un score identique ou supérieur pour un composé soit obtenu au hasard. En général, le composé est accepté lorsque la probabilité estimée est < 0,05.

Outre les dispositions qui précèdent, l'invention comprend encore d'autres dispositions qui ressortiront de la description qui va suivre, qui se réfère à des exemples de mise en oeuvre du gène ace-1 et de ses produits (ADNc, protéine) selon la présente invention ainsi qu'au tableau résumant les séquences de la Demande et aux dessins annexés dans lesquels : - la figure 1 illustre l'alignement des séquences en acides aminés des protéines AChEl d'Anopheles gambiae, Schizaphis graminum, An. stephensi, Aedes aegypti, Drosophila melanogaster, Lucilia cuprina, Musca domestica et Culex pipiens. Par convention, les acides aminés sont numérotés en référence à la séquence de l'AChE du poisson torpille (Torpedo californica ; SWISSPROT P04058). Les séquences N-et C-terminales ne sont pas représentées en raison de leur variabilité.

Les acides aminés conservés entre AChE 1 et AChE2 sont indiqués en gris. Les acides aminés spécifiques d'AChE2 sont indiqués en noir. Les 3 résidus représentant la triade catalytique (S200, E327 et H44o) sont encadrés. Le site de liaison à la choline (W84) est souligné. Les cercles représentent la position des 14 résidus aromatiques bordant la gorge du site actif dans l'AChE de Torpedo, dont 10 sont présents dans toutes les AChEl et AChE2 (cercles pleins), les autres n'étant pas conservés (cercles vides).

Trois liaisons disulfures intramoléculaires entre des résidus cystéines sont indiquées.

La flèche horizontale indique la position du fragment K (amplifié à l'aide des amorces PdirAGSG et PrevAGSG). La région hypervariable d'AChE2 qui est absente dans AChEl est entourée.

- la figure 2 illustre la détection génétique des moustiques résistants aux organophosphorés et/ou aux carbamates par PCR-RFLP :

. la figure 2 A représente la comparaison de la séquence en acides aminés du fragment K de différentes espèces de moustiques : Cx Pip (Culex pipiens), Ae alb (Aedes albopictus), Ae aeg (Aedes aegypti), An alb (Anopheles albimanus), An gamb (Anopheles gambiae), An fun (Anopheles funestus), An nil (Anopheles nili), An sac (Anopheles sacharovi), An pse (Anopheles pseudopunctipennis). Les acides ami- nés variants sont grisés. Les séquences suivantes sont identiques : An. darlingi et An. albinianus ; An. sundaicus, An. gambiae et An. arbiensis ; An. mouchetai, An. funestus et An. minimus ; An. stephensi et An. saccharovi.

. la figure 2B illustre la comparaison des séquences nucléotidiques correspondant au fragment K des souches sensibles (S-LAB) et résistantes (SR). Les nucléotides variants sont grisés (t o c en position 3 ; a- g en position 84 : le site. EcoRI (gaattc) situé autour de cette position, utilisé pour l'analyse PCR-RFLP, est présent uniquement dans la souche S-LAB ; c o t en position 173). La figure 2C illustre les profils de restriction obtenus après électrophorèse en gel d'agarose des produits de digestion par EcoRI, du fragment K amplifié par PCR. La souche homo- zygote sensible S-LAB présente un profil caractérisé par 2 bandes (214 pb et 106 pb), la souche homozygote résistante présente un profil caractérisé par une seul bande de 320 pb et les moustiques résistants issus du croisement en retour présentent un profil hétérozygote caractérisé par 3 bandes (320 pb, 214 pb et 106 pb).

- la figure 3 illustre l'arbre phylogénétique des protéines AChE.

L'analyse phylogénétique a été réalisée à partir de 47 séquences de protéines AChE de 35 espèces différentes provenant de la base de données ESTHER (http : //www. ensam. inra. fr/cgi-bin/ace/index). Les séquences ont été alignées et un arbre a été construit comme décrit à l'exemple 1. Seuls les noeuds correspondant à des valeurs de"bootstrap"> 50% (c'est à dire des scores supérieurs à 500) sont indiqués.

L'échelle représente une divergence de 10 %. Agam : An. gambiae ; Aeg : Aedes aegypti ; Aste : Anopheles stephensi ; Cp : Culex pipiens ; Dmel : Drosophila melano- gaster : Lcup : Lucilia cuprina : Mdom : Musca domestica : Ldec : Leptinotarsa decemli- neata ; Amel : Apis mellifera : Ncin : Nephotettix cincticeps ; Sgra : Schizaplzis grami- num ; Rapp : Rhipicephalus appendiculatus ; Bmic : Boophilus microplus ; Bdec : Boophilus decoloratus ; Hsap : Homo sapiens ; Btau : Bos taurus ; Fcat : Felix catus ; Ocun : Oryctolagus cuniculus ; Rnor : Rattus norvegicus ; Mmus : Mus musculus ;

Ggal : Gallus gallus ; Drer : Danio reno ; Eele : Electrophorus electricus ; Tamr : Torpedo marmorata ; Tcal : Torpedo californica ; Bfas : Bungarus fasciatus ; Mglu : Myxine glutinosa ; Bflo : Branchiostoma floridae ; Blan : Branchiostoma lanceolatum ; Cint : Ciona intestinalis ; Csav : Ciona savigtiyi ; Cele : Caenorhabditis elegans ; Cbrig : Caenorhabditis briggsae ; Dviv : Dictyocaulus viviparus ; Lopa : Loligo opalescens.

- la figure 4 illustre le cladogramme des protéines AChEl et AChE2.

Les séquences des protéines AChEl et AChE2 ont été traitées comme à la figure 1. La séquence Bmic a été ajoutée comme séquence externe pour définir l'origine de l'arbre.

Les cadres marqués d'une astérisque représentent les protéines codées par un gène qui ségrège avec la résistance aux insecticides. Les cadres vides représentent les protéines codées par un gène qui ne ségrègue pas avec la résistance aux insecticides. L'échelle correspond à une divergence de 10 %.

- la figure 5 illustre la comparaison des séquences en acides aminés de la protéine AChE1 de C. pipiens, entre une souche sensible (S-LAB) et une souche résistante (SR) aux insecticides. L'unique mutation glycine 247(119) # sérine 247(119) (indiquée en grisée) est responsable de la résistance aux insecticides chez les moustiques de l'espèce C. pipiens ; elle correspond à la substitution de la glycine située en position 247 de la séquence de l'AChEl de C. pipiens (ou en position 119, en référence à la séquence de l'AChE du poisson torpille), par une sérine.

- les figures 6A et 6B illustrent la comparaison des séquences nucléotidiques codant pour la protéine AChEl de C. pipiens, entre une souche sensible (S-LAB) et une souche résistante (SR) aux insecticides ; toutes les mutations sont silencieuses à l'exception de la mutation en position 739 (G o A) qui entraîne, d'une part la substitution du codon glycine (GGC) en position 247 de la séquence de la protéine AchEl de la souche sensible (S-LAB) par un codon sérine (AGC) respon- sable de la résistance aux insecticides dans la souche SR, et d'autre part, l'apparition d'un site Alu I (AGCT) dans la séquence de la souche résistante, utile pour la détection de la mutation. La mutation (G- A) en position 739 de la séquence nucléotidique et la mutation glycine X sérine en position 247 de la séquence en acides aminés sont indiquées en grisé. Les séquences des amorces utilisées pour détecter la mutation en position 739 (amorce Ex3dir et Ex3rev), ainsi que le site Alu I sont indiqués en gras et soulignés.

- la figure 7 (A, B et C) illustre la structure tridimensionnelle de l'AchEl de C. pipiens, obtenue par modélisation moléculaire à partir de la structure de l'AchE du poisson torpille : La figure 7A illustre (i) la structure globale des deux protéines et (ii) et l'encombrement stérique des liaisons de Van der Waals de la sérine 200 et de l'histidine 440 du site catalytique de l'enzyme, ainsi que celui de l'acide aminé en position 119 qui est muté dans les cas de résistance ; le résidu en position 119 est proche des résidu S200 et H440 du site catalytique.

Les figures 7B et 7C illustrent la comparaison de l'encombrement stérique des liaisons de Van der Waals des acides aminés glycine (figure 7C) et sérine (figure 7B) en position 119, de respectivement la souche sensible et résistante.

L'encombrement de la chaîne latérale de la Sérine en position 119 dans la souche résistante, réduit l'espace du site catalytique ce qui empêche vraisemblablement l'insecticide d'interagir avec la sérine catalytique (S200).

- la figure 8 illustre la détection par PCR-RFLP de la mutation glycine o sérine dans le troisième exon codant du gène ace-1, chez des moustiques de l'espèce C pipiens : 1 bande (520 pb) est détectée chez les individus homozygotes sensibles SS, 2 bandes (357 pb et 163 pb) sont détectées chez les individus homozy- gotes résistants RR et 3 bandes (520 pb, 357 pb et 163 pb) sont détectées chez les individus hétérozygotes résistants RS.

- les figures 9A et 9B illustrent la comparaison des séquences du gène ace-1 d'An. gambiae, entre une souche sensible (KISUMU) et une souche résis- tante (YAO) aux insecticides ; toutes les mutations sont silencieuses à l'exception de deux mutations : la première correspond au remplacement de la valine (CGT) en posi- tion 33 de la séquence de l'AChEl de la souche sensible (SEQ ID NO : 5) par une alanine (CGC) dans la souche résistante et la seconde est la même mutation glycine (GGC)- sérine (AGC) que celle trouvée chez Culex pipiens. La mutation glycine (GGC) o sérine (AGC) entraîne l'apparition d'un second site Alu I (AGCT) dans la séquence du troisième exon codant de la souche résistante, utile pour la détection de la mutation. Les séquences codantes du gène ace-1 sont indiquées en gras et les muta- tions sont indiquées en grisé. Les séquences des amorces Ex3AGdir et Ex3Agrev

utilisées pour détecter la mutation glycine (GGC) e sérine (AGC), ainsi que les sites Alu I du troisième exon codant sont indiqués en gras et soulignés.

- la figure 10 illustre la quantification de l'activité acétylcholinesté- rase des protéines recombinantes AChEl de Culex pipiens, sensibles (S-LAB, barres blanches) et résistantes (SR, barres grisées), produites en cellules d'insecte S2, par comparaison avec celle de broyats de C. pipiens de souche S-LAB (barres blanches hachurées) et de souche SR (barres grisées hachurées). L'activité acétylcholinestérase des extraits cellulaires et des broyats de moustiques a été mesurée en l'absence (C) et en présence de 104M et 10-2M de propoxur. L'unique mutation glycine2477p ;- >sérine247 (119) rend l'acétylcholinestérase insensible à l'insecticide.

- la figure 11 illustre la détection par PCR-RFLP de la mutation glycine o sérine dans le troisième exon codant du gène ace-1, chez des moustiques de l'espèce Culex pipiens, Anopheles gambiae et Anopheles albimanus : 1 bande (194 pb) est détectée chez les individus homozygotes sensibles S S, 2 bandes (74 pb et 120 pb) sont détectées chez les individus homozygotes résistants RR et 3 bandes (194 pb, 74 pb et 120 pb) sont détectées chez les individus hétérozygotes résistants SS.

- la figure 12 illustre la quantification de l'activité acétylcholinesté- rase des protéines AChEl de respectivement Culex pipiens, Anopheles gambiae et Anoplzeles albimanus sensibles (SS, barres grisées) et résistantes (RS, bandes noires et RR, bandes blanches).

- la figure 13 représente l'alignement des séquences nucléotidiques du fragment de 194 pb d'Anopheles gambiae, de Culex pipiens et d'Anopheles albimanus, sensibles (S) ou résistants (R). Fond grisé clair : séquences correspondant aux amorces Moustdirl et Moustrevl. Fond grisé : site Alu I. Fond grisé foncé : Guanine du codon Gly des individus sensibles.

- la figure 14 représente les séquences nucléotidiques du fragment de 194 pb d'Anopheles albimanus sensible (S) et résistant (R). Le codon spécifiant Gly (GGC) et Ser (AGC) est en gras. Le site Alu I est souligné.

Tableau II : Liste des séquences<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> Numéro Séquence<BR> <BR> <BR> <BR> d'identification<BR> <BR> <BR> <BR> <BR> SEQ ID NO : 1 fragment de la région centrale de la protéine AChE1 Anopheles<BR> <BR> <BR> <BR> gambiae (positions 70 à 593 de la SEQ ID NO : 3).<BR> <BR> <BR> <BR> <P> SEQ ID NO : 2 ADNc AChE1 Anopheles gambiae<BR> <BR> <BR> <BR> SEQ ID NO : 3 Protéine AChE1 Anopheles gambiae<BR> <BR> <BR> <BR> SEQ ID NO : 4 ADNc AChE1 Anopheles gambiae (souche KISUMU)<BR> <BR> <BR> <BR> SEQ ID NO : 5 Protéine AChE1 Anopheles gambiae (souche KISUMU)<BR> <BR> <BR> <BR> SEQ ID NO : 6 ADNc AChE1 Culex pipiens souche S-LAB (séquence complète)<BR> <BR> <BR> <BR> SEQ ID NO : 7 Protéine AChE1 Culex pipiens souche S-LAB (séquence complète)<BR> <BR> <BR> <BR> SEQ ID NO : 8 fragment peptidique K AChE1 Culex pipiens<BR> <BR> <BR> <BR> SEQ ID NO : 9 fragment peptidique K AChE1 Aedes aegypti<BR> <BR> <BR> <BR> <BR> SEQ ID NO : 10 fragment peptidique K AChE1 Aedes albopictus<BR> <BR> <BR> <BR> SEQ ID NO : 11 fragment peptidique K peptidique AChE1 Anopheles darlingi<BR> <BR> <BR> <BR> SEQ ID NO : 12 fragment peptidique K AChE1 An. sundaicus<BR> <BR> <BR> <BR> SEQ ID NO : 13 fragment peptidique K AChE1 An. minimus<BR> <BR> <BR> <BR> SEQ ID NO : 14 fragment peptidique K AChE1 An. moucheti<BR> <BR> <BR> <BR> SEQ ID NO : 15 fragment peptidique K AChE1 An. arabiensis<BR> <BR> <BR> <BR> SEQ ID NO : 16 fragment peptidique K AChE1 An. funestus<BR> <BR> <BR> <BR> SEQ ID NO : 17 fragment peptidique K AChE1 An. pseudopunctipennis<BR> <BR> <BR> <BR> SEQ ID NO : 18 fragment peptidique K AChE1 An. sacharovi<BR> <BR> <BR> <BR> SEQ ID NO : 19 fragment peptidique K AChE1 An. stephensi<BR> <BR> <BR> <BR> SEQ ID NO : 20 fragment peptidique K AChE1 An. albimanus<BR> <BR> <BR> <BR> <BR> SEQ ID NO : 21 fragment peptidique K AChE1 An. niG<BR> <BR> <BR> <BR> SEQ ID NO : 22 gène ace-1 An. gambiae<BR> <BR> <BR> <BR> SEQ ID NO : 23 gène ace-1 An. gambiae KISUMU<BR> <BR> <BR> <BR> SEQ ID NO : 24 fragment nucléotidique K AChE1 C. pipiens (souche S-LAB)<BR> <BR> <BR> <BR> SEQ ID NO : 25 fragment nucléotidique K AChE1 C. pipiens (souche SR)<BR> <BR> <BR> <BR> SEQ ID NO : 26 fragment nucléotidique K AChE1 Aedes aegypti<BR> <BR> <BR> <BR> SEQ ID NO : 27 fragment nucléotidique K AChE1 Aedes albopictus (AJ 438598)<BR> <BR> <BR> <BR> SEQ ID NO : 28 fragment nucléotidique K AChE1 Anopheles darlingi (AJ 438599)<BR> <BR> <BR> <BR> SEQ ID NO : 29 fragment nucléotidique K AChE1 An. sundaicus (AJ 438600)<BR> <BR> <BR> <BR> SEQ ID NO : 30 fragment nucléotidique K AChE1 An. minimus (AJ 438601)<BR> <BR> <BR> <BR> SEQ ID NO : 31 fragment nucléotidique K AChE1 An. moucheti (AJ 438602)<BR> <BR> <BR> <BR> <BR> SEQ ID NO : 32 fragment nucléotidique K AChE1 An. arabiensis (AJ 438603)<BR> <BR> <BR> <BR> SEQ ID NO : 33 fragment nucléotidique K AChE1 An. funestus (AJ 438604)<BR> <BR> <BR> <BR> SEQ ID NO : 34 fragment nucléotidique K AChE1 An. pseudopunctipennis (AJ 538605) #<BR> <BR> <BR> <BR> SEQ ID NO : 35 fragment nucléotidique K AChE1 An. sacharovi (AJ 538606)<BR> <BR> <BR> <BR> SEQ ID NO : 36 fragment nucléotidique K AChE1 An. stephensi (AJ 538607)<BR> <BR> <BR> <BR> SEQ ID N0 : 37 fragment nucléotidique K AChE1 An. albimanus (AJ 538608)<BR> <BR> <BR> <BR> SEQ ID NO : 38 fragment nucléotidique K AChE1 An. nili (AJ 538609)<BR> <BR> <BR> <BR> SEQ ID NO : 39 amorce PkdirAGSG<BR> <BR> <BR> <BR> SEQ ID N0 : 40 amorce PkrevAGSG<BR> <BR> <BR> <BR> SEQ ID NO : 41 amorce PbdirAGSG<BR> <BR> <BR> <BR> SEQ ID NO : 42 amorce PbrevAGSG SEQ ID NO : 43 amorce culex-bdirl

SEQ ID NO : 44 amorce culex-krevl SEQ ID NO : 45 amorce AG1-Adir SEQ ID NO : 46 amorce AG1-Arev SEQ ID NO : 47 amorce AG1-Bdir SEQ ID NO : 48 amorce AG1-Brev SEQ ID NO : 49 amorce AG1-Cdir SEQ ID NO : 50 amorce AG1-Crev SEQ ID NO : 51 Protéine AChE1 Ciona intestinalis SEQ ID NO : 52 Protéine AChE1 Ciona savignyi SEQ ID NO : 53 Protéine AChE2 Anopheles gambiae SEQ ID NO : 54 Amorce culex-5'dir SEQ ID NO : 55 Amorce culex-3'dir SEQ ID NO : 56 ADNc AChE1 C. pipiens souche SR (séquence codante complète) SEQ ID NO : 57 Protéine AChE1 C. pipiens souche SR (séquence complète) SEQ ID NO : 58 Amorce Ex3dir SEQ ID NO : 59 Amorce Ex3rev SEQ ID NO : 60 Fragment nucléotidique du troisième exon codant souche Espro-P*-R**** SEQ ID NO : 61 Fragment nucléotidique du troisième exon codant souche Pro-R-Q**-S SEQ ID NO : 62 Fragment nucléotidique du troisième exon codant souche S-LAB-Q-S***** SEQ ID NO : 63 Fragment nucléotidique du troisième exon codant souche Padova-P-R SEQ 1D NO : 64 Fragment nucléotidique du troisième exon codant souche Praias-P-R SEQ ID NO : 65 Fragment nucléotidique du troisième exon codant souche Supercar-Q-R SEQ ID NO : 66 Fragment nucléotidique du troisième exon codant souche BrugesA-P-S SEQ ID NO : 67 Fragment nucléotidique du troisième exon codant souche BQ-Q-R SEQ ID NO : 68 Fragment nucléotidique du troisième exon codant souche DJI-Q-R SEQ ID NO : 69 Fragment nucléotidique du troisième exon codant souche Harare-Q-R SEQ ID NO : 70 Fragment nucléotidique du troisième exon codant souche Martinique-Q-R SEQ ID NO : 71 Fragment nucléotidique du troisième exon codant souche Barriol-P-R SEQ ID NO : 72 Fragment nucléotidique du troisième exon codant souche Bleuet-P-S SEQ ID NO : 73 Fragment nucléotidique du troisième exon codant souche BrugesB-P-S SEQ ID NO : 74 Fragment nucléotidique du troisième exon codant souche Heteren-P-S SEQ ID NO : 75 Fragment nucléotidique du troisième exon codant souche Ling-Q-S SEQ ID NO : 76 Fragment nucléotidique du troisième exon codant souche Mao-Q-S SEQ ID NO : 77 Fragment nucléotidique du troisième exon codant souche TemR-Q-S SEQ ID NO : 78 Fragment nucléotidique du troisième exon codant souche Uppsala-T***-S SEQ ID NO : 79 Fragment nucléotidique du troisième exon codant souche Trans-Q-S SEQ ID NO : 80 Fragment nucléotidique troisième exon codant souche BEQ-Q-S SEQ ID NO : 81 Fragment nucléotidique troisième exon codant souche BSQ-Q-S SEQ ID NO : 82 Fragment nucléotidique troisième exon codant souche Brazza-Q-S SEQ ID NO : 83 Fragment nucléotidique du troisième exon codant souche Bouaké-Q-R SEQ lD NO : 84 Fragment nucléotidique du troisième exon codant souche Thai-Q-S SEQ ID NO : 85 Fragment nucléotidique du troisième exon codant souche Madurai-Q-S SEQ ID NO : 86 Fragment nucléotidique du troisième exon codant souche Recife-Q-R SEQ ID NO : 87 Fragment nucléotidique du troisième exon codant souche Brésil Q-S SEQ ID NO : 88 Fragment nucléotidique du troisième exon codant souche Moorea Q-S SEQ ID NO : 89 Fragment nucléotidique du troisième exon codant souche Killcare P-S SEQ ID NO : 90 (1) SEQ ID NO : 91 (1) SEQ ID NO : 92 (1) SEQ ID NO : 93 (1)

SEQ ID NO : 94 (1) SEQ ID NO : 95 (1) SEQ ID NO : 96 (1) SEQ ID NO : 97 (1) SEQ ID NO : 98 (1) SEQ ID NO : 99 (1) SEQ ID NO : 100 (1) SEQ ID NO : 101 (1) SEQ ID NO : 102 (1) SEQ ID NO : 103 (1) SEQ ID NO : 104 (1) SEQ ID NO : 105 (1) SEQ ID NO : 106 (1) SEQ ID NO : 107 (1) SEQ ID NO : 108 (1) SEQ ID NO : 109 (1) SEQ ID NO : 110 (1) SEQ ID N0 : 111 (1) SEQ ID NO : 112 (1) SEQ ID NO : 113 (1) SEQ ID NO : 114 (1) SEQ ID NO : 115 (1) SEQ ID NO : 116 (1) SEQ ID NO : 117 (1) SEQ ID NO : 118 (1) SEQ ID NO : 119 (1) SEQ ID NO : 120 gène ace-1 An. gambiae souche YAO SEQ ID NO : 121 ADNc AChE1 An. gambiae souche YAO (séquence codante complète) SEQ ID NO : 122 protéine AChE1 An. gambiae souche YAO (séquence complète) SEQ ID NO : 123 amorce Ex3 AG dir SEQ ID NO : 124 amorce Ex3 AG rev SEQ ID NO : 125 ADNc AChE1 An. gambiae souche KISUMU (séquence complète) SEQ ID NO : 126 protéine AChE1 An. gambiae souche KISUMU (séquence complète) SEQ ID NO : 127 gène ace-1 d'An. gambiae (incluant 2 exons 5'non-codants) SEQ ID NO : 128 amorce Moustdirl SEQ ID NO : 129 amorce Moustrevl * P = Culex pipiens pipiens (sous-espèce pipiens) ** Q = Culexpipiens quinquefasciatus (sous espèce quinquefasciatus) *** T = Culex torrentiutn **** R= résistant ***** S = sensible (1) fragments peptidiques du troisième exon codant correspondants aux fragments nucléotidiques SEQ ID NO : 60 à 89 Les séquences nucléotidiques (SEQ ID NO : 27 à 38) et les séquences peptidiques correspondantes (SEQ ID NO : 10 à 21) ont été soumises le 8 mars 2002 à différentes banques de séquences, mais n'ont été rendues accessibles que le 30

novembre 2002 dans la base de séquences EMBL et le 11 janvier 2003 dans la base de séquences GENBANK.

EXEMPLE 1 : Matériels et méthodes a) Souches et croisements Cinq souches de C. pipiens ont été utilisées : S-LAB, une souche standard sensible aux insecticides (Georghiou et al., 1966, Bull. Wld. Hlth Org., 35, 691-708), SA1, SA4 et EDIT qui possèdent une seule AChE sensible aux insecticides, et SR qui est homozygote pour une AChE insensible aux insecticides (Berticat et al., Genet. Res., 2002,79, 41-47). Les souches possédant une AChE sensible et insensible sont dénommées respectivement S et R. b) Nomenclature des gènes ace et numérotation des séquences d'acides aminés ace-1 représente le locus codant pour une AChE cholinergique res- ponsable de la résistance aux organophosphorés et/ou aux carbamates chez C. pipiens (AChEl), précédemment dénommé Ace. 1 (Raymond et al., Genetica, 2001,112/113, 287-296). ace-2 représente le second locus ace, qui n'est pas impliqué dans la résis- tance aux insecticides chez C. pipiens (précédemment dénommé Ace. 2), dont la fonc- tion est inconnue chez C. pipiens. L'unique gène ace présent dans Drosophila melanogaster, qui est homologue à ace-2, est donc dénommé de même.

Dans les analyses qui suivent, les positions des résidus d'acides aminés sont indiquées en référence à la séquence de l'AChE du poisson torpille [Torpedo californica ; GENBANK P04058], selon la nomenclature recommandée par Massoulié et al., 1992, In Multidisciplinary approaches to cholinesterase functions, eds, Schafferman, A. & Velan, B. (Plenum Press New York), p 285-288]. c) Analyse de la transmission du gène ace-1 Les femelles étant indiquées en premier, des croisements FI (S X R) et des croisements en retour (FI X S-LAB et S-LAB X FI) ont été obtenus par croisement en masse d'adultes. Quelques larves issues des croisements en retour ont été traitées avec une dose de carbamate (propoxur, 4mg/L) qui tue 100 % des larves sensibles. La liaison entre ace-1 et la résistance au propoxur a été étudiée par RFLP chez les larves survivantes, à partir d'un produit PCR de 320 pb permettant d'identifier les allèles S et R. Les expériences ont été réalisées de façon indépendante, avec S = SA1, S = SA4 et S = EDIT.

d) Analyse des séquences et assemblage des gènes Toutes les analyses de séquences ont été effectuées à partir des séquences brutes d'Anopheles gambiae disponibles sur le serveur INFOBIOGEN (http ://www. infobiogen. fr) et des outils disponibles sur le site (http : //www. ncbi. nlm. nih. gov/blast/blast). Les séquences génomiques codant une AChE ont été identifiées à l'aide des logiciels TBLASTN et BLAST (Altschul et al., J.

Biol. Mol., 1990,215, 403-410). Les séquences génomiques identifiées ont été assem- blées à l'aide du logiciel ABI Prism Auto-Assembler (v2.1, PERKIN ELMER). Les séquences ont été vérifiées et corrigées à l'aide du logiciel Ensembl Trace Server (http : //trace. ensembl. org/). Deux concaténations de respectivement 5195 et 6975 paires de bases, codant respectivement pour AChEl et AChE2 ont été assemblées à partir de respectivement 64 et 74 séquences indépendantes (redondance moyenne de 10,5 et 6,5). Les exons et les séquences protéiques ont été identifiés à l'aide d'une combinai- <BR> <BR> son entre les logiciels FGENESH (http : //www. sanger. uk) et BLASTX (http ://www. ncbi. nlm. nih. gov). Les séquences génomiques d'AChE d'ascidies ont été assemblées à partir de séquences brutes déposées dans les bases de données du NCBI (Ciona savignyi) et du Doe Joint Institute (Ciona intestinalis, http : llwww. igi. doe. govlprogramslcionalciona-mainage. html). Les recherches dans les bases de données de Drosophila ont été effectuées à l'aide de Flybase (http ://www. fruitfly. org/). e) Comparaisons de séquences Les séquences des protéines AChEl et AChE2 d'Anopheles gambiae déduites des séquences génomiques et les séquences peptidiques déduites de fragments PCR de C. pipiens et A. aegypti ont été alignées avec celles des AChE connues, à l'aide du logiciel ClustalW, en utilisant une matrice BLOSUM et des paramètres par défaut (Thompson et al., N. A. R., 1994,22, 4673-4680).

Un arbre phylogénétique a été construit en utilisant l'algorithme du plus proche voisin (neighbour-joining algorithm) de la version DDBJ de Clustal W (http ://hypernig. nig. ac. ip/homology/exclustalw-e. shtml). L'analyse de type Bootstrap (1000 comptages et 111 valeurs d'entrée) a été utilisée pour évaluer les degrés de confiance pour la topologie de l'arbre. La construction des arbres a été réali- sée à l'aide du logiciel Treeview (v1. 6.6).

f) Numéros d'accession Les numéros des séquences (numéros d'accession dans les bases de données ou les numéros d'identification dans la liste de séquences) ayant servi à l'analyse génétique sont les suivants.

- Craniata : Homo sapiens : NP00046 ; Bos taurus : P23795 ; Felix catus : 06763 ; Oryctolagus cuniculus : Q29499 ; Rattus norvegicus : P36136 ; Mus musculus : P21836 ; Gallus gallus : CAC37792 ; Danio reno : Q9DDE3 ; Electropho- rus electrics : 6730113 ; Torpedo marmorata : P07692 ; Torpedo californica : P04058 ; Bungarusfasciatus : Q92035 ; Myxine glutinosa : Q92081.

- Cephalocordés : Branchiostoma floridae : 076998 et 076999 ; Branchiostoma lanceolatum : Q95000 et Q95001.

- Urocordés : Ciona intestinalis : SEQ ID NO : 51 ; Ciona savignyi : SEQ ID NO : 52.

-Nématodes : Caenorhabditis elegans (1 à 4) : P38433,061371, 061459 et 061372 ; Caenorhabditis briggsae (1 à 4) Q27459,061378Q9NDG9 et Q9NDG8 ; Dictyocaulus viviparus : Q9GPLO.

- Insectes : Anopheles gambiae (1 et 2) : SEQ ID NO : 3 et SEQ ID NO : 53 (BM 629847 et BM 627478) ; Aedes aegypti (1 et 2) : SEQ ID NO : 9 et AAB3500 ; An. stephensi : P56161 ; Culex pipiens : SEQ ID NO : 7 (ace-1) et Esther data base pour ace-2 ; Drosophila melanogaster : P07140 ; Lucilia cuprina : P91954 ; Musca domestica : AAK69132. 1 ; Leptinotarsa decenzlineata : Q27677 ; Apis mellifera : AAG43568 ; Nephotettix cincticeps : AF145235_1 ; Schizaphis graminum : Q9BMJ1.

- Arachnides : Rhipicephalus appendiculatus : 062563 ; Boophilus rrzicroplus (1 et 2) : 045210 et 061864 ; Boophilus decoloratus : 061987 ; - Mollusques : Loligo opalescens : 097110. g Clonage du fragment K et sénotvpage d'ce-7 chez Culex pipiens L'ADN de moustique a été extrait comme décrit dans Rogers et al., <BR> <BR> [Plant Molecular Biology manual, 1988, eds. Gelvin, S. B. 1 Schilperoot, R. A. (Kluwer Academic Publishers, Boston), VolA6, pl-10]. Les oligonucléotides PkdirAGSG (5'- ATMGWGTTYGAGTACACSGAYTGG-3', SEQ ID NO : 39) et PkrevAGSG (5'- GGCAAARTTKGWCCAGTATCKCAT-3', SEQ ID NO : 40) amplifient un fragment

de 320 pb (fragment K) à partir de l'ADN génomique de plusieurs moustiques. 30 cycles d'amplification PCR ont été réalisés dans les conditions suivantes : 94°C pendant 30s, 50°C pendant 30s à et 72°C pendant 30s. Les séquences ont été détermi- nées directement sur les produits PCR sur un séquenceur ABI prism 310, à l'aide du kit Big Dye Terminator.

Le génotypage d'ace-1 chez Culex est réalisé dans les conditions suivantes : Les fragments K obtenus comme décrit précédemment sont digérés par EcoRI et le produit de digestion est séparé par électrophorèse sur un gel d'agarose à 2%. Les profils de restriction montrent : 1 bande (320 pb) chez les moustiques homo- zygotes résistants RR, 2 bandes (106 pb et 214 pb) chez les moustiques homozygotes SS et 3 bandes (103 pb, 214 pb et 320 pb) chez les moustiques hétérozygotes RS. h) Clonage de l'ADNc d'ace-1 chez les individus sensibles et résistants L'ADNc du gène ace-1 de Culex pipiens a été obtenu à partir de l'ARN extrait d'individus de la souche sensible de référence S-LAB et de la souche résistante SR, au tout premier stade de développement larvaire L1. La transcription inverse a été réalisée avec un oligonucléotide 18T et la SuperScriptIIRNaseH (IN VITROGEN), selon les conditions recommandées par le fabricant.

-souche S-LAB Deux fragments d'ADNc ont été amplifiés par PCR à l'aide d'oligo- nucléotides dégénérés obtenus à partir de l'alignement des séquences des gènes ace-1 d'Anopheles gambiae et de Schizaphis graminum : - un fragment b (193pb) a été amplifié à l'aide du couple d'amorces PbdirAGSG (5'GGYGCKACMATGTGGAAYCC3', SEQ ID NO : 41) et PbrevAGSG (5'ACCAMRATCACGTTYTCYTCCGAC3', SEQ ID NO : 42).

- un fragment k (320pb) a été amplifié à l'aide du couple d'amorces PkdirAGSG (5'ATMGWGTTYGAGTACACSGAYTGG3', SEQ ID NO : 39) et PkrevAGSG (5'GGCAAARTTKGWCCAGTATCKCAT3', SEQ ID NO : 40).

Les fragments b et k ainsi obtenus ont ensuite été clonés et séquencés, selon les techniques classiques connues en elles-mêmes de l'Homme du métier, telles que décrites dans Current Protocols in Molecular Biology (Frederick M. AUSUBEL, 2000, Wiley and son Inc, Library of Congress, USA).

Un fragment d'ADNc de plus grande taille a été amplifié par PCR, à l'aide d'amorces spécifiques de Culexpipiens déduites des séquences des fragments b et k précédemment obtenues. A savoir : - un fragment CulexA (1127 pb) a été amplifié par PCR à l'aide du couple d'amorces amorces : culex-bdirl (5'TACATCAACGTGGTCGTGCCACG3', SEQ ID NO : 43) et culex-krevl (5'GTCACGGTTGCTGTTCGGG3', SEQ ID NO : 44). Le fragment Culex A de 1127 pb ainsi obtenu a ensuite été cloné et séquencé, comme ci-dessus.

Les extrémités des ADNc ont été amplifiées par la technique RACE (Rapid Amplif cation of cDNA Ends), à l'aide d'un kit commercial (du kit Gene Racer (IN VITROGEN) selon les conditions indiquées dans le manuel d'utilisation. Ensuite elles ont été clonées puis séquencées, comme ci-dessus.

- souche SR La séquence complète de l'ADNc du gène ace-1 de la souche résis- tante SR a été amplifiée par PCR à l'aide des amorces culex-5'dir (5'- CCACACGCCAGAAGAAAAGA-3', SEQ ID NO : 54) et culex-3'dir (5'- AAAAACGGGAACGGGAAAG-3, SEQ ID NO : 55) et le fragment de 2497 pb ainsi obtenu a été cloné et séquencé, comme ci-dessus. i) Clonage du gène ace-1 chez les individus sensibles et résistants L'ADN génomique de la souche KISUMU (souche sensible de réfé- rence de l'Afrique de l'Ouest) et de la souche YAO (souche résistante isolée en Côte d'ivoire) d'A. gambiae a été extrait à partir d'individus homozygotes comme décrit dans Rogers et al., [Plant Molecular Biology manual, 198S, eds. Gelvin, S. B. 1 Schilperoot, R. A. (Kluwer Academic Publishers, Boston), VolA6, pl-10].

3 fragments chevauchants (A, B et C) ont été amplifiés dans les conditions suivantes : 94°C pendant 30s, 50°C pendant 30s à et 72°C pendant 30s (30 cycles), à l'aide d'amorces synthétisées à partir de la séquence du gène ace-1. A savoir : - le fragment A (1130pb) a été amplifié à l'aide du couple d'amorces AG1-Adir (5'CGACGCCACCTTCACA3', SEQ ID NO : 45) et AGI-Arev (5'GATGGCCCGCTGGAACAGAT3', SEQ ID NO : 46),

- le fragment B (1167pb) a été amplifié à l'aide du couple d'amorces AGI-Bdir (5'GGGTGCGGGACAACATTCAC3', SEQ ID NO : 47) et AG1-Brev (5'CCCCGACCGACGAAGGA3', SEQ ID NO : 48), et - le fragment C (876pb) a été amplifié à l'aide du couple d'amorces AGI-Cdir (5'AGATGGTGGGCGACTATCAC3', SEQ ID NO : 49) et AG1-Crev (5'CTCGTCCGCCACCACTTGTT3', SEQ ID NO : 50).

Les séquences des fragments A, B et C ont été déterminées directe- ment sur les produits PCR, à l'aide d'oligonucléotides internes, inclus dans ces frag- ments, en utilisant le kit Big Dye Terminator et un séquenceur ABI prism 310. j) détection de la mutation du troisième exon codant responsable de la résistance aux insecticides chez les moustiques des espèces C. pipiens et An. gambiae L'ADN de moustique a été extrait comme décrit dans Rogers et al., précité, puis un fragment du troisième exon codant a été amplifié par PCR, séquencé et la mutation dans la séquence codante du troisième exon codant a été détectée par PCR-RFLP, selon le principe tel que décrit ci-dessus pour le fragment K.

- pipiens Un fragment de 520 pb du troisième exon codant a été amplifié à partir de l'ADN génomique de plusieurs moustiques, par PCR à l'aide du couple d'amorces : - Ex3dir 5'-CGACTCGGACCCACTGGT-3' (SEQ BD NO : 58) et - Ex3rev 5'-GTTCTGATCAAACAGCCCCGC-3' (SEQ ID NO : 59).

Le fragment ainsi obtenu a été digéré par Alu I et le produit de digestion séparé par électrophorèse sur un gel d'agarose à 2%. Les profils de restric- tion attendus sont les suivants : 1 fragment (520 pb) chez les individus homozygotes sensibles SS, 2 fragments (357 pb et 163 pb) chez les individus homozygotes résis- tants RR et 3 fragments (520 pb, 357 pb et 163 pb) chez les individus hétérozygotes résistants RS.

-An gambiae Un fragment de 541 pb du troisième exon codant a été amplifié à partir de l'ADN génomique de plusieurs individus, par PCR à l'aide du couple d'amorces : - Ex3AGdir 5'-GATCGTGGACACCGTGTTCG-3' (SEQ ID NO : 123) et

- Ex3AGrev 5'-AGGATGGCCCGCTGGAACAG-3' (SEQ ID NO : 124).

Le fragment ainsi obtenu a été digéré par Alu I et le produit de séparé par électrophorèse sur un gel d'agarose à 2%. Les profils de restriction attendus sont les suivants : 2 fragments (403 pb et 138 pb) chez les individus homozygotes sensibles SS, 3 fragments (253 pb, 150 pb et 138 pb) chez les individus homozygotes résistants RR et 4 fragments (403 pb, 253 pb, 150 pb et 138 pb) chez les individus hétérozygotes résistants RS ; étant donné que les fragments de 150 pb et 138 pb co- migrent, les individus homozygotes et hétérozygotes résistants sont détectés respecti- vement par la présence de 2 bandes (253 pb et environ 150 pb) et de 3 bandes (403 pb, 253 pb et environ 150 pb) en gel d'agarose.

- C. pipiens. An. gambiae et An. albimanus Un fragment de 174 pb du troisième exon codant a été amplifié à partir de l'ADN génomique de plusieurs moustiques, par PCR à l'aide du couple d'amorces : - Moustdirl : 5'CCGGGNGCSACYATGTGGAA 3' (SEQ ID NO : 128), et -Moustrevl : 5'ACGATMACGTTCTCYTCCGA 3' (SEQ ID NO : 129).

Le fragment ainsi obtenu a été digéré par Alu I et le produit de digestion séparé par électrophorèse sur un gel d'agarose à 2 %. Les profils de restric- tion attendus sont les suivants : 1 fragment (194 pb) chez les individus homozygotes sensibles SS, 2 fragments (74 pb et 120 pb) chez les individus homozygotes résistants RR et 3 fragments (194 pb, 74 pb et 120 pb) chez les individus hétérozygotes résis- tants RS.

Les résultats sont illustrés à la figure 11.

La figure 12 montre que l'on obtient avec des moustiques An albirnanus résistants par test biochimique classique, les mêmes caractéristiques d'inhibition par le propoxur que pour les moustiques An. gambiae et C. pipiens.

L'application du test diagnostique, également dénommé"G119S", à l'aide de l'amplimère Moustdirl et Moustrevl révèle la présence d'un site AluI associé à la résistance (Figure 11). Le séquençage des fragments amplifiés d'An. albimanus

confirme la substitution du codon Gly GGC chez les individus SS en codon Ser AGC chez les individus RR (figures 13 et 14). k) Mesure de l'activité acétylcholinestérase Les ADNc codant les AchEl de respectivement la souche S-LAB et la souche SR ont été clonées dans le vecteur d'expression eucaryote pAc5. 1/V5-His (INVITROGEN), selon les techniques classiques d'ADN recombinant en suivant les protocoles standards tels que ceux décrits dans Current Protocols in Molecular Biology, précité. Des cellules de drosophile (cellules de Schneider S2) ont été trans- fectées par les vecteurs recombinants ainsi obtenus, à l'aide du réactif Fugen@ (ROCHE), en suivant les instructions du fabricant. 24 heures après la transfection, les cellules ont été récoltées par centrifugation puis lysées dans du tampon phosphate 0.25M contenant 1% Triton X-100. L'activité acétylcholinestérase des extraits cellu- laires obtenus a été mesurée, en présence ou en l'absence d'insecticide (propoxur), par la méthode telle que décrite dans Bourguet et al., Biochemical Genetics, 1996,34, 351-362.

EXEMPLE 2 : Mise en évidence de 2 gènes ace chez Anopheles gambiae Des gènes homologues des gènes d'acétylcholinestérases humaines et de drosophiles ont été recherchés à partir de fragments de séquences déposées dans les bases de données, en utilisant le logiciel TBLASTN. Deux groupes de fragments distincts codant pour une AChE très similaire à celle de la drosophile ont été identi- fiés. Deux gènes de respectivement 6975 pb (ace-1) et 5195 pb (ace-2) ont été reconstruits à partir de fragments chevauchants de chaque groupe. L'analyse des gènes à l'aide des logiciels FGENESH et BLASTX montre que les gènes ace-1 et ace-2 sont constitués respectivement d'au moins 7 et 8 exons codant pour des protéines d'environ 534 et 569 acides aminés, dénommées respectivement AChEl et AChE2. Toutefois, cette analyse n'a pas permis de déterminer avec certitude la séquence des extrémités 5' et 3'de l'ADNc et les séquences NH2 et COOH des protéines correspondantes, qui ne sont pas conservées entre les différentes AChE.

L'analyse des séquences en acides aminés confirme que les protéines AChE1 et d'AChE2 sont très homologues à l'AChE de Drosophila (BLASTP : P < e~ iso) et contiennent un motif canonique FGESAG autour de la sérine en position 200, en référence à la séquence de l'Ache de Torpedo (S2oo figure 1), qui est caractéristique

du site actif des AchE. En outre d'autres motifs caractéristiques des AChE ont égale- ment été retrouvés dans les deux séquences (AChEl et AChE2) : le site de liaison à la choline (résidu Tryptophane en position 84, W84), les trois résidus de la triade cataly- tique (résidus sérine, acide glutamique et histidine, respectivement en positions 200, 327 et 440 : S200, E327 et H44o), les six résidus cystéine potentiellement impliqués dans des ponts disulfures conservés (C67-C94 ; C254-C26s ; C402-Cs21), et des résidus aromati- ques bordant la gorge du site actif (10 et 11 résidus, respectivement pour AChEl et AChE2).

Dans les deux séquences, on observe la présence d'un résidu phénylalanine en position 290 (F290) mais pas en position 288 ; cette caractéristique commune aux AChE d'invertébrés est responsable d'une plus large spécificité de subs- trat des AChE d'invertébrés, par rapport à celles de vertébrés.

L'analyse des séquences C-terminales des AChE de diptère montre la présence d'un peptide hydrophobe correspondant à un signal d'addition d'un glyco- lipide, indiquant le clivage post-traductionnel d'un fragment C-terminal et l'addition d'une résidu d'ancrage glycolipidique comme chez Drosophila et d'autres espèces de moustiques. Dans toutes les séquences on observe également la présence d'un résidu cystéine dans la séquence C-terminale précédant le site potentiel de clivage du peptide hydrophobe. Ce résidu cystéine pourrait être impliqué dans une liaison disulfure intermoléculaire, liant les deux sous-unités catalytiques du dimère d'AChE.

Les protéines AChEl et AChE2 d'An. gambiae présentent 53 % de similarité entre elles et montrent respectivement : 76 % et 55 % de similarité avec l'AChE de Schizaphis graminum (numéro d'accession NCBI AAK09373 ou GENBANK 12958609), 53 % et 98 % de similarité avec l'AChE d'An. stephensi (GENBANK 2494391), 54 % et 95 % de similarité avec l'AChE d'Aedes aegypti (GENBANK 2133626), 52 % et 83 % de similarité avec l'AChE de Drosophila (GENBANK 17136862).

La différence majeure entre AChEl et AChE2 réside dans une inser- tion de 31 acides aminés dans la séquence d'AChE2 (figure 1). Cette séquence, dénommée"insertion hydrophilique"dans l'AChE de Drosophila, est absente dans les AChEs de vertébrés et de nématodes et pourrait être caractéristique de l'AChE2, au moins chez les diptères.

Ces résultats démontrent la présence de deux gènes ace dans le génome d'Anopheles gambiae, l'un codant pour AChE1 qui est apparentée à l'AChE de Schizaphis graminum, et l'autre pour AChE2 qui est apparentée à l'AChE de Drosophila et aux AChEs connues de moustiques. La présence d'autres gènes ace chez An. gambiae est très improbable dans la mesure où des recherches complémen- taires dans les bases de données du génome d'An gambiae, en utilisant des paramètres moins stringents, ont détecté uniquement des séquences codant pour des alpha-estéra- ses (EC 3.1. 1) et des carboxylestérases (EC 3.1. 1.1).

EXEMPLE 3 : Mise en évidence d'un unique gène ace chez Drosophila melano- gaster La présence d'un gène homologue du gène ace-1 a été recherchée dans le génome de Drosophila. Les recherches TBLASTN ont permis de détecter le gène ace précédemment identifié, homologue du gène ace-2 d'Anopheles gambiae mais n'ont pas permis de détecter d'autres séquences homologues du gène ace-1. Des recherches à l'aide de paramètres moins stringents ont permis de détecter uniquement des alpha et des carboxylestérases. Ces résultats démontrent que le génome de la drosophile contient un unique gène ace (ace-2).

EXEMPLE 4 : Mise en évidence d'au moins deux gènes ace chez les autres espè- ces de moustiques La présence du gène ace-1 dans le génome d'autres espèces de moustiques a été analysée par PCR à l'aide d'oligonucléotides dégénérés (PdirAGSG et PrevAGSG, SEQ ID NO : 39 et 40) permettant d'amplifier un fragment exonique (fragment K, d'environ 320 pb figure 1), correspondant à des séquences conservées entre les séquences d'AChEl d'An. gambiae et Schizaphis graminum mais divergentes entre les séquences d'AChEl et AChE2 d'An. gambiae.

La séquence des produits PCR obtenus à partir de l'ADN génomique de différentes espèces de moustiques, montre un pourcentage d'identité très élevé entre les séquences d'Anopheles, Culex et Aedes. En outre, la plupart des substitutions sont silencieuses puisque les séquences en acides aminés déduites de ces séquences nucléotidiques ne diffèrent entre elles que par 5 à 6 acides aminés (Figure 2A). Le fragment K a également été amplifié par RT-PCR à partir de l'ARNm de C. pipiens, indiquant que le gène ace-1 est exprimé sous forme d'ARNm ; ce résultat est en

accord avec l'existence, chez C. pipiens, de deux AChEs possédant des propriétés catalytiques distinctes.

EXEMPLE 5 : Analyse de la liaison entre le gène ace-1 et la résistance aux insecticides Afin d'analyser la liaison entre le gène ace-l et la résistance aux insecticides, le fragment K amplifié à partir de l'ADN génomique de C. pipiens résis- tants (souche R), a été séquencé. La comparaison des séquences du fragment K entre les souches S et R montre des différences au niveau de 3 nucléotides (substitutions silencieuses, Figure 2B). L'une de ces substitutions affecte un site EcoRl, ce qui permet de différencier facilement le locus ace-1 des souches S et R par PCR-RFLP : les profils de restriction montrent 1 bande (320 pb) chez les individus homozygotes résistants, 2 bandes (106 pb et 214 pb) chez les moustiques homozygotes SS et 3 bandes (103 pb, 214 pb et 320 pb) chez les moustiques hétérozygotes RS (figure 2C).

La liaison entre le gène ace-1 et la résistance au propoxur a été étu- diée, en triple, de la façon suivante : des larves de croisement en retour (S x R) x S ont été traitées par une dose létale pour les individus sensibles et le génotype d'ace-1 a été analysé chez les survivants, par PCR-RFLP.

Les résultats montrent que l'exposition au propoxur tue 50 % des larves dans tous les croisements en retour, c'est à dire tous les individus sensibles.

Toutes les larves survivantes (100 pour chaque croisement en retour, 300 au total) montrent un profil hétérozygote en RFLP, indiquant qu'elles possèdent toutes une copie du gène ace-1 de la souche R.

Ces résultats démontrent que le gène ace-1 est lié de façon très étroite avec la résistance aux insecticides (moins de 1 % de recombinaison avec un degré de confiance de 0,05).

EXEMPLE 6 : Analyse de la phylogénie des gènes ace-1 et ace-2.

Des arbres phylogénénétiques ont été construits à partir des séquen- ces des régions conservées des AChE d'An gambiae (SEQ ID NO : 1 et fragment 34- 393 de la séquence SEQ ID NO : 53, figure 1), des fragments K de C. pipiens et Aedes aegypti (SEQ ID NO : 8 et 9) et de 33 séquences d'AChE disponibles dans GENBANK, à l'aide de la méthode du plus proche voisin (neighbour joining method), comme décrit dans le matériels et méthodes.

La figure 3 illustre l'hétérogénéité du nombre de gènes ace au cours de l'évolution du règne animal. Chez les cordés, les céphalocordés possèdent au moins deux gènes ace alors que les urocordés n'en possèdent qu'un seul, comme déduit de l'analyse de leur génome. Chez les arthropodes, les diptères possèdent, soit un seul gène ace (Drosophila du sous-ordre des brachycères) ou deux gènes ace (moustiques du sous-ordre des nématocères). La topologie de l'arbre montre que ces deux gènes ace se sont dupliqués très précocement au cours de l'évolution, probablement avant la séparation entre les protostomes et les deutérostomes. Ces résultats sont supportés par le fait que les AChE de mollusques, de nématodes et d'arthropodes se ramifient à partir des séquences des cordés (craniatia, céphalocordés et urocordés). Les résultats montrent que les arthropodes et les nématodes possèdent une AChE apparentée.

Ces résultats indiquent que les gènes ace-1 et ace-2 identifiés chez les insectes proviennent d'un événement de duplication très ancien et que l'absence du gène ace-1, au moins chez certaines espèces du sous-ordre des brachycères (Drosophila) résulte de la perte d'un gène ace plutôt que d'une duplication récente du gène ace chez les nématocères. Ces résultats suggèrent également que les extrapola- tions faites à partir d'études chez D. melanogaster sont à considérer avec réserve dans la mesure où la situation de Drosophila n'est ni représentative des diptères ni de l'ensemble de la classe des insectes.

EXEMPLE 7 : Détermination de la séquence d'ADNc du gène ace-1 L'ADNc d'ace-1 a été cloné à partir de deux souches d'Anopheles gambiae (souche KISUMU sensible et souche YAO résistante) et de deux souches de Culex pipiens (souche S-LAB sensible et souche SR résistante), comme décrit dans le matériels et méthodes.

La séquence complète de l'ADNc de la souche KISUMU correspond à la séquence SEQ ID NO : 125 qui code pour une protéine de 737 acides aminés (SEQ ID NO : 126). La séquence complète de l'ADNc et de la protéine AChEl de la souche YAO correspondent respectivement aux séquences SEQ ID NO : 121 et SEQ ID NO : 122.

Les séquences SEQ ID NO : 4 et SEQ ID NO : 5 correspondent à la séquence quasi-complète (à l'exception du premier exon codant du gène ace-1), respectivement de l'ADNc et de la protéine AChE1 de la souche KISUMU.

La séquence complète de l'ADNc des souches S-LAB et SR de C. pipiens correspond respectivement aux séquences SEQ ID NO : 6 et SEQ ID NO : 56 qui codent pour une protéine de 702 acides aminés (SEQ ID NO : 7 et SEQ ID NO : 57, respectivement pour la souche S-LAB et la souche SR).

EXEMPLE 8 : Détermination de la séquence du gène ace-1 La séquence du gène ace-1 a été déterminée à partir de l'ADN génomique de deux souches d'Anopheles gambiae, la souche sensible de référence de l'Afrique de l'Ouest (souche KISUMU) et une souche résistante de Côte d'ivoire (souche YAO), comme décrit dans le matériels et méthodes.

La séquence complète d'An. gambiae correspond à la séquence SEQ ID NO : 127 qui présente une organisation intron-exon comprenant au moins 9 exons et incluant deux exons 5'non-codants (Tableau I) La séquence quasi-complète (à l'exception des deux premiers exons 5'non-codants) du gène ace-1 de la souche KISUMU correspond à la séquence SEQ ID NO : 23.

La séquence quasi-complète (à l'exception des deux premiers exons 5'non-codants et du premier exon codant) du gène ace-1 de la souche YAO corres- pond à la séquence SEQ ID NO : 120.

EXEMPLE 9 : Identification de mutation (s) dans la séquence en acides aminés de la protéine AChEl, responsable (s) de la résistance aux insecticides chez les moustiques des espèces Culex pipiens et Anopheles gambiae.

La séquence nucléotidique codant la protéine AChEl (ADNc) a été déterminée à partir de deux souches d'Anopheles gambiae (souche KISUMU sensible et souche YAO résistante) et de deux souches de Culex pipiens (souche S-LAB sensible et souche SR résistante), comme décrit à l'exemple 7.

Les séquences en acides aminés de la protéine AChEl des souches sensibles et résistantes, déduites des séquences précédentes, ont ensuite été alignées (figures 5,6 et 9).

La comparaison des séquences en acides aminés de la protéine AChE1 de C. pipiens (figure 5 et 6) montre qu'il existe une seule mutation non-silen- cieuse entre la souche sensible (S-LAB, SEQ ID NO : 7) et la souche résistante aux insecticides (souche SR, SEQ ID NO : 57), située dans la région codée par le troisième

exon codant du gène ace-1 : la glycine (GGC) en position 247 (ou en position 119, en référence à la séquence de l'AChE du poisson torpille) de la souche sensible est remplacée par une sérine (AGC) dans la souche résistante (G247 (119) o S247 (ll9)), La localisation de l'acide aminé en position 247 dans la structure de l'acétylcholinestérase de C. pipiens et l'effet de la substitution glycine < sérine sur cette structure ont été analysées par modélisation moléculaire à partir de la structure de l'acétylcholinestérase du poisson torpille. Les résultats sont illustrés dans la figure 7 (A, B et C). La figure 7A montre que l'acide aminé en position 119 est proche des résidus du site catalytique (S2oo et H44o). La figure 7C montre que, par comparaison avec la glycine de la souche sensible (figure 7B), l'encombrement de la chaîne latérale de la sérine de la souche résistante, réduit l'espace du site catalytique ce qui empêche vraisemblablement l'insecticide d'interagir avec la sérine catalytique (S200).

La comparaison des séquences en acides aminés de la protéine AChE1 d'An. gaznbiae montre qu'il existe deux mutations non-silencieuses entre la souche sensible (KISUMU, SEQ ID NO : 5) et la souche résistante aux insecticides (souche YAO, SEQ ID NO : 122) : la première correspond au remplacement de la valine (CGT) en position 33 de la séquence de la souche sensible (SEQ ID NO : 5) par une alanine (CGC) dans la souche résistante et la seconde est la même mutation glycine o sérine que celle trouvée chez Culex pipiens.

Etant donnée la position externe de la valine dans la structure de l'acétylcholinestérase, cette mutation n'est certainement pas impliquée dans la résis- tance chez Anopheles gambiae et seule la sérine doit être responsable de la résistance aux insecticides, à la fois chez Anopheles gambiae et Culexc pipiens.

EXEMPLE 10 : Détection de la mutation dans le troisième exon codant du gène ace-1 responsable de la résistance aux insecticides chez les moustiques des espèces Culex pipiens et Anopheles gambiae.

Le profil de restriction du troisième exon codant du gène ace-l contenant la mutation glyeine o sérine, a été vérifié dans de nombreuses populations et souches de moustiques des espèces C. pipiens et An. gambiae, sensibles et résis- tantes aux insecticides de la classe des organophosphorés et des carbamates, par PCR- RFLP selon le protocole tel que décrit à l'exemple 1.

De manière plus précise : - chez C. pipiens, la mutation glycine (GGC) e sérine (AGC) intro- duit un site Alu I (AGCT) unique dans la séquence de la souche résistante, qui est mis en évidence à partir d'un produit PCR de 520 pb, amplifié à l'aide des amorces Ex3dir et Ex3rev, comme illustré dans la figure 6.

- chez An. gambiae, la mutation glycine (GGC)-> sérine (AGC) introduit un deuxième site Alu I (AGCT) dans la séquence de la souche résistante, qui est mis en évidence à partir d'un produit PCR de 541 pb, amplifié à l'aide des amorces Ex3AGdir et Ex3AGrev, comme illustré dans la figure 9.

Les résultats de PCR-RFLP ont ensuite été vérifiés par séquençage du fragment PCR de 520 pb ou 541 pb du troisième exon codant.

- E, spèce C pipiens.

Les populations et souches de Culex pipiens, résistants (R) ou sensibles (S) qui ont été analysées sont présentées dans le Tableau III ci-dessous : Tableau III : Souches et populations de l'espèce C. pipiens analysées Classification Nom RIS* Pays Reference C. p. BO R Burkina-Faso Isolée par les inventeurs quinque HARARE R Zimbabwe Isolée par les inventeurs fasciatus SUPERCAR R Côte d'Ivoire (F. Chandre, Thèse de Doctorat, Université Paris XII, 1998). DJI R Mali Isolée par les inventeurs MARTINIQUE R Martinique Bourguet et al., Biochem. Genet., 1996, 34, 351-362 RECIFE R Brésil Isolée en 1995 par A.-B. Failloux, Institut Pasteur, Paris (France) PRO-R S Etats-Unis Georghiou et al., Bull. Wld Hlth Org., 1966,35, 691-708. S-LAB S Etats-Unis eorghiou et ai., Bull. Wld Hlth Org., 1966, 35, 691-708. TEM-R S Etats-Unis Georghiou et al., J. Econ. Entomol., 1978,71, 201-205. TRANS-P S Etats-Unis Priester et ai., J. Econ. Entomol., 1978,71, 197-200 LING S Chine eill, et al., J. American Mosquito Control Assoc ;, 2001,17, 238-244 THAI S Thailand Guillemaud et ai., Heredity, 1996,77, 535-543. MAO S Chine Qiao et al., Biochem. Genet., 1998,36, 417-426. MADURAI S Inde Nielsen-Leroux, et ai., J. Med. Entomol., 2002,39, 729-735 BSQ S Afrique duSud Isolée en 1991 par A. J. Cornel (Sth Afr. Inst. Med. Res., South Africa) BED S Afrique duSud Isolée en 1991 par A. J. Comel (Sth Afr. Inst. Med. Res., South Africa BOUAKE S Côte d'lvoire Magnin et al., J. Med. Entomol., 1988,25, 99-104 BRAZZA S Congo Beyssat-Arnaouty, Thèse de Doctorat, Université de Montpellier Il (1989). BRESIL S Brésil Isolée par les inventeurs MOOREA S Polynésie N. Pasteur, et al., Genet. Res., 1995,66, 139-146 C. p. pipiens ESPRO R Tunisie H. Ben Cheikh et al., J. Am. Mosquito Control Assoc., 1993,9, 335-337 PRAIAS R Portugal Bourguet et al., J. Econ. Entomol., 1996,89, 1060-1066 PADOVA R Italie Bourguet et al., Genetics, 1997, 147, 1225-1234. BARRIOL R France hevillon et al., Evolution, 1995,49, 997-1007. BRUGES-A S Belgique Raymond et al., Genet. Res., 1996,67, 19-26. S BRUGES-B Belgique Raymond et al., Genet. Res., 1996,67, 19-26. KILLCARE S Australie Guillemaudetal., Proc. R. Soc. Lond. B, 1997,264, 245-251. BLEUET S France Rioux et al., C. R. Séances Soc. Biol. Fil., 1961,155, 343-344 HETEREN S Pays-Bas Isolée par les inventeurs C. forrenfium UppSALA S Suède M. Raymond, Ent. Tidskr., 1995,116, 65-66.

* R/S résistant ou sensible aux insecticides de la classe des organophosphorés et des carbamates

L'analyse par PCR-RFLP de l'ensemble des moustiques du Tableau ni montre qu'il existe une corrélation parfaite entre la résistance aux insecticides et le profil de restriction par PCR-RFLP, à savoir : 1 bande (520 pb) est détectée chez les individus homozygotes sensibles SS, 2 bandes (357 pb et 163 pb) sont détectées chez les individus homozygotes résistants RR et 3 bandes (520 pb, 357 pb et 163 pb) sont détectées chez les individus hétérozygotes résistants RS (figure 8).

Ces résultats ont été confirmés par le séquençage du produit PCR de 520 pb pour l'ensemble des moustiques du Tableau III analysés par PCR-RFLP.

L'alignement des séquences obtenues (SEQ ID NO: 60 à 89), illustré dans le Tableau IV ci-dessous montre que chez les moustiques de l'espèce C. pipiens, la mutation glycine # sérine, située en position 739 en référence à la séquence de l'ADNc du gène ace-1 de la souche sensible de référence (souche S-LAB), qui est responsable de la résistance aux insecticides, provient de deux groupes de mutations indépendantes, respectivement chez C. pipiens pipiens et C. pipiens quiquefasciatus.

Tableau IV: Analyse de l'origine de la mutation glycine # sérine responsable de la résistance aux insecticides chez les moustiques de l'espèce C. pipiens Position dews mutastions en référence à la séquence d'ADNc du gène ace-1 de la souche S-LAB (SEQ ID NO: 6) 4 4 4 4 5 5 5 5 5 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 7 7 7 7 8 8 5 5 7 9 1 2 6 7 9 0 5 6 8 8 9 9 1 3 3 4 4 5 6 7 7 8 9 9 1 4 0 3 1 8 3 8 4 3 7 3 1 0 1 4 1 6 4 2 9 1 7 6 3 4 7 0 0 8 3 6 Souches de C. pipiens C. pipiens qwuiquefascia BO (R)* T C A T C G G G G C G G G C C C C C A C C T C C C C G G A T <BR> <BR> <BR> <BR> <BR> <BR> <BR> Harare (R) - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -<BR> Supercar (R) - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -<BR> DJI (R) - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -<BR> Martinique (R) - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -<BR> Recife (R) - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -<BR> ProR (S)* - T - C - - - - - - - - - - - - - - G - - - - - - - - - - G<BR> S-Lab (S) - T - C - - - - - - - - - - - - - - G - - - - - - - - - - G<BR> TemR (S) - T - - - - - A - - - - - - - - - - G - - - - - - - A - - -<BR> Trans (S) - T - - - - - A - - - - - - - - - - G - - - - - - - A - - Ling (S - T C C - - - - - - - - - - - - - - G - - - - T - - - - - - Thai (S) - T C C - - - - - - - - - - - - - - G - - - - - - - - - - G Mao (S) - T - C - - - - - - - - - - - - - - G - - - - - - - - - - - <BR> <BR> <BR> <BR> <BR> <BR> <BR> Madurai (S) - T - C - - A - - - - - - - - - - - G - - - - - - - - - - G<BR> BSQ (S) - T C C - - - - - - - - - - - - - - G - - - - - - - - - - G<BR> BE (S) - T - - - - - A - - - - - - - - - - G - - - - - - - - - - -<BR> Boualse (S) - T - C - - - - - - - - - - - - - - G - - - - - - - - - - - Brazza (S) - T C C - - - - - - - - - - - - - - G - - - - - - - - - - G Bresil (S) - T - C - - - - - - - - - - - - - - G - T - - - - - - - - G Moorea (S) - T - - - - - - - - - - - - - - - - G - - - - - - - - - - G C.pipiens pipiens Espro (R) A T - C - - - A - - C - - - A G T T A - - - T - T T - - G - Praias (R) A T - C - - - A - - C - - - A G T T A - - - T - T T - - G - Padova (R) A T - C - - - A - - C - - - A G T T A - - - T - T T - - G - Barriol (R) A T - C - - - A - - C - - - A G T T A - - - T - T T - - G - BrugeA (S) A T - C - - - A - - C - - - A G T T G - - - T - T T - - G - BrugesB (S) A T - C - - - A - - C - - - A G T T G - - - T - T T - - G - Killcare (S) A T - C - - - A - - C - - - A G T T G - - - T - T T - - G - Bleuet (S) A T - C - - - A - - C - - - A G T T G - - - T - T T - - G - Heteren (S) A T - C - A - A - A C - - - A G T - G - - - T - - T - A G - *(R) résistant aux insecticides *(S) sensible aux insecticides

- An. gambiae Des souches sensibles KISUMU (souche sensible de référence de l'Afrique de l'est) et VK-PER (souche de référence KDR de l'Afrique de l'ouest) ainsi que des populations sensibles de la région de Yaoundé ont été testées par le test PCR-RFLP comme décrit ci-dessus.

Les résultats du test PCR-RFLP, montrent qu'il existe pour l'ensemble des moustiques An. gambiae analysés, une corrélation parfaite entre la résistance aux insecticides et le profil de restriction par PCR-RFLP, à savoir : 2 bandes (403 pb et 138 pb) sont détectées chez les individus homozygotes sensibles SS, 2 bandes (253 pb et environ 150 pb) ou 3 bandes (403 pb, 253 pb et environ 150 pb) sont détectées chez les individus résistants, respectivement chez les individus homo- zygotes (RR) et hétérozygotes (RS).

EXEMPLE 11 : Analyse de l'activité acétylcholinestérase des protéines AChEl sensibles et résistantes aux insecticides.

Les AchE1 recombinantes de respectivement la souche S-LAB et la souche SR ont été exprimées dans des cellules d'insecte et l'activité acétyl- cholinestérase a été mesurée à partir des extraits cellulaires comme décrit à l'exemple 1.

Les résultats illustrés dans la figure 10 montrent que l'unique muta- tion glycine247/7/p ;->sérine247/7/o) rend l'acétylcholinestérase insensible à l'insecticide.

Ainsi que cela ressort de ce qui précède, l'invention ne se limite nullement à ceux de ses modes de mise en oeuvre, de réalisation et d'application qui viennent d'être décrits de façon plus explicite ; elle en embrasse au contraire toutes les variantes qui peuvent venir à l'esprit du technicien en la matière, sans s'écarter du cadre, ni de la portée, de la présente invention.