NOVEL BASEMENT MEMBRANE ASSOCIATED FIBULIN FRAGMENTS THAT FUNCTION AS TUMOR SUPPRESSORS WITH ANTI-ANGIOGENIC ACTIVITY

This invention was supported by the U.S. federal government under grants DK55001, DK62987, AA 13913, and DK 61688 awarded by the National Institutes of Health. The U.S. government has certain rights in this invention.

RELATED APPLICATIONS

This application claims the benefit of U.S. provisional patent application

No. 60/924,757, filed May 30, 2007.

FIELD OF THE INVENTION

The present invention relates to molecular biology, molecular genetics, and the mechanisms of tumor angiogenesis. In particular, the present invention provides for portions of basement membranes with anti-angiogenic and anti-tumor activity.

BACKGROUND

Fibulins are a family of secreted glycoproteins characterized by repeated epidermal-growth-factor-like domains and a unique C-terminal structure. Five distinct fibulin genes, encoding at least nine protein products generated by alternative splicing, have been identified. Fibulins modulate cell morphology, growth, adhesion and motility. Fibulin- 1, the first member to be identified, was discovered in affinity chromatography experiments that used the short cytoplasmic tail of βl integrin receptors.

Fibulin expression may correlate with certain types of malignancies. The up- regulation of fibuIin-4 is found in colon carcinomas, and fibulin- 1 is over expressed in estrogen receptor-positive ovarian carcinomas and breast cancers increased by estrogens. This up-regulation may inhibit the mobility of cancer cells, thus suppressing their invasiveness. High concentration of the fibulin-1 splice variant selectively delays tumor transformation, although the mechanism of this delay remains unclear.

The lysosomal aspartic protease, cathepsin D, plays a role in cancer cell progression and metastasis, with dual apoptosis regulatory functions. It is one of the prognostic molecular markers in early breast cancer. In addition, an inverse relationship between fibulin-1 and cathepsin D expression patterns has been observed in human breast carcinomas.

Angiogenesis, the growth of new blood vessels developing from preexisting vessels, is central to the growth of cancer. Fibulin-1 expression is up-regulated during cutaneous wound healing. Fibulin 5 is essential for elastogenesis in vivo. Fibulin-5 antagonizes VEGF signaling in the endothelial cells, as well as enhances the expression of TSP-I. Yet, there is a need to determine whether fibulins and/or fragments or portions of fibulins inhibit the angiogenesis, particularly during tumor development and regression.

DESCRIPTION OF THE DRAWINGS

Figures IA- IE relate to the molecular cloning, protein expression and purification of human fibulin-1 and fibulin-5. (A-B) PCR products of human fibulin- 1 and fibulin-5 were analyzed by 1% agarose gel. The arrow indicates the human fibulin-1 in panel A and fibulin-5 DNA fragment in panel B. (C-D) Expression and purification of human fibulin-1 and fibulin-5 in E. coli. The total cell extracts before and after ImM IPTG induction and the purified protein were applied to 12% or 10% SDS-PAGE and visualized by Coomassie blue staining. The arrow indicates human fibulin-1 protein in panel C and human fibulin-5 in panel D, respectively. (E) In vitro proliferation of human fibulin-1 and fibulin-5. Aliquots of Oμg/ml, lμg/ml. 5μg/ml, lOμg/ml, 20μg/ml of proteins were applied into CPAE cells individually. Cell density was measured at 595nm. Cells growing in 0.1% serum served as a negative control The data indicates that 1 Oμg/ml of human fibulin-1 and fibulin-5 significantly inhibits endothelial cell proliferation.

Figures 2A-2I present data from in vivo tumor study of human fibulin-1 and fibulin-5. Fig. 2A: Tumor growth curve of HTl 080 cells with stable expression of fibulin- 1 or fibulin-5. One million cells were injected into BALB/c SCID mice subcutaneously and the tumor volume was measured every three days. Six mice were used in each group. ♦, vector-transfected control cells; ■, pSecTag-fibulin-1- transfected cells; A , pSecTag-fibulin-5-transfected cells. *, 0.01<P<0.05,

**, 00KP<0.01. Fig. 2B: Quantification of CD31 staining in HTl 080 tumor. The mice were sacrificed twenty-eight days after injection and tumors were sectioned and stained with CD31. Ten sections for each sample were analyzed at X200 magnification in a blinded fashion. The number of blood vessels significantly decreased in HTl 090 fibrosarcoma over-expressing either fibulin-1 or fibulin-5 compared to the vector-transformed control cells. *, PO.05. Figs. 2D-2F show representative pictures of CD31 staining on HTl 080 fibrosarcoma (Fig. 2D, control) or HTl 080 with fibulin-5 over-expression (Fig. 2E) or with fibulin-1 over-expression (Fig. 2F). Fig. 2C: Quantification of apoptopic cells in HTl 080 tumors with the over- expression of human fibulin-1 or fibulin-5 by TUNEL assay. Over-expressoin of fibulin-1 significantly induced apoptosis of HT1080 cancer cells. ***, PO.001. Fig. 2G-2I: Representative picture of TUNEL assay of apoptopic cells in HT1080 tumor with over-expression of control (Fig. 2G), fibulin-5 (Panel H), or fibulin-1 (Fig. 21). Ten sections for each sample were analyzed at 40Ox magnification with a blind fashion. The apoptopic cells, co-localization of TUNEL and the nuclei are indicated with arrows. All results were shown as mean ± SEM.

Figures 3A-3D show fibulin sequence alignment and cathepsin D digestion pattern of human fibulin- 1 and fibulin-5. Fig. 3 A shows the alignment carried out using Cluster W software. * indicates identical amino acids. FVK, CRL, and YFD potential cathepsin cleavage sites are shown in lighter gray in the human fibulin-1 D sequence. Fig. 3B shows a 10% SDS-PAGE analysis of human fibulin-1 digestion product of cathepsin D. Digestion yielded two products, a 55kDa protein (similar in molecular weight to fibulin-5) and a 35 kDa protein. Human fibulin-1 could not be digested by cathepsin-B; fibulin-5 could not be digested by cathepsin D. Fig. 3C shows a western blot of human fibulin-1 digestion products by cathepsin D using anti- FLAG antibody. The 55 kDa protein, named FF55, could not be detected by anti- FLAG-tag antibody, demonstrating that FF55 was the C-terminal product from human fibulin-1 because the FLAG tag was introduced into the N-terminus of fibulin- 1. Fig. 3D presents a schematic illustrating that FF55 is similar in size to fibulin-5 and that FF55 is derived from the C-terminus of fibulin-1.

Figures 4A-4C show data indicating that a fragment from human fibulin- 1 inhibits endothelial-cell proliferation. Fig. 4A: Analysis of a fragment of fibulin-1 PCR products using a 1% agarose gel. Fig. 4B: Western blot of FF55 expression

in 293 cells using anti-FLAG antibody, FF55 was successfully expressed by transfecting pSpec-Tag-FF55 into 293 cells. Fig. 4C: In vitro proliferation assay of FF55. An application of lOμg of FF55 significantly inhibits endothelial cell proliferation in vitro,

DETAILED DESCRIPTION

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

Generally, nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. The methods and techniques of the present application are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

Enzymatic reactions and purification techniques are performed according to manufacturer's specifications, as commonly accomplished in the art or as described herein. The terminology used in connection with, and the laboratory procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques can be used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.

It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about."

All patents and other publications identified are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

The fibulins are a family of secreted glycoproteins that are characterized by repeated epidermal-growth-factor-like domains and a unique C -terminus structure. Fibulins modulate cell morphology, growth, adhesion and motility. In the initial basement membrane degradome screen, the degradation of basement membrane proteins by cathepsin D, contained fragments of fibulin-1 and the full length fibulin-5. The present invention provides for the anti -angiogenic activity of fibulin-1 and fibulin-5. Another aspect of the present invention provides for HT 1080 cancer cell lines with stable expression of either fibulin-1 or fibulin-5. The present invention also provides for tumor studies demonstrating that both fibulin-1 and fibulin-5 suppress HT 1080 tumor growth. CD31 labeling and TUNEL assay further reveal that fibulin-1 suppression of HT 1080 tumor growth is associated with diminished angiogenesis and also enhanced apoptosis of tumor associated cells. In contrast, fibulin-5 inhibits tumor angiogenesis yields a minimal apoptotic affect. Cathepsin D digestion of fibulin-1 produces a fragment with nearly the same molecular weight as fibulin-5 and this 55kDa fragment (named FF55) inhibits endothelial cell proliferation. This further favors the notion that degradation of basement membrane by cathepsin D can liberate both fibulin-1 fragments and fibulin-5, which function to inhibit angiogenesis.

Fibulins are a family of secreted glycoproteins, which are characterized by repeated epidermal-growth-factor-like domains and a unique C-terminal structure. Timpl et al., 4 Nat. Rev. MoI. Cell. Biol. 479-89 (2003). Five distinct fibulin genes,

encoding at least nine protein products generated by alternative splicing, have been identified. Fibulins have been shown to modulate cell morphology, growth, adhesion and motility. See Timple, 2003; Gallagher et al., 1 1 Trends MoI. Med. 336-40 (2005); Argraves et al,, 4 EMBO Rep. 1127-31 (2003). Fibulin-1 was the first member to be identified in affinity chromatography experiments that used the short cytoplasmic tail of βl integrin receptors. Argraves et al., 58 Cell 623-29 (1989).

There is an apparent correlation between fibulin expression and certain type of malignant cells, such as upregulation of fibulin-4 in colon carcinomas (Gallagher et al., 489 FEBS Lett, 69-66 (2001)), and of fibulin- 1 in estrogen receptor (ER)-positive ovarian carcinomas and breast cancers increased by estrogens (Roger et al., 153 Am. J. Pathol. 1579-88 (1998); Greene et al., 88 Br. J. Cancer 871-78 (2003); Hayashido 75 Cancer 654-58 (1998)). This upregulation might inhibit the mobility of cancer cells, which would suppress their invasiveness. High concentration of the fibulin- ID variant selectively delayed tumor transformation, although the mechanism of the delay is yet unclear.

The lysosomal aspartic protease cathepsin D has been discovered to play an essential role in cancer cell progression and metastasis, as well as dual apoptosis regulatory functions. Liaudet el al., 237(2) Cancer Lett. 167-79 (2005); Nomura & Katunuma 52 J. Med. Invest. 1-9 (2004). It is one of the prognostic molecular markers in early breast cancer. Esteva & Hortobagyi, 6 Breast Cancer Res. 109-18 (2004). In addition, an inverse relationship between fibulin-1 and cathepsin D expression was observed in human breast carcinomas. Pupa et al., 23 Oncogene 2153-60 (2004).

Previously, a basement membrane degradation screen was developed to evaluate the potential contribution of the basement membrane degradome in the regulation of angiogenesis. Kalluri, 67 Cold Spring Harbor Symp. Quant. Biol. 255-66 (2002). This was done employing many tumor microenvironment- associated proteases to degrade basement membrane preparations from amnion and placental tissue. When cathepsin D was used in this degradation screen, fibulin- 1 fragments and intact full length fibulin-5 were among the degradation products. This led to further analysis of the role of these fibulin proteins in the regulation of angiogenesis.

Angiogenesis, the growth of new blood vessels developing from preexisting vessels, is central to the growth of cancer. An upregulation of fibulin-1 has been

detected during cutaneous wound healing. Lee et al., 199 J. Am. Coll. Surg. 403-10 (2004); Fassler et al, 222 Exp. Cell Res. 11 1-16 (1996). Fibulin-5 is essential for elastogenesis in vivo. Yanagisawa et al., 415 Nature 168-71 (2002); Nakamura et al., 415 Nature 171-75 (2002). Fibulin-5 antagonizes VEGF signaling in the endothelial cells, as well as enhanced the expression of TSP-I . Albig & Schiemann. 23 DNA Cell Biol. 367-79 (2004). More specifically, fibulin-5 suppresses tumor formation by controlling cancer cell proliferation, motility, and angiogenic sprouting. Albig et al., 66 Cancer Res 2621^29 (2006); Albig & Schiemann, 2004; Albig & Schiemann, 1 Future Oncol 23-35 (2005).

Given the foregoing, it is possible that fibulins inhibit the angiogenesis process during tumor development and regression. Embodiments disclosed herein provide for recombinant fibulins and portions of fibulins that inhibit angiogenesis. More particularly, an embodiment of the invention provides for fibrosarcoma HTl 080 cell lines that stably express recombinant human fibulin-1 and human fibulin-5, useful in more thoroughly exploring the mechanism of fibulins in the regulation of cancer. More specifically, fibulin-1 inhibits tumor growth by suppressing tumor angiogenesis and inducing apoptosis of tumor associated cells. Fibulin-5 also inhibits tumor angiogenesis with a lesser ability to induce apoptosis, In an additional embodiment, at least one truncated fragment of fibulin-1 digested by cathepsin D, named FF55, holds anti-angiogenesis function.

Thus, the fibulins of the present invention provide for a non-toxic therapeutic drug useful, for example, in cancer therapies. The fibulins of the present invention are anti-angiogenic molecules and angiogenesis inhibitors. Fibulin-1 (and its splice variants and fibulin-5 may function as tumor suppressor by inhibiting tumor growth via suppression of angiogenesis, pericytes recruitment and also stroma recruitment. Fibulin genes and gene products may be useful as markers for cancer progression and tumor growth. Polymorphisms associated with fibulin genes (fibulin-1 to -5) may be genetic determinants of cancer progression. Fibulin fragments (fibulins -1 to -5) may be anti-cancer agents and anti-angiogenic molecules and angiogenesis and tumor growth inhibitors. Commercial applications include anti-cancer agents, inhibitors of angiogenesis, and tumor growth inhibitors.

Fibulins of the present invention are accepted by one of ordinary skill of the art as isolated or purified fibulin proteins, peptides, and polypeptides, including

multimers, that are found to possess anti-angiogenic activity. These include full- length fibulins, as well as portions of fibulins which may be made using peptide synthesis, recombinant DNA techniques, fragmentation of fibulins by digestion, and the like, that have anti-angiogenic activity. For example, the fibulins of the present invention may block angiogenesis (i.e. inhibit blood vessel formation), alter the formation of capillary structures by endothelial cells, prevent the formation of excess blood vessels in tissues, and/or inhibit in vivo tumor cell colonization of tissues. This activity could be clinically useful in various diseases where it is not desirable to have an increased blood supply such as hypervascularization in the eye (e.g. a cause of blindness), Kaposi sarcoma lesions, and tumor angiogenesis.

The fibulins peptides with anti-angiogenic activity of the present invention also include derivatives of these fibulins. Derivatives, as used herein, include a chemically modified compound wherein the modification is considered routine by the ordinary skilled chemist, such as additional chemical moieties (e.g., an ester or an amide of an acid, protecting groups, such as a benzyl group for an alcohol or thiol, and tert-butoxycarbonyl group for an amine). Derivatives also include radioactively labeled fibulins with anti-angiogenic activity, and conjugates of fibulins (e.g., biotin or avidin, with enzymes such as horseradish peroxidase and the like, with bioluminescent agents, chemoluminescent agents or fluorescent agents, or other conjugates with proteins). Additionally, moieties may be added to the active fibulin or fibulin fragment to increase half-life in vivo. Dervatives also encompasses cyclized peptides and polymerized peptides. Derivatives also encompasses analogs, such as a compound that comprises a chemically modified form of a specific compound or class thereof, and that maintains the pharmaceutical and/or pharmacological activities characteristic of said compound or class, are also encompassed in the present invention. Derivatives, as used herein, also encompasses prodrugs of the fibulin anti- angiogenic peptides, which are known to enhance numerous desirable qualities of pharmaceuticals (e.g., solubility, bioavailability, manufacturing, etc.).

The fibulins of the present invention can be contained in pharmaceutically acceptable formulations. Such a pharmaceutically acceptable formulation may include a pharmaceutically acceptable carrier(s) and/or excipient(s). As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and anti fungal agents, isotonic and absorption delaying agents,

and the like that are physiologically compatible. For example, the carrier can be suitable for injection into the cerebrospinal fluid. Excipients include pharmaceutically acceptable stabilizers. The present invention pertains to any pharmaceutically acceptable formulations, including synthetic or natural polymers in the form of macromolecular complexes, nanocapsules, microspheres, or beads, and lipid-based formulations including oil-in-water emulsions, micelles, mixed micelles, synthetic membrane vesicles, and resealed erythrocytes.

When the fibulins or fibulin formulations are delivered to a patient, they can be administered by any suitable route, including, for example, orally (e.g., in capsules, suspensions or tablets) or by parenteral administration. Parenteral administration can include, for example, intramuscular, intravenous, intraarticular, intraarterial, intrathecal, subcutaneous, or intraperitoneal administration. The agent can also be administered orally, transdermally, topically, by inhalation (e.g., intrabronchial, intranasal, oral inhalation or intranasal drops) or rectally. Administration can be local or systemic as indicated. Agents can also be delivered using viral vectors, which are well known to those skilled in the art. For example, formulations may be delivered using weekly intravenous dosing.

Both local and systemic administration are contemplated by the invention. Desirable features of local administration include achieving effective local concentrations of the active compound as well as avoiding adverse side effects from systemic administration of the active compound. Localized delivery techniques are described in, for example, 51 J. Biomed. Mat. Res. 96-106 (2000); 100(2) J. Control Release 211-19 (2004); 103(3) J. Control Release 541-63 (2005); 15(3) Vet. Clin. North Am. Equine Pract. 603-22 (1999); 1(1) Semin. Interv. Cardiol. 17-23 (1996).

The pharmaceutically acceptable fibulin formulations can be suspended in aqueous vehicles and introduced through conventional hypodermic needles or using infusion pumps.

The amount of fibulin formulation administered to the individual will depend on the characteristics of the individual, such as general health, age, sex, body weight and tolerance to drugs as well as the degree, severity and type of rejection. The skilled artisan will be able to determine appropriate dosages depending on these and other factors.

Fibulin-1 and fibulin-5 belong to a family of extracellular matrix proteins, which can adhere to endothelial cells and regulate their motility and proliferation. Some studies have suggested a possible role for fibulin-1 as a tumor suppressor, but a mechanism behind such activity was not established. Using HTl 080 cell lines with stable expression of fibulin-1 and fibulin-5 as a model, the present invention provides for fibulin-1 for the inhibition tumor growth by suppressing tumor angiogenesis and inducing apoptosis of cells in the tumor. Fibulin-5 also inhibits tumor angiogenesis.

More specifically, fibulins were explored by molecular cloning and protein purification of human fibulin-1 and fibulin-5. The genes of human fibulin-1 (fibulin-1 D splice variant) and fibulin-5 were cloned by PCR using the human placental cDNA library as the template. A 2.1Kb fragment of human fibulin-1 and a 1.3Kb fragment of human fibulin-5 were generated (Figs. IA- IB). DNA sequencing confirmed that the sequences of both genes were correct.

To express human fibulin-1 and fibulin-5 in E. coll, the gel-purified DNA fragment was ligated into pQE-Tri vector and transformed into XLl -Blue cells. As shown in Figs. IC-I D, both fibulin-1 and fibulin-5 were successfully expressed in E. coli under the induction of ImM of IPTG. The molecular weight of recombinant fibulin-1 protein was around 72 kDa, and that of fibulin-5 was around 50 kDa. After the protein was purified by talon metal affinity chromatography, the fraction containing greater than 95% of pure protein was visualized by the Coomassie blue staining. It should be noted that fibulin-1 and fibulin-5 produced in mammalian cells undergo glycosylation and therefore have higher molecular weights than those produced in E. coli. Argraves et al, 111 J. Cell Biol 3155-64 (1990; Aspberg et ah, 274 J. Biol. Chem. 20444-49 (1999). Western blot using anti-HϊS antibody further demonstrated that the expressed proteins were indeed human fibulin-1 and fibulin-5.

The present invention provides for the inhibition of endothelial cells by fibulin-1 and fibulin-5. To determine whether fibulin-1 and fibulin-5 inhibit endothelial cell proliferation, CPAE cells were exposed to different amounts of purified proteins in vitro. As shown in Fig. IE, human fibulin-5 started to inhibit endothelial cell proliferation at the concentration of 5μg/ml. Ten μg/ml of fibulin-5 significantly inhibited endothelial cell proliferation. Human fibulin-1 started to inhibit endothelial cell proliferation at the concentration of lOμg/ml, but was not as effective as fibulin-5 and required higher concentrations of protein to have an effect on

endothelial cell proliferation. Nevertheless, at a concentration of 10 μg/ml, both fibulin-1 and fibulin-5 inhibit endothelial cell proliferation in vitro.

To explore the function of fibulin-1 and fibulin-5 in the regulation of tumor growth, human fibulin-1 and fibulin-5 cDNA expression vectors were constructed. The vectors were used to generate HTl 080 cancer cell lines with stable expression of fibulin-1 and fibulin-5. In order to evaluate the overexpression of fibulins in cancer cells, a FLAG-tag was added at the N-terminus of both fibulin-1 and fibulin-5 by PCR and then ligated into pSecTag-2A plasmid. Zeocin resistant clones were isolated and immunoblot analysis of whole cell extracts was used to identify clones that expressed high levels of fibulin-1 and fibulin-5. The amount of protein secreted into the conditioned culture medium by HT 1080 cell line expressing fibulin-1 or fibulin-5 was evaluated by western blot using the FLAG-tag antibody.

The present invention provides for the suppression of tumor growth by fibulin-1 and fibulin-5. To investigate whether the expression of fibulin-1 and fibulin-5 can suppress tumor growth, HT 1080 cells expressing fibulin-1 or fibulin-5 were injected subcutaneously into mice, and the tumor growth was monitored. As shown in Fig. 2 A, the latency of tumor growth in mice with either fibulin-1 or fibulin-5 expressing HT 1080 cancer line was significantly longer when compared to control vector-transfected line. In the control experiment the tumor reached 500mm ³ around eighteen days after injection, while for the fibulin-5 -expressing cells, the average time was twenty-five days. For fibulin-1 -expressing cells, the tumors were smaller than 500mm ^J even after twenty-eight days.

The present invention provides for the inhibition of tumor angiogenesis with fibulin-1 and fibulin-5. For example, HTl 080 tumors were evaluated for blood vessel density. Mice were sacrificed twenty-eight days after tumor cell injections and tumors in each group were harvested. The tumors were sectioned and labeled with CD31, an endothelial cell marker. Immunohistochemistry clearly revealed that both fibulin-1 and fibulin-5 significantly inhibit tumor angiogenesis (Figs. 2D-2F). Blood vessel quantification reveals a 45% reduction in the HTl 080 tumors overexpressing either fibulin-1 or fibulin-5 (Fig. 2B).

Additionally, the present invention provides for apoptosis of tumor-associated cells induced by fibulin-1. More specifically, apoptosis in tumor samples was detected and quantified using a TUNEL assay. Fibulin-1 induced apoptosis much more

robustly when compared to fibulin-5 (Figs. 2G-2I). Fibulin-5 induced apoptosis in 2.5% of all cells in the tumor section, while fibulin-1 induced apoptosis in 5.7% of all cells (Fig. 2C).

The present invention also provides for portions of fibulin-1. For example, cathepsin D degrades fibulin-1 to generate a fragment with similar molecular size as the full length fibulin-5. An alignment of human fibulin-1 and fibulin-5 protein sequence reveals a high degree of homology (Fig. 3A). Sequence analysis reveals three potential cathepsin D cleavage sites (FVK, CRL and YFD, light gray in Fig. 3A). Arnold et al., 249 Eur. J. Biochem. 171-79 (2997); Lohmuller et si., 384 Biol. Chem. 899-909 (2003).

More specifically, human recombinant fibulin-1 protein was digested using active cathepsin D. Two fragments were generated upon degradation; one was about 5 SkDa, similar to fibulin-5 in size, and other one was 3 SkDa (Fig. 3B), Cathepsin B digestion of fibulin-1 did not generate this fragment, however, suggesting that the digestion of fibulin-1 by cathepsin D was specific. Because a FLAG-tag was placed on the N-terminus of the recombinant proteins, western blot analysis with anti-FLAG-tag antibody further demonstrates that the 55kDa fragment generated by cathepsin D is derived from the C-terminal region of fibulin-1, as indicated by its inability to bind the anti-FLAG-tag antibody (Fig. 3C).

A gene fragment encoding the human fibulin-1 derived 55kDa fragment was cloned via PCR (Fig. 4A). This 1 ,5kb fibulin-1 DNA was ligated into pSecTag-2A plasmid for E. coli protein expression in 293 cells. Western blot with anti-FLAG antibody demonstrated that the 55kDa protein fragment derived from human fibulin-1 was successfully expressed in 293 cells (Fig. 4B). This fragment was not generated when cathepsin B was used in the degradation assay (Fig. 3 B-C).

To evaluate the effect of this novel fragment on endothelial cell proliferation, CPAE cells cultured with 10% FCS were exposed to different amounts of FF55 fragment in vitro. CPAE cells cultured in 0.1% FCS were used as a control to demonstrate low cell proliferation levels. The in vitro proliferation assay demonstrates that lOμg/ml of this novel fragment significantly inhibits endothelial cell proliferation (Fig. 4C). To further characterize the in vitro effects of FF55, an endothelial tube assay was performed. HUVEC cells were cultured on Matrigel with increasing concentrations of FF55in (lμg/mL-lOμg/mL). The results of this assay demonstrate

that 10μg/mL inhibited tube formation when compared to PBS control. This supports the notion that FF55 may also inhibit angiogenesis in vivo.

Thus, the present invention provides that fibulins associated with basement membrane can function as endogenous angiogenesis inhibitors and control the rate of tumor growth. The present invention, in conjunction with reports from other laboratories, suggest that among the five members of the fibulin family, fibulin-1, fibulin-3 and fibulin-5 exhibit anti-angiogenesis activity and demonstrate an ability to suppress tumor growth. Albig et al., 2006. It is likely that these inhibitors have a restricted distribution in select tissue-specific basement membranes and are liberated to function as angiogenesis inhibitors upon the degradation of preexisting vasculature.

There is an inverse relationship between the expression of fibulin- 1 and cathepsin D in human breast cancers. Pupa et al.. 23 Oncogene, 2153-60 (2004). This notion is further favored by the fact that cathepsin D degrades fibulin- 1 to generate a fragment with the ability to inhibit the proliferation of endothelial cells. The present work indicates that an increase of cathepsin D in the tumor microenvironment can induce the degradation of fibulin-1 , leading to a potential decrease of its protein level in the tumors. This novel anti -angiogenic fragment from fibulin- 1 exhibits the same molecular size as fibulin-5 and shares significant amino acid homology with it. In fact, one of the putative cathepsin D cleavage sites in the fibulin-1 sequence aligns with the N-terminal start of fibulin- 5 sequence. Therefore, it is likely that the anti- angiogenic sites of fibulin-5 and the fibulin-1 fragment are similar.

The novel fibulin- 1 fragment generated by cathepsin D, named FF55, inhibits endothelial cell proliferation and tube formation in vitro. This novel basement membrane derived fibulin-1 fragment adds to growing list of endogenous inhibitors of angiogenesis derived from basement membrane proteins, such as endostatin, tumstatin, canstatin, and arresten. Nyberg et al., 65 Cancer Res. 3967-79 (2005).

EXAMPLES Example 1. Molecular cloning of human fibulin-1 and human fibulin-5

Cell lines and Reagents. HTl 080 and CPAE cells were purchased from American Type Culture Collection. SCID mice were purchased from Charles River Inc. Lipofectamine2000, pfx DNA polymerase, zeocin, and pSecTag-2A vector were

bought from Invitrogen. pQE-Tri system vector was obtained from Qiagen. Human placental cDNA library was purchased from Clontech. In situ cell death detection kit (TUNEL) and Wst-1 kit were obtained from Roche. MTT assay kit was purchased from Chemicon. Talon metal affinity resins was obtained from BD Biosciences. Cathepsin D, cathepsin B, and anti-FLAG M2 Affinity gel were purchased from Sigma.

Molecular cloning of human fιbulin-1 and human βbulin-5. A 2.1kb gene fragment containing the human fibulin-1 gene and a 1.3kb fragment containing human fibulin-5 gene were generated by PCR with pfx DNA polymerase (Invitrogen) using the human placental cDNA library as the template with the following primers. For fibulin-1, the primers were 5 ' -ATCCGCCC ATGG AGCGCGCCGCGCGCCGTC-3 ' (SEQ ID NO: 1) and 5 ' -G ACC AGCTCG AGG AACCAGT ACTCAGAGACGTCC-3 ' (SEQ ID NO:2). For fibulin-5, the primers were 5'-ATCTGACCATGGCAGGAATAAAAAGGATACTCAC-S ' (SEQ ID NO:3) and 5 ' -GACTG ACTCG AGGAATGGGTACTGCGAC AC-3 '(SEO ID NO:4). The underlined sequences denoted the restriction enzyme sites Ncol and Xhol that were included for subsequent cloning purposes. The PCR conditions for fibulin-1 and fibulin-5 were: thirty cycles for 95°C for 1 min, 65 ⁰ C for 1 min, and 68°C for 3 min. The resulting PCR products were gel-purified and ligated into pQE-tri plasmid for expression.

Protein expression in E. coli. PQE-FibulinlD and pQE-Fibulin5 plasmids were transformed into XLl -Blue cells for protein expression in the presence of lOOμg/ml of ampicillin and 12.5μg/ml of tetracycline. Human fibulin-1 and fibulin-5 were expressed in E. coli under the induction of ImM IPTG at 37°C for three hours. The proteins were purified using talon metal affinity resins according to the manual from BD Biosciences. Generally, the cell pellet was resuspended in lysis buffer (2OmM Tris-HCl, pH 7.5, 15OmM NaCl, 25mM MgCl ₂ ) at 2-5ml per gram wet weight. The lysozyme was added to 1 mg/ml and incubated on ice for 30 min followed by sonication on ice for six, 10 sec bursts at 300W with a 10 sec cooling period between each burst. The lysates was centrifuged at 10,000xg for 30 min at 4 ⁰ C. The supernatant was applied to talon metal affinity column, which was equilibrated with lysis buffer (2OmM Tris-HCl, pH 7.5, 15OmM NaCl, 25mM MgCl ₂ ). After the column was washed with washing buffer (2OmM Tris-HCl, pH 7.5, 10OmM NaCl, 25mM MgCl ₂ , 1OmM imidazole), the proteins were eluted with elution buffer (2OmM Tris-HCl, pH 7.5, 15OmM NaCl, 25mM MgCl ₂ , 10OmM imidazole) and

collected in 1 ,5ml eppendorf tubes. The protein was analyzed by SDS-PAGE and visualized by Coomassie-blue staining.

Example 2. In vitro proliferation assay.

CPAE cells were seeded at a concentration of 4x10 ³ cells/well in lOOμl DMEM medium containing various amount of human fibulin-1 or fibulin-5 using 96- well plates. After incubation for 48 hours at 37°C, 5% CO ₂ , 10μl of MTT solution A and B was added into each well and incubated for four hours at 37°C and 5% CCV The MTT solution C was added and the absorbance at 595nm was measured against a background control as blank using a microplate reader.

Establishment of tumor cell lines stably expressing fibulin-1 and fibulin-5. All media and reagents used for cell culture were purchased from Gibco BRL unless otherwise indicated. HTl 080 cells were initially grown in Dulbecco's modified Eagle's medium, supplemented with 10% (v/v) FCS (fetal calf serum), 100U/ml penicillin, lOOU/ml streptomycin, and 250ng/ml Fungizone.

The fibulin-1 or fibulin-5 gene, with a FLAG-tag at the N-terminus, was generated by PCR and gel purified. The genes were then inserted into pSecTag-2A plasmid to obtain the pSecTag-FibulinlD and pSecTag-FibulinS plasmids, respectively. To produce stably transfected cell lines, cells in exponential growth were plated in 100mm dishes. After 18-24 hours, 2μg of plasmid DNA was transfected into HT 1080 fibrosarcoma cells using Iipofectamine2000 according to the manufacture's instructions, respectively. Transfected HTl 080 were selectively grown in culture containing 400μg/ml zeocin for three weeks. Drug -resistant clones were selected randomly and subcloned individually for further study. The expression levels of fibulin-1 or fibulin-5 were examined by Western Blot using anti- FLAG-tag antibody.

Example 3. In vivo tumor studies.

Eight week old BALB/c mice were use for in vivo tumor study. HTl 080 cells stably expressing fibulin-1 and fibulin-5 were injected (IxIO ⁶ cells) in 0.1ml of serum-free Eagle's medium subcutaneously. Tumor dimensions were measured every three days using a digital caliper, and the volume of the tumors was calculated using the formula: Volume=0.52χlengthχwidthχwidth. Six mice were used in each experimental group. All mouse studies were reviewed and approved by the

Institutional Animal Care and Use Committee of Beth Israel Deaconess Medical Center.

TUNEL assay, The detection and quantification of apoptosis at single cell level was carried out according to the manual by using the in situ cell death detection kit from Roche. In general, the paraffin-embedded tissue sections were dewaxed and rehydrated through a graded series of ethanol and double distilled water. The tissue sections were then incubated with proteinase K solution (20μg/ml in 1OmM Tris-HCl, pH 7.5) at 37°C for 30 min. The slides were rinsed with PBS twice and incubated with TUNEL reaction mixture at 37°C for 60 minutes. After the slides were rinsed with PBS three times, Vectashield (Vector Labs., App Imaging) mounting medium was applied and samples were analyzed under a fluorescence microscope. In each group, the numbers of apoptotic cells were counted at 40Ox magnification in a blinded fashion for ten separate fields and averaged.

Immuno histochemistry, Immunohistochemistry staining was performed as previously described. Maeshima et al., 295 Science 140-43 (2002). Briefly, 4 μM frozen sections were fixed in 100% cold acetone (-20 ⁰ C) for 5 min, then air-dried. They were incubated with primary antibody rat anti-mouse CD31 (Pharmingen), at 4°C overnight. Subsequently, they were washed three times with PBS buffer and incubated with FITC-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories, Inc.) at room temperature for 1 hour. After three times wash with PBS, Vectashield (Vector Laboratories, App Imaging) mounting medium was applied and sections were imaged under a fluorescent microscope. In each group, the number of blood vessels comprised of CD31 -positive endothelial cells of blood vessels was counted at 20Ox magnification in a blinded fashion for ten separate fields per section and averaged.

Cathepsin digestion. Twenty micrograms of proteins were digested with 1OU Cathepsin D in buffer containing 5OmM NaAc, pH 4.0, 50 mM NaCl at 37°C overnight. For cathepsin B digestion, 20μg of proteins were digested with 1OU enzyme in the buffer containing 5OmM NaAc, pH 6.0, 5OmM NaCl at 40 ⁰ C overnight. The digested product was analyzed by SDS-PAGE.

Example 4. Molecular cloning, protein expression, and in vitro proliferation assay of FF55.

The FF55 DNA fragment was produced by PCR using a human placenta cDNA library as the template with the forward primer (5'- atgctaggcccagccggccgac tacaaggacgacgatgacaagagctgccggcttggagaatcctgcatc-3') and the reverse primer (5 ^: -gctaagctcgagtcagaaccagtactcagagacgaagatgc-3 ⁵ ). The PCR protocol was: 95 ⁰ C for two min, followed by 35 cycles of 95°C for one min, 65 ⁰ C for one min, and 68 ⁰ C for two min. The resulting PCR products were gel-purified and ligated into pSecTag-2A plasmid for protein expression.

The pSecTag-FF55 plasmid was transfected into HEK293 cells using iipofectamine2000. The protein was expressed in DMEM medium contain- ning 400μg/mI of zeocin and purified using anti-Flag M2 affinity gel. The activity of the purified protein was tested in CPAE cells in vitro. CPAE cells were seeded at 4x10 ³ cells/well in 96-well plates in lOOμl DMEM medium containing different concentrations of FF55. After incubation for 48 hours at 37°C and 5% CO ₂ , lOμl of WST-I was added to each well and incubated for 4 hours at 37 ⁰ C and 5% CO ₂ . The absorbance at 440nm was measured against a background control as a blank using a microplate reader.

Statistical Analysis. All results are shown as mean±SEM. Statistical differences between two groups were calculated by using student's t test or Welch's / test. ANOVA was used to determine statistical differences between three or more groups. As needed, further analysis was carried out by using t test with Bonferroni correction to identify significant differences. A P value less than 0.05 was considered statistically significant. *, 0.01<P< 0.05, **, 0.00KPO.01, ***, 0.000 KpO.001.