The present invention relates to novel expression vectors for expressing desired genes within a range of bacterial hosts and, in particular, to expression vectors based on the RK2 replicon and the TOL plasmid regulatory functions. The cloning and expression of genes is a central tool in biotechnology. Traditionally, genes have been cloned and expressed in enteric bacteria, most notably E. coli , which for a long time was regarded as the most useful host for gene cloning. However, the inability of E. coli to express some biological properties, for example certain metabolic activities, or to carry out appropriate modifications and processing of certain gene products, has encouraged the development of alternative host-vector systems, in particular for different hosts. The use of non-enteric bacteria for basic and applied molecular research has extended the need for well characterised vector systems for such organisms. Thus, vector systems have been designed which are specific for the bacterial species of interest, e.g. soil bacteria. However, a more useful approach would be to design vectors which may be used across a broad range of microbial hosts, and work in recent years has been directed to this.

In addition, expression of foreign genes, and indeed over expression of native genes, can significantly perturb the physiology of the host cell and constitute a strong selective pressure for elimination or inactivation of the cloned genes. Vectors in which the expression of cloned genes can be regulated and controlled have therefore become increasingly important.

The present invention is directed towards meeting this continuing need for new and improved expression

vectors for the controlled expression of genes in a wide range of hosts. In particular, it has been found that efficient and controlled expression of cloned genes in a broad range of hosts may be achieved by constructing expression vectors which combine the replicon from the RK2 plasmid family with the expression regulatory functions of the TOL plasmidε.

In its broadest aspect, the present invention thus provides an expression vector comprising an RK2 minimum replicon together with an expression cassette comprising the regulatory functions of a TOL plasmid.

As used herein the term "expression cassette" refers to a nucleotide sequence encoding or comprising the various functions required to express a DNA sequence, notably the promoter-operator functions and the associated regulatory sequences required for expression from that promoter, e.g translational and transcriptional control elements and/or sequences encoding regulatory proteins, which may act to regulate expression, for example at the level of the promoter. RK2 is a well-characterised naturally occurring 60Kb self-transmissible plasmid of the IncP incompatibility group well known for its ability to replicate in a wide range of gram-negative bacteria (Thomas and Helinski, 1989, in Promiscous Plasmids in

Gram-negative bacteria (Thomas, CM., Ed.) Chapter 1, pp 1-25, Academic Press Inc (London) Ltd, London) . It has been determined that the minimal replicating unit of RK2 consists of two genetic elements, the origin of vegetative replication ( oriV) , and a gene (trfA) encoding an essential initiator protein (TrfA) that binds to short repeated sequences (iterons) in oriV (Schmidhauser and Helinski, 1985, J. Bacteriol. 164, 446-455; Perri et al. , 1991, J. Biol. Chem; 266, 12536- 12543) . This minimal replicating unit is termed the so- called "RK2 minimum replicon", and has been extensively characterised and studied in the literature. A wide range of replicons (termed "mini-RK2 replicons") and

cloning vectors based on the RK2 minimum replicon or on derivatives of the RK2 plasmid have been prepared and described in the literature (see, for example, Li e_t al.. 1995, J. Bacteriol. 177, 6866-6873; Morris et al.. J. Bacteriol., 177, 6825-6831; Franklin and Spooner, in Promiscous Plasmids in Gram-negative bacteria (Thomas, C ., ed) Ch. 10, pp 247-267, Academic Press Inc. (London) Ltd., London; Hauσan et al.. 1992, J. Bacteriol 174:7026-7032; and Valla ≤£ al., 1991, Plasmid, 25, 131-136) .

The TOL plasmids are another series of well- characterised naturally occurring plasmids and their derivatives, which occur in Pseudo onas sp. and which encode the enzymes required for the catabolism of toluene and xylenes (for a review see Assinder and Williams 1990, Adv. Microb. Physiol., 31, 1-69).

The catabolic genes of TOL plasmids are organised in two operons, an upper pathway operon (OP1) encoding genes and regulatory sequences required for the oxidation of aromatic hydrocarbons to aromatic carboxylic acids, and a lower, or meta pathway operon (OP2) necessary for the oxidation and ring clearage of the aromatic nucleus of aromatic carboxylic acids, giving rise to intermediates which are channelled into the intermediary metabolism. The expression of the two operons is controlled by two positive regulatory proteins XylR and XylS, in the presence of the corresponding substrate ligands toluene/xylene and benzoate/toluate respectively. Activated XylR stimulates transcription from the Promoter Pu of the upper pathway operon, whereas activated XylS induces the meta pathway operon from the promoter Pm. XylR may also induce the promoter Ps of the xylS gene (see Assinder and Williams, Supra) . A regulatory cassette based on the xylR gene and Pu promoter has been described and used to prepare expression vectors which enable regulated gene expression induced by aromatic hydrocarbons (Keil and Keil, 1992, Plasmid, 27, 191-

199) . However, it has not previously been proposed to combine the TOL regulatory functions Pu/xylR or Pm/xylS with an RK2-based replicon within an expression vector construct. Viewed from a further aspect, the present invention thus provides an expression vector comprising a RK2 minimum replicon together with a promoter Pm and/or Pu and a corresponding regulatory gene xylS and/or xylR as derived from a TOL plasmid. In such expression vectors of the invention the catabolic genes of the TOL plasmids, encoding the enzymes of the metabolic pathway, are generally absent. Especially, the full complement of catabolic structural genes, in any one, or both, of the operons, are absent. The novel vectors of the invention allow the regulated expression of cloned genes in a wide range of host cells.

As mentioned above, the RK2 replicon has been well studied and its complete nucleotide sequence is reported (Pansegrau fit al., 1994, J. Mol. Biol., 239, 623-633) . Thus, sources for the RK2 minimum replicon are well established and readily available. Hence, for example, the RK2 minimum replicon may be derived from the parental plasmid RK2 or from any of the vast number of derivatives or mini RK2 plasmids described and available from the literature (see e.g. Li fit al; Morris fit al. , Franklin and Spooner; Haugen fit al; and Valla et al-, Supra) . As exemplary of a suitable source plasmid for the minimum RK2 replicon may be mentioned plasmid pFFl (Durland fit al. , 1990, J. Bacteriol, 172, 3859-3867), but many other source plasmids are available and could be used. The separate elements of the minimum replicon, oriV and the trfA gene may be isolated from the same source together or separately or from separate sources. Likewise, any of the TOL plasmids and their derivatives widely known and described in the literature could be used as the source of the TOL regulatory functions (see e.g. Assinder and Williams, Keil and

Keil, Supra and Mermod fi al., 1986, J. Bacteriol., 167, 447-454) . Indeed, a number of plasmids are known in the literature which have TOL genes inserted, and any of these could be used as the source of the TOL regulatory functions for the present invention. The regulatory genes xylR and/or xylS may be inserted together with the Pu and/or Pm promoter from the same source or the promoter and regulatory gene may be derived independently from separate sources. Thus, for example a Pm promoter may be derived from plasmid pERD21, (a RSFlOlO-based replicon, Ramos fit al., 1988, Febs Letters, 226, 241-246) , a Pu promoter may be derived from plasmid pRD579 (an Rl-based replicon, Dixon ≤t al., 1986, Molec. Gen. Genet. 203, 129-136), a xyl S gene may be derived from plasmid pERD839 (a plasmid based on the RSF1010 replicon, Michan ≤t l., 1992, 267, 22897-22901; this publication also mentions other plasmids which may be the source of xylS genes, e.g. pERD103 for wild-type xylS) and a xylR gene may be derived from plasmid pTS179 (a pACYC184 replicon, Inouye fit al-, 1983, J.

Bacteriol., 155, 1192-1199. Alternatively the Pu/xylR expression cassette of Keil and Keil (supra) could be used. These sources are however only exemplary, and a number of alternative source plasmids could be used, selected from among the vast number known in the literature.

Techniques for excising the desired nucleotide sequences containing the TOL promotor and/or regulatory regions or the RK2 minimum replicon functions from a selected source and introducing them into an expression vector or intermediate construct are well known and standard in the art, and are described for example in Sambrook fit al. , 1989, Molecular cloning; a laboratory manual, 2nd Edition, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, N.Y.

As will be described in more detail in the Examples below, it is convenient to isolate the desired sequences from a selected source and introduce them, using

techniques standard in the art, into a series of intermediate constructs, which may be plasmids, introducing or adding or deleting elements to arrive at the expression vectors of the invention. As used herein the terms "RK2 minimum replicon" and "TOL regulatory functions" and indeed the separate genetic elements " oriV" , " trfA" "Pm", "Pu", "xylS" and "xylJ?" include not only the native or wild-type functions as they appear in the original, parental or archetypal source plasmids but also any modifications of the functions, for example by nucleotide addition, deletion, or substitution or indeed chemical modification of the nucleotides, which occur naturally, e.g. by allelic variation or spontaneous mutagenesis, or which are introduced synthetically. Techniques for modification of nucleotide sequences are standard and well known in the literature and include for example mutagenesis, e.g. the use of mutagenic agents or site- directed mutagenesis. PCR may also be used to introduce mutations. Appropriate or desired mutations, may for example be selected by mutant screening of the genetic element in question e.g. the promoter.

Thus, modifications may be introduced into the trfA gene, for example, to increase copy number of the vector within a host cell, or to achieve temperature sensitive replication. Such modifications have been described in the literature. The copy number of RK2 within E. coli is usually estimated to be 5-7 plasmids per chromosome. However, this may be elevated in both E. coli and other bacteria by certain point mutation in the trfA gene, which may lead to copy numbers up to 23-fold higher than normal. Such "copy up" or " cop mutations" are described for example in Durland et al. , 1990, J. Bacteriol, 172, 3859-3867; Haugan fit_ai., 1992 supra; and Haugan fit_al., 1995, Plasmid, 33, 27-39. Cop mutations have been shown to be most effective in increasing copy numbers in E. coli ; in other bacteria, such high copy numbers may not be tolerated. Nonetheless, cop mutations in the trfA

gene may be used to increase expression in bacterial species beyond E. coli .

Results have shown that expression of genes from the vectors of the invention may be modified by changing the copy number of the vectors. This is a unique and useful feature, which could be used, for example, to reduce expression due to the formation of inclusion bodies. A lower copy number of cop plasmids may also be used to reduce background and gene expression, in the absence of inducer. This may be particularly useful if the gene product is toxic to the host cell.

Studies have shown that cop mutations in trfA tend to be localised between the Nde I and Sfi I sites in trfA, and that cop mutations may readily be prepared by exchanging the Sfi I/Nde I fragment internally in the trfA gene, and straight-forward one-step cloning procedures (see Haugan fit_al., 1995, supra) . It is therefore advantageous to keep the Sfi I and Nde I sites in trfA unique in the vectors of the invention. Mutations may also be introduced into trfA to render the replication of RK2-oriV plasmids temperature sensitive, as described for example in Valla et al. , 1991 and Haugan ei__al., 1992, supra. The trfA gene is known to encode two related proteins of 44 and 33 kDa that are produced by independent translation initiation at two start codons within the same open reading frame (Shingler and Thomas, 1984, J. Mol. Biol. 175, 229-249). Mutations may be introduced using analogous techniques to alter other functional properties of these proteins. Within the scope of the invention, vectors may be created which permit regulated expression of CrfA, permitting replication of the vector to be controlled. Thus, for example, vectors have been constructed in which trfA is placed under control of the Pm promoter. This may be achieved simply by deleting trfA from its original position in a vector of the invention such as pJB653ATG (see Example 1) and inserting it downstream of Pm . Vectors in which trfA is under the control of Pu

may analogously be constructed. The useful property of such vectors is that they replicate as long as the promoter is kept induced by the presence of the external inducer (i.e. an aromatic hydrocarbon), while replication is blocked in the absence of the inducer; a certain minimum amount of TrfA protein is required for replication and if insufficient TrfA is expressed the vectors cannot replicate, which generally occurs in the absence of inducer (although this is dependent on cell growth temperature - see Table 8) .

Vectors which allow controlled trfA expression may have a number of uses. For example, if a cop mutant of. trfA is used, the copy number of the plasmid may be controlled by the inducer, indirectly making it possible to control the expression level of a gene controlled by another promoter. The vectors could also be used to insert transposons and inactivate specific genes by homologous recombination. Thus, the vector may be established in a host, the culture grown in the presence of inducer, and then plated onto selective plates in the absence of inducer. Only those cells where transposition or recombination has taken place will survive.

The ability to control trfA expression may be of interest from a safety point of view. The expression system makes it possible to eliminate the vector after production, since its existence is dependent on the particular inducer.

Modifications may also be introduced to any of the TOL-based regulatory functions. Thus, modifications, e.g. by introduction of point mutations including either by random or side-directed mutagenesis, may be made to the promoters Pu or Pm or to the regulatory genes xylR or xylS, for example to improve expression, alter the regulatory characteristics, or to extend the host range of the vectors, etc. For example, a mutant of the Pm promoter which exhibits down-regulation of expression, which might be useful in some circumstances, is reported

in Kessler _f it_al., 1993, J. Mol. Biol. 230, 699-703. Conversely, mutations to enhance expression may also be made. Thus, for example, expression could be increased by expressing more XylS, as described for example by Kessler fit al- , 1994, J. Bacteriol., 176, 3171-3176. A number of modifications of the xylS gene have also been reported, for example the xylS mutant xylS2tr6, which exhibits an altered effector specificity, and can mediate a 3-8 fold higher level of transcription than can wild-type xylS at a wide range of temperatures

(Ramos et al. , supra), and the mutant gene xylSarg41pro (= χy-15839) , which causes a reduction in the basal transcription level from Pm, compared to wild type xylS (Michan et al. , supra) . All such modifications may be used according to the present invention.

It has also been found that the xylR/xylS genes may be inserted into the vectors in either orientation.

As mentioned above, the expression vectors of the invention may advantageously be used to express a desired gene within a broad range of host cells. It has surprisingly been found that high level and tightly controlled expression may be obtained across a broad range of hosts using the same vector system. This high level of expression maintained across a range of hosts is an unusual feature. In addition to the broad host range of the vectors, the Pu and Pm promoters give a very high induced to uninduced ratio, indicating that tight control of expression may be achieved. Especially, it has been observed that levels of expression from the Pm promoter are surprisingly high for different genes and for different hosts, as compared with Pu or other promoters. The use of a Pm promoter therefore represents a preferred aspect of the invention. Transcription from the Pu and Pm promoters can be activated by different inducers, and different inducer compounds can lead to different levels of promoter activation (Ramos e_t_al., 1990, J. Mol. Biol. 211, 373-

382) . This property may also be used to fine-tune expression levels.

It may also be possible, further to modify expression levels by modifying culture conditions. Thus, the expression system may be improved by changing the growth condition of the host cell, e.g. temperature, culture medium composition and other culture conditions such as speed of agitation, vessel size etc. Such culture modifications are known in the art. It has been found, for example, that expression increases at lower temperature. It may further be possible also to modify expression from Pu by means of catabolite repression, for example by adding certain sugars, e.g. glucose to the growth medium during culture of the host cells. The "genes" which may be expressed in the vectors of the invention include any desired or cloned genes including partial gene sequences, or any nucleotide sequence encoding a desired expression product, including fusion protein products, such as, for example, a desired gene sequence linked to a further nucleotide sequence encoding a further polypeptide such as β- galactosidase or glutathione-S-transferase. Such "fusion proteins" are well known in the art. The genes which are expressed from the vectors of the invention may thus include genes which are heterologous or homologous to the host cell.

The host range of the vectors is broad and includes a vast range of Gram-negative bacteria, as well as Gram- positive bacteria. Suitable Gram-negative bacteria include all enteric species, including, for example, Escherichia sp., Salmonella, Klebsiella, Proteus and Yersinia . and non-enteric bacteria including AzotoJbacter sp., Pseudomonas sp., Xanthomonas εp., Caulo acter sp, Acinetobacter sp., Aeromonas sp., Agrobacteri um sp., Alcaligenes sp., Bordatella sp., Haemophilus Influenzae, Methylophilus methylotrophus , Rhizobium sp. and Thiobacillus sp. (see also Thomas and Helinski, supra) . Gram-positive bacterial hosts which may be used include

Clavibacter sp.

Such transformed host cells are included within the scope of the present invention. A further aspect of the present invention thus includes a host cell containing an expression vector as hereinbefore defined.

Methods for introducing expression vectors into host cells and in particular methods of transformation of bacteria are well known in the art and widely described in the literature, including for example in Sambrook et al.. (supra) . Electroporation techniques are also well known and widely described.

In a still further aspect, the invention thus also provides a method of expressing a desired gene within a host cell, comprising introducing into said cell an expression vector as hereinbefore defined containing said desired gene, and culturing said cell under conditions in which said desired gene is expressed. Advantageously, the desired gene may encode a desired polypeptide product and hence the invention also provides a method of preparing such a desired polypeptide product by culturing a host cell containing an expression vector of the invention into which the desired gene has been introduced, under conditions whereby said polypeptide is expressed, and recovering said polypeptide thus produced.

To express the desired genes, the expression vectors of the invention conveniently contain one or more sites for insertion of a cloned gene, e.g. one or more restriction sites, located downstream of the promoter region. Preferably, multiple, e.g. at least 2 or 3, up to 20 or more, such insertion sites are contained. Vectors containing multiple restriction sites have been constructed, containing eg. 20 unique sites in a polylinker. Suitable cloning sites for insertion of a desired gene are well known in the art and widely described in the literature, as are techniques for their construction and/or introduction into the vectors of the invention (see eg. Sambrook fi

al . , supra) .

For ease of construction, appropriate cloning sites may be introduced in the form of a polylinker sequence, using nucleic acid manipulation techniques which are standard in the art. A range of suitable polylinker sequences are known in the art and may simplify the routine use of the expression vectors. Thus, for example a well-known polylinker/lacZ' region may be used, as described for example in the vectors of Ditta _f it_al., 1985, Plasmid, 13, 149-153, simplifying standard cloning procedures and identification of plasmids with inserts, by using the blue/white selection technique based on lacZ, which is well-known in selection procedures. A number of other features may also be included in the vectors of the invention. Thus, the vectors may include features which assist in plasmid transfer, such as the oriT function of RK2 plasmids, which facilitates conjugation and is useful in cases where transformation/ electroporation is inefficient, or if very high transfer frequencies are required.

Functions may also be introduced to stabilise the expression vectors, or to assist in their maintenance in a broad range of hosts. RK2 encodes two operons containing the parDE and parcBA genes, respectively, which are involved in the maintenance of RK2 plasmids or heterologous replicons in diverse bacterial hosts (Roberts _f it_al. , 1990, J. Bacteriol, 172, 6204-6216; Schmidhauser and Helinski, supra,- Sia et al.. 1995, J. Bacteriol, 117, 2789-2797; and Roberts ej__al., 1992, J. Bacteriol, 174, 8119-8132) . Par functions or loci, including any of the par genes eg parDE may thus be introduced into the vectors of the invention.

Selectable markers are also usefully included in the vectors of the invention for example to facilitate the selection of transformantε. A wide range of selectable markers are known in the art and described in the literature. Any of these may be used according to

the present invention and include for example the antibiotic resistance markers carried by the RK2 plasmids and their derivatives, or indeed any of the TOL plasmids or their derivatives, or any other plasmid. However, properties such as sugar utilisation, proteinase production or bacteriocin production or resistance may also be used as markers. The TOL plasmid xylE structural gene may also be used as a marker. This gene encodes the product C230 which may readily be detected qualitatively or assayed. Spraying a plate of bacterial colonies with catechol rapidly distinguishes C230 ⁺ colonies since they turn yellow due to the accumulation of 2-hydroxy muconic semialdehyde, enabling transformants/transconjugants etc. rapidly to be identified, by the presence of xylE in the vectors.

Other features which may be included in the vectors include further regulatory and/or enhancer functions, for example transcriptional or translational control sequences such as start or stop codons, transcriptional initiators or terminators, ribosomal binding sites etc. Thus, for example, in vectors where trfA expression is not controlled, a transcriptional terminator, preferably a bidirectional terminator, may advantageously be positioned between the promoter and the trfA gene. In this way read-through transcription from the trfA gene into the Pu/P promoters may be prevented and transcription initiated at Pu or Pm should not affect trfA expression. It will however be appreciated that the use of transcriptional terminators has general applicability to avoid read-trough transcription of protein encoding portions of the vector, such as the trfA gene and the cloned gene of interest. Such functional elements are known in the art and a suitable transcriptional terminator is described in, for example, Fellay £t__al.. 1987, Gene, 52, 147-154 and Frey and

Krisch, 1985, Gene, 36, 143-150. As will be described in more detail in the Examples below, whilst TOL-based control elements such as start codons or ribosomal

binding sites etc. naturally asεociated with the Pu/P promoters may be used, alternative or additional such elements may also be introduced. Example 1 describes the preparation of an ATG expression vector, where sequences downstream of the ATG initiator were eliminated, permitting gene sequences to be inserted directly in this ATG site. A vector construct has also been created in which bases between the promoter and Shine-Dalgarno sequence are modified to create a new restriction site. Thus, the vector pJB653ATG of Example 1 has been modified in this fashion, making it poεεible to combine mutationε in the Shine-Dalgarno sequence with mutations in the promoter.

Further modifications which may be made to the vectors, include size reduction by removal of unnecessary DNA from source or intermediate plasmids, removal of undesired restriction sites, addition of new restriction sites etc., which may be achieved by standard DNA manipulation techniques. As mentioned above, the high levels of expression obtainable across a broad host range, make the expreεsion vectors of the present invention particularly useful as tools for maximising and/or controlled expression of a desired gene produc . Control of trfA expression permits a further means of regulating or controlling expresεion of a desired gene product. The vectors may also be used for expresεion εtudies and physiological analyses in bacteria, for example to analyse metabolic pathways, eg. determine rate limiting stepε, conveniently also at intermediate or low expression levels, or for εtudies of plasmid transfer and dispersal in natural environments. The vectors of the invention may have particular utility as an environmental safety standard. The vectors of the invention, since they allow expression, and indeed in some cases replication of the vector, to be tightly controlled, are particularly safe from an environmental point of view. In particular, the trfA controlled

vectors would not be able to replicate in the natural environment, due to the absence of the inducer (except under certain cell growth temperatures - see Table 8) , were they to escape into the environment, as a result of, for example, leakage of host cells from a fermentor. Thus, the vectors present in the eεcaped cells would eventually be eliminated as the escaped cells propagated, since the vectors would be unable to replicate, thereby also eliminating the inserted foreign gene from the environment.

The invention will now be described in more detail in the following Examples, with reference to the following drawings in which:

Figure l shows a map and the construction of general purpose broad host-range cloning vectors.

Restriction siteε relevant for the conεtruction or uεe of the vectorε are εhown. Each εtep in the construction is indicated by an arrow. The restriction sites in the polylinker downstream the lacZ promoter is marked with ^τ , and the sites are, in the counterclockwise direction,- Hindlll, Sp I, PstI, Sall/HincII/AccT, Xbal, BamHI, Xmal /S al , Kpnl , Sacl , and EcoRI . Sites in the polylinker that are not unique are indicated elsewhere on each vector. Note that the sites for Ndel and SfiI are unique for all the vectors, except for pJB32l.

Figure 2 presents graphs showing the broad host- range stabilization properties of the 0.8 b parDE region in vector pJB321E. In various species: (A) E. coli DHS ; (B) A. vinelandii ; (C) P. aeruginosa . Symbols: ■, pJB3E; °, pJB321E.

Figure 3 showε a map and the construction of broad host-range expression vectors pJB137 and pJB653. The sites in the polylinker (originally from pUC19) downstream of the promoters Pm and Pu are indicated. Other notations are aε deεcribed in the legend to Figure 1. Ndel and Sfil are unique in all the vectors, except for in the parDE derivatives pJB139 and pJB654 (Table 1) .

Figure 4 presents graphs showing Expression analysis of celB as a function of cell growth in E. coli PGM1. (A). Expression from pJB137celB (Pu) . (B) Expression from pJB653celB { Pm) . The basal expression level of celB from Pm is between 200 and 300 nmole/min/ mg protein. (□) , presence,- (♦) , absence of inducer dated at t = 0.

Figure 5 shows amylose combination in E. coli PGM1 aε a function of celB expreεεion from pJB653celB. Figure 6 εhows a map of pJB653ATG. pJB653ATG differs from pJB653 by lacking 275 bp downstream of the translation initiation ATG (underlined) and by the construction of an Afllll site at the initiating ATG by changing one base from C to A (marked with the symbol *) . Note that pJB653ATG contains a unique PstI site, in contrast to pJB653, which contains two such sites (Figure 3) ,- RBS; ribosome binding site (32) .

Figure 7 presents graphs showing the expreεεion of luc from pJB653ATGIuc in (A) E. coli DH5 , (B) X. campestris and (C) P. aeruginosa aε a function of cell growth in the presence (♦) and absence (□) of inducer. The basal expression levels of Luc from Pm in E. coli , X. campestris and P. aeruginosa are 4 x 10 ⁶ ,8 x 10 ⁵ and 5.1 x 10 ⁷ cpm, respectively (average values) . ^a The cpm values correεpond to the activity in 10 μl cell culture at OD ₆₆₀ =0.3.

Figure 8 shows an SDS-PAGE gel of sampleε of protein expressed in E. Coli DH5α from the " CelB" vectors of Example 2; lane 1: Molecular weight standard. lane 2: DH5 (pJB653ATGcelB) induced. lane 3: DH5 (pJB653ATGcelB) uninduced. lane 4: DH5 (pJB653ATGcelBcop271C) induced. lane 5: DH5α (pJB653ATGcelBcop271C) uninduced. lane 6: DH5 (pJB653ATGcelBcop251Λf) induced. lane 7: DH5 (pJB653ATGcelBcop251M) uninduced;

Figure 9 shows a map of vector pJBSDl, as described in Example 4.

EXAMPLE 1

In this Example we describe the construction of a series of well characterized broad host-range multi- purpose cloning vectors based on the RK2 replicon.

These vectors were used to develop tightly controlled gene expression systems. For this purpose we used the Pu/Pm promoters and the corresponding positive regulatory genes xylR/xylS, all originating from the TOL plasmid of Pseudomonas putida.

To characterise the functionality of the two promoters, we used the genes encoding the enzymes phosphoglucomutaεe (CelB) from Acetobacter xylinum (Fjaervik, et al.. 1991, FEMS Microbial. Lett., 77, 325- 330) , and luciferaεe from the firefly Photinus pyralis . Amylose accumulation in E. coli was used as a model to study the intracellular effects of varying CelB expression, since E. coli cells lacking phosphoglucomutaεe (in contrast to wild type) accumulate amylose intracellularly when grown on maltose as carbon source (Adhya fit_al., 1971, J. Bacteriol., 108, 621- 626) .

The use of luciferase as a reporter was motivated by the fact that microorganisms generally do not naturally express this enzyme, in contrast to phosphoglucomutase.

Materials and Methods

Bacterial strains, plasmids and growth media.

The bacterial strains and plasmids used in this study are described in Table l. P. aeruginosa and E. coli strains were grown in L-broth or on L-agar (Sambrook et al .. supra) . In the amylose accumulation experiments L-broth was supplemented with 1% maltose. The growth temperature was 30°C for P. aeruginosa . E. coli cells were grown at 37°C, except for the expresεion analyεiε of celB and luc transcribed from the

Pm/Pu promoters, where 30°C was used. A . vinelandii and X. campestris were grown at 30°C in Burk medium (Schmidhauser and Helinski, supra) and YM broth (Difco) , respectively. Antibiotics were used at the following concentrations: ampicillin, loo μg/ml (wild type trfA) , 1 mg/ml ( cop272 C) , or 2 mg/ml ( cop254D) ; carbenicillin, 100 μg/ml; tetracycline, 15 μg/ml; chloramphenichol, 30 μg/ml; kanamycin, 50 μg/ml; streptomycin, 2 mg/ml.

Conjugative matings and electrotransformations.

Conjugative matings from E. coli to P. aeruginosa were performed on membranes and the mixtures were incubated on nonselective agar-medium at 30°C for 3 hours. S17.1 containing the relevant plasmids was used as donor strain. The mating mixture was incubated for 3 hours at 30°C and then plated on agar-medium containing carbenicillin and streptomycin. Plasmids were transferred to A. vinelandii and X. campestris by electrotransformation at a field strength of 12.5 kV/cm, as described for E. coli (Hanahan fit_al., 1991, Methods Enzymol, 204, 63-113) and the cells were then plated on agar-medium containing ampicillin.

DNA manipulations. Plasmid DNA was prepared by the alkaline lysis protocol for E. coli , and all other standard techniqueε were performed according to Sambrook et al, εupra. Transformations of E. coli were performed by the method of Chung et al.. 1989, Proc. Natl. Acad. Sci., USA, 86, 2171-2175. DNA sequencing was performed by the dideoxy chain-termination method (Sanger fit_al., 1977, Proc. Natl. Acad. Sci., 74, 5463-5467). Cell growth at OD _66o was monitored with a Beckman DU-65 ( celB expression experiments) and a Shimadzu UV-160A spectrophotometer ( luc expression experiments) . For PCR amplification of the luc gene from pGEMluc the following primers were syntheεized; 5'GATCCCCATGGAAGACGCCAA3' and 5'CGGAGGATCCCAATAGCTAAGAA3' . The primers contain a Ncol

and a BamHI site, respectively. For PCR amplification of the 139 bp EcoRI /Pstl fragment, using pJB653 aε template, the following primerε were used; 5'AGGTGAATTCACATGTTCATGACTCCA3 ' (containing an EcoRI and an Afllll site), and 5'AGGGCTGCAGTGTCCGGTTTGA3 ' (containing a PstI site) .

Analysis of plasmid stability.

E. coli DH5α, A . vinelandii and P. aeruginosa containing pJB3E/pJB321E were grown under selection to stationary phase, diluted 100-fold in the same medium and then grown exponentially under selection. The stability assay was initiated by diluting the cells to 1 x 10 ³ cells/ml in non-εelective medium, followed by growth over night. Cultures were then again diluted and grown overnight in non-selective medium (as above) , and this procedure waε repeated until the total number of generations had reached 200-400, as indicated in the Results Section. After each dilution aliquots were plated on nonεelective agar medium. The colonies were εprayed with 50 mM catechol to monitor the frequency of plaεmid-containing cellε (yellow colonieε, Franklin fit al., 1981, Proc. Natl. Acad. Sci, 78, 7458-7462).

The results were also double-checked by replica plating 100 colonies on agar-medium containing ampiciilin.

Expression studies and amylose measurements.

For CelB and Luc expresεion studies referring to Figure 4, Figure 7, and Table 3, cells were grown overnight in selective medium, diluted 100-fold in the same medium and then grown exponentially to OD ₆₆₀ = 0.1. Stimulation of celB and luc transcription from the Pin promoter was then induced by addition of m-toluic acid to 2 mM or 0.5 mM for E. coli and X. campestris, respectively. 0.5 mM IPTG was used for inducing luc expression from the ptrc promoter in pTrc99Aluc. Cells containing pJBl37celB were diluted again (2000-fold) and

grown to OD ₆₆₀ = 0.1. 3-Methylbenzylalcohol was then added to 3 mM for stimulating transcription from the Pu promoter. Thiε extra εtep was included to eliminate background CelB remaining from stationary phase. Samples were removed at various time during growth for analysiε of CelB or Luc activitieε.

For measurements of the CelB activities deεcribed in Table 2 cellε were diluted 1000-fold after overnight growth and then grown to OD ₆₆₀ = 0.1 before addition of the inducer. For analysis of amylose accumulation cells were grown in selective medium overnight, diluted 200- fold, and then grown further to OD ₆₆₀ = 0.3-0.4. m-toluic acid was then added to 2 mM. Measurementε of amylose accumulation (Brautaεet ≤t_al., 1994, Microbiology, 140, 1183-1188) and CelB activities were performed 16 hours after addition of the inducer.

Preparation of cell-free extracts and measurements of phoshoglucomutase activitieε were performed as described by Fjaervik fit_al., (supra) . Measurements of luciferase activities were performed by using the Luciferase Aεsay System from Promega, and cell extracts were prepared from 90 μl cell culture, as described by the manufacturer. Samples were removed during growth and diluted or concentrated to OD ₆₆₀ = 0.3 before preparation of the extracts. 10 μl of the cell extracts was used for the quantitation of light intensity by a scintillation counter.

Results

Construction of general purpose broad host-range cloning vectors.

Figure 1 outlines the procedures involved in constructing a set of relatively small RK2-based vectors with different antibiotic resistance markers (pJB3, pJB3Cm6, pJB3Tc20, and pJB3Kml) . Plasmid pFFl was used as a starting point for all the constructs, and many of the steps in the construction procedure εerved to delete

unneceεsary DNA sequences (size reduction) , to eliminate undesired restriction endonuclease sites, or to create new such siteε. One of the uεeful consequences of this is that the Ndel and Sfil siteε in trfA were kept unique. All vectorε share in common a polylinker/lacZ ¹ region. Most of the restriction endonuclease sites in the polylinker region are unique, and the exceptions are caused by the presence of some of these sites in antibiotic resiεtance marker geneε. All vectorε contain oriT.

The complete nucleotide εequences of the vectors were establiεhed by combining εequences previously reported in the literature and by sequencing many of the junction sites involved in the construction procedures. This greatly simplifies the routine use of the vectors, further improvements, and generation of more specialized derivatives.

Vector stability. To improve plasmid stability for some hosts we inserted parDE into pJB3 generating pJB321, as shown in Figure 1. To simplify stability measurements the xylE' fragment from pJBl09 was also inεerted into the polylinker of pJB3 and in pJB321, generating plaεmids pJB3E and pJB321E, respectively. The fragment was inserted in such an orientation that xylE' could be transcribed from the lac promoter in the vector. Figure 2 demonstrates the stabilizing effects of the parDE sequences in three different species. In E. coli the unmodified plasmid (pJB3E) is relatively stable, but in the presence of parDE (pJB321E) virtually no plasmid loss was observed (Figure 2A) .

As can be seen from Figure 2B pJB321E is much more stable than pJB3E, illustrating the usefulness of this vector modification for certain hosts. In Pseudomonas aeruginosa the stability difference between the two plasmids was marginal (Figure 2C) , but the frequency of plasmid loss is so low in both caseε that for most

purposes practical problems should not be experienced.

Construction of broad host-range expression vectors.

Plasmid pJB7 was used as a εtarting point for the construction of expresεion vectors pJB137 and pJB653, containing the Pu and Pm promoters, reεpectively (Figure 3) . In the firεt εtepε the genes encoding the positive regulators XylR and XylSArg41Pro were inserted. The mutant gene xylSarg41pro was used because it causes a reduction of the level from Pm, compared to wild type xylS (Michan et al., supra) . The Pu and Pm promoters were then inserted, generating plaεmidε pJB134 and pJB64. The remaining εtepε up to the final constructs pJB137 and pJB653 served to fill in undesired restriction endonuclease siteε, to create new εites, and to insert a bidirectional transcriptional terminator between the Pu/Pm promoters and the trfA gene. This terminator has previously been shown to function in a wide variety of Gram-negative species (Fellay et al. , supra and Frey and Krisch, εupra) . To simplify the routine use of these expresεion vectorε they contain a polylinker region downεtream of the Pu/Pm promoterε (Figure 3) . In analogy to pJB321 (Figure l) the parDE region was also inserted into each of the constructε, generating pJB139 and pJB654 (Table 1) .

Expression of the AcefcoJbacfcer xylinum phosphoglucomutase gene, celB, from the Pu and Pm promoters.

The 1.9 kb BamHI celB fragment from pUC7 celB was cloned in an orientation that allowed transcription of the gene from Pu in pJB137 and Pm in pJB653, generating pJB137 celB and pJB653 celB . The expression levels were then monitored as a function of cell growth (Figure 4A) . As can be seen, the Pu promoter expresεes very low levels of phosphoglucomutase in the absence of inducer as long as the cellε are kept growing exponentially. The expression level in the presence of inducer is also low, but several fold higher than in uninduced cells.

Aε the cellε enter εtationary phase the expresεion levels in the uninduced and induced cells increases strongly, although the induced cells express much more of the enzyme. Figure 4B showε the reεultε of a correεponding expression study of pJB653 celB, containing the Pm promoter. Expresεion from Pm does not seem to be affected εignificantly by the εtage of growth but leakage and maximum expression are higher than for Pu. The results demonstrate that the leakage expression of this promoter is not growth phase dependent, and that the background level of expresεion iε much higher than in exponentially growing cellε containing pJB137celB (see legend to Figure 4) . As subsequent experimentε εhow, thiε backward expreεsion is sufficiently low not to cause a problem. Moreover, if necessary to reduce leakage (uninduced) expresεion, a down mutant of the Pm promoter could be used (Kesεler et al. , εupra) . Stimulation of the Pm promoter resulted in much higher expresεion levelε of CelB than from Pu. For unknown reaεonε the levels of phosphoglucomutase dropped significantly at prolonged incubation levels, in contrast to what was observed in the experiments with the Pu promoter. The copy numbers of the vectors were increased by exchanging the SfiI /Ndel fragment internally in the trfA gene. We have done this in pJB653celi3 and pJB137celB to analyse the copy number effects on celB expresεion (Table 2) . For the Pu promoter in pJB137 the cop271C mutation leadε to an increaεe in celB expreεsion both in the absence and presence of inducer, and the magnitude of the increase is approximately proportional to the increase in copy number. (Haugen et al.. 1992, supra) . Surprisingly, however, when the copy number was increased further (about 20-fold) using cop254D (Haugen £t_al., 1992, supra) expression levels did not increase beyond the levels of cop27lC. For the Pm promoter leakage expression increased strongly by introduction of

the cop mutations, while the cop254D mutant expressed even lesε phoεphogluco utaεe than cop271C

The effects of the cop254D mutation on expression was rather puzzling, but we believe that the results may at least partly be caused by a poisoning effect on the cellε mediated by the high copy number of cσp254D (Haugan e al.. 1995, supra) . We observed directly that the PGM1 strain containing this mutant was somewhat inhibited in its growth rate, while such an effect was not obεerved in another E. coli εtrain, DH5α. As can be seen from Table 2, the expression levels of phosphoglucomutase for the cop254D/Pm combination were much higher in DH5α than in PGM1. These results thus strengthen the hypothesis that cop-mutant mediated cell poisoning effects may influence strongly the expression from Pm .

Use of pJB6S3celB for studies of effects of celB expression on amylose accumulation in E. coli . Figure 5 demonstrates that when cells are grown on maltose as carbon source amyloεe accumulates in similar quantities as cellular protein in PGM1. In the presence of a low level of expression of celB (uninduced state of Pm) amylose accumulation is only slightly affected. In other words, the leakage εyntheεis is not sufficiently high to block amylose accumulation, illustrating that this promoter system can be used to analyεe rate- limiting εtepε in metabolic pathways. In the presence of inducer amylose accumulation is strongly reduced, aε expected, in response to the increase in the intracellular phosphoglucomutase level. However, we found it surprising that a significant accumulation still takes place in spite of the presence of very high levels of phosphoglucomutaεe. We believe that this effect iε εomehow the reεult of the particular biochemical properties of the Acetobacter xylinum phosphoglucomutaεe enzyme. This is clearly illustrated by the observation that the phosphoglucomcaεe positive

parent strain of PGM1 Hfr3000, does not accumulate measurable quantities of amylose (Brautaset, supra) , even though the activity levels of the enzyme is as low as about 2% of the CelB activity under induced conditions (data not shown) . This test system therefore seems to illustrate a case where a metabolic process can be modified by replacing an enzyme in a given host by a heterologous variant of the same enzyme.

Construction of an ATG vector and its use to study luciferase expression in E. coli , X. campestris and P. aeruginosa .

The DNA fragments containing the Pu/Pm promoterε in pJB137/pJB653 both contain the riboεome-binding site. In addition, these fragments include for Pm the 5' terminal part of the first gene from the meta-cleavage pathway operon (Inouye £t_al. , 1984, Gene, 29, 323-330) and for Pu the 5' terminal part of an ORF that has not been identified upstream of the first gene in the upper pathway operon (Harayama fit_al. , 1989, J. Bacteriol.

171, 5048-5055; Inouye et al. _f 1984, Proc. Natl. Acad. Sci. 84, 1688-1691). This means that during expression of celB translation is probably first initiated at the natural signal sequenceε, and then reinitiated at the corresponding elements from A. xylinum . In order to create a more well-defined expresεion system we modified the region downstream of Pm in pJB653 such that the sequenceε downstream of the translation initiation ATG were eliminated, and new genes can be cloned directly in this ATG site after digesting the vector with Afllll

(same cohesive ends as Ncol ) . Afllll was chosen since there is a Ncol site in the vector. The new vector was designated pJB653ATG (Figure 6) . The luc gene from the firefly was then inserted at the ATG site, generating plasmid pJB653ATGluc (Table 1) . This plasmid was then used to monitor luc expression in E. coli , X. campestris and P. aerugrinosa. Our data based on expression of luc in pJB653ATG, show that it is posεible to obtain more

than a 100-fold induction level in X. campestris . Figure 7A shows that the kinetics of activation in E. coli were similar to that of celB (Figure 4B) , but the Luc activity was more stably maintained than the CelB activity upon prolonged incubation. Another difference is that the maximal ratio between the induced and uninduced state was significantly higher (between 300 and 400 fold) with pJB653ATGluc than with pJB653 celB (between 50 and 100 fold) . It is not clear whether this effect is somehow caused by the use of different reporter enzymes or by the changes introduced in the sequenceε downstream of the Pm promoter.

To quantitatively compare luc gene expression with some well-known expression vector we subcloned the l uc gene at the ATG in the commercially available E. coli vector pTrc99A, generating pTrc99Aluc (Table 1) . Theεe experiments showed that the Luc activity in such cellε (after IPTG induction) was similar to the activities in induced cells containing pJB653ATGluc, while the induction ratio was much lower from pTrc99A (Table 3) . The high levelε of expreεεion from the induced Pm promoter were unexpected, becauεe the copy number of the RK2 replicon iε much lower than that of pTrc99A, and also because ptrc is known to be a very εtrong promoter. Pm has to our knowledge not been evaluated in this respect. To analyse these resultε further we inεerted the cop271C mutation into the trfA gene of pJB653ATGluc and then repeated the expresεion experimentε. The expreεsion levels were much higher from this construct and exceeded the levels expresεed from pTrc99A by a factor of seven. These data indicate that the Pm promoter may be useful for the purpose of maximizing gene expression.

To study the performance of pJB653ATGluc in a non- enteric host we transferred the plasmid to X. campestris, and measured luc expression in a similar way as in E. coli . Figure 7B demonstrates that as in E. coli luc expression is very low in uninduced cellε, while the

activity increaεes more than 100-fold nine hours after induction. Figure 7C illustrates luc expresεion in P. aerugrinosa, in which the maximum luc expression level was achieved 12 hours after induction, resulting in a 120-fold induction ratio. It can therefore be concluded that pJB653ATGluc haε a broad potential for expression studieε in bacteria.

Table 1 . Bacterial strains and plasmids used in Example

Bacterial strain Properties Reference or plasmid

Escherichia coli DH5α endAl hsdR17 supE44 thi -1 λ Bethesda Research gyrA96 relAl ΔlacU169 (φS0 lacZΔM15) Laboratories S17.1 RP4 2-T::Mu-Km::Tn7 pro res mod* 2 PGM1 pg derivative of Hfr3000 2 Pseudomonas aeruginosa PA01161S Spontaneous streptomycin resistant derivative of PA01161

Azotobacter vinelandii

UW Wild type Xanthomonas campestris

B100-152 Spontaneous exopolysaccharide mutant.

Plasmids

RK2 60 b broad-host-range plasmid originally isolated from Klebsiella aerogrenes Ap ^r .Km ^r .Tc ^r . pFFl RK2 minimal replicon Ap ^r .Cπ .5.9 kb. pjB2 Derivative of pFFl where the JBcoRl, Bglll , and Sail sites were filled This work. in by three steps. Ap ^r .Cm ^r .5.9 kb. pUC19 ColEl replicon Ap ^r .2.7 kb. pUC19-3 Derivative of PUC19 where the Ndel site was filled in (step 1) and the This work. Sspl and Afllll sites flanking the lac region were converted to iVsil and Bglll (steps 2 and 3, respectively) . Ap ^r .2.7 kb. pJB5 Derivative of PJB2 where 0.5 kb of This work the upstream part of the Cm

resistance gene was deleted with Pvull digestion, followed by insertion of a Bglll linker at the same site (step 1) . Two BamHl sites flanking Pneo were also filled in (step 2) . Ap ^r . 5.4 kb. pKH3 Derivative of pJB5 where 0.7 kb This work Pstl/Bglll fragment was replaced with a 1.0 kb Nsil/Bglll fragment containing the polylinker and lac regions from pUC19-3. AP ^r .5.7 kb.

pJB7 Deletion derivative of pJB5 obtained This work by digestion with Afllll + Bco47III (0.4 kb, step 1) and WotI + partial

AccI digestion (0.5 kb, step 2) .

Ap ^r . 4.5 kb. pJB3 Derivative of pJB7 where 1.5 kb This work

Bgll l/Sfil fragment was replaced with a l.θ kb Bglll/ Sfil fragment containing the polylinker and lac regions from pKH3. Ap ^r . 4.8 kb. pRR120 pBluescript II SK(+) with 0.8 kb 9 parDE region from RK2. Ap ^r . 3.8 kb. pJB9 Derivative of pRR120 where the This work polylinker sites between Hiπdlll and

Smal, downstream of parDE, were deleted by digestion with Hindlll

(filled in) and Smal. Ap ^r . 3.8 kb. pJBlO Derivative of pJB9 where the Jpnl This work site upstream of parDE was converted to Bglll. Ap ^r . 3.8 kb. pHL12 Derivative of pJB9 where the BamHI This work site downstream of parDE was filled in (step 1) , and the K nl site upstream of parDE converted to Xbal (step 2) .

Ap ^r . 3.8 kb. pJB313 Derivative of pJB3 where 0.8 kb Bglll/ This work

BamHI fragment containing the parDE fragment from pJBlO was inserted into the Bglll site. Ap ^r . 5.6 kb. pJB321 Same as pJB313, except that the parDE fragment is in the opposite orientation. p xylΩ RSFIOIO replicon, Cm ^r . 13.2 kb. pUC7 ColEl replicon. Ap ^r 2.7 kb. pJB107 Derivative of pUC7 where the promoterless xylE gene from pαxylEQ was cloned as a 2.0 kb BajnHI fragment into ρUC7 digested with the same enzyme.

Ap ^r . 4.7 kb. pJB109 Derivative of pJB107 where the two This work

SacII sites flanking the xylE gene in pJB107 was converted to EcoRI sites

(step 1) . This 1.2 kb EcoRI fragment

(here noted xylE' ) was then cloned into pUC7 digested with EcoRl (step 2) .

Ap ^r . 3.9 k . pJB3E Derivative of pJB3 where the 1.2 kb This work

EcoRI xylE ' fragment from pJB109 was cloned into the polylinker EcoRI site in

PJB3. Ap ^r . 6.0 kb. pJB313E Derivative of pJB313 where the 1.2 kb This work EcoRI xylE ' fragment from pJB109 was cloned into the polylinker EcoRI site in pJB313. Ap ^r . 6.8 kb. pJB321E Derivative of pJB321 where the 1.2 kb This work

EcoRI xylE ' fragment from pJB109 was cloned into the polylinker EcoRI site in pJB321. Ap ^r . 6.8 kb. pSV16 RK2 replicon. AP ^r . Km ^r . 3.3 kb. 12 PJB3Kml Derivative of pJB3 where the Km This work resistance gene of pSV16 was inserted into the Bglll site as an 1.2 kb BamHI fragment . Ap ^r . Km ^r . 6.1 kb. pJB3Km2 Same as pJB3Kml, except that the Km This work resistance gene was cloned in the

opposite orientation. pUC7Tc Derivative of pUC7 where the Tc This work resistance gene of RK2 was cloned as a 2.3 kb blunt-ended Stul/Bglll fragment into the Hindi site of pUC7. Ap ^r . Tc ^c .

5.0 kb. pJB3Tc20 Derivative of pJB3 where the Tc This work resistance gene from pUC7Tc was inserted as a 2.3 kb BamHI fragment into the Bglll site. AP ^r . Tc ^r . 7.1 kb. pJB3Tcl9 Same as pJBTc20, except that the Tc This work resistance gene was cloned in the opposite orientation. pUC7Cm Derivative of pUC7 where the Cm This work resistance gene was cloned as a 1.4 kb

Pstl/HgiAl blunt-ended fragment from pFFl into the Hindi site of pUC7. Ap ^r . Cm ^r . 4.1 kb. pJB3Cm6 Derivative of pJB3 where the Cm This work resistance gene of pUC7Cm was cloned as an 1.4 kb BamHI ragment into the Bglll site. Ap ^r . Cπ . 6.2 kb. pJB3CmlO Same as pJB3Cm6, except that the Cm This work resistance gene was cloned in the opposite orientation. pJB8 Derivative of pJB7 where the JVcoI This work site was converted to EcoRI. Ap ^r . 4.5 kb. pERD839 RSF1010 replicon containing xylS839. 13 Km ^r . Sm ^r . 14.7 kb pJB86 Derivative of pJB8 where xylS839 was This work cloned as a 1.7 kb BamHl fragment from pERD839 into the Bglll site. The xylS839 gene is transcribed in the same direction as the Jbla and trfA gene. Ap ^r . 6.2 kb. pERD21 RSF1010 replicon containing the Pm 14 promoter. Km ^r . 13.8kb. pUC129 ColEl replicon. Ap ^r . 3.3 kb. 15

pJB103 pUC129 with Pm promoter cloned as an This work 0.6 kb EcoRI/PvuII fragment from pERD21 into the EcoRI/EcoRV-digested vector. Ap ^r . 3.9 kb. pJB64 Derivative of pJB86 where the Pm This work promoter was cloned as an 0.6 kb Nsil / EcoRI fragment from pJB103 into pJB86 digested with PstI and EcoRI. Ap ^r . 6.8 kb. pJB651 Derivative of pJB64 where the This work orientation of Pm was reversed by digestion with Kpnl followed by religation (step 1) . A series of restriction endonuclease sites upstream of Pm were eliminated by Hindlll and EcoRI digestion (step 2) , and downstream of Pm by Sa l and BamHI digestion (step 3) . The remaining Kpnl site downstream of Pm was converted to a Hindlll site (step 4) . Ap ^r . 6.8 kb. pJFF350 ColEl replicon containing transcriptional 16 terminators of the Ω-Km transposable element. Km ^r . 5.3 kb. pJBI7 Derivative of pUC19 where the Xbal site This work in the polylinker was filled in (step 1) , and the polylinker PstI site was converted to Xbal (step 2) . Ap ^r . 2.7 kb. p7B1725 The 3.6 kb blunt-ended Hindlll fragment This work containing the Ω transcriptional terminators and the Km resistance gene from pJFF350 was cloned into the Hindi site of pJB17 (step 1) . The Km and ori region (3.0 kb) from pBR322 was deleted by Styl digestion (step 2) . Ap ^r . 3.3 kb. pJB1726 The XJal site in pJB1725 was converted This work to a Hindlll site. Ap ^r . 3.3 kb. pJB652 Derivative of pJB651 where the Ω This work transcriptional terminators of pJB1726

were cloned as an 0.6 kb Hindlll/EcoRI fragment into pJB651 digested with the same enzymes. Ap ^r . 7.4 kb. pJB653 Derivative of pJB652 where the PstI This work fragment containing the Pm promoter was cloned in the opposite direction by digesting pJB652 with PstI followed by religation. This step was necessary since DNA sequencing showed that Pm was in the incorrect orientation in pJB652.

Ap ^r . 7.4 kb. (It should be noted that although xylS was cloned from pERD839, sequencing data indicates that pJB653 contains wild-type xylS - this is reflected in Figure 6.) pJB654 The Xbal site upstream parDE in pJB139 and the BJbsI site upstream xylSB39 in pJB653 were filled in (step 1) . Originally, there were two Xbal sites and two BJbsI sites flanking parDE and xylS839, respectively. The 3.0 kb Sfil/ Bbsl (Bbsl made blunt) fragment of pJB653 was replaced with the 3.8 kb Sfil/ Xjbal (Xjbal made blunt) parDE containing fragment from pJB139. Ap ^r . 8.2 kb. pTS174 pACYC184 replicon, carries xylR . Cm ^r . 17 pJBlOl Derivative of pUC7 where a 2.4 kb This work

■xylP-containing Hpal fragment was cloned into the polylinker Hin i site of pUC7. Ap ^r . 5.1 kb pJB13 Derivative of pJBΘ where the xylR This work gene of pJBlOl was cloned as a 2.4 kb BamHI fragment into the Bglll site of pJB8. The xylR gene is transcribed in the same direction as the bla and trfA gene. Ap ^r . 6.9 kb. pRD579 Rl replicon, carries the Pu promoter. 18 Cb ^r .

pUC18 ColEl replicon. Ap ^r . 2.7 kb. ₈ pJB105 Derivative of pUClθ where the Pu This work promoter was cloned as an 0.3 kb EcoRI/ BamHI fragment from pRD579 into pUC18 digested with the same enzymes.

Ap ^r . 3.0 kb. pJB134 Derivative of pJB13 where the Pu This work promoter was cloned as an 0.4 kb EcoRI/ PstI fragment from pJB105 into pJB13 digested with the same enzymes.

Ap ^r . 7.0 kb. pJB136 Derivative of pJB134 where the EcoRI This work site upstream of the Pu promoter was filled in (step 1) , and the BamHI site downstream of Pu was converted to EcoRI

(step 2) . Ap ^r . 7.0 kb. pJB137 Derivative of pJB136 where the Ω This work transcriptional terminators from pJB1725 were cloned as an 0.6 kb EcoRI/XJbal fragment into pJB136 digested with the same enzymes. Ap ^r . 7.6 kb. pJB139 Derivative of pJB137 where the Xbal This work site was illed in (step 1) , and the Ttlαl site converted to Xbal (step 2) . The parDE fragment from pHL12 was inserted into the Xbal site as a 0.8 kb Xbal fragment (step 3) . The parDE gene is transcribed counterclockwise to the xylR gene. Ap ^r . 8.4 kb. pTB16 ColEl replicon. Ap ^r . 4.3 kb. 19 pUC7celB Derivative of pUC7 where the 1.9 kb This work blunt-ended SphHI celB fragment from pTB16 was cloned onto the Hind i site of pUC7. Ap ^r . 4.6 kb. pJB137celB Derivative of pJB137 where the 1.9 This work kb BamHI celB fragment from pUC7 celB was cloned in pJBl37 digested with the same enzyme. celB is transcribed

from the Pu promoter. Ap ^r . 9.5 kb. pJB653celB Derivative of pJB653 where the 1.9 This work kb BamHI celB fragment from pUC7celB was cloned in pJB653 digested with the same enzyme. celB is transcribed from the Pm promoter. Ap ^r . 9.3 kb. pFFl cop254D pFFl containing the cop254D mutation. Ap ^r . Cm ^r . 5.9 kb. pFFlcop271C pFFl containing the cop271C mutation. 20 Ap ^r . Cm ^r . 5.9 kb. pJB137 celBcop254D Derivative of pJB137celB This work where the 0.6 kb Ndel/ Sfil fragment was replaced with the 0.6 kb Ndel/ Sfil fragment from pFFIcop254I> containing the cop254D mutation. Ap ^r . 9.5 kb. pJB137 celBcop271C Derivative of pJB137ce2B This work where the 0.6 kb Ndel/ Sfil fragment was replaced with the 0.6 kb Ndel/ Sfil fragment from pFFlcop271C containing the cop271C mutation. Ap ^r . 9, . kb. pJB653 celBcop254D Derivative of pJB653 celB This work where the 0.6 kb Ndel/Sfil fragment was replaced with the 0.6 kb Ndel/Sfil fragment from pFFlcop254D containing the cop254D mutation. Ap ^r . 9.3 kb. pJB653 celBcop271 C Derivative of pJB653 celB This work where the 0.6 kb Ndel/Sfil fragment was replaced with the 0.6 kb Ndel /Sfil fragment from pFFlcop.?71C containing the cop271C mutation. Ap ^r . 9.3 kb. pGEM-luc pGEM-luc contains the luc gene Promega encoding firefly luciferase. Ap ^r . 4,9 kb. pTrc99A Expression vector containing the trc Pharmacia LKB promoter. ColEl replicon. Ap ^r . 4.2 kb. Biotechnology pTrc99Aluc Derivative of pTrc99A where the luc This work gene from pGEM-luc was cloned as a 1.7 kb Ncol/Bamrll fragment amplified by PCR into pTrc99A digested with the same

enzymes. Ap ^r . 5.9 kb. pJB653ATG ATG expression vector. A derivative This work of pJB653 where the 413 bp EcoRl/PstI fragment containing the Pm promoter is replaced with a 139 bp EcoRI/PstI fragment containing Pm and an Afllll site.

Ap ^r . 7.2 kb. pJB653ATG2uc The luc gene from pGEM- luc was This work cloned as a 1.7 kb NcoI/BamRI fragment into the Af HI/BamHI site of

PJB653ATG. Ap ^r . 8.9 kb. pJB653ATGluccop271C Derivative of pJB653ATGluc This work where the 1.5 kb BamHI/Sfil fragment was replaced with the 1.5 kb BamHI/Sfil fragment from pJB653 celBcop271C.

Ap ^r . 8.9 kb .

Ap ^r , ampicillin resistance; Cπf, chloramphenicol resistance; Km ^r , kanamycin resistance; Tc ^r , tetracycline resistance; Cb ^r , carbenicillin resistance.

1. Simon. R.U. Priefer and A. Pύhler, 1983, Bio/ Technology, 1, 784-791.

2. Adhya, S. and M. Schwartz, 1971, J. Bacteriol, 108,

621-262.

3. Haugan, K., Karunakaran, P., Trøndervik A. and Valla S., 1995, Plasmid, 33, 27-39.

4. Bishop, P.E. and Brill, ., 1977, J. Bacteriol, 130, 954-956.

5. Hόtte, B., Rath-Arnold, I., Pύhler, A. and Simon R., 1990, J. Bacteriol, 172, 2804-2807.

6. Ingram, L.C., Richmond, M.H. and Sykes R.B., 1973, Agents Chemoter, 3, 279-288.

7. Durland, R.H., Toukdarian, A., Fang. F. and Helinski, D.R., 1990, J. Bacteriol, 172, 3869-3867.

8. Norrander, J., Kempe, T. and esεing, J. , 1983, Gene, 26, 101-106.

9. Robertε, R.C. and Helinεki, D.R., 1992, J. Bacteriol, 174, 8119-8132.

10. Frey, J., Mudd, E.A. and Kriεch, H.M., 1988, Gene, 62, 237-247.

11. Vieira, J. and Mesεing J., 1982, Gene, 19, 259-268.

12. Valla, S., Haugan, K., Durland, R.H. and Helinεki, D.R., 1991, Plaεmid, 25, 131-136.

13. Michan, C, Zhou, L., Gallegos, M., Timmis, K.N. and Ramos, J., 1992, J. Biol. Che . , 267, 22897- 22901.

14. Ramos, J.K., Gonzalez-Carrero, M. and Timmis, K.N.,

1988, FEBS Letters, 226, 241-246.

15. Keen, N.T. , Tamaki, S., Kobayashi, D. and Trollinger, D., 1988, Gene, 70, 191-197.

16. Fellay, R. , Krisch, H.M. , Prentki, P. and Frey, J.,

1989, Gene, 76, 215-226.

17. Inouye, S., Nakazawa, A. and Nakazawa, T., 1983, J. Bacteriol., 155, 1192-1199.

18. Dixon, R., 1986, Molec. Gen. Genet., 203, 129-136.

19. Brautaset, T., Standal, R., Fjaervik, E. and Valla, S., 1994, Microbiology, 140, 1183-1188.

20. Haugan, K., Karunakaran, P., Trøndevik, A. and Valla, S., 1995, Plasmid, 33, 27-39.

TABLE 2. CelB activities as a function of plasmid copy number in E. coli

CelB activity

Strain (nmole/min/mg protein)

t = 0 uninduced ³ induced ³ hours

PGMl (pJB137 celB)

PGM1 (pJB137 celBcop271 C)

PGMl (pJB137 celBcop254D)

PGMl (pJB653 celB)

PGMl (pJB653 celBcop271C)

PGMl (pJB653 celBcop254D)

DH5α (pJB653 celB)

DH5 (pJB653 celBcop254D)

Cells were harvested 4 (pJB653 celB) or 6 (pJB137 celB) hours after induction.

TABLE 3 Luc activity as a function of plasmid copy number in E. coli DH5α

Luc activity (cpm x 10 ⁶ )

t = 0 hours at induction

EXAMPLE 2

Materials and Methods

In this Example the expression from Pm, of three genes, luc, celB, and cat , encoding chloramphenicol acetyltranferase (CAT) was compared in E. coli , X. campestris and P. Aeruginosa . The trfA mutation designated cop251M has been previously isolated by Durland et al. , 1990 (supra) and has also independently been isolated by us. Thiε copy up mutant was cloned into the expression vector pJB653ATG (see Example l) , using techniques as described in Example 1, generating pJB653ATGcop251M. Further following the procedures of Example 1, the luc gene was inserted into pJB653ATGcop251M, generating pJB653ATGluccop251M. As a comparison, plasmid pT7-7(1.9) was constructed, in which celB was cloned into pT7-7 (United States Biochemical Corporation (USB) , Cleveland, Ohio,

USA; Tabor and Richardεon, 1985, Proc. Natl. Acad. Sci. USA, 262, 1074-1078) as a 1.9 kb Ndel /PstI PCR fragment into the Ndel and PstI sites of pT7-7. The fragment for cloning was prepared by PCR techniques using- standard methods. An Ndel site at the ATG in CelB was created in a PCR reaction using appropriately modified primers.

Plasmids pJB653ATGluc, pJB653ATGl uccop271C, pTrc99Aluc, pJB653ATG eel B, pJB653ATG elBcop272C were as prepared in Example 1. The vector pJB653ATGcat was constructed as followε: cat waε cloned aε a 662 bp Ncol BanjHI fragment from pCat3Baεic (from Promega) into Afllll/BamHI in pJB653ATG (obtained according to Example 1) . First, the .Xbal site downstream cat in pCat3Basic waε converted to a BamHI site by the use of a BamHI linker (ΝEB) after making the Xbal site blunt by Klenow. The comparative vector pTrc99Acat was constructed as follows: cat was cloned as a NcoI/BamHI fragment (aε above) into NcoI/BamKI in pTrc99A.

Expression studies

All strains were grown as described in Example 1. Transcription from Pm was induced by 2 mM or 0.5 mM m- toluic acid in E. coli and X. campestris, reεpectively. 0.25 mM IPTG was used for induction of expression from the pTrc promoter. The strain containing pT7-7(l.9) was grown in LB medium + ampicillin + kanamycin overnight at 30°C. The cells were diluted 50-fold and grown further for 3 hours. Cells containing the Pm vectors were diluted 100-fold. celB expreεεion was induced by heat at 42°C for 30 minutes and the cells were grown for another 1.5 hours at 30°C. Preparation of cell-free extracts and measurements of phosphoglucomutase and luciferase activitieε are described in Example 1. The preparation of cell extracts for chloramphenicol acetyltransferase activities were performed as described by Sambrook et al. , 1989, εupra (a modified version); 1) Cells were harvested from 1 ml culture by centrifugation

at 12000g, 1 minute at 4°C. 2) The cell pellets were resuspended in lOOμl of freshly prepared 1 mg/ml egg white lysozyme, 20% sucrose, 30 mM Tris-Cl pH 8.0, l mM EDTA pH 8.0. On ice for 10 minutes. 3) Lysis waε completed by freezing/thawing in liquid N ₂ /37°C (2x) . In caεe of deacetylaεeε in the cell extract, the extracts were incubated at 65° for 10 minutes, followed by centrifugation at 12000g for 10 minutes. CAT activity was measured according to the protocol of the Quan-Υ-CAΥ assay system from Amersham Life Science.

Results

The results are presented in Tables 4, 5 and 6. It will be seen that in addition to luc and celB, the cat gene may also be expresεed from the expreεεion vectorε of the invention, at significant levels of expresεion (Table 5) . Theεe data indicate that the Pm promoter iε a strong syεtem for expreεεion. Table 4 shows that luc expresεion waε even better in Pεeudomonas as compared with E. coli . Luc iε better expressed from a wild-type trfA vector in Pεeudomonas, than from cop mutants in E. coli , suggesting that there is a potential for further improvement in expresεion in Pseudomonas . In the case of cat expression, expression in Pseudomonas with wild- type trfA is better than in E. coli , but not with cop mutantε.

TABLE 4 Measurements of Luc activity in E. coli , P. aeruginosa and X. campestris

Luc activity cpm x 10 ^e

Xanthomonas campestris

B100-152 pJB653ATGluc 21 0.6 240

Pseudomonas aeruginosa

PA01161S pJB653ATGluc 12 51 6200

t = 0 hours at induction

TABLE 5. Measurements of CAT activity in E. coli , P. aeruginosa and X. campestris

CAT activity dpm x 10 ⁶

Xanthomonas campestris B100 - 152 pJB653ATGcat 16 0.03 0.85

Pseudomonas aeruginosa

PA01161S pJB653ATGcat 12 0.79 78

t = 0 hourε at induction

TABLE 6. Measurements of CelB activity in E. coli

CelB activity ¹¹ (nmole/min/mg protein)

Strain/plasmid # hours ³ uninduced induced

^a t = 0 hours at induction ^b Preparation of cell extracts: 10 ml cell culture was resuspended in 3 ml 40 mM imidazol-HCl pH 7.4 before εonication expr. For pT7-7(1.9), 5 ml cell culture waε reεuεpended in 3 ml 40 mM imidazol-HCl pH 7.4. ^c nd = not determined in thiε experiment, but previouε results have shown that the uninduced state is approximately 50% lower than induced state. ^d The pJB653ATG vector used for expression of celB is not the same as used for luc and cat expresεion analyεis. The vector used for celB expresεion haε an Ndel εite in the ATG start site and not an Afllll site. The vector suitable for celB expression may be produced as follows: The PstI site upstream of the polylinker in pJB653NdeI-A (see Table 7) was made blunt, and the Hindlll/ Sfil fragment of pJB653NdeI -A was replaced by the 848-bp Hindlll/Sfil fragment containing the trfA gene from pTBtrfA2. The PstI site (originally from the HindiII/SfiI fragment of pTBtrfA2) was made blunt. Ap ^r . 6.8kb. pTBtrfA2 was produced as follows: trfA waε cloned as a 1.2 kb Pstl/EcoRI fragment from pRDllO-34

(Table 7) into the same sites in pALTER-1 (Table 7) . The Ndel site in the trfA gene was eliminated by site- specific mutagenesiε. Tc ^r . 6.9 kb.

EXAMPLE 3

An SDS-PAGE (8% polyacrylamide) was performed on sampleε of protein expresεed in E. coli DH5α from the " celB" vectorε of Example 2, uεing εtandard procedureε aε described in Sambrook e_£ al, supra, as followε:

#μl extract loaded on gel

8.2

10 7.4 10

6.9 9.5

The concentrations OmM and 2mM refer to the inducer (see Example 2) .

The results are shown in Figure 8, which show celB expression as protein, rather than activity, from the various "CelB" vectors of Example 2.

EXAMPLE 4

The vector pJBSDl was constructed in which in the vector pJB653ATG of Example 1, the location of trfA was altered such that it was deleted from its original location in pJB653ATG and placed downstream of the Pm promoter. pJBSDl is shown in Figure 9, and details of its construction are summarised in tabular form in Table 7 below, with reference to the following source plasmids:-

Charaπr-.firiHr-.iπfi and Referenre.q of the plasmiris πseri in the construction of pJBSDl pJB653ATG ATG expresεion vector (see Example 1) . pRDUO - 34 pBR322 replicon where an EcoRI/Pst fragment was subεtituted with the trfA gene from plasmid RD2. Durland et al. , J. Bacteriol, 172, 3759-3867 (1990) . pALTER ^® -! Mutagenesis vector used in the Altered εites ^® II in vitro mutagenesis system. From Promega. pSELECT ,TM Mutagenesiε vector used in the Altered sites™ in vitro mutagenesiε syεtem. From Promega. pTB16 A plasmid carrying celB gene encoding phosphoglucomutaεe. Brautaεet et al, Microbiology 140, 1183-1188 (1994) .

TABLE 7 : Deεcription of the plasmids used in the construction of pJBSDl

1. pJB653ATG ATG expresεion vector (εee Example

1) , Ap ^r , 6.8 kb.

2. pJB653NdeI -A Derivative of pJB653ATG in which the Afllll εite waε converted to a

Ndel site by replacing the 143 bp

Pstl/JScoRI fragment of pJB653ATG with the Pstl/EcoRI PCR fragment containing the Ndel εite, Ap ^r , 6.8 kb. pJB653NdeI -B Derivative of pJB653NdeI -A in which the PstI εite upεtream of the Pm promoter haε been filled in, Ap ^r ,

6.8 kb. pRD110-34 ColEl replicon where EcoRI-PstI fragment of pBR322 was substituted

with the trfA gene from plasmid RK2, Tc ^r , 4.8 kb. (Durland et al. , J. Bacteriol., 172, 3759-3867 (1990) .) 5. pALTER-1 - Mutagenesis vector used in the

Altered εiteε II in vitro mutageneεis system, Tc ^r , 5.7 kb. From Promega.

6. pALTERtrfA-l - trfA was cloned aε a 1.2 kb PstI/ EcoRI fragment from pRD110-34 into the same siteε in pALTER-l, Tc ^r , 6.9 kb.

7. pALTERtrfA- Ndel - Derivative of pALTERtrfA-l in which the Ndel εite in the trfA gene was eliminated by site specific mutagenesis, Tc ^r , 6.9 kb.

8. pJB653NdeIC2 - Derivative of pJB653NdeI -B in which the 1.2-kb HindiII /SfiI fragment was replaced with the 1.2 kb Hindlll/Sfil fragment from pALTERtrfA -NdeI, Ap ^r , 6.8 kb.

9. pJB653NdeIC2b - Derivative of pJB653NdeIC2 in which the PstI site has been filled in, Ap ^r , 6.8 kb. 10. pSELECT -1 - Mutagenesis vector used in the

Altered sites in vi tro mutagenesis εyste , Tc ^r , 5.7 kb. From Promega.

11. pTB16 - A ColEl replicon carrying celB gene encoding phosphoglucomutaεe, Ap ^r , 4.3 kb. (Brautaset et al. ,

Microbiology 140, 1183-1188 (1994) .)

12. pSEL(1.9)B - The celB gene from pTB6 was cloned as a 1.9 kb Sp I fragment into the same site in pSELECT-l. Ndel site was made at the start codon of celB by site directed mutagenesis, Tc ^r , 7.6 kb.

13. pJB653NdeIC2bCelB - Derivative of pJB653NdeIC2b in which the celB gene from pSEL(i.9)B waε cloned as a 1.9 kb Ndel/BamHI fragment into the same siteε of pJB653NdeIC2b , Ap ^r , 8.7 kb.

14. pJB653NdeIC2btrfA - Derivative of pJB653NdeIC2bCelB in which the 1.9 kb Ndel/ PstI fragment containing celB gene was replaced with a 1.2 kb Msel/PstI fragment containing the trfA gene,

Ap ^r , 8 kb.

15. pJBSDl - Derivative of pJB653NdeIC2b rfA in which the trfA gene downstream of Pneo promoter was deleted with PvuII/Hindlll digestion followed by filling in and religation of the vector part, Ap ^r , 6.6 kb.

Ap ^r = ampicillin resiεtance Tc ^r = tetracycline reεiεtance

PJBSDl was tranεferred to E. coli DH5α aε deεcribed in Example 1, and the cellε were grown in LB medium overnight at 30°C in the presence of 1 mM toluate and 0.1 mg/ml of ampicillin. Some plates were incubated at 23°C for 2 days. Cells were then diluted and plated on LB medium containing the ampicillin and toluate concentrations indicated in Table 8, at approximately 100 cells per plate. The plates were incubated at the temperatureε indicated in Table 8 and the results are shown in Table 8. + means that colonieε appeared after overnight incubation, while - means no growth.

Reading the data in the Table 8 horizontally, it will be seen that replication is controlled by the inducer level. It appears that slightly less inducer is required as the temperature is lowered; at 23°C the plasmids appear to replicate even in the absence of inducer. The reason for thiε could be that Pm is better

expreεsed, that the beta-lactamase is better expressed or more active, that the functionality of TrfA increases somewhat, or that the plasmid copy number increases slightly. Possibly, more TrfA is made at low temperatures or lesε is required for replication. Such TrfA expresεion at low temperatureε could be dealt with by introducing mutationε in Pm or its Shine-Dalgarno sequence, such that trfA expression is reduced. If Table 8 is read vertically, it will be noted that the ampicillin resistance level is affected by the inducer concentration, even at a fixed temperature. Thiε muεt mean that aε inducer concentrations are being lowered, trfA expresεion becomeε reduced. Thiε first leads to copy number reductions (reduced ampicillin tolerance) and then (no inducer) to total block of replication (no growth even at low ampicillin concentrations) . The properties of vector pJBSD7 are thus remarkable and unique.

Table 8

Control of pJBSDl replication by the externally added inducer m-Toluic acid

CO

10

m

CO

15 i\-l <35