ACKNOWLEDGEM T OF FEDERAL FUNDI G

Particular aspects of the present, laveniiion ware, at least in part, supported by Grant Num er 2010-04487 fioni the United States Department of Agriculture (LISDA-AFM- NIFA); _< and the United States government therefore lias certain rights in the invention.

FIELD OF THE IiOTNTiO

Aspects of the invention relate generally to bacteria, bacteriocins {e.g., colkras; or niierooinsV and proximity-dependent inhibition (PDiJ, and in more particular embodiments to composition and methods, for controlling and/or killing- pathogenic- bacteria (e.g., iteroherrtorthagie and or enterotoxigenic strains of £. co.B% comprising use of a novel imoreein.

BACKGROUND

Ejic erwkm li are commonly fonnd in the gtrt of both hmnans and animals. Most i. co are considere symbiotic; however, pathogenic strains have bee isolated that arc associated with ibadborne illness in people and animals e.g., pathogenic ·£. mli K and affect swine and calves, respectively. Transmission of pathogenic E. calf occurs lhmugb.ffc.c-a! contamination of food o wateir, and is commonly associated with the consumption of undercooked m at j¾tw mi _. lk, or contamina e vegetables.

Pathogenic E. oii includes the Shiga-ΐοχίη producing .strains blown as ST C>. Shiga- toxin is named, for its msernblance to the Shiga- toxin produced by Shigella dysmteriae . STEC Infection can be asymptomatic, or include symptoms of .fever, watery diarrhea, severe abdominal pain, hemolytic uremic syndrome (HUB) and even death, with more _. evere cases typically being reported, in young children or the ^■ elderly. l¾¾rohaenmrrhagie . oli (EHEC are ^' a subset of S EC characterised by their ability to form attaching and: effacing intestinal lesions. Cattle are the main reservoir for EHEC, the bacteri living asymptomatieally in the cow intestine, although these bacteria have also been isolated, from the intestinal tract of other domestic animal including sheep, pigs, goats, and dogs. These EHEC predominantly colonize the recto-anal junction, of cattle, thereb increasing the risk of transmission to humans through fecal contamination, Numerous EHEC have been isolated including serotypes 01 I I , OT45, O !,03, 026, and 0157. According to the Centers for Disease Control and revention, 01 S?;H? is flic most common serotype that cattsm .£. co/i-linked food i, poisoning in die United S ales. The .: infectious dose is estimated to be as low as 1.0-100 bacterid. Currently, no treatment is available for EHEC infections. Furttiehftore, .antibiotic, treatment cm worsen- sjyjrijptoms of an EHEC iniefetioa y Inducing sblga-toxin production and increasing, the risk of HUS.

The introduction of antibiotics as therapeutics- in the m id- 1940s: was a important adv acem^at for medicine in. terms- of reducing human morbidity and mortality. Mo ever, the su se uent: emergence of ^' antibiotic resistant bacteria indicates that bacteria adapt to antibiotic pressure. Resistance can be .ac ired and. maintained within a population through horizontal transfer of resistant genes, and/or t rough selection for mutations that confer resistance, ynfortitaately. the use of antibiotics is widespread and invariabl selects for resistance as continual exposure t the drugs inhibit susceptible strains; and aiiows. _: resistant strains to emer e and dominate a _. p pdati ji. :Sei«ctio¾ ^' oi -rosistajiee occurs for all. bacteria exposed t# antibiotics, not just the specific pathogens that are be isg targeted. Such as, when earofioxaclii was used to treat E. oli infections poultry, it simultaneously selected for resistance in Campylobacter jejuni The increasing prevalence, of resistant bacterial pathogens threatens the effectiveness of currently available antibiotics and presents a difficult .challenge in human, and animal medicine. The development οΓηονεΙ strategies t control pathogenic bacteria is necessary to 1} combat infection b existing strains and 2} provide alternatives so that antibiotic use; and hence the emergence of resistant strains, can b decreased..

Some bacteria have de eloped the ability to inhibit othe b cteria, and further characLerlzatren. of how this occurs could be heip in the design, of new anti-bacterial, strategies. For example, cell-eel! inhibition mechanisms have been documented in the literature and range from contact-dependent inhibition (b 20) to production of narrow- speetrom antimicrobial proteins called baeterioems, Bacterioc ns typically restrict the growth Of closely related bacteria (reviewed: in (28, 3 !)), E co/f produce numerous baeterioems (31), classrii as either eoliclns or mierocin (2, 1 1). Golleins are high-molecular weight, whereas mleroeins are typically <!ø kBa. Microcins can be either chromosomaiiy or plasmid encoded, whereas eoliclns have only been found on plasrmds (13, 29, 30). Colicm production, is usually correlated with an SOS response to stress (22, 34) and release of the edlicin typically occurs through cell lysis, Mierocin are secreted from intact cells (8, 27). Baeterioems have been, identified thai kiii. competitors through, pore feniiaiion, nuclease- activity, or by inhibiting protei synthesis (3, 23-25).

Sa ant et ab reeentfy described a novel, bacterial inhibition phenotype whereby defined strains of E$.<!kezicM& mil from cattle are able to Inhibit growth of other E toU. s¾¾iiis-mciud:mg-.is«v©ral. stmins^f enierohernQSthagic.-jK. H {EHBC} and enterotoxigenic £. coli (ETEC) (32). During vi competition assays, susceptible strafes decline an average 4-6 log in population relate to their expected population density when a MoiiocuitiiKis:, The inhibitio phenotype was called "pffiXHTtity-depetrdent inhibition" (PDI) because of the apparent need, for inhibitor inid susceptible strains to be located in close physical proximity for the phenofype to be: observed. Two -different E.. calr strains were described as expressin this trait (P I");. rmdtidnig resistant K cnli-25 and antibiotic susceptible £ coli~264, £. coU-2% and E. mli-264 do not aiieot the growth 6f. each other,; indicating that immunity is either conferred actively through the presence of an immunity mechanism, or passively ^' through the absence of a receptor llgand found on susceptible cells.

Certain characteristics, of the PDI pheriotype resemble that _, of microciu production, For example, rshibition is effective against closely related species; PDI is not dependent on an S() response; and production presumably does not Mil the inhibitor strain (32), Nevertheless;,: mieroeins are soluble proteins and when Sawant et al (32) employed a split- well experiment they demonstrated, thai close cell-cell proximity ^' is required for the PDI phenotype to function. These findings suggest that the inhibition tnechanism is not due to a soluble molecule unless -the concentration is so low as to require: close proximity to be effective (32).

ITsc initial report of PDI provided detailed description of the piienotype and a similar phenotype ha been described between Bibemei a Ireh lt arid Mdnnheimia naemoiyii (4). everthele s, the exact mechanism of PDI and. requisite genes for inhibition and immunity at the time that the PPI wa originally described. Progress in this field could aid the de velopme t, of strategics to combat the emergence and spread; of pathogenic bacteria, and tO: provide treatme ts for infection with. pathogenic bacteria.

SU ARY OF E EMPLARY ASPECTS

Particular embodiments, of the invention demonstrate, for the first time, that "proximity-dependen i«hibiti n ^! * (hereinafter ^PDF) results in death, of &e _: susceptible cells, and tha t PDI can be used for killing pathogenic E. coil in vitro && surfaces and materials of interest, and in vivo, and ftrrther the PDI can be used propftylactioaJly and therapehtically.

Additional embodiments of the invention identify the PDI gene cluster, which resembles that of a class ii microcin. The gone _: cluster includes ORF putativeiy encoding proteins for microcin _. synthesis, immunity, and export, in .additio , t&!C is required for inhfthtion, thereby eonihlning that the mierocin is secreted by a type I secretion system (TISS).

According to further enmodiments of the invention; the FDi phenotype is cansed by a novel mierocin, designated herein as MeePDI, atid MccPDI is utilized in numbe Of different m$ beneficial applications. In some rastaaees, the. use of MccFDi &ή&οέ bacteria that produce MccPFll advantageoissly replaces the use of antibiotics ..

Ever strain from a genetically; diverse panel of is. co!i 0157:B7 and additional strains of mil serpvar 026 were snsoeptihie to the PDl phenotype. Live-dead staining was consistent with, inhibition by killing of susceptible ceils. Comparative genome analysis identified the generic component of Fl¾ which: is _. composed of a plasmid-bome (Incll) operon encodin a putative mieroehi and associated genes for ttansport, immunity,- and mfcroein activation. Transfer of the: plasmid to a POX ^" strain resulted In transfer of the phenotype and deletion of the genes within the operon resulted in los of the inhibitio phenotype. Deletion of ehromnsonmlry encoded t&l also resnlted in loss of the inhibitory phenotype and this e¾ firmed : _: that the putative mieroein is most likely secreted, vi a type I secretion pathway. Deletion of an unrelated plasniid gene -had no effect on the PD1 phenotype. Quantitative RT-FCR demonstrated tha mteroein expression is correlated with, logarithmic -phase growth.

Accordin to yet fh ther embodiments of l¾e invention, the ability to inhibit a diversity of - mil strains indicates that tins mierocin has utility to influence gut community composition, and substantia! utility for control of important enteric pathogens,

i some aspects, the bacteria that are killed flysed, inhibited, damaged, etc..) are any that have (carry, bear, include, contain, etc.) the ompF protein in, or as a. component of their outer membrane. OmpF er "outer, membr ne protein t ^' αΐ QmpF potin} _* is an integral membrane protein located hi the osier membrane of B. ^' . found in a trimer forrrtation and is a non-specific transport channel that allows for the passive diffusion of small polar irio!eenles (:6ΘΟ-700 Da in size) through the cell's outer membrane, e.g, water, ions, glucose:, and other nutrients as well as waste products. Without being bound, by theory, the m eroem described herein ap ear to bind to OmpF when exerting its lethal effects! IEF BESCKffiTION OF Tlffi DRAWINGS

Figure 1. FDi is ei!eetiv* against a broad panel of 0157:H? . nd STEC Ό26 Ε. calf isolates. n average, suseepible pppuiatjons were reduced: greater than 5~iogs followin 24 h co~ culture with .£ <¾> z~25. Ctinfca} arid bovine-biased ©157 genotypes are indicated (33), Kkh i!a pneumonia was not inhibite by PDI and is included as a negative control. Error bars co es ond t the standard, error of the mean based ort duplicate expeTi iri ents,

Figure 2. Schematic Of the putative PDI sequence f-5 kh). Whole en me sequencing identified a large plasmid confatoiiig a unique region that is present in PDf strains bat not PDF strains (GenBank accession JQ901381 ) (SEQ ID NO;}; Bioinformaiio; identified five open readme .frames putativeiy corresponding to genes for nueroein synthesis i pM &n m«p4% mummif (mcpj), and export impp and mcpS).

Fi ures 3A-B, Targeted gene deletion results in t¼e loss of- the PDI p.henotype, A. CFl!s of P f E eoli-\M following: co-culture with wild-type K mt -25 or E- eo/r-25 knockout nrutants. Results are expressed as the difference in CFlJs of the sensiti e strain grown in ce- ouitur and monoculture. B. Competitions with PDI " E. cofcZtjA indicate which knocfcsur mutants HO longer exhibit immunity to PDI. Immunity to PtSl is restored in the cp! complemented clone. Resslts- are expressed as th difference of log CPUs during co-culture and. individual culture. Experiments were conducted in triplicate with error bars representing the staadaid error of the mean. * statistically ssgn ticant ANOVA (p- alue 0,01 with unnett's upper one-sided uiulti le-eomparison test with control).

Figure 4; Ex ession of m Afb £ c&it-IS is correlated ^' with g owth phase. Expression of m-ψΜ was. measured during 24 hr culture in M9. Closed circles are the mean normalized mepM expression ^SEM (n - 2 replicates). Open circles are the mean, colon fanning units (CF ^' U) ±SEM (n - 2 replicates),

Flgare.5. MecP0I-produeing £< ^' c H-25 inhibits the growth of susceptible E li~lM in neonatal calves. A. competition index .(CI _. ) was calculated as (X-Y)/(X-f-Y), where X is the CPU οίΕ. £¾ i-25AmcpMAmcpPor E. coh-lSAiraM colonies and Y is the CPU of E coin 1 86 colonies. A CI approaching ÷1 indicates the E. co!s-lS mutant is me dominant strain and a CI approaching -.1 indicates co i-l.S6 is dominant. The mean. CI for the positi ve i ^' hiaci bars; E. eaU~25Ati&M and E co -iW; n ^ 7)) and negative co trol (white bars; E coii- 25AmcpMAmep3 and ceU-iM; « ^:::: 4} calves on day one and day six. Error bars correspond to _. the standard error of the mea and the asterisk sh ws significant di&renee betweeniVfccPDl-piodiicing and non-producing groups (P ~ 0.003).

Figure 6. The. production of MccPOi contributes to the fitness of E e E-25 within a calf Each, data point represents the percentage of the £ o r-25 nvutant -relative to the total lactose .fermentin enteric CPU at the corresponding day post inoculation. Closed circles -represent E κί; /-25.Δ£ί¾Μ .(n~7 calves) mi open elreles correspond, to & cafr-SSAtnep Aracpl ,(«=4 calves). Error bars represent the standard ^' error of the roean<

Figure 7A aad B,

tissues, Bars represent die frequency of recovery for competing strains in each trial at i¾st segments of the CE tract: A. Mcc ^' PDi-prpducing £. co&-25AtraM (black) and £. c H- 186 (grey).

»r 4 B. G o th curves of E, c U-2$,-E, il BW251 13, and the McePDl-reBistoti niutaots nipA _^ ipF, MsbA, Acfe , AampF, and o pR when cultured .in M9 minimal media _: (A) or LB media (B).

DETAILED DESCRIPTIO

The enetic components thai are responsible for th PjDI phenotype . observed fxom.E- ίίο ί-25 8!3il E. c≠i-2 4 - _> fcr *¾e first tOTe _> identified, herein. This 4 - b operon is present on. pPDl (see Example 10 below) and is _: comprised of the genes mcpM, ep mcpA, mepi), and ηιψβ (see Example ^' *) below),

According, to partieitto aspects, inhibition is mediated b : the microein encoded by mcpM, whose mature gene product is desi ated herein as MccPDL A DNA probe designed ^• from: the aecjaenee of he: nwpA gene hybridised t a -1 © kb plasinid in both inhibitor shams. Pksmid I NA from the susceptible non-inhibitor strains, is ^" , eoil- and E. cos>/-82, did not hybridiz to the mcpA -specific probe., pFDi was subsequently marked with a kanamyc-in resistant cassette (AiraM) and transferred to the P F strain, E, coU-4.. Wild-type ;

does not exhibit the inhibitory phenotype, as indicated by competition assays with the susceptible £ coli-l M (Tabl 2; and see Example 6 ^' hereni below). E. eoii- also exhibits susceptibility to PDJ ₅ . based on.€FTi counts following eo-eu!ture -with PDF ^' .£. c< ~2$4, Following transformatio with. pPDlAt M, E, Η-4 acquired the inhibitory phenotype and immunit (Table 2; and see Example 6).. Together these results indicate FDl and self- innnunit are encoded by the 98.8 kb plasroid (see Example 1.0 below).

To demonstrate the necessity for each gene in the operon for FBI function, genetic knockouts were constructed and used, herein to. show that disrupting any gene within the PDi operon blocked the inhibitory phenotype and, additionally, irnnismity to FIJI was lost i the mcpM and mcpl mutants (Figure 3). According to particular aspects, this _: indicated that all the genes were important for FDL but immunity was dependent on only one or two genes. Due _: to ih direct downstream loc tion of MC 1 _< loss of immunity in Urn mcpM mutant was likely caused by a polar effect from &mcpM. This is consistent with the ability hew herein ie eennitenre immunity y the expression of mcpl atone. A faoug mcpl likely does, iot: play a direct role in killing, it is necessary for. self-innnuniiy and iw this reason is required for PDI. Deleting: ! iM, a gene located -20 Kb upstream of ihe PDI Operon, did not affect either inhibition or immu i y indicating thai the methods used ¾e*ein.3i4.¾Dt i terfere ^' - vith ^· PDI, Fhithsmtore, the l . mepg, and mcpD tmiiants lost the ability to inhibit but retained imnnnnty, consistent with a role in toxi transport.

According ^' to., particular aspects,, arid based, on gene el aster and sequence anal sis, MccPDi is best characterized as a Gram-negative class lia mieroetn. The PDi gene elitster is relatively simple, consisting -of two genes .for ^' export, one far immunity, on presumptively tor mieroein activation, and the nticroein gene itself Unlike class Ϊ an lib iwieroc ns, which, have several genes fbr fosMtanslatiouai modification* MccPDi only: has one recognisable gehe thai is pntatively required for niieroein activation. The dedicated transport system invol ves die products of tw plasmid-eneoded genes, ϊΗψΒ and mcpD* These two PDI genes have homology with hfyS and kfyD of the E oli α-hen iysin. TI SS (9). Thfc nudticontponertt export system has similar organization to transport systems far other class 11 microoms, including ceEd^ MceL, and MccV (10, 18, 26). MepB contains the tTansmeinhrane- domains and nncleotide-hinding domains ^" , including the highly conserved Walker A and B motifs and ABC signature, characteristic of the ABC-transporter superfanhiy of proteins (21%. McpD is thought t act as .a; membrane fusio protein, forming a channel through, the periplasm and connecting to the outer membrane protein TolC, the third component of class If mleroein export rtiaehinery (7, P, I S, 26). In total, these proteins form the export system allowing secretio of protein r½m die cytoplasm: across the periplassiie space and into the exctaeelfelar medium. MepM has homology to other inieroci precursors within the -terminal sequence, which encodes a _. putative signal peptide (6) thai is consistent with TI SS transport. The presence of a conserved doubl glycine suggests, the MepM precursor contains an IS residue signal peptide that is cleaved to produce a mature MecTDl. There is no .apparent sequence identity with, other mieroeins in the activity region C-terminal sequence) (6),

This indicates that a nmq receptor is probably involved with. the. uptake of MeePDi and. that the meebamsrn of killing is different from. Other mieroeins. The fact that only £ coli ^' and Shig lfa (data not shown) are currently known to be susceptible to this PDI (MccPDi) suggests, target. e¾l| recognition occurs through a specific recepto , possibly only expressed in these species.

Class Ha nucrqci gene clusters are typically composed of onl four genes: two necessary for ffiicrocfo export, one for immunity,. and one encoding the mierocm. The PDI operon is unique because it also .iiwiodes a _. gene presumably irwolved with mierqcin processing or export. Deleting mcpd in & interrupts, the mttibitory phenotype but does no : affect i uuunty. It is possible this mutant has downstream effec s en the roieroein transport system. (Is. a polar eileet); however, not to be honnd b flteory, bioinfo maie a al sis suggests the protein product is likely io be involved with |¾ ~uanslational ffiodifleatiori of McpM. MepA has sisivii.arity ^: to MtmM, and csP (both 29% identi ty) of the MeeM and MeeB492 gene ckister¾ respectively. Wifkens et al. (36) showed an mefe^ mutant had a ηοΏ-inhibitory phenotype and the ierocjn product collected from cell lysate was .found, at a higher molecular weight than mature MceE492, suggesting the presence of.au inactive lerocin precursor. Consistent i h a. role in protein, ruodification, MepA contains a CaaX amino terminal protease domain (PF02S37) that fonefions in

proteins with the CaaX sequence motif (3S). Furihermore, d e McpM C erminu» putative!y contains a modified tenriinal GaaX sequence, suggesting McpM may be processed either before or during transport., resulting in the fully mature MeePDi .

Although n .crooins are released exttaeeilflla to inhibit competing bacteria, no antimicrobial conipounds we:re delected through rnembrans iivided competitions or spent media assays in previous work (32). It is possible the PDI microcm requires contact between competing cells or some other signal to become active fo the: media. Alternatively, the methods, used in the Exam les section herei may interfere with, the detection, of a soluble mierocin in these assays, o the concentration of: secreted, microcm Is too low to have a. biological effect except when, inhibitor cells express the rnieroein i close proxhihty io suseeprfble strains. Without being bound by theory, k Is likel that MceHDi interacts with an. outer membra:ne protein O pp, winch is highl conserved in all sequenced E, cent and igfeZte. Data presented, in Examples 1:2 below shows that six genes (aip , _t nipF^dsbd, d&b3 _s o p and m ) were required for susceptibility to PDI, suggesting that OnrpF acts as: the receptor for MeePDI and the other genes required for sensitivity are: necessary for expression and. folding of OffipK and/or they are required: to transiocafe MccPDI across the cellular membrane,.

Lif other rnicroeins, _: MccPDI is a low molecular weight, protein that inhibits, the growth of closely related species. However, where the activity of some mieroems extends to

S a range of Gram-negative bacteria mdu ag Escherichia, Klebsiella, Salniouei! , and Pseudom n s McePDl has only been observed to inhibit Escherichia,, and testing has also show inhibition of Shigella but n t Salmonella or Klebsiella (dates net shown), in Exam les presented below, the FD strain E, evli-2$ was competed against a _. panel of p ^' athoge e E mii 01S7:M:7 (n-25) and E co!i- ^' O (p All the steips were susceptible t llkg (Figure 3) and the average reduction following co-culture was greate than 5 logs. The degree of killing may actually be much greater as oof methods t et rmi e cell counts were limited to 2xl0 ³ CFCJ/mi, Calculations for the _: degree of killing were determined using. 2x1 D ^"; CFU/ml for instances where the susceptible population was undetectable. Nonetheless, PDI effectively kills greater than 99% of the competing population. Because many of these pathogens- are significant i diseases of both, animals and humans (33), MeePD! has application i clinical medicine, food safety and ther fields, Figure-. 4. shows that native mcpM transcription occurs primarily -during rapid growth of the inhibitor popnianes.

The invention provides methods -and compositions fo . killi g and/or tor preventing or decreasing the adverse effects of pathogenie bacteria such as pathogenic Escherichia eol ^' f (E. coii ^' ). The methods involve contacting tiie pathogenic bacteria with the novel mkrocin described herein, mierocin. McePDl, tire amino acid sequence of which, is presented in SEQ ID NO: 24. The contact may be via a preparation of the inicrocin itself Or via a preparation of a bacterium encoding the mieroci a, a described in detail ^' below _*

HOSTS, MMOGENS AND SOtm &QV ^O TAMiNAH ^

While most .£, coli strains are harmless, some serotypes; can cause seriou and even deadly diseases in a host, either as fhe result of exposure to the pathogenic bacteria via direct transmission fioni: another infected host, or by ingestion of or exposure to (e.g. handling) contaminated food products or from -other sources of the bacteria i&g. ibrnites). In particular, the targeted pathogenic bacteria include £ mii strains exp essing the OnipF protein, which are known to be vulnerable to the McePDl mierocin. Tlsc methods, and. compositions: are also elective for killfog.(e ;g, iysing) or preventing or decreasing the adverse effects of pathogenic Shigella sp. Those Of skill in the art will recognize that phylogenetie studies indicate that Shigella is more appropriately treated as a subgenus of Escherichia, and thai certain strains generally considered E. mii (e.g. E. coli 015?:H7). could be classified as Shigella, Herein, the phrases ^' "pathogenic bacteria" and ^k pathogsrne eoW encompasses both pathogenic . coli and pathogenie Shigella, although, the two may li discussed separately, for clarity and to accord with historic desigu lons. The term "pathogenic" refers to the ability of the bacterium to cause disease s mptoms in one or more hosts. Th targeted Imcteriu need not cause dise se in all hosts that is it : capable of eolon ug. Suceessr i coioiv zation of some hosts by the bacterium may be entirely benign (asymptomatic:, harmless, etc,}. However, such non-susceptible hosts may serve as reservoirs of ti e pathogenic- bacteria which, when transmitted to a susceptible best, canse disease. Herein, these two genres of hosts may be referred to as " 'disease susceptible hosts" and ^fi «orv<di¾ease Susceptible hosts", respectively, or simply as ^susceptible h ts" and "non-siiseept bk: hosts". I will be understood that; the methods of treatment described herein may be advantageousl applied: to both susceptible and uou-susceptlble hosts. For the saseeptible hosts, treatment may prevent, cure (felh or partially) or ameliorate disease: symptoms, or prevent o decrease adverse effect that would Otherwise be caused by pathogenic bacteria,, Tftes beneficial effects are: brought .about by killing and/or damaging establishe pathogenic bacteria, or by preventing, slowing: or minimizing ^' the growth of pathogenic bacteria to hich the host is nem y exposed, for non-susceptible hosts, treatment ma destroy or lessen the number of pathogenic bacteria that Cab. eoiorrixe the host or that might otherw se eolonixe the host, but for intervention usin the methods and compositions described hereto, thereby lessenin or eliminating .transmission of the pathogenic bacteri to other disease susceptible and non-susceptible hosts.

Susceptible hosts that ma be subject to diseases caused by patitogpnic E: <¾$: are usually etidotherrn and may be mammals. Such mammal inelude but are not limited to: primates, (e,g; humans}, livest ck: e.g. eattle, pip, sheep goats, etc., especially neonates, juveniles, elderl or immune compromised Individuals; etc, Alternatively, various avian spesi.es may also be .subject to such infections, including hut not: limited to: chickens, turkeys, ducks, etc. Non--s«seeptibI host that m y act as reservoirs of pathogenic: bacteria, that are passed to susceptible hosts includ substantiall the -same endoiherms described above, as susceptible h ts.

Farther, pathogenic bacteria may be transmitted mon members of a particular host group (e.g: from person to person, among cows In a herd, etc.) or even, from One area of an individual host organism to anothe area of the sam organism, e.g pathogenic bacteria, may be transmitte from the anus to the urethra via fecal eoiita inatiQii, causing urethral, infection..

Particular combinations of susceptible hosts and pathogenic bacteria include the following exempla animal pa tbogens _. of interest:

Poultry ~ avian pathogenic £ a (AFEC)

1:0 Calves - ii 99 (which causes calf .dia rhea)

S ifte --- coii KSS (winch causes post-weaning diarrhea)

For food safety:

£ cali 015" :W

The United States Departinent of.Agncu.tore ^· (OSDA) "Big. 6" ^' STEC £ m pathogens: £. ^&:,.&erovats 026, CMS, OiCR 01 ) 1 , 0H2C and 0145. Diarriioeagenie £, coii hmmn pafom :.

various er^ropailiogeme £ : coii (SPEC)

Various enrsroliaemsrrbagie Έ. c i.(EU

various enterotoxigenic E, co^ lETEC)

various enter invasive .£ coii (ΕΙΕό; feekding Shigella)

various eBterOaggregati ve £. tioli- (EAEC)

various so-called iffusel ad ejsmt ? coii -(DABC)

Extraintestinal li (IxPEe) hmttan-pathovars:

nropatlrogenic E eo fUFEG

neonatal meningitis if. coii (NMBQ

Exemplary patlioge c Shigella specie of interest which may be killed by the compos tions and methods of the invention include bat are not limited to: Serogroup A: X dyseftteriae, Serogroup Br S. fiexn&i, arid Serogroup D; 5. s imi _? and serotypes and: serovars thereof,

i addition, eontarmnatioa. with pathogenic bacteria can occur via other routes- ^' of transmission such via fbniites, (inanimate objects such as countertops, cutting boards, utensils, towels, money, clothing, .dishes, toys, dirt, excreted feces, diapers, surfaces in bams and stockyards, etc.), o via unpasteurized milk, dairy products, juices, etc.;: or via eouiaMinated water (e.g. drinking water; ponds and. lakes, sw mming pools, etc.); or via. contaminated animals, meat, or produce; or J¼iits, etc,

In ome aspects, the: methods of the invention involve corrtactkrg pa&ogenic bacteria itii the Hiicroein MeePDI Accordingly, the invention provides i) sribstanti iiy purified., MecPDI Hrierocim protem; and ii) substantially pure cultures of bacteria that produce the fflieroein protein. PROTEINS ANB UCLEIC ACIDS

h some spects, rise nvention provides eeP i iieroeio protein angor gene that encodes fee protein (e,g, SIQ ID NOS; 33 or 31 and 24) as well as proieia$/pol¾3eptides of the operon disclosed eme, and: fee: genes which encode them (e.g. SBQ ID OS: 25-32).

Substantially purified MecPDI mierocl protein ma be produced ^' either ree mbmantly, or from a native or naturally occurring source, srieh as the bacteria described, herein. These of skill in the art are familiar with techniques for genetically engineering; organisms ^' to reeenfeinautly produce or overproduce a protein of interest such as. MccPDI, Generally, such techniques involv excision of a gene encodin the protein from a natural source e.g. using nucleases o by amplifying the gene e,g, via PGR using primers complement ry to sequences that flank fee; gene of interest. The gene can then be mserted into and positioned: within a vector (e.g. an. expression vector such as a plasmid or virus) so that it is able to be expressed (transcribed into translatable mRNA), Typically, the g ne that i to: he iranseribeo! is juxta osed, to one or more suitable control element such as promoters, enhancers, etc. which drive expression of fee gene. Suitable vectors include hut are not limited to: plasmids, adenoviral vectors, baeulo virus, vectors (e.g\ o-called huttle or ^hacmid" vectors, and the- like). Suitable vectors may he. chosen- or eohsrri!cted to contain appropriate regulatory sequences, including promoter sequences, terminator sequences, poiyadenyktion sequences, enhancer sequences, marker genes, and other sequences. The vectors may also contain a plasm I of viral backbone;

Typically, the vector is used to genetically engineer or infect a host organism where the gene is transcribed, and _. translated into protein, in tire host, the gene may be expressed from fee. vector (iTarfscribed exirachronmsomally) and may be overexpressed, i.e, expressed at a level, feat is higher than, normally occurs in its native bacterial host. Alternatively, the gene ma be inserted into the chromosome of the best. Exemplary expression systems that may be utilized include bat are not: limited to bacteria (such as K coli), yeast, baeulovirus, plant, mammalian, and cell-foe systems. Host bacteria may be heterologous, i.e, they .may be non-native bacteria, in. which fee gene is not present in nature. Alternatively, they may be native bacteria, that are natural hosts, but: which are genetically engineered to produce -the rn.tcr.oein in. greater abundance (at higher levels o concentrations) than in the native, non- engineered: host. Exemplar heterologous bacterial, hosts include but: ate not limited to: various lactohaoi!!us species such as ^' Lactobacillus easel LactohacilMs cundophiius, Lactobacillus femtentutn, Lactobacillus gasseri, Lactobacillus pentosus, L ctob cillus pl tita m, Lactobacillus spwvg nes, Lactobacillus bnwis, L&ciotacill delb eekit Lactobacillus liv rius, Lactobacillus: hiigafdiL laei&baei!im kttiirs, _. Lactobacillus rh&mt m Lactobacillus h , Laciobaeiilm leishm is, Laciobaeiil nse i, laaobacitltis rmteri, Lactobaciiim sak i _^ La&obacUi cetfobiosus, Lactobaetll s &isp&itt$, Lactobacillus eurvaiuSi Lactobacillus oaiic sicm, and Lactobacillus Mvetims, and others taught for es&raple,■ m, United: States- p tM application 2iK)90169582 (Chua)., the. complete c tents of ^' hich- .is hereby incorporated by reference m -entirety; and other types of bacterial, fungal and/or viral recombinant hosts. Mammalian cells available in the art for heterologou protein ex$r ¾sio¾ include Aly p ocy ic cell lines fe;-g, ₅ NSC)), 1ΊΕ 2 3 cells, Chinese bajftsier ovary (CH0) ceils, COS cells, HeL cells, baby hamster Jddney cells, oocyte cells, and ceils from a transgenic animal, e.g., nummar «pit ie1 . ^' ,ceJt For details, see Sanihroofc. et ah, Molecular Cloning: A Laboratory Manual, 2nd e&. Cold Spring: Harbor Laborator Press (1989). Many established techniques used with vectors, including the nmnipulat n, preparation, mutagenesis sequencing, and transf ction. Of DMA, are described in Cnrreni Protocols in Molecular Biology. Second Ed tion, Atfsu ei et al. eds., John Wiley & Sons ( 1992).

The vector or chromosome trora which the mieroein is transcribed, (no des:at least a genetic sequence encoding he nncroeiii described herein arid may comprise one or more additional genes of the oper n described . ^' herein, ie:< genes niepM (SEQ ID NO: 2.3), mcpl (SEQ ID NO. 25), mcpA (SEQ ID O 27), νκρί) (SEQ ID NO: 29), and. >KC _P H J S F.Q ID NO 31,), each.of which encodes a respective protein or ruaciioha l variant thereof (see below for explanation, of "variant". The one or more (at least one) gene(s) in roe vector or clxromosome is are expressable arid are operably (fictio all , expressihjy) linked to one or more control or expression elements, e:g, promoters, enhance s, etc, in a manner thai facilitates, causes or allows expression of the genefs). In. some aspects, the genes- are present on a plas id such, as the plasrnid with the nucleotide sequence shown in SEQ ID NO; 33), or plasmid with at least about 55, 60, 65, 70, 75, SO, H5, 90, o 95% or more (e.g.. , 97, 8, 99%) identity. The plasmid may he located: in a native host bacterium, e.g, M~2S- whieb is, resistant to tetracyeime, sttepfemyem and sulf . drugs) and/or E-26 (which is not antibiotic resistant).

The protein that is produced is the mietoein MccFDI (or another protein encode by the operon as described above) or a. physiologically active variant thereof. By "physiologically active variant" or "active variant" or "fimct.ion.al variant", we mean a protein sequence that is able to kill pathogenic bacteria as described herein. The -protein may have the sequence shown in SEQ ID NO: 24, or may include this sequence, or a sequence that shares at least about 95% identity ^' to SEQ ID NO; 24 (e.g. that is about 95, 96, 97, 98 or 9 H identical thereto, as detenruse by alignment methods that are eH~fcnown), but that retains the abilit t kill and/or impede growth/reproduction of .and'or colonizatio y pathogenic bacteria. Com ared:: to the wild type microe ^ ch. v riants are at least about. 50%, and usually about 55, 60, 65, 70 _» 75, SO, 85.. 90, or. 95% or more, as potent- re killing, impeding growth and/or io ization, ere. in ^' some embodiments, the variant -may be more potent than the Bstive mietoein,

The variants of MecFDi tha t may be used in the. pr ctice of the invention may inehide those in which one or more amine acids are substituted by conservative or non-conservative amino acids, as is dnderstood in the art. Further, deletions or insertions may also be tolerated without impairing the function, Iri addition, the ieroein may be included in a chimeric or fusion protein that includes other useful sequences, e.g. taggin s quences (e.g. histidine tags), various targeting sequences (e.g. sequences thai promote secretion or target the protein to a subcelltdar apartmen or to the membrane), other antimicrobial sequences (e g, other microems}.. and the like. _* as well as spacer or linking sequences, ^' The sequence of the icroem may be altered to prevent or discourage proteolysis, to promote olubility, or in any other suitable manner.

Some aspects of the invention provide a microeio with it sequence such as that shown in SEQ ID NO; 24, but which is foreshortened b I S -ammo acids at the amino terminus,. i . the I S amino terminal residues present in SEQ IB NO: 24 are absent in. this sequence, which is shown below as SEQ ID NO: 35, As described above for SEQ ID 24, active variants of the sequence represented by SEQ ID NO: 35 are also encompassed by the invention.

N A N S. N F E G P R.N D R S S G A R. ^' N S L G N A ] ^> I M lY S D P S T V 1. C A N A V F S G I G G I K G G P I G M A R G T I G G A V V G Q C L S D H G S G G S G N

R 6 S S S , S C S G N N V G G T C N R (SEQ ID NO: 35).

The invention also encompasses nucleic acid sequences that encode the mieroein and active variants thereof as described herein. For example, the encoding se uence ¹ may be thai which is represented in SEQ ID NO: 23., but this is not always the case. Variants of SEQ ID NO: 2;?, usually having: at least about 95, 96, 97, 98. or 99% identity thereto, are also contemplated. However, those of skill in the: art will recognise thai ^' . he identity may be much lower (e.g, . bout 50, 55, 6(f 65, 70, 75, 80, 85 or 96%) and the sequence may still encode .a fully- functional mkmein, e.g.. due to the redundancy of the genetic code. C lcul tes of "homology" and/or "sequence identity" between two sequences .may be ^■ performed as follows: The sequences are aligned ΐοι optimal comp rison, purposes . (e.g., gaps can. be introduced in. one or both of a first and a second, amino acid or nucleic acid sequence for optimal alignment and non-honiologeus sequences can be disregarded ϊύχ comparison purposes), in a referred emhedioierti, the length of a reference sequence aligned for comparison purposes, is at least 30%, preferably at - least 40 :, more preferably at least 50%, even, mare preferably at least 60%, and even more preferably at least 70%, 80%, 0%, 1 0% of the length, of the eference ( aiive). sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position the first sequence is occupied by the: same amino acid residue, or nucleotide as the corresponding position ^' iiv the second sequence, then the molecules are identical at that position (as used herein amino acid o ^■ nucleic acid "identity" is: equivalent to amino acid or nucleic acid 'h m log '' . The percent identit between, the two sequences is a function of the number of identical positions shared by the sequences, taking in to account the number of gaps, and the le gth of each gap, which need io be introduced for optimal alignment of die two sequences.

^' The -comparison ^' o sequences and determination of percent identify between ^' two sequences can be accomplished using a mathematical algorithm. In an exemplary embodiment, the percent identity between two amino acid sequences is determined using the NeedJeman. and Wiinsch. (1970, J, MoL Biol. 48:444-453) algorithm that has been incorporated into the GAP program in the GCG: software package, using either a Blossum 62 matrix or a ΡΑΜ25Θ matrix, and a gap weight of Io, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4. 5, or 6. in an exemplary embodiment, the percent homoiogy/ideritity between two nucleotide sequences is determined using the GAP program in the GCG software package, using a NWSgapdtta.GMP matrix an a gap weight of 40* 50, 60, 70, or SO a d a length weight of 1. 2. 4, 5, or 6. A particularly preferred: set of parameters (and the one that: may be used if the practitioner is uncertain about what parameters m-ay be applied to determine if a molecule is within a sequence identity o homology limitation of the invention), are a Blossum 62 scoring atrix with a gap penalty of 12, a gap extend penalty of 4, and a frame shift gap penalty of 5 , The percent identitymomology between two amino acid or nucleotide sequences can also be -determined using the algorithm, of B... Meyers and W. Miller ((I S) CAS ^' IOS, 4: 11- 17) that has been incorporated into the ALIGN program (version 2:0): using a PAM.i.20. weight residue table, a gap length, penalty of 12 and a gap penalty of 4. ^' The eulturing and the- maintenance of cultures of microorganisms such as the bacteria of the invention is earned out e g, as described herein in the Examples section. Bacterial pre arations may be iyop lteed or feeze-dried.

The productio of the substantially purified ieroein protein, is earned out by methods known to those of skill n the art, e.g. by collecting unpuriiled protein fr m a source such as the bacteria (or other expression system) that make the protein, and purifying and charactering, the protein tising known, steps, e.g. various -separation techniques and identification techniques hic include but are not limited to; eeniri&gation, column ebromatography, affinity chromatography, electrophoresis, precipitation, sequencing, spectroscopy, etc. Preparations may he -lyophttized or treeze-dried. By "substantially purified" we mean that the mieroein is provided in a form that is. at least about ?-S v?t%, preferably at least about 89wf i¾, more preferably at least about 90 t%, and most preferably at least about 95 wt% or more free fro ^' rn other macromaiecules such as other ^" e tides, proteins, auclek acids, lipids-* rn.emb.rans ffagmeots, etc., as is understood, b those of skill in the as?.

OMPOSITIONS

The mierooins and/ r bacteria producing mierocins (both of which may be referred to herein as "active ageut(s) or "acti ve ¾gre :te-ut(s)}" of mis invention will generally be used as bactericidal active ingredient, in a composition, i.e. a formulaiion, with at least one additional component such as a surfactant, a solid or liquid diluent, etc,, which serves as a carrier. The formulation or composition ingredients are selected to ^' be consistent with the physical properties of the active ingredient, the -mode of application and envirorm ta ^' iaetars at the site of use, e.g. such as surface type, f^g- sod or soli substra te, etc,), mois u e _* , temperature, etc. if the composition is to be administered to a host, the ingredients are selected so as to be physiologically compatible, with .the host.. Useful fbnnnlaiicms include both liquid and solid compositions. Liquid compositions include solutions (including emulslflabie concentrates), suspensions, emulsions {including miereemulsions arid/or.

suspoemtdsions} and the like, which optionally can be thickened into gels. The general types of. aqueous liquid compositions are soluble concentrate, suspension concentrate, capsule suspension,. concentrated, emulsion, microemuision and suspoernulsioh. The general types of nonaqueous liquid compositions are smulsifiable eonecntrate^triicroenmlsifiable concentrate, dispersibie concentrate and oil dispersion.

The general types of solid compositions are dusts, powders, granules, pellets, prills, pastilles, tablets, films, filled or layered films., coalings, impregnations, gels, cakes, a d the like, which, can be w-ater-dispersibi© ("wettable") or water-soluble, Films and coatings .formed fern film-i rming solutions or llowable suspensians way be useM for some; appt&atia , Active ingredients can be. (micro) encapsulated and mrther formed into a suspension or solid fomiu!atiori; alteriialively the. ntire- formulation of active ingredient ca be encapsulated (or ''overcoated''}- Encapsulation eaa. control or -delay -release of the active ingredient, An eniuislfiable. granule e-orobmes the advantages of both an emulsiftable concentrate

foundatio and a dry granular formulation. High-strengtft compositions may be used as ihtemrediates for further formulation.

Sprayab!e fonm atons are typically extended in a suitable medium before spraying, liquid and solid fdt niations are formulated to be readily diluted in -the spray medium, which may be aqueous-based, e.g, water. Spray volumes can range from, about ne to- several thousand liters, sprayable formulations may be sank mixed With water or another suitabl medium for treatment by aerial or ground application, e.g. of stockyards, bams, stables, stalls, bins containing produce, etc, . ^' Smaller ^' volume spray ionnulaiions for use on smaller surfaces (e.g. couritefffips, for application to small quantities of food stuffs., etc.) ate also

contemplated ^' .

The formulations will typically contain effective amounts of active ingredient, in. the range of about 1 to about 99 percent by weight.

Solid diluents include, for example, clays such as bentonite, montmorillomte, atiapulgiie and kaolin, gypsum, cellulose, tUa um dioxide, zinc o?d e, starch, dextrin, sugars (e.g.-, lactose, sucrose^ silica, talc, mica, diatomaceous earth, urea, calcium carbonate, sodium: carbonates and bicarbonate, and sodium sulfate, Typical solid diluents are described in Watkins ^' et al, Handbook of Insecticide Dust Diluents and Carriers, 2nd. Ed., DofSand Books, Caldwell, N.J.. the complete contents ofwhieh is hereby incorporated by reference in entirety

Liquid diluents include _. , for example, water, N,H- imemyl&lk30a:mides (e.g., Ν,Ν- dtme&ylfbrniamide), limonene, d meth l--su1£ ide ^¾Jpy^¾d¾me& (e.g., N- mei ylpyfrolidinone), eifty!ene;glyeol, triethylene glycol, propylene glycol, dipropylene glycol, polypropyleiie glycol, propylene carbonate, butylene carbonate, paraffins (e.g., white, mineral oils, normal paraffins, isopa;raffitrs), aiky!benxenes. alkylnap halenes, glycerine, glycerol, triacetate, sorbitol, aromatic hydrocarbons, dearoma&ed aliphahcs, alkylbenzeues, aikylnaplithalenes, ketones sue a eyclohexanone, 2-heptatiorie, isophorone and 4-hydroxy- 4-memyl-2- enian.one, acetates such as isoainyl acetate, hesyl acetate, faeptyl acetate, ociyl acetate, nonyl acetate, tddecyl acetate and isobornyl acetate, other esters such as alkylated. i? lactate esters, dibasic esters a«d..gamma. «t rolaet ¾lei and alcohols, which can be linear, branched, saturated or uftsaiurai s eh as methanol, ethauol, n-propaool, isopropyl alcohol, n-baiani).!, isobuiyl alcohol, n-h¾xa¾«S, 2-ethylhexasol _s -n-O0tooi, decanoi isodeeyl alcohol, isooetadeeanol, alcolidl iridecyl alcohol, oleyl alcoho eydohexaricl, retraliydrofntftiryl ateohoi, diaee tone: alcohol and benz l alcohol. Uquid diluents also include: glycerol esters of sa rated and unsaturated fatty acids (typicail QrC¾}, such 8$ p nt seed and fruit oils (e.g., oils of oli ve, castor, linseed, ^■ sesame, c m (maize), eanut, sunflowen grapeseed, safflower, cottonseed, soybean, rapeseed, coconut and palm kernel), animal- sourced fats (e.g. , beef tallow, pork tallow, lard, cod li ver oil, fish oil), nd mixiure&thereof Liquid diluents also include -alkylated, fatty acids (e.g., methylated, eihylaied, bulylated) wheteia the fatty aei ^' ds-ihay be obtained by hydrolysis of glycerol esters from pianfand aniniai sources, nd can be purified by distillation. Typical liquid, diluents are described, in Marsden, Solvents Guide, 2nd Ed., Interseience, New York, 1950, the complete contents of which is hereby incorporated by reference in entirety.

The solid and liquid compositions of the pteseut invention may include one or more surfactants. When added te liquid, surfactants (also k ws as "suriaee^aetive. agents") generally modify, most often, reduce, the' surface tension of the liquid. Depending O the nature of tfre lrydrophille and lipophilic groups in, a sturfactant molecule, surfactants can he useful as wetting agents, dispersams, emulsifiers or defoarolng agents. Surfactants can be classified as nonienic, n onic or cationic.. Exemplary suitable surfactants can be found, for example, in United States patent application 2D13Q143 40 io L ng, the en irii contents: of which is hereby incorporated by reference. Also useful for die present compositions are mixtures of nonionie and. anionic surfactants or nlixtures f nonionie and ca onic surfactants. onionlc, anionic: and: cationse surfactants. nd their reconftnended uses are disclosed in a variety of published references including McGutcrteon's Enmisifiers and Detergents, annual American and International Editions published b McGnteheonV Division, I ^' he

Manufacturing Confectioner Publishing: CO.; Sisely atid Wood, Encyclopedia of Surfac Active. Agents, Chemical :Pubh Co., Inc, New York, 1964; and A, S. Davidson and B.

Mifwidsky, Synthetic Detergents, Seventh Editiou, John Wile and Sons, New York, 1987,. the complete contents of each of which is hereby incorporated b refereuce in entirety.

Compositions of dns invention may also contain, formulation auxiliaries and additives, known to those skilled in the art as formulation aids (some -of which may be considered to also function as solid diluents* liquid diluents qrsttf sslaais). ^: $ίχ fotmu!atiiprt auxiliaries and. additives may control: M (buffers), foaming, during processing; (anti.foanis ^: such polyorganesiloxaries}, sedimentation of active in redients {sus end ng agents),- viscosity (tinxoiropie thicke ers), in-container microbial growth (anliroicrobia ), product freezing; (aatlftee es), color

evaporation (evaporation retardauts), and other formulation attributes. Film formers tnclnde, for e ample, poiyviay! aestates, polyvinyl aee e copolymers, polyvi%dpyT ¾lidoxie-vffiy3 acetate copolymer, polyvinyl alcohols, polyvinyl alcohol copolymers and axes. Examples of: formulation auxiliaries and: additives include those listed i MeCuteheon's Volume 2;

Functional Materials, annual International and North American editions published by

McCuteheon's. Division, lie Manrt&cmnng Confectioner FUblisliiftg Co., die complete contents of which Is hereby incorporated by refefence in. entirety

"The active agents described Iterem a id anv other active ingredients a typicall incorporated into tire present compositions by dissolving or .suspending the active ingredient: in a solvent or by grinding in a liquid or dry diluent. Solutions., including emu!sifiabie concentrates, cars, be prepared by simply mixing the ingredients. The preparation xftay be lyophillzed (freeze dried). If the solvent of a liquid compositio intended tor use as: an enru!sifiable concentrate is waier nrrai$cible, an emtiisifier is typically added, to emulsify the active -containing solvent upon dilution with water. Active ingredient slurries, with pisrlie!e diameters of up to 2,000 jim ean bs-wet milled using: media- mills io/0¾ialrr particles, with average diameters below 3 μηι. Aqueous slurries can he made into finished suspension concentrates; (see, for ex m le, XLS, Fat. No, 3,060,084, the complete contents of which, is hereb incorporated by l fcrence in entirety) or fbrtter rocessed: by spray drying to form water^dispersible granules. Dry tormn!ahon usually require dry milling processes, which produce average particle diameters in the 2;tO 10 gm range. Dusts and powders can be prepared, by Mending and usually grinding (such as with a hammer mill or iluid^energy mili). Grannies and pellets can be prepared by spraying tire active materia! iipon preformed granular carriers or by agglomeration techniques. See . Browning, "Agglomeration", Chemical

Eftgirreering, Dec, 4, 1967, pp 147-48, Perry's Chemical Engineer's Handbook, 4th Ed., McCraw-Hili ew Yoik, 1963, pages 8-57 and following, and WO 91/13S46. Pellets can be prepared, as described » -U.S. Pat. No, 4, 172,714. Water-dispersihle and water-soluble granules can be prepared as tanght in S.,Fat. No, 4,144,050, U.S. Pat, No, 3,920,442 and DE 3,246,493, Tablets can be prepared as taught in U S, Pat. No. 5,180,587, CS, Pat. No. 5,232,701 and U,S. Pat. Ho. 5,208,030, films can be prepared as taught in <3E 2,095,558: and fJ.S. Pat. N©- _: 3,299,566, For inrther infbrtnation regarding the art of formulation, see T. S.; Woods, " he Formal ator's Tboi box- -Product Forms for Modem. Agricnltnre" in Pesticide Chemistry and Bioscience, The FoodrE&vironiheni Challenge, X Brooks and T. R. Roberts, Eds,, Proceedings of the 9 th Intejmtional Congress on Pesticide Chemistry, The Royal Societ of Chemistry, Cambridge, I 9:9 _: p«. 120-133. See also D.Si Pat No. 3,235,361, Col. 6, line 16 through Coi. 7, line 19 and Examples 10-41;: U.S. Pat. No. 3,309,192, Col. 5, line 43 troug Col 7, lino 62 d Examples 8, 12, I S, 39, 41, 52, 5^, 58, 132, 138-140, 162-164, m, 1 7 and 169-182; U.S.- Pai. No. 2,891 ,855, Cel. 3, line 6 through Cob S, line 17 Examples 1 -4; Kliogmao, Weed Control as a Science. John Wiley and SOBS, Inc., New ^" York, 1961 , pp 81 -96; Hance et al. Weed Control Handbook, 8 th Ed., Blaekwoil Scientific

Publications, Oxford, 1 9;,and Devrijgraenfe formulation tectmology, FJB Publications, Richmond, t¾ 2000.The complete eoatenfcs- of e^ch of tbese- erences is hereby

incorporated by reference in entirety.

In addition, the formulations may include other suitable active agents, e.g. other antimicrobial agents such as other rnicrocins, antibiotics, etc,; or broadly defined

antirnicmbiais: such as antiseptics or heavy metals, etc,

INCORPORATION i! T0.- VAR0US F OBiJCT

The active agents described herein ma be incorporated into and or used as an amendment to many different products, e.g. substrates and media which include but are not limited to: so-called "hand-saRi ^ing ⁵ ' preparations and soaps, gels, etc.; various sprays and washes; detergents arid various cleaning agents; .fabrics e.g. linings for materials suc as diapers an other garments that may be contacted by feces; "booties" that are used to cover and protect shoes; disposable or non-disposable gloves; disposable or non-disposable food preparation surfaces, e.g. as sheets of material that can be placed on. a cutting surface, or in av cuitiiig, surface itself; in storage apparatuses for implements used in food, preparation (e.g. knife blocks, or holders, etc); and: others.

n some aspects, me ac ive agents described herein are incorporated into packaging materials, e.g. packaging materials designed to contain meat or meat products; or produce. For example, me packaging material may be impregnated with the acti ve agent either during o after anuiaei e, or ma be coated onto one or more surfaces of the material. The packagin _, material may be a film _s , fo med from a flexible polymer that: may fee transparent, or may be a rigid or semi-rigid container fo ied from e.g. plastic resin, styroibam, wood, cardboard or pasteboard or other molded cellnlose product, or made from some other so-called "natural' ^* material. The packaging material may be in the form of "peanats^ The material may be biodegradable. United States patent applications 20120259295 (Bonutti) and 20030234466 ( asmnssen) and references cited therein, the complete cements of all of which are hereby incorporated by reference i«. -eirf&ety, iseuss; the preparation of various types, -of packaging materia !&

The active agents may be incorporated into robiotie fomndatioos. Sneh tomiularions may be designee! or tailored to sui the mode of administration and the .host to hich the probietie is administered, lor example. If the targeted host is a human, the active agents may be added to other known probiotie products (kefir, yognrts, "sm othie ^ ete;,) _: and/or other ingredients thai increase palatabiiity m y be. adder! (e.g< flavorings, thickeners, coloring agents, etc;}. The f miufatlon may he chewable (e.g. gum or tablet) or taken ^, as a pill. Other or anisms may also be present in file prObloi to. preparation e,g, lactic acid bacteria (LAB), bifidobacteria, yeasts arid various bacilli. If the recipient host is a juvenile such as a calf; the probiotie may be a milk, substitute formulation. If the recipient is a bird o fowl, the prohioiie may be a formulation of drinking water. Probiotics may also be formulated as strppositories.

ETHOiJS AND USES

in some aspects, the mveation provides methods of u ing the microoins nd bacteria that produce the rnicroeins descxibed herein, for preventing or decreasing the transmission of pathogenic Eschgriek li (£. cp(i) bacteria from a first location to. a second location, e.g. from a first host (that may or not fee a susceptible host) or first contaminated area, to a sec nd host, or previously uneoptamlnated area. The second host nay or ma not be -susceptible The first location may be a "reservoir" host or ansa/loation that is already colonized; by the pathogenic bacteria. Alternatively, the -first host or location may fee likely to be oolo teed or possible to colonize,

A m st tisnM hosts

If the first location is a ^' -susceptible (or non-susceptible) first host, die method comprises adnnnisiering to the first host the nijofoein described herein or a baerelitmi that contains and expresses a Pncieotido seqneiiee encoding die mkroein. By "administering" we mean the deliberate, intentional, active introduction of the bacterium, int the first host (he, the arposeM inoculation of the first host), usually by a hum or by a device, instrnrnent o machine designed and operated by a ^' human, in other words, the bacterium is not inadvertently, passivoiy or accidentally transmitted, or is not transmitted as the result of an act of nature, or as the resu It of _: contamination of a source of the bacteria. Generally, the "bacterium that is delibera ely administered is a substantially pure, genetically homogenous poptdaiien of substantially identical bacteria, or part of a imxtrcee. of several types of such substantially pnre bacteria (e.g several different serotypes, serovars, or strains. The baetena that are so administered are generall -eilltsred in Vitro ifor a: time prior t adrr nistratlori, and the■method may involve etdturing the bacteria from a: natural source, selecting a single colony for propagation, and propagating lire bacteria to .form a . cul ture .that i s sufficiently large or populous, to successfully inoculate a. host,

A lnrinistration resolts in contact between pathogenic bacteria tha reside in/on the first nost an<l tite killing or damaging, etc. of the pathogens. Alternatively , administration may be prop ylaatie, ..i.e. tbe first host is not already infected wit -the- pathogen, and infection, is prevented or decreased; if bacteria are administered, the step of administering, may also, result is coiotrisrdon of a host that is treated with the adminislsrM bacteria, re. bacteria that have the gene encoding the rnieroein. Thus, in some aspects, the step of adinlnisteiiag results in an alteration of the microflora (e.g; "gut" or "digestive tract" nii«oflora}. of the lecipient host, and the bacteria thus are a "probiotic" as discussed elsewhere herein, competing fot nutrition and attachment: site to within, the host, "Digestiv tract" includes e,g. the mouth, esophagus, stomach, small intestine and large intestine (winch, includes ; the eeeurn, colon and rectum).- ¾ general, the amount of microem that is administered, in. order to be effective is in thcxarige offtonj about the amount of truerocin would range between about 1 ug. and 100 tug- depending on the application and dilution factor; and th amount of bacteria that is administered in order f» he effective is iu the . ange of from about .10 ^" to about i0 ^!i , and is preferably in the range of from abou l(f to about iff. Those of skiil in tbe art wi.il: recognise thai variations may occur, depending ¹ e.g. W how ma h microem is produced by the . ^' bacterial strain in: question., by the species, size, age, etc. of the snbjsei to whom the microein and/Or the: bacteria (or other recombinant host that produces the nnerocin) is administered...

WKetv the microem is administered, it may be in soy suitable toon or incorporated into any suitable vehicle, Exemplary vehicles for admiriistering the. microein include but are not limited, to: liquids . uch as drinking water, formula, and the like; and solid or semisolid forms such as suppositories, pills, tablets, etc. The vehicle may be e solid "slow release" vehicle. The vehicle may include ot be contained within e.g. a »en»eabid or semi^ ermeable bag or poueh. which can be suspended or retained indefinitely in. ths gut of a host rganism (e.g. a eow}, ifom wbleli the active agent leaches or is released over time. The ^; bag or pouch may he biodegradable.

For avian hosts (e.g. chickens), an. exemplary mode of administration is addition of niierocin-prtidricmg bacteria to drinking water or feed. Administration in this manner may he termed "probsotfc" because th goal Is to encourage coionizatioo of the bird ^' digestive system with the. harmless, protecti ve bacteria, although coi tk is not a requirement for pesitive effects to accrue. Tlie protective microein-prodncing bacteria can destroy or kill and thus outeornpete pathogenic bacteria, eneoimtered. by the bird, preventing colonization by the pathogens, or a least deereasmg the level of colonization of and henee transmission from, the bird, if the microdn itself is added to the -drinking water or teed, it will destroy or kill pathogenic bacteria encountered by the bird, preventing eoioirtzatioii. b tie pathogens, or a least decreasing the level: of colonization of, arid hence transmission from, the bird, and: possibl allow oilier non-pathogenic bacteria to flourish.

Similar strategies may be employed lor b vi e Hosts, -e,g. addition of mfc-roein- prodncing bacteria or ttie mieroein itself to drinking water, feed, salt licks, calf formula, efc,, or administration, of the bacteria: as a prob.iot.ie to encourage the establishment of microefn- produemg bacteria as described herein, or to prdvi.de ^' a; protective shield against infection by pathogenic bacteria- Appi&giion to surfaces

Those of skill in the art will recognize that it is: also benefioiai to preverit (discourage, impede, lessen, decreas , eto ) imns«n¾sion of pathogenic bacteria Irom. no host -sources to possible hosts, e,g. to prevent transmission from surfaces or areas w&ieh harbor the pathogens. The Invention also comprises reethods.of doing so by applying the ieroem of the in ention and/or bacteria encoding tbe niicrocit to surfaces which harbor the pathogens,: or which. are suspected m harboring the pathogens, or which Could become eoniamiriated with pathogens. Applying -or treating such surfaces ma be accomplished by any of man methods, e.g. by sprayin a preparation of the nncroein or bacteria, by ap lying a.

Cdmposition Comprisin a powder or granules, etc. Suitable compositions are described above. In general, he amount of microem thaiis applied to a surface in. -Order ^' to be effective i in the range of from between about 1 ug and 100 rag; and the amount of bacteria that ^" is. applied is in the range of from, about Iff to about and is preferably in. the range of from about id ⁶ to about l(f .

Areas that are particularly prone to contamination with pathogenic bacteria ihdud those which house of livestock or Fowl, Snob areas, especially commercial area s, may be treated using the compositions of die invention, _, s ec all spray f ipulations. The areas may or may not be associated with a commercial enterprise, e.g. they may be associated with for proiit or non-profit farnrs, stables, etc. The areas may also be set aside for anirnalse.g, as reserves, ¾oes, stockyards etc., or may be jocated at veterinary facilities. The compositions of the invention may be applied, to any suitable surface where ^' the raicroem may be useful to kill pathogenic haeferia. e.g. soli Or grass, looting, stalls _* pens, niilking carousels, feed lot. surfaces, drinking and/or feeding containers, cages, crate truck beds, etc. Exemp.ia.ry ^' animals ^' which ^' are housed ia msc areas and. are potential hosts of pathogenic bacteria include but are not limited to; livestock e,g. horses, mares, mules, jacks, jennies, edits, cows, calves, yearlings, bulls, oxen, sheep, goats, lambs, kids,lrogs, shoals, pigs, bison,, and others; and avian species such as land and water fowl e.g.: chickens, turkeys, ducks, geese, ostriches, guinea fowl etc. The preparations of the iuvemion may Be applied to the - ^' animals themselves, or to specific areas of the animals, e;g> to feet, the anal area, etc,

In addition, the preparations: of the Invention may be applied: to various pr dnets, especially products derived from anhnais that are susceptible to infection with a-aoVor to disease caused by pathogenic bacteria. The preparations may be applied to or included in (mixed into), For example, meats or meat products (including both, raw and so-called ⁱ ready to eat" meat and poultry products), eggs, hides, carcasses, horns, hooves, feathers, etc.

Dis s prtsve ed o treated

The types of diseases arid conditions that may be prevented or treated- usin the methods and compositions disclosed herein include any of those which ate caused ¾y _. pathogenic E. eo/i, including but are not limited to: food poisonin (e.g.. in humans),, gastroenteritis, diarrhea, urinary tract infections, neonatal meningitis, hemolytic-uremic syndrome, peritonitis, mastitis, septicemia and Gram-negative pneumonia, shigellosis, dysentery, etc. In soriie aspects, probiotjc preparations are contemplated, e.g. liquid or Solid preparations that are taken prophyiaetiealiy to prevent or treat disease, symptoms or so-called Traveler's diarrhea, prior to or uring travel.

Herein, where a. range of values is provided, it is understood that eac interest ng- value, to the: tenth of the unit of the lower limit hnless the context clearly dictates otherwise, between the upper and lower ^. limit of that range a d- anyHither stated- .or .fittt¾fve»-in value i that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges arid are also encompassed within the invention, subject: to any specifically excluded limit in the Stated range. Where the Stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention..

Unless defined otherwise, all technical and scientific terms nsed her in have the. ame meaning _: a commonly understood hy one of ordinary skill in the- art- to which this inventio belongs. Although any methods and materials similar or . equivalent to those described herein can also be used in the practice or testing of the present invention, representative illustrative met ods _. and. materials ar now described. All publications and -patents -eited in this specification are herein incorporated by .refer nce as if each individual publication or patent were specifically and individually indicated to be- incorporated by reference: and are incorporated herein hy tefeence to disclose and describe the methods; and/or materials in connection with which the publications are cited. The citation of any puhlieatiori is for lis disclosure prior lb the Sling dare nd should not: be construed as aft admission that the present invention is not entitled to antedate such publication by ^■ -virtue of prior invention. Further, the dates of publication, provided may be different from the actual publication dates which may need to be independently confirmed.

If is noted that, as used herein and in the- appended claims, the singular forms "a", "an", and "the" include plural referents yrdess the context deafly dictates ethei- ise. It is: further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis .for use of such exclusive terminology as "solely, " "only" a» the like in connection with the recitation of claim elements, or nse of a "negative" limitation.

As will _. be apparent to those of skill in tire art upon reading this disclosure, each of the individual em odiments described and illustrated herei has discrete components and features which may be readily separated from or combined with the fe tures of an of the other seve al embodiments wii¾out. ^: parting: .from the scope or spirit of the present invention. An recited method can be carried, out in the order of events recited or in any other order which is logically possible.

Before exemplary embodiments of the present Inventio are describe in greater detail, it is to be understood, that this invention is not limited to particular embodiments described, as such may, of course, vary, ft is also to be understood that the terminology used herein is for the urpose of describing particular embodiments' only, and is not intended to be iitttittag, since the seope of the present invention will be limited only by the appended, claims.

EXAMPLES.

EXA PLE 1. Materials and Methods

&& mt $trwm _> media, and culture conditions. E, caii strains (l ⁱ able 1 ) were eoitared in Loria-Beriani ^' (LB.) media (FisBer Scientific, Pittsburgh, PA) o in M9 minimal media (6 g i, sfeHPG*. 3 g/L K¾P(¾, 0,5 g/L NaCL 1. g I ¾CI, 2 mg thiamine, 1 m gS0* 0.1 IBM CaC¾ and 0.2% glucose} at 3 C with shaking: (200 rpm), unless stated therwise. Components tor the M9 media were purchased from Fisher Scientific (Pittsburgh, PA), Sigma- Aldrich (St.: Louis, MO) and IT. Baker Reagents and Chemicals . Philli sbitrg,. NJ), Antibiotics were added to media at the-.f<>ll.ewi»g ^' edni ^' ertiratioijs ^' :-. amjSi&ilin t&nip:) 100 M /mi (Fisher Biotech, Fair L wn, MI); fcanairiyciri (km} 50 fig/ml (Fisher Scientific., Pittsburgh, PA); nalidixic acid .(rial) 30 }¾/ml (MP Biomedicals, Solon _? 0H) _: ; and tetracycline (tet) .50 tig/rhi (Fisher Scientific; Pittsburgh, FA), Steins that would otherwise be antibiotic susceptible were selected for nalidixic acid resistance through, successive, passage, in IB media with, inereasmg ^■ .nalidixic, acid conoearmtioris tlritli the strains were capable of growth at 30 ^tgrti liabl !, E. oUst and PGR primer sequences used in this work.

PVimers; MoRSiSiigtms extensions

Strato (HJ* and H¾ -SVft, _. t 0&, a fid JRef.

mcpM loci

FDIftvd;

TAGriGCAGGGGCATAAGAA

(SEQiDNO:!)

PDi ·<-- :

AGGAAACGGAAAeAGC'AACT

iSEQ.i O::2)

E.c&li-IS ^v e, SSuT^ PDT ¾pft* ^, «¾v: .(IT*

^' GCGACCTTTCGCTTTGATGG

S.EQiDNO:4)

mcpM-fwd

CCGIAATGACCGTXCCAGT

(SEQ1D1 G;5}

€GAI1TCCACrACCA ^' K¾;T€

SEQ ID NG:6)

Hi:

ATA,ACCCGTATCTT¾\€GTTGC

CTTACG GA

K2:

CTAGAATGCGGAATAATI FAG AGTTTGAT Primers: Homologous exfensioBs

Strala Rvf. iSi ^' iO ID NO:*)

m.:

HI:

CTAATTTAAIAAACATACTEAG CGCCCTCCATTATATCTAT

·£, cos- SSti ^' TA KaaA AmepM, This woi:k

H2:

AACGGACAAAA-AACAAACAA

CGGATAGGGGAAATATGAX

CSE mNO-12)

K o - SSu \ Kia , Am<pB, H2:

AGGAGTTTCACCCGTCACA

(SEQ IG G : i 6

HI;

TC AGGCATK;CCAT ΑΑ ATG AC

GAGTATCAAGGTTOACG

£ £¾¾?-- SSuT^. Kan*, &mq?D.

(SEQ ID G.:i7)

H2;

TrGAGGGAAAGGTTACTTATTO

Μ ^' ΪΑΑΑΑΑΤΑΑΤα- SPV¼ier$; Homologous extetisioiis tr ia (HI ^s ami H2% Vm _> r *n&

mcpM loci

(SEQiD O:i¾

E, coii Witd-type, SSu7 ^R _? PDF (32)

CQli-6 WM vpe _} SSul* PDF (32)

/:: coh- Wild-type, SSuT POP This work

E.,coii-i Hii-ivpc. Naf PDf (32)

K C£i --2¾4 ild-type, Naf , FDf (32)

£ i /i

Naf (19) K\2

^!: E, (X)H~25 geae^-specifie sequences are. slio a. For . ene deletioa mutants, homologous extensions also s4 the fcaimmycfe primer site: TGTGlACKSCI ^' aACiCTGCTFCCj (SEQ ID MO: 21% 3' t the £, ςρΙϊ-&5 specific se uence,

* E, GOB-2$ gsue-speoiiie se ue ces are showm For gene deletion mutants, homologous extensions also had the kansniyei primer site: ^T ATCi A Al'ATCCTCC F A (SEQ ID NO-; 22), 3' to the -E, coti~2 spe-eitle sequence.

Competition assuys ω meas re inhibitim ph type. Bacterial strains- were giwa indivdually overnight m. LB-. Equal volumes of each competing strain wer inoculated into fresh M media at a 1:200 dilution, for a final 1:100 dilatio of total eslk. C turss were then incubated at 37°C for 8 to 24 . it was previously shown thai the PDI phenotype does not differ significantly between 8 and 24 h competitions (32). Mixed cultures were then serially dilu ed, plated on LB supplemented with the appropriate antibiotic to select for each competing strain, and enumerated.

live/dead staining and flow cytometry. Viability assays were conducted usin the Live/0ead$ Baelj ht^ Bacterial. Viability Kit (1*34856, olecul r Probes, Invitrogfen, Eugene, OR), Cell ^' cultures ^' were grown in M9 media for six hours a 3? 3.and. then I ml of each culture was collected by eentrifu tion, washed in .S5% NaCf and resuspended in 0.85% aC , Cells were then, diluted 1 :10 in 0.85% NaCi that contained 1.5 μΙ. of 3,34 m SY ^' TO 9· and ^' 1. μΐ of 3D mM prop&lfum iodide. Samples were incubated at room temperature in the dark for 15 min. Flow cytometry was performed on. _: FACCalifeur flow eytojnefer ( D Biosciences) and. data, was analyzed, usin : FCS Express software De Novo software, Thornton, Ontario, Canada), Initial aram ter were established b analysing col! suspensions, with known live- and dead-eel! populations. These bacterial suspensions were prepared as follows: cells were grown in M : minimal media to late-log phase and 1 ml aliquots of the cultures were collected by eentriJ gatkm, washed in 0.85% NaCi,. and resuspended in either 0.85%: NaCi (live portion) or 70% isoptopy! alcohol (dead portion). Samples were incubated at room temperature for. 30 min, then processed and analysed by flow cytometry as described above. Ratios of live to dead ceils used for the standard were (live: dead): 0:100, 50:50, and 100:0. Gates specific to our Έ. co!i (based o side and forward light scatter) were used: to collect dat on 50,099 cell events. Green versus red fluorescence was measured to distinguish between SYTO 3 stained live ceils and propidimn iodide-SYTO 9 stained dead cells. Nonspecific signal was excluded at the time of data .acquisition.

Sequencing and analysis.. Genomic■.extractions of .£. ^' eoii-2S, £. c ti~%2 _f and £ coli- 264 we ^' re prepared using, the DNeasy Blood & Tissue kit (Qiagen, Valencia, CA) according to the maptrfaetureC ^■■ Instructions. Sequencing was conducted at foe Genomics Core La at Washington State University using a. Roche 4.54 FLX Titaniorn Genome Sequencer to a depth, of 4 represented fey 399,070 reads. Sequences were assembled using; Newblcr (version 2.5.3). Annotation enipioyed Glimmer version 3.92 for gene calling, and then the data was piped into CLC Genomics Workbencb (CLC io, Cambridge, MA) where the resulting genes were screene against the current BLAST, SignaiF and ^' Ham databases for functional predictions. The annotated sequence has been deposited in GetiBank under (note: sequence submitted, accession riPm er pending).

-gene deletion: Gene-specific knockouts: were generated, using the methods described by Datsenko and Wanner (5), Briefly, the gene of interest was replaced with a PC -generaied fcariaraycia resistance marker. PCR primers were designed to m lify the kananiyein resistance gene Horn the template plasm.td p D4. .Each...primer incorporated 36-50 tit of the region flanking the gene of interest (Table .{).. PCR products wer column purified (Qiagen, Valencia, CA), digested overnight at 37°C with. Opnf (New .England Biolabs, Ipswich, MA), purified again, and suspended in 30 μ| 3.0 mM Tris, pH 8.0. £V c&H- 25 carryin the λ Red pi smid pKD4 (Amp ⁸ ) were grown in SOB (2% bacfetrypione, 0.5% yeast extract, 10. mM NaCl, 2.5 ffiM KCI, 10 nlM gCtj, 10 mM. gSOs) with 1. tftM L- arabiuose at 30*C to an. 0i¾¾ of -Clil The ceils ere then, made eleetroeohipeterti by washing twice with, ice-cold waiter, once with 10% glycerol and concentrating the celts 100- fold in 10% glycerol BJe trocompetetit cells (50 μ!) were pulsed with -100 ng of PCR product using the Gene Pulsar I (Bio-Rad, Hercules, CA), SOC media,(i2) was immediately added to the cells that were then incubated 2 h at,30 ^! 'C. Cells were plated on LB with kananiyein and incubated overnight at 30 ^? C to select for tf sformants, PCR mplificati n esing primers within the kananiyein resistanc gene combined with genomic rimers adjacent to the sequence of interest were used to verify that the resistance cassette integrated at the desired location.

C tplemematim of tticpl hiOck& L A pETi O TOPO® vector (inviirogen, Grand Island, NY) was used for inducible expression of the putati ve immunity gene. This gene was PCR. amplified front E, mli-25 Using pri e s that produce a 3 ^* single-stranded overhang identical to the S ^! end of the pETKM) vector, allowing directional joining of our gen of interest and the vector, Ligation, and transformation was conducted according to the instructions of the Champion™ pET Directional ΤΟΡΟ Expression kit, Brierly, 2 ui of PGR product was added to ϊ μΐ, Salt Solution (provided in kit), 1 pi TOPO vector, and 2 μΐ sterile water. This reaction ineubaied at room temperature tor 25 min. and then w¾s placed on ice for 30 m«t. An aliquot (3 μΐ) was added into SO μΐ -chemically competent To lO .B, coii and incitfeaied on ice for 2 nwn. Cell$ were heat shocked for 30 sec at 42 ^C' C then transferred to ice. SOC media (250 uJ) was added and the cells were incubated 1. h at 37 ^¾ C Ceils were then plated on LB agar containing arnpicillin and incubated overnight at 37 C, Tratisforman s were screened by PCR. using foe universal. T? forwar and reverse primers to identify clones containing the ρΕΊΊΟΘ vector with an insert. Five transfbrrnanLs were selected for sequencing to verify they contained the correct insert Plasmid was then, isolated using the PureYield Plasmid M iprep System (Profoega, Madison, Wl). and transferred to a st cell by eleetroporatior? as described above. Tmnsfbnriarits were selected by their growth on IJB wife ampiinllin,

Transforming £. co&4 with the P1M plasmid. The pPDl Am¾¾i plasmid was pari fed using the " MPrep.: Ex ress™ Matrix (MP Biomedicals, Solon, OH). E. eoB4- was then made eke tmeornpetent and. transformed (as described, above for tfe -gene ^' deletion mutants), with p DlAi Successful transibrniants were selected oil ^' LB with kaaastiycm and. PGR verified, for tbe presence of tbe PDl region _^

Ph id mattiig qwmm nu<. £ celi-254mcp md ^'■ £ Kl were grown overnight iti . IiB media with kaaaiftyciri or nalidixic acid, respectively. Equal amounts of plasrnid- bearing strain £, coti-ZSi cpM were mixed with, lion-plas id-bearing E, CQH I2 and eenteifuged for.3 min at 16,000 x g. The eells were washed and concentrated i0;0~fold in 1 fflM: MgSO*. Ceil suspensions were then pipetted: onto a nitrocellulose membrane placed on a non-selective LB -agar plate. Following 24 ^' h incubation at 30**C, the. ceils were resuspended in sterile PBS and dilutions plated on _. l.B-agar Containing nalidixic acid and/or kanarnyein. the corrugation efficiency was calculated b dividing- the CPU of transcoirjxigants by the CFCf of donor cells, Plasmid profiles were prepared for a srubset of transeonj gants. io confer the presence of plasnrid. Profiles were contracted as. described by Kado and Liu (14), The same experiments, using kanamycin and tetracycline tor selection, were then repeated using the K12 ^' ΡΌΐ ή ψΑί ^• t an ^' sCoftjwgaBt and & cali~6 to determine whether the plasmid is self-mobilizable.

R ^■ NA isolation, firsi-sir d cJ NA sytrik&s s, md micro in: MT-qPCR. K cvfc25 encoding Mep wa inoenlated. into .5 ml M9 minimal media containing tetracycline and incubated overnight at. 37°C. One ml of overnight culture was inoculated into 300 ml of room temperature M media arid incubated at 37°C. Aliquots containing approximately 1 _. 0 - i cells were removed .immediately alter jnoeulatiort (0 h), :an 2 , 4 h, p ^' \ 10 h, 12 b, and 24 h. post-inoculation, pells were pelleted by centriftigation at 4¾ and !total- KA was isolated: and DNase treated using RiboPure-bacteria kit (Asibioa) according to: manufacturer instructions; RNA concentrations were determined using a NanoDrop ND- 10(10 spectrophotometer. RNA. .samples f mm a given time course experiment were dilute to the same concentration as the least concentrated .sample. To assess DMA contaminatio in RNA Samples prior to cDN A synthesis and. expression: analysis, equivalent R A concentrations to be used in the corresponding eDNA RT-qPCR reactions were, run under Identical conditions used for RT-qPCR analysis using polymerase sigma subrmit rpoD primers (Table 1), RNA. samples with, cycle threshold <C0 values less than 37,5 cycles were again treated w ith . ^' DNase and. Ct a ues reanalyzed prior to eDNA synthesis. First-strand eDNA synthesis: was completed using S μ! of RNA (2-2Q ϋ μ{ random hexamefs and Superscript ill reverse transcriptase (Invirrogen) in a final reaction volume of 20 pi according to anufaeturer instructions. To verify the specificity of the iep&fptimem (Table I), a single PCR .product of the-: correct size (213 bp) wa detected in PDF strains but sot in PDF strains when analyzed o« agarose gels, rpoD. primers, described above, amplified a single PGR product of the correct size (336 bp) when analyzed on agarose gels frorri all PDF ^" and PDF & -coli strains tested. The amplification efficiency of primer sets was then determined using plasmi DN encoding their respective targets Under identical condi tions used for RT-qPC&.

All RT- qPGR reactions were performed as a sing!e^plex reaction in. tri licate in 96- weil plates. Positive controls and no template control ^' s were included in duplicate for each primer set Each reaction was performed using 2 μ| FcDNA _s .500 nM final concentration per primer, and SsoFastEva Green. Sapermix (Sio-Rad} In a final volume of 20 ΐ All: PCR reactions: were performed o CFX96 Real-Time PCR. Detection Syste with version 2.1 software (Bio-Ead) with the following cycling conditions: 95*C for 3 s, 40 cycles of 9 for 1 5S ^fi' C for 5 s, and 72¾. For 15 s, Morrnaiized (AACt) microem expressio was automatically computed using tee Bio-R CFX Manager Software version 2.1 using rpoD as the reference gene,

EX MPLES. PDl is effecti ve against a bread range o f E, e&h

in this Example, PDl was shown to fee effective against a broad range of E. mil Because M. eoE 0157:B7 is present d by a diversity of :geaetie types (33) We first determined if the PDl phenotype was effective against die. representati e panel of strains, S^ i^.T«pi e¾ ttti - «>viii^bia§ed and eliniea!-btased genotypes (33) from, both the U.S. an New Zealand Were highly susceptible to the PDPphenotype . ^' with an average reduction >5. log compared to the poptdattOn for their respective monocultures (Figure 1% Three strains of coli 026 were also tested, and similar reductions were found in population numbers (Figur 11.

EXAMPLE.3.. Five/dead staining indicated that, PDl is bactericidal

Jn. this example, Pive ead staining indicated that FDI is bactericidal. Although susceptible cells show a substantial reduction in their CFii/:ml following competition with PDl ^* strains, it was not clear if the effect Is bacteriostatic or bactericidal. Li ve dead staining was used in eorrjnnction with flow-cytometry to address this questio using £.. cok~2$. and i¾; coli 01.S7 H7 gakaj. in mono- or co-culture. The percent of dead ceils detected from the two mono-cultures as 0,50 ± 0.06% and OJ 1 ¾ QM%, respectively (mean ± SEM), When eo- cultured for six hours the percent of dead cells inc eased to 1 ,27 ± 0,09%, consistent with .killin oF ? cob: Oi5?:PF7 Sakai. When this susceptible str in was eo-e oitiired with, a PDF strain: ύαϋ-8), _: the percentage of dead cells was 3 * 0. 3%, These results, which were based en 3 independently replicated assays, indicate that PDI functions by killing susceptible cells,

EXAMPLE 4, The mierocin-eneoding gene cluster was identified

hi this exaropk, the microera-encoding gene cluster was identified. In addition, to fire two Df .strains, E. -c≠i- 2 was identified fr m earlier work (16) as geneticall imilar (no differences) to £, ωίι-25 based on XfoaT maeto-restt etiori, pulsed-fie!d gel electrophoresis (PFGB) profile (unpublished data). Despite having a comparable genetic prgSle, E. co ~Z2 does not express fhe PDI phenotvpe. Genome se uencing of these two strain allowed an in- depth comparison that identified one relatively large region of sequence dit¾ence that was located on a large, plasmid m .£ CQH-2 . Although evious work using a different method: did not detect the presence of plasrni s in M, ίί~25 (32), _. these results were verified by p½smid purification (14) a subsequent. Southern analysis probing for ^: mepA .(data, not shown). PCK amplification Of the PDI icons ( rimers available in Table 1) confirmed this, region, i present in tie PPf strains E, c B-25 and & <¾>&-264, but not the FI strains E. co/i-6, . coU-U, or £, αάίϊΛΜ.

The B, U~25 hiel ! microem-oonraining plasahd is 98,809 bp with a 6*€ content of 49%· and a codin density of 88%. Annotation of the! 32 coding se ue ces revealed that most of the piasmid content is devoted to genes involved in transfer, including a tm- s stem and. a pit system, or encodes proteins of un-knowa function. The novel region of interest is a locus of approximately 4,800 bp thai encodes five genes (Figure 2). Two genes, winch we have designated m pB m4 mcp , encode homology of HlyB and HlyD that are known to be the structural components of a microcin. transfer system, along with ehroniosoniai!y encoded toiC (?, 10, I , 26), Me A, which contains a CaaX protease domain (:PF02pl.7), is-.thowght. to. be the "activity" protein that processes the. microcin, encoded by m pM, to its raatnre _: form pjfiortp. -tmnsf^rffoifx) the cell.. mcpl likely encodes an immunity protein. This, novel seqsenee was also found in a recen GenBank submisskn of E, c li I EC.1QF (Accession A101101000076; version: A1GU01 0QQ76.1 Gi;37 229i,¾ incorporated by: reference herein, in its entirety);

E AMPLE 5. Knockout itmtatians froth E, coIi-ZS blocked PDI

This example shows that knockout imitations- from E, coU-lS blocked PDF Four of the five putative mierocin genes (Figure 2) were individually knocked out in E GU -ZS to

3.3 analyze their ^' rote in FFJI The m ^' cpJ gem knockout was construe ted as a double knockout, imcpM ^' &mcpL Each region of interest was replac d with a kanamyein resistant cassette and verified by PGR. fo the correct insertion site. Subsequently each knockout ^' mutant was put into competition with the PDF E: coliA 86 to determine whether the deletion affected the FDf phenpiype, CFlf counts followin co-culture in M minimal media showed that E... c^M d was greatly inhibited by E. coii~2$ but was no longer Inhibited by the -&mcpD. &mcpB, ½φ¾ AmcpM&mcp and A A mutants (Figure 3.A > C n ersel , each mutant ^' was also competed with E. εβΒ-2 to determine how each knockout affected immunity to Di (Figure SB), Only the AmppM and A pMA pi strains became susceptible to VDl indicating thai the other knockout sta ns retained immunity. B¾mun¾" was full restored when mepl was complemented back into tho Amup &mcpI strain, verifying thai th s ge © is required for resistance to-killing- by ,P 1 ⁺ strains (Figure 3B), Expression Qi mcpi m a FDl ^' strain -doe no confer immunity, indicating this gene alone i$ insufficient to prevent inhibition from the microem (data not: shown);

Class Π rnicr cins are typically secreted by a XI SB m4 he presence of me putative ABC transporter and membmne-tusion genes, mepB and- mepD, is consistent with, this st !cttne in £. mHi~2S. These secretion sys ns require co-expression of. a ehromosoraally encoded TolC on the eel! surface (7, 10, 18, 26). Consequently, 4 mtC str in was constructed . and this disrupted the ability of £ c f-25 to inhibit coIi-.ίΜ (Figure 3A.} But it did not influence Immunity: (Figure 3B) ^' . These results are consistent with the requirement for a TI SS- for PM functioii. To verify that the ene: kn ckout procedure wa hot producing artifacts, a gene deletion i an unrelated region of the plasmid was also generated; As expected, deleting tr ^' M did not affect inhibition or immunity (Fi go re 3),

EXAMPLE .6; Transferring the PDI plasmM to a non-inhibitor E, mli contad the inhibitory phenoty e

This example shows that transferring the PD1 plasmid to a non-inhibito £. ceU conferred: fi® inhibitory phenotype. Although the above knockou mutants verified that the genes involved ith PDi bad been identified, it was desirable to confirm from .the mutants that all the genes uqne. to PDI. were included on pPDL Generating the ftdf mutant in E. coti-lS provided a selectable marker on. pPD.I that did not interfere with the PDI pirenotype (see above),. Following transformation with pWl&ir&M, £. coU-4 acfuited the ability to inhibit susceptible tr in^ an immunity to inhibition by E. c i-264 (Table 2).

Table 2 shows competition results of wild-type Eicali-4 and: E. cMi-4 carrying, the P ! plasmid verifies: th PDI genes are present on. the plasmid. CPUs of PDT E following- co-culture with wild-type E. coliA or E. oii-4 + pPDI verifies the plasmid confers the mhibitoty phenotype. Inmiurni ta- FDi is also maintained on the plasmid, as indicated by- the ability of £ m -i- HM to strrave co-culture with fixe PE>f strain E. -coti-264. Results are expressed ass log CFfls/mi. ± ^" the SEM «F3 replicates.

This data indicates that -all the PDI-spseifk? genes ate present on pPDL Nevertheless, there is a possibility that, other, e oniosomaliy-eneoded ^' .genes common to E. o¾-23 and £. coii~264 re involved with FDI x ressi n or function.

Table 2. Competition resn!t of wild-type £.eoii~4 and ti- sarrying the ^: PDl plasmid versified the FDI genes are present on the plasmid,

Lpgif)(C i)/nd

Competition

£ ^' . coIi-4 Competitor

:E !i-4 i Vi vs. .£ i¾iii-i 86 (PDr} 8,83 ± 0.05 &. 4 ± 0.06 vs. f: c h-lM (PDf) 4.70 0.28 9J4 ± 0.02

vs /·: 86 i ^' PDH *λ ! 8 ι 0.06 4.0.3 ± 0,6 i

vs. E e /j-264 (PDF) .8.88 * 0.03 S.?6 ^ 0.02

EXA PLE 7. The PDl MtcpM piasnwd ^: was s own to be §e3f rah¾hussible

This e-x-ample shows that the PDl AritepAf plasmid. is self-transmissible. Kilter m tin experiments between the &mcpM mutant, and E. c li Κ.-Γ2 showed the PDl plasmid is mobile with a conjngation efficiency ranging between 4.81x10 ^' * and 3 ^' . ^' 66x1.0 ^" *. Plasmid profiles of K12 Katf" verified the presence of a single phstni of -1.00 Mb,, consistent with the PDl pksrnid. Another, serie of conjugation exper nrents between the K 12 fransfomiants and. is. U't) cortfiprffid that the plasmid. is seif-transrmssiblo. Using this assay corn ^' ligation of tiie PDl plasmid was not detected when there was a ftirsetional. mierocm. system, presumably because reci ient cells are killed,

EXAMPLE 8. The kinetics of the expression of mcpM were determmed

This example she s the kinetics of th expression of mcpM, Expression of the PDl phenotype has been observed throughout -Jog-phaSe- .-gr th, but this ilineiian appears io _: subside when cells enter stationary phase (32). This earlier work was limited by the analyile sensitivity of ^' the phenotypie assay and thus better describe the kinetics, of mieroeirt sxpfessiotr we eippioyed a quantitative PGR assay. RT-qPCR data confirmed that expression of the mierocifi increases rapidl during ^' the log-phase growth and drop off rapidly in stationary phase (Figure 4>.

EXAMPLE 9. cD A sequences and protein sequences fo niepM, nicpl, rnepA, mcpD, and raepB were detenpined

This exam le shows the cDNA se uences an protein sequences encoded ^' hyme-p f, i pl _? m<.p:A:, mcpD, and mep.Bi

(SEQ ID NO ^' S: 23 and, 24} e ^' DNLA seqpence and protein sequence Ibr mcpM

ATGGCA AT TAAGAGAATTAACTTT AGAGCAACIXi TAAGGTGGOCCCCGTAATG

ACIXXIGTCGAAACGCACGAACTCATAIITATAGTC

GCTAACGCTGTATTTAGTGGAATGATTGGTGGTGGGATCAAAGGAGGTCCGATAG GAATGGCAAGAGGTAGGATTGG GGAGCGGTTGTTGGTCAATGTC TGGTAGTGGAAATGGAAGTGGTAACAiXAGGAAGTTGGAGTAG^

TAATOTT ^' GGCGGAACATGTAAGGGATAA

MAN ^' I R E L T L I)E I T X V S G G N AN S H F E G F R N D R S S G A RN SL G R N A P Til 1YSDPS T V K A A V F S G M i G G A I K G G P 1 G M A κ G i f G G A V¥ GQ C 1, S D HGS G NGS G N RG S ^' S S SCSGNNVGG T C N R Step

(SEQ ID NOS:25 and 2 ) ο.0ΝΑ. seijaence and protein sequence Tor mep.l

ATGGAGGGGGCT CXmGTTTAXTAAAlT GTm

GGGA.TTTGGACTATTGAGTGGGITXTCTGTI'ATTG

CTlT¾ ^' ^GTrrrCA CIATI¾TA

rfCAlXjGA(TAmTCATAGAAAAAAXAAGAACAA ^' fCl :CGCGAAAmG

M G A T M P Ϊ K . X S P ί C G X X, L G E A X !, S G S S V I X) X, Y F S I, P S E E S K I V V M L ί T L F S T A R F M D Y 11 E K.I R T I S A K. Stop

(SEQ ID NOS:2? arid 28) cD A sequence nd protein sequence :for mcpA ATGAATGAT;AACA:TATATAA

XXGXTGTXAXAXGAACAGTTGXGAXAXl^ACACeGG

GQTT KSATcrra^

AlTi ATATT TTTAGTlAAGAAGAAmCCAGGTrGIAAAATCAGCAXAAAGAGA

AAXGCGAAAAGA1 AAAGCTATIAGXAAXAXCATXXOT

AAXTGGAXrGAAAXAXXTAXACXGGXCGXGACAGTiX ^

TXTACCGAA£:ATGTCXATTCGGTCXTCXATGI:A

AcCeCCXGCGTCTGXACAXtTXTAiiTltCXG€CTGAXG

GTGGCTGATCAAAXTATTCXGTITATXAXGXCAATOl ATro

TTGGA XAAGGGOATrrrCXAXCCAAXGCIXrn ^{^} ACATGCGGG A

GITAXATTGXTAAAXAXATTAmG:

MN P NIY YS K D A ί A. F L L L V V ί S X V V I F T P A P TI Q Y t: G !. D !. A S V.F 1 XEXL M S T S F Y Ϊ F Y L R LP G C K I X I K TN A I I I X L V I S F A

V I L M 0 L Li F A Y R D N l. N S E S X S L.N W I E 1 F Ϊ I. V I, T V P Y Y E E 1 V

Y R T C L F G L E C X X Y K K E L F X F C V C T 8 L X F C I, M H p Q Y Y N Y A D Q i I, L F ί M. S M. L L L N 1 R ICS.K G ! F Y P M 1.1, H A Ϊ G F Y I L L N I L Sto

(SEQ ID HQS: 29 and 30) cD A se uence nd protera se uence far ntcp

A'rGAAIATATXCACMAGTGAAGGAAXAGAACAlXATAATGAGACXGAAl ^' A ^' I ^' GGI ^' GACAl ^' TA1TTIAG€AACAXCAT3TAG€CXA:ICX FrAT(rrGCAACAG ^: ri¾GAXXAXT CArFAXGTXAAGTCXG GXGXAXXCAXAXATXAGGG^

CAXGrrACAGGrAXCGXCAXGCXOT

AXGCACKIATARCRIAA€ACAACXGACXGTATX;CGAAGGAGAA€AGGTAACTGCA G

GGACACAACTCXAXCAXAXAAGXGGAGA CATX^

CATFAGCAACGALBAGTATTRCCCXGAAGAGTCAGXALALXA GT

GCAAXCC7TIX3AGXCGC(IAGAXAAXAGXCAACAACAGGAAGCGATACGC5GAAAG

GATCIATATCACITGAGGCGCAAAXAAGAAGXGGAGAACAAAGACXTCAC ^' L GG

1¾AAGGXGAGGGAGAACTGGGTAIA:I ^' CGGXCATGGAACGGIA1A AAAA7XG(} G¾TACGCA lAlBX :I ;A(3 IA CCiAArrc ^^

GCGGCTGAACAAAAGGTimAGAl€AG€Gl ^' GAGGGGGT ^' rcXCCAGXTAGATAC ^' iG CAAXGGACAGA CCAAAGATGAAeXAAATCATCiTArrGTTCAGGGGAAAAGGC GTAAAGCAGAACTCGAeAGACAATTCCAGGTGCTAAAACAAeAACAGGATGAAC TGGCGGGA:CAAGAAAAATTTA:GAGXGAGGGCTCGAGTATGCGGeA:CT TTCCTGC TGTACTGATC'AAACAGGGGGA:GTCTGTGAAAGCATi:;TGAAGCGGTGATGACTCTC ATTCCCGAIAATCGTCATT^

GTITI'ATGGGACCAGGTGAACGGGTATCTGTGAAG ^{^} ^ ^{^}

ClTCCOACrTATiy^

TCGCGTTATTGTTGAACCTGAAAATAC rTA

CCGCTAAGAeCAGGCAIGACTCTGGAAGGAG

TATGGGAATGGCTXMCAGAGCGGCTATC ^{^}

M N 1 F R. S 1 ^; . AiEH H N Γ ⁾ T EYGDil L P T S F L S V G A T V Ϊ 1. F 1 M L S 1, J

V IYYGS Y T R K A. H L ! G I V M P S S G E V K 1 ί P Q Y AG Y ^' V ^' TQL T V S £ G E H T A G I Q _. 1 V H I S G E H Y N G HGT G T L TMS f S L T Q Y I M L A. S Q Q S F E S RO S QQQEAiRQ KM I S L E P Q I R S A E Q !i L Q L A E R Q A E L A I S VME R Y K K I. A G T it Y V S DT F Q Q K. Q I D V S A A Q Q H V E D D R Q _. G L T, Q X H I A M D T A D E I N M L ί V Q SR. A B L I> R Q L Q Y 1 K Q Q Q E L G Q E K H T L K A E ¥ S G T ί A A ¥ L 1 K Q G Q S V K A S E P V T L I DK A H I, Q I E I, Y A T S Q K A G F I R F G Q R V S L K F S A F P: YQK EG I G

Y G I Ϊ R K 1 S H T ϊ I, A F S L T. PVS P Y T W E N E G H Y R ¥ 1 ¥ F P E T F I FAY6KKBP L R V G M T E E G D V E E> T R H L W E W E T E P E W S M K G N LMvp

(SEQ ID NOS: 31 and 32) cDN A, se uence and protein seguei e fot mcpB

ATGGAATCAATAAACTGGAAAGTAAGGAAACAACmCCCGTTATCCGTCAAACC ^XGA CTC ATGC TCTO^

TYl AACAf TTFATC ACA^

GACGGTACAAAGGTrGATCGAATCTGCAGCGlGCATCCAlTrAIGA ^' I ^' GAGGTGGA

GITCCGC GGAACGGGAAGATCTGAGG GTCI AATCI CCATC A TCTGGAGTG

GGATATGAACCATITCGTCC^^

GATGAT€CGGACAGAGGAAAAATTAX3AATA

TTXACAGGAGTGGC ACTGG ΑΑ ^' ΓΤΑ ACXGG AGGC AGTGATTXC AG GCCCCGGA ACG AGAGAAAAAAAT€GACCTGGGTGAAC GA€AGGGAAAACGGGGGGGGTTrrAGC AlXX ATCACaAAAAT^

ai ACmxTTAATCAAGTC(}m TTGATGAA<rrTC (5eTC(iCAGCA(}ACA«AAO TGTA TCTARJTCATTATAGTGGC

TCTCGCTAGGAGGACAATGGGCAAGGATCAGT RATCCGTCAATITTAACA GCA

ATGGACTGCCAGAGTTRRCCATCAXGTTGTAAGACTCCCTOT^

GGCGAAGTAAAGGAAGLA TAATGCCCGTTTRGAAG(;AGLAGA A AATGCAGE.

AGGCGGTGACAACGCAGG ^' RTGTTGAAGGGARRCTGGA ATGCTACTTATTC GAG

TGGTCTTTGEATGATGCTGTTOTAXAGGCCAGGAATGAGA!TTAATGGCAG AAT

GCAGCTATXAXATAXGGCGCACLX GAGCAXTGTGG

CTCXTGAAGAIXJXGXGGGATGCAGGAACRAAGGABTC

CCCXTAACGGGAXXXAGAGTCXGAGAAXC ACGGXGX^

CGGCCTGGCTGAAGCI AACGTTACCGGCAGAAACACACAGGTACGGCAGAAIT; TTTACAAATGAGCTATGAACTGACG

CATRATTTLG GG€AGGGAGGAGTAGAAGTGC1¾GATGG

AXGTIXJGTXGCTTACITATCCTATC

GAGTGATAACfl Tl¾CCIX¾

AI¾I GTGCIAACACCACAGGAABGTCACGAGAA:TGAGCACCAT^

ATAAI XAAACAAXATCTGCAAGCC AIX^ACCAXXACTXAXX^GaAAAAAXAACAm

CAlA TGGATAACGCGTGACXAATOCi il ^' TCClGGAGAAAmiTAGCAATAACA GGTAAAXCAGGATGTGGCAAATCAACA^GGTAAAGCITATTCTTGGAA'nrATA CAGCAAGXGAAGGAAGAATXAATGCAXTIX GCATACCAGATACAGA^ ^{^}

ITTTGAGGrrCGTCAACGAATIXKICAC^^^^

GGTTGTATAGeTGATAATAlAATGTTTI TAGCGAAATTAGAGATCATGAACAGA

I ^' GGGTAAATGCGCAAGTC GGACTmiAGACAGlGAXATtATGGCA

GG ^; C) ^: CTAXCAACA iACTTGC ^} AGAAACC KjAGG ⁽ :iGG:A

CAACGIArCIACTGGCAAGAGCACIXjXATAAAAAACCCGGXCTATM

ACGAAGCAACOAGXCAXCTTCATGTGGAAAGIXIAAA

TACGCCAAClXGGAXTCCIGXTCXGTTA^

CCl'GCCAGAAC1X^A¾ATA¾AAfAATCACCGCAACAGGAGGI'GA

M E S ί N W V R K Q X F V I R I ESAECGLACL A M I AC WHO L X D L. S T L R E F I I Q G M. T I, Q R L I EX A A I K i, S S R V t. L E P E D L C L N L P S t L H W D MH HFVVLH VRG N I Y ί H Oll G 1 T ! S ί . i .0 Λ G K H F T G V A E EL TFASD ^' FTP NERK IH L R Q P T G K TP 1. L A S MT lilFA L A I, E 1 LA L G GP I, LMQLVIDEVLVA ADR S L L Y VI i V A I, L I, L S L I Q LFL S L A R Q W ATI ^' S L SVNFNMQWTA ^' RV F H H L V R L P L A W P D A R S K G S EN A F E A V D ί 1 Q Q LI Q V L E G I L i) M L L 1 VTALC MLL Y S P G M T E I A. VI A API Y G A ERA: E W Y P A L JR. Q S V E D V W D AGT BSGH L FT LN G IQSL i NOV T I FI R E A A W L N L N V ! R R N T QL QNRLQMSYELT E T L T F. S V V S A Π L W Q G A V E V LD G TP TVGMLVAYLS Y Q M RF SSSISML T P N F F S W R MXDVY N E R LAPIVL PQEG HQ NQ H H WAN K N E ^' PIS AS Q Y E H YDNT HP P L L 1 E K IT F S H K G A D P I E P A S L LF P EI L A.J G K S G C G K. S T L V K L L G 1 H T P S E 0 R I A F G 1 P II T H S D Y F Q V R R 1 G T Y LQDD Y 1. BIG SI ADNi FFSElRDHE H M R KC A S L ALiDSDIM AM P M G Y S 1. L G E T O G G L S G Q K Q R J L L A R A..E Y K R P G L LL L ! E; A T S H E O V E S E I E I. S Q T E R Q L Q FP VI E ί H R. P E T IASA0R VI Y L R D Gli F S E I T Y R P A T H N Ϊ N N H P N R R

EXA PLE ^' jfCf. Seque ce for plasniid cQtfteinmg the unique 4.8-kb opera st .region that is present in Ρ0 strains but not FDf strains (GenBank accession.; JQ90.!381)

This sequence for the pk&fmd eorrtaiinrtg the uni ue 4.8-kb ^' operon region that is present in ΡΡΓ strains but not PDF steins was ^' determine (GenBank accession JQ ^' 901381) antl is presented as SBQ ID NO: 33. The .region covering mepM _^ mcpLmpA, mcpD, and. tMpB- is presented as SEQ ID NO: 34.. ^' Within SEQ ID NO: 34, the nucleotide postions of individual o eroii components are as follows: mepM (41253-43442); mcp.i (43443-44695Ϊ; mcpA (44798-45433); mcp.D (4543S~45654); and mcpBi$5663-46QZ6). iFERENCES for Ε ΜϊΚΟϋΜϊ aad EXAMPLES E!O

1. Adki, S. R, Panii-na, A. P. Hemday, J. E, Btekham, E, A. Braaien, arid D. A. Fo .

2005: Science 309: 1245 .

•2, Aseasio, C„ and J. G, Pei'eK-Dia , 1976. Bioc er Biophys Res Corninon 69:7-1 .

3. Bullock, I.0. _; . $. Co , I R ^: . Dankert, and W. A, Cramer.1983. J Biol Chem.

258:9908- 12,.

4. Dassanayake, R, P., D. R. Call, A. A. Sawant, N ^' .. C, CasavaiU, G€. Weiser, Γλ P

Knawles, and S. Srikutnarah.2010. Appl Environ Microbiol 76:1008-13. 5:, Bs&enkcK K, A. _» and B. L« Wanner, 2000.. Proc Nati -Acad Sci U S A.97:6640-5.

6, DM( esfts _? S., D, De¾tou»i:ie x-Ga«zoii, J. Ped«2¾ and $. Re aiist 2007, at Prod fep 24:708-34,

7. Ga¾ge , C, . Moreno, and M. Lavrna.1993. J Baclerioi 175:5430-7,

S, Garrido, M ^: . M. Berrem, R, KoKo- ami F. Moreno, 19 SB; EMBO .! 7: 1853-62,

9. Genisenev, L, G Dietrich, a W. Goebci.2002. Isiftds Microbiol I0;:39-4

10. Giisoft, L, H. K,,Maharit; and R. Kftlieiv 1990. EMBO J 9:3i:?5-S4.

11. Gratia, A.1925. C. . Sec, Biol laris) 93: 1040 J .

I 2.. Hanahah, D, 1983. j Mol Biol 1 :SS7-S0.

13. Hardy, , G, G: G. Meynel, J. E, Do rnan, and B. G. Spmtl 1.973, Mol Gen enet 125:217-30.

14. a o, C i _s and S, X Liu, 1981. J Baeieriol 145:1:365-73.

! 5 , Ka aniuni, X 1 9 . $.msha Byori 45 : 86 S-S .

16 Rhaehatry an, Λ. R, X Besser, a d D. R, Call .2008 ^■ Appl Environ Micmsfeioi 74:391-5.

17. acha&yarl, A. R., D. D, Hancock, X E. Bssser, and D. R, Call.2006. Appi Environ Microbiol 72443-8.

15. Lagos, J M. Baeza, G Commi, C, E , E. Strafasbnrgstv j. A. Castillo, C. Veruiita. and O. Monasierio.2001. Mo! Microbiol 42:229-43.

W. Lederberg, J., d E. L. tatara.1946. ature i -58:558,

20. LemOBnier, M., B, R. Levin, T. Rorseo, K, Garner, M. R. Baqaero, J. Mercanie, E, Lemicfeez, F. Baquero, and J. B!a¾q)u¾¾.2008. Proe Biol Sci 275:3-10.

21. Linton, K, J,, and C.,F Miggins.1 98. Mol Microbiol 28:5-13,

22. Lwoff, A.. _s F. Jac b, £, Rife, arid M. Gage.1952. C R Hebd S a ces Aead Sci

234:2308-10.

23. Martinez, M. C„ C. lAzdu sM, andX. Pattus.1983, EMBO J 2:1.50!-7

24. Nomam,.M., at)d M. NakamisTa.1.962, 7:306-9.

2 . Ohno-lwashila, Y., ami K. i Uoti.1 82, J Biol diem 257:6446-51.

26. Pons, A. M., F. Delaiande, M, Buarte, S. Beaort I. E nnsiue, S, Sable, A. Van.

Doraselaer, and G. Cot jceau, 2004. Chemother 48:505- 13;

Zl I¼sley, A. E, aad S. X Cole; 1 86. J Gen Microbiol 132:2297^07.

28.. Reeves, P 1965. The Baeieriocms. Baeterioi Rev 29:24-45.

29. Riley, M. A., and D, M. Gordon.1992, J Geft Mieffibio! 138: 1345-52.

30. Riley, M. A.. Y iS and J. Wa 1.994. Pros Nati Acad Sci BS Α?1'Λ 1276-80, 31. Riley, M. A., and J, B; Wertz. ,2002. Aha Rev Microbiol §6:U 7-37.

32. Sawaat; A- A,, R C. Casayant, I). ft Call and X E. Besser. 2011 . Appl Bnvnfcn Microbiol 7?;2345~$ ί ,

33. Shringi, S., A. Garcia, . K. Lahrners, K. A. Patter, S. Muthupakru, A. G. Swenties, C I Hovde, D. .. Call, I. G. Fo , and T. E, Besser. 2012. Meet ImmuB SO: 369-80.

34. Smareia, J. 1062, Experientia 18:271 -3.

35. Traeblood, C. E., V- k Boyartebuli, E, A.. Pkologiou. . Ra¾e a _s ,c D, Poulter, and i. Rine. 2000. Mol Cell ol 20:4381 -^2.

36. Wiikens, M., I. E. Vilknueva, I Cofre, J, Chnaidmnart, and R. Lagos. 1 97. J

Bacterial 179:4789-94.

EXAMP LE.1:1. Mkroem McePDl reduces the pmvaknce of susceptible Eseheriefaa coii in: ueoiiaial: calves

MscPPl m i crock roducing . coli-lS or the equjvftkgtt knockout strains were eo~ inoeulated into calves with susceptible . <?£> *-! 86 to investigate the function of MccFDI m vb¾. M cPDI-producing E. c<?H-Z5 ouf-eoirspeted .E. i::o ?-186 (P ~ 0,003), c nsistent with MecPDi being responsible for antibiotic resistant c h-%5 competitive advantage in calves. ¾ increasing rev lence of antibiotic resistant bacteria presents .a _. major challenge tor both human and aTvirnal health. High: levels of antimicrobial usage in livestock potentially plays an important role in aniplifymg and retaining antibiotic resistance genes in bacterial populations (6, 7, 13). Nevertheless, even in the absence of antibiotic use resistant bacteria can persist (2., 5, 8). A previous study showed that E. oii strains with .resistanc o. streptomycin,

sulfadiazine, and tetracycline (SSuX) were the dominant E. 'i found in calves t the Washington State University (WS1J) dairy (10). Mixtures Of these SSu & coii isolates, including strain B: eo f-25, demonstrated: a fitness advantage In dairy calves and in broth culture over antibiotic susceptible strains (10). The mechanism allowing/these strains to dominate- m calves was unknown, hut was not associated with antimicrobial resistance traits (0). Recently we showed L coii-25 produces the novel tnicroein, McePDL that is responsible .for killing susceptible Έ. mii isx vitro. MccPDI-production allows e¾?fr-2S to inhibit a diversify of B, eoli, including oiates eiiterohemorrhagic (EHEC) and enterotoxigenic (ETEC) strains (4, 1 1 ). The spectrum of MceP ^' Di activity rrtakes coii-25 attractive as a prohiotie against pathogenic bacteria with potential for prophylactic, therapeutic, and food, safety applications: Consequently, we tested the hypothesis that an MccPDi^roducing i&li- 25At aM strain will limit colonization of dairy calves by the MccPOl-snscepiible E. coiiAM, while McePDI-knOekout s raia E. coii~25&mcpMAmtyl would exhibit no selective advantage in vivo (4),

This study was dotiducted irtihe- large animal isolation facilities at SU r der a SO instiftitloiml Animal Gate and Use Committee approved protocol Calves inoca!ated with the same strains wore housed in groups when possible. Bulk milk was fed two to three rimes daily with one feeding containing 1 tbsp. of milk non-antibiotic containing supplement (.10). Calves were pre-sereened for nalidixic acid-, kanamycin- _s and chloramphenicol -resistan E, ooli using methods described below. If resistant bacteria were detected, the calf was not used in the study Ka am oi " and ehloraniptelcoResistarit & C(?/; ^' -25 mutants were generaied (Table 1 ) to allow the use of calves that earned either kanamyein ar-e ora^phe,mpol resistant flora, fa«t did. not. cany both.. Each calf i 3 days old) was orally inocul ted with lif CFli of each competing B, eofi strain. Inoculum was prepared by pelleting overnight cultures of each strain, resaspeiidirig the cells in fresh LB, and mixing the cultures immediately before moculation. If the inoculated strains were not detected at ne day post-iaoeid.ai.ion, a second dose wa.s;adtt3irxi tored -on day two. Day one refers to the day following the final, inoculatio , The trial include two groups of calves with group one (n~ ) receiving MecPDl. koockoai E. eo Z-SSAmc MAmcpi a idi?: coli-lM and group two receiving McePDi-prodneing C eoM >5AmM and E. eoii 8 >; chance enrol Iment of calves with incompatible antibiotic: resistant flora led to rejection of more calves from grOtrp one.

Fecal samples were collected directly from ihe^re-ctum of each calf immediately ioHowing inoculation (day 0} and each day for; six days (10). Within 4 h of collection ten-told serial dilutions of each sample were prepared in. sterile PBS and plated on MaeCorikey agar to detennirie total colony forming units of lactose fermen ting enteric bacteria with colony ^' morphology, consistent with ^' £ ^' coH. MaeConkey agar supplemented with kanamycin (50 !tg/m!) aid tetrac cli e (S0:pg/mi) _; chloramphenicol (34 pg rn ^' l) and tetracycline (50 ug ml), or nalidixic acid (30 pg/ml) was used to enumerate the test-strains present in the fecal samples. A coinpetitton index (Ci) was calculated to compare the fitness _: f competing strains (Figure 5). PGR was used to confirm the identity of the c U-25 mutants by pairing primers within, the resistance cassette (3) with ioeus-apeciSe primers (Table ¾ n ^::: 368). The putative E. eo ?"l 6 ^T isolates ( ^' ~ 172) recovered fr m the fecal, samples were confirmed by puhsed-ield gel electrophoresis analysis ( 1):, Table 3, E. coti strains a«d. PGR primer sequences used in this work.

At sis -days post-inoculation, calves were eutbanked and five to ten centimeter lengths of & eecii , spiral colon, deseeudmg colon, and reetai-apal junction. (RAJ) were collected. Ail fecal mstfcx was renieved by rinsing flic tissue m sterile PBS. A 6 mm: sterile biops punch was used to. collect a sample and make a ί :T0 dilutio (sa vol) in PBS.■Tire tissue was homogenized, serially diluted., and plated on o MscGonkey agar supplemented, with, antibiotics.

A ^■ previous study wit ctili-!ZS indicated the mic )Ci:u-prod«cin.g strain iS. cali- 25AtraM slioald have a distinct advantage over the. susceptible ^■ strain K coli~\m (10), As expected, b day six, E- coM~Z5 mM dominated £ coiH 86 (CI - 0-22, P ^::; 0.003; Fig. I ). hi contrast, the mierocin- iOefcQnt strain E co¾ ^' -25AtnopMAmcpi ¼3S sigrufioandy less fit than £ co/i-186 (CI -0,95; Figure 5), Notably, different treatment outcomes were asymmetric with the CI for E. &H-25&irnM. (0,22) being a smaller magnimde than the competition index for <;fi) i-23 _: Anlo MAmcpI (-0.95), Tins could possifely be expiaiued by the presence of native MecPDI --expressing strains that would also compete with B coii~25MmM. while enhancing inhibition of the susceptible E, ,ci i~2 rhcpM&rncpl.

if most native E, mii strains are susceptible to MecPDL and if th MccFDI. producing strain ha¾ a fitness advantage relative to non-producing strains of £ coii, then., he .eePM- prodneing strain should be found in greater numbers relative to the total £. coli population. e:enitTHcmte 3. the CPU for the E, coti-25 mutants relative to the CFll laetose-fmnentmg enteric bacteria in the fecal samples. E. co/i-25AmcpMA cpl -aceoimted for <β.2% of the total lactose-ferme iing enteric bacteria by day & whereas £' c&li÷2S raM consistentl comprised >2% of this population throughout: the trial (repeated measures ANOVA, P = 0.01; Figure 6). There was no difference between he to tal number of iactose -fennenting bacteria between the two groups (P - ^« 0.96). These results confirm fte MccPDI-produelag: stotiu has a selective advantage over the non-producing strain in this model

E. cffii was consistently ^' recovered f om: tissues of the lower gastrointestinal tract. ^' iGl). The inoculated strains, however, were typically only detected at eotmts. ist above the detection level, E. coft-23AtraM strain was recovered more frequently compared to E. ii- i S ^' , whereas E, cr ii-%5&mcpMAmcpi was recovered at. a ireqUency similar to the E. mli-l strain (P ~ 0.01 and. P ~ M)S2 _f respectively; paired t-test; Figure 7A and B). There were no: apparent differences in the- frequency of detection between tissues (ANOVA, P ^::: 0.41). These results are consistent with E, coH-lSAixaM having an in vivo fitness advantage allowing better Colonization within calves.

Sixteen arbitrarily selected £ wM from each calf were tested for strain identity. Of calves inoculated with E. coft-25AlraM and B. coE~ \ , we detected the expected strains in 5 and n calves, respectively. We only recovered, th expected, strains froiii 1 of 4 caives for the uon-niicroc in treatment group..

Bacteriocin-produeing bacteri present an attractive means to control p thogens: in food animal production. E. adi^ x reduces, the shedding of E. coli-iM eoiifirming that MecPDI i functional in vivo: Changing the timing and doses of -£att-2S t M may potentially improve the treatment effect because, it. is unknown when or at what concentration MecPDI functions in vivo. Future research should investigate the use of multiple

haeferioeinogenie strains, increased doses, or pre-inoculation of E co//-2.5AtraM to limit pathogenic R edit populations in cattle. REFERENCES ^' for EXAMPLE 11

I .. Broschat, S. !.,,, .0. R. Gall M. A. Davis, D, M S. Ldckwood, R. Ahmed, ahd X E. Bease-r. 2010. 1 Clin Microbiol 48:4072-82.

2. ¾astos-Dane¾ E., G. Gsrbaud, M. igore-fey J ^' . R Laibnt, and P, Courvalm. 1987. Antiniierob Agents Chemother 31 :784~8,

3. Didsento, K. A, and B, L Warmer 2000. Proc. Natl Acad Sci U S A 97:6640-5.

4. Ehersart, L 1, J. R. Deringer, . A. Brayton, A, A. Sawan , T. E. Besse ^' r, and D. R Call. 2012, Appl Environ Microbiol 78:6592-9.

5. Ern e, V. L, D. M. Llvemiore,. P. Stephens, and I, M. Hail. 2001. Lancet 357; 1-325-8,

6. Miiiton.. M, _t -D. I. Hainpson, E, Ba pson, nd A, H. Union, .IMS. J Hyg: ^' (Lend). 9S:??~85.

7. Jackson, Q R., P. J- Fedorka-Cray j. . Barrett, and S. R. tadery. 2004, Appl Environ Microbiol 70:4205-10.

S. Rhachatryan, A. R., T. E. Besser, I). D. Hancock, and D, R, Call, 2006 Appl Environ Microbiol 72:45M.

9. Khachatryan, A. R., D, D. Hancock, X E. Besser, and D, R, .Gall 2006. Appl Bnvnon MifirobWi 72:443-8.

10. ^' $¾acftateyan _s A. R„ D. D. Hancock, T, E. Besser* and D. R. Call. 2004- Appl Environ Microbiol 70:752-7.

I I. Sawant, A- A„ N. C. Casavant, IX E, Call and X E. Besser. -2 J 1. Appl Environ Microbiol 77:2345-51 ,

12. Shringi, S. _; A, Garcia, K. Lahffiers, K. A. Potter, S. Muthupa!ani, A, G, S ennes, C. J. Hdvde, D. R. Gail, J. G. Fox, and X E. Besser. 2012, Infect Immxm. 80:369-80,

13. Singer, R, S, _? . Finch, H, C, Wegener, R, Bywator, J. Walters, and M. Eipsitcb, 2003. Lancet Infect Dis 3:47-51.

EXAMPLE Π, identification of a receptor and associated proteins reqaired for MecPM to recognise and inhibit susceptible E. mil

The £, c<?ii Keio Collection, a single-gene deletion library, was screened for mutants able to grow in the presence of the MccPDl producing stram E, cdli~25< The ek Collection includes individual gene knockouts for all non-essential genes diatare expressed by E, coli strain BW25113, lwcli is also sensitive to FDl. Screening of the full library followed By verification experiments demonstrated, that mutants of ^" tpA _y a pF, dstiA, ds .B, mpF _f or c pR were no longer sensitive to PDI. indicating these ..genes are required for MecPD! function,

MXlBUAtS AN METHODS

St m . and culiiire: ridUm . E. sulfadiaaas , tetraeyelioeE, (SSuTli)] (26), £ colt S-l?, E, c li BW25 I 13 aud the ?. ed/r BW25 ! O. g&ie-deletierf library (Keio Collection, kanaarycmR, Thernlo Scientific) were used n this ^■ study. E. coli B ISIB. was purchased .from the Coli Genetic Stock Geater (CGSC, Yak) and it is susceptible t& antibiotics employed in the current study. To isolate, this strain in a mixed culture, E cou BW2511 3 was made nalidixic acid resistant by passaging 5 times with increasing concentrations until it was capable of growing in 30 μ¾ ι«1 nalidixic acid. Unless stated otherwise, -all strains were cultured in either Lmia Broth (LB ) or M9 Minimal Media at 3? ^a € shaking 250 rpm. Antibiotics were used at the- i !owmg cc centrations: tetracycline (50 μ-g tnl) e!tioramphenlcoS (34 μ|ί¾ιί}, kanamycin (50 ηιΐ nalidixic acid ^' 00 -g/ml) and auipioiihn (100 ug/nii}..

Sci&eftiag the Keio co kciionjor ioss of ^' P ^' Die Keio collection of coii knockouts (Thermo Scientific.) was employed to identify genes associated with susceptibility to ecPDI. Each mutant was grown overnight at 37¾ without shaking in a 9G-weil plate c niainkg 1.50 μ.Ι f esh LB (50 jig/mi kanatnyera) per w-eJ!. A 10 ml culture of.E. nali-lS was also started at this- time- in LB (50: μ-g ml tetracycline) and incubated at 7 C with shaking (250 rprn). The following day each mutant was individually placed into eo-eulUsre with £ in a sterile, U-bottom 96-w .l _. plate with 200 μί 9 minimal media per well. A 96-pin replicator (Boekel Scientific) was used to transfer overnighi cultures GT pi) of ^' each strain for competition, experiments. The. replicator was sterilized 3X between each, use by submerging pins into 70% efhano! a«d flaming. The £: coii-25 culture was oured into a sterile plastic trough and. transferred in the same manner, Competition cultures were inenhated overnighi at 37*C, shaking at I ^' OO rpm. Approximately 24 h later co-cultures (~i pi) were transferred onto LB agar containing kanaruycin or tetracycline to select for the Keio strains or E. cf -2S, respectively. The plates were incubated at 3 C for at least 6 h. Growth on tetracycline- verified the presence of ^' & coii-25 in tire culture. No; growth, on. kanam cin indicated, that the Keio knockout strain being tested was still susceptible to PDi. Growth of a: Keio mutant stein on the -kanamycin plate -indicated putative identification of gene knoelcosis that were no longer susceptible to PDI.

^' Cattipttiti&H- as$a-f$. and enumeration ofre$i$kmt E, ii mutants. To confirm detection of PDi-resIstant strain from the Keio collection,, prospective strain were grown overnight in LB with antibiotic selection. Eac muf at stra n culture was to added (.10 μ\) with £ έοΐί _* 25 culture (10 pt) to 2 ml U9 media. These co-cuihtre were cutated at SVC for 8 to 2 h, To determine tii CFOs of each: strain following competition, serial dilutions of the co- cultures were: repared: in a 96-well plate containing, sterile PBS and then spotted (5 !) onto LB agar supplemented with kauamycin or tetracycli e: Agar plates (3 per enumerated dilution) were incubated overnight at 3 ^' £ and colonies were tallied for total eoiony forming-., units (cm).

PCR verification- of the knockout mutunLw Primers corresponding to sem.ien.ce up- and down- sireanrihe deleted gene (Table 3) were designed to verify the location of fee kananryein. cassette inserti n. Reactions ^ were carried out with an initial denaturing step at 95 C for min, followed by 30 cycles of 95°C for 20; $$X for 20 s _? ?2°C for 1. .min 20 ¾ and a final extension at 72*C iar | min. The PGR products were evaluated using electeop of- es s alongside an O'gene Ruler 1Kb plus ladder (Thermo Scientific) to determine live amplie n sizes. T¾e wild-type (non-niytant) £ cetii X¾W251 ! 3 was Included as eoatrol in addition to. a no-teroplate negative control,

Regen ra tg m iantmuim in £, coU S! 7, To validate tiie findings from the Keio ..library screen, we generated independent mutants in a PDi sensitive strain, jfc c&ti SI?.- The methods ¹ used to create these mutants- were previously described by Datserdio and Warmer (2000; Proe Natl Acad -M USA .97:6640-5) and were die same used to create the Keio Collection (Baba et al, oi Syst. Biol 2:2006 0008). The new gene-deletion mutants were ^aerated, wim the insertion- of chlOrariipheineol resistance (cat) instead of a kanamycut cassette as was used for the Keio Colleetiori. ! ^a C primers were designed to amplify the ^' chloramphenicol cassette from piaamid pKD3 and contained extensio s identical to the sequence Banking the gene of interest (Table 3). g. coli S 3.7 was tj nsformed with the pK∑ $ plasffiid, which facilitaies homologous recombination between the gene of interest and the PCR ainpheon. E, c≠i S17 ÷ pKD 6 was grown.: in. super optimal hroth.;i2% baeto-tryptom .0,5% yeast extract _* $ niM NaCT 2,5 mM RCLJO mM gC¾> with ampidl¾rrsf¾i,0,l M. atahinose to induce the proteins necessary for homologous recombination. These induced cells were then made: competent and electroporafcd with the- chloramphenicol aniphcon containing the requisite flanking sequences. Transformed cells were recovered at 0 ^a C and were plated onto LB aga with chloramphenicol to select tor successful deletion mutants.- PCR was used to verify the insertion site of the: chlorampbemcol cassette (Table 3) using PCR conditions: as describe above.

#8 Gto tk curves. All strains, nclud ng the gene knockout mutants, were, assessed for their ability to grow i M9 and LB media. Growth curves were rati on a BtoSereen C (Oy Gro t Curves Ab Ltd). Each sixain was grown individually overnight in LB media with antibiotic selection. These cultures were used fo inoculate (i; 1,000 ^■ dilution) M9 minimal media or LB broth without -antibiotics. (Mhi c iticuba ed for 24 n at 37 ⁶ C with continuous snaking and optical d nsity (450-5¾(l nni) measured every 30 mia.

Fluorescem labeling and ' microscopy. £. cal 25Amc MAm£pL £. co!i-tS Air&M, and E. coli- IS6 were each transformed wi th a vector expressing cheny red fluorescent protein (pFPV- tftCherry) or GFP (pFPV25). Competition assays (described above) ere, conducted with, the ftuoTeseenily labeled cells; one with ; ccPDI-produciftg £. cvli-2$At&M 4· pFPV-niCherry and DI-susesprible £. mliA 8 i? ÷ pFPV35, and another with MccPDl- nonpr duemg mti~ 2SAnrcpM.¾mepi + pFPV-nrCherry and FDLsuseeptihle & coU-lM ÷ p ^' FPV25. Additionally, these competitions were repeated where each strain earned the opposite piasmid to ensure the results were not caused by either strain: differentially expressing, either fluorescent protein. Individual cultures were run as controls. Each culture was visualized, at 24 h using a- fUioressent scope at 60x magnification.

RESULTS-

Six E. ωίΐ mutants in tiffi Keio Collection were -resistant to FUI. The single gene deletion etili mutant library, called --the Kei Collection, was used, to identi y: genes putativeiy associated with Msceptihiiity to ee DL Approximately- 3,985 mutants were screened using a high-throughpu 96-wfeH plate method. Following two rounds of screening using these methods, six mutants were identified as potentially being resistant to inhibition by E. c i-2S. These mutants were then piaced into a 2 ml competition experiment (M9 media) with K ceH-25 and CFUs were: ubsequently enumerated afte 2-4 h co-culture. Mutants that were able to grow to a population density >! i CF1J wore considered resistant: t PDi and these included, the mutants with a deletion in a}pA _t . aipF. dshA, dsb . _y ompF, or :omp.H (Table 4).

Table 4-. Gene-knockout mutants that are no longer susceptible to killing by £ eoli-25. PC prime sequences ^' amplify the gene of interest atid were used to verify the specific k ockouts, The.CFLTs represent the average of triplicate, eompetifion assays.

■ SBQiDNO: 57) regulator for- ^i! £ . call S3? gene-speeifie sequences, are shown. Par gene deletion mutants, flanki ng sequences also inclu ed the ehloramphe eol primer site:

TOTGmGGCTGGAGGTGCT Ca (SJ¾iD ¾ 60) ^f the £. -cvii Sil specific sequence. ^b -E. coli-25 gene-apeeiic se tience.s are shown. For gene deletion mutants, flanking ^' sequences also included ihe .chlommphenie l primer site: CATA1X3AATATCCTCCTTA, (SEQ i O: 6i 3 ^r to t e E, coH Si 7 specific sequence;