NOVEL NUCLEIC ACID MOLECULES AND THEIR USE IN THERAPY Cross-reference to related applications

This application claims priority from Swedish application 1750774-0 filed on 19 June 2017, which is incorporated herein by reference in its entirety.

Technical field

The present invention relates to products and methods for therapy using nucleic acid molecules, and in particular in relation to treatment of alpha- 1 -antitrypsin deficiency. The invention also relates to pharmaceutical compositions comprising the nucleic acids and/or delivery vehicles comprising the nucleic acids, and their use in manufacture of pharmaceutical compositions for use in therapy, such as treatment of alpha- 1 -antitrypsin deficiency.

Background

Alpha- 1 -antitrypsin (AAT) is a 52 kDa glycoprotein with a half-life of 4-5 days in the serum. In the lungs, wild-type AAT inactivates the neutrophil elastase that, if active, would degrade lung parenchyma proteins and connective tissue. The function of AAT is not limited to the inhibition of the elastase from neutrophils, pancreas or bacteria. AAT also neutralises proteinase-3, myeloperoxidase, cathepsin G, a-defensins from neutrophils, chymases and trypsinases, granzyme-B from T lymphocytes, specific kallikreins and the coagulation cascade serine proteinases plasmin, thrombin, urokinase and factor Xa. It has been suggested that AAT may have several anti-inflammatory and tissue-protective properties by reducing the expression of leukotriene B4 and pro-inflammatory cytokines tumor necrosis factor-a

(T F-a), interleukin (ϋ)-1β, IL-6, IL-8, IL-32 and monocyte chemoattractant protein- 1. AAT inhibits caspases 1 and 3 protecting lung alveolar and endothelial cells, pancreas β cells, cardiomyocytes and skin fibroblasts from apoptosis (Serres and Blanco, 2014). 80 % of AAT is synthesised in the liver and additional amounts are synthesised in monocytes, macrophages, pancreas, lung alveolar cells, enterocytes, endothelium and some cancers. The total amount produced per day is 34 mg per kg bodyweight per day. Only 0.5-10 % of AAT reaches the biological fluids, e.g. the alveolar fluid.

Mutations of the AAT-gene are linked to the hereditary disorder, alpha- 1-antitryspin deficiency (AATD). AATD is an inherited condition affecting both lungs and the liver. The disease is caused by deficient variants of alpha- 1 -antitrypsin (AAT), thereby limiting their protective and regulatory activity against tissue modifying enzymes and inflammation.

In the lungs, wild-type AAT inactivates the neutrophil elastase that, if active, would degrade lung parenchyma proteins and connective tissue. In patients with AATD, the protective function of AAT in the lungs against neutrophil elastase has been lost and patients may develop emphysema of the lungs by middle adulthood resulting in a marked decline in lung function (Kramps et al, 1980). The patients are severely limited in their quality of life and need life-long inhalation therapy to control their respiratory disease. Ultimately, the patients require lung transplantation to survive. The liver-associated variant of AATD affects a minority of disease-carrying individuals and may exhibit elevated liver enzymes and hyperbilirubinemia in newborns (Sveger 1988). 15-19 % of patients over age of 50 with a history neonatal jaundice will develop severe liver disease (Cox and Smyth, 1983).

AATD has a high prevalence in Northern European countries occurring at one per 1 : 1500- 1 :3000 individuals (Eriksson, 1965). Once AATD is suspected it can easily be diagnosed by serum blood samples and genetic testing. The most common deficient variant of alpha- 1- antitryspin (AAT) is the protease inhibitor PI type Z (Pi*ZZ or Z-AAT, where both wild-type Pi*M alleles are exchanged with two Z alleles) containing a Gly342.Lys amino acid exchange. The mutation causes conformational change leading to abnormal interaction between Z-AAT monomers that can aggregate to polymers in the hepatocyte's cytoplasm (Carrell et al., 1996). Non-degraded accumulated Z-AAT polymers not only activate the proteosomal and autophagy degradative pathways (Lawless et al., 2004; Hidvegi et al., 2005; Teckman et al, 2000), but also inflammatory pathways, leading to chronic hepatitis, fibrotic remodelling of the liver and finally end-stage liver disease (Sveger and Eriksson, 1995).

The inability of hepatocytes to secrete Z-AAT dimers further results in lowered AAT serum levels and diminished activity against neutrophil elastase in the lung parenchyma, thereby greatly increasing the risk for the development of lung emphysema. The main function of M- AAT is to inhibit tissue modifying enzymes such as neutrophil elastases in the lung parenchyma. In absence of sufficient levels of active AAT, neutrophil elastase is allowed to breakdown lung parenchyma, thereby triggering the events that cause lung emphysema with time. In addition, Z-AAT lacks inhibitory ability compared to M-AAT contributing to the failing inhibitory effect of the minute levels of secreted Z-AAT.

The most-prevalent AAT mutant alleles are Pi*S and Pi*Z with a prevalence of 5 to 10 % and 1 to 3 %, respectively. Their combined phenotypes differ from wild-type Pi*MM by significantly reduced serum levels of circulating AAT resulting in vanishing inhibitory effect in the lungs. Pi*Z aggregates to polymers in hepatocytes, is inaccessible to proteasomal breakdown and leads to liver disease. A homozygous Pi*ZZ patient has a decrease of serum levels to 10-20 % of normal and has a greatly increased life-time risk of developing lung emphysema.

In patients with two SS alleles (PiSS phenotype) AAT levels are decreased to 40 % of normal levels, but their ability to inhibit neutrophil elastases is not impaired. AAT in patients with PiF phenotype has a severely impaired ability to inhibit neutrophil elastases and may develop lung emphysema.

The most severe cases of AATD are caused by the rare Pi null-null phenotype, where AAT production is completely abolished by frame shift mutation, mutations leading to an early termination codon, splicing errors or deletions in coding regions of the gene.

AATD is not only associated with lung and liver disease, but also with necrotising

panniculitis (McBean et al, 2003). It has also been suggested that intracranial aneurysms, fibromuscular dysplasia, bleeding disorders, anterior uveitis, systemic necrotizing vasculitis and Wegener granulomatosis (Cox 1994; Fearnley et al., 1988; Mazodier et al., 1996; Barnett et al, 1999). Penetrance is rare and symptoms can be efficiently treated with augmentation therapy which is used off-label in regards to panniculitis. In Pi*ZZ, pi*SZ and Pi* MZ phenotypes some cases of AATD related systemic vasculitis have been described. AAT inhibited proteinase 3 is suggested to play an important role in the onset in this systemic inflammation.

State-of-the-art treatment of AATD consists of routine therapy in obstructive pulmonary disease and the augmentation therapy. In augmentation therapy, alpha- 1 -antitrypsin from healthy donors is purified, pooled and injected into the diseased AATD patient.

Unfortunately, the augmentation therapy is costly, non-curative and is limited to patients without strong impairment of their lung function (Petrache et al., 2009). Furthermore, the augmentation therapy does not improve or cure AATD related liver failure and liver transplantation remains until today the only known curative method to resolve AATD- induced progressive liver disease.

Novel therapies are becoming available with the development of gene therapeutical approaches to eliminate genetic disorders. Examples of novel therapies are the administration of aerosols containing purified alpha- 1 -antitrypsin (Hubbard & Crystal, 1990). The application of synthetic inhibitors of neutrophil elastase, of chemical chaperones, of synthetic polypeptides that block Z-AAT and antioxidant therapies have also been proposed to inhibit progression of emphysema development, however, efficacy have not been evaluated in trials (Mahadeva et al., 2002; Parfrey et al. 2004, Burrows et al., 2000; Sandhaus 2004). Promising in vitro results have been achieved showing the accelerated autophagy degradation of Z-AAT polymers induced by carbamazepine (Hidvegi et al., 2010). The development of recombinant AAT has been proposed to meet the need for AAT substitute. However, the lack of or improper glycosylation of the recombination protein by using host species other than humans contributes to inacceptable half-life and immunogenicity of the synthetic AAT (Karnaukhova et al, 2006; Spencer et al., 2005).

Gene therapy is one of the most promising opportunities to favourably modulate gene expression and to cure genetic disease. In common, gene therapy is defined as the delivery of DNA, mRNA, siRNA, microRNA or antisense oligonucleotides into the cells as a therapeutic drug to treat diseases, and it can be performed using various viral and non-viral delivery vehicles.

RNA interference

RNA interference (RNAi) is a naturally occurring gene regulatory mechanism endogenous for all cells. In nature, it is mediated by small non-coding micro RNA molecules that target and regulate the expression of a specific set of genes. Researches have learned to utilise this tool with the aim to downregulate distinct target genes. Various methods have been developed to introduce RNAi mediators. In general, the introduced RNA molecules have to be

complimentary and specific to the aimed target gene sequence to achieve effective downregulation and to minimise the risk of off-target downregulation of genes that share highly similar targeted nucleotide sequences.

Most commonly, scientist transfect target cells with synthetic double stranded RNA (dsRNA). The endoribonuclease Dicer degrades the dsRNA into short interfering RNA (siRNA) of -22 bp in length and siRNAs are loaded into the effector complex RNA-induced silencing complex (RISC). Within the RISC, siRNAs are unwound and hybridize with complementary mRNA sequences of the target gene. The mRNA molecules are subsequently cleaved by the argonaute proteins and rendered useless for protein translation, thereby reducing protein synthesis of this specific gene.

RNAi has become an important tool in gene therapeutical approaches to correct the expression of misfolded genes in conformational diseases. Lentiviral delivery allow the long- lived expression of short hairpin RNAs (shRNAs) from a lentiviral complex integrated into the genome as used in this application. Lentiviral transduction can also be achieved in hard- to-transfect and non-dividing cells making RNAi accessible in all sorts of target cells. In the case of shRNAs. shRNA molecules are transcribed as pri-microRNA, processed into pre- microRNA by the Drosha complex and exported from the nucleus by Exportin-5. Pre- microRNA is translocated to the Dicer complex and degraded in siRNA and subsequently integrated into the RISC to degrade target gene mRNA (Brummelkamp et al., 2002).

siRNA oligonucleotide transfer describes a method in which chemically synthesised 19-21 bp oligonucleotides are delivered into target cells by delivery vectors and incorporated into the RNA interference (RNAi) machinery. In vivo, siRNA oligonucleotides are prone to elimination by endonucleases and immune responses, mechanisms that can be overcome by chemical modification of the introduced siRNA oligonucleotides such as the exchange by 2'- OH groups of ribose with O-methyl or 2'-fluoro groups. In contrast, interaction of siRNA conjugates can facilitate interaction with serum proteins and delivery into specific target cells such as hepatocytes. However, such conjugates can also activate clearing by the mononuclear phagocyte system. In addition, siRNA are small particles that can easily pass through the glomerular filtration barrier. Some siRNA nanoparticle delivery systems may also undergo degradation at the glomerular filtration barrier through electrostatic interaction. Promising siRNA nanoparticles such as Dynamic Poly Conjugates (DPCs) and triantennary N- acetylgalactosamine (GalNAc) conjugates deliver the therapeutic siRNA in the first pass through the liver and are favourable application in liver directed gene therapy. Cyclodextrin polymers (CDPs) have been developed as non-viral delivery vehicles due to their low toxicity and Lipid based siRNA nanoparticles, namely stable nucleic acid-lipid particle (SNALP), are efficiently incorporated into the liver involving an apolipoprotein E (APOE)-dependant internalisation. Liver parenchyma cells are normally accessed by nanoparticles through the miniature fenestrations within the sinusoidal barrier. To enhance cellular entry conjugates can be coupled to adequate ligands that attach to target cell receptors mediating endocytosis and facilitating release from endosomes.

Non-viral vehicles: Non-viral gene therapy vehicles have been reviewed in detail by Ramarmooth and Narvekar and by Yin and co-workers, and are summarised in the following sections:

Non-viral vehicles address some of the limitations associated with viral gene vectors.

Particularly, immune responses are normally not triggered as introduced nucleotides are coated with synthetic coating material that represents an unknown antigen to the human immune system. There is also the possibility that non-viral vectors may deliver larger payloads to target cells than do viral vectors (Pack et al, 2005). However, development of non-viral vectors as clinically applicable tools has been restricted due to their greatly reduced delivery efficiency (Putnam et al, 2006).

Various methods of non-viral vehicles may not be applicable in humans because of the size and the constitution of the human body. Such methods include a) gene gun/ballistic DNA where DNA particles coupled to heavy metals are translocated at high speeds through cellular membranes by using electric or helium gas discharge; b) electroporation, where cell membrane pores are formed by applying an electrical field allowing nucleotides to enter the target cell; c) sonoporation, where externally applied ultrasound waves temporarily render the target cell's membranes permeable to oligonucleotides that are trapped with micro-bubbles, latter being composed of an inert gas and a biological compound such as lipids; d)

hydroporation, in which large volumes of DNA solution are injected within a specific time frame leading to permeabilisation of capillary endothelium and pores in the membrane of parenchymal cells; e) magnetofection, where DNA molecules are coupled to magnetic nanoparticles, injected into the body, translocated to the target site by external magnets, where DNA is subsequently released by enzymatic cleavage from the nanoparticle, charge interaction or degradation; f) needle injection, where DNA material in directly injected into the target cell. Other methods such as mechanic massage or photoporation, i.e. the use of a pulsed laser to generate cell membrane pores for transgene entry, have never been published (Yin et al, 2014; Ramarmooth and Narvekar, 2015).

In recent years, many biological, chemical and synthetic compounds have been modified to overcome the barriers of non- viral gene delivery. Entrapment of therapeutic DNA is obligatory to evade degradation by endonucleases and to improve in vivo half-life. The vectors have to ensure translocation to the correct target tissue, extravasation from the blood vessel through the endothelium, uptake by the target cell and endosomal escape to avoid intracellular degradation. Once delivered into the cytosol, transgenic DNA has to penetrate the nuclear complex to exert its transcription activity. Moreover, expression of the transgene should be continuous. Normally plasmid DNA is used as expression vectors as they do not integrate into the genome, thereby minimising the risk of insertional mutagenesis.

Expressional activity is controlled by promoters such as promoters derived from

cytomegalovirus (CMV), respiratory syncytial virus (RSV) and simian virus (SV40) although these are transient. The use of mammalian promoters such as the human ubiquitin C (UBC) and the eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) promoters demonstrate constitutive expression and are the preferred choice for enduring transgene expression in targeted tissue cells. Off-target transgene expression can be restricted by using tissue specific promoters such as liver specific alpha fetoprotein promoter albumin enhancer-promoter promoter (AFP-ALB). Introduced siRNA, miRNA and shRNA have to be able to integrate into the RISC machinery for effective knockdown of target genes. mRNA molecules delivery by gene therapy vehicles have to be effectively forwarded to the translational machinery in the cytosol for transgene expression (Yin et al., 2014)

Lipid-based DNA vectors represent the oldest form of non-viral vectors. Phospholipids and cationic lipids such as l,2-di-0-octadecenyl-3-trimethylammonium propane (DOTMA), 2,3- dioleyloxy-N-[2-(sperminecarboxamido)ethyl]-N,N-dimethyl-l-p ropanaminium

trifluoroacetate; N-(2-{[N(2),N(5)-bis(3-aminopropyl)ornithyl]amino}ethyl)-N,N -dimethyl- 2,3-bis[(9Z)-octadec-9-en-l-yloxy]propan-l-aminium trifluoroacetate (DOSPA), N-[l-(2,3- Dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl- sulfate (DOTAP) and 1,2- dimyristyloxy-propyl-3-dimethyl-hydroxy ethyl ammonium bromide DMRIE efficiently engulf negatively charged plasmid DNA and mediate transgene delivery. Neutral helper lipids such as cholesterol and dioleoyl phosphatidylethanolamine (DOPE) have enhanced transfection activity and DNA-lipid hybrid stability. However, the usefulness of lipid-based DNA vectors is greatly questioned because of low efficacy in transgene delivery, immune responses, relatively poor stability and rapid clearance from the blood stream. Synthetic cation lipids can be fabricated also as emulsion or as solid lipid nanoparticles. Peptides can also be attached to lipid based-vehicles in order to selectively direct the vehicles to specific target genes.

Polymeric vectors such as poly (L-Lysine) (PLL)-based vehicles condensate DNA and can be used for liver-targeted gene therapy. Cell translocation through the membrane is mediated by the interaction of positively charged moieties of PLL with negatively charged glycoproteins of the cell membrane. However, they are marked by poor transfection efficiency because of their inability to overcome intracellular endosomes and their proven cytotoxicity. The hydrophilic polymer polyethylene glycol (PEG) has been demonstrated to increase circulation times of PLL-baed vehicles by minimising interaction with serum components.

Polyethyleineimine (PEI) vectors are proposed to increase endosomal escape by the buffering capacity of the large amount of amine groups, reducing the acidification of endosomes and their rupture, thereby releasing the endocytosed gene therapy vehicle. Co-polymers of PEG- PEI have been demonstrated to improve vehicle stability and cytotoxicity.

Although mRNA molecules are less stable than DNA as gene therapeutical candidates, they are characterised by their reduced immunogenicity. Their point of action is localised in the cytosol, making the barrier of nuclear translocation obsolete. Specific modifications such as the incorporation of 2-thiouridine, 5-methylcytidine or pseudouridine reduce immune stimulation or degradation. mRNA can also be encapsulated with polymer-lipid formulations and have been described in successful experiments using intramuscular and intranasal gene transfer.

Virus-based vehicles

Viral gene delivery vectors have been broadly investigated and optimised to become promising and efficient tools of gene delivery. Viruses represent an ideal tool to manipulate genetic expression of eukaryotic cells as they naturally possess the ability to enter the cells, escape the endosomal degradation and release the incorporated genetic information into sites of replication within the target cells. Viral gene therapy uses this unique ability and simultaneously modifies viral vehicles in a way that prohibits them from producing replicating viruses. Viral vectors have been successfully used in a number of clinical trials where genetic disorders were corrected. Nevertheless, there have also been misfortunes in which treated patients have died. Various viral vectors vehicles - each derived from distinct virus strains - have been developed with the aim to find the ideal candidate for viral gene therapy ensuring they meet the hard safety criteria imposed in human trials. The ability to infect specific types of target cells is called tropism. Tropism of viral vectors can be limited or extended by modifying the genetic constituents of the virus that are responsible for the interaction with the target upon cell entry. Modern viral vectors are made replication-deficient by deletion of genetic elements and their production rely on the presence of helper viruses or DNA acting in trans providing the missing genes. This DNA can be supplemented either as plasmid DNA that is co-transfected with vector DNA or by using producer cell lines that have been stably transfected with DNA containing the missing information for viral production. Vannucci and co-workers have in detail reviewed some viral vectors suited for gene therapy.

Adenoviral vectors (AdV) are derived from Adenoviruses, naturally causing mild respiratory and gastroenteric disease. Their prime advantages are their low pathogenicity, wide tropism, the high level of expression and favourable features in terms in efficient gene therapy.

However, because of their natural abundance, there is a high level of pre-existing immunity against adenoviruses with common serotypes (Bessis et al., 2004). Therefore, AdV in gene therapy are derived from rare serotypes minimising the risk of immune reactions upon application. Nowadays, third generation AdV allow the incorporation of 8 kb of heterogenic DNA and ensure the production of vectors particles at high titers. However, the expression of transgenes is transient and AdV demonstrate high immunogenicity, exemplified by one fatality caused by a cytokine storm against the injected AdV.

Adeno-associated viruses (AAV) belong to the Parvoviridae family and are dependent on co- infection of helper viruses. When helper viruses are absent, AAV integrate into chromosome 19 and remain silent until the co-infection with a helper virus that ensures completion of replication. On the virus parental strain, the structural proteins rep and cap are flanked by inverted terminal repeats (ITRs). When producing AAV vectors, the structural proteins are provided in trans as separate plasmids while a eukaryotic promoter and a transgene replace the rep and cap sequences between the ITRs. The advantages of AAV vectors are their low pathogenicity, the possibility to infect dividing and non-dividing cells, the site specific integration in the host genome, the low immunogenicity and their wide cellular tropism.

However, the size of the promoter-transgene sequence is limited to only 5 kb and initiation of expression is delayed. The need for a helper virus has until recently been an obstacle, however, necessary genes from the helper virus can efficiently be provided by a separate helper plasmid.

Herpes simplex viruses (HSV) are large viruses that mainly infects skin, mucosa, neurons and B lymphoid cells. Vectors particles are produced in large quantities (1* 10 ¹² plaque forming units/ml) and cloned transgenic constructs can be as large as 50 kb due to the deletion of several unnecessary herpes virus genes from the parental strain. Unfortunately, prevalence of HSV in humans is 70 % and may trigger immune reaction and degradation of HSV-derived vectors in most patients upon exposure. The cytotoxic effect in vitro of HSV derived vectors may be a limiting factor in advancing to clinical application. There is also a risk that HSV- derived vectors may recombine with quiescent HSV endogenous to the host to create a new virus strain that is uncontrollable.

Retroviruses consists of a genome encoding for capsid protein (gag), the replication enzymes (pol) and the envelope glycoprotein (env). They are flanked by long terminal repeats (LTRs) that act as expression promoters. When retrovirus infect the host cell, the capsid is released into the cytoplasm where reverse transcriptase (RT) converts the viral RNA genome into a double stranded DNA that migrates to the nucleus and randomly integrates into the host genome, allowing constituent transgene expression. The structural proteins gag, pol, and env can be deleted, making room for eukaryotic-transgene inserts with a size of 9 kb. Structural plasmids provide the necessary structural genes in trans, minimising the risk of recombination and the spontaneous generation of retroviral particles. The env glycoprotein can be exchanged with different envelope protein derived from various viral strains, thereby modifying its tropism. This approach is called pseudotyping and allows viruses to be redirected to specific target cells. Retroviruses are produced in high titers and are normally not degraded by the host immune system as there is no pre-existing immunity. Unfortunately, retrovirus do integrate randomly, leading to insertional mutagenesis and leukaemia (Baum et al, 2006). They are also unsuitable to infect non-dividing cells, greatly limiting their tropism and clinical application. Researches have tried to overcome the problem of insertional mutagenesis by integrating insulator sequences inserted downstream of the LTRs and thereby almost eliminating the promotional activity of LTRs. The use of self-inactivating vectors disrupts the promotional activity of the 5' LTR by truncating the LTR during the reverse transcription. Expression of transgenes located between the LTRs is then solely dependent on heterogenic promoters such as CMV promoter, EF promoter and SFFV promoter.

Lentiviruses share some of the genetic information of retroviruses. In addition, their genome contains some regulatory genes to regulate virus replication and to evade the host immune system. The use of lentiviral vectors allows the infection of dividing and non-dividing cells with heterogenic DNA with a size up to 9kb. In the third generation vector, all regulatory genes are deleted from the lentiviral vector. However, the regulatory gene rev is provided in trans on a separate plasmid. The rev responsive element were retained on the lentiviral transfer vector and packaging vector. Vectors are self-inactivating minimising the risk of off- target promotional activity of LTRs. Pseudotypization can be achieved by exchanging the env plasmid provided in trans. Most commonly used is vesicular stomatitis virus glycoprotein (VSV-G) that uses membrane phospholipid for cell entry. VSV-G is characterised by a broad tropism and high transduction efficiency. Cell-specific expression of transgenes can be achieved either by different pseudotypization or be using a tissue-specific transgene promoter. US 2015/0011607 Al discloses compounds, compositions and methods useful for reducing a- 1 antitrypsin target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. One DsiRNA disclosed therein is referred to as SEQ ID NO 3279, and corresponds to shRNA2 (SEQ ID NO: 41) in the present disclosure.

Summary of the invention

The present invention aims to provide an effective treatment of alpha- 1 -antitrypsin deficiency by decreasing production of misfolded alpha- 1 -antitrypsin protein, thereby decreasing the amount of aggregated Z-AAT in hepatocytes.

The present invention also aims to provide an effective treatment of alpha- 1 -antitrypsin deficiency by providing a functional alpha- 1 -antitrypsin protein, i.e. alpha- 1 -antitrypsin protein having an inhibitory activity on tissue-modifying enzymes comparable to human wild- type alpha- 1 -antitrypsin protein, in combination with decreased production of misfolded alpha- 1 -antitrypsin protein.

The present invention also aims to increase levels of circulating alpha- 1 -antitrypsin above the threshold needed to ensure anti-inflammatory systemic activity of alpha- 1 -antitrypsin and to subsequently decrease the incidence of lung emphysema, panniculitis, aneurysms,

fibromuscular dysplasia, bleeding disorders, anterior uveitis, systemic necrotizing vasculitis and Wegener granulomatosis

The invention fulfils its aims by providing nucleic acid molecules, viral and non-viral delivery vehicles, and methods as disclosed herein.

In a first aspect, the invention relates to a ribonucleic acid molecule consisting of 19, 20, or 21 nucleotides and comprising a sequence selected from SEQ ID NO: 39, 40, 43 and 44.

In a further aspect, the invention relates to a chemically modified ribonucleic acid consisting of 19, 20, or 21 nucleotides and comprising a sequence selected from SEQ ID NO: 39, and 43.

In one embodiment of this aspect, the chemically modified ribonucleic acid is modified in the phosphodiester backbone, such as by incorporation of phosphorothioate, boranophosphate, or methylphosphonate; or in the sugar backbone such as at the 2'-position of the ribose unit, such as by substitution of the 2' -OH group for -O-CH3, -CH2CH2OCH3, or -F or by incorporation of 2-thiouridine, 5-methylcytidine or pseudouridine.

In a further aspect, the invention relates to an RNA molecule consisting of 40-100

nucleotides, comprising two sequences spaced 4-10 nucleotides apart, wherein the two sequences are selected from the sequence pairs: SEQ ID NO: 39 and 40; and SEQ ID NO: 43 and 44. In a further aspect, the invention relates to a DNA molecule comprising at least one nucleotide sequence complementary to at least one RNA molecule according to the invention such as one or two RNA molecules according to the invention.

In one embodiment of this aspect, the nucleotide sequence complementary to an RNA molecule according to the invention is operably linked to a single RNA polymerase promoter sequence.

In one embodiment of this aspect, the DNA molecule comprises at least two nucleotide sequences complementary to at least two different RNA molecule according to the invention, wherein each nucleotide sequence complementary to an RNA molecule according to the invention is independently operably linked to an RNA polymerase promoter sequence and wherein the RNA polymerase promoter sequence is the same for each nucleotide sequence complementary to an RNA molecule according to the invention.

In one embodiment of this aspect, the DNA molecule comprises at least two nucleotide sequences complementary to at least two different RNA molecule according to the invention, wherein each nucleotide sequence complementary to an RNA molecule according to the invention is independently operably linked to an RNA polymerase promoter sequence and wherein the RNA polymerase promoter sequence is different for each nucleotide sequence complementary to an RNA molecule according to the invention.

In one embodiment of this aspect, each RNA polymerase promoter sequence present in the DNA molecule is selected from RNA polymerase promoters HI, 7SK, and Ul .

In a further aspect, the invention relates to a DNA molecule comprising a sequence encoding a functional human alpha- 1 -antitrypsin and having at least 90 % identity to SEQ ID NO: 1, characterized in that said sequence comprises a plurality of point mutations in relation to SEQ ID NO: 1, said point mutations rendering an RNA-transcript of said DNA molecule resistant to gene silencing by RNA interference mediated by an RNA molecule according to the invention.

In one embodiment of this aspect, the point mutations in relation to SEQ ID NO: 1 are selected from the group: T919A, C920G, T921C, C924A, A925T, G926C, C927T, T928C, A930G, T933C, T934C, A936C, T984C, A987G, C988T, G990A, C993T, C996T, T999A. In one embodiment of this aspect, the DNA molecule comprises the following point mutations in relation to SEQ ID NO: 1 : T919A, C920G, T921C, C924A, A925T, G926C, C927T, T928C, A930G, T933C, T934C, A936C.

In one embodiment of this aspect, the DNA molecule comprises the following point mutations in relation to SEQ ID NO: 1 : T984C, A987G, C988T, G990A, C993T, C996T, T999A.

In one embodiment of this aspect, the DNA molecule comprises the following point mutations in relation to SEQ ID NO: 1 : T919A, C920G, T921C, C924A, A925T, G926C, C927T, T928C, A930G, T933C, T934C, A936C, T984C, A987G, C988T, G990A, C993T, C996T, T999A. In one embodiment of this aspect, the DNA molecule comprises a point mutation G75A in relation to SEQ ID NO: 1.

In one embodiment of this aspect, the DNA molecule encodes a protein comprising an amino acid sequence according to positions 25-418 of SEQ ID NO: 45.

In a further aspect, the invention relates to an RNA molecule comprising a nucleotide sequence complementary to a DNA molecule according to the invention.

In a further aspect, the invention relates to a virus particle comprising a recombinant viral genome, characterized in that said genome comprises a DNA molecule comprising the sequence of a DNA molecule according to the invention

In a further aspect, the invention relates to a virus particle comprising a recombinant viral genome, characterized in that said genome comprises an RNA molecule comprising a nucleotide sequence complementary to a DNA molecule according to the invention.

In a further aspect, the invention relates to a vehicle for delivery of nucleic acid material to a human cell in vivo, characterized in that said vehicle comprises a DNA molecule comprising the sequence of a DNA molecule according to the invention, and/or an RNA molecule according to the invention.

In one embodiment of this aspect, the vehicle is selected from the group plasmid DNA, lipid- based vectors, and polymeric vectors.

In a further aspect, the invention relates to a method for treatment of a subject comprising administering a nucleic acid molecule according to the invention, a virus particle according to the invention, or a vehicle according to the invention, to said subject.

In one embodiment of this aspect, a vehicle according to the invention is delivered to the subject by way of gene gun/ballistic DNA, electroporation, sonoporation, hydroporation, magnetofection, needle injection and/or other methods facilitating the incorporation of DNA or RNA into the cell leading to a modified transcription and expression of target genes.

In one embodiment of this aspect, the subject has alpha- 1 -antitrypsin deficiency

In one embodiment of this aspect, the subject's genome is heterozygous or homozygous for a G342K mutation in a gene encoding alpha- 1 -antitrypsin.

In one embodiment of this aspect, the alpha- 1 -antitrypsin deficiency manifests as liver cirrhosis, pulmonary emphysema, necrotising panniculitis, systemic vasculitis, (intracranial) aneurysms, fibromuscular dysplasia, bleeding disorders, anterior uveitis, systemic necrotizing vasculitis and Wegener granulomatosis.

In a further aspect, the invention relates to a nucleic acid molecule according to the invention, a virus particle according to the invention, or a vehicle according to the invention, for use in a method for treatment according to the invention. In one embodiment of this aspect, a vehicle according to the invention is delivered to the subject by way of gene gun/ballistic DNA, electroporation, sonoporation, hydroporation, magnetofection, needle injection and/or other methods facilitating the incorporation of DNA or RNA into the cell leading to a modified transcription and expression of target genes. In one embodiment of this aspect, the subject has alpha- 1 -antitrypsin deficiency.

In one embodiment of this aspect, the subject's genome is heterozygous or homozygous for a G342K mutation in a gene encoding alpha- 1 -antitrypsin.

In one embodiment of this aspect, the alpha- 1 -antitrypsin deficiency manifests as liver cirrhosis, pulmonary emphysema, necrotising panniculitis, systemic vasculitis, (intracranial) aneurysms, fibromuscular dysplasia, bleeding disorders, anterior uveitis, systemic necrotizing vasculitis and Wegener granulomatosis.

In a further aspect, the invention relates to the use of a nucleic acid molecule according to the invention, a virus particle according to the invention, or a vehicle according to the invention, in the manufacture of a pharmaceutical composition.

In one embodiment of this aspect, the pharmaceutical composition is for use in a method of treatment according to the invention.

Description of the drawings

Figure 1: shRNA targets and synthetic alpha-l-anitrypsin: The shRNA target sites are marked schematically within the wild-type M-AAT and the defective Z-AAT sequence bars (black gene bar). In sAAT and sAAT2, the silent point mutations have been incorporated at the sites targeted by shRNAs to render sAAT/sAAT2 resistant to shRNAs and to delete the in-frame BamHI site (the x at the 5'-end of sAAT). sAAT2 does not have incorporated the silent point mutations at the sRNA Ctrl 1 and shRNA Ctrl 2 target sites. However, the silent point mutations at the shRNA 1, 2 and 3 target sites are still incorporated. shRNA Ctrl 1 and shRNA Ctrl 2 are positive control shRNAs for knock-down of alpha- 1 -antitrypsin expression by the means of RNA interference. shRNAs 1, 2, and 3 are newly designed shRNAs that aim at previously untargeted sites of M-AAT and Z-AAT. The number of point mutations has been defined in the sAAT/sAAT2 gene bars (grey gene bars). E.g. at the site for shRNAl, 12 point mutations were introduced to acquire resistance against shRNAl in sAAT/sAAT2. Specifically designed qPCR primers targeting the mutated sites of sAAT (primers 1/2) allowed the synthesis of sAAT-specific qPCR amplicons to discriminate against qPCR amplicons derived solely from M-AAT using M-AAT specific primers 3/4. The sAAT recombinant protein sequence was cloned into unicistronic pSFFV.IRES.dTom to yield pSFFV.sAAT.IRES.dTom. The sAAT2 was cloned into pLVTHM. shRNAl to yield a multicistronic lentiviral transfer vector allowing co-expression of multiple shRNAs and a recombinational protein. sAAT was cloned into pSFFV.sAAT.IRES.dTomato to yield LV- sAAT upon lentiviral transduction. sAAT2 was cloned into pLVTHM.sHRNAlx3 to yield pLVTHM.shRNAlx3.sAAT2 where the genetic elements needed for the expression of shRNA and sAAT2 are combined within one lentiviral transfer vector.

Figure 2: Insertion of shNRA into pLVTHM: Paired shRNA oligonucleotides were annealed and cloned into pLVTHM using the MM and CM restriction sites to yield pLVTHM.shRNAl, pLVTHM. shRNA2 or pLVTHM. shRN A3. The HI promoter regulating the RNA Polymerase Ill-mediated expression of shRNA is located upstream of the MlullClal shRNA insertion site. The EcoKI site at the 5'-end of the HI promoter was used to generate the multicistronic lentiviral transfer vector such as pLVTHM. shRNAx3.sAAT2 allowing combinational expression of multiple shRNAs and the recombinant sAAT/sAAT2 protein simultaneously. The sequence in Figure 2 is provides as SEQ ID NO: 46 in the appended sequence listing.

Figure 3: pSFFV.sAAT.IRES.dTom: sAAT was cloned into the lentiviral transfer vector pSFFV.IRES.dTom using the BamRl restriction site to yield pSFFV.sAAT.IRES.dTom. Expression of sAAT is controlled by the strong eukaryotic promoter spleen focus forming virus (SFFV) promoter. The IRES element downstream of sAAT allows co-expression of the red fluorescence protein dTomato to easily identify transduced cells. Lentiviral production using the lentiviral transfer vector pSFFV.sAAT.IRES.dTom along with structural lentiviral plasmids yielded LV-sAAT.

Figure 4: pLVTHM.shRNAl: Paired shRNA oligonucleotides were annealed and cloned into pLVTHM by MM and CM. The HI shRNA promoter regulating the RNA Polymerase III is located upstream of the shRNA insertion site. eGFP is co-expressed under the control of an EF-la promoter to easily identify transduced cells. Lentiviral production using the lentiviral transfer vector pLVTHM. shRNAl/2/3 along with structural lentiviral plasmids yielded LV-shRNAl, LV-shRNA2 or LV-shRNA3, respectively.

Figure 5: pLVTHM.shRNAlx3: A newly designed insert containing two shRNAs each individually under the control of one RNA polymerase promoter (7SK and Ul) were synthesized and cloned into the EcoKI cloning site of pLVTHM.shRNAl to generate pLVTHM. shRNA 1x3. pLVTHM. shRNA 1x3 allowed expression of multiple shRNAs from different promoters (multicistronic expression), thereby maximizing knock-down by RNA interference and minimizing the risk of recombinational events leading to loss of shRNA activity. For reasons of clarity, only shRNA promoters and shRNA sequences are shown in this figure. All other genetic elements of pLVTHM are still integrated in the

pLVTHM. shRNA 1x3 transfer vector as depicted in figure 4. Lentiviral production using the lentiviral transfer vector pLVTHM. shRNA 1x3 along with structural lentiviral plasmids yielded LV-shRNAlx3.

Figure 6: A newly designed insert containing sAAT2 and two shRNAs, each individually under the control of the RNA polymerase promoter 7SK and Ul, were synthesized and cloned into the EcoKI cloning site of pLVTHM.shRNAl to generate pLVTHM. shRN Al x3. s AAT2. pLVTHM. shRNA lx3.sAAT2 allowed expression of multiple shRNAs thereby maximizing knock-down by RNA interference and minimizing the risk of recombinational events leading to loss of shRNA activity. Simultaneously, one recombinant protein sAAT2 was expressed along with shRNAs to replace the knocked-down and defective M-AAT/Z-AAT. For reasons of clarity, only the SFFV, promoter, the sAAT2 transgene, the shRNA promoters and shRNA sequences are shown in this figure. All other genetic elements of pLVTFDVI are still integrated in the pLVTFEVI.shRNAlx3.sAAT2 transfer vector as depicted in figure 4. Lentiviral production using the lentiviral transfer vector pLVTFEVI.shRNAlx3.sAAT2 along with structural lentiviral plasmids yielded LV-shRNAlsAAT2.

Figure 7. Knock-down of native AAT. HepG2 cells were transduced with LV-shRNA Ctrl 1/2, LV-shrNAl/2/3 or LV-scramble at on multiplicity of infection of 1. Expression of native AAT was determined by qPCR. Positive control shRNAs 1 and 2 was able to significantly knock-down expression of native AAT In addition, newly developed shRNAl and shRNA3 demonstrated an effective and significant knockdown of the AAT target gene in HepG2 cells shRNA 2 (prior art) did not show a significant knock-down of native AAT compared to scrambled shRNA The results are based on eight independent experiments. * p > 0.05; ** p<0.05; *** p<0.005

Figure 8: Knock-down of native AAT in sorted HepG2 cells. HepG2 cells were transduced with LV-shRNA Ctrl 1/2, LV-shrNAl/2/3 or LV-scramble at on multiplicity of infection of 0.5. The transduced cells were sorted by FACS to acquire pure cell cultures. Cell cultures were propagated for three weeks and RNA was isolated. Expression of native AAT was determined by qPCR. Positive control shRNAs 1 and 2 was able to significantly knock-down expression of native AAT In addition, newly developed shRNAl and shRNA3 demonstrated an effective and significant knock-down of the AAT target gene in HepG2 cells shRNA 2 (prior art) did not show a significant knock-down of native AAT compared to scrambled shRNA The results are based on three independent experiments. * p > 0.05; ** p<0.05; *** p<0.005

Figure 9. Overexpression and secretion of synthetic AAT (sAAT). A HepG2 cells were transduced with LV-sAAT (LV-sAAT) or left untreated (ctrl). Five days after transduction the supernatant cell medium containing the secreted AAT/sAAT was collected and prepared for Western Blot analysis along with the cell lysates. In cell lysates, expression of AAT/sAAT is slightly elevated in treated cells compared to control cells. Levels of secreted AAT/sAAT is highly elevated in the cell medium of treated cells compared to untreated cells indicating a highly efficient production and secretion of synthetic sAAT from treated HepG2 cells. B HepG2 cells were transduced with LV-sAAT, LV-shRNAl/2/3 or left untreated. Five days after transduction the supernatant cell medium containing the secreted AAT/sAAT was collected and prepared for Western Blot analysis. AAT/sAAT is expressed in cells treated with LV-sAAT but cannot be detected in control cells or in cells treated with LV- shRNAl/2/3. Indicating that high level expression of AAT/sAAT is specific to cells treated with LV-sAAT. The picture is representative for three independent experiments.

Figure 10: Expression of synthetic AAT in transduced cells. HepG2 cells were treated with LV-sAAT, LV-shRNAlx3-sAAT or LV-scramble. RNA was isolated after six days and samples were prepared for qPCR using primers 3 and4 (SEQ 31 and SEQ 32). A standard curve for sAAT and sAAT2 was determined. Synthetic AAT was specifically detected in cells transduced with LV-sAAT or LV-shRNAlx3-sAAT2. A total of 3191 and 2687 copies of sAAT and sAAT2 were determined in the analysed samples, respectively, while no copies of sAAT/sAAT2 were detected in control samples. The results are based on three independent experiments.

Figure 11: Knock-down of M-AAT by multicistronic expression of shRNA 1. HepG2 cells were transduced with LV-shRNAlx3 (MOI 1 or 2) and LV-shRNAlx3.sAAT2 (MOI 1). RNA was isolated six days after transduction and expression of M-AAT was analysed by qPCR using M-AAT specific primers 1 and 2 (SEQ 29 and SEQ 30). All samples demonstrate significant knock-down of M-AAT ranging from 55 % to 44 %(p _S hRNAix3 1 MOI = 0.0262;

p _S hRNAix3 2MOi = 0.0056; p _S hRNAix3.sAAT2 = 0.0446). Despite the presence of 2687 copies of sAAT2 in the sample LV-shRNAlx3.sAAT2, no significant increase of AAT levels were detected, indicating the specificity of the M-AAT primers. The results are based on three independent experiments. * p <0.05

Sequences

The following sequences are relevant to the present disclosure and included in the appended sequence listing.

Alpha- 1 -antitrypsin sequences

Open reading frame of native alpha- 1 -antitrypsin (M-AAT), M_000295.4 (SEQ ID NO: 1):

ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGT CCCTGTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACA TCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTG AGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATAT CTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCA AGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGAT TCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAG CCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCC TGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGC CTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTA CGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAG AGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGA CCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACC ACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTA AGAAGCTGTCCAGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCAT CTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCAC GATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGTCTGCCAGCTTACATT TACCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGTCAACT GGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGA GGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACGAG AAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCC CCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATAC CAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA

Open reading frame of synthetic alpha- 1 -antitrypsin (sAAT) (SEQ NO: 2):

ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGT CCCTGTCTCCCTGGCTGA4G^JCCCCAGGGAGATGCTGCCCAGAAGACCGACACT AGTCATCACGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTG AGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATAT CTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCA AGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGAT TCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAG CCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCC TGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGC CTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTA CGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAG AGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGA CCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACC ACCGTGAAGGTGCCTATGATGAAAAGACTTGGTATGTTTAACATCCAGCACTGTA AGAAGCTGTCCAGCTGGGTTTTATTGATGAAGTACCTGGGCAATGCCACCGCCAT CTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCAC GATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGAGCGCATCTCTGCAC CTCCCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGCCAGT TAGGTATTACAAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGG AGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACGA GAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATC CCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATA CCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA

AGATCC = BamHl restriction site of the native M-AAT has been deleted by introducing a silent point mutation (bold) at nucleotide 75 of the M-AAT cDNA transcript (G75 A)

GACCGACACTAGTCATCAC = Target sequence of silencing RNA/shRNA in M-AAT, resistant in sAAT because of point mutations (bold)

Open reading frame of synthetic alpha- 1 -antitrypsin (sAAT2) (SEQ ID NO: 3): ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGT CCCTGTCTCCCTGGCTGA4G^JCCCCAGGGAGATGCTGCCCAGAAGACAGATACA TCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTG AGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATAT CTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCA AGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGAT TCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAG CCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCC TGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGC CTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTA CGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAG AGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGA CCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACC ACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTA AGAAGCTGTCCAGCTGGGTTTTATTGATGAAGTACCTGGGCAATGCCACCGCCAT CTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCAC GATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGAGCGCATCTCTGCAC CTCCCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGCCAGT TAGGTATTACAAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGG AGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACGA GAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATC CCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATA CCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA

AGATCC = the BamHl restriction site of the native M-AAT has been deleted by introducing a point mutation (bold)

GACCGACACTAGTCATCAC Target sequence of silencing RNA/shRNA in M-AAT, resistant in sAAT2 because of point mutations (bold)

Open reading frame of PiZZ alpha- 1 -antitrypsin (Z-AAT) (SEQ ID NO: 4):

ATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGT CCCTGTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACA TCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTG AGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATAT CTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCA AGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGAT TCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAG CCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCC TGAAGCTAGTGGATAAATTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGC CTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTA CGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAG AGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGA CCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGCGACC ACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTA AGAAGCTGTCCAGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCAT CTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCAC GATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGTCTGCCAGCTTACATT TACCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGTCAACT GGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGA GGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACAAG AAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCC CCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATAC CAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAA

A = point mutation in Z-AAT

Interfering RNA sequences

Silencing RNA sequences are initially constructed as oligonucleotides that are annealed and cloned into shRNA expressing lentiviral transfer vector pLVTHM. The shRNA is designed as depicted below following the instructions from the original publication (Wiznerowicz and Trono, 2003). The original TTCAAGAGA-loop has been exchanged for an ACTCGAGA- loop.

• +linker: CGCGT CCCC

· 19-21 nt sense siRNA:

• Loop: ACTCGAGA

• 19-21 nt anti-sense siRNA

• Termination: χχχχχ

• Linker+CM: GGAA AT

Specific sequences were constructed as follows.

shRNA ctrll: 102-120 bp of ORF NM000295.4 (positive control shRNA published in Cruz et al, 2007)

sense siRNA: GACAGATACATCCCACCAT (SEQ ID NO: 5)

anti-sense siRNA: GACAGATACATCCCACCAT (SEQ ID NO: 6)

oligonucleotide for annealing and cloning:

oligo 1: 5'- CGCGT CCCC GACAGATACATCCCACCAT ACTCGAGA

ATGGTGGGATGTATCTGTC χχχχχ GGAA AT- 3' (SEQ ID NO: 7)

oligo 2: 5'- CGAT TTCC AAAAA GACAGATACATCCCACCAT TCTCGAGT

ATGGTGGGATGTATCTGTC GGGG A- 3' (SEQ ID NO: 8)

shRNA ctrl2: 732-752 bp of ORF NM000295.4 (positive control shRNA published in Li et al, 2011) sense siRNA: GATGAAGCGTTTAGGCATG (SEQ ID NO: 9)

anti-sense siRNA: CATGCCTAAACGCTTCATC (SEQ ID NO: 10)

oligonucleotide for annealing and cloning:

Oligo 3: 5'- CGCGT CCCC GATGAAGCGTTTAGGCATG ACTCGAGA

CATGCCTAAACGCTTCATC TTTTT GGAA AT- 3 ' (SEQ ID NO: 11)

Oligo 4: 5'- CGAT TTCC AAAAA GATGAAGCGTTTAGGCATG TCTCGAGT CATGCCTAAACGCTTCATC GGGG A- 3' (SEQ ID NO: 12)

shRNA 1: 917bp-937bp of ORF NM000295.4

sense siRNA: GGTCTGCCAGCTTACATTTAC (SEQ ID NO: 13)

The corresponding RNA sequence is provided as SEQ ID NO: 39.

anti-sense siRNA: GTAAATGTAAGCTGGCAGACC (SEQ ID NO: 14) The corresponding RNA sequence is provided as SEQ ID NO: 40.

oligonucleotide for annealing and cloning:

Oligo 5: 5'- CGCGT CCCC GGTCTGCCAGCTTACATTTAC ACTCGAGA GTAAATGTAAGCTGGCAGACC TTTTT GGAA AT- 3 ' (SEQ ID NO : ( 15)

Oligo 6: 5'- CGAT TTCC AAAAA GGTCTGCCAGCTTACATTTAC ACTCGAGA GTAAATGTAAGCTGGCAGACC GGGG A - 3' (SEQ ID NO: 16)

shRNA 2 (prior art): 785-803 of ORF NM000295.4

sense siRNA: GGGTGCTGCTGATGAAATA (SEQ ID NO: 17)

The corresponding RNA sequence is provided as SEQ ID NO: 41.

anti-sense siRNA: TATTTCATCAGCAGCACCC (SEQ ID NO: 18)

The corresponding RNA sequence is provided as SEQ ID NO: 42.

oligonucleotide for annealing and cloning:

Oligo 7: 5'- CGCGT CCCC GGGTGCTGCTGATGAAATA ACTCGAGA

TATTTCATCAGCAGCACCC TTTTT GGAA AT- 3' (SEQ ID NO: 19)

Oligo 8: 5'- CGAT TTCC AAAAA GGGTGCTGCTGATGAAATA ACTCGAGA TATTTCATCAGCAGCACCC GGGG A- 3' (SEQ ID NO: 20)

shRNA3: 981-1001 of ORF NM000295.4

sense siRNA: GGGTCAACTGGGCATCACTAA (SEQ ID NO:21) The corresponding RNA sequence is provided as SEQ ID NO: 43.

anti-sense siRNA: TTAGTGATGCCCAGTTGACCC (SEQ ID NO: 22)

The corresponding RNA sequence is provided as SEQ ID NO: 44.

oligonucleotide for annealing and cloning:

Oligo 9: 5'- CGCGT CCCC GGGTCAACTGGGCATCACTAA ACTCGAGA TTAGTGATGCCCAGTTGACCC TTTTT GGAA AT- 3' (SEQ ID NO:23)

Oligo 10: 5'- CGAT TTCC AAAAA GGGTCAACTGGGCATCACTAA ACTCGAGA TTAGTGATGCCCAGTTGACCC GGGG A- 3' (SEQ ID NO:24)

Scramble shRNA:

sense siRNA: GTGATCGCGTCAACGACTAGA (SEQ ID NO: 25)

anti-sense siRNA: TCTAGTCGTTGACGCGATCAC (SEQ ID NO: 26)

oligonucleotide for annealing and cloning:

Oligo 11: 5'- CGCGT CCCC GTGATCGCGTCAACGACTAGA ACTCGAGA TCTAGTCGTTGACGCGATCAC TTTTT GGAA AT- 3' (SEQ ID NO: 27)

Oligo 12: 5'- CGAT TTCC AAAAA GTGATCGCGTCAACGACTAGA ACTCGAGA TCTAGTCGTTGACGCGATCAC GGGG A- 3' (SEQ ID NO: 28)

Primers

qPCR primers

Sequencing primers 100 SEQ ID TGATAGAGAAAAGTGAAAGTCGGGG Forward sequencing NO: 35 primer on pLVTHM to check shRNA insertion of the cloning

olignonucleotide

101 SEQ ID GACCCAGTACAAGCAAAAAGCAGCA reverse sequencing

NO: 36 primer on pLVTHM to check shRNA insertion of the cloning

olignonucleotide

Sequence for multiple shRNA

Sequence of insert for shRNA 1 x 3 (SEQ ID NO: 37):

GCGCGjAATTCCjGTACGCTGCAGTATTTAGCATGCCCCACCCATCTGCAAGG CATTCTGGATAGTGTCAAAACAGCCGGAAATCAAGTCCGTTTATCTCAAACT TTAGCATTTTGGGAATAAATGATATTTGCTATGCTGGTTAAATTAGATTTTAG TTAAATTTCCTGCTGAAGCTCTAGTACGATAAGTAACTTGACCTAAGTGTAA AGTTGAGATTTCCTTCAGGTTTATATAGCTTGTGCGCCGCCTGGGTACCTCC GCGTCCCCGGTCTGCCAGCTTACA TTTAC ACT CG AG AGTAAA TGTAAGCTGGCAGACC GGTCTTCACCTGAGGTrrrrGCGCGCGCCTAAGGACCAGCTTCTTTGGGAGAGA ACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCCCT TGGCGGCTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGG GACTGGGCAAGGCACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTA GATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCTGCTTCACCACGAA GGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGA ATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGGGGCAAG TGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGC CCAAGATCTCCGCGTCCCCGGTCTGCCAGCTTACATTTACAC CGAGAGTAAATGTA A GC TGGCA GACCGCAGT IGGAGTTTCAAAA GTA GA CTGG j AATTCGCGC

Bold = promoter

Bold italique = promoter termination sequence

Italique = shRNA sense and anti-sense

Underlined = loop

I = restriction site

Sequence of insert for shRNA 1 x 3 containing sAAT2 (SEQ ID NO: 38): GCGCGjAATTCCjGTACGAGCTAGCTGCAGTAACGCCATTTTGCAAGGCATGG AAAAATACCAAACCAAGAATAGAGAAGTTCAGATCAAGGGCGGGTACATGA AAATAGCTAACGTTGGGCCAAACAGGATATCTGCGGTGAGCAGTTTCGGCCC CGGCCCGGGGCCAAGAACAGATGGTCACCGCAGTTTCGGCCCCGGCCCGAG GCCAAGAACAGATGGTCCCCAGATATGGCCCAACCCTCAGCAGTTTCTTAAG ACCCATCAGATGTTTCCAGGCTCCCCCAAGGACCTGAAATGACCCTGCGCCT TATTTGAATTAACCAATCAGCCTGCTTCTCGCTTCTGTTCGCGCGCTTCTGCT TCCCGAGCTCTATAAAAGAGCTCACAACCCCTCACTCGGCGCGCCAGTCCTC CGAC AGACTGAGTCGGCCGGTG4 TGCCGTCTTCTGTCTCGTGGGGCA TCCTCCTGCT GGCAGGCCTGTGCTGCCTGGTCCCTGTCTCCCTGGCTGAAGATCCCCAGGGAGATGC TGCCCAGAAGACAGATACATCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCA CCCCCAACCTGGCTGAGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAA CAGCACCAA TA TCTTCTTCTCCCCAGTGAGCA TCGCTACAGCCTTTGCAATGCTCTCCC TGGGGACCAAGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCAC GGAGA TTCCGGAGGCTCAGA TCCA TGAAGGCTTCCAGGAACTCCTCCGTACCCTCAAC CAGCCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGC CTGAAGCTAGTGGATAAGTTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGCCTT CACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTACGTGGAG AAGGGTACTCAAGGGAAAA TTGTGGA TTTGGTCAAGGAGCTTGACAGAGACACAGTTTT TGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGACCCTTTGAAGTCAAGG ACACCGAGGAAGAGGACTTCCACGTGGACCAGGTGACCACCGTGAAGGTGCCTATGAT GAAGCGTTTAGGCATGTTTAACATCCAGCACTGTAAGAAGCTGTCCAGCTGGGTTTTAT TGA TGAAGTACCTGGGCAA TGCCACCGCCA TCTTCTTCCTGCCTGA TGAGGGGAAACT ACAGCACCTGGAAAATGAACTCACCCACGATATCATCACCAAGTTCCTGGAAAATGAAG ACAGAAGGAGCGCATCTCTGCACCTCCCCAAACTGTCCATTACTGGAACCTATGATCTG AAGAGCGTCCTGGGCCAGTTAGGTA TTACAAAGGTCTTCAGCAA TGGGGCTGACCTCT CCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGC TGACCATCGACGAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACC CA TGTCTA TCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAA TGA TTGAACA AAA TACCAAGTCTCCCCTCTTCA TGGGAAAAGTGGTGAATCCCACCCAAAAA TAACjGT ACGCTGCAGTATTTAGCATGCCCCACCCATCTGCAAGGCATTCTGGATAGTG TCAAAACAGCCGGAAATCAAGTCCGTTTATCTCAAACTTTAGCATTTTGGGA ATAAATGATATTTGCTATGCTGGTTAAATTAGATTTTAGTTAAATTTCCTGCT GAAGCTCTAGTACGATAAGTAACTTGACCTAAGTGTAAAGTTGAGATTTCCT TCAGGTTTATATAGCTTGTGCGCCGCCTGGGTACCTCCGCGTCCCCGGJC GC CAGCTTACA TTTACAC CGAGAGTAAA TGTAAGCTGGCA G^CCGGTCTTCACCTGAG Gr7T7TGCGCGCGCCTAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGG GCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCCCTTGGCGGCTCTGG CAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGG CACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCG CAGAGGCTGCTGCTTCGCCACTTGCTGCTTCACCACGAAGGAGTTCCCGTGC CCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGAATCCCAGCTGTGT GTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGGGGCAAGTGACCGTGTGTGT AAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGGCCCAAGATCTCCGC GTCCCCGGTCTGCCAGCTTACATTTACACTCGAGAGTAAATGTAAGCTGGCAGACCGC AGTCTGGAG7T C 4 4 GTA GA CTGG j AATTCGCGC

Bold = promoter (5'-3 ' order: SFFV, 7SK, Ul)

Bold italique = promoter termination sequence

Bold italique underlined = stop codon of s AAT2

Italique = shRNA sense and anti-sense

Italique underlined = ORF of sAAT2

Underlined = loop

I = restriction site

The amino acid sequence of human alpha- 1 -antitrypsin protein is provided as SEQ ID NO:

45:

MPSSVSWGIL LLAGLCCLVP VSLAEDPQGD AAQKTDTSHH DQDHPTFNKI TPNLAEFAFS 60 LYRQLAHQSN STNIFFSPVS IATAFAMLSL GTKADTHDEI LEGLNFNLTE IPEAQIHEGF 120

QELLRTLNQP DSQLQLTTGN GLFLSEGLKL VDKFLEDVKK LYHSEAFT FGDTEEAKKQ 180

INDYVEKGTQ GKIVDLVKEL DRDTVFAL YIFFKGKWER PFEVKDTEEE DFHVDQVTTV 240

KVPMMKRLGM FNIQHCKKLS SWVLLMKYLG NATAIFFLPD EGKLQHLENE LTHDIITKFL 300

ENEDRRSASL HLPKLSITGT YDLKSVLGQL GITKVFSNGA DLSGVTEEAP LKLSKAVHKA 360 VLTIDEKGTE AAGAMFLEAI PMSIPPEVKF NKPFVFLMIE QNTKSPLFMG KWNPTQK

Positions 5281 - 5760 of pLVTHM.shRNAl is disclosed in Figure 2 and included in the sequence listing as SEQ ID NO: 46.

Abbreviations and definitions

The abbreviation "AAT" means alpha- 1 -antitrypsin protein. Human AAT protein is the gene product of the gene SERPINA1, GenBank accession number NM 000295. It has a wild-type sequence as disclosed in the GenPept database accession number NP 000286. The gene product is a 418 amino acid precursor protein with an amino acid sequence according to SEQ ID NO: 45, comprising a 24 amino acid signal peptide. The mature protein comprises amino acid residues 25-418 of SEQ ID NO: 45. Allelic variants of wild-type AAT that do not confer AAT deficiency are known and include e.g. variants called Ml, Ml V, MIA, M2, M3, M4, B(Alhambra), F, P(St. Albans), and Christchurch, see e.g. the Online Mendelian Inheritance in Man database, available online at www.omim.org, entry 107400. Allelic variants of human AAT that do not confer AAT deficiency when present in a human subject are denoted "functional AAT" in the context of this description.

Detailed description In a first aspect, the present invention relates to ribonucleic acid molecules useful as small interfering RNA molecules (siRNAs). Such RNA molecules are useful in therapeutic methods using RNA interference to target and regulate the expression of AAT variants causing or contributing to AAT deficiency. The ribonucleic acid molecules useful as siRNAs according to the invention are typically 19, 20, or 21 nucleotides in length and comprise a sequence selected from SEQ ID NO: 39, 40, 43 and 44.

The siRNA molecules may be chemically modified in order to improve their therapeutic effect in vivo, i.a. by overcoming immune responses and elimination by endonucleases. Such chemical modifications may be modifications in the phosphodiester backbone, such as by incorporation of phosphorothioate, boranophosphate, or methylphosphonate; or in the sugar backbone such as at the 2'-position of the ribose unit, such as by substitution of the 2' -OH group for -O-CH3, -CH2CH2OCH3, or -F or by incorporation of 2-thiouridine, 5- methylcytidine or pseudouridine.

In a further aspect, the present invention relates to ribonucleic acid molecules useful as short hairpin RNA molecules (shRNAs). Such RNA molecules are useful in therapeutic methods using RNA interference to target and regulate the expression of AAT variants causing or contributing to AAT deficiency. The ribonucleic acid molecules useful as shRNAs according to the invention typically consists of 40-100 nucleotides, and comprises two sequences separated by a loop region of 4-10 nucleotides, wherein the two sequences are selected from the sequence pairs: SEQ ID NO: 39 and 40; and SEQ ID NO: 43 and 44.

The invention also relates to DNA molecules useful in producing shRNAs in vivo or ex vivo. Such DNA molecules comprise at least one nucleotide sequence complementary to at least one shRNA molecule as described above. A DNA molecule suitable for use in producing shRNAs according to the invention may also comprise two or three, or more, sequences complementary to shRNAs according to the invention. The sequences comprised in the DNA molecule may be complementary to one and the same, or different, shRNAs.

In a preferred embodiment, any nucleotide sequence complementary to a shRNA molecule according to the invention is operably linked to a RNA polymerase promoter sequence. Each nucleotide sequence complementary to a shRNA molecule according to the invention could be operably linked to a separate RNA polymerase promoter sequence. Alternatively, more than one nucleotide sequence complementary to a shRNA molecule according to the invention are operably linked to a single RNA polymerase promoter sequence. In one embodiment, all nucleotide sequences complementary to shRNA molecules according to the invention are operably linked to a single RNA polymerase promoter sequence.

In one embodiment, the RNA polymerase promoter sequence or RNA polymerase promoter sequences are selected from the group consisting of RNA polymerase promoters HI, 7SK, and Ul .

In one aspect, the invention relates to a DNA molecule comprising a sequence encoding a functional human alpha- 1 -antitrypsin and having at least 90 % identity to SEQ ID NO: 1, wherein said sequence comprises a plurality of point mutations in relation to SEQ ID NO: 1, said point mutations rendering an RNA-transcript of said DNA molecule resistant to gene silencing by RNA interference mediated by an RNA molecule according to the above mentioned aspects of the invention.

Preferred point mutations and their effect on resistance to gene silencing by RNA interference are disclosed in Table 1.

Table. 1 : Mutations in synthetic alpha- 1 -antitrypsin

Location of silent point mutation on

sAAT sAAT2 Resistance against shRNA the M-AAT cDNA transcript

G75A Yes Yes No, only deletes Bam l site

A105C Yes No

T108C Yes No

H IT Yes No

112A Yes No

shRNA Ctrl 1

113G Yes No

114T Yes No

C117T Yes No

T120C Yes No

G738A Yes No

C739A Yes No

T741A Yes No

shRNA Ctrl 2

T742C Yes No

A744T Yes No

C747T Yes No

G789T Yes Yes

C790T Yes Yes

G792A Yes Yes shRNA2 (prior art)

C793T Yes Yes

A801G Yes Yes

T919A Yes Yes

C920G Yes Yes

T921C Yes Yes

C924A Yes Yes

A925T Yes Yes

G926C Yes Yes

shRNA 1

C927T Yes Yes

T928C Yes Yes

A930G Yes Yes

T933C Yes Yes

T934C Yes Yes

A936C Yes Yes

T984C Yes Yes

A987G Yes Yes shRNA3

C988T Yes Yes G990A Yes Yes

C993T Yes Yes

C996T Yes Yes

T999A Yes Yes

In one embodiment, the DNA molecule comprising a sequence encoding a functional human alpha- 1 -antitrypsin also comprises the G75A mutation in relation to SEQ ID NO: 1, which mutation renders a BamHl site in SEQ ID NO: 1 inoperative.

In a preferred embodiment of the above aspect, the functional human alpha- 1 -antitrypsin encoded by the DNA molecule comprises or consists of an amino acid sequence according to positions 25-418 of SEQ ID NO: 45. In one embodiment, the functional human alpha- 1- antitrypsin encoded by the DNA molecule comprises or consists of an amino acid sequence according to SEQ ID NO: 45.

In one aspect, the invention relates to an RNA molecule useful as a synthetic retroviral gene for use in a gene delivery based on a retrovirus. Such RNA molecules should comprise sequences that, when used in an appropriate retroviral vector, serves to express the shRNA molecules according to the above mentioned aspects of the invention and/or mRNA for functional alpha- 1 -antitrypsin, that is resistant to gene silencing by said shRNA molecules or the siRNA molecules according to the invention. Such RNA molecules typically comprise a nucleotide sequence complementary to DNA molecules according to the above mentioned aspects.

In one aspect, the invention relates to virus particles comprising a recombinant viral genome, wherein said genome comprises a DNA molecule comprising the sequence of a DNA molecule according to the above aspects, encoding shRNA molecules and/or functional human alpha- 1 -antitrypsin resistant to gene silencing by said shRNA molecules or the siRNA molecules according to the invention.

In one aspect, the invention relates to virus particles comprising a recombinant viral genome, wherein said genome comprises an RNA molecule comprising the sequence of an RNA molecule according to the above aspects, encoding shRNA molecules and/or functional human alpha- 1 -antitrypsin resistant to gene silencing by said shRNA molecules or the siRNA molecules according to the invention. Such virus particles are useful as viral delivery vehicles of the nucleic acid materials according to the invention.

In one aspect, the invention relates to non-viral delivery vehicles for nucleic acid material to a human cell in vivo, wherein said vehicle comprises a DNA molecule according to the above aspects, encoding shRNA molecules and/or functional human alpha- 1 -antitrypsin resistant to gene silencing by said shRNA molecules or the siRNA molecules according to the invention. Alternatively or additionally, the non-viral delivery vehicle may comprise an RNA molecule according to the above aspects, encoding shRNA molecules and/or functional human alpha- 1- antitrypsin resistant to gene silencing by said shRNA molecules or the siRNA molecules according to the invention. The non- viral delivery vehicle may be selected from the group plasmid DNA, lipid-based vectors, and polymeric vectors.

In a further aspect, the invention relates to a method for treatment of a subject comprising administering a nucleic acid molecule according to the invention to a subject in need thereof. In embodiments of this aspect, the nucleic acid material is administered by the viral or non- viral delivery vehicles discussed above. The non-viral delivery vehicles may be administered by e.g. gene gun/ballistic DNA, electroporation, sonoporation, hydroporation,

magnetofection, or needle injection.

In a preferred embodiment, the condition to be treated by the method of treatment is alpha- 1- antitrypsin deficiency. In one embodiment, the subject to be treated carries the G342K mutation in a gene encoding alpha- 1 -antitrypsin, and may be homozygous or heterozygous for this mutation. Thus, in one aspect the method further comprises analysis of the genome of a potential subject to be treated with respect to mutation status of a gene encoding alpha- 1- antitrypsin and determination of whether the subject carries the G342K mutation in a gene encoding alpha- 1 -antitrypsin. A subject carrying the G342K mutation in at least one allele is particularly amenable to treatment with the method according to the invention.

In one embodiment, the alpha- 1 -antitrypsin deficiency manifests as liver cirrhosis, pulmonary emphysema, necrotising panniculitis, systemic vasculitis, aneurysms (such as intracranial aneurysms), fibromuscular dysplasia, bleeding disorders, anterior uveitis, systemic necrotizing vasculitis or Wegener granulomatosis.

In one aspect, the invention relates to the nucleic acids, and viral and non- viral delivery vehicles according to the invention for use in methods for treatment of the human or animal body, preferably the human body, even more preferably in the methods of treatment according to the above mentioned aspects of the invention.

In one aspect, the invention relates to the use of the nucleic acids, and viral and non-viral delivery vehicles according to the invention for use in the manufacture of a pharmaceutical composition for use in methods for treatment of the human or animal body, preferably the human body, even more preferably in the methods of treatment according to the above mentioned aspects of the invention.

The various aspects and embodiments of the invention are further explained and described below. Detailed background knowledge and information relevant to the invention are also discussed in the background section of the present disclosure and in the references discussed throughout this disclosure, which are all explicitly incorporated by reference herein.

Elimination of the misfolded AAT protein:

The technique of RNA interference was used to decrease the synthesis of endogenous and potentially hazardous AAT. RNA interference was mediated by short-hairpin RNA, although the functionality of the specific RNA sequences used for knockdown of the endogenous AAT gene are not limited to shRNA molecules but can also be exploited to other RNA interfering molecules such as siRNA and miRNA. In the experiments described in this invention, shRNA expression was mediated by lentiviral vectors that had integrated into the cell genome. Expressional activity was controlled by the RNA polymerase III promoter HI, the RNA polymerase promoter III 7SK, or the RNA polymerase II promoter Ul . Expression of shRNA was either unicistronic from one HI promoter, or multicistronic from multiple RNA polymerase promoters. Unicistronic expression was accomplished by cloning of the shRNA oligonucleotides (SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, scramble SEQ ID NO: 25, scramble SEQ ID NO: 26) into the lentiviral transfer vector pLVTHM using the MM and CM restriction sites as suggested by the original work (figure 2, figure 4). Multicistronic expression of several shRNAs was accomplished by cloning of the respective promoter sequences combined with downstream shRNA oligonucleotides into the EcoBl cloning site upstream of the HI promoter of the original pLVTHM transfer vector (figure 5). The synthesis and cloning of oligonucleotides for multicistronic shRNA expression was performed by commercially available services and sub-cloned into a cloning vector by commercially available cloning services. In case of pLVTHM. shRNA 1x3 the synthesized cloning oligonucleotide (SEQ ID NO: 37) consisted of restriction sites, promoter sequences, promoter termination sequences, shRNA sense and loop and anti-sense sequences. In case of pLVTHM . shRNA 1x3. s A AT2, the synthesized oligonucleotide included also the SFFV promoter sequence and the sAAT2 recombinant protein sequence (SEQ ID NO: 38).

HEK293T producer cell lines were transfected with lentiviral vectors along with structural plasmids psPAX2 and pMD2.G in order to produce viral particles. Viral particles were used to infect target cells, to release and to integrate the genetic information into the cell genome provided by the transfer vector. Normally, the gene sequence inserted into the target cell genome upon target cell transduction is framed by the 5'LTR and the self-inactivating of the transfer vector. In these experiments, variants of pLVTHM were used to integrate single or multiple shRNAs, combined with recombinant protein (sAAT2) or not.

The insertion order of the following genetic elements is presented in a 5'-3' directional manner.

(i) For the viral particles produced with transfer vector with unicistronic (expression of one single shRNA from one promoter) shRNA expression, the 5'LTR was integrated followed by the psi-packaging signal, the Rev responsive element (RRE), the EF-la promoter, the (cPPT), the eGFP coding sequence, the Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE), the tetracycline responsive element (TetO), the EcoBl cloning site, the HI promoter, the MM cloning site, the cloned shRNA oligonucleotide, the CM restriction site and the self-inactivating 3'LTR (figure 4).

(ϋ) For lentiviral particles produced with a transfer vector with multicistronic shRNA expression (multiple shRNA are expressed from individual promoters HI, 7SK or Ul), 5'LTR was integrated followed by the psi-packaging signal, the Rev responsive element (RRE), the EF-la promoter, the (cPPT), the eGFP coding sequence, the Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE), the tetracycline responsive element (TetO), the 5' EcoBl restriction site (generated by splitting the original EcoKI site by the cloning procedure), the BsiWI site, the 7SK promoter sequence, the shRNA sense-loop- antisense sequence, a spacer, the 7SK termination sequence, a second spacer, the Ul promoter sequence, a second shRNA sense-loop-anti sense sequence, a spacer, the Ul termination sequence, the 3' EcoBl restriction site, the HI promoter, the MM cloning site, the cloned shRNA oligonucleotide, the CM restriction site and the self-inactivating 3'LTR (figure 5).

For the lentiviral particles produced with a transfer vector with combined expression ore recombinant protein and multicistronic shRNA expression, 5'LTR was integrated followed by the psi-packaging signal, the Rev responsive element (RRE), the EF-la promoter, the (cPPT), the eGFP coding sequence, the Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE), the tetracycline responsive element (TetO), the 5' EcoBl restriction site (generated by splitting the original EcoKI site by the cloning procedure), the 5' BsiWI site (added in during the oligonucleotide synthesis step), the SFFV promoter, the sAAT2 ORF, the 7SK promoter sequence, the shRNA sense-loop- antisense sequence, a spacer, the 7SK termination sequence, a second spacer, the Ul promoter sequence, a second shRNA sense-loop-anti sense sequence, a spacer, the Ul termination sequence, the 3' EcoBl restriction site, the HI promoter, the MM cloning site, the cloned shRNA oligonucleotide, the CM restriction site and the self-inactivating 3'LTR.

It is essential to note that in the mentioned multicistronic transfer vectors, the shRNA sequences are interchangeable, i.e. in one vector shRNA expression is not confined to one type of shRNA (e.g. shRNAl). Each promoter individually controls the expression of its succeeding shRNA, meaning that in the presence of three different promoters there is the possibility to express two different shRNA (shRNAl plus shRNA 3) using one single lentiviral vector.

Some publications suggest that using one and the same RNA polymerase promoter in multicistronic shRNA expression has no influence on the efficiency of shRNA expression (Stove et al., 2006). However, it has been demonstrated that recombinational events may occur between homology sequences when using promoters of the same type (ter Brake O et al, 2008). Therefore, distinct RNA polymerase promoters were chosen to mediate individual shRNA expression from one lentiviral vector to achieve highly efficient knock-down of the target gene. In this invention these were the 7SK promoter, the Ul promoter and the HI promoter already integrated into the pLVTHM transfer vector. The interfering RNA sequences were designed by the means of online RNAi design web tools made available by Invitrogen, Thermo Scientific and Invivogen. In this specific application, the described experiments implement the calculated RNA sequences as short-hairpin RNAs expressed with the help of RNA polymerase promoters delivered to target cells by the means of lentiviral delivery. It has to be emphasized that the calculated RNA sequences are not limited to the use as solely shRNAs, but can also be introduced into target cells and tissue by other viral or non-viral delivery systems which use miRNA and siRNA as expression modulators instead of shRNAs. The experiments described in this application are used as examples of RNAi with these specific RNA sequences.

Three positive control shRNA (shRNA Ctrl 1, shRNA Ctrl 2 and shRNA2) that had previously published were taken along with experiments. The target sequence of shRNA Ctrl 1 is located at 102 - 120 bp of the ORF of NM_000295.4 (sense strand SEQ ID NO: 5; anti-sense strand SEQ ID NO: 6). The sequences were integrated into the sense and anti-sense cloning oligonucleotides SEQ ID NO: 7 and SEQ ID NO: 8. The target sequence of shRNA Ctrl 2 is located at 732- 752 bp of ORF of NM_000295.4 (sense strand SEQ ID NO: 9, anti-sense SEQ ID NO: 10). The matching cloning oligonucleotides were SEQ ID NO: 11 and SEQ ID NO: 12. The target sequences for shRNA2 were 785- 803 bp of the ORF of NM_000295.4 (sense SEQ ID NO: 17, anti-sense SEQ ID NO: 18; sense oligonucleotide SEQ ID NO: 19 and antisense SEQ ID NO: 20). The sense and anti-sense oligonucleotides were annealed and cloned into the linearized pLVTHM lentiviral transfer vector.

The target sequences were for shRNA 1 917 - 937 bp of the ORF of NM_000295.4 (sense SEQ ID NO: 13, anti-sense SEQ ID NO: 14; sense oligonucleotide SEQ ID NO: 15 and antisense SEQ ID NO: 16), and for sRNA 3 981-1001 bp of the ORF of NM_000295.4 (sense SEQ ID NO: 21, anti-sense SEQ ID NO: 22; sense oligonucleotide SEQ ID NO: 23 and antisense SEQ ID NO: 24). The sense and anti-sense oligonucleotides were annealed and cloned into the linearized pLVTHM lentiviral transfer vector. In the original pLVTHM lentiviral transfer vector, shRNA expression is mediated by the HI promoter in a unicistronic manner. In the newly designed multicistronic versions of pLVTHM, shRNAs were expressed each individually controlled by one specific RNA polymerase promoter. Theoretically, one could randomly combine any shRNA in these vectors to create the most the efficient RNAi knock-down tool.

Rescue expression of synthetic AAT (sAAT7sAAT2)

In this invention, synthetic AAT is expressed by lentiviral vectors to replace the AAT that has been subject to RNA interference mediated by shRNA and to replace defective AAT.

However, expression of the synthetic proteins described in this invention is not limited to lentiviral vectors, but can be extended to all kinds of viral and non-viral expression systems. Expression of sAAT and sAAT2 does not have to be combined with the expression of shRNAs, but can be stand alone as well. sAAT/sAAT2 were cloned into the lentiviral transfer vector pSFFV.IRES.dTomato in which shRNA and rescue expression of the recombinant sAAT/sAAT2 was not combined. When using this approach, target cells were first transduced with LV-shRNA introducing the essential elements for knock-down of endogenous M-AAT/Z-AAT. Subsequently, target cells were transduced with LV-sAAT to ensure replacement expression of sAAT. Double transduction of target cells is possible and this approach has been widely used to transduce cells with several recombinant proteins at a time. However, risks are lower transduction efficiency and increased cell toxicity.

The expression of the recombinant protein sAAT and sAAT2 was controlled by the spleen focus forming virus (SFFV) promoter. The SFFV promoter was chosen because of its strong eukaryotic expression ability in various cell types and its safety characteristics. Numerous publications use the SFFV promoter to mediate highly efficient expression of recombinant proteins. The high expressional activity of SSFV may be a crucial prerequisite to overcome the serum level therapeutic threshold of AAT needed to treat AATD related lung emphysema. Other eukaryotic promoters, including hepatocyte derived Albumin promoter may not exhibit expressional activity high enough to secure AAT serum levels above the 11 μΜ threshold.

The synthetic sAAT and sAAT2 were designed with integrated point mutations compared to wild-type NM 000295.4 to (i) eliminate one BamHI restriction site at position 75 nt of the ORF of NM_000295.4 and (ii) to render the synthetic AAT gene sequence and mRNA resistant against the introduced interfering RNAs. By deletion of the BamHI restriction site the recombinant gene sequence will be flanked by BamHI restriction sites to facilitate restriction analysis patterns and to be able easily excise the whole gene in subsequent cloning strategies. However, the BamHI site is not essential for the invention and does not have implications on expression levels of sAAT/sAAT2 or shRNA knockdown ability.

In order to test the application and to compare with suitable positive controls one designed sAAT. sAAT does contain the silent point mutations making it resistant to all shRNA described above including the control shRNAs. In contrast, sAAT2 does not contain the silent mutations within the target sequences of shRNA Ctrl 1 and shRNA Ctrl 2. Thus, sAAT2 equals the naturally occurring M-AAT to higher extent which may have beneficial effects on expression levels and sustainability in the blood stream.

The target sequences of all shRNAs are presented in the sequence of wild-type M-AAT (NM_000295.4 SEQ ID NO: 1). Z-AAT differs from M-AAT by only one amino acid exchange which is located outside the sequences targeted by the shRNAs. Therefore, in the context of RNA interference mediated by these specific shRNAs, Z-AAT can be considered as being equivalent to M-AAT in this application. Although shRNAs do not target sAAT or sAAT2, the sequences in sAAT/sAAT2 corresponding to the targeted sequences in M- AAT/Z-AAT are highlighted in the sAAT/sAAT2 genes (SEQ ID NO: 2 and SEQ ID NO: 3) for reasons of clarification.

Primers for wild type AAT and synthetic sAAT Knock-down efficiency and rescue expression of sAAT/sAAT2 was monitored mainly by the means of quantitative PCR. In order to distinguish M-AAT/Z-AAT from sAAT/sAAT2, primers were designed to specifically recognize and amplify either M-AAT/Z-AAT or sAAT/sAAT2. In the synthetic version of AAT, silent point mutations were integrated at short- stretched specific locations to render the sAAT/sAAT2 immune against shRNAs. These modified genetic stretches were approximately 19-21 bp long, representing the ideal template for sAAT/sAAT2 specific qPCR primers.

For M-AAT/Z-AAT detection, the primer pair 1/2 used the forward (sense) target sequence of shRNA 2 (prior art) (785 - 803 bp) of M-AAT/Z-AAT as a forward qPCR primer template (SEQ ID NO: 29) and the reverse (anti-sense) target sequence of shRNA 3 (981 - 1001 bp) of M-AAT/Z-AAT as a reverse qPCR primer template (SEQ ID NO: 30).

For detection of sAAT/sAAT2, the primer pair 3/4 used the forward (sense) sequence of sAAT/sAAT2 replacing the target sequence of shRNA 2 (prior art) (785 - 803 bp) as a forward qPCR primer template (SEQ ID NO: 31) and the reverse sequence (anti-sense) of sAAT/sAAT2 replacing the reverse target sequence of shRNA 3 (981 - 1001 bp) as a reverse qPCR primer template (SEQ ID NO: 32). The primer pair exclusively detected DNA template from sAAT/sAAT2, resulting in the amplication of sAAT/sAAT2 fragments only. The discrimination against M-AAT/Z-AAT made it a valuable asset in specifically detecting synthetic AAT.

In the qPCR experiments, the malate dehydrogenase (MDH) gene was used as reference gene. The MDH specific primers (SEQ ID NO: 33 and SEQ ID NO: 34) were previously published in Riedel et al (2013).

Sequencing primers

In order to detect the insertion of the cloning oligonucleotides in pLVTHM. shRNA 1, pL VTHM . shRNA 1x3 or pL VTHM . shRNA 1x3. s A AT2, sequencing primers were design to amplify the nucleotide template located between the EcoBl cloning site located upstream of the and the CM site at the 3' end of the insertion site. This allowed full length sequence analysis of short shRNA only insertions as well as extenden sAAT- multiple shRNA insertions.

Methods

The following section describes methods useful in working the present invention. The methods are exemplary and illustrative, and shall not be considered as limiting the scope of the invention, which is that of the appended claims. The skilled person will appreciate that materials and methods that are common general knowledge in the art may also be used to put the present invention into practice. Such materials and methods are disclosed i.a. in Molecular Cloning: A Laboratory Manual (Sambrook et al., CSH Laboratory Press, NY, USA), Gene Biotechnology (Wu et al, CRC Press) and Bioanalytik, (Lottspeich, 1998, Spektrum

Akademischer Verlag, Heidelberg ).

Cell Culture Maintenance Lenti-X™ 293T Cell Line (ClonTech # 632180) was used for lentiviral production. The cells cultures were thawed according to manufacturer's instructions and maintained in T-175 cm ² flasks containing Dulbecco's Modified Earl's Medium (DMEM; Lonza #BE12-614F) supplemented with 100E/100E Penicillin/Streptomycin (PenStrep; Lonza #17-602E), 2 mM L-Glutamine (Lonza #17-605E), 1 mM sodium pyruvate (Lonza #BE13-115E) and 10 % HyClone™ Fetal Bovine Serum (FBS; GE #SV30160.03) if not stated otherwise.

HepG2 cells (Sigma-Aldrich #85011430-1VL) were used for transduction experiments. The cells were thawed according to the manufacturer's instructions and maintained in T-175cm ² flasks containing Roswell Park Memorial Institute medium (RPMI; Lonza #BE12-115F) supplemented with Penicillin/Streptomycin and 10 % FBS if not stated otherwise.

For sub-cultivation, cell cultures were washed with Dulbecco ^' s phosphate buffered saline (DPBS, Lonza #17-512F), trypsinised with HyClone Trypsin 0.05% (GE SH40003.01), resuspended in medium and transferred into new cell culture flasks.

Generation of lentiviral transfer plasmids

Cloning of single shRNA into pLVTHM

siRNA/shRNA sense nucleotide sequences were designed by the web based RNAi software Block-iT™ RNAi designer by Invitrogen, GeneAssist™ Custom siRNA Builder by Thermo Scientific and siRNA Wizard™ by Invivogen. The sense and anti-sense oligonucleotides were designed as described by Wiznerowicz and Trono. The paired sense and anti-sense oligonucleotides contained an overhang 5 '-MM restriction site, followed by a CCCC linker element, the 19-21 nucleotide (nt) sense siRNA sequence, the ACTCGAGA hairpin loop, the 19-21 nt anti-sense siRNA sequence, the χχχχχ termination signal, a GGAA linker and an overhang 3 '-CM restriction site. The overhang restriction sites were implemented to easily insert the oligonucleotide into the lentiviral transfer vector linearised with CM and MM.

Sense and anti-sense oligonucleotides were acquired from Eurofins Genomics with high liquid pressure chromatography (HLPC)-purity and diluted to stock solutions with concentration around 2 μg/ml (~100μΜ). 2 μg of sense and 2 μg anti-sense oligonucleotides of one oligonucleotide pair were transferred into a 1.5 ml centrifugation tube and diluted with 48 μΐ annealing buffer (10 mM Tris, 50 mM NaCl, 1 mM EDTA, pH 7.5-8.0). The oligo mixture was incubated at 95 °C and cooled down at RT for > 45 min.

The annealed oligonucleotides were cloned into the pLVTFDVI (a gift from Didier Trono, Addgene plasmid #12247) shRNA expressing lentiviral transfer plasmid backbone using a standardized cloning protocol. In short, 2 μg of pLVTFDVI was digested with 1 μ1/10 units MM (New England Biolabs, NEB R0198S) and 2 μ1/20 units CM (NEB R0197S) in NEB buffer 3.1 at 37 °C for 10 minutes. The restriction enzymes were heat-inactivated at 65 °C for 20 min and the digested plasmid was gel-purified using the Macherey & Nagel (M&N) Gel and PCR Clean-up kit (M&N #740609.250) following the manufacturer's instructions. The annealed oligonucleotides were diluted 1 : 10 and 1 : 100. 1 μΐ of diluted oligonucleotides were ligated into 200 ng of the linearised pLVTHM vector using 1 μ1/400 u T4 ligase (NEB M0202S), 13.5 μΐ distilled water and 2 μΐ lOx ligase buffer (NEB B0202S). The ligation reaction was incubated at room temperature for 30 minutes and the ligase was heat-inactivated at 65 °C for 10 minutes. 1-5 μΐ of the ligation mixture was immediately transformed into One Shot STBL3 chemically competent E. coli (Invitrogen #C737303) following the

manufacturer ^' s instructions. Transformed STBL3 E. coli were transferred into LB- Agar plates containing 50 μg/ml Ampicillin and incubated overnight at 37 °C. Bacterial colonies were transferred into LB-medium containing 50 μg/ml Ampicillin and incubated overnight at 37 °C in a rotating shaker. The high copy plasmids from the bacterial overnight cultures were purified in a mini-scale (NucleoSpin ^® Plasmid, M&N #740588.250), medium-scale

(NucleoBond ^® PC 100, M&N #740573) or large-scale (NucleoBond ^® PC 2000, M&N

#740576) format following the manufacturer's instructions. The purified plasmids were named pLVHTM. shRNActrl 1 , pLVTHM. shRNActrl2, pLVTHM. shRNA 1 ,

pLVTHM.shRNA2 or pLVTHM. shRN A3, respectively (common name as a group:

pLVTHM. shRN A). The transfer plasmids were analysed for shRNA oligonucleotide insertion by restriction digest analysis and by sequencing using sequencing primers 100 and 101 upstream and downstream of the MlullClal insertion site. Sequencing was performed using the Mix2Seq ^® sequencing services of Eurofins Genomics.

Design of synthetic alpha-l-antitrypsin (sAAT)

There were several prerequisites for the recombinant synthetic alpha- 1 -antitrypsin. First, the recombinant synthetic alpha- 1 -antitrypsin should easily be cloned into a well-known lentiviral expression vector. Second, the newly designed sAAT should also be resistant to all shRNA/siRNA directed against naturally occurring alpha-l-antitrypsin (M-AAT and all MZ, ZZ isoforms) tested in this application. Third, it was required that the lentiviral expression vector had a high expressional activity in human hepatocytes in order to ensure sufficient rescue expression of the recombinant sAAT and to maintain therapeutical levels of alpha-l- antitrypsin in the blood stream.

In order to meet these prerequisites, a total of 39 nucleotides of the wild-type M-AAT

(NM_000295.4) were manually identified as candidates for silent point mutations, thereby protecting the wild-type amino acid sequence and protein folding as seen in M-AAT. While 38 point mutations were introduced to render sAAT resistant to shRNA/siRNA knock-down, one single silent point mutation (G75 A) was introduced to delete one BamHI restriction site within the open reading frame of M-AAT (Table 1). The deletion of the in-frame BamHI restriction site made it possible to flank the recombinant sAAT with BamHI restriction sites and to digest the recombinant sAAT gene with BamHI without interrupting the ORF. This way it was possible to easily introduce the full-length sAAT into the lentiviral expression vector pSFFV.IRES.dTom that uses BamHI restriction sites for insertion of recombinant genes. pSFFV.sAAT.IRES.dTom was a gift from Axel Schambach (Medizinische Hochschule Hannover, Germany). Cloning of sAAT

Synthesis and cloning of sAAT into pSFFV.IRES.dTom was performed by Gene Art ^® g synthesis and cloning services from ThermoFisher Scientific. The product was named pSFFV.sAAT.IRES.dTom (figure 3).

Design of transfer vector containing multiple shRNAs

Expression of shRNA is dependent on the promotional activity regulating the RNA

Polymerases. In pLVTFEVl.shRNA, expression of the single shRNA is dependent of the HI promoter (5398 - 5612) located upstream of the MM/CM cloning site (5611 - 5681) for shRNA-oligonucleotides. One approach to maximize sRNA knockdown of native alpha- 1- antitrypsin was to multiply the numbers of shRNA elements in the pLVTFIM. shRNA vector. This could be achieved by insertion of additional shRNAs, each individually regulated by the promotional activity of specific RNA polymerase promoters such as the RNA polymerase III 7SK promoter and RNA polymerase II Ul promoter. An EcoRI restriction site (5392) was located upstream of the HI promoter allowing insertion of such additional elements into pLVTHM.sRNA.

The design of the insert (SEQ ID NO: 37) containing additional RNA polymerase promoters and shRNAs included a 5' GCGC overhang, an EcoRI site (GAATTC) followed by a BsWI site (CGTACG), the 7SK promoter sequence

CTGCAGTATTTAGCATGCCCCACCCATCTGC

AAGGCATTCTGGATAGTGTCAAAACAGCCGGAAATCAAGTCCGTTTATCTCAAAC TTTAGCATTTTGGGAATAAATGATATTTGCTATGCTGGTTAAATTAGATTTTAGTT AAATTTCCTGCTGAAGCTCTAGTACGATAAGTAACTTGACCTAAGTGTAAAGTTG AGATTTCCTTCAGGTTTATATAGCTTGTGCGCCGCCTGGGTACCTC, the shRNA sense-loop-antisense sequence CGCGTCCCCGGTCTGCCAGCTTACATTTAC ACTCGAGA GTAAATGTAAGCTGGCAGACC (for shRNA 1; sense and anti-sense in italique, hairpin loop underlined), a GGTCTTCACCTGAGG spacer, the 7SK terminations sequence TTTTT, a GCGCGCGC spacer, the Ul promoter sequence

CTAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAG GGAGAGGCAGACGTCACTTCCCCTTGGCGGCTCTGGCAGCAGATTGGTCGGTTGA GTGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACTGTCGGTGACATCACGGAC AGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCT GCTTCACCACGAAGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCG GAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGG GGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGA GGCCCAAGATCTC, a second shRNA sense-loop-antisense sequence CGCGTCCCC GGTCTGCCAGCTTACATTTACACTCGAGAGTAAATGTAAGCTGGCAGACC (for shRNA 1; sense and anti-sense in italique, hairpin loop underlined), a GCAGTCTGGAG spacer, the Ul termination sequence TTTCAAAAGTA GACTG, an 3' EcoRI site and a 3' GCGC overhang.

Synthesis of the newly designed insert and cloning into pLVTHM.shRNA was performed by GeneArt ^® gene synthesis and cloning services from ThermoFisher Scientific. The newly generated plasmids were purified as described earlier. Insertion was validated by sequencing and restriction analysis. The plasmids were named pLVTHM.shRNAYx3 (Y representing the character of the shRNA = shRNAl shRNA2 or shRNA3) and allowed expression of triple shRNA controlled by three individual RNA polymerase promoters.

Design of transfer vector containing combined expression of a rescue synthetic alpha-1- anitrypsin 2 (sAAT2) and multiple shRNAs

One major goal was to acquire simultaneous expression of multiple shRNA and recombinant synthetic alpha- 1 -antitrypsin resistant to shRNA from transduction with one lentiviral specimen. To achieve this, expressional elements needed for the rescue expression of a synthetic alpha- 1 -antitrypsin 2 (sAAT2) were integrated into one cloning oligonucleotide insert along with additional RNA polymerase promoters and shRNAs. The expressional elements were spleen focus forming virus (SFFV) promoter, a spacer and the ORF of sAAT2 and were flanked by a BsiWI restriction site. The SFFV promoter is characterized by high expressional activity in hepatocytes. sAAT2 (SEQ ID NO:3) was modified compared to sAAT by removing the silent point mutations causing resistance against shRNA Ctrl 1 and shRNA ctrl2. The sequence of the entire insert containing sAAT2 expressional elements and multiple shRNAsl can be viewed in sequences as SEQ ID NO: 38.

The insert was synthesized as a whole and cloned into pLVTHM.shRNA by GeneArt ^® gene synthesis and cloning services from ThermoFisher Scientific. The newly generated plasmids were purified as described earlier. Insertion was validated by sequencing and restriction analysis.

Lentivirus production using the calcium chloride transfection method

The procedures for lentiviral production were based on the calcium chloride transfection method described earlier (Dull et al., 1998). The following stock solutions were prepared in advance:

HBS (2x): 50 mM HEPES, 280 mM NaCl (16.36 g/L), 1.5 mM Na ₂ HP0 ₄ (0.21 g/L), adjust pH to 7.12 with 5 M NaOH.

Calcium Chloride (2.5 M): 27.75 g anhydrous CaCl ₂ (Sigma #C5670) are dissolved in 100 ml dH ₂ 0, sterile-filtered through a 0.22 μπι filter and aliquoted into 1 ml aliquots.

Chloroquine (25 mM): 0.129 g chloroquine diphosphate salt (Sigma #C6628) were dissolved in 10 ml distilled water, sterile-filtered through a 0.22 μπι filter and aliquoted into 500 μΐ aliquots. Protamine sulfate (8 mg/ml): 80 mg protamine sulfate (Sigma #P4020) were dissolved in 10 ml distilled water, sterile-filtered through a 0.22 μπι filter and aliquoted into 500 μΐ aliquots.

10-14 days before lentiviral production HEK293T were propagated frequently every 2-3 days in T175cm ² flasks. 24 hours before transfection, cells were harvested and 4.5* 10 ⁶ HEK293T cells were seeded into 10 cm Petri dishes containing DMEM + supplements. Two hours before transfection, cell confluency was determined and should have reached approximately 70 % - 80 %. The cell medium was exchanged to DMEM containing Penicillin/Streptomycin, 1 mM L-glutamine, 1 mM sodium pyruvate 10% FCS, 10 mM chloroquine (Sigma #6628) and 10 mM HEPES (Gibco #15630-080).

Preparation of the transfection plasmids were started one hour before transfection. For a large- scale batch of lentiviral production of one specific lentivirus, ten Petri dishes were treated with transfection plasmids. The following numbers are stated as the required amounts for each Petri dish. For a medium-scale lentiviral production using ten Petri dishes the numbers have to be multiplied by ten. The plasmids pMD2.G, and psPax2 and were a gift from Didier Trono (Addgene plasmid # 12259, and 12260, respectively).

10 μg of lentiviral transfer plasmid, 12 μg of psPax2 plasmid (containing the Gag-pol-rev genes) and 1.5 μg of the vesicular stomatitis virus (VSV) envelope expression plasmid pMD2.G plasmid were mixed in a 50 ml conical tube. The plasmids were diluted with sterile distilled water to a volume of 450 μΐ and 50 μΐ 2.5 M CaCh were added. The mixture was transferred into 500 μΐ room temperature FIBS (making it a total volume of 1000 μΐ), incubated at room temperature for 20 minutes. One ml of the mixture was added dropwise moving in circles above the Petri dish to cover the entire dish area. The transfected cells were incubated for 12 hours at 37 °C at 5 % C0 ₂ . The medium was exchanged 12 and 24 hours after transfection with DMEM containing supplements without chloroquine. The cell culture supernatant containing the lentiviral particles was collected 36 hours after transfection and sterile filtered through 0.22 μιη Millex-GP filters (Millipore # SLGP033RS). The sterile filtered supernatant, approximately 70 ml in total volume, was transferred into the Centricon ^® Plus-70 Centrifugal Filter Units.

Concentration of the lentivirus by ultrafiltration

A 15-20-fold concentration of the lentivirus supernatant was achieved by ultrafiltration with the Centricon ^® Plus-70 Centrifugal Filter Units (Millipore #UFC710008). A total of 70 ml sterile filtered supernatant was transferred into the Centricon ^® Plus-70 Centrifugal Filter Unit container and placed into a refrigerated centrifuge. The supernatant was filtered by

centrifugation at 3500 g at 4 °C for approximately 17-20 minutes until the retained

supernatant reached a volume of about 3-4 ml. The container was placed into the collection cup and centrifuged at 1500 g, 4 °C for 2 min. The concentrated lentivirus was aliquoted into 1.5 ml centrifugation tubes and stored at -80 °C.

Determination of lentivirus titers using FACS Titration of the lentivirus was performed using flow cytometry associated sorting (FACS)- based calculations of multiplicity of infection (MOI) and infective particles per volume. The concentrated lentiviral was diluted 1 : 10 with RPMI 1640 + supplements. 1 * 10 ⁵ HepG2 cells were seeded into each well of a 24-well dish and maintained in RPMI 1640 + supplements containing 4 g/ml protamine sulphate. For transduction, rising volumes (i.e. 1 μΐ, 2 μΐ, 5 μΐ, 10 μΐ, 20 μΐ and 40 μΐ) of the diluted lentivirus were added to the HepG2 cells and incubated at 37 °C 5 % C0 ₂ for 24 hours. Medium was exchanged every two to three days. The HepG2 cells were harvested on day five for flow cytometry analysis. Cells were washed with PBS (GE, #) once and treated with 100 μΐ 0.05% trypsin acid (EDTA, GE, #) for 5 minutes at 37 °C. Cells were detached by soft shaking of the wells and resuspended with 400 μΐ RPMI + supplements. The cells were centrifuged at 300 rcf for 5 min and resuspended with 300 μΐ FACS buffer (PBS + 1% BSA + 2 mM EDTA). The percentage of fluorescent cells was detected by flow cytometry and used to calculate the viral.

Lentivirus infection of target cells

Concentrated lentivirus was thawed shortly before transduction of cells. HepG2 cells were seeded at a density of 0.45* 10 ⁵ or 1 * 10 ⁶ cells into the wells of 12-well dishes or 6-well dishes, respectively, prior to transduction and maintained in RPMI 1640 + supplements + protamine sulfate. Target HepG2 cells were transduced with a calculated amount of infective lentiviral particles equalling the desired MOI. Transduction was performed for 24 hours at 37 C, 5 % CO2. Medium was exchanged 24 hours after transduction and cells were maintained with RPMI supplemented with 10 % FCS and Penicillin/Streptomycin. Medium was exchanged every two to three days. Cells were prepared for Western Blot, FACS or quantitative real-time PCR at least three days after transduction.

FACS and sub-cultivation

HepG2 cells were prepared and pelleted as mentioned in the protocol for determination of lentiviral titers by FACS. The cells were resuspended in PBS (+ 5 mM EDTA) and filtered through a cell strainer with 40 μιη pores (Falcon 352340). The cells were sorted for eGFP fluorescent cells and sub-cultured in 6 well plates for analysis with FACS, qPCR and Western Blot once recovered.

mRNA isolation

Total RNA from transduced and non-transduced cells was isolated using the RNA isolation kit from Macherey & Nagel (reference number 740955.250). All steps were performed on ice. In detail, cell medium was discarded, 250 μΐ Lysis Buffer RAl supplemented with 1% (v/v) β-mercaptoethanol was added to the cells and incubated for 1 minute. The entire cell layer was repeatedly aspirated with a 3 ml syringe to disrupt the cell membrane and release RNA. The cell suspension was transferred into the NucleoSpin ^® filter units accompanying the RNA isolation kit. RNA isolation was performed using the manufacturer's instructions. RNA was eluted with 60 μΐ RNAse-free water. DNAse digestion of the RNA samples was repeated with the QIAGEN DNAse digestion kit to ensure minimal background DNA signals during qPCR. Additional digestion of RNA with DNAse and RNA precipitation

Isolated mRNA was once again digested with QIAGEN RNAse-free DNAse set (50) (Qiagen # 79254) following the manufacturer's instructions to ensure efficient removal of residual genomic DNA. In detail, 30 μΐ of isolated mRNA was treated with 10 μΐ Rx buffer RDD, 2.5 μΐ DNAse and 57.5 μΐ water and incubated for 30 min at room temperature. RNA was precipitated using the sodium acetate ethanol precipitation assay. For this, 10 μΐ (1/10 volume) of 3 M sodium acetate was added to the mRNA mixture treated with DNAse along with 2.5 times volume 100 % Ethanol. The mixture was incubated at -20 for at least two hours and centrifuged at 4 °C for 60 min at 11000 g. The RNA pellet was washed with 200 μΐ 70 % ethanol and air-dried for 15 min. The RNA pellet was resuspended with 50 μΐ RNAse-free water. The RNA concentration was determined using the Nanodrop 2000.

Reverse transcription

Reverse transcription was performed with High Capacity cDNA Reverse Transcription Kit (ThermoFisher Scientific #4368814) following the manufacturer's instructions. In short, 500 ng RNA were mixed with 2 μΐ reverse transcriptase (RT) buffer, 0.8 μΐ dNTPs, 2 μΐ random primer, 1 μΐ RT (50 u) and distilled water was added up to a total volume of 20 μΐ. The reverse transcription reaction was performed at 25 °C for 10 min, at 37 °C for 120 min, at 85 °C for 5 min and kept on hold at 4 °C until further treatment.

qPCR

cDNA samples were diluted 1 : 10 with distilled water. qPCR reactions were performed using iQ™ SYBR ^® Green Supermix (BioRad #170-8886) following the manufacturer's

instructions. In short, 5 μΐ diluted cDNA was mixed with 0.5 μΐ forward qPCR primer, 0.5 μΐ reverse qPCR primer, 10 μΐ of SYBR Green mix and 4 μΐ distilled water per sample. qPCR cycles were onedenaturation cycle at 95 °C for 2 min, then 39 cycles of 5 seconds

denaturation at 95 °C and elongation at 60 °C for 30 seconds. At the end, a melting curve was determined. Gene expression analysis was performed using the AACT method (Livak and Schmittgen, 2001).

Western Blot

Medium supernatant of transduced and non-transduced HepG2 cells was collected in 1,5 ml 1.5 ml centrifugation tubes and protein was precipitated by trichloroacetic (Sigma # T6399) acid protein protocol.

The cell medium supernatant was treated with 100 % trichloroacetic acid to a final volume of 20 % trichloroacetic acid. The mixture was centrifuged at 4 °C for 30 minutes and the precipitate was resuspended in 300 μΐ treated with 10 mis T-PER Tissue Protein Extraction Reagent (Thermo #78510) containing one tablet Complete protease inhibitor (Sigma #000000011697498001) and one tablet Phosstop (Sigma #000000004906845001).

The protein concentration of the resuspended precipitate and the cell lysate was determined by Pierce 660 nm Protein Assay Reagent (Thermo #22860) following the manufacturer's instructions.

Each sample was treated with 2x SDS PAGE buffer and heated to 95 °C for 5 min. Equal amounts of protein (for lysate and cell medium supernatant, respectively) were loaded on SDS-PAGE 10 % and electrophoresed at 120 V for 1.5-2 hours. The proteins were transferred by wet blotting onto a nitrocellulose membrane at 100 mA for one hour. The membranes were washed three times with PBS-T (PBS containing 0.2 % (v/v) Tween-20) and incubated with 5% skim milk (w/v in PBS-T). The membranes were washed three times with PBS-T, incubated with primary antibodies goat-anti-AAT (Bethyl #A80-122A, dilution 1 :200) or rabbit anti-actin (Abeam ab8227, dilution 1 : 1000) overnight. The membranes were washed three times with PBS-T and incubated with secondary antibodies rabbit-anti-goat (Daco #P0160, dilution 1 :2000) and donkey-anti-rabbit (GE #NA934V, dilution 1 :2000), respectively, for one hour. The membranes were washed three times with PBS-T and prepared for chemolumiscence using Immobilon Western Chemiluminescent HRP Substrate (Millipore #WKBLS0500). HRP activity was measured by chemiluminescent detection.

RESULTS

Lentiviral transfer plasmids pSFFV.dTom.sAAT, pLVTHM.shRNAl/2/3,

pL VTHM . shRN A 1x3 and pL VTHM. shRNA 1 x3. s AAT2 were generated by molecular cloning. Insertion of the shRNA oligonucleotides and transgenic synthetic alpha- 1-antitiy sin was confirmed by restriction analysis and sequencing. Lentivirus were produced by

HEK293T cells using the calcium transfection method. Lentivirus titers for the SFFV-driven lentivirus ranged from 1.05 * 10 ⁶ to 6.75* 10 ⁶ infectious particles/ml. Titers for the pLVTFDVI- based lentiviruses ranged from 1.5* 10 ⁶ to 3.44 10 ⁷ infectious particles/ml. Lentiviral titers for LVTFDVI-based lentiviruses containing multicistronic expression of shRNAs and sAAT2 were determined to 2.09* 10 ⁶ infectious particles/ml for LV-shRNAlx3 and 7.16* 10 ⁵ infectious particles/ml for LV-shRNAlx3.sAAT2.

For overexpression and RNAi knock-down experiments, HepG2 cells were transduced with a specified multiplicity of infection. RNA from transduced cells was isolated and gene expression was determined by the means of qPCR.

Knock-down of native AAT by single shRNA expression

HepG2 cells were transduced with LV- shRNA 1/2/3, LV-shRNA Ctrl 1/2 and LV-scramble with a MOI of 1. Expression of native AAT (M-AAT, Z-AAT and other native AAT isoforms) was determined after six days by the means of qPCR (figure 7). The results demonstrate that shRNAl and shRNA 3 efficiently knock-down native AAT by the means of lentivirus mediated RNA interference. In these experiments shRNA 1 demonstrates a knockdown efficiency of 31% (p _S hRNAi=0.001) compared to scrambled shRNA. ShRNA 3 exhibits a knock-down efficiency of 44.5% The knock-down efficiency of the novel shRNAs 1 and 3 is similar to positive control shRNAs 1 and 2 and is statistically significant. On the contrary, shRNA 2 (prior art) (18.9 % ± 26.%) was not able to knock-down native AAT in a statistically significant manner compared to scrambled shRNA in this specific experimental setting. Control shRNA Ctrl 1 and shRNA Ctrl 2 show knock-down efficiencies of 31.7 % (± 26.8 %) and 34.5 % (± 22.5 %), respectively (pshRNA ctm < 0.05; p _S hRNA ctri2 < 0.05).

In a second attempt, HepG2 cells were treated with LV-shRNA 1/2/3, LV-shRNA Ctrl 1/2 and LV-scramble with a MOI of 0.5. Transduced eGFP positive cells underwent FACS processing to acquire pure cell cultures. Sorted cell cultures were cultured for three weeks until determination of MAAT expression by the means of qPCR (figure 8). The results show that shRNA 1 and shRNA 3 have knock-down efficiencies equivalent to control shRNAs that are significant compared to scramble shRNA. In pure cell cultures, shRNA 1 and shRNA 3 demonstrate a knock-down efficiency of 77.4 % (± 16.9%) and 76.5 % (± 15.7%), respectively Results from pure cell cultures confirm that the knock-down efficiency of 22 % (± 19.9 %) of shRNA 2 (prior art) is non-significant in this experimental setting Control shRNA Ctrl 1 and shRNA Ctrl 2 show significant knock-down efficiencies of 81.2 % (± 7.6 %) and 56.2 % (± 12.2 %), respectively

(PshRNA ctrll < 0.005; PshRNA ctrl2 < 0.005).

Overexpression of synthetic AAT

HepG2 cells were transduced with LV-sAAT or LV-shRNAlx3.sAAT2 with a MOI of 1. Expression of AAT/sAAT in the cell lysate and of secreted AAT/sAAT accumulated in the cell culture medium was determined by the means of Western blot. Proteins in the supernatant cell medium was precipitated by trichloroacetic acid precipitation and protein concentrations were determined using Pierce protein assay. In cell lysates, expression of AAT/sAAT is slightly elevated in treated cells compared to control cells. Levels of secreted AAT/sAAT is highly elevated in the cell medium of treated cells compared to untreated cells indicating a highly efficient production and secretion of synthetic sAAT from treated HepG2 cells (figure 9A). HepG2 cells treated with LV-sAAT also demonstrate specific high level expression compared to HepG2 cells treated with knock-down LV-shRNAl/2/3 (figure 9B).

In addition, expression of synthetic AAT (sAAT or sAAT2) was determined by the means of qPCR. For this reason, primers specifically detecting the synthetic variants used in this application were designed based on the distinct point mutations integrated in sAAT and sAAT2. HepG2 cells were transduced with LV-sAAT or LV-shRNAlx3.sAAT2 and RNA was isolated after six days. qPCR was performed to detect expression of sAAT and sAAT2 and expression levels were expressed as absolute quantities (copy number of sAAT/sAAT2). The results demonstrate that synthetic AAT (sAAT/sAAT2) are strongly expressed compared to non-treated control samples. HepG2 cells transduced with LV-sAAT contain 3191 (+/- 689.6) copies of sAAT in the analysed sample while HepG2 cells transduced with LV- shRNAl . sAAT2 contain 2687 (+/- 500) copies of sAAT2 (figure 10).

Knock-down of native AAT by expression of multiple shRNAs

Knock-down of native AAT by multicistronic shRNA expression was achieved by transduction of HepG2 cells with LV-shRNAlx3 or LV-shRNAlx3.sAAT2. RNA was isolated six days after transduction and AAT expression was analysed by M-AAT specific primers. The results demonstrate that native AAT is knocked-down significantly by LV- shRNAlx3 and LV-shRNAlx3. sAAT2 (pL -shRNAix3 1 MOI = 0.0057; pL -shRNAix3 2 MOI =

0.0263; pL -shRNAix3.sAAT2 = 0.0446). Native AAT is knock-downed by 55% (± 11%) in cells treated with LV-shRNAl at a MOI of 1, by 51% (± 5%) at a MOI of 2 and 44% (± 12%) in cells treated with LV-shRNAlx3.sAAT2 (figure 11).

The primers specifically amplify native AAT as expression levels of M-AAT remain within range in HepG2 cells transduced with LV-shRNAlx3.sAAT2 despite strong expression of sAAT2 (figure 10). If the primers had amplified sAAT2, readings would have been elevated by 100-fold or more.

References

Barnett VT, Sekosan M, Khurshid A. Wegener's granulomatosis and alphal -antitrypsin- deficiency emphysema: proteinase-related diseases. Chest. 1999 Jul; 116(l):253-5.

Brummelkamp TR, Bernards R, Agami R. A system for stable expression of short interfering RNAs in mammalian cells. Science. 2002 Apr 19;296(5567):550-3

Cox DW. Alpha- 1 -Antitrypsin: a guardian of vascular tissue. Mayo Clinic Proc.

1994;69: 1123-4

Cox DW, Smyth S. Risk for liver disease in adults with alpha 1 -antitrypsin deficiency. Am J Med. 1983 Feb;74(2):221-7.

Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L. A third-generation lentivirus vector with a conditional packaging system. J Virol. 1998 Nov;72(l 1):8463-71.

Fearnley IR, Spalton DJ, Ward AM, Slavin B, Muncey F. Alpha 1-antitrypsin phenotypes in acute anterior uveitis. Br J Ophthalmol. 1988 Aug;72(8):636-9.

Mazodier P, Elzouki AN, Segelmark M, Eriksson S. Systemic necrotizing vasculitides in severe alphal -antitrypsin deficiency. QJM. 1996 Aug;89(8):599-611.

McBean J, Sable A, Maude J, Robinson-Bostom L. Alphal -antitrypsin deficiency

panniculitis. Cutis. 2003 Mar;71(3):205-9.

Baum, C, Kustikova, O., Modlich, U., Li, Z. & Fehse, B. Mutagenesis and oncogenesis by chromosomal insertion of gene transfer vectors. Hum. Gene Ther. 17, 253-263 (2006).

Bessis, N., GarciaCozar, F. J. & Boissier, M. C. Immune responses to gene therapy vectors: influence on vector function and effector mechanisms. Gene Ther. 11 (Suppl. 1), S10-S17 (2004).

Burrows JA, Willis LK, Perlmutter DH. Chemical Chaperones mediate increased secretion of mutant alpha- 1-antitrypsin (alpha- 1 -AT) Z: A potential pharmacological strategy for prevention of liver injury and emphysema in alpha 1-AT deficiency. Proc Natl Acad Sci U S A. 2000;97: 1796-1801

Carrell RW, Lomas DA, Sidhar S, Foreman R. Al -Antitrypsin Deficiency. Chest 1996, 110;6,243S-247S.

Cruz PE, Mueller C, Cossette TL, Golant A, Tang Q, Beattie SG, Brantly M, Campbell- Thompson M, Blomenkamp KS, Teckman JH, Flotte TR. In vivo post-transcriptional gene silencing of alpha- 1 antitrypsin by adeno-associated virus vectors expressing siRNA. Lab Invest. 2007 Sep;87(9):893-902.

Eriksson S. Studies in alpha 1-antitrypsin deficiency. Acta Med Scand Suppl. 1965;432: 1-85. Hidvegi T, Ewing M, Hale P, Dippold C, Beckett C, Kemp C, Maurice N, Mukherjee A, Goldbach C, Watkins S, Michalopoulos G, Perlmutter DH. An autophagy-enhancing drug promotes degradation of mutant alphal -antitrypsin Z and reduces hepatic fibrosis. Science. 2010;329(5988):229-32.

Hidvegi T, Schmidt BZ, Hale P, Perlmutter DH. Accumulation of mutant alphal -antitrypsin Z in the endoplasmic reticulum activates caspases-4 and -12, FkappaB, and BAP31 but not the unfolded protein response. J Biol Chem. 2005 Nov 25;280(47):39002-15.

Hubbard RC, Crystal RG. Strategies for aerosol therapy of alpha- 1 -antitrypsin deficiency by the aerosol route. Lung 1990; 168 Suppl:567-578.

Karnaukhova E, Ophir Y, Golding B. Recombinant human alpha- 1 proteinase inhibitor: towards therapeutic use. Amino Acids. 2006;30(4):317-32.

Kramps JA, Bakker W, Dijkman JH: A matched-pair study of the leukocyte elastase-like activity in normal persons and in emphysematous patients with and without alphal -antitrypsin deficiency. Am Rev Respir Dis 1980, 121 :253-261.

Lawless MW, Greene CM, Mulgrew A, Taggart CC, O'Neill SJ, McElvaney NG. Activation of endoplasmic reticulum-specific stress responses associated with the conformational disease Z alpha 1-antitrypsin deficiency. J Immunol. 2004 May l; 172(9):5722-6.

Li CI, Xiao P, Gray SJ, Weinberg MS, Samulski RJ. Combination therapy utilizing shRNA knockdown and an optimized resistant transgene for rescue of diseases caused by misfolded proteins. Proc Natl Acad Sci U S A. 2011 Aug 23; 108(34): 14258-63

Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 Dec;25(4):402-8.

Mahadeva R, Dafforn TR, Carrell RW, Lomas DA. 6-mer peptide selectively anneals to a pathogenic serpin conformation and blocks polymerization. Implications for the prevention of Z alpha(l)-antitrypsin-related cirrhosis. J Biol Chem. 2002 Mar l;277(9):6771-4. Epub 2001 Dec 28.

Pack DW, Hoffman AS, Pun S, Stayton PS. Design and development of polymers for gene delivery. Nat Rev Drug Discov. 2005 Jul;4(7):581-93.

Parfrey H, Dafforn TR, Belorgey D, Lomas DA, Mahadeva R. Inhibiting polymerization: new therapeutic strategies for Z alphal -antitrypsin-related emphysema. Am J Respir Cell Mol Biol. 2004 Aug;31(2): 133-9. Epub 2004 Mar 11.

Petrache I, Hajjar J, Campos M. Safety and efficiency of alpha- 1-antitryspin augmentation therapy in the treatmedn of patients with alpha- 1-antitiy spin deficiency. Biologies

2009;3 : 193-204.

Putnam, D. Polymers for gene delivery across length scales. Nature Mater 2006. 5, 439-451. Ramarmooth M, Narvekar A, Non Viral Vectors in Gene Therapy- An Overview. Journal of Clinical and Diagnostic Research. 2015 Jan, Vol-9(l): GE01-GE06

Riedel G, Rudrich U, Fekete-Drimusz N, Manns MP, Vondran FW, Bock M. An extended ACT-method facilitating normalisation with multiple reference genes suited for quantitative RT-PCR analyses of human hepatocyte-like cells. PLoS One. 2014 Mar 21;9(3):

Sandhaus RA. Alpha- 1 -Antitrypsin deficiency. 6: new and emerging treatments for alphal- antitrypsin deficiency. Thorax. 2004 Oct; 59(10): 904-909.

Serres F, Blacno I. Role of alpha- 1 antitrypsin in human health and disease. Journal of Internal Medicine, 2014, 276; 311-335

Spencer LT, Humphries JE, Brantly ML. Antibody response to aerosolized transgenic human alphal -antitrypsin. N Engl J Med. 2005;352(19):2030-1.

Stove V, Smits K, Naessens E, Plum J, Verhasselt B. Multiple gene knock-down by a single lentiviral vector expressing an array of short hairpin RNAs. Electronic Journal of

Biotechnology 2006, 9(5): 572-579

Sveger T, Eriksson S. The liver in adolescents with alpha- 1 -antitrypsin deficiency.

Hepatology 1995, 22:514-517

Ter Brake O, Hooft K, Liu Y, Centlivre M, von Eige K, Berkhout B, Lentiviral Vector Design for Multiple shRNA Expression and Durable HIV-1 Inhibition, Mol Ther 16(3):557-564

Teckman JH, Perlmutter DH. Retention of mutant alpha(l)-antitrypsin Z in endoplasmic reticulum is associated with an autophagic response. Am J Physiol Gastrointest Liver Physiol. 2000 Nov;279(5):G961-74.

Vannucci L, Lai M, Chiuppesi F, Ceccherini-Nelli L, Pistello M. Viral vectors: a look back and ahead on gene transfer technology. New Microbiol. 2013 Jan;36(l): 1-22.

Wiznerowicz M, Trono D Conditional suppression of cellular genes: lentivirus vector- mediated drug-inducible RNA interference. J Virol. 2003 Aug . 77(16):8957-61

Yin H, Kanasty R, Eltouky A, Vegas A, Darkin JR, Anderson D. Non- Viral vectors for gene based therapy Nature Rev. Genet. 2014, 15, 541-555.