NOVEL VACCINE FOR THE PREVENTION OR TREATMENT OF AN

INFECTION CAUSED BY A HERPES VIRUS.

TECHNICAL FIELD

The present invention relates to the prevention or treatment of an infection caused by a herpes virus. The present invention provides vaccine compositions, methods and articles of manufacture intended for use in the prevention or treatment of an infection caused by a herpes virus, for example, a genital herpes infection caused by herpes simplex virus 2 (HSV-2). BACKGROUND OF THE INVENTION

Protection against genital herpes simplex virus 2 (HSV-2) infection requires local memory immune responses in the genital tract that can prevent virus spread to the dorsal root ganglia (DRG) of mice ^1,2 . Viral spread to the DRG occurs within 18hrs of infection, too quickly for circulating memory cells to be recruited into the female reproductive tract (FRT) ³ . Once in the DRG, HSV can no longer be cleared and the infection is life long ^3,4 . Mucosal vaccines can elicit local protective mucosal immune responses at distant sites ^5,6 , including the FRT, with the potential to prevent HSV-2 reaching or disseminating from the DRG ⁷ . However, mucosal vaccines are rare due to a lack of effective mucosal adjuvants. Thus, current initiatives to combat the genital HSV-2 epidemic are to develop new mucosal vaccines that protect against intravaginal (IVAG) HSV-2 challenge.

HSV-specific antibody in the vaginal lavage (VL) provides some protection against genital HSV-2 challenge but this is greatly improved by the presence of HSV-specific CD4 or CD8 tissue resident memory (T _RM ) cells ^12"14 . Shin et al. (2012) successfully recruited CD8+ TR _M cells into the genital tract epithelium of female mice without the need for IVAG challenge using a 'Prime and Pull' vaccine strategy ¹ . Mice were subcutaneously immunised with 10 ^5"6 pfu of live TK- HSV-2 to elicit HSV-2 specific immune cells in the circulation ¹ . Three days after immunisation, mice were intravaginally treated with chemokines, CXCL9 and CXCL10, that recruited HSV-2 specific CD8+ T cells from the circulation to the FRT ¹ . These CD8+ T _RM cells in the genital epithelia protected mice against subsequent IVAG challenge with a lethal dose of HSV-2 ¹ . Thus, the chemokine 'Pull' boosted recruitment of HSV-2 specific CD8+ T cells into the FRT and established CD8+ T _RM in the genital epithelium ¹ . This local memory immune response was the key to providing protection against genital HSV-2 challenge ¹⁵ but whether it can prevent virus dissemination from the DRG was not tested.

Oral vaccines are an underdeveloped immunisation strategy against STIs despite been able to elicit mucosal immune responses in the female genital tract ¹⁰ . Ogra et al. (1973) measured polio-specific antibody (S-IgA) in vaginal washes from females given the oral polio vaccine (OPV) ¹⁰ . Furthermore, Applicants previously showed that oral immunisation of mice with lipid C mixed with chlamydial major outer membrane protein (MOMP) elicited protective immunity against IVAG challenge with C. trachomatis ⁶ .

Applicants generated a genital tract immune response elicited by oral immunisation with Lipid K mixed with TK- HSV-2 or glycoprotein D (gpD) . These vaccines elicited HSV-2- specific IgA and IgG in the FRT and recruited antigen-specific T cells to the reproductive tract-draining caudal lumbar lymph nodes (CLN) but not the genital tract epithelium. The presence of antibody was associated with enhanced survival (60%) of mice after lethal IVAG WT HSV-2 challenge. To improve survival, orally immunised mice were intravaginally treated with the non-specific inflammatory agent l -fluoro-2,4-dinitrobenzene (DNFB) or chemoattractants CXCL9 and CXCL10. These pulled HSV-2-specific CD8 T _RM cells into the FRT, resulting in 100% protection against lethal WT HSV-2 challenge. Using the 'Prime and Pull' vaccine in HSV-2 infected guinea pigs, Applicants significantly reduced pathology reoccurrence compared to 'Prime' only controls. Thus, Applicants show an oral vaccine followed by an IVAG 'Pull' which acts as a protective prophylactic and therapeutic vaccine in mice and guinea pigs respectively.

Accordingly, the present invention provides a novel approach to management or treatment of genital herpes by providing compositions, methods and/or articles of manufacture involving oral administration of an antigen combined with a vaginal prime. SUMMARY OF TH E INVENTION

The inventions described and claimed herein have many attributes and examples including, but not limited to, those set forth or described or referenced in this Summary of the Invention . It is not intended to be all-inclusive and the inventions described and claimed herein are not limited to or by the features or examples identified in this Summary of the Invention, which is included for purposes of illustration only and not restriction .

In one aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at physiolog ical temperature.

In one aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at between about 30°C and 37°C.

In another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups. In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group.

In a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid.

In another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% of a triglyceride comprising a Ci4 acyl group.

In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group and at least about 15% of a triglyceride comprising a C 14 acyl group.

In yet a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid and at least about 15% myristic acid.

In yet a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises between 40% and 50% lauric acid and between 15% and 20% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid K.

In yet a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid C.

In a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid Ca. In a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid PK.

In a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid SPK.

In another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at physiological temperature.

In yet another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at between about 30°C and 37°C.

In another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups.

In yet another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group.

In a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid.

In another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% of a triglyceride comprising a Ci ₄ acyl group.

In yet another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group and at least about 15% of a triglyceride comprising a Ci ₄ acyl group. In yet a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid and at least about 15% myristic acid.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises between 40% and 50% lauric acid and between 15% and 20% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid K.

In a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid C.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid Ca.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid PK.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid SPK.

In yet another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at physiological temperature.

In yet another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at between about 30°C and 37°C.

In another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups.

In yet another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group.

In a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid.

In another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% of a triglyceride comprising a C 14 acyl group.

In yet another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group and at least about 15% of a triglyceride comprising a C14 acyl group.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid and at least about 15% myristic acid.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid component of the lipid carrier comprises between 40% and 50% lauric acid and between 15% and 20% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid carrier is Lipid K.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid carrier is Lipid C.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid carrier is Lipid Ca. In yet a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid carrier is Lipid PK.

In yet a further aspect of the present invention there is provided a vaccine composition comprising a glycoprotein D antigen derived from a herpes simplex 2 virus (HSV-2) and a lipid carrier, wherein the lipid carrier is Lipid SPK.

In another aspect of the present invention there is provided a vaccine composition as described herein, wherein the vaccine composition is formulated for a route of administration selected from the group consisting of oral; parenteral including subcutaneous, intradermal, intramuscular; mucosal; and aerosol.

In another aspect of the present invention there is provided a vaccine composition as described herein, wherein the vaccine composition is formulated for oral administration.

In another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at between about 30°C and 37°C.

In another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group.

In a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid.

In another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% of a triglyceride comprising a Ci ₄ acyl group.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% myristic acid.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group and at least about 15% of a triglyceride comprising a Ci ₄ acyl group. In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid and at least about 15% myristic acid.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises between 40% and 50% lauric acid and between 15% and 20% myristic acid.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid carrier is Lipid K.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid carrier is Lipid C.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid carrier is Lipid Ca.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid carrier is Lipid PK.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex virus antigen and a lipid carrier, wherein the lipid carrier is Lipid SPK.

In another aspect of the present invention there is provided a vaccine composition as described herein, wherein the vaccine composition is formulated for oral administration.

In another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at between about 30°C and 37°C.

In another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group. In a further aspect of the present invention there is provided a n oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid.

In another aspect of the present invention there is provided a n oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% of a triglyceride comprising a Ci ₄ acyl group.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% myristic acid.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group and at least about 15% of a triglyceride comprising a Ci4 acyl group.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid and at least about 15% myristic acid.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid component of the lipid carrier comprises between 40% and 50% lauric acid and between 15% and 20% myristic acid.

In yet another aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid K.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid C.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid Ca.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid PK.

In yet a further aspect of the present invention there is provided an oral vaccine composition comprising a herpes simplex 2 virus (HSV-2) antigen and a lipid carrier, wherein the lipid carrier is Lipid SPK. According to these aspects of the present invention, the vaccine composition comprising a herpes simplex virus antigen includes, but is not limited to, an antigen derived from a herpes simplex virus 1 (HSV-1) or a herpes simplex virus 2 (HSV-2).

In another aspect of the present invention there is provided a method for treating a patient infected by a herpes virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered locally at a site of infection or proximal to a site of infection, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient,

wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

In another aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

a vaccine composition according to the present invention and as described herein; and

an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

In a further aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia, of the patient provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus. In yet a further aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

(i) an oral vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

In yet a further aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

(i) via an oral route of administration, a vaccine composition comprising a glycoprotein D antigen derived from a herpes virus and Lipid K; and

(ii) via an intra-vaginal route of administration, an amount of an immunogenic agent sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

In another aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered locally at a site of infection or proximal to a site of infection, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient,

wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In another aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and (ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In a further aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia, of the patient provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In yet a further aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) an oral vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In yet a further aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) via an oral route of administration, a vaccine composition comprising a glycoprotein D antigen derived from a herpes virus and Lipid K; and

(ii) via an intra-vaginal route of administration, an amount of an immunogenic agent sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus. In yet a further aspect of the present invention there is provided a method for preventing spread of a herpes virus to a neurological tract following infection by the virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered locally at a site of infection or proximal to a site of infection, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient,

wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent spread of a herpes virus to a neurological tract following infection by the virus.

In another aspect of the present invention there is provided an article of manufacture for use in the treatment of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and

(iii) optionally, instructions for how to treat the herpes infection in the patient. In another aspect of the present invention there is provided an article of manufacture for use in the treatment of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and (iii) optionally, instructions for how to treat the genital herpes infection in the patient.

In another aspect of the present invention there is provided an article of manufacture for use in the prevention of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and (ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and

(iii) optionally, instructions for how to prevent the herpes infection in the patient.

In yet another aspect of the present invention there is provided an article of manufacture for use in the prevention of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and

(iii) optionally, instructions for how to prevent the genital herpes infection in the patient.

In yet another aspect of the present invention, there is provided a method for reducing a patient's risk to contracting, or being predisposed to contracting, an infection caused by a human immunodeficiency virus (HIV), the method comprising treating or preventing an infection caused by a herpes virus in the patient according to the present invention and as described herein.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows HSV-2 specific antibody and neutralisation capacity in the sera and VL of immunised mice. One week following final immunisation, (A) sera and (B) VL was taken from mice and subjected to an antigen-specific ELISA. The endpoint titre was calculated for each mouse (n = 10) and was used to calculate mean and SEM for each mouse group. (C) Sera and VL from immunised mice were mixed with 50pfu of TK- HSV-2 for lhr at 37°C before being plated on Vero cells. The plaques formed after three days were counted for each mouse (n = 10) and the mean and SEM for each vaccine group was calculated. The data represents three different experiments. One-way ANOVA with Bonferroni's Multiple Comparison Test compared control and vaccinated groups. (**) p<0.01 ; (***) p<0.001. n = 10

Figure 2 shows IFNy expression by CD8+ T cells in mice. One week after final immunisation, the spleen, MLN, GIT, CLN and FRT were pooled for 10 mice from each vaccine group. Cells were exposed to 10 ⁵ pfu of UV-inactivated TK- HSV-2 for three days before analysis by flow. For representative gating refer to Figure 9. (A) IFNy expression by CD8+ T cells in the spleen of immunised mice. The CD8-derived IFNy expression in the gastrointestinal immune system was observed in the (B) MLN and (C) GIT. IFNy expression by CD8+ T cells was also assessed at the site of infection by analysing the (D) CLN and (E) FRT. Error bars represent the SD of the mean. Two-tailed student's T test compared PBS controls to vaccine groups. Data is representative of two experiments. (*) p<0.05.

Figure 3 shows IFNy expression by CD4+ T cells in mice. One week after final immunisation, the Spleen, MLN, GIT, CLN and FRT were pooled for 10 mice from each vaccine group. Cells were exposed to 10 ⁵ pfu of UV-inactivated TK- HSV-2 for three days before analysis by flow. For representative gating refer to Figure 9. (A) IFNy expression by CD4+ T cells in the spleen of immunised mice. The CD4-derived IFNy expression in the gastrointestinal immune system was observed in the (B) MLN and (C) GIT. IFNy expression by CD4+ T cells was also assessed at the site of infection by analysing the (D) CLN and (E) FRT. Error bars represent the SD of the mean. Two-tailed student's T test compared PBS controls to vaccine groups. Data is representative of two experiments. (*) p<0.05.

Figure 4 shows pathology, survival and viral load in the spinal cord of orally immunised mice after IVAG infection with a lethal dose of WT HSV-2. (A) Orally immunised mice were monitored daily for pathology associated with a lethal WT HSV-2 infection. Pathology scores are representative of the following; 0, no symptoms/signs of infection; 1, Genital Erythema; 2, Moderate genital inflammation; 3, Severe and purulent genital lesions with loss of hair. (B) Mice presenting with a disease score of 3 were euthanised. (C) Euthanised mice had spinal cords extracted and viral load was determined by qRT-PCR of pre-weighed spinal cord removed from mice at sacrifice. Comparison of pathology and survival data was performed by One-way ANOVA followed by Tukey's multiple comparison test. Comparison of viral load in the spinal cord was performed by a two-tailed unpaired student's T test. (*) p<0.05; (**) p<0.01. (***)p<0.001. n=5-10.

Figure 5 shows CD8+ T _RM cells and IFNy in the FRT of mice. Mice were orally immunised with either 10 ⁶ pfu of live or UV-inactivated TK- HSV-2 mixed with Lipid K before IVAG application of either DNFB, CXCL9/10, CpG or Lipid K three days after final oral immunisation. Twelve weeks following IVAG 'Pull' mice were euthanised and their FRTs were removed and CD3+ CD8+ CD103+ T _RM cells isolated using flow. (A) The number of CD3+ CD8+ CD103+ T _RM cells per 10 ⁶ cells in individual FRTs of mice orally immunised with the 'Prime and Pull' method. (B) Removed FRTs CD8 cells were exposed to 10 ⁵ pfu of UV- inactivated TK- HSV-2 for 12hrs before IFNy expression by these cells was quantified. IFNy-expressing CD3+ CD8+ T cell numbers, exposed to 10 ⁵ pfu of UV-inactivated TK- HSV-2 for 12hrs, isolated from the FRTs of mice immunised by the 'Prime and Pull' strategy are expressed as a percent of total CD8 cells. (*) p<0.05; (**) p<0.01. n= 2-5.

Figure 6 shows pathology, survival and viral load in the spinal cord of mice immunised with the 'Prime and Pull' strategy. Mice orally immunised with either 10 ⁶ pfu of live or UV-inactivated TK- HSV-2 had the 'Pulls' DNFB, CXCL9/10, CpG or Lipid K applied intravaginally. Twelve weeks following IVAG pull, mice were intravaginally challenged with a lethal dose of WT HSV-2 and their genital pathology monitored daily. (A) Pathology scores are representative of the following; 0, no symptoms/signs of infection; 1, Genital Erythema; 2, Moderate genital inflammation; 3, Severe and purulent genital lesions with loss of hair. (B) Mice presenting with a disease score of 3 were euthanised. (C) Euthanised mice had spinal cords extracted and viral load was determined by qRT-PCR of pre-weighed spinal cord removed from mice at sacrifice. ND, not detectable virus. Comparison of pathology and survival data was performed by One-way ANOVA followed by Tukey's multiple comparison test. Comparison of viral load in the spinal cord was performed by a two-tailed unpaired student's T test. (*) p<0.05; (**) p<0.01. (***)p<0.001. n=3-10.

Figure 7 shows pathology in guinea pigs infected with HSV-2 before oral immunisation with Lipid K mixed with HSV-2 antigen and IVAG application of either DNFB or Imiquimod Pull. Guniea pigs were intravaginally infected with HSV-2 before oral immunisation with Lipid K mixed with live or UV-inactivated HSV-2 antigen. Three days after oral immunisation, DNFB or Imiquimod was intravaginally applied. Pathology scores are representative of the following; 0, no signs of disease, 1, redness and minor swelling external to genital area; 2, a few (2-3) small vesicles; 3, several (>4) large vesicles; 4, severe vesicular-ulcerative disease of the perineum. (A) Pathology observed in HSV infected guinea pigs prior to IVAG pull. (B) Pathology observed in HSV infected guinea pigs after IVAG pull. (C) HSV reoccurrence in the genital tract of infected guinea pigs after oral immunisation and IVAG pull.

Figure 8 shows lymphocyte proliferation in the SPL, MLN, GIT, CLN and FRT. Lymphocytes were isolated from the tissues of orally immunised mice and exposed to 10 ⁵ pfu of UV-inactivated TK- HSV-2 for 72hrs. Results are expressed as percentage of cells above the PBS immunised group that proliferated to antigen. Blue = negative control. Red = sample.

Figure 9 shows representative gate data for T cell staining. Lymphocytes were isolated from each tissue before CD4+ and CD8+ T cells were gated. IFNy responses were then measured based on gates for the CD4+ and CD8+ T cells.

Figure 10 shows IFNy secreting CD8 T _RM cell numbers. Mice were orally immunised with Lipid K mixed with 10 ⁶ pfu of either live or UV-inactivated TK- HSV-2 before IVAG application of CpG or Lipid K. Twelve weeks following IVAG 'Pull' mice were euthanised and their FRTs removed. IFNy secreting CD3+ CD8+ CD103+ cells were isolated using flow. Two-tailed students T test compared 'Prime' only controls with 'Prime and Pull' immunised groups. (*) p<0.05. n= 2-5.

Figure 11 shows CD4 T cells in the FRT of mice. Mice were orally immunised with

Lipid K mixed with 10 ⁶ pfu of live TK- HSV-2 before IVAG application of (A) DNFB or (B) CXCL9/10. The FRT was removed 12 weeks following IVAG pull and stained for CD4 T cells (green). Figure 12 shows CD8 T cells in the FRT of guinea pigs. WT HSV-2 infected guinea pigs were orally immunised with Lipid K mixed with TK- HSV-2 before IVAG pull with PBS (A-D), Imiquimod (E-G) or DNFB (H-K). The FRT was removed on day 88 pi before staining with anti-guinea pig CD8. CD8 T cells = brown.

GENERAL DEFINITIONS

Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (for example, in immunology, immunohistochemistry, protein chemistry, and biochemistry).

It is intended that reference to a range of numbers disclosed herein (e.g. 1 to 10) also incorporates reference to all related numbers within that range (e.g. 1, 1.1, 2, 3, 3.9, 4, 5, 6, 6.5, 7, 8, 9 and 10) and also any range of rational numbers within that range (for example 2 to 8, 1.5 to 5.5 and 3.1 to 4.7) and, therefore, all sub-ranges of all ranges expressly disclosed herein are expressly disclosed. These are only examples of what is specifically intended and all possible combinations of numerical val ues between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application in a similar manner.

The term "and/or", e.g., "X and/or Y" shall be understood to mean either "X and Y" or "X or Y" and shall be taken to provide explicit support for both meanings or for either meaning.

Throughout this specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

Throughout this specification, unless specifically stated otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or group of compositions of matter.

SELECTED DEFINITIONS

The term "derived from" as used in the context of an antigen derived from a herpes virus refers to any virus or virus subcomponent (e.g. glyco/peptide or glyco/protein) that is derived from a herpes virus, for example by recombinant expression means or generated synthetically.

The term "immunogenic agent in an amount sufficient to induce a cell-mediated immune response" as used herein means any agent that induces T cell memory to the antigen including, but not limited to, CD4+ and CD8+ T cells, as well as resident memory T cells (T _RM ).

The term "Lipid K" as used herein refers to a lipid composition 1.5% caproic acid, between 5.0% and 11.0% caprylic acid, between 4.0% and 9.0% capric acid, between 40.0% and 50.0% lauric acid, between 15.0% and 20.0% myristic acid, between about 7.0% and 12.0% palmitic acid, between about 1.5% and 5.0% stearic acid, between about 4.0% and 10.0% oleic acid, between about 1.0% and 3.0% linoleic acid, not more than 0.2% linolenic acid, not more than 0.2% arachidic acid and not more than 0.2% eicosenoic acid

The term "Lipid C" as used herein refers to a lipid composition comprising about 1% myristic acid, about 25% palmitic acid, about 15% stearic acid, about 50% oleic acid an about 6% linoleic acid .

The term "Lipid Ca" as used herein refers to a lipid composition comprising about 2.8% myristic acid, about 22.7% palmitic acid, about 2.5% palmitoleic acid, about 1.1% daturic acid, about 15.9% stearic acid, about 38.0% oleic acid, about 1.7% oleic acid and about 4.0% linoleic acid, having a total saturated fat composition of about 42.4%, a monounsaturated fat composition of about 42.2%, and a polyunsaturated fat composition of about 4.0%.

The term "Lipid PK" as used herein refers to a lipid composition comprising about 7.0% caproic acid, about 5.8%capric acid, about 45.0% laurate, about 18.2% myristic acid, about 9.9% palmitic acid, about 2.9% stearic acid, about 7.6% oleic acid and about 2.3% linoleic acid and a total saturated fat composition of about 88.8%, a monounsaturated composition of about 7.6%, and a polyunsaturated fat composition of about 2.3%.

The term "Lipid SPK" as used herein refers to a lipid composition comprising about 6.7% caproic acid, about 5.6% capric acid, about 44.3% laurate, about 17.9% myristic acid, about 9.6% palmitic acid, about 3.0% stearic acid, about 8.4% oleic acid and about 2.6% linoleic acid, and a total saturated fat composition of about 87.3%, a monounsaturated fat composition of about 8.4%, and a polyunsaturated fat composition of about 2.6%.

The term "prophylactic agent" as used herein refers to any molecule, compound, and/or substance that is used for the purpose of preventing a herpes infection. Examples of prophylactic agents include, but are not limited to, antigens, proteins, immunoglobulins (e.g., multi-specific Igs, single chain Igs, Ig fragments, polyclonal antibodies and their fragments, monoclonal antibodies and their fragments), antibody conjugates or antibody fragment conjugates, peptides (e.g., peptide receptors, selectins), binding proteins, proliferation based therapy, and small molecule drugs.

The term "therapeutic agent" as used herein refers to any molecule, compound, and/or substance that is used for the purpose of treating and/or managing a disease or disorder. Examples of therapeutic agents include, but are not limited to, proteins, immunoglobulins (e.g., multi-specific Igs, single chain Igs, Ig fragments, polyclonal antibodies and their fragments, monoclonal antibodies and their fragments), peptides (e.g., peptide receptors, selectins), binding proteins, biologies, proliferation-based therapy agents, hormonal agents, radioimmunotherapies, targeted agents, epigenetic therapies, differentiation therapies, biological agents, and small molecule drugs.

The term "effective amount", "prophylactically effective amount" and "therapeutically effective amount" as used herein refers to the amount of a therapy that is sufficient to result in the prevention of the development, recurrence, or onset of a disease or condition and one or more symptoms thereof, to enhance or improve the prophylactic effect(s) of another therapy, reduce the severity, the duration of disease, ameliorate one or more symptoms of the disease or condition, prevent the advancement of the disease or condition, cause regression of the disease or condition, and/or enhance or improve the therapeutic effect(s) of another therapy.

As used herein, the terms "prevent", "preventing" and "prevention" in the context of the administration of a therapy to a patient or subject refers to the prevention or inhibition of the recurrence, onset, and/or development of a disease or condition or a symptom thereof in a subject resulting from the administration of a therapy (e.g., a prophylactic or therapeutic agent), or a combination of therapies (e.g., a combination of prophylactic or therapeutic agents) .

As used herein, the terms "treat", "treatment" and "treating" in the context of the administration of a therapy to a patient or subject refer to the reduction or inhibition of the progression and/or duration of a herpes infection, the reduction or amelioration of the severity of a herpes infection, and/or the amelioration of one or more symptoms thereof resulting from the administration of one or more therapies.

The terms "manage", "managing", and "management" in the context of the administration of a therapy to a subject refer to the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent) or a combination of therapies, while not resulting in a cure of the disease or condition. In certain examples, a subject is administered one or more therapies (e.g., one or more prophylactic or therapeutic agents) to "manage" the disease or condition so as to prevent the progression or worsening of the disease or condition.

The term "subject", "patient" and "animal" may all be used interchangeably in this specification and are intended to encompass any mammal including human, and non-human mammals such as cats, dogs, horses, cows, sheep, deer, mice, rats, primates (including gorillas, rhesus monkeys and chimpanzees), possums and other domestic farm or zoo animals. Thus, the vaccine compositions, pharmaceutical compositions, methods and articles of manufacture as described herein have application to both human and non-human animals, in particular, and without limitation, humans, primates, farm animals including cattle, sheep, goats, pigs, deer, alpacas, llamas, buffalo, companion and/or pure bred animals including cats, dogs and horses. Preferred subjects are humans, and most preferably "patients" who, as used herein, refer to living humans who may receive or are receiving medical care or assessment for a disease or condition.

DETAILED DESCRIPTION

The development of more effective compositions and/or delivery systems for vaccines by alternate non-injectable routes is desirable. Oral administration of vaccines in particular has a number of advantages including ease of administration and targeting of an mucosal immune response. Despite this, oral vaccination of animals and humans to provide mucosal and/or systemic immunity has to date been largely ineffective. Efficacy of such vaccines has been hampered by degradation of the vaccine as it passes through the gut.

To improve immune responses, antigens have been mixed with a number of adjuvant substances to stimulate immunogenicity. These adjuvants are primarily alum and oil-in-water emulsions. The latter group is typified by the Freund's mineral oil adjuvants. However, the use of Freund's complete adjuvant (FCA) in human and veterinary vaccines is contraindicated because of toxic reactions that have been reported. For these reasons, Freund's adjuvant may also be unsuitable for oral administration.

In other oil-in-water emulsions surfactants have been required because of the high oil content. Detergent properties of surfactants render them unsuitable for parenteral or oral administration. Further, toxic reactions even for approved surfactants have been reported. Further drawbacks with emulsions are that they are heterogeneous systems of one immiscible liquid dispersed in another. This preparation is often unstable and results in separation of the aqueous phase over time, and therefore poses difficu lties for maintaining vaccines in stable suspension. Moreover, antigens trapped in the aqueous phase of water- in-oil emulsions are unlikely to be protected from degradation in the stomach or other portions of the digestive system.

Liposomes and lipid vesicles have also been explored for use with vaccines, particularly with small antigenic components that may be readily encapsulated. However, liposomes and vesicles are costly and time consuming to produce, and the extraction procedures used in their preparation may result in alteration of the chemical structure or viability of vaccine preparations and hence their immunogenicity. For example, heat and solvents may alter the biological integrity of antigenic components such as proteins.

Oral immunization has long been viewed as an attractive means of protecting a host against infectious agents that invade the body across the mucosal surfaces lining the gastrointestinal, respiratory and urogenital tracts. The potential of oral immunization, as demonstrated in many animal studies, has not been realized in humans, with only the oral polio, oral typhoid, oral cholera and rotavirus (i.e. RotaRix and RotaTeq) vaccines approved for human use, all of which are live attenuated vaccines. Limitations that have prevented the use of oral immunization in humans include the need for large antigen doses, destruction of antigen by normal digestive processes and the need for strong mucosal adjuvants to overcome the induction of oral tolerance that is often induced by feedi ng of protein subunit antigens ²² . The most commonly used adjuvants in animal studies of oral immunization, the ADP-ribosylating bacterial exotoxins (ABARES) such as cholera toxin (CT) and E. coli heat labile toxin (LT), cannot be used in humans because of both gastric and neurological toxicity ^23,24 . Because of this the potential of oral immunization in humans will only be realized if safe adjuvants can be found to replace adjuvants such as ABARES.

Recent advances in lipid-based oral delivery system for oral vaccine delivery in animals has been made by the Applicants ²⁵ . Feeding of live Mycobacterium bovis Bacille Calmette-Geurin (BCG) vaccine incorporated in Lipid C to mice produced resistance to infection ²⁶ . Similar results were found in white tail deer ²⁷ , guinea pigs ²⁸ , brushtail possums ²⁹ , badgers and mice, where immunization with Lipid C based vaccines protected against aerosol challenge with live M. bovis. Levels of protection were observed to be greater than those seen in animals immunized with non-incorporated BCG, and were equivalent to BCG administered by the subcutaneous route and was associated with strong interferon gamma (IFNy) production by systemic and mucosal T cells.

These findings were, however, confined to formulation of an entire organism as antigen (i.e.) a living Mycobacterium bovis Bacille Calmette-Geurin (BCG) in Lipid C, a lipid carrier comprising triglycerides rich in Cis acyl groups including, for example, stearic and oleic acids.

The present invention is based on the unexpected discovery that antigens derived from herpes virus, and in particular herpes simplex virus 2 (HSV-2), may be formulated in a lipid carrier comprising triglycerides predominantly rich in C12 and C14 acyl groups with delivery via the oral route, in conjunction with a separate immunostimulation of genitalia, resulting in both prevention (i.e. prophylaxis) in a mouse model (Examples 1-11 ; Figures 1- 6, 8-12) and treatment (i.e. therapy) in a giunea pig model (Example 12; Figures 7, 13). Induction of protective mucosal immunity against lethal HSV-2 infection could be elicited by an oral vaccine. Protection against HSV-2 correlated with HSV-2-specific IgG and IgA in vaginal lavage together with recruitment of CD4 and CD8 T cells to the draining caudal and lumbar lymph nodes. Furthermore, combining this oral vaccine with vaginal application of DNFB or CXCL9/10, to induce transient local inflammation, led to the recruitment of CD8 and CD4 tissue resident memory cells into the genital epithelia. This 'Prime and Pull' immunisation also prevented viral dissemination to the spinal cords following vaginal challenge in mice. Furthermore, the 'Prime and Pull' vaccine reduced genital pathology in guinea pigs infected with HSV-2. Thus, combining an oral 'Prime' and a vaginal 'Pull' represents the first oral vaccine that can protect against lethal vaginal HSV challenge.

Accordingly in one aspect of the present invention there is provided a method for treating a patient infected by a herpes virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered locally at a site of infection or proximal to a site of infection, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient,

wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

In another aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of a genital infection caused by a herpes virus.

The vaccine compositions according to the present invention typically comprise an antigen derived from a herpes virus and a lipid carrier. In certain examples, the vaccine compositions are formulated for oral delivery to a subject or patient. As such, the lipid carrier is in a form that undergoes a solid to liquid phase transition at, or approximating, physiological temperatures. In this way, the lipid carrier may retain the antigen in a stable, non-degradable state prior to administration advantageously improving the shelf life of the vaccine. Following administration, the lipid component of the lipid carrier undergoes a solid to liquid phase transition at physiological temperature thereby releasing a prophylactically or therapeutically effective amount of antigen to the mucosal lining of the gut sufficient to invoke a mucosal immune response to the antigen.

Accordingly in another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at or approximating physiological temperatures.

Accordingly in another aspect of the present invention there is provided a vaccine composition comprising provided an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier undergoes a solid to liquid phase transition at between about 30°C and 37°C.

The lipid carrier comprises a triglyceride component that facilitates a temperature induced phase transition at, or approximating, physiological temperatures. In certain examples according to the present invention, the lipid component of the lipid carrier comprises a mixture of saturated and unsaturated triglycerides including polyunsaturated, monounsaturated triglycerides. This includes, but is not limited to, a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups.

Accordingly, in a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises a mixture of triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups.

In non-limiting examples according to the present invention, triglycerides comprising any one or more of Ce, Cs, Cio, C12, Ci ₄ , Ci6, Cis and/or C20 acyl groups includes myristic, palmitic, stearic, oleic, linoleic, parinic, lauric, linolenic, capric, caprylic, caproic, arachidonic, and eicosenoic acids, or mixtures thereof.

According to the various Examples that follow, the lipid component of the lipid carrier comprises predominantly, although not exclusively, triglycerides consisting in C12 and Ci ₄ acyl groups. For example, but without limitation, lauric acid (C12) and myristic acid (Ci ₄ ).

As such, in yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group.

In a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid.

In another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% of a triglyceride comprising a Ci ₄ acyl group.

In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 15% myristic acid. In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% of a triglyceride comprising a C12 acyl group and at least about 15% of a triglyceride comprising a C 14 acyl group.

In yet a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises at least about 40% lauric acid and at least about 15% myristic acid.

In yet a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid component of the lipid carrier comprises between 40% and 50% lauric acid and between 15% and 20% myristic acid.

In yet another aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid K.

In a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid N.

In yet a further aspect of the present invention there is provided a vaccine composition comprising an antigen derived from a herpes virus and a lipid carrier, wherein the lipid carrier is Lipid C.

The genital pull agent according to the present invention achieves transient local inflammation sufficient to induce a cell-mediated immune response (i.e.) recruitment of CD4 and CD8 T-cells. A person skilled in the art will understand that, based on the teaching of this specification, any immunogenic agent may be used provided that its action is sufficient to achieve local inflammation and invoke a cell-mediated immune response in the local area of infection. For example, in the genitalia of the patient being treated. Typically, according to the present invention, the immunogenic agent is administered intra-vaginally. Examples of immunogenic agents that invoke a cell mediated immune response according to the present invention include, but are not limited to, dinitrofluorobenzene (DNFB), chemokine (C-X-C motif) ligand 9 (CXCL9) and/or chemokine (C-X-C motif) ligand 10 (CXCL10), Imiquimod, Resiquimod, polyinosinic: polycytidylic acid (Poly I :C), CpG and Nonoxonyl 9.

The antigen derived from a herpes virus may comprise any antigen sufficient to invoke an immune response, including a cell-mediated immune response. In an example, the antigen comprises a glyco/peptide or glyco/protein derived from a herpes virus. For clarity, the term derived includes via recombinant or synthetic source. Examples of peptide or protein based antigens derived from a herpes virus include, but a re not limited to, glycoproteins such as glycoprotein D (gpD), glycoprotein B (gpB), glycoprotein E (gpE; including gpE2), and glycoprotein C (gpC; including gpC2) derived from herpes virus.

The present invention also contemplates herpes virus antigens where the entire virus in a killed or live/attenuated form may be used as an antigen. For example, a live attenuated herpes virus antigen where attenuation is achieved through mutation or gene inactivation may be used in accordance with the vaccine compositions, methods and kits described herein (e.g.) inactivation of thymidine kinase gene in HSV-2.

The vaccine compositions according to the present invention may be administered by a variety of routes including parenteral (subcutaneous, intradermal, intramuscular), mucosal, aerosol and oral administration, but are not limited thereto. In an examples, oral administration is desirable. The compositions may be orally administered in the form of pellets, tablets, capsules, lozenges, or other suitable formulations. Oral administration enjoys wide consumer acceptance where the use of needles and syringes can be avoided and is an economical and practical method for vaccinating wildlife.

Accordingly, in a further aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia, of the patient provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

In yet a further aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

(i) an oral vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus. In yet a further aspect of the present invention there is provided a method for treating a patient having a genital herpes infection, the method comprising the steps of administering to the patient:

via an oral route of administration, a vaccine composition comprising a glycoprotein D antigen derived from a herpes virus and Lipid K; and via an intra-vaginal route of administration, an amount of an immunogenic agent sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to treat or ameliorate the symptoms of an infection caused by a herpes virus.

The present invention further contemplates prophylactic methods to prevent infection caused by a herpes virus.

As such, in another aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered locally at a site of infection or proximal to a site of infection, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient,

wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In another aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

a vaccine composition according to the present invention and as described herein; and

an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In a further aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient: (i) a vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia, of the patient provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In yet a further aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) an oral vaccine composition according to the present invention and as described herein, wherein the vaccine composition is administered orally to the patient; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

In yet a further aspect of the present invention there is provided a method for preventing in a patient an infection caused by a herpes virus, the method comprising the steps of administering to the patient:

(i) via an oral route of administration, a vaccine composition comprising a glycoprotein D antigen derived from a herpes virus and Lipid K; and (ii) via an intra-vaginal route of administration, an amount of an immunogenic agent sufficient to invoke a cell mediated immune response in the patient, wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent an infection caused by a herpes virus.

The prophylactic methods according to the present invention advantageously prevent spread of herpes virus to neurological tracts, such as the spinal cord. Patients who have previously contracted a herpes infection may contract recurring infections, despite exhaustive treatment, caused by latent virus that establishes within neurological tracts. For example, the spread of latent virus to the spinal cord in the case of genital herpes.

Accordingly, in yet a further aspect of the present invention there is provided a method for preventing spread of a herpes virus to a neurological tract following infection by the virus, the method comprising the steps of administering to the patient:

(i) a vaccine composition according to the present invention and as described herein; and (ii) an immunogenic agent administered locally at a site of infection or proximal to a site of infection, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient,

wherein administration of the vaccine composition and the immunogenic agent to the patient is sufficient to prevent spread of a herpes virus to a neurological tract following infection by the virus.

Lipid Carriers & Delivery /Administration

Lipids employed in the vaccine compositions according to the present invention are desirably suitable for animal or human consumption and may be selected from a broad range of natural (vegetable or animal derived), or synthetic lipid products including oils, fats and waxes.

In certain examples, the lipid carrier can be liquid at temperatures above about 30°C. That is, the lipid can be selected to achieve melting point at physiological temperature in the animal to which it is administered, most usually via the oral route. Desirably, the lipid will be in the form of a solid at 10-30°C at atmospheric pressure, and preferably is still solid at from 20-30°C at atmospheric pressure. However the melting temperature of lipid is not exclusive and may include oils, fats and waxes with a range of melting temperatures.

In other examples, lipids for use in the vaccine formulations according to the present invention can undergo a transition from the solid phase to a liquid phase between about 30°C and human physiological temperature of about 37°C. Summaries of lipid phase behaviour are available in the art. Accordingly, a person skilled in the art can select a lipid having the desired properties and melt point based on information in the art and simple experiment.

In general, suitable lipid formulations can include triglycerides such as glyceryl esters of carboxylic acids, compounds consisting of an aliphatic chain and a -COOH end, and saturated and non-saturated fatty acids and mixtures thereof.

In some examples, triglycerides contain primarily Cs to C20 acyl groups, for example myristic, palmitic, stearic, oleic, linoleic, parinic, lauric, linolenic, arachidonic, and eicosapentaenoic acids, or mixtures thereof.

In other examples, lipid formulations useful in the invention include medium chain fatty acids, for example, C i2"Ci4- Lipid formulations preferred for use in the vaccine compositions of the present invention contain : about 40% to about 80%, alternatively about 40% to about 60%, alternatively about 40% to about 50% C12 and/or C_ ₄ fatty acids.

In certain examples, lipid formulations for use in the invention may contain : saturated fatty acids in an amount from about 20% to about 60%, alternatively from about 30% to about 55%, and in still other examples, from about 40% to about 50%. Monounsaturated fatty acids can be in the range of about 25% to about 60%, alternatively from about 30% to about 60%, and in yet other examples, from about 40% to about 55%.

Polyunsaturated fatty acids can be in the range of about 0.5% to about 15%, alternatively from about 3% to about 11%, and in further examples, in the range of about 5% to about 9%.

In certain examples according to the compositions of the present invention include about 40% to about 50% saturated fatty acids, about 40% to about 50% monounsaturated fatty acid, and about 5% to about 9% polyunsaturated fatty acid.

The lipid formulation is useful in the preparation of antigenic compositions, and in protecting antigens within the composition from degradation. The lipids also maintain antigens in a uniform suspension. That is, in the compositions of the invention the antigenic components can be uniformly distributed throughout a solid or paste like lipid matrix. The lipids also protect the antigens from destruction by gastrointestinal secretions when orally administered. Protection from macrophage attack is also likely when administered by other routes such as subcutaneously. This allows for uptake of the antigens through the gastrointestinal mucosa .

Formulations for a wide range of delivery routes may also include add itives such as fillers, extenders, binders, wetting agents, emulsifiers, buffing agents, surfactants, suspension agents, preservatives, colourants, salts, antioxidants including mono sodium glutamate (MSG), vitamins such as vitamin E, butylated hydroxanisole (BHA), albumin dextrose-catalase (ADC), protective coatings, attractants and odourants, and agents to maintain desired integrity of the antigen(s) contained in the lipid but are not limited thereto.

Protective coatings or enterocoatings may be selected, for example, from gels, paraffins, and plastics including gelatin. The coatings further aid in the prevention of exposure to gastric acids and enzymes when the oral administration route is selected.

When used for oral administration, the formulation may also include additives which, for example, improve palatability, such as flavouring agents (including anise oil, chocolate and peppermint), and sweeteners (including glucose, fructose, or any other sugar or artificial sweetener) .

In one example, the composition includes at least two antigenic components selected from any of those identified above, and may include multiple combinations of subunit antigens. Three or more antigenic components are feasible.

The concentration of the antigenic component(s) in the composition may vary according to known art protocols provided it is present in an amount which is effective to stimulate an immune response on administration to an animal. In particular, an immune response in the gut associated lymphoid tissue of the small intestine. For protein and peptide type antigens a range of from 10-1000μg per gram of formulation is appropriate. For virus-type antigens a range of 1 x 10 ³ to 1 x 10 ¹⁰ , preferably 1 x 10 ⁵ to 1 x 10 ^s Plaque Forming Units (PFU)/ml_ is appropriate. The immune response may be humoral, or cell- mediated including a mucosal immune response.

Accordingly, in a further aspect the present invention relates to a method for stimulating a mucosal immune response in an animal by administering an antigenic composition of the invention to the animal.

A composition may be prepared using techniques known in the art. Conveniently, the lipid formulation is heated to liquefy if required, and the antigenic component(s) and other ingredients (when used) as described above are added. Dispersal of the antigenic composition may be achieved by mixing, shaking or other techniques that do not adversely affect the viability of the antigenic component.

Alternative compositions for use in the invention can be essentially free of aqueous components including water. The term "essentially free" as used herein means that the composition contains less than about 10% aqueous components, and preferably less than about 5% aqueous components. As indicated above, the presence of components, particularly aqueous solvents, reduces the protective effect of the lipid formulation especially in the gut.

An antigenic composition of the invention can also be useful for generating a response to a second or further antigenic molecule of a type as indicated above for the antigenic component, particularly those that are weakly immunogenic. This may be achieved by co-delivery of the second or further antigenic molecule in an antigenic composition by conjugating the antigenic molecule to another antigenic component of the composition. Conjugation may be achieved using standard art techniques. In particular, an antigen of interest may be conjugated to an antigenic carrier or adjuvant by a linker group which does not interfere with antibody production in vivo. The antigenic carrier or adjuvant may be any of the antigenic components. Suitable linker groups include mannose receptor binding proteins such as ovalbumin and those that bind to Fc receptors. The second or further antigenic molecule is preferably a protein or peptide. A particularly preferred protein is an immunocontraceptive protein. The lipid again acts as the delivery matrix. When the composition is administered an enhanced immune response to the conjugated molecule or co-delivered molecule results.

The compositions of the invention may be administered by a variety of routes including parenteral (subcutaneous, intradermal, intramuscular), mucosal, aerosol and oral administration, but are not limited thereto. In one example, oral administration is desirable. The compositions may be orally administered in the form of pellets, tablets, capsules, lozenges, or other suitable formulations. Oral administration enjoys wide consumer acceptance where the use of needles and syringes can be avoided and is an economical and practical method for vaccinating wildlife. In one example the applicants have therefore provided a novel live vaccine formulated for oral administration.

In an alternate example, the compositions may be formulated for parenteral administration by injection. This form of administration may also include injectable and subcutaneous depot formulations compatible with body tissues. Time release absorption from the depot may be achieved using the lipid formulation alone or with additional biodegradable polymers. The depot allows for sustained release of the antigenic component in a process which more closely approximates the infection process, facilitating the mounting of an immune response in the animal to which the composition is administered. A lipid protective effect also occurs with these forms of administration.

Vaccine compositions according to the present invention can be administered as a single dose, particularly for parenteral administration, or in repeated doses over time. For example, an initial dose and booster doses at spaced intervals. The dosage for administration is determined by the release rate of the antigen component in combination with its antigenicity. Usual considerations such as weight, age, sex of the animal, concurrent treatments (if any), and nature of the antigen to be treated may also be taken into account. Generally the dose range for oral vaccination will be as given above, i.e. 1 x 10 ⁵ to 1 x 10 ¹⁰ , preferably 1 x 10 ⁷ to 1 x 10 ⁹ CFU/kilogram per dose. For peptide and protein type antigens the dose range will be from 1-10,000 ug, preferably 10-1000 ug. For virus-type antigens the dose range will be from 1 x 10 ³ to 1 x 10 ¹⁰ , preferably 1 x 10 ⁵ to 1 x 10 ^s PFU/ml. Whichever method of delivery is used, when live organisms are used in the vaccine formulation they are expected to multiply within the host to facilitate the immune response.

In other examples, compositions of this invention may be formulated as a single dose preparation or as a multidose preparation for mass vaccination programmes. Some of these examples may be in the form of a kit or article of manufacture, including a composition in a suitably administrable form and instructions for use.

Until required for use, the compositions of the invention may be stored for limited periods at room temperature, or preferably under normal refrigeration conditions at approximately 4°C. At 4°C the lipid formulation facilitates storage and maintenance of organisms in a dormant but viable state without deterioration. For parenteral delivery, the composition is then warmed to 30 to 40°C to liquefy prior to administration. For oral administration the composition is a solid or a paste.

Kits and Articles of Manufacture

The vaccine compositions and formulations described herein may also be used in the manufacture of a prophylactic or therapeutic agent for managing a herpes virus infection. As such, in another aspect of the present invention there is provided an article of manufacture for use in the treatment of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and

(iii) optionally, instructions for how to treat the herpes infection in the patient. In another aspect of the present invention there is provided an article of manufacture for use in the treatment of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and (iii) optionally, instructions for how to treat the genital herpes infection in the patient.

In another aspect of the present invention there is provided an article of manufacture for use in the prevention of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and (iii) optionally, instructions for how to prevent the herpes infection in the patient.

In yet another aspect of the present invention there is provided an article of manufacture for use in the prevention of an infection caused by a herpes virus in a patient, the article of manufacture comprising :

(i) a vaccine composition according to the present invention and as described herein; and

(ii) an immunogenic agent administered to the genitalia of the patient, provided that the immunogenic agent is administered in an amount sufficient to invoke a cell mediated immune response in the patient; and (iii) optionally, instructions for how to prevent the genital herpes infection in the patient.

Articles of manufacture are also provided comprising a vessel containing a vaccine composition and/or a genital pull agent (in any dose or dose form or device) as described herein and instructions for use for the treatment of a subject.

The invention is further described with reference to the following examples. It will be appreciated that the invention as claimed is not intended to be limited in any way by these examples.

EXAMPLES

Example 1: Methods & Materials Animals, Cells, Proteins and Viruses

Female C57BL/6 mice (6-8 weeks) were obtained from the Animal Resources Centre (Perth, Australia). Female Hartley guinea pigs (6-8 weeks) were obtained from the University of Adelaide. All procedures were approved by the Queensland University of Technology Animal Research Ethics Committee (Approval #11000001248) and were undertaken at QUT's Medical Engineering Research Facility (MERF) and the Queensland Institute of Medical Research (QIMR). TK- ¹⁰ ' ²⁰ and WT HSV-2 virus strains were kindly provided by Professor Nicholas King at the Sydney Institute of Emerging Infectious Diseases and Biosecurity (SEIB).

Spodoptera frugiperda (SF9) cells were grown in Sf-900 II SF Medium (Gibco, Sydney, NSW) at 28°C, atmosphere. The gpD gene was isolated from WT HSV-2 strain 333 by PCR using primers designed on NCBI Blast (forward : 5' CC GGTACC ATGGGGCGTTTGACC 3'; and reverse: 5' CC GAATTC CGTAA AAC AATG G CTGGTG C 3'). The gpD gene was cloned into the PiB-V5-His plasmid (Invitrogen, California, USA) before transfection into SF9 cells. Here, 1ml of Sf-900 II SFMedium was mixed with 5μg of purified plasmid and 6μΙ of cellfectin (Sigma, Missouri, USA). The mixture was placed on confluent SF9 cells in a 6 well plate for 4hrs at 27°C, atmosphere. Transfected SF9 cells were grown in Sf-900 II SFMedium in the presence of 2% FCS and ^g of blasticidin (Sigma) until confluent. gpD expression was determined by western blot before gpD was purified on TALON resin (Invitrogen). gpD-expressing SF9 cells were lysed and added to an equilibrated 5ml TALON resin pellet. Protein was purified as per manufacturers instructions. Purity of eluted protein was determined by SDS-PAGE and antigenicity was determined by Western blot.

Vero cells (WHO, Geneva, Switzerland) were cultured in complete RPMI medium with 10% FCS at 37°C, 5% C0 ₂ . TK- and WT HSV-2 were grown in Vero cells in presence of 5% FCS at 37°C, 5% C0 ₂ for 72hrs. TK- and WT HSV-2 were purified by ultracentrifugation on a 30% sucrose cushion at 113,000 x g for lhr at 4°C (Optima L90K, Beckman Coulter, California, USA) .

Vaccine Preparation

Lipid K was supplied by Immune Solutions Ltd (Dunedin, New Zealand). One hundred and ten (110) μί of Lipid K was mixed with 40μί of HSV-2 by vortexing at 37°C followed by gentle mixing overnight at room temperature. For non-antigen containing control vaccines, Lipid K was combined with sterile PBS. Anesthetized mice were orally immunised as described ^6,11 . Mouse model

Mice were orally immunsed four times at weekly intervals. One week following final immunisation, mice were intravaginally challenged with 5.5xl0 ⁵ pfu of WT HSV-2 during the diestrus phase of the Oestrus cycle.

For the 'Prime and Pull,' mice were orally immunised four times on a weekly basis before vaginal application of the 'Pull' three days following last oral immunisation. The IVAG 'Pull' consisted of either 0.05% v/v DNFB (Invitrogen) in acetone/oil (4: 1), 3μg of CXCL9 and CXCL10 (Peprotech, USA) or UV-inactivated TK- HSV-2 mixed with either ^g of CpG (Sigma) or 20μΙ of Lipid K. Eleven weeks later, mice were subcutaneously injected with Progesterone (12.5mg/ml; Vibrac Animal Health) before IVAG infection one week later with 5.5xl0 ⁵ pfu of WT HSV-2.

Guinea pig model

Guinea pigs were intravaginally infected with 5xl0 ⁵ pfu of WT HSV-2 one week prior to first oral immunisation. Guinea pigs were orally immunised four times before intravaginal application of 0.05% v/v DNFB (Invitrogen) in acetone/oil (4: 1), or 2.5% v/v Aldara/XY lubricant three days following final oral immunisation. Guinea pigs were euthanised at 88 dpi. Collection of vaginal wash

The vaginal vault was flushed with 50μΙ_ of sterile PBS, which was stored at -80°C until required.

Virus neutralisation assay

Sera or VL from immunised mice were diluted in 2% v/v FCS/Media/Penicillin,

Streptomycin, Gentamycin (PSG) at 1 :20 and 1 : 5 respectively. Fifty pfu of TK- HSV-2 in a 60μΙ volume of 2% v/v FCS/media/PSG was added to the sera or VL and thoroughly mixed. The solution was incubated at 37°C in 5% v/v C0 ₂ /air for lhr before being overlayed on confluent Vero cells in a 24-well plate and incubated 37°C, 5% v/v C0 ₂ /air for lhr before overlay of 3% v/v carboxymethycellulose/dsRPMI. Vero cells were incubated at 37°C, 5% v/v C0 ₂ /air for 72hrs before overnight staining of monolayer with 0.5% w/v crystal violet.

HSV-2 Pathology

Pathology was monitored daily and for mice was scored as follows; 0, no symptoms/signs of infection; 1, Genital erythema ; 2, Moderate genital inflammation ; 3, Severe and purulent genital lesions with loss of hair. At stage 3, mice were euthanised. Guinea pig pathology was monitored daily and scored as follows; 0, no redness/disease; 1, redness and/or swelling; 2, a few small vesicles; 3, several large vesicles; 4, several large ulcers with skin breakages. At stage 4, guinea pigs were euthanised .

Cardiac Bleed

Blood was collected from the left ventricle, allowed to clot for 30min at room temperature before being spun at 15,000 x g for 30sec. The serum was removed and frozen at -80°C until use.

Detection of viral load in spinal cord by quanitative PCR

The spinal cord was collected and genomic DNA prepared. Briefly, tissue was homogenised in a salt homogenising buffer (0.4M NaCI, lOmM Tris-HCI pH 8, 2mM EDTA pH 8.0) before addition of proteinase K and SDS. Samples were incubated overnight at 55°C. Sodium chloride solution was added before samples were centrifuged and the supernatant collected. Isopropanol was added to the supernatants and incubated at -20°C for lhr. DNA was pelleted by centrifugation, washed with ethanol and resuspended in TE buffer (Invitrogen). HSV-2 DNA copy number was measured with primers detecting the TK gene (forward : 5' TTGTCTCCTTCCGTGTTTCAGTT 3'; and reverse 5' GGCTCCATACCGACGATCTG 3') by qPCR as described ^1"3 ' ¹¹ . DNA purified from WT- HSV-2 was used as standard to calculate viral load equivalents.

ELISA

Immunopure ELISA plates (Invitrogen, Australia) were coated overnight with 10 ⁵ pfu of UV-inactivated TK- HSV-2 (50μί εΙΙ) diluted in sodium bicarbonate buffer (pH 9.6) at 37°C. After three washes with 0.05% Tween 20 in PBS (PBST), the plates were blocked for lhr at 37°C with 100μΙ_ of PBST containing 5% FBS. One hundred μΙ_ of sample was added in duplicate and serially diluted 2-fold in PBST. Serum was diluted 1/100 to 1/12,800 and vaginal fluid was diluted 1/20 to 1/2560. Samples were incubated for lhr at 37°C. After three washes with PBST, the plates were incubated with either rabbit anti-mouse IgG (1/1000) or IgA ( 1/500) secondary antibodies (Southern Biotech - In vitro Technologies Pty Ltd, Noble Park, Australia) for lhr at 37°C followed by tetramethylbenzidine (TMB; Biorad, Sydney, Australia) colour-development system. The end point titre was defined as the mean of the PBS control wells + two standard deviations.

CFSE dye dilution assay

Lymphocyte proliferation against HSV-2 was determined by CFSE staining. SPL, CLN and FRT lymphocytes were labelled with CFSE ¹ ' ³ ' ¹⁰ ' ²⁰ ' ²¹ then plated at 5xl0 ⁶ cells/well before the addition of ConA ^g/well), UV-inactivated TK- HSV-2 (10 ⁵ pfu/well) or T cell media. Cells were incubated in the dark at 37°C 5% C0 ₂ /air for 72hrs. Samples were analysed on a FACSaria (BD Bioscience, San Jose, USA) using Flowjo v4.8 software (BD Biosciences).

Flow cytometry

SPL, MLN, GIT, CLN and FRT tissues were homogenised through a 70μιη cell strainer before being stimulated with 10 ⁵ pfu of UV-inactivated TK- HSV-2 for either 12hrs or 72hrs. The cells were then incubated for 72hrs at 37°C, 5% C0 ₂ /air. Con A (ΙΟμς/ιηΙ; Sigma- Aldrich) was incubated with the cells for 5hrs at 37°C, 5% C0 ₂ /air. Following surface staining, cells were fixed with 4% paraformaldehyde before intracellular cytokine staining. Samples were analysed with a FACSaria and Flowjo v4.8 software (BD Biosciences).

Statistical Analysis

Figures represent data from two or three independent experiments. The data was expressed as the mean±standard error of the mean and were compared by One-Way Anova using Graphpad Prism 5 (Graphpad, California, USA) unless otherwise stated. Differences were considered significant when p<0.05.

Example 2: Serum and Vaginal lavage IgG and IgA responses

Oral immunisation with Lipid K combined with HSV-2 antigen elicited significantly (p<0.01) higher IgG and IgA responses in both sera and VL of mice compared to the PBS immunised controls. IgG was the dominant isotype in both sera and VL (Figure 1).

HSV-2 specific IgG and IgA was significantly (p<0.001) increased in the sera and VL of mice orally immunised with >10 ⁶ live TK- HSV-2 compared to PBS controls. Similarly, oral immunisation of mice with Lipid K mixed with >40 ⁶ pfu of UV-inactivated TK- HSV-2 significantly (p<0.001) increased HSV-2 specific IgG and IgA in the sera and VL compared to PBS controls. However, HSV-2 specific IgG and IgA responses to UV-inactivated vaccines were significantly (p<0.05) lower than those observed in the sera of mice immunised with live HSV-2. Likewise, oral immunisation with 20C^g of gpD significantly i ncreased concentrations of IgG in the sera (p<0.001) and VL (p<0.05) compared to PBS controls, however the IgG concentration was not as high as that in the sera of mice immunised with whole virus (Figure 1A and IB).

Example 3: In vitro viral neutralisation by serum and VL antibody

Sera and VL from PBS immunised mice failed to neutralise TK- HSV-2 infection in vitro. However, TK- HSV-2 plaques were significantly (p<0.001) reduced by the sera and VL of mice orally immunised with >40 ⁶ pfu of live or inactivated TK- HSV-2. In these immunised groups, sera/PBS (1 : 50) neutralised >50% of TK- HSV-2 compared to serum from PBS controls and had a greater neutralisation capacity than the VL. The sera from mice orally immunised with gpD also significantly (p<0.001) reduced plaque formation, with a 60% neutralisation capacity compared to PBS controls. However, the VL from gpD- immunised mice had no neutralisation effect on TK- HSV-2. ELISA titres (Figure 1A and IB) correlated with neutralisation activity (Figure 1C).

Example 4: CFSE proliferation in the SPL, MLN, GIT, CLN and FRT

The spleen (SPL), mesenteric lymph nodes (MLN), gastrointestinal tract (GIT), caudal and lumbar lymph nodes (CLN) and FRT were removed from orally immunised mice. The tissues from 10 mice were pooled before lymphocytes from each tissue were isolated and labelled with CFSE and activated by exposure to 10 ⁵ pfu of UV-inactivated TK- HSV-2 for 72hrs (Table 1). Representative gates are shown in Figure 8.

Splenocytes from mice orally immunised with Lipid K and intravaginally infected with live TK- HSV-2 had the highest lymphocyte proliferation. Oral immunisation with >10 ⁶ pfu of live TK- HSV-2 mixed with Lipid K induced higher splenocyte proliferation compared to PBS immunised controls. Likewise, splenocyte proliferation in mice orally immunised with 10 ^s pfu of UV-inactivated TK- HSV-2 was higher than PBS controls. Splenocyte proliferation was increased in mice intravaginally immunised with 10 ⁵ pfu of live TK- HSV-2 compared to PBS immunised controls (Table 1).

Oral immunisation with >40 ⁶ pfu of live TK- HSV-2 mixed with Lipid K also elicited significant lymphocyte proliferation in the MLN and GIT compared to PBS controls. The increase in proliferation was 2-fold above the PBS immunised group and was higher than in the recipients of the UV-inactivated vaccine. Oral immunisation of mice with >40 ⁶ pfu of UV-inactivated TK- HSV-2 elicited significant proliferation in the MLN compared to PBS controls but only immunisation with 10 ^s live virus elicited proliferation in lymphocytes from the GIT > 10%. CFSE proliferation in the MLN was enhanced by oral immunisation with gpD compared to PBS controls.

Lymphocyte proliferation almost doubled in the CLN of mice orally immunised with >40 ⁶ pfu of live TK- HSV-2 compared to PBS controls. Similarly, mice orally immunised with either 10 ^s pfu of inactivated TK- HSV-2 or gpD mixed with Lipid K had enhanced lymphocyte proliferation in the CLN compared to PBS controls. However, none of these vaccines elicited antigen specific lymphocyte proliferation in the FRT. CFSE proliferation above 20% was only observed in the CLN and FRT of mice intravagi nally infected with TK- HSV-2 (Table 1). Table 1: Lymphocyte proliferation (%) induced by 72hrs exposure to 10 ⁵ pfu UV-inactivated TK- HSV-2

Example 5: Vaccine-induced IFNy expression by CD4 and CD8 T cells

IFNy expression by CD8+ T cells isolated from SPLs was significantly (p< 0.05) increased in mice orally immunised with >40 ⁶ pfu of live TK- HSV-2 mixed with Lipid K compared to PBS immunised controls. CD8+ cells from mice immunised with Lipid K mixed with >40 ⁶ pfu of inactivated TK- HSV-2 also showed increased IFNy secretion but this was not significant compared to PBS immunised controls. IFNy secretion by CD8+ T cells was significantly increased in mice intravaginally immunised with live TK- HSV-2 (p<0.05). Thus, IFNy expression by CD8 T cells was increased in the lymphocytes isolated from SPLs of mice immunised with whole virus vaccines (Figure 2a).

CD8+ T cells isolated from the MLN and GIT of mice orally immunised with >40 ⁶ pfu of live TK- HSV-2 mixed with Lipid K had a significant (p<0.05) two to three-fold increase in IFNy-secreting CD8 T cells compared to PBS immunised controls. In the GIT, the 10 ⁶ live TK- HSV-2 vaccine group had a 2-3-fold increase in IFNy-secreting CD8 cells compared to mice receiving the 10 ⁶ UV-inactivated TK- HSV-2 vaccine (Figure 2b and 2c). CD8 T _RM cells were not observed in the FRT of orally immunised mice (Figure 9). Representative gates are shown in Figure 9.

CD4+ T splenocytes from mice orally immunised with Lipid K mixed with >40 ⁶ pfu of live TK- HSV-2 had a 2-fold increase in IFNy expression compared to PBS immunised controls (Figure 3a).

CD4+ T cells from the MLN and GIT of mice orally immunised with Lipid K mixed with 10 ⁶ pfu of live TK- HSV-2 had significant (p<0.05) increases in IFNy expression compared to PBS immunised controls. Furthermore, CD4+ T cell IFNy expression was significantly (p<0.05) increased in the MLN of mice orally immunised with Lipid K mixed with 10 ⁶ pfu of live TK- HSV-2 compared to mice orally immunised with Lipid K mixed with 10 ⁶ pfu of inactivated TK- HSV-2 (Figure 3b and 3c).

IFNy expression by CD4+ T cells was increased in the CLN by immunisation with >40 ⁶ pfu of TK- HSV-2, the gpD vaccine and significantly (p<0.05) increased after IVAG immunisation. CD4 IFNy expression was highest in the IVAG immunisation group. However, this was not observed in the FRT as only IVAG immunisation of mice led to CD4+ expression of IFNy (Figure 3d and 3e).

Example 6: Mice pathology after WT HSV-2 challenge

Following immunisation mice were challenged with a lethal dose of WT HSV-2.

Pathology three scores were reported in all PBS immunised control mice within eight days of HSV-2 IVAG challenge (Figure 4a). Compared to the control group, pathology was significantly (p<0.01) reduced in mice orally immunised with 10 ⁶ pfu of live TK- HSV-2 mixed with Lipid K. However, a significant reduction in pathology was not observed in mice orally immunised with >10 ⁶ pfu of UV-inactivated TK- HSV-2 or 200μg of gpD. Intravaginal infection (LIC) of mice with 10 ⁵ pfu of TK- HSV-2 three to four weeks before WT HSV-2 genital challenge, significantly (p<0.001) reduced pathology compared to PBS controls (Figure 4a). Example 7: Mice survival and viral load in the DRG

Oral immunisation of mice with Lipid K mixed with 10 ⁶ pfu of live TK- HSV-2 significantly (p<0.05) enhanced survival of mice compared to PBS immunised controls (Figure 4b). In this group, 60% (6/10) of mice survived lethal IVAG HSV-2 challenge (Figure 4b). Enhanced survival correlated with a significantly reduced viral load in the spinal cord compared to PBS immunised controls (Figure 4c). This was also true for the LIC group (100% survival), which also had a significantly (p<0.001) reduced viral load in the spinal cord (Figure 4c).

Example 8: CD8 T _RM cell counts in the FRT

Oral immunisation with Lipid K mixed with TK- HSV-2 alone did not elicit CD8+ T _RM cells in the FRT (Figure 5a). However, mice orally immunised with Lipid K mixed with 10 ⁶ pfu of live TK- HSV-2 followed by IVAG application of DNFB (Live/DNFB) or CXCL9/10 (Live/CXCL) had a significant (p<0.05) increase in CD8+ T _RM cells (CD3+ CD8+ CD103+) in the FRT compared to 'Prime' only controls (Figure 5a). Each 'Prime and pull' immunised mouse had a 3-fold increase in CD8+ T _RM cells in the FRT than the 'Prime' only controls. However, mice orally immunised with Lipid K mixed with TK- HSV-2 followed by an IVAG pull with either CpG or Lipid K had no enhanced CD8 T _RM count in the FRT (Figure 10a). Live/DNFB immunised mice had CD4 T cells in the FRT 12 weeks following IVAG pull compared to no CD4 T cells in the FRT in Live/CXCL immunised mice (Figure 11).

LIC mice had a significant (p<0.05) increase in CD8+ T _RM cells in the FRT compared to 'Prime' only controls. The LICs had a 10-fold increase in the number of CD8+ T _RM cells compared to the 'Prime' only controls. Furthermore, LIC mice had a 3-fold increase in the number of CD8+ T _RM cells compared to mice orally immunised with the Live/DNFB or Live/CXCL vaccines.

Example 9: CD8+ T cell IFNy expression

Mice immunised with the live vaccine followed by either DNFB or CXLC9/10 IVAG pull had a significant ( >2-fold, p<0.05) increase in IFNy-secreting CD3+ CD8+ T cells in the FRT compared to 'Prime' only controls. Furthermore, CD3+ CD8+ T cells in the FRT of Live/DNFB immunised mice had a 4-fold increase in IFNy-secreting CD8+ cells compared to live immunised groups (Figure 11). However, no increase was observed in IFNy expression by CD3+ CD8+ T cells in mice immunised with the UV/DNFB or UV/CXCL (Figure 5b). A significant (p<0.05), 2-fold increase in IFNy expression by CD3+ CD8+ T cells was observed in the FRT of LICs compared to the CD3+ CD8+ T cells isolated in the FRT of mice orally immunised with 10 ⁶ pfu of live TK- HSV-2 (Prime only) controls.

Prime and Pull vaccination resulted in prolonged IFNy-secretion by FRT CD3+ CD8+ T cells. CD3+ CD8+ cells from mice orally immunised with the Live/DNFB or Live/CXCL vaccines continued to have a significantly (p<0.05) increased secretion of IFNy after 72hrs exposure to UV-inactivated TK- HSV-2 (Figure 11).

Example 10: Mice pathology

'Prime and Pulled' mice were intravaginally challenged with a lethal dose of WT HSV-

2 12 weeks following final immunisation. Mice immunised with Lipid K mixed with live TK- HSV-2 before IVAG pull with either DNFB or CXCL9/10 had a significant (p<0.05) reduction in pathology compared to PBS immunised controls after WT HSV-2 challenge (Figure 6a). Sixty percent of mice immunised with Live/CXCL had no pathology and all pathology had resolved within 7dpi. The live infections controls (LICs) also had a significant (p<0.05) decrease in pathology compared to PBS immunised controls (Figure 6a). Pathology was not decreased in mice orally immunised with Lipid K mixed with TK- HSV-2 followed by an IVAG pull with either CpG or Lipid K had no enhanced CD8 T _RM count in the FRT (Figure 10b). Example 11: Mice survival and viral load in the DRG

'Prime and Pull' immunised mice were monitored daily for pathology against a lethal IVAG dose of WT HSV-2 challenge. Mice immunised with the Live/DNFB or Live/CXCL vaccines had a significant (p<0.01) enhancement of survival compa red to PBS immunised controls (Figure 6b). All mice (100%) survived the lethal IVAG WT HSV-2 challenge compared to no survival (0%) in the PBS control group. The survival was the same as the LIC group, which also had 100% survival. Enhanced survival was associated with a greatly reduced viral load in the spinal cord compared to PBS immunised controls (Figure 6c). Survival was not enhanced in mice orally immunised with Lipid K mixed with TK- HSV-2 followed by an IVAG pull with either CpG or Lipid K had no enhanced CD8 T _RM count in the FRT (Figure 10c).

Example 12: Guinea pig pathology

Guinea pigs were intravaginally infected with 5xl0 ⁵ pfu of WT HSV-2 before 'Prime and Pull' immunisation. Before the intravaginal pull, guinea pigs immunised with Lipid K mixed with live TK- HSV-2 without the pull had a significant (p<0.001) reduction in genital pathology compared to PBS immunised controls (Figure 7a). Likewise, guinea pigs orally immunised with Lipid K mixed with UV-inactivated TK- HSV-2 had a significant (p<0.05) reduction in genital pathology compared to PBS controls (Figure 7a).

After the intravaginal pull, guinea pigs orally immunised with Lipid K mixed with live TK- HSV-2 before IVAG pull with DNFB had significantly (p<0.05) reduced pathology compared to PBS immunised controls (Figure 7b). Furthermore, the DNFB/live immunised guinea pigs had significantly (p<0.05) reduced pathology compared to the no pull/live immunised guinea pigs (Figure 7b). Live/DNFB immunised guinea pigs had less reoccurrence events compared to other vaccine groups (Figure 7c).

Guniea pigs intravaginally treated with either DNFB or Imiquimod had more CD8 T cells in the periphery of the FRT compared to no pull controls. No pull controls had CD8 T cells within the FRT but not in the periphery of the tissue (Figure 12).

Example 13: Discussion

Vaccine-induced CD4+ and/or CD8+ T _RM cells in the FRT of mice have been shown to protect against lethal intravaginal WT HSV-2 challenge ^13,15 . Oral immunisation with Lipid K mixed with TK- HSV-2 antigen induced HSV-2-specific IgG and IgA in the VL, increasing survival against IVAG HSV-2 challenge to 60%, but did not elicit CD8+ T _RM cells in the FRT. However, IVAG application of either DNFB or CXCL9/10 following oral immunisation recruited (pulled) CD8+ T _RM cells and CD4 T cells into the genital epithelium, providing complete protection against lethal intravaginal HSV-2 challenge.

Protection induced by oral immunisation with Lipid K mixed with live TK- HSV-2, without the local 'Pull' was short-lived. The 60% protection observed in mice intravaginally challenged at one week following immunisation was not observed at 12 weeks. The absence of T cells after oral immunisation suggests vaccine-induced IgG and IgA in the vaginal lavage mediated protection against intravaginal HSV-2 challenge. The difference in survival overtime reflects this.

Addition of a single topical treatment of either DNFB or CXCL9/10 (Pull) three days following oral immunisation led to protection in 100% of mice against lethal HSV-2 challenge. Protection was associated with greatly decreased spread of the virus from the genital epithelium to the spinal cord. Protection of the neurons from HSV-2 infection would reduce reactivation and viral shedding thereby reducing disease and transmission risk ³ . The exact role CD8+ T _RM cells play in this protection is still unclear but is likely due to the release of IFNy within the first 12hrs of infection resulting in control of viral replication and spread to the neurons.

CD8+ TR _M cells have been implicated in prevention of HSV-2 release from the DRG in humans where they acted as a blockade at the DEJ near the DRG, to contain the virus in the neurons ^16,17 . Guinea pigs immunised with the Live/DNFB vaccines were protected against genital pathology after genital HSV-2 infection. An increase in the number of HSV-2-specific TR _M cells may have acted as a blockage against HSV-2 reactivation from the DRG. The use of Imiquimod as a pull did not suppress pathology, which indicates an inability to enhance an effective population of T _RM cells. However, further optimisation of the 'Pull' needs to be achieved before clinical application of the vaccine.

DNFB obviously elicits too much inflammation to be safely used in humans ¹⁸ and CXCL9/10 chemo-attractants are mouse specific and expensive, which may limit their use in human trials. A cheap, effective 'Pull', that is safe for human use needs to be identified to enable the prime and pull approach to be trialled in humans as both a prophylactic and therapeutic vaccine.

Overall, the 'Prime and Pull' strategy presented in this paper provided 100% protection against a lethal IVAG WT HSV-2 challenge in mice. Clearly, the ability to recruit and establish a long-term CD8+ and CD4+ T _RM cells in the FRT was crucial to protection. The establishment of these CD8+ and CD4+ T _RM cells in mucosal tissues could be used to aid new vaccines in preventing mucosal infections.

All patents, publications, scientific articles, web sites, and other documents and materials referenced or mentioned herein are indicative of the levels of skill of those skilled in the art to which the invention pertains, and each such referenced document and material is hereby incorporated by reference to the same extent as if it had been incorporated by reference in its entirety individually or set forth herein in its entirety. Applicants reserve the right to physically incorporate into this specification any and all materials and information from any such patents, publications, scientific articles, web sites, electronically available information, and other referenced materials or documents.

Although the invention has been described by way of example, it should be appreciated that variations and modifications may be made without departing from the scope of the invention as defined in the claims. Furthermore, where known equivalents exist to specific features, such equivalents are incorporated as if specifically referred in this specification. The specific compositions and methods described herein are representative of preferred examples and are exemplary and not intended as limitations on the scope of the invention. Other aspects and examples will occur to those skilled in the art upon consideration of this specification, and are encompassed within the spirit of the invention as defined by the scope of the claims. It will be readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein suitably may be practiced in the absence of any element or elements, or limitation or limitations, which is not specifically disclosed as essential. Thus, for example, in each instance described or used herein, in examples or examples of the present invention, any of the terms "comprising", "consisting essentially of", and "consisting of" may be replaced with either of the other two terms in the specification. Also, the terms "comprising", "including", containing", etc. are to be read expansively and without limitation. The assays and methods illustratively described herein suitably may be practiced in differing orders of steps, and that they are not necessarily restricted to the orders of steps indicated herein or in the claims. Further, as used or described herein and in the appended claims, the singular forms "a," "an," and "the" include plural reference unless the context clearly dictates otherwise. Under no circumstances may the patent be interpreted to be limited to the specific examples or examples or methods specifically disclosed herein.

The terms and expressions that have been employed are used as terms of description and not of limitation, and there is no intent in the use of such terms and expressions to exclude any equivalent of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention as claimed. Thus, it will be understood that although the present invention has been specifically disclosed by preferred examples and optional features, modification and variation of the concepts disclosed herein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as described herein, and as defined by the appended claims.

The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. Other examples are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. REFERENCES

1. Shin, H. & Iwasaki, A. A vaccine strategy that protects against genital herpes by establishing local memory T cells. Nature 491, 463-467 (2012).

2. Parr, E. L. & Parr, M. B. Immunoglobulin G is the main protective antibody in mouse vaginal secretions after vaginal immunization with attenuated herpes simplex virus type 2.

Journal of Virology 71, 1-8 (1997).

3. Wakim, L. M., Jones, C. M., Gebhardt, T., Preston, C. M. & Carbone, F. R. CD8+ T- cell attenuation of cutaneous herpes simplex virus infection reduces the average vira l copy number of the ensuing latent infection. Immunology and Cell Biology 86, 666-675 (2008). 4. Lycke, E. et al. Herpes simplex virus infection of the human sensory neuron.

Archives of Virology 101, 87-104 (1988).

5. Hickey, D. K. et a/. Intranasal immunization with C. muridarum major outer membrane protein (MOMP) and cholera toxin elicits local production of neutralising IgA in the prostate. Vaccine 22, 4306-4315 (2004).

6. Hickey, D. K., Aldwell, F. E. & Beagley, K. W. Oral immunization with a novel lipid- based adjuvant protects against genital Chlamydia infection. Vaccine 28, 1668-1672 (2010).

7. Wizel, B., Persson, J., Thorn, K., Nagy, E. & Harandi, A. M. Nasal and skin delivery of IC31((R))-adjuvanted recombinant HSV-2 gD protein confers protection against genital herpes. Vaccine 30, 4361-4368 (2012).

8. Stanberry, L. et al. Glycoprotein-D-Adjuvant Vaccine to Prevent Genital Herpes. The new England Journal of Medicine 347, 1652-1661 (2002).

9. Belshe, R. et al. Efficacy Results of a Trial of a Herpes Simplex Vaccine. The new England Journal of Medicine 366, 34-43 (2012).

10. Ogra, P. & Ogra, S. Local antibody response to Poliovaccine in the human female genital tract. The Journal of Immunology 110, 1307-1311 (1973).

11. Parr, E. L. & Parr, M. B. Immune responses and protection against vaginal infection after nasal or vaginal immunization with attenuated herpes simplex virus type-2.

Immunology 98, 639-645 (1999).

12. Mackay, L. K. et a/. Long-lived epithelial immunity by tissue-resident memory T (Trm) cells in the absence of persisting local antigen presentation. Proceedings of the National Academy of Sciences 1-6 (2014). doi : 10.1073/pnas.1202288109/- /DCSupplemental/pnas.201202288SI.pdf

13. Iijima, N. & Iwasaki, A. A local macrophage chemokine network sustains protective tissue-resident memory CD4 T cells. Science 346, 93-98 (2014).

14. Iwasaki, A. Antiviral immune responses in the genital tract: clues for vaccines. Nat Rev Immunol 10, 699-711 (2010). 15. Gebhardt, T. et al. Memory T cells in nonlymphoid tissue that provide enhanced local immunity during infection with herpes simplex virus. Nature Immunology 10, 524-530 (2009).

16. Zhu, J. et al. Immune surveillance by CD8aa. Nature 1-6 (2013).

doi : 10.1038/naturel2110

17. Zhu, J. et al. Virus-specific CD8+ T cells accumulate near sensory nerve endings in genital skin during subclinical HSV-2 reactivation. Journal of Experimental Medicine 204, 595-603 (2007).

18. Gebhardt, T. et al. Different patterns of peripheral migration by memory CD4+ and CD8+ T cells. Nature 477, 216-219 (2011).

19. Walter, A. et al. Aldara activates TLR7-independent immune defence. Nature

Communications 4, 1560 (2013).

20. McDermott, M., Smiley, J ., Leslie, B., Rudzorga, H. & Beinenstock, J. Immunity in the Female Genital Tract After Intravaginal Vaccination of Mice with an Attenuated Strain of Herpes Simplex Virus Type 2. Journal of Virology 51, 747-753 (1984).

21. Parish, C. R., Glidden, M. H., Quah, B. J. C. & Warren, H. S. Use of the Intracellular Fluorescent Dye CFSE to Monitor Lymphocyte Migration and Proliferation. (John Wiley & Sons, Inc., 2001). doi : 10.1002/0471142735. im0409s84

22. Weiner HL. Oral tolerance, an active immunologic process mediated by multiple mechanisms. J Clin Invest 2000 Oct; 106(8) :935-7

23. Williams NA, Hirst TR, Nashar TO. Immune modulation by the cholera-like enterotoxins: from adjuvant to therapeutic. Immunol Today 1999 Feb;20(2) :95-101

24. van Ginkel FW, Jackson RJ, Yuki Y, McGhee JR. Cutting edge: the mucosal adjuvant cholera toxin redirects vaccine proteins into olfactory tissues. J Immunol

2000; 165(9) :4778-82

25. Aldwell FE, Tucker IG, de Lisle GW, Buddie BM. Oral delivery of Mycobacterium bovis BCG in a lipid formulation induces resistance to pulmonary tuberculosis in mice. Infect Immun 2003;71(l) : 101-8; PCT International Patent Application No: PCT/NZ2002/00132

26. Aldwell FE, Tucker IG, de Lisle GW, Buddie BM. Oral delivery of Mycobacterium bovis BCG in a lipid formulation induces resistance to pulmonary tuberculosis in mice. Infect

Immun 2003;71(l) : 101-8

27. Nol P, Palmer MV, Waters WR, Aldwell FE, Buddie BM, Triantis JM, et al. Efficacy of oral and parenteral routes of mycobacterium bovis bacille Calmette-Guerin vaccination against experimental bovine tuberculosis in white-tailed deer (Odocoileus virginianus): a feasibility study. J Wildl Dis 2008 Apr;44(2) : 247-59

28. Clark S, Cross ML, Nadian A, Vipond J, Court P, Williams A, et al. Oral vaccination of guinea pigs with Mycobacterium bovis Bacille Calmette-Guerin (BCG) vaccine in a lipid matrix protects against aerosol infection with virulent M. bovis. Infect Immun 2008 Jun 2 29. Aldwell FE, Keen DL, Parlane NA, Skinner MA, de Lisle GW, Buddie BM. Oral vaccination with Mycobacterium bovis BCG in a lipid formulation induces resistance to pulmonary tuberculosis in brushtail possums. Vaccine 2003 Dec 8;22(l) : 70-6