***

Field of invention

The hereof description regards nucleic acid molecules encoding CSPG4 chimeric proteins and relative therapeutic uses, in particular for the treatment and/or prevention of CSPG4-positive neoplasms.

Background of the invention

Neoplastic cells are often distinguished from normal cells as they express tumor associated antigens

(TAA) that can provide the cells with a proliferative and invasive advantage, contributing to tumor progression. These TAA can be recognized by the immune system that, thanks to its specificity and immunological memory, can attack and eliminate tumor cells in a selective manner without damaging cells of normal tissues, preventing recurrences and metastasis, which are the principal causes of tumor-associated death. This basis gives rise to the idea of generating anti-tumor DNA vaccines encoding for a specific TAA, in order to stimulate the oncological patient's immune system and to induce a specific and long-lasting immune response against tumor cells expressing the TAA.

A TAA highly involved in tumor processes is chondroitin sulfate proteoglycan 4 (CSPG4), a transmembrane proteoglycan initially identified 35 years ago on the membrane of human melanoma cells

(Wilson et al . 1981, Campoli et al. 2010), and recently recognized as overexpressed on neuroectodermic-derived tumors such as glioblastomas (Stallcup and Huang 2008), in certain types of lymphoblastic and acute myeloid leukemia (Petrovici et al . 2010), in triple negative breast cancers (Wang et al . 2010a) and in head and neck carcinomas (Wang et al . 2010b) . Moreover, its overexpression has been recently observed in cancer stem cells (Wang et al . 2010b) , extremely resistant to conventional therapies and responsible for recurrences and metastasis, making CSPG4 an even more interesting target .

Thanks to its characteristics, CSPG4 has been considered by the National Cancer Institute as a prioritized antigen for translational research into clinical practice (Cheever et al . 2009) . However, as for many other TAA, CSPG4 is an immunologically tolerated self-antigen, and the success of an anti- CSPG4 DNA vaccine therefore relies on its ability to break immune tolerance.

An attempt to develop a DNA vaccine for the treatment of canine malignant melanoma has been carried out by the hereof inventors and is described in (Riccardo et al . 2014) . In this cited study, dogs affected by a stage II-III CSPG4-positive oral malignant melanoma, previously subjected to surgical resection of the tumor, were vaccinated with a plasmid encoding the human CSPG4. The vaccine was effective in prolonging the survival of canine patients thanks to the induction of a direct humoral response against CSPG4. However, the vaccine-induced antibodies recognized the canine CSPG4 protein with a low affinity Moreover, the vaccine did not induce an evident specific cell-mediated response and some vaccinated dogs developed metastases that resulted in their death.

Summary of the invention

The object of the present description is to develop means for treating and/or preventing CSPG4- positive neoplasms in mammals, wherein these means are able to break the immune tolerance of the organism to be treated, stimulating a humoral response against CSPG4 and a specific cell-mediated immune response.

In agreement with the invention, the aforesaid object is obtained thanks to the solution specifically recalled in the attached claims, which represent an integral part of the present description.

One embodiment of the present invention regards a nucleic acid molecule encoding a full-length chimeric protein, chondroitin sulfate proteoglycan 4 (CSPG4), where the CSPG4 chimeric protein includes from the N- terminal to the C-terminal:

i) a first portion derived from the human CSPG4 sequence and a second portion derived from the canine CSPG4 sequence, or

ii) a first portion derived from the canine CSPG4 sequence and a second portion derived from the human CSPG4 sequence.

Brief description of the figures

The invention will be now described in detail, purely as an illustrative and non-limiting example, with reference to the attached figures, wherein:

Figure 1. Specific humoral response against CSPG4-positive human melanoma cells (SK-MEL28, ATCC ^® HTB-72 ^™ ) (A) and against a primary cell line obtained, as described in (Riccardo et al . 2014) , from a bioptic sample of a canine patient affected by CSPG4- positive oral melanoma (B) evaluated 2 weeks after the last vaccination of BALB/c mice with the plasmid pcDNA3. l-HuDo-CSPG4-l or with the empty control plasmid pcDNA3.1. The antibody titer is expressed as mean fluorescence intensity (MFI) .

- Figure 2. Immunofluorescence assay to evaluate the specific antibody response against a primary cell line obtained from a bioptic sample of a dog affected by CSPG4-positive oral melanoma, induced in a canine patient vaccinated with plasmid pcDNA3. l-HuDo-CSPG4-l . Representative images of primary melanoma cells incubated with the serum of a canine patient before the start of the vaccination cycle (A) and after the IV immunization (B) . A secondary FITC-con ugated antibody (F7884, Sigma) was used to reveal canine immunoglobulins that recognized canine CSPG4 protein in its native conformation on the membrane of the primary melanoma cells. Cell nuclei were stained with DAPI . Magnification 20X.

Figure 3. Evaluation of the activation of T lymphocytes from healthy human donors following 7 days of co-culture with mature dendritic cells (mDC) transfected with empty pCDNA3.1, pCDNA3.1-Human-CSPG4 (Yang et al . 2004) and pCDNA3. l-HuDo-CSPG4-l . The specific IFNy release from pre-stimulated T lymphocytes against CSPG4-positive human melanoma cells Mell300 [kind gift from P. Circosta and maintained in culture as described in (Circosta et al . 2009)] was evaluated in the absence (A) or presence (B) of an antibody against HLA class I molecules (W6/32, Sigma) . The number of spots were counted with a Transtec 1300 ELISPOT Reader (AMI Bioline) and results were expressed as number of spots/lxlO ⁵ cells. (C) The release of ⁵¹ Cr from labeled CSPG4-positive Mell300 cells, following incubation with lymphocytes pre-stimulated in the different conditions was detected, and results were expressed as number of lytic unit/10 ⁷ effector cells. (D) The intracellular expression of perforin (Pfp) within CD8+ cells was evaluated using an APC-con ugated antibody directed against Pfp (clone dG9, Biolegend) and the results were expressed as percentage of Pfp+ and CD8+ cells. - Figure 4. Nucleotide sequence of the chimeric antigen HuDo-CSPG4-l (SEQ ID No.: 5) . The illustrated sequence includes: (A) the site recognized by the restriction enzyme EcoRI (double-underlined sequence) and the first 3737 bp of the human CSPG4 sequence (from the ATG start codon to the cutting site of the restriction enzyme Bglll - single-underlined sequence) , and (B) the 3187 bp of the canine CSPG4 sequence (from the cutting site of the restriction enzyme Bglll to the STOP codon) as well as the sequence recognized by the restriction enzyme Xbal (sequence highlighted with a dotted line) .

- Figure 5. Sequence of the chimeric antigen DoHu- CSPG4-1 (SEQ ID No.:10) . The illustrated sequence includes: (A) the site recognized by the restriction enzyme EcoRI (double-underlined sequence) and the first 5018 bp of the canine CSPG4 sequence (XM_544783.2, from the ATG start codon to the cutting site of the restriction enzyme Bglll - single-underlined sequence) and (B) the 3232 bp of the human CSPG4 sequence (from the cutting site of the restriction enzyme Bglll to the STOP codon) as well as the sequence recognized by the restriction enzyme Xbal (sequence highlighted with a dotted line) .

Detailed description of the invention

The invention will be now described in detail, purely as an illustrative and non-limiting example.

In the following description, many specific details are presented to provide a complete understanding of the embodiments . The embodiments can be implemented in practice without one or more specific details, or with other methods, compounds, materials, etc. In other cases, structures, materials, or well- known operations are not shown or described in detail to avoid obscuring certain aspects of the embodiments.

Throughout the present specification, the reference to "one embodiment" or "an embodiment" signifies that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the presence of expressions such as "in a certain embodiment" or "in an embodiment" in various sites throughout the present specification does not necessarily always refer to the same embodiment.

Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

The titles used herein are simply for convenience and do not interpret the object or the meaning of the embodiments .

The present description concerns means for treating and/or preventing CSPG4-positive neoplasms in mammals, where these means are able to break the immune tolerance of the organism to be treated, stimulating a humoral response against CSPG4, and a specific cellular-mediated immune response.

In one embodiment, the present description concerns nucleic acid molecules encoding chimeric CSPG4 proteins, where the chimeric CSPG4 proteins include a portion derived from the nucleotide sequence of the human oncogene CSPG4 (in which the "NCBI Reference Sequence" is Gene ID 1464) and a portion derived from the nucleotide sequence of the canine oncogene CSPG4 (in which the "NCBI Reference Sequence" is XM_544783.2 or Gene ID 487658) . The human and canine amino acid sequences of CSPG4 have an 82% identity and an 88% similarity; the aforesaid characteristics of the canine and human CSPG4 sequences allow their assembly and production of chimeric proteins with a conformation and membrane expression similar to the native human and canine CSPG4 proteins so that they can induce a humoral and cellular-mediated response in the organism in which they are expressed.

One embodiment of the present description concerns a nucleic acid molecule encoding a full-length chimeric protein chondroitin sulfate proteoglycan 4 (CSPG4), where the chimeric CSPG4 protein includes from the N-terminal to the C-terminal:

i) a first portion derived from the human CSPG4 sequence and a second portion derived from the canine CSPG4 sequence, or

ii) a first portion derived from the canine CSPG4 sequence and a second portion derived from the human CSPG4 sequence,

where this chimeric protein is able to induce a humoral and cellular response.

In one embodiment, the nucleic acid molecule encoding a chimeric protein chondroitin sulfate proteoglycan 4 (CSPG4) comprises a first portion having an amino acid sequence encoded by a nucleotide sequence selected from SEQ ID No.: 11 to 17 or a sequence having a sequence identity of at least 90% with one of the sequences from SEQ ID No.: 11 to 17, and a second portion having an amino acid sequence encoded by a nucleotide sequence selected from SEQ ID No.: 18 to 23 or a sequence having a sequence identity of at least 90% with one of the sequences from SEQ ID No.: 18 to 23, and in which the first portion and the second portion are adjacent to each other and linked as indicated in the following Table 1:

Table 1

First portion Second portion

SEQ ID No. : 11 SEQ ID No. : 18

SEQ ID No. : 12 SEQ ID No. : 19 First portion Second portion

SEQ ID No. 13 SEQ ID No. 20

SEQ ID No. 14 SEQ ID No. 21

SEQ ID No. 15 SEQ ID No. 22

SEQ ID No. 16 SEQ ID No. 23

SEQ ID No. 17 SEQ ID No. 23

The SEQ ID No.: 11 corresponds to the first 1920 bp (from the ATG start codon) of the human CSPG4 sequence; the SEQ ID No.: 12 corresponds to the first 4767 bp (from the ATG start codon) of the human CSPG4 sequence; the SEQ ID No.: 13 corresponds to the first 1965 bp (from the ATG start codon) of the canine CSPG4 sequence (Gene ID 487658); the SEQ ID No.: 14 corresponds to the first 4815 bp (from the ATG start codon) of the canine CSPG4 sequence (Gene ID 487658); the SEQ ID No.: 15 corresponds to the first 3737 bp (from the ATG start codon) of the human CSPG4 sequence; the SEQ ID No.: 16 corresponds to the first 5018 bp (from the ATG start codon) of the canine CSPG4 sequence (XM_544783.2) ; the SEQ ID No.: 17 corresponds to the first 3785 bp (from the ATG start codon) of the canine CSPG4 sequence (Gene ID 487658) .

The SEQ ID No.: 18 corresponds to the 5007 bp starting from the base 1966 until the STOP codon of the canine sequence (Gene ID 487658); the SEQ ID No.: 19 corresponds to the 2157 bp starting from the base 4816 until the STOP codon of the canine sequence (Gene ID 487658); the SEQ ID No.: 20 corresponds to the 5049 bp starting from the base 1921 until the STOP codon of the human sequence; the SEQ ID No.: 21 corresponds to the 2202 bp starting from the base 4768 until the STOP codon of the human sequence; the SEQ ID No.: 22 corresponds to the 3187 bp starting from the base 3786 until the STOP codon of the canine sequence (Gene ID 487658); the SEQ ID No.: 23 corresponds to the 3232 bp starting from the base 3738 until the STOP codon of the human sequence.

In a preferential embodiment, the nucleic acid molecule encoding the chimeric protein chondroitin sulfate proteoglycan 4 (CSPG4) comprises a first portion having an amino acid sequence encoded by a nucleotide sequence selected from SEQ ID No.: 11, 15 and 17, and a second portion having an amino acid sequence encoded by a nucleotide sequence selected from SEQ ID No.: 18, 22 and 23, and in which the first portion and the second portion are adjacent to each other and linked as indicated in Table 1.

In one embodiment, nucleic acid molecules encoding chimeric CSPG4 proteins are part of a plasmid suitable for the in vivo administration in mammals, preferably a dog or a human, more preferably a dog. In addition to the aforesaid nucleic acid molecules encoding chimeric human/dog CSPG4 proteins, the plasmids can include other functional sequences necessary for the transcription of the chimeric protein, known to the expert of the field, among which can be cited: transcriptional promoters, sequences that start or stop transcription, genes encoding for antibiotic resistance, etc .

In an another embodiment of the hereof description, nucleic acid molecules encoding chimeric CSPG4 proteins or the relative plasmids are formulated as pharmaceutical compositions for the in vivo administration in a mammal, these pharmaceutical compositions can obviously contain pharmaceutically acceptable excipients and/or vehicles. Being vaccine pharmaceutical compositions, these compositions can contain adjuvants to stimulate the immune response of the organism to be treated. These adjuvants are well known in the state-of-the-art and it is not necessary in this description to provide specific details that are trackable in the scientific literature available to an expert in the field. Equally known to an expert in the field are the methods for administering a DNA vaccine in an animal or human patient.

Pharmaceutical compositions containing nucleic acid molecules encoding the herein-described chimeric CSPG4 proteins are used for the treatment and/or the prevention of CSPG4-positive neoplasms in a mammal. The term "treatment" means the administration of the aforesaid pharmaceutical compositions to patients (veterinary or human) who have already developed a CSPG4-positive neoplasm; the term "prevention" means the administration of the aforesaid pharmaceutical compositions to patients (veterinary or human) who are at risk of developing a CSPG4-postive neoplasm.

The hereof description demonstrates that plasmids encoding full-length chimeric human/dog CSPG4 proteins are able to stimulate an immune response in mice, dogs and humans, making these molecules suitable for producing a DNA vaccine intended for the treatment and/or prevention of a CSPG4-positive tumor in a mammal.

Hybrid plasmids encoding full-length chimeric human/dog CSPG4 proteins subject of the present description, being able to induce a combined humoral and cellular response, are more efficient in treating dogs affected by CSPG4-positive malignant melanomas (MM) compared to plasmids encoding the human CSPG4 antigen described in (Riccardo et al, 2014) .

Moreover, the possibility of studying new antitumor therapies in large animals such as dogs, which spontaneously develop tumors characterized by histological, molecular and clinical-biological features similar to the human neoplasm counterparts, is acquiring a huge value for the translation of the preclinical phase into human clinics. In particular, canine MM (cMM) is one of the most interesting tumors for comparative oncology studies, since it shows many similarities to the human tumor counterpart, both from the anatomic, histopathologic and the genetic point of view (Bergman 2007, Simpson et al . 2014) . In a manner analogous to that of humans, MM is also a frequent tumor in dogs, for which the standard treatments are: surgical resection of the tumor, and radio- and chemo- therapy, which only result in the local control of the tumor in 75% of animals, however the 1-year survival rate does not exceed 30% because of recurrences and metastases (Boston et al . 2014) .

Considering that CSPG4 expression is also very frequent in several human neoplasms, such as MM, neuroectodermic-derived tumors (such as glioblastomas), lymphoblastic and acute myeloid leukemia, osteosarcomas, head and neck tumors and triple negative breast cancers, the present inventors investigated the possibility of using nucleic acid molecules encoding chimeric CSPG4 proteins described herein for the treatment of these human neoplasms.

Unexpectedly, the present inventors discovered that nucleic acid molecules encoding chimeric CSPG4 proteins, subject of the hereof description, can be used for preventing and/or treating CSPG4-positive neoplasms in humans . Indeed, the results reported here in human dendritic cells show that these nucleic acid molecules are able to break the tolerance and the unresponsiveness of the human T cells against the CSPG4 self-antigen and, therefore, can be used in the human oncology field for CSPG4-positive neoplasms.

Materials and Methods Construction of hybrid human/dog sequences encoding chimeric CSPG4 proteins

Two hybrid sequences encoding chimeric CSPG4 proteins were generated: the HuDo-CSPG4-l encoding the chimeric CSPG4 protein in which the N-terminal region is derived from the human sequence and the remaining part from the canine sequence, and the DoHu-CSPG4-l sequence encoding the CSPG4 chimeric protein in which the N-terminal region is derived from the canine sequence and the remaining part from the human sequence.

The human and the canine CSPG4 sequences, of which the "NCBI Reference Sequences" are Gene ID 1464 and XM_544783.2, respectively, were inserted into the plasmid backbone pcDNA3.1 (Clontech) , generating the plasmids pcDNA3.1-Human-CSPG4 and pcDNA3. l-Dog-CSPG4 , respectively. These plasmids were used as templates to amplify- by means of PCR- the cDNA fragments encoding the human and canine CSPG4 portions to be used to generate the hybrid sequences HuDo-CSPG4-l and DoHu- CSPG4-1.

In particular, to amplify the portion encoding the N-terminal part of the human CSPG4 to be inserted into the HuDo-CSPG4-l sequence, the plasmid pcDNA3.1-Human- CSPG4 and the following primers were used:

- forward oligonucleotide (SEQ ID No . : 1 ) that anneals on the ATG start codon and including- upstream- the sequence of the EcoRI recognition site and the EcoRI activity optimization followed by the Kozak sequence,

SEQ ID No.:l: 5' - CCGGAATTCGCCATGCAGTCCGGGCCGCGGCCC - 3' ;

reverse oligonucleotide (SEQ ID No . : 2 ) that anneals on the human CSPG4 sequence starting from 117 bp downstream of the Bglll cutting site and including the sequence of the Xbal recognition site and Xbal activity optimization,

SEQ ID No.:2: 5' - GGTCTAGAGACACCATCACCAGGTAGCC - 3' .

PCR was performed using reagents and the "proofreading" Taq polymerase from QIAGEN. Reagent quantities and specific reaction conditions (temperatures and times) are reported in the following Tables 2 and 3. Table 2

Table 3

The PCR product was purified with the "QIAquick PCR Purification Kit" (QIAGEN) , digested with EcoRI and Bglll restriction enzymes, purified again by gel electrophoresis and gel extraction using the "QIAquick Gel Extraction" (QIAGEN) . The obtained product was named Hu-Fragment A.

Analogously, to amplify the portion encoding the C-terminal part of the canine CSPG4 to be inserted into the sequence HuDo-CSPG4-l , the plasmid pcDNA3.1-Dog- CSPG4 and the following oligonucleotides were used:

forward oligonucleotide (SEQ ID No.: 3) that anneals on the dog CSPG4 sequence starting from 388 bp upstream of the Bglll cutting site and including the sequence of the EcoRI recognition site and EcoRI activity optimization followed by the Kozak sequence, SEQ ID No.:3: 5' - CCGGAATTCGCCTGCTTGAAGTGCAGGCATCCG - 3' ;

reverse oligonucleotide (SEQ ID No . : 4 ) that anneals on the STOP codon of the canine CSPG4 sequence and including the sequence of the Xbal recognition site and Xbal activity optimization,

SEQ ID No.:4: 5' - GGTCTAGATCACACCCAGTACTGGCCGTT - 3' .

PCR was performed using reagents and the "proofreading" Taq polymerase from QIAGEN. Reagent quantities and specific reaction conditions (temperatures and times) are reported in the following Tables 4 and 5.

Table 4

Table 5 Amplification protocol

Temperature Time Event

94°C 2 min Initial denaturation

94°C 15 sec Denaturation

Gradient from Oligonucleotide

30 sec

44 to 56°C annealing

72°C 4 min 30 sec Extension

For a total of 35 cycles

72°C 8 min Final extension

4°C

The PCR product was purified with the "QIAquick PCR Purification Kit" (QIAGEN) , digested with Bglll and Xbal restriction enzymes, purified again by gel electrophoresis and gel extraction using the "QIAquick Gel Extraction" (QIAGEN) . The obtained product was named Do-Fragment A.

To generate the hybrid sequence HuDo-CSPG4-l , Hu- Fragment A and Do-Fragment A were linked by means of a ligation reaction using reagents and the relative quantities are listed in table 6.

Table 6

The ligation reaction was incubated at 16°C for 4 hours .

The ligation product is the hybrid sequence HuDo- CSPG4-1 containing the EcoRI and Xbal restriction sites at its ends. HuDo-CSPG4-l (SEQ ID No.:5) includes the first 3737 bp (from the ATG start codon to the cutting site of the Bglll restriction enzyme - SEQ ID No.: 15) of the human CSPG4 sequence and the remaining 3187 bp (from the cutting site of the Bglll restriction enzyme to the STOP codon - SEQ ID No.: 22) of the canine CSPG4 sequence. The plasmid including the HuDo-CSPG4-l sequence was used to perform the DNA vaccination and the immunological assays listed below.

To amplify the portion encoding the N-terminal part of the canine CSPG4 to be inserted in the DoHu- CSPG4-1, pcDNA3. l-Dog-CSPG4 and the following oligonucleotides were used:

forward oligonucleotide (SEQ ID No.: 6) that anneals on the ATG start codon and including- upstream- the sequence of the EcoRI recognition site and EcoRI activity optimization followed by the Kozak sequence,

SEQ ID No.: 6: 5' - CCGGAATTCGCCATGGCCCTCGGTGCTCTGCAG - 3' ;

reverse oligonucleotide (SEQ ID No . : 7 ) that anneals on the canine CSPG4 sequence starting from 255 bp downstream of the Bglll cutting site and containing the Xbal recognition site and Xbal activity optimization,

SEQ ID No.:7: 5' - GGTCTAGACCCACGTCTAGGGAGAAGGA - 3' .

PCR was performed using reagents and the "proofreading" Taq polymerase from QIAGEN. Reagent quantities and specific reaction conditions (temperatures and times) are reported in the following Tables 7 and 8.

Table 7

PCR solutions (20 ul final volume)

Reagents Volume

DNA (template) 1 μΐ (100 ng)

Buffer 10X 2 μΐ

dNTPs 10 mM 0.5 μΐ

Forward oligonucleotide

1.2 μΐ

(SEQ ID No. : 6) PCR solutions (20 ul final volume)

Reagents Volume

Reverse oligonucleotide

1.2 μΐ

(SEQ ID No. : 7)

Taq Polymerase (ΐυ/μΐ) 0.5 μΐ

H ₂ 0 13.6 μΐ

Table 8

The PCR product was purified with the "QIAquick PCR Purification Kit" (QIAGEN) , digested with EcoRI and Bglll restriction enzymes, purified again by gel electrophoresis and gel extraction using the "QIAquick Gel Extraction" (QIAGEN) . The obtained product was named Do-Fragment B.

Analogously, to amplify the portion encoding the

C-terminal part of the human CSPG4 to be inserted into the sequence DoHu-CSPG4-l , the plasmid pcDNA3.1-Human- CSPG4 and the following oligonucleotides were used:

forward oligonucleotide (SEQ ID No . : 8 ) that anneals starting from 152 bp upstream of the Bglll cutting site and containing the sequence of the EcoRI recognition site and EcoRI activity optimization followed by the Kozak sequence,

SEQ ID No.:8: 5' - CCGGAATTCGCCGCCGTTCTCTATAGCCACAA - 3 ' ;

reverse oligonucleotide (SEQ ID No.: 9) that anneals on the STOP codon of the human CSPG4 sequence and including the sequence of the Xbal recognition site and Xbal activity optimization,

SEQ ID No.: 9: 5' - GGTCTAGATCACACCCAGTACTGGCCATT - 3' .

PCR was performed using reagents and the "proofreading" Taq polymerase from QIAGEN. Reagent quantities and specific reaction conditions (temperatures and times) are reported in the following Tables 9 and 10.

Table 9

Table 10

The PCR product was purified with the "QIAquick PCR Purification Kit" (QIAGEN) , digested with Bglll and Xbal restriction enzymes, purified again by gel electrophoresis and gel extraction using the "QIAquick Gel Extraction" (QIAGEN) . The obtained product was named Hu-Fragment B. To generate the hybrid sequence DoHu-CSPG4-l , Do- Fragment B and Hu-Fragment B were linked by means of a ligation reaction using reagents and the relative quantities listed in table 11.

Table 11

The ligation reaction was incubated at 16°C for 4 hours .

The ligation product is the hybrid sequence DoHu- CSPG4-1 containing the EcoRI and Xbal restriction sites at its ends. DoHu-CSPG4-l (SEQ ID No.:10) includes the first 5018 bp (from the ATG start codon to the cutting site of the Bglll restriction enzyme - SEQ ID No.: 16) of the canine CSPG4 sequence and the remaining 3232 bp (from the cutting site of the Bglll restriction enzyme to the STOP codon - SEQ ID No.: 23) of the human CSPG4 sequence .

Construction of the pcDNA3.1 -HuDo-CSPG4-l and pcDNA3. l-DoHu-CSPG4-l plasmids

Ligation products HuDo-CSPG4-l and DoHu-CSPG4-l were purified by means of phenol/chloroform extraction (SIGMA) , digested with EcoRI and Xbal restriction enzymes, purified again as described above, so that they are then able to be inserted into any suitable cloning vector. Each of the products thus obtained was inserted through a ligation reaction into the pcDNA3.1 plasmid previously digested with the same restriction enzymes, dephosphorylated using the Alkaline Phosphatase Enzyme, Calf Intestinal (BioLabs) and purified by means of gel electrophoresis and gel extraction using the "QIAquick Gel Extraction" (QIAGEN) ; reagents and volumes are listed in Table 12.

Table 12

The ligation reaction was incubated at 16°C for 4 hours .

The ligation product was then used to transform strain DH5 E. coli bacteria. Transformation of strain DH5a E. coli

Competent bacteria cells 100 μΐ

Ligation product 10 μΐ

To transform the strain DH5 E. coli, competent bacteria were incubated on ice for 30 minutes with the ligation product followed by a thermic shock for 45 seconds at 42°C, and immediately transferred to ice for 2 minutes. A 1 ml-volume of Luria Bertani (LB) growth medium was added and transformed bacteria cells were incubated for 1 hour at 37°C. Cellular suspensions were then centrifuged at 13000 rpm for 1 minute and pellets were suspended in 150 μΐ of LB. Bacteria cells were then plated on petri dishes containing a solid selective medium (LB with agar + ampicillin 100 μg/ml) and left to grow overnight at 37 °C. Plasmid DNA was extracted from the clones by means of the "Miniprep" kit (QIAGEN) and was subsequently analyzed by enzymatic digestion. The plasmid DNA extracted from one of the positive clones was sequenced, obtaining the SEQ ID No . : 5 corresponding to the chimeric human/dog antigen of the pcDNA3. l-HuDo-CSPG4-l plasmid, and the SEQ ID No.: 10, corresponding to the chimeric dog/human antigen of the pcDNA3. l-DoHu-CSPG4-l plasmid.

RESULTS

Evaluation of the immunogenicity of the hybrid plasmid pcDNA3.1-HuDo-CSPG4-1

In vivo: laboratory mice

Firstly, the immunogenicity of the hybrid plasmid pcDNA3. l-HuDo-CSPG4-l was evaluated in 7-week-old BALB/c female mice (Charles River) . Briefly, 50 \iq of pcDNA3. l-HuDo-CSPG4-l in 20 μΐ of a 0.03% NaCl solution was administered intramuscularly to mice anesthetized with a solution of Zoletil (Virbac) and Rompum (Bayer) . The injection was followed by electroporation by means of CLINIPORATOR (Igea) . Mice vaccinated with the empty plasmid pcDNA3.1 were used as controls. The immunization was performed twice for each animal, with an interval of 14 days from each other. At 2 weeks after the last vaccination, a blood sample was taken and the presence of specific antibodies directed against the human and canine CSPG4 proteins was evaluated in the sera. In particular, sera of vaccinated animals were incubated for 45 minutes at 4°C with human melanoma cells overexpressing the human CSPG4 protein ( SK-MEL28 cells, ATCC ^® HTB-72 ^™ , Figure 1A) or with canine melanoma cells expressing the canine CSPG4 protein (a primary cell line derived from a bioptic sample of a canine patient affected by CSPG4- positive oral melanoma, Figure IB) . After washing with a solution denominated washing buffer, composed of phosphate-buffered saline (PBS) containing 0.2% of bovine serum albumin (BSA) and 0.1% of sodium azide (NaN ₃ ) , samples were incubated for 30 minutes at 4°C with an FITC-con ugated anti-mouse immunoglobulin antibody (F0232, Dako) , washed with washing buffer and analyzed using a FACScan cytofluorimeter instrument (Becton Dickinson Immunocytometry System) .

Results demonstrated that all the animals vaccinated with the hybrid plasmid pcDNA3. l-HuDo-CSPG4- 1 showed a specific antibody response against the human (Figure 1A) and the canine (Figure IB) CSPG4 proteins.

These results highlight that the plasmid pcDNA3.1- HuDo-CSPG4-l : i) encodes for a chimeric human/dog CSPG4 protein, correctly translated; ii) is immunogenic in mice, inducing an antibody response against both the human and the canine CSPG4 proteins.

In vivo: dogs

To evaluate the immunogenicity and the consequent anti-tumor potential of the plasmid pcDNA3.1-HuDo- CSPG4-1 against CSPG4-positive tumors in the veterinary field, dogs affected by stage II and III, CSPG4- positive oral melanoma were vaccinated with the hybrid plasmid in question, 1 month after surgical resection of the tumor. The DNA vaccination protocol consisted of one injection- in the caudal muscle of the leg- of 500iq of pcDNA3. l-HuDo-CSPG4-l plasmid in 200 μΐ of 0.03% NaCl solution, followed by electroporation by means of CLINIPORATOR (Igea) . The vaccination was then repeated after 2 weeks and then monthly.

Serum of the canine patients was collected before the start of the vaccination cycle and after the IV immunization, and the presence of specific antibodies against the canine CSPG4 protein was evaluated by means of an immunofluorescence assay. In particular, CSPG4- positive canine melanoma cells were plated on immunofluorescence slides, fixed in 4% formalin and incubated for 1 hour at room temperature with animal sera (diluted 1:10) collected before the vaccination and after the IV immunization. Cells were then washed twice with PBS and were incubated with a FITC- conjugated anti-dog immunoglobulin antibody (F7884, Sigma) . After three washes with PBS, slides were air- dried and mounted using Fluoromount Aqueous Mounting Medium (Sigma) and then analyzed using a Zeiss axiovert 200M fluorescence-inverted microscope equipped with the Apotome Zeiss system, which uses a CCD camera as image detector. Figure 2 reports representative results obtained by one of the vaccinated dogs.

The data demonstrate that the plasmid pcDNA3.1- HuDo-CSPG4-l is effective in breaking the tolerance in canine patients affected by CSPG4-positive oral melanoma. Indeed, immunization with the plasmid pcDNA3. l-HuDo-CSPG4-l induces- in the vaccinated dogs- a specific antibody response against the canine CSPG4 protein, demonstrating an anti-tumoral effect for the treatment of CSPG4-positive canine tumors.

In vitro: human

Finally, we performed "human surrogate" assays to evaluate, in a human clinical context, the efficacy of the hybrid plasmid pcDNA3. l-HuDo-CSPG4-l in breaking the immunological tolerance and reverting the unresponsiveness of the T cells against the tolerated CSPG4 antigen.

In particular, we generated in vitro mature dendritic cells (mDC) from CD14+ monocytes derived from the blood of HLA-A2-positive healthy donors obtained from the Blood Bank of Torino, according to the protocol described in (Occhipinti et al . 2014) . The mDC were then transfected using the "DC transfection kit" (Amaxa, Lonza) with pcDNA3.1-Human-CSPG4 , pcDNA3.1- HuDo-CSPG4-l plasmids or with the empty control pcDNA3.1 plasmid. Transfected mDC were used to stimulate autologous T cells from the healthy donor.

After 7 days of co-culture, the activation of T cells against the human CSPG4 protein was evaluated by means of an interferon-γ ( IFNy) -enzyme-linked immunospot assay (ELISPOT) . In particular, T lymphocytes pre-stimulated with mDC transfected with the different plasmids were incubated with the human HLA-A2 CSPG4-positive Mell300 melanoma cell line (publicly available from P. Circosta at the Immune Oncology Lab, Istituto per la Ricerca e la Cura del Cancro di Candiolo, 10060, Torino, Italy) and maintained in culture as described in (Circosta et al . 2009), and the specific IFNy release was evaluated. Results show that after 7 days of co-culture, T lymphocytes pre-stimulated with mDC transfected with the hybrid pcDNA3. l-HuDo-CSPG4-l plasmid were able to release IFNy against the CSPG4-positive Mell300 cells in higher quantities compared to the IFNy release detected when T lymphocytes were pre-stimulated with mDC transfected with the pcDNA3.1-Human-CSPG4 or empty pcDNA3.1 plasmids (Figure 3A) . This response of T lymphocytes pre-stimulated with pcDNA3. l-HuDo-CSPG4-l transfected mDC is specific since it was completely abolished when an antibody (W6/32, Sigma) blocking the HLA class I molecules on the surface of Mell300 cells was used in the assay (Figure 3B) .

Moreover, an in vitro cytotoxicity assay was performed; briefly, Mell300 cells were labeled with ⁵¹ Cr (PerkinElmer) in 5% C0 ₂ for 1 hour at 37°C and after washing with PBS, 5xl0 ³ cells were co-incubated in a final volume of 200 μΐ with effector T cells recovered after 7 days of co-culture with transfected mDC . After 4 hours of incubation, 50 μΐ of supernatant was collected and the radioactivity was measured using a "TopCount Scintillation Counter" (Packard Biosciences) . In this in vitro cytoxicity assay, only T lymphocytes pre-activated with pcDNA3. l-HuDo-CSPG4-l tranfected mDC, but not those transfected with pcDNA3.1-Human-CSPG4 (Yang et al . 2004) or the empty pcDNA3.1, were able to specifically kill CSPG4-positive melanoma cells (Figure 3C) . When T cells pre-stimulated in the different conditions were stimulated again with monoclonal antibodies anti-CD3/anti-CD28 (1 mg/ml anti- human CD3 mAb : OKt 3, eBioscience ; 1 mg/ml anti-human CD28 mAb: CD28.2, Biolegend) in the presence of Brefeldin A (10 mg/ml, Sigma) for 6 hours at 37°C, intracellular perforin production was analyzed. In particular, cells were treated with a fixing and permeabilization solution (eBioscience) for 45 minutes at 4°C, and after washing, cells were incubated for 30 minutes at 4°C with an APC-con ugated antibody directed against the perforin (clone dG9, Biolegend) . An increasing percentage of CD8+ lymphocytes producing perforin was evident when lymphocytes were pre- stimulated with pcDNA3. l-HuDo-CSPG4-l transfected mDC compared to those pre-stimulated with mDC transfected with pcDNA3.1-Human-CSPG4 or empty pcDNA3.1 (Figure 3D) These results show the ability of pcDNA3.1-HuDo- CSPG4-1 plasmid to break the tolerance and the unresponsiveness of T cells against the CSPG4 self- antigen, highlighting its application in human clinical oncology . Re erences

Bergman, P. J. (2007) . "Canine oral melanoma." Clin Tech Small Anim Pract 22(2) : 55-60. doi: 10.1053/j.ctsap.2007.03.004.

Boston, S. E., X. Lu, W. T. Culp, V. Montinaro, G.

Romanelli, R. M. Dudley, J. M. Liptak, L. A. Mestrinho and P. Buracco (2014) . "Efficacy of systemic adjuvant therapies administered to dogs after excision of oral malignant melanomas: 151 cases (2001-2012) ." J Am Vet Med Assoc 245 (4) : 401-407. doi: 10.2460/ avma .245.4.401.

Campoli, M., S. Ferrone and X. Wang (2010) . "Functional and clinical relevance of chondroitin sulfate proteoglycan 4." Adv Cancer Res 109: 73-121. doi : 10.1016/B978-0-12-380890-5.00003-X.

Cheever, M. A., J. P. Allison, A. S. Ferris, 0. J.

Finn, B. M. Hastings, T. T. Hecht, I. Mellman, S. A. Prindiville, J. L. Viner, L. M. Weiner and L. M. Matrisian (2009) . "The prioritization of cancer antigens: a national cancer institute pilot project for the acceleration of translational research." Clin Cancer Res 15(17) : 5323-5337. doi: 10.1158/1078- 0432.CCR-09-0737.

Circosta, P., L. Granziero, A. Follenzi, E. Vigna, S. Stella, A. Vallario, A. R. Elia, L. Gammaitoni, K. Vitaggio, F. Orso, M. Geuna, D. Sangiolo, M. Todorovic, C. Giachino and A. Cignetti (2009) . "T cell receptor (TCR) gene transfer with lentiviral vectors allows efficient redirection of tumor specificity in naive and memory T cells without prior stimulation of endogenous TCR." Hum Gene Ther 20(12) : 1576-1588. doi: 10.1089/hum.2009.117.

Petrovici, K., M. Graf, K. Hecht, S. Reif, K. Pfister and H. Schmetzer (2010) . "Use of NG2 (7.1) in AML as a tumor marker and its association with a poor prognosis." Cancer Genomics Proteomics 7(4) : 173-180. doi .

Riccardo, F., S. Iussich, L. Maniscalco, S. Lorda Mayayo, G. La Rosa, M. Arigoni, R. De Maria, F. Gattino, S. Lanzardo, E. Lardone, M. Martano, E. Morello, S. Prestigio, A. Fiore, E. Quaglino, S. Zabarino, S. Ferrone, P. Buracco and F. Cavallo (2014) . "CSPG4- specific immunity and survival prolongation in dogs with oral malignant melanoma immunized with human CSPG4 DNA. " Clin Cancer Res 20(14) : 3753-3762. doi: 10.1158/1078-0432.CCR- 13-3042.

Simpson, R. M., B. C. Bastian, H. T. Michael, J. D. Webster, M. L. Prasad, C. M. Conway, V. M. Prieto, J. M. Gary, M. H. Goldschmidt, D. G. Esplin, R. C. Smedley, A. Piris, D. J. Meuten, M. Kiupel, C. C. Lee, J. M. Ward, J. E. Dwyer, B. J. Davis, M. R. Anver, A. A. Molinolo, S. B. Hoover, J. Rodriguez-Canales and S. M. Hewitt (2014) . "Sporadic naturally occurring melanoma in dogs as a preclinical model for human melanoma." Pigment Cell Melanoma Res 27(1) : 37-47. doi: 10.1111/pcmr .12185.

Stallcup, W. B. and F. J. Huang (2008) . "A role for the NG2 proteoglycan in glioma progression." Cell Adh Migr 2(3) : 192-201. doi. PMC2634088.

Wang, X., T. Osada, Y. Wang, L. Yu, K. Sakakura, A. Katayama, J. B. McCarthy, A. Brufsky, M. Chivukula, T. Khoury, D. S. Hsu, W. T. Barry, H. K. Lyerly, T. M. Clay and S. Ferrone (2010a) . "CSPG4 protein as a new target for the antibody-based immunotherapy of triple- negative breast cancer." J Natl Cancer Inst 102(19) : 1496-1512. doi: 10.1093/ nci/d q343. PMC2950168.

Wang, X., Y. Wang, L. Yu, K. Sakakura, C. Visus, J. H. Schwab, C. R. Ferrone, E. Favoino, Y. Koya, M. R. Campoli, J. B. McCarthy, A. B. DeLeo and S. Ferrone (2010b) . "CSPG4 in cancer: multiple roles." Curr Mol Med 10(4) : 419-429. doi: CMM # 48 [pii]. Wilson, B. S., K. Imai, P. G. Natali and S. Ferrone (1981) . "Distribution and molecular characterization of a cell-surface and a cytoplasmic antigen detectable in human melanoma cells with monoclonal antibodies." Int J Cancer 28(3) : 293-300. doi .

Yang, J., M. A. Price, C. L. Neudauer, C. Wilson, S. Ferrone, H. Xia, J. Iida, M. A. Simpson and J. B. McCarthy (2004) . "Melanoma chondroitin sulfate proteoglycan enhances FAK and ERK activation by distinct mechanisms." J Cell Biol 165(6) : 881-891. doi: 10.1083/ cb.200403174. PMC2172406.