Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
NUCLEIC ACID MOLECULES WHICH CODE FOR ENZYMES DERIVED FROM WHEAT AND WHICH ARE INVOLVED IN THE SYNTHESIS OF STARCH
Document Type and Number:
WIPO Patent Application WO/1999/058688
Kind Code:
A2
Abstract:
The invention relates to nucleic acid molecules which code for enzymes and which are involved in the synthesis of starch in plants. These enzymes concern soluble starch synthases derived from wheat. The invention also relates to vectors and host cells which contain the described nucleic acid molecules, especially transformed plant cells and plants which can be regenerated therefrom, which exhibit an increased or reduced activity of the inventive starch synthases.

Inventors:
LOERZ HORST (DE)
LUETTICKE STEPHANIE (DE)
BLOCK MARTINA (DE)
Application Number:
PCT/EP1999/003156
Publication Date:
November 18, 1999
Filing Date:
May 07, 1999
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
HOECHST SCHERING AGREVO GMBH (DE)
LOERZ HORST (DE)
LUETTICKE STEPHANIE (DE)
BLOCK MARTINA (DE)
International Classes:
A01H5/00; A21D2/18; A23L29/212; C08B30/00; C12N5/10; C12N9/10; C12N15/09; C12N15/54; C12N15/60; C12N15/82; C12Q1/68; (IPC1-7): C12N15/54; A01H5/00; C08B30/00; C12N5/10; C12N9/10; C12N15/82
Domestic Patent References:
WO1997045545A11997-12-04
WO1997044472A11997-11-27
WO1999014314A11999-03-25
Other References:
TADASHI BABA ET AL: "IDENTIFICATION, CDNA CLONING, AND GENE EXPRESSION OF SOLUBLE STARCHSYNTHASE IN RICE (ORYZA SATIVA L.) IMMATURE SEEDS" PLANT PHYSIOLOGY,US,AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, Bd. 103, Nr. 2, Seite 565-573 XP000565731 ISSN: 0032-0889
Download PDF:
Claims:
Patentansprüche :
1. Nucleinsäuremolekül, codierend ein Protein mit der Funktion einer Stärkesynthase aus Weizen, ausgewähtt aus der Gruppe bestehend aus (a) einem Nucleinsäuremolekül, das ein Protein codiert, das die unter Seq ID NO. 2 angegebene Aminosäuresequenz umfaßt, (b) einem Nucleinsäuremolekül, das die unter Seq ID No. 1 dargestellte Nucleotidsequenz oder einen Teil davon umfasst oder eine hierzu korrespondierende Ribonucleotidsequenz ; (c) einem Nucleinsäuremolekül, das mit einem der unter (a) oder (b) genannten Nucteinsäuremoteküte hybridisiert oder komplementär dazu ist, und (d) einem Nucleinsäuremolekül, dessen Nucleotidsequenz aufgrund der Degeneration des genetischen Codes von der Sequenz eines unter (a), (b) oder (c) genannten Nucleinsäuremoleküls abweicht.
2. Nucleinsäuremolekül nach Anspruch 1, dadurch gekennzeichnet, daß es ein DNAMolekül ist.
3. DNAMolekül nach Anspruch 2, dadurch gekennzeichnet, daß es ein cDNAMolekül ist.
4. Nucleinsäuremolekül nacheinem oder mehreren der Ansprüche 1 bis 3, das regulatorische Elemente enthält.
5. Nucleinsäuremolekül nach Anspruch 1, dadurch gekennzeichnet, daß es ein RNAMolekül ist.
6. Nucleinsäuremolekül, das spezifisch mit einem Nucleinsäuremolekül nach einem der Ansprüche 1 bis 5 hybridisiert. Nucleinsäuremoiekül nach Anspruch 6, das ein Oligonucleotid mit einer Länge von mindestens 15 Nucleotiden ist. Vektor, enthaltend ein DNAMolekül nach einem der Ansprüche 1 bis 5. Vektor nach Anspruch 8, worin besagtes Nucleinsäuremolekül in sense Orientierung mit regulatorischen Elementen verknüpft ist, die die Transkription und Synthese einer translatierbaren RNA in prooder eukaryontischen Zellen gewährleisten. Vektor nach Anspruch 8, worin besagtes Nucleinsäuremolekül in sense Orientierung mit regulatorischen Elementen verknüpft ist, die die Synthese einer nichttransiatierbaren RNA in prooder eukaryontischen Zellengewährleisten. Vektor nach Anspruch 8, worin besagtes Nucleinsäuremolekül in antisenseOrientierung mit regulatorischen Elementen verknüpft ist, die die Synthese einer nichttranslatierbaren RNA in prooder eukaryontischen Zellengewährleisten. Wirtszelle, die mit einem Nucleinsäuremolekül nach einem oder mehreren der Ansprüche 1 bis 5 oder einem Vektor nach einem oder mehreren der Ansprüche 8 bis 11 transformiert ist oderdie von einer solchen Zelle abstammt. Protein, codiert durch ein Nucleinsäuremolekül nach einem oder mehreren der Ansprüche 1 bis 4. Verfahren zur Herstellung eines Proteins nach Anspruch 13, worin eine Wirtszelle nach Anspruch 12 unter Bedingungen kultiviert wird, die die Synthese das besagten Proteins erlauben und besagtes Protein aus den kultivierten Zellen und/oder dem Kulturmedium isoliert wird. Verfahren zur Herstellung einer transgenen Pflanzenzelle, worin a) ein Nucleinsäuremolekül nach einem oder mehreren der Ansprüche 1 bis 5 oder b) ein Vektor nach einem oder mehreren der Ansprüche 8 bis 11 in das Genom einer pflanzlichen Zelle integriert wird. Transgene Pflanzenzelle, die mit einem Nucteinsäuremotekü ! nach einem oder mehreren der Ansprüche 1 bis 5 oder einem Vektor nach einem oder mehreren der Ansprüche 8 bis 11 transformiert wurde oder die von einer solchen Zelle abstammt. Verfahren zur Herstellung einer transgenen Pflanzenzelle, worin a1) ein Nucleinsäuremolekül nach einem oder mehreren der Ansprüche 1 bis 5 oder a2) ein Vektor nach einem oder mehreren der Ansprüche 8 bis 11 in das Genom einer pflanzlichen Zelle integriert wird und b) eine vollständige Pflanze aus besagter Pflanzenzelle regeneriert wird. Pflanze, enthaltend eine Pflanzenzelle nach Anspruch 16. Pflanze nach Anspruch 19, die eine monokotyle oder dikotyle Pflanze ist. Pflanze nach Anspruch 19, die eine Nutzpflanze ist. Pflanze nach Anspruch 20, die eine stärkespeichernde Pflanze ist. Pflanze nach Anspruch 21, die eine Mais, Reis, Kartoffel oder Weizenpflanze ist. Vermehrungsmaterial einer Pflanze nach einem oder mehreren der Ansprüche 18 bis 22. Stärke, erhätlich aus einer Pflanzenzelle gemäß Anspruch 16, einer Pflanze nach einem oder mehreren der Ansprüche 18 bis 22 oder aus Vermehrungsmaterial nach Anspruch 23. Verwendung der Stärke nach Anspruch 24 zur Herstellung von Lebensmitteln oder Lebensmittelvorprodukten, vorzugsweise von Back oder Teigwaren. Verwendung der Stärke nach Anspruch 24 zur Herstellung von Verpackungsmaterialien oder Einwegartikeln.
Description:
Nucleinsauremoleküle codierend Enzyme aus Weizen, die an der Stärkesynthese beteiligt sind Die vorliegende Erfindung betrifft Nucleinsäuremoleküle, die ein Enzym aus Weizen codieren, das an der Stärkesynthese in Pflanzen beteiligt ist. Bei diesem Enzym handelt es sich um eine lösliche Stärkesynthase vom Typ 1.

Weiterhin betrifft die Erfindung Vektoren, Wirtszellen, sowie Pflanzenzellen und Pflanzen, die die erfindungsgemäßen Nucleinsäuremolekülen enthalten.

Ferner werden Verfahren zur Herstellung transgener Pflanzen beschrieben, die aufgrund der Einführung von erfindungsgemäßen Nucleinsäuremolekülen eine in ihren Eigenschaften veränderte Stärke synthetisieren.

Im Hinblick auf die zunehmende Bedeutung, die pflanzlichen Inhaltsstoffen als erneuerbaren Rohstoffquellen in letzter Zeit beigemessen wird, ist es eine der Aufgaben der biotechnologischen Forschung, sich um eine Anpassung dieser pflanzlichen Rohstoffe an die Anforderungen der verarbeitenden Industrie zu bemühen. Um eine Anwendung von nachwachsenden Rohstoffen in möglichst vielen Einsatzgebieten zu ermöglichen, ist es darüber hinaus erforderlich, eine große Stoffvielfalt zu erreichen.

Neben Ölen, Fetten und Proteinen stellen Polysaccharide die wesentlichen nachwachsenden Rohstoffe aus Pflanzen dar. Eine zentrale Stellung bei den Polysacchariden nimmt neben Cellulose die Stärke ein, die einer der wichtigsten Speicherstoffe in höheren Pflanzen ist. Hierbei ist Weizen eine der wichtigsten Kulturpflanzen, da ca. 20 % der Gesamtstärkeproduktion der Europäischen Gemeinschaft aus ihr gewonnen werden.

Das Polysaccharid Stärke ist ein Polymer aus chemisch einheitlichen Grundbausteinen, den Glucosemolekülen. Es handelt sich dabei jedoch um ein sehr komplexes Gemisch aus unterschiedlichen Molekülformen, die sich hinsichtlich ihres Polymerisationsgrades des Auftretens von Verzweigungen der Glucoseketten und deren Kettenlängen unterscheiden, die darüber hinaus derivatisiert, z. B. phosphoryliert sein können. Daher stellt Stärke keinen einheitlichen Rohstoff dar. Man unterscheidet insbesondere die Amylose-Starke, ein im wesentlichen unverzweigtes Polymer aus-1,4-glycosidisch verknüpften Glucosemolekülen, von der Amylopektin-Stärke, die ihrerseits ein komplexes Gemisch aus unterschiedlich verzweigten Glucoseketten darstellt. Die Verzwei- gungen kommen dabei durch das Auftreten von zusätzlichen-1,6- glycosidischen Verknüpfungen zustande. In Weizen besteht die synthetisierte Stärke zu ca. 11 bis 37 % aus Amylose-Stärke.

Um eine möglichst vielfältige Anwendung von geeigneten Stärken für unterschiedlichste industrielle Bedürfnisse zu ermöglichen, ist es wünschenswert, Pflanzen zur Verfügung zu stellen, die in der Lage sind, modifizierte Stärken zu synthetisieren, die für verschiedene Verwendungszwecke besonders gut geeignet sind. Eine Möglichkeit, derartige Pflanzen bereitzustellen, besteht in züchterischen Maßnahmen. Die züchterischen Einflußnahme erweist sich beim Weizen aufgrund seines polyploiden Charakters (tetra-und hexaploid) jedoch sehr schwer. Erst kürzlich gelang durch Kreuzung natürlich auftretender Mutanten die Herstellung eines"waxy" (Amylose-freien) Weizens (Nakamura et al., Mol. Gen. Genet. 248 (1995), 253-259).

Eine Alternative zu züchterischen Verfahren besteht in der gezielten Modifikation stärkeproduzierender Pflanzen durch gentechnologische Methoden.

Voraussetzung hierfür ist jedoch die Identifizierung und Charakterisierung der an der Stärkesynthese und/oder Stärkemodifikation beteiligten Enzyme sowie die Isolierung der diese Enzyme codierenden Nucleinsäuremoleküle.

Die biochemischen Synthesewege, die zum Aufbau von Stärke führen, sind im wesentlichen bekannt. Die Stärkesynthese in pflanzlichen Zellen findet in den Plastiden statt. In photosynthetisch aktiven Geweben sind dies die Chloroplasten, in photosynthetisch inaktiven, stärkespeichernden Geweben die Amyloplasten.

Wichtige an der Stärkesynthase beteiligte Enzyme sind die Stärkesynthasen sowie die Verzweigungsenzyme. Bei den Stärkesynthase sind verschiedene Isoformen beschrieben, die alle eine Polymerisierungsreaktion durch Übertragung eines Glucosylrestes von ADP-Glucose auf a-1,4-lucane katalysieren.

Verzweigungsenzyme katalysieren die Einführung von a-2,6-Verzweigungen in lineare a-1,4-lucane.

Stärkesynthasen können in zwei Klassen eingeteilt werden : die Stärkekorn- gebundenen Stärkesynthasen ("granule-bound starch synthases" ; GBSS) und die löslichen Stärkesynthasen ("soluble starch synthases" ; SSS). Diese Unterscheidung ist nicht in jedem Fall eindeutig zu treffen, da einige der Stärkesynthasen sowohl stärkekorngebunden als auch in löslicher Form vorliegen (Denyer et al., Plant J. 4 (1993), 191-198 ; Mu et al., Plant J. 6 (1994), 151- 159). Für verschiedene Pflanzenspezies werden innerhalb dieser Klassen wiederum verschiedene Isoformen beschrieben, die sich hinsichtlich ihrer Abhängigkeit von Startermolekülen unterscheiden (sogenannte"primer dependent" (Typ II) und"primer independent" (Typ I) starch synthases).

Lediglich für die Isoform GBSS I gelang es bisher, die genaue Funktion bei der Stärkesynthese zu ermitteln, in denen diese Enzymaktivität stark oder volikommen reduziert ist, synthetisieren eine amylosefreie (sogenannte"waxy") Stärke (Shure et al., Cell 35 (1983), 225-233 ; Visser et al., Mol. Gen-Genet.

225 (1991), 289-296 ; WO 92/11376), so daß diesem Enzym eine entscheidende Rolle bei der Synthese der Amylose-Stärke zugesprochen wird.

Dieses Phänomen wird ebenfalls in Zellen der Grünalge Chlamydomonas reinhardtii beobachtet (Delrue et al., J. Bacteriol. 174 (1992), 3612-3620). Bei Chlamydomonas konnte darüber hinaus gezeigt werden, daß GBSS I nicht nur an der Synthese der Amylose beteiligt ist, sondern auch einen Einfluß auf die Amylopektinsynthese besitzt. In Mutanten, die keine GBSS l-Aktivität aufweisen, fehlt eine bestimmte Fraktion des normalerweise snythetisieren Amylopektins, die längerkettige Glucane aufweist.

Die Funktionen der anderen Isoformen der Stärkekorn-gebundenen Stärkesynthasen, insbesondere der GBSS II, und der löslichen Stärkesynthasen sind bisher unklar. Es wird angenommen, daß die löslichen Stärkesynthasen zusammen mit Verzweigungsenzymen an der Synthese des Amylopektins beteiligt sind (siehe z. B. Ponstein et al., Plant Physiol. 29 (1990), 234-241) und daß sie eine wichtige Funktion bei der Regulation der Stärkesyntheserate spielen.

Bei Weizen wurden mindestens zwei Isoformen der Stärkekorn-gebundenen Stärkesynthase (60 kDA und 100-105 kDA) und eine weitere Isoform, die möglicherweise eine losliche Stärkesynthase (Denyer et al., Planta 196 (1995), 256-265 ; Rahman et al., Aust. J. Plant Physiol. 22 (1995), 793-803) repräsentiert, auf der Proteinebene identifiziert. Das Vorhandensein mehrerer SSS-lsoformen wurde schon früher mit Hilfe chromatographischer Methoden nachgewiesen (Rijven, Plant Physiol. 81 (1986), 448-453). Eine GBSS I aus Weizen codierende cDNA ist bereits beschrieben (Ainsworth et al., Plant Mol.

Biol. 22 (1993), 67 bis 82).

Nucleinsäuresequenzen, die Stärkesynthase-Isoformen aus Weizen codieren bzw.

Teilsequenzen solcher Nucleinsäuren sind bisher aus der WO 97/45545 bekannt. cDNA-Sequenzen, die für andere Stärkesynthasen als für die GBSS I codieren, wurden bisher lediglich für Erbse (Dry et al., Plant J. 2 (1992), 193-202), Reis (Baba et al., Plant Physiol. 103 (1993), 565 bis 573) und Kartoffel (Edwards et al., Plant J. 8 (1995), 283 bis 294) beschrieben.

Außer beim Weizen wurden lösliche Stärkesynthasen auch in einer Reihe weiterer Pflanzenarten identifiziert. Lösliche Stärkesynthasen sind beispielsweise bis zur Homogenität aus Erbse (Denyer und Smith, Planta 186 (1992), 609 bis 617) und Kartoffel (Edwards et al., Plant J. 8 (1995), 283 bis 294) isoliert worden.

In diesen Fällen stellte sich heraus, daß die als SSS III identifizierte Isoform der löslichen Stärkesynthase identisch ist mit der Stärkekorn-gebundenen Stärkesynthase GBSS II (Denyer et al., Plant J. 4 (1993), 191 bis 198 ; Edwards et al., Plant J. 8 (1995), 283 bis 294). Für einige weitere Pflanzenspezies wurde das Vorhandensein mehrerer SSS-isoformen mit Hilfe chromatographischer Methoden beschrieben, beispielswiese bei Gerste (Tyynelä und Schulman, Physiologica Plantarum 89 (1993) 835-841 ; Kreis, Planta 148 (1980), 412 bis 416). DNA-Sequenzen, die diese Proteine codieren, wurden jedoch bisher nicht beschrieben.

Um weitere Möglichkeiten bereitzustellen, beliebige stärke-speichernde Pflanzen, vorzugsweise Getreide, insbesondere Weizen, dahingehend zu verändern, daß sie eine modifizierte Stärke synthesieren, ist es erforderlich, jeweils DNA- Sequenzen zu identifizieren, die weitere Isoformen der Stärkesynthasen codieren.

Der vorliegenden Erfindung liegt somit die Aufgabe zugrunde, Nucleinsäuremoleküle, insbesondere solche aus Weizen, zur Verfügung zu stellen, die an der Stärkebiosynthese beteiligte Enzyme codieren und mit deren Hilfe es möglich ist, gentechnisch modifizierte Pflanzen herzustellen, die die Herstellung von in ihren chemischen und/oder physikalischen Eigenschaften veränderten pflanzlichen Stärken ermöglichen.

Diese Aufgabe wird durch die Bereitstellung der in den Patentansprüchen bezeichneten Ausführungsformen gelöst.

Die vorliegende Erfindung betrifft daher Nucleinsäuremoleküle, die Proteine mit der Aktivität einer töstichen Stärkesynthase aus Weizen, wobei derartige Moleküle vorzugsweise Proteine codieren, die im wesentlichen die unter Seq ID No. 2 angegebene Aminosäuresequenz umfassen. Insbesondere betrifft die Erfindung Nucleinsäuremoleküle, die die unter Seq ID No. 1 angegebene Nucleotidsequenz oder einen Teil davon enthalten, bevorzugt Moleküle, die die in Seq ID No. 1 angegebene codierende Region umfassen, besonders bevorzugt Nucleotid Nr. 9 bis 570 von Seq ID Nr. 1 sowie entsprechende Ribo- nucleotidsequenzen.

Ferner betrifft die vorliegende Erfindung Nucleinsäuremoleküle, die mit einem der erfindungsgemäßen Nukleinsäuremoleküle hybridisierten.

Gegenstand der Erfindung sind ebenfalls Nucleinsäuremoleküle, die eine lösliche Stärkesynthase aus Weizen codieren und deren Sequenz aufgrund der Degeneration des genetischen Codes von den Nucleotidsequenzen der oben be- schriebenen Moleküle abweicht.

Die Erfindung betrifft auch Nucleinsäuremoleküle, die eine Sequenz aufweisen, die zu der gesamten oder einem Teil einer der obengenannten Sequenzen komplementär ist.

Der Begriff"Hybridisierung"bedeutet im Rahmen dieser Erfindung eine Hybridisierung unter konventionellen Hybridisierungsbedingungen, vorzugsweise unter stringenten Bedingungen, wie sie beispielsweise in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2. Aufl. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) beschrieben sind.

Besonders bevorzugt erfolgt eine"Hybridisierung"unter den folgenden Bedingungen : Hybridisierungspuffer : 2 x SSC ; 10 x Denhardt-Lösung (Fikoll 400 + PEG + BSA ; Verhältnis 1 : 1 : 1) ; 0,1% SDS ; 5 mM EDTA ; 50 mM Na2HPO4 ; 250, ug/ml Heringssperma-DNA ; 50/lg/ml tRNA ; oder 0,25 M Natriumphosphatpuffer pH 7,2 ; 1 mM EDTA ; 7% SDS Hybridisierungstemperatur T = 65 bis 70°C Waschpuffer : 0,2 x SSC ; 0,1 % SDS Waschtemperatur T = 40 bis 75°C.

Nucleinsäuremoleküle, die mit den erfindungsgemäßen Nucleinsäuremolekülen hybridisieren, können prinzipiell Stärkesynthasen aus jeder beliebigen Weizenpflanze codieren, die derartige Proteine exprimiert.

Nucleinsäuremoleküle, die mit den erfindungsgemäßen Molekülen hybridisieren, können z. B. aus genomischen oder aus cDNA-Bibliotheken von Weizen oder Weizenpflanzengewebe isoliert werden. Alternativ können sie durch gentechnische Methoden oder durch chemische Synthese hergestellt werden.

Die Identifizierung und Isolierung derartiger Nucleinsäuremoleküle kann dabei unter Verwendung der erfindungsgemäßen Moleküle oder Teile dieser Moleküle bzw. der reversen Komplemente dieser Moleküle erfolgen, z. B. mittels Hybridisierung nach Standardverfahren (siehe z. B. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2. Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

Als Hybridisierungsprobe können z. B. Nucleinsäuremoleküle verwendet werden, die exakt die oder im wesentlichen die unter Seq ID No. 1 angegebene Nucieotidsequenz oder Teile dieser Sequenz aufweisen. Bei den als Hybridisierungsprobe verwendeten Fragmenten kann es sich auch um synthetische Fragmente handeln, die mit Hilfe der gängigen Synthesetechniken hergestellt wurden und deren Sequenz im wesentlichen mit der eines erfin- dungsgemäßen Nucleinsäuremolekuls übereinstimmt.

Die mit den erfindungsgemäßen Nucleinsäuremolekülen hybridisierenden Moleküle umfassen auch Fragmente, Derivate und allelische Varianten der oben beschriebenen Nucieinsäuremoleküle, die eine erfindungsgemäße Stärkesynthase aus Weizen codieren. Unter Fragmenten werden dabei Teile der Nucleinsäuremo- leküle verstanden, die lang genug sind, um eines der beschriebenen Proteine zu codieren. Der Ausdruck Derivat bedeutet in diesem Zusammenhang, daß die Sequenzen dieser Moleküle sich von den Sequenzen der oben beschriebenen Nucleinsäuremoleküle an einer oder mehreren Positionen unterscheiden und einen hohen Grad an Homologie zu diesen Sequenzen aufweisen. Homologie bedeutet dabei eine Sequenzidentität von mindestens 40 %, insbesondere eine Identität von mindestens 60 %, vorzugsweise über 80 % und besonders bevorzugt über 90 %. Die Abweichungen zu den oben beschriebenen Nucleinsäuremolekülen können dabei durch Deletion, Substitution, Insertion oder Rekombination entstanden sein.

Homologie bedeutet ferner, daß funktionelle und/oder strukturelle Aquivalenz zwischen den betreffenden Nucleinsäuremolekülen oder den durch sie codierten Proteinen, besteht. Bei den Nucleinsäuremolekülen, die homolog zu den oben beschriebenen Molekülen sind und Derivate dieser Moleküle darstellen, handelt es sich in der Regel um Variationen dieser Moleküle, die Modifikationen darstellen, die dieselbe biologische Funktion ausüben. Es kann sich dabei sowohl um natürlicherweise auftretende Variationen handeln, beispielsweise um Sequenzen aus anderen Organismen, oder um Mutationen, wobei diese Mutationen auf natürliche Weise aufgetreten sein können oder durch gezielte Mutagenese eingeführt wurden. Ferner kann es sich bei den Variationen um synthetisch hergestellte Sequenzen handeln. Bei den allelischen Varianten kann es sich sowohl um natürlich auftretende Varianten handeln, ais auch um synthetisch hergestellte oder durch rekombinante DNA-Techniken erzeugte Varianten.

Die von den verschiedenen Varianten der erfindungsgemäßen Nucleinsäuremoleküle codierten Proteine weisen bestimmte gemeinsame Charakteristika auf. Dazu können z. B. Enzymaktivität, Molekulargewicht, immunologische Reaktivität, Konformation etc. gehören sowie physikalische Eigenschaften wie z. B. das Laufverhalten in Gelelektrophoresen, chromatographisches Verhalten, Sedimentationskoeffizienten, Löslichkeit, spektroskopische Eigenschaften, Ladungseigenschaften, Stabilität ; pH-Optimum, Temperatur-Optimum etc.

Wichtige Charakteristika einer Stärkesynthase sind : i) ihre Lokalisation im Stroma der Plastiden pflanzlicher Zellen ; ii) ihre Fähigkeit zur Synthese linearer a- 1,4-verknüpfter Polyglucane. Diese Aktivität kann wie in Denyer und Smith (Plante 186 (1992), 606 bis 617) beschrieben bestimmt werden. Bei dem durch die erfindungsgemäßen Nucleinsäuremoleküle codierten Protein handelt es sich um eine lösliche Stärkesynthase vom Typ I aus Weizen. Diese Proteine weisen gewisse Homologiebereiche zu bisher bekannten löslichen Stärkesynthasen aus anderen Pflanzenarten auf.

Bei den erfindungsgemäßen Nucleinsäuremolekülen kann es sich um DNA- Moleküle handeln, insbesondere um cDNA-oder genomische Moleküle. Ferner können die erfindungsgemäßen Nucleinsäuremoleküle RNA-Molekülesein, die z. B. durch Transkription eines erfindungsgemäßen Nucleinsäuremoleküls resultieren können. Die erfindungsgemäßen Nucleinsäuremoleküle können z. B. aus natürlichen Quellen gewonnen sein oder durch rekombinante Techniken oder synthetisch hergestellt sein.

Gegenstand der Erfindung sind auch Oligonucleotide, die spezifisch mit einem erfindungsgemäßen Nucleinsäuremolekül hybridisieren. Derartige Oligonucleotide haben vorzugsweise eine Länge von mindestens 10, insbesondere von mindestens 15 und besonders bevorzugt von mindestens 50 Nucleotiden. Die erfindungsgemäßen Oligonukleotide sind dadurch gekennzeichnet, daß sie spezifisch mit erfindungsgemäßen Nucleinsäuremolekülen hybridisieren, d. h. nicht oder nur in sehr geringem Ausmaß mit Nucleinsäuresequenzen, die andere Proteine, insbesondere andere Stärkesynthasen codieren. Die erfindungsgemäßen Oligonucleotide können beispielsweise als Primer für eine PCR-Reaktion verwendet werden oder als Hybridisierungsprobe für die Isolierung verwandter Gene. Ebenso können sie Bestandteile von antisense-Konstrukten sein oder von DNA-Molekülen, die für geeignete Ribozyme codieren.

Ferner betrifft die Erfindung Vektoren, insbesondere Plasmide, Cosmide, Phagemide, Viren, Bacteriophagen und andere in der Gentechnik gängige Vektoren, die die oben beschriebenen erfindungsgemäßen Nucleinsäuremoleküle enthalten. Derartige Vektoren sind zur Transformation pro- oder eukaryontischer, vorzugsweise pflanzlicher Zellen geeignet.

Besonders bevorzugt erlauben die Vektoren die Integration der erfindungsgemäßen Nucleinsäuremoleküle, gegebenenfalls zusammen mit flankierenden regulatorischen Regionen, in das Genom der Pflanzenzelle.

Beispiele hierfür sind binäre Vektoren, die bei dem Agrobakterien-vermittelten Gentransfer eingesetzt werden können. Vorzugsweise ist durch die Integration eines erfindungsgemäßen Nucleinsäuremoleküls in sense-oder anti-sense- Orientierung die Synthese einer translatierbaren oder gegebenenfalls nicht- transiatierbaren RNA in den transformierten pro-oder eukaryontischen Zellen gewährleistet.

Der Begriff"Vektor"bezeichnet im allgemeinen ein geeignetes, dem Fachmann bekanntes Hilfsmittel, das den gezielten Transfer eines ein-oder doppelsträngigen Nukleinsäuremoleküls in eine Wirtszelle ermöglicht, beispielsweise einen DNA-oder RNA-Virus, ein Virusfragment, ein Plasmidkonstrukt, das in An-oder Abwesenheit von regulatorischen Elementen zum Nukleinsäure-Transfer in Zellen geeignet sein kann, Trägermaterialien wie Glasfaser oder auch Metallpartikel wie sie z. B. beim"particle gun"-Verfahren eingesetzt werden können, er kann aber auch ein Nukleinsäuremolekül umfassen, das durch chemische oder physikalische Verfahren direkt in eine Zelle gebracht werden kann.

In einer bevorzugten Ausführungsform sind die in den Vektoren enthaltenen Nucleinsäuremoleküie verknüpft mit regulatorischen Elementen, die die Transkription und Synthese einer translatierbaren RNA in pro-oder eukaryontischen Zellengewährleisten oder-sofern gewünscht-dieSynthese einer nicht-translatierbaren RNA gewährleisten.

Die Expression der erfindungsgemäßen Nucleinsäuremoleküle in prokaryontischen Zellen, beispielsweise in Escherichia coli, ist für eine genauere Charakterisierung der enzymatischen Aktivitäten der Enzyme, für die diese Moleküle codieren, von Bedeutung. Es ist insbesondere möglich, das Produkt, das von den entsprechenden Enzymen in Abwesenheit anderer, in der pflanzlichen Zelle an der Stärkesynthese beteiligter Enzyme synthetisiert wird, zu charakterisieren. Dies läßt Rückschlüsse zu auf die Funktion, die das entsprechende Protein bei der Stärkesynthese in der Pflanzenzelle ausübt.

Darüber hinaus ist es möglich, mittels gängiger molekularbiologischer Techniken (siehe z. B. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2.

Aufl. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) verschiedenartige Mutationen in die erfindungsgemäßen Nucleinsäuremoleküle einzuführen, wodurch es zur Synthese von Proteinen mit eventuell veranderten biologischen Eigenschaften kommt. Hierbei ist zum einen die Erzeugung von Deletionsmutanten möglich, bei denen durch fortschreitende Deletionen vom 5'- oder vom 3'-Ende der codierenden DNA-Sequenz Nucieinsäuremolekule erzeugt werden, die zur Synthese entsprechend verkürzter Proteine führen. Durch derartige Deletionen am 5'-Ende der Nucleotidsequenz ist es beispielsweise möglich, Aminosäuresequenzen zu identifizieren, die für die Translokation des Enzyms in die Plastiden verantwortlich sind (Transitpeptide). Dies erlaubt es, gezielt Enzyme herzustellen, die durch Entfernen der entsprechenden Sequenzen nicht mehr in den Plastiden, sondern im Cytosol lokalisiert sind, oder aufgrund der Addition von anderen Signalsequenzen in anderen Kompartimenten lokalisiert sind.

Andererseits ist auch die Einführung von Punktmutationen denkbar an Positionen, bei denen eine Veränderung der Aminosäuresequenz einen Einfluß beispielweise auf die Enzymaktivität oder die Regulierung des Enzyms hat. Auf diese Weise können z. B. Mutanten hergestellt werden, die einen veränderten Km- Wert besitzen oder nicht mehr den normalerweise in der Zelle vorliegenden Regulationsmechanismen über allosterische Regulation oder kovalente Modifizierungunterliegen.

Des weiteren können Mutanten hergestellt werden, die eine veränderte Substrat- oder Produktspezifität des erfindungsgemäßen Proteins aufweisen, indem sie beispielsweise ADP-Glucose-6-Phosphat anstelle von ADP-Glucose verwerten.

Weiterhin können Mutanten hergestellt werden, die ein verändertes Aktivitäts- Temperatur-Profil des erfindungsgemäßen Proteins aufweisen.

Für die gentechnische Modififikation prokaryontischer Zellen können die erfindungsgemäßen Nucleinsäuremoleküle oder Teile dieser Moleküle in Plasmide eingebracht werden, die eine Mutagenese oder eine Sequenzveränderung durch Rekombination von DNA-Sequenzen erlauben. Mit Hilfe von Standardverfahren (vgl. Sambrook et al., 1989, Molecular Cloning : A laboratory manual, 2. Aufl., Cold Spring Harbor Laboratory Press, NY, USA) können Basenaustausche vorgenommen oder natürliche oder synthetische Sequenzen hinzugefügt werden.

Für die Verbindung der DNA-Fragmente untereinander können an die Fragmente Adaptoren oder Linker angesetzt werden. Ferner können Manipulationen, die passende Restriktionsschnittstellen zur Verfügung stellen oder die überflüssige DNA oder Restriktionsschnittstellen entfernen, eingesetzt werden. Wo Insertionen, Deletionen oder Substitutionen in Frage kommen, können in vitro- Mutagenese,"primer repair", Restriktion oder Ligation verwendet werden. Als Analysemethode werden im aligemeinen Sequenzanalyse, Restriktionsanalyse oder weitere biochemisch-molekularbiologische Methoden durchgeführt.

In einer weiteren Ausführungsform betrifft die Erfindung Wirtszellen, insbesondere pro-oder eukaryontische Zellen, die mit einem oben beschriebenen erfindungsgemäßen Nucleinsäuremolekül oder einem erfindungsgemäßen Vektor transformiert sind, sowie Zellen, die von derart transformierten Zellen abstammen und ein erfindungsgemäßes Nucleinsäuremolekül oder einen Vektor enthalten. Dabei handelt es sich vorzugsweise um pro-oder eukaryontiache, insbesondere um pflanzliche Zellen.

Gegenstand der Erfindung sind ferner rekombinant herstellbare Proteine mit der Aktivität einer Stärkesynthase, die durch die erfindungsgemäßen Nucleinsäuremoleküle codiert werden, sowie Verfahren zu deren Herstellung, worin eine erfindungsgemäße Wirtszelle unter dem Fachmann bekannten, geeigneten Bedingungen kultiviert wird, die die Synthese des erfindungsgemäßen Proteins erlauben, und es anschließend aus den Wirtszellen und/oder dem Kulturmedium isoliert wird.

Durch die Bereitstellung der erfindungsgemäßen Nucleinsäuremoleküle ist es nun möglich, mit Hilfe gentechnischer Methoden in den Stärkemetabolismus von Pflanzen gezielt einzugreifen und ihn dahingehend zu verändern, daß es zur Synthese einer modifizierten Stärke kommt, die in ihren physikalisch-chemischen Eigenschaften, beispielsweise dem Amylose/Amylopektin-Verhältnis, dem Verzweigungsgrad, der durchschnittlichen Kettenlänge, dem Phosphatgehalt, dem Verkleisterungsverhalten, den Gel-oder Filmbildungseigenschaften, der Stärkekorngröße und/oder der Stärkekornform im Vergleich zu bekannter Stärke verändert ist.

Möglich ist somit die Expression der erfindungsgemäßen Nucleinsäuremoleküle in pflanzlichen Zellen, um die Aktivität der entsprechenden Stärkesynthase zu erhöhen, oder die Einführung in Zellen, die dieses Enzym natürlicherweise nicht exprimieren. Ferner ist es möglich, die erfindungsgemäßen Nucleinsäuremoleküle nach dem Fachmann bekannten Methoden zu modifizieren, um erfindungsge- mäße Stärkesynthasen zu erhalten, die nicht mehr den natürlichen zelleigenen Regulationsmechanismen unterliegen, bzw. veränderte Temperatur- Aktivitätsprofile oder Substrat-bzw. Produktspezifitäten aufweisen.

Bei der Expression der erfindungsgemäßen Nucleinsäuremoleküle in Pflanzen besteht grundsätzlich die Möglichkeit, daß das synthetisierte Protein in jedem beliebigen Kompartiment der pflanzlichen Zelle lokalisiert sein kann. Um die Lokalisation in einem bestimmten Kompartiment zu erreichen, muß die die Lokalisation in Plastiden gewährleistende Sequenz deletiert werden und die verbleibende codierende Region gegebenenfalls mit DNA-Sequenzen verknüpft werden, die die Lokalisierung in dem jeweiligen Kompartiment gewährleisten.

Derartige Sequenzen sind bekannt (siehe beispielsweise Braun et al., EMBO J.

11 (1992), 3219-3227 ; Wolter et al., Proc. Natl. Acad. Sci. USA 85 (1988), 846-850 ; Sonnewald et al., Plant J. 1 (1991), 95-106).

Die vorliegende Erfindung betrifft somit auch ein Verfahren zur Herstellung transgener Pflanzenzellen, die mit einem erfindungsgemäßen Nucteinsäuremolekül oder Vektor transformiertwerden, worin ein erfindungsgemäßes Nucleinsäuremolekül oder ein erfindungsgemäßer Vektor in das Genom einer pflanzlichen Zelle integriert wird, die transgenen Pflanzenzellen, die mittels eines erfindungsgemäßen Nucleinsäuremoleküls oder Vektors transformiert wurden sowie transgene Pflanzenzellen, die von derartig transformierten Zellen abstammen. Die erfindungsgemäßen Zellen enthalten ein oder mehrere erfindungsgemäße Nucleinsäuremoleküle oder Vektoren, wobei diese vorzugsweise mit regulatorischen DNA-Elementen verknüpft sind, die die Transkription in pflanzlichen Zellen gewährleisten, insbesondere mit einem geeigneten Promotor. Derartige Zellen lassen sich von natürlicherweise vorkommenden Pflanzenzellen unter anderem dadurch unterscheiden, daß sie ein erfindungsgemäßes Nucleinsäuremolekül enthalten, das natürlicherweise in diesen Zellen nicht vorkommt oder dadurch, daß ein solches Molekül an einem Ort im Genom der Zelle integriert vorliegt, an dem es sonst nicht vorkommt, d. h. in einer anderen genomischen Umgebung. Ferner lassen sich derartige erfindungsgemäße transgene Pflanzenzellen von natürlicherweise vorkommenden Pflanzenzellen dadurch unterscheiden, daß sie mindestens eine Kopie eines erfindungsgemäßen Nucleinsäuremoleküls stabil integriert in ihr Genom enthalten, gegebenenfalls zusätzlich zu natürlicherweise in den Zellen vorkommenden Kopien eines solchen Moleküls. Handelt es sich bei dem (den) in die Zellen eingeführten Nucleinesäuremolekül (en) um zusätzliche Kopien zu bereits natürlicherweise in den Zelten vorkommenden Molekülen, so lassen sich die erfindungsgemäßen Pflanzenzellen von natürlicherweise vorkommenden insbesondere dadurch unterscheiden, daß diese zusätzlicher) Kopie (n) an Orten im Genom lokalisiert ist/sind an denen sie natürlicherweise nicht vorkommt (vorkommen). Dies iäßt sich beispielsweise mit Hilfe einer Southern Blot-Analyse nach dem Fachmann bekannten Verfahren einfach überprüfen.

Ist das in das pflanzliche Genom eingeführte erfindungsgemäße Nucleinsäuremolekül heterolog in Bezug auf die Pflanzenzelle, so weisen die transgenen Pflanzenzellen Transkripte der erfindungsgemäßen Nucleinsäuremoleküle auf, die sich z. B. durch Northern-Blot-Analyse nach dem Fachmann bekannten Verfahren einfach nachweisen lassen.

Ist das eingeführte erfindungsgemäße Nucleinsäuremolekül homolog in Bezug auf die Pflanzenzelle, können die erfindungsgemäßen Zellen von natürlicherweise auftretenden beispielsweise aufgrund der zusätzlichen Expression erfindungsgemäßer Nucleinsäuremoleküle unterschieden werden. Die transgenen Pflanzenzellen enthalten vorzugsweise mehr Transkripte der erfindungsgemäßen Nucleinsäuremoleküle. Dies kann z. B. durch Northern-Blot-Analyse nachgewiesen werden."Mehr"bedeutet dabei vorzugweise mindestens 10% mehr, bevorzugt mindestens 20% mehr und besonders bevorzugt mindestens 50% mehr Transkripte als entsprechende, nicht-transformierte Zellen.

Vorzugsweise weisen die Zellen ferner eine entsprechende (mindestens 10%, 20% bzw. 50% ige) Aktivitätsteigerung oder ggf. eine Aktivitätsreduzierung des erfindungsgemäßen Proteins auf. Die transgenen Pflanzenzellen können nach dem Fachmann bekannten Techniken zu ganzen Pflanzen regeneriert werden.

Ebenfalls ist ein Gegenstand der vorliegenden Erfindung ein Verfahren zur Herstellung transgener Pflanzen, worin ein oder mehrere erfindungsgemäße Nucleinsäuremoleküle oder Vektoren in das Genom einer pflanzlichen Zelle integriert werden und eine vollständige Pflanze aus besagter Pflanzenzelle regeneriert wird. Die durch Regeneration der erfindungsgemäßen transgenen Pflanzenzellen erhältlichen Pflanzen sind ebenfalls Gegenstand der vorliegenden Erfindung. Ferner sind Gegenstand der Erfindung Pflanzen, die die oben beschriebenen transgenen Pflanzenzellen enthalten. Bei den transgenen Pflanzen kann es sich prinzipiell um Pflanzen jeder beliebigen Pflanzenspezies handeln, d. h. sowohl monokotyle als auch dikotyle Pflanzen. Bevorzugt handelt es sich um Nutzpflanzen, vorzugsweise stärkesynthetisierende bzw. stärkespeichernde Pflanzen, besonders bevorzugt Roggen, Gerste Hafer, Weizen, Hirse, Sago, Mais, Reis, Erbse, Markerbse, Maniok, Kartoffel, Tomate, Raps, Sojabohne, Hanf, Flachs, Sonnenblume, Kuherbse oder Arrowroot, insbesondere Weizen, Mais, Reis und Kartoffel.

Die Erfindung betrifft ebenfalls Vermehrungsmaterial der erfindungsgemäßen Pflanzen, beispielsweise Früchte, Samen, Knohen, Wurzelstöcke, Sämlinge, Stecklinge, Calli, Protoplasten, Zelikulturen etc..

Die vorliegende Erfindung betrifft ferner ein Verfahren zur Herstellung einer modifizierten Stärke umfassend den Schritt der Extraktion der Stärke aus einer oben beschriebenen erfindungsgemäßen Pflanze und/oder aus stärkespeichernden Teilen einer solchen Pflanze.

Verfahren zur Extraktion der Stärke von Pflanzen oder von stärkespeichernden Teilen von Pflanzen, insbesondere aus Weizen, sind dem Fachmann bekannt, vgl. z. B. Eckhoff et al. (Cereal Chem. 73 (1996) 54-57)"Starch : Chemistry and Technology (Hrsg. : Whistler, BeMiller und Paschall (1994), 2. Ausgabe, Academic Press Inc. London Ltd ; ISBN 0-12-746270-8 ; siehe z. B. Kapitel XII, Seite 412-468 : Mais und Sorghum-Stärken : Herstellung ; von Watson ; Kapitel XIII, Seite 469-479 : Tapioca-, Arrowroot-und Sagostärken : Herstellung ; von Corbishley und Miller ; Kapitel XIV, Seite 479-490 : Kartoffelstärke : Herstellung und Verwendungen ; von Mitch ; Kapitel XV, Seite 491 bis 506 : Weizenstärke : Herstellung, Modifizierung und Verwendungen ; von Knight und Oson ; und Kapitel XVI, Seite 507 bis 528 : Reisstärke : Herstellung und Verwendungen ; von Rohmer und Klem). Vorrichtungen, die für gewöhnlich bei Verfahren zur Extraktion von Stärke von Pflanzenmaterial verwendet werden, sind Separatoren, Dekanter, Hydrocyclone, Sprühtrockner und Wirbelschichttrockner.

Die erfindungsgemäßen transgenen Pflanzenzellen und Pflanzen synthetisieren aufgrund der Expression eines erfindungsgemäßen Nucleinsäuremoleküls eine Stärke, die in ihren physikalisch-chemischen Eigenschaften, z. B. dem Amylose/Amylopektin-Verhältnis, dem Verzweigungsgrad, der durchschnittlichen Kettenlänge, dem Phosphatgehalt, dem Verkleisterungsverhalten, der Stärkekorngröße und/oder der Stärkekornform im Vergleich zu in Wildtyp- Pflanzen synthetisierter Stärke verändert ist. Insbesondere kann eine solche Stärke im Hinblick auf die Viskosität und/oder die Film-oder Gelbildungseigenschaften von Kleistern dieser Stärke im Vergleich zu bekannten Stärken verändert sein.

Gegenstand der vorliegenden Erfindung ist ferner eine Stärke, die aus den erfindungsgemäßen Pflanzenzellen, Pflanzen sowie deren Vermehrungsmaterial erhältlich ist und Stärke, die durch das oben beschriebene erfindungsgemäße Verfahren erhältlich ist.

Ferner ist es möglich, mit Hilfe der erfindungsgemäßen Nucleinsäuremoleküle Pflanzenzellen und Pflanzen zu erzeugen, bei denen die Aktivität eines erfindungsgemäßen Proteins verringert ist. Dies führt ebenfalls zur Synthese einer Stärke mit veränderten chemischen und/oder physikalischen Eigenschaften verglichen mit Stärke aus Wildtyp-Pflanzenzellen.

Ein weiterer Gegenstand der Erfindung ist somit auch ein transgene Pflanzenzelle, enthaltend ein erfindungsgemäßes Nukleinsäuremolekül, in der die Aktivität einer Stärkesynthase im Vergleich zu einer nichttransformierten Zellen reduziert ist.

Die Herstellung von Pflanzenzellen mit einer verringerten Aktivität einer Stärkesynthase kann beispielsweise erzielt werden durch die Expression einer entsprechenden antisense-RNA, einer sense-RNA zur Erzielung eines Cosuppres- sionseffektes oder die Expression eines entsprechend konstruierten Ribozyms, das spezifisch Transkripte spaltet, die eine Stärkesynthase codieren, unter Verwendung der erfindungsgemäßen Nucleinsäuremoleküle nach dem Fachmann bekannten Verfahren, vgl. Jorgensen (Trends Biotechnol. 8 (1990), 340-344), Niebel et al., (Curr. Top. Microbiol. Immunol. 197 (1995), 91-103), Flavell et al.

(Curr. Top. Microbiol. Immunol. 197 (1995), 43-46), Palaqui und Vaucheret (Plant. Mol. Biol. 29 (1995), 149-159), Vaucheret et al., (Mol. Gen. Genet. 248 (1995), 311-317), de Borne et al. (Mol. Gen. Genet. 243 (1994), 613-621).

Vorzugsweise wird zur Reduzierung der Aktivität einer erfindungsgemäßen Stärkesynthase in den pflanzlichen Zellen die Anzahl der sie codierenden Transkripte reduziert, z. B. durch Expression einer antisense-RNA.

Hierzu kann zum einen ein DNA-Molekül verwendet werden, das die gesamte für ein erfindungsgemäßes Protein codierende Sequenz einschließlich eventuell vorhandener flankierender Sequenzen umfaßt, als auch DNA-Moleküle, die nur Teile der codierenden Sequenz umfassen, wobei diese Teile lang genug sein müssen, um in den Zellen einen antisense-Effekt zu bewirken. Es können im allgemeinen Sequenzen bis zu einer Mindestlänge von 15 bp, vorzugsweise einer Länge von 100-500 bp, für eine effiziente antisense-lnhibition insbesondere Sequenzen mit einer Länge über 500 bp verwendet werden. In der Regel werden DNA-Moleküle verwendet, die kürzer als 5000 bp, vorzugsweise Sequenzen, die kürzer als 2500 bp sind.

Möglich ist auch die Verwendung von DNA-Sequenzen, die einen hohen Grad an Homologie zu den Sequenzen der erfindungsgemäßen DNA-Moleküle aufweisen, aber nicht volikommen identisch sind. Die minimale Homologie sollte größer als ca. 65 % sein. Die Verwendung von Sequenzen mit Homologien zwischen 95 und 100 % ist zu bevorzugen.

Gegenstand der Erfindung ist auch ein Verfahren zur Herstellung einer modifizierten Stärke umfassend den Schritt der Extraktion der Stärke aus einer erfindungsgemäßen Zelle oder Pflanze und/oder aus stärkespeichernden Teilen einer solchen Pflanze.

Gegenstand der Erfindung ist ferner Stärke, die aus den erfindungsgemäßen Zellen, Pflanzen sowie Vermehrungsmaterial oder deren Teilen erhältlich ist sowie Stärke, die durch ein erfindungsgemäßes Verfahren erhältlich ist.

Die erfindungsgemäßen Stärken können nach dem Fachmann bekannten Verfahren modifiziert werden und eignen sich in unmodifizierter oder modifizierter Form für verschiedene Verwendungen im Nahrungsmittel-oder Nicht-Nahrungsmittelbereich.

Grundsätzlich lassen sich die Einsatzmöglichkeiten der erfindungsgemäßen Stärken in zwei große Bereiche unterteilen. Der eine Bereich umfaßt die Hydrolyseprodukte der Stärke, hauptsächlich Glucose und Glucanbausteine, die über enzymatische oder chemische Verfahren erhalten werden. Sie dienen als Ausgangsstoff für weitere chemische Modifikationen und Prozesse, wie Fermentation. Für eine Reduktion der Kosten kann hierbei die Einfachheit und ko- stengünstige Ausführung eines Hydrolyseverfahrens von Bedeutung sein.

Gegenwärtig verläuft es im wesentlichen enzymatisch unter Verwendung von Amyloglucosidase. Vorstellbar wäre eine Kosteneinsparung durch einen geringeren Einsatz von Enzymen. Eine Strukturveränderung der Stärke, z. B.

Oberflächenvergrößerung des Korns, leichtere Verdaulichkeit durch z. B. geringeren Verzweigungsgrad oder eine sterische Struktur, die die Zugänglichkeit für die eingesetzten Enzyme begrenzt, könnte dies bewirken.

Der andere Bereich, in dem die erfindungsgemäßen Stärken wegen ihrer polymeren Struktur als sogenannte native Stärke verwendet wird, gliedert sich in zwei weitere Einsatzgebiete : 1. Nahrungsmittelindustrie Stärke ist ein klassischer Zusatzstoff für viele Nahrungsmittel, bei denen sie im wesentlichen die Funktion des Bindens von wäßrigen Zusatzstoffen übernimmt bzw. eine Erhöhung der Viskosität oder aber eine erhöhte Gelbildung hervorruft. Wichtige Eigenschaftsmerkmale sind das Fließ-und Sorptionsverhalten, die Quell-und Verkleisterungstemperatur, die Viskosität und Dickungsleistung, die Löslichkeit der Stärke, die Transparenz und Kleisterstruktur, die Hitze-, Scher-und Säurestabilität, die Neigung zur Retrogradation, die Fähigkeit zur Filmbildung, die Gefrier/Taustabilität, die Viskositätsstabilität in Salziösungen, die Verdaulichkeit sowie die Fähigkeit zur Komplexbildung mit z. B. anorgani- schen oder organischen lonen.

2. Nicht-Nahrungmittelindustrie In diesem großen Bereich kann die Stärke als Hilfsstoff für unterschiedliche Herstellungsprozesse bzw. als Zusatzstoff in technischen Produkten eingesetzt werden. Bei der Verwendung der Stärke als Hilfsstoff ist hier insbesondere die Papier-und Pappeindustrie zu nennen.

Die Stärke dient dabei in erster Linie zur Retardation (Zurückhaltung von Feststoffen), der Abbindung von Füllstoff-und Feinstoffteilchen, als Festigungsstoff und zur Entwässerung. Darüber hinaus werden die günstigen Eigenschaften der Stärke in bezug auf die Steifigkeit, die Härte, den Klang, den Griff, den Glanz, die Glätte, die Spaltfestigkeit sowie die Oberflächen ausgenutzt.

2.1 Papier-und Pappeindustrie Innerhalb des Papierherstellungsprozesses sind vier Anwendungsbereiche, nämlich Oberfläche, Strich, Masse und Sprühen, zu unterscheiden.

Die Anforderungen an die Stärke in bezug auf die Oberflächenbehandlung sind im wesentlichen ein hoher Weißegrad, eine angepaßte Viskosität, eine hohe Viskositätsstabilität, eine gute Filmbildung sowie eine geringe Staubbildung. Bei der Verwendung im Strich spielt der Feststoffgehalt, eine angepaßte Viskosität, ein hohes Bindevermögen sowie eine hohe Pigmentaffinität eine wichtige Rolle. Als Zusatz zur Masse ist eine rasche, gleichmäßige, verlustfreie Verteilung, eine hohe mechanische Stabilität und eine vollständige Zurückhaltung im Papierfließ von Bedeutung. Beim Einsatz der Stärke im Sprühbereich sind ebenfalls ein angepaßter Feststoffgehalt, hohe Viskosität sowie ein hohes Bindevermögen von Bedeutung.

2.2 Klebstoffindustrie Ein großer Einsatzbereich der Stärken besteht in der Klebstoffindustrie, wo man die Einsatzmöglichkeiten in vier Teilbereiche gliedert : die Verwendung als reinem Stärkeleim, die Verwendung bei mit speziellen Chemikalien aufbereiteten Stärkeleimen, die Verwendung von Stärke als Zusatz zu synthetischen Harzen und Polymerdispersionen sowie die Verwendung von Stärken als Streckmittel für synthetische Klebstoffe. 90 % der Klebstoffe auf Stärkebasis werden in den Bereichen Wellpappenherstellung, Herstellung von Papiersäcken, Beuteln und Tüten, Herstellung von Verbundmaterialien für Papier und Aluminium, Herstellung von Kartonagen und Wiederbefeuchtungsleim für Briefumschläge, Briefmarken usw. eingesetzt.

2.3 Textil-und Textilpflegemittelindustrie Ein großes Einsatzfeld für die Stärken als Hilfsmittel und Zusatzstoff ist der Bereich Herstellung von Textilien und Textilpflegemitteln. innerhalb der Textilindustrie sind die folgenden vier Einsatzbereiche zu unterscheiden : Der Einsatz der Stärke als Schlichtmittel, d. h. als Hilfsstoff zur Glättung und Stärkung des Klettverhaltens zum Schutz gegen die beim Weben angreifenden Zugkräfte sowie zur Erhöhung der Abriebfestigkeit beim Weben, Stärke als Mittel zur Textilaufrüstung vor allem nach qualitätsverschlechternden Vorbehandlungen, wie Bleichen, Färben usw., Stärke als Verdickungsmittel bei der Herstellung von Farbpasten zur Verhinderung von Farbstoffdiffusionen sowie Stärke als Zusatz zu Kettungsmitteln für Nähgarne.

2.4 Baustoffindustrie Der vierte Einsatzbereich ist die Verwendung der Stärken als Zusatz bei Baustoffen. Ein Beispiel ist die Herstellung von Gipskartonplatten, bei der die im Gipsbrei vermischte Stärke mit dem Wasser verkleistert, an die Oberfläche der Gipsplatte diffundiert und dort den Karton an die Platte bindet. Weitere Einsatzbereiche sind die Beimischung zu Putz-und Mineralfasern. Bei Transportbeton werden Stärkeprodukte zur Verzögerung der Abbindung eingesetzt.

2.5 Bodenstabilisation Ein weiterer Markt für die Stärke bietet sich bei der Herstellung von Mitteln zur Bodenstabilisation an, die bei künstlichen Erdbewegungen zum temporären Schutz der Bodenpartikel gegenüber Wasser eingesetzt werden. Kombinationsprodukte aus der Stärke und Polymeremulsionen sind nach heutiger Kenntnis in ihrer Erosions-und ver- krustungsmindernden Wirkung den bisher eingesetzten Produkten gleichzusetzen, liegen preislich aber deutlich unter diesen.

2.6 Einsatz in Pflanzenschutz-und Düngemitteln Ein Einsatzbereich liegt in der Verwendung der Stärke in Pflanzenschutzmitteln zur Veränderung der spezifischen Eigenschaften der Präparate. So kann die Stärke zur Verbesserung der Benetzung von Pflanzenschutz-und Düngemitteln, zur dosierten Freigabe der Wirkstoffe, zur Umwandlung flüssiger, flüchtiger und/oder übelriechender Wirkstoffe in mikrokristalline, stabile, formbare Substanzen, zur Mischung inkompatibler Verbindungen und zur Verlängerung der Wirkdauer durch Verminderung der Zersetzung eingesetzt werden.

2.7 Pharmaka, Medizin und Kosmetikindustrie Ein weiteres Einsatzgebiet besteht im Bereich der Pharmaka, Medizin und Kosmetikindustrie. In der pharmazeutischen Industrie kann die Stärke als Bindemittel für Tabletten oder zur Bindemittelverdünnung in Kapseln eingesetzt werden. Weiterhin kann die Stärke als Tablettensprengmittel dienen, da sie nach dem Schlucken Flüssigkeit absorbieren und nach kurzer Zeit soweit quellen, daß der Wirkstoff freigesetzt wird.

Medizinische Gleit-und Wundpuder basieren aus qualitativen Gründen auf Stärke. Im Bereich der Kosmetik werden Stärken beispielsweise als Träger von Puderzusatzstoffen, wie Düften und Salicylsäure eingesetzt. Ein relativ großer Anwendungsbereich für die Stärke liegt bei Zahnpasta.

2.8 Stärkezusatz zu Kohlen und Briketts Einen Einsatzbereich bietet die Stärke als Zusatzstoff zu Kohle und Brikett.

Kohle kann mit einem Stärkezusatz quantitativ hochwertig agglomeriert bzw. brikettiert werden, wodurch ein frühzeitiges Zerfallen der Briketts verhindert wird. Der Stärkezusatz liegt bei Grillkohle zwischen 4 und 6 %, bei kalorierter Kohle zwischen 0,1 und 0,5 %. Des weiteren gewinnen Stärken als Bindemittel an Bedeutung, da durch ihren Zusatz zu Kohle und Brikett der Ausstoß schädlicher Stoffe deutlich vermindert werden kann.

2.9 Erz-und Kohleschlammaufbereitung Die Stärke kann ferner bei der Erz-und Kohleschlammaufbereitung als Flockungsmittel eingesetzt werden.

2.10 Gießereihilfsstoff Ein weiterer Einsatzbereich besteht als Zusatz zu Gießereihilfsstoffen. Bei verschiedenen Gußverfahren werden Kerne benötigt, die aus Bindemittel- versetzten Sänden hergestellt werden. Als Bindemittel wird heute überwiegend Bentonit eingesetzt, das mit modifizierten Stärken, meist Quellstärken, versetzt ist.

Zweck des Stärkezusatzes ist die Erhöhung der Fließfestigkeit sowie die Verbesserung der Bindefestigkeit. Darüber hinaus können die Quellstärken weitere produktionstechnische Anforderungen, wie im kalten Wasser dispergierbar, rehydratisierbar, gut in Sand mischbar und hohes Wasserbindungsvermögen, aufweisen.

2.11 Einsatz in der Kautschukindustrie In der Kautschukindustrie kann die Stärke zur Verbesserung der technischen und optischen Qualität eingesetzt werden. Gründe sind dabei die Verbesserung des Oberflächenglanzes, die Verbesserung des Griffs und des Aussehens, dafür wird Stärke vor der Kaltvulkanisation auf die klebrigen gummierten Flächen von Kautschukstoffen gestreut, sowie die Verbesserung der Bedruckbarkeit des Kautschuks.

2.12 Herstellung von Lederersatzstoffen Eine weitere Absatzmöglichkeit der modifizierten Stärken besteht bei der Herstellung von Lederersatzstoffen.

2.13 Stärke in synthetischen Polymeren Auf dem Kunststoffsektor zeichnen sich folgende Einsatzgebiete ab : die Einbindung von Stärkefolgeprodukten in den Verarbeitungsprozeß (Stärke ist nur Füllstoff, es besteht keine direkte Bindung zwischen synthetischem Polymer und Stärke) oder alternativ die Einbindung von Stärkefolgeprodukten in die Herstellung von Polymeren (Stärke und Polymer gehen eine feste Bindung ein).

Die Verwendung der Stärke als reinem Füllstoff ist verglichen mit den anderen Stoffen wie Talkum nicht wettbewerbsfähig. Anders sieht es aus, wenn die spezifischen Stärkeeigenschaften zum Tragen kommen und hierdurch das Eigenschaftsprofil der Endprodukte deutlich verändert wird. Ein Beispiel hierfür ist die Anwendung von Stärkeprodukten bei der Verarbeitung von Thermoplasten, wie Polyethylen. Hierbei werden die Stärke und das synthetische Polymer durch Koexpression im Verhältnis von 1 : 1 zu einem'master batch' kombiniert, aus dem mit granuliertem Polyethylen unter Anwendung herkömmlicher Verfahrenstechniken diverse Produkte hergestellt werden. Durch die Einbindung von Stärke in Polyethylenfolien kann eine erhöhte Stoffdurchlässigkeit bei Hohlkörpern, eine verbesserte Wasser- dampfdurchlässigkeit, ein verbessertes Antistatikverhalten, ein verbessertes Antiblockverhalten sowie eine verbesserte Bedruckbarkeit mit wäßrigen Farben erreicht werden.

Eine andere Möglichkeit ist die Anwendung der Stärke in Polyurethanschäumen.

Mit der Adaption der Stärkederivate sowie durch die verfahrenstechnische Optimierung ist es möglich, die Reaktion zwischen synthetischen Polymeren und den Hydroxygruppen der Stärken gezielt zu steuern. Das Ergebnis sind Polyurethanfolien, die durch die Anwendung von Stärke folgende Eigenschaftsprofile erhalten : eine Verringerung des Wärmeausdehnungskoeffizienten, Verringerung des Schrumpfverhaltens, Verbesserung des Druck/Spannungsverhaltens, Zunahme der Wasserdampfdurchlässigkeit ohne Veränderung der Wasseraufnahme, Verringerung der Entflammbarkeit und der Aufrißdichte, kein Abtropfen brennbarer Teile, Halogenfreiheit und verminderte Alterung. Nachteile, die gegenwärtig noch vorhanden sind, sind verringerte Druckfestigkeit sowie eine verringerte Schlagfestigkeit.

Die Produktentwicklung beschränkt sich inzwischen nicht mehr nur auf Folien.

Auch feste Kunststoffprodukte, wie Töpfe, Platten und Schalen, sind mit einem Stärkegehalt von über 50 % herzustellen. Des weiteren sind Stärke/ Polymermischungen günstig zu beurteilen, da sie eine sehr viel höhere biologische Abbaubarkeit aufweisen.

Außerordentliche Bedeutung haben weiterhin auf Grund ihres extremen Wasserbindungsvermögen Stärkepfropfpolymerisate gewonnen. Dies sind Produkte mit einem Rückgrat aus Stärke und einer nach dem Prinzip des Radikalkettenmechanismus aufgepfropften Seitengitters eines synthetischen Monomers. Die heute verfügbaren Stärkepfropfpolymerisate zeichnen sich durch ein besseres Binde-und Rückhaltevermögen von bis zu 1000 g Wasser pro g Stärke bei hoher Viskosität aus. Die Anwendungsbereiche für diese Superabsorber haben sich in den letzten Jahren stark ausgeweitet und liegen im Hygienebereich mit Produkten wie Windeln und Unterlagen sowie im landwirtschaftlichen Sektor, z. B. bei Saatgutpillierungen.

Entscheidend für den Einsatz der neuen, gentechnisch veränderten Stärken sind zum einen die Struktur, Wassergehalt, Proteingehalt, Lipidgehalt, Fasergehalt, Asche/Phosphatgehalt, Amylose/Amylopektinverhältnis, Molmassenverteilung, Verzweigungsgrad, Korngröße und-form sowie Kristallinität, zum anderen auch die Eigenschaften, die in folgende Merkmale münden : Fließ-und Sorptionsverhalten, Verkleisterungstemperatur, Viskosität, Viskositätsstabilität in Salzlösungen, Dickungsleistung, Löslichkeit, Kleisterstruktur und-transparenz, Hitze-, Scher-und Säurestabilität, Retrogradationsneigung, Gelbildung, Gefrier/Taustabilität, Komplexbildung, Jodbindung, Filmbildung, Klebekraft, Enzymstabilität, Verdaulichkeit und Reaktivität.

Die Erzeugung modifizierter Stärken mittels gentechnischer Verfahren kann zum einen die Eigenschaften der aus der Pflanze gewonnenen Stärke dahingehend verändern, daß weitere Modifikationen mittels chemischer oder physikalischer Verfahren nicht mehr notwendig erscheinen. Zum anderen können die durch gentechnische Verfahren veränderte Stärken weiteren chemischen Modifikationen unterworfen werden, was zu weiteren Verbesserungen der Qualität für bestimmte der oben beschriebenen Einsatzgebiete führt. Diese chemischen Modifikationen sind grundsätzlich bekannt. Insbesondere handelt es sich dabei um Modifikationen durch Hitzebehandlung, Behandlung mit organischen oder anorganischen Säuren, Oxidation und Veresterungen, welche z. B. zur Entstehung von Phosphat-, Nitrat-, Sulfat-, Xanthat-, Acetat-und Citratstärken führen. Desweiteren können ein-oder mehrwertige Alkohole in Gegenwart starker Säuren zur Erzeugung von Stärkeethern eingesetzt werden, so daß Stärke-Alkylether, 0-Allylether, Hydroxylalkylether, O- Carboxylmethylether, N-haltige Stärkeether, P-haltige Stärkeether), S-haltige Stärkeether, vernetzte Stärken oder Stärke-Pfropf-Polymerisate resultieren.

Eine bevorzugte Verwendung der erfindungsgemäße Stärken liegt in der Herstellung von Verpackungsmaterial und Einwegartikeln einerseits sowie als Lebensmittel oder Lebensmittelvorprodukt andererseits.

Zur Expression der erfindungsgemäßen Nucleinsäuremoleküle in sense-oder antisense-Orientierung in pflanzlichen Zellen werden diese mit regulatorischen DNA-Elementen verknüpft, die die Transkription in pflanzlichen Zellen gewährleisten. Hierzu zählen insbesonderePromotoren, Enhancer und Terminatoren. Generell kommt für die Expression jeder in pflanzlichen Zellen aktive Promotor in Frage.

Der Promotor kann dabei so gewähit sein, daß die Expression konstitutiv erfolgt oder nur in einem bestimmten Gewebe, zu einem bestimmten Zeitpunkt der Pflanzenentwicklung oder zu einem durch äußere Einflüsse determinierten Zeitpunkt. In Bezug auf die Pflanze kann der Promotor homolog oder heterolog sein. Geeignete Promotoren sind z. B. der Promotor der 35S RNA des Cauliflower Mosaic Virus und der Ubiquitin-Promotor aus Mais für eine konstitutive Expression, der Patatin-Promotor B33 (Rocha-Sosa et al., EMBO J. 8 (1989), 23-29) für eine knollenspezifische Expression oder ein Promotor, der eine Expression lediglich in photosynthetisch aktiven Geweben sicherstellt, z. B. der ST-LS1-Promotor (Stockhaus et al., Proc. Natl. Acad. Sci. USA 84 (1987), 7943-7947 ; Stockhaus et al., EMBO J. 8 (1989), 2445-2451) oder für eine en- dosperm-spezifische Expression der HMG-Promotor aus Weizen, der USP- Promotor, der Phaseolinpromotor oder Promotoren von Zein-Genen aus Mais.

Ferner kann eine Terminationssequenz vorhanden sein, die der korrekten Beendigung der Transkription dient sowie der Addition eines Poly-A-Schwanzes an das Transkript, dem eine Funktion bei der Stabilisierung der Transkripte beigemessen wird. Derartige Elemente sind in der Literatur beschrieben (vgl.

Gielen et al., EMBO J. 8 (1989), 23-29) und sind beliebig austauschbar.

Die vorliegende Erfindung stellt Nucleinsäuremoleküle zur Verfügung, die ein Protein mit der Funktion einer ös ! iche Stärkesynthase aus Weizen codieren. Die erfindungsgemäßen Nucleinsäuremoleküle erlauben die Herstellung dieses Enzyms, dessen funktionale Identifizierung innerhalb der Stärkebiosynthese, die Herstellung gentechnisch veränderter Pflanzen, bei denen die Aktivität dieses Enzyms verändert ist und ermöglicht somit die Synthese einer Stärke mit veränderter Struktur und veränderten physikalisch-chemischen Eigenschaften in derartig modifizierten Pflanzen.

Die erfindungsgemäßen Nucleinsäuremoleküle können prinzipiell auch dazu verwendet werden, Pflanzen herzustellen, in denen die Aktivität der erfindungsgemäßen Stärkesynthase erhöht oder verringert ist und gleichzeitig die Aktivitäten anderer, an der Stärkesynthese beteiligter Enyzme verändert sind.

Durch die Veränderung der Aktivitäten einer Stärkesynthase in Pflanzen kommt es zur Synthese einer in ihrer Struktur veränderten Stärke. Ferner können Nucleinsäuremoleküle, die eine Stärkesynthase codieren oder entsprechende antisense-Konstrukte, in Pflanzenzellen eingebracht werden, bei denen bereits die Synthese endogener GBSS I-, SSS-oder GBSS ll-Proteine aufgrund eines antisense-Effektes oder einer Mutation inhibiert ist oder die Synthese des Verzweigungsenzyms inhibiert ist (wie z. B. in WO 92/14827 oder Shannon und Garwood, 1984, in Whistler, BeMiller und Paschall, Starch : Chemistry and Technology, Academic Press, London, 2nd Edition : 25-86).

Soll die Inhibierung der Synthese mehrerer an der Stärkebiosynthese beteiligter Enzyme in transformierten Pflanzen erreicht werden, so können DNA-Moleküle zur Transformation verwendet werden, die gleichzeitig mehrere, die entsprechenden Enzyme codierenden Regionen in antisense-Orientierung unter der Kontrolle eines geeigneten Promotors enthalten. Hierbei kann alternativ jede Sequenz unter der Kontrolle eines eigenen Promotors stehen, oder die Sequenzen können als Fusion von einem gemeinsamen Promotor transkribiert werden bzw. unter der Kontrolle eines gemeinsamen Promoters stehen. Letztere Alternative wird in der Regel vorzuziehen sein, da in diesem Fall die Synthese der entsprechenden Proteine in etwa gleichem Maße inhibiert werden sollte. Für die Länge der einzelnen codierenden Regionen, die in einem derartigen Konstrukt verwendet werden, gilt das, was oben bereits for die Herstellung von antisense- Konstrukten ausgeführt wurde. Eine obere Grenze for die Anzahl der in einem derartigen DNA-Molekül von einem Promotor aus transkribierten antisense- Fragmente gibt es prinzipiell nicht. Das entstehende Transkript sollte aber vorzugsweise eine Länge von 10 kb und insbesondere eine Länge von 5 kb nicht überschreiten.

Codierende Regionen, die in derartigen DNA-Molekülen in Kombination mit anderen codierenden Regionen in antisense-Orientierung hinter einem geeigneten Promotor lokalisiert sind, können aus DNA-Sequenzen stammen, die for folgende Proteine codieren : Stärkekorn-gebundene (GBSS I und 11) und lösliche Stärkesynthasen (SSS I und 11), Verzweigungsenzyme (Isoamylasen, Pullulanasen, R-Enzyme,"Branching"-Enzyme,"Debranching"-Enzyme), Stärkephosphorylasen und Disproportionierungsenzyme. Dies ist nur eine bei- spielhafte Aufzählung. Auch die Verwendung anderer DNA-Sequenzen im Rahmen einer derartigen Kombination ist denkbar.

Mit Hilfe derartiger Konstrukte ist es möglich, in Pflanzenzellen, die mit diesen transformiert wurden, die Synthese mehrerer Enzyme gleichzeitig zu inhibieren.

Weiterhin können die Konstrukte in pflanzliche Mutanten eingebracht werden, die für ein oder mehrere Gene der Stärkebiosynthese defekt sind (Shannon und Garwood, 1984, in Whistler, BeMiller und Paschall, Starch : Chemistry and Technology, Academic Press, London, 2nd Edition : 25-86). Diese Defekte können sich auf folgende Proteine beziehen : Stärkekorn-gebundene (GBSS I und II) und lösliche Stärkesynthasen (SSS I und 11), Verzweigungsenzyme (BE I und II),"Debranching"-Enzyme (R-Enzyme), Disproportionierungsenzyme und Stärkephosphorylasen. Dies ist nur eine beispielhafte Aufzählung.

Mit Hilfe einer derartigen Vorgehensweise ist es weiterhin möglich, in Pflanzenzellen, die mit diesen transformiert wurden, die Synthese mehrerer Enzyme gleichzeitig zu inhibieren.

Zur Vorbereitung der Einführung fremder Gene in höhere Pflanzen stehen eine große Anzahl von Klonierungsvektoren zur Verfügung, die ein Replikationssignal für E. coli und ein Markergen zur Selektion transformierter Bakterienzellen enthalten. Beispiele für derartige Vektoren sind pBR322, pUC-Serien, M13mp- Serien, pACYC184 usw.. Die gewünschte Sequenz kann an einer passenden Restriktionsschnittstelle in den Vektor eingeführt werden. Das erhaltene Plasmid wird für die Transformation von E. coli-Zellen verwendet. Transformierte E. coli- Zellen werden in einem geeigneten Medium gezüchtet, anschließend geerntet und lysiert. Das Plasmid wird wiedergewonnen. Als Analysemethode zur Charakterisierung der gewonnenen Plasmid-DNA werden im allgemeinen Restriktionsanalysen, Gelelektrophoresen und weitere biochemisch- molekularbiologische Methoden eingesetzt. Nach jeder Manipulation kann die Plasmid-DNA gespalten und gewonnene DNA-Fragmente mit anderen DNA- Sequenzen verknüpft werden. Jede Plasmid-DNA-Sequenz kann in den gleichen oder anderen Plasmiden cloniert werden.

Für die Einführung von DNA in eine pflanzliche Wirtszelle stehen eine Vielzahl von Techniken zur Verfügung. Diese Techniken umfassen die Transformation pflanzlicher Zellen mit T-DNA unter Verwendung von Agrobacterium tumefaciens oder Agrobacterium rhizogenes als Transformationsmittel, die Fusion von Protoplasten, die Injektion, die Elektroporation von DNA, die Einbringung von DNA mittels der biolistischen Methode sowie weitere Möglichkeiten.

Bei der Injektion und Elektroporation von DNA in Pflanzenzellen werden an sich keine speziellen Anforderungen an die verwendeten Plasmide gestellt. Es können einfache Plasmide wie z. B. pUC-Derivate verwendet werden. Sollen aber aus derartig transformierten Zellen ganze Pflanzen regeneriert werden, ist in der Regel die Anwesenheit eines selektierbaren Markergens notwendig.

Je nach Einführungsmethode gewünschter Gene in die Pflanzenzelle können weitere DNA-Sequenzen erforderlich sein. Werden z. B. für die Transformation der Pflanzenzelle das Ti-oder Ri-Plasmid verwendet, so muß mindestens die rechte Begrenzung, häufig jedoch die rechte und linke Begrenzung der Ti-und Ri- Plasmid T-DNA als Flankenbereich mit den einzuführenden Genen verbunden werden.

Werden für die Transformation Agrobakterien verwendet, muß die einzuführende DNA in spezielle Plasmide cloniert werden, und zwar entweder in einen intermediären Vektor oder in einen binären Vektor. Die intermediären Vektoren können aufgrund von Sequenzen, die homolog zu Sequenzen in der T-DNA sind, durch homologe Rekombination in das Ti-oder Ri-Plasmid der Agrobakterien integriert werden. Dieses enthält außerdem die für den Transfer der T-DNA notwendige vir-Region. Intermediäre Vektoren können nicht in Agrobakterien replizieren. Mittels eines Helferplasmids kann der intermediäre Vektor auf Agrobacterium tumefaciens übertragen werden (Konjugation). Binäre Vektoren können sowohl in E. coli als auch in Agrobakterien replizieren. Sie enthalten ein Selektionsmarker-Gen und einen Linker oder Polylinker, welche von der rechten und linken T-DNA Grenzregion eingerahmt werden. Sie können direkt in die Agrobakterien transformiert werden (Holsters et al. Mol. Gen. Genet. 163 (1978), 181-187). Das als Wirtszelle dienende Agrobakterium soll ein Plasmid, das eine vir-Region trägt, enthalten. Die vir-Region ist für den Transfer der T- DNA in die Pflanzenzelle notwendig. Zusätzliche T-DNA kann vorhanden sein.

Das derartig transformierte Agrobakterium iäßt sich zur Transformation von Pflanzenzellen verwenden.

Die Verwendung von T-DNA für die Transformation von Pflanzenzellen ist intensiv untersucht und ausreichend in EP 120 516 ; Hoekema, In : The Binary Plant Vector System Offsetdrukkerij Kanters B. V., Alblasserdam (1985), Chapter V ; Fraley et al., Crit. Rev. Plant. Sci., 4,1-46 und An et al. EMBO J. 4 (1985), 277-287 beschrieben worden.

Für den Transfer der DNA in die Pflanzenzelle können Pflanzen-Explantate zweckmäßigerweise mit Agrobacterium tumefaciens oder Agrobacterium rhizogenes kokultiviert werden. Aus dem infizierten Pflanzenmaterial (z. B.

Blattstücke, Stengelsegmente, Wurzeln, aber auch Protoplasten oder Suspensions-kultivierte Pflanzenzellen) können dann in einem geeigneten Medium, welches u. a. bestimmte Zucker, Aminosäuren, Antibiotika oder Biozide zur Selektion transformierter Zellen enthalten kann, wieder ganze Pflanzen regeneriert werden. Die so erhaltenen Pflanzen können dann auf Anwesenheit der eingeführten DNA untersucht werden. Andere Möglichkeiten der Einführung fremder DNA unter Verwendung des biolistischen Verfahrens oder durch Protoplastentransformation sind bekannt (vgl. z. B. Willmitzer, L., 1993 Transgenic plants. In : Biotechnology, A Multi-Volume Comprehensive Treatise (H. J. Rehm, G. Reed, A. Pühler, P. Stadler, eds.), Vol. 2,627-659, VCH Weinheim-New York-Basel-Cambridge).

Während die Transformation dikotyler Pflanzen über Ti-Plasmid-Vektorsysteme mit Hilfe von Agrobacterium tumefaciens wohl etabliert ist, weisen neuere Arbeiten darauf hin, daß auch monokotyle Pflanzen der Transformation mittels Agrobacterium basierender Vektoren sehr wohl zugänglich sind (Chan et al., Plant Mol. Biol. 22 (1993), 491-506 ; Hiei et al., Plant J. 6 (1994), 271-282).

Alternative Verfahren zur Transformation von monokotylen Pflanzen bestehen mittels des biolistischen Ansatzes, der Protoplastentransformation oder der physikalisch oder chemisch induzierten DNA-Aufnahme in Protoplasten, z. B. durch Elektroporation von partiel permeabilisierten Zellen, Transfer von DNA mittels Glasfasern, Makroinjektion von DNA in Blütenstände, die Mikroinjektion von DNA in Mikrosporen oder Pro-Embryonen, die DNA-Aufnahme durch keimenden Pollen und die DNA-Aufnahme in Embryonen durch Quellung (zur Übersicht : Potrykus, Physiol. Plant (1990), 269-273).

Drei der oben genannten Transformationssysteme konnten in der Vergangenheit für verschiedene Getreide etabliert werden : die Elektroporation von Gewebe, die Transformation von Protoplasten und der DNA-Transfer durch Partikel-Beschuß in regenerierbare Gewebe und Zellen (zur Übersicht : Jähne et al., Euphytica 85 (1995), 35-44).

Die Transformation von Weizen wird in der Literatur verschiedentlich beschrieben (zur Übersicht : Maheshwari et al., Critical Reviews in Plant Science 14 (2) (1995), 149 bis 178) : Hess et al. (Plant Sci. 72 (1990), 233) benutzten das Verfahren der Makroinjektion, um Pollen und Agrobakterien in unmittelbare Nähe zu bringen. Die Mobilisierung des Plasmids, das das nptil Gen als selektierbaren Marker enthielt, wurde mittels Southern Blot Analyse und NPTII Test nachgewiesen. Die Transformanten zeigten einen normalen Phänotyp und waren fertil. Die Kanamycin-Resistenz konnte in zwei aufeinanderfolgende Generationen nachgewiesen werden.

Die erste transgene, fertile Weizenpflanze, die nach Beschuß mit Mikroprojektil- gebundener DNA regeneriert werden konnte, wurde von Vasil et al.

(Bio/Technology 10 (1992), 667-674) beschrieben. Das Zielgewebe für den Beschuß war eine embryogene Kalluskultur (Typ C Kallus). Als Selektionsmarker wurde das bar Gen eingesetzt, das eine Phosphinothricin Acetyltransferase codiert und somit eine Resistenz gegen das Herbizid Phosphinothricin vermittelt.

Ein weiteres System wurde von Weeks et al. (Plant Physiol. 102 (1993), 1077 -1084), sowie Becker et al. (Plant J. 5 (2) (1994), 299-307) beschrieben.

Hier ist das Zielgewebe für die DNA-Transformation das Skutellum unreifer Embryonen, das in einer einleitenden in vitro Phase zur Induktion somatischer Embryonen angeregt wurde. Die Effizienz der Transformation liegt bei dem von Becker et al. (loc cit.) entwickelten System mit 1 transgene Pflanze pro 83 Embryonen der Sorte"Florida"deutlich höher als bei dem von Weeks et al. etablierten System mit 1 bis 2 transgenen Pflanzen pro 1000 Embryonen der Sorte"Bohwhite".

Das von Becker et al. (loc. Cit) entwickelte System bildet die Basis für die in den Beispielen beschriebenen Transformationsexperimente.

Ist die eingeführte DNA einmal im Genom der Pflanzenzelle integriert, so ist sie dort in der Regel stabil und bleibt auch in den Nachkommen der ursprünglich transformierten Zelle erhalten. Sie enthält normalerweise einender oben erwähnten Selektionsmarker, der den transformierten Pflanzenzellen z. B.

Resistenz gegenüber einem Biozid wie Phosphinothricin oder einem Antibiotikum wie Kanamycin, G 418, Bleomycin oder Hygromycin vermittelt oder die Selektion über die An-oder Abwesenheit bestimmter Zucker oder Aminosäuren gestattet. Der individuell gewählte Marker sollte daher die Selektion trans- formierter Zellen gegenüber Zellen gestatten, denen die eingeführte DNA fehlt.

Die transformierten Zellen wachsen innerhalb der Pflanze in der üblichen Weise (siehe auch McCormick et al., Plant Cell Reports 5 (1986), 81-84). Die resultierenden Pflanzen können normal angezogen werden und mit Pflanzen, die die gleiche transformierte Erbanlage oder andere Erbanlagen besitzen, gekreuzt werden. Die daraus entstehenden hybriden Individuen haben die entsprechenden phänotypischen Eigenschaften. Von den Pflanzenzellen können Samen gewonnen werden.

Es sollten zwei oder mehrere Generationen angezogen werden, um sicherzustellen, daß das phänotypische Merkmal stabil beibehalten und vererbt wird. Auch sollten Samen geerntet werden, um sicherzustellen, daß der entsprechende Phänotyp oder andere Eigenarten erhalten geblieben sind.

Die nachfolgenden Beispiele sollen die Erfindung illustrieren und stellen keinerlei Beschränkung dar.

1. Clonierungsverfahren Zur Clonierung in E. coli wurde der Vektor pBluescript 11 SK (Stratagene) verwendet.

2. Bakterienstämme Für den Bluescript-Vektor und für die antisense-Konstrukte wurde der E. coli Stamm DH5a (Bethesda Research Laboratories, Gaithersburg, USA) verwendet. Für die in vivo Excision wurde der E. coli-Stamm XL1-Blue verwendet.

3. Transformation unreifer Weizenembryonen Medien MS : 100 ml/I Makrosalz (D. Becker und H. Lörz, 1 ml/I Mikrosalz Plant Tissue Culture 2 ml/I Fe/NaEDTA Manual (1996), B 12 : 1-20) 30 g/I Saccharose #30 : MS + 2,4-D (2 mg/l) #31 : MS + 2,4-D (2 mg/l) + Phosphinothricin (PPT, aktive Komponente des Herbizids BASTA (2 mg/))) #32 : MS + 2,4-D (0,1 mg/l) + PPT (2 mu/1) #39 : MS + 2,4-D (2 mg/ml) + je 0,5 N Mannit/Sorbit Die angegebenen Medien wurden auf den pH-Wert 5,6 mit KOH eingestellt und mit 0,3 % Gelrite verfestigt.

Die Methode zur Transformation unreifer Embryonen aus Weizen wurde von Becker und Lörz (D. Becker und H. Lörz, Plant Tissue Culture Manual (1996), B12 : 1 bis 20) entwickelt und optimiert.

In den nachfolgend beschriebenen Experimenten wurde sich an das von Becker und Lörz (loc. Cit) ausgearbeitete Protokoll gehalten.

Zur Transformation werden Ahren mit Karyopsen der Entwicklungstufe 12 bis 14 Tage nach Anthesis geerntet und oberflächensterilisiert. Die isolierten Skutella werden mit der dem Medium zugewandten Embryoachse auf Induktionsmedium # 30 plattiert.

Nach 2 bis 4 tägiger Vorkultur (26°C, dunkel) werden die Explantate auf Medium # 39 zur osmotischen Vorkultur (2 bis 4 h, 26°C, dunkel) umgesetzt.

Zur biolistischen Transformation werden pro Schuß ca. 29 Ng Goldpartikel, auf die zuvor wenige, ug der Ziel-DNA gefällt wurde, eingesetzt. Da es sich bei den durchgeführten Experimenten um Co-Transformanten handelt, wird die Ziel-DNA in einem Verhältnis von 1 : 1, bestehend aus dem Zielgen und einem Resistenzmarkergen (bar-Gen) dem Fällungsansatz zugegeben.

4. DIG-Markierung von DNA-Fragmenten Die Markierung von DNA-Fragmenten, die als Screeningsonden eingesetzt wurden, erfolgte über eine spezifische PCR unter Einbau von DIG-markiertem dUTP (Boehringer Mannheim, Deutschland).

In den Beispielen verwendete Medien und Lösungen : 20 x SSC 175,3 g NaCI 88,2 g Natrium-Citrat ad 1000 ml mit ddH20 pH 7,0 mit 10 N NaOH Bei der DSMZ in Braunschweig, Bundesrepublik Deutschland, erfolgte die Hinterlegung des Plasmids pTaSSI 8/1 gemäß Budapester Vertrag unter der Nummer DSM 12794.

Beispiel 1 : Identifizierung, Isolierung und Charakterisierung einer cDNA, die eine 16seiche Stärkesynthase (SS I) aus Weizen (Triticum aestivum L., cv. Florida) codiert Zur Identifizierung der vollständigen cDNA, die eine Isoform einer ös) ichen Stärkesynthase (SS I) aus Weizen codiert, wurde die Strategie des homologen Screening verfolgt. Hierfür wurde eine cDNA-Bank aus Weizen mit geeigneten Oligonucleotiden durchmustert (gescreent). Das SS I spezifische Oligonucleotid, das zum Screening eingesetzt wurde, war mittels des 5'RACE-Verfahren (Rapid Amplification of cDNA Ends) wie nachfolgend beschrieben isoliert worden.

Die Synthese der Weizen cDNA Bank erfolgte aus poly (A) + RNA von ca. 20 Tage alten Karyopsen (Endosperm) in einem Lambda Zap II Vektor analog den Angaben des Herstellers (Lambda ZAP II-cDNA Synthesis Kit, Stratagene GmbH, Heidelberg, Deutschland). Nach Titerbestimmung der cDNA-Bank konnte ein Primärtiter von 1,26x106 pfu/ml ermittelt werden.

Das Durchmustern der cDNA Bank wurde mit einer SS I Sonde aus Weizen durchgeführt. Es wurde mittels 5'-RACE ein DNA Fragment isoliert und die Amplifizierung des 5'Endes mit einem 5'RACE-Kit (nachfolgend"Kit") der Firma Boehringer (Mannheim, Deutschland) durchgeführt. Alle Schritte wurden analog den Angaben des Herstellers durchgeführt. Es wurden ausschließlich Reagenzien und Enzyme aus dem Kit verwendet, wenn nicht anders beschrieben.

Zunächst wurde poly (A) + RNA ca. 20 Tage alter Karyopsen in einzelsträngige cDNA transkribiert und in eine Tailing-Reaktion eingesetzt. Die daraus resultierende, im 5'-Bereich mit dem Oligo (dA) Anker#9 (Kit) versehene cDNA wurde in einer ersten Reaktion mit den Primern Oligo (dT) #8 (Kit) und B2F5 nach einem modifizierten Protokoll wie folgt amplifiziert : In einem 50 ul Ansatz wurden 5, ul getailte cDNA, 5, ul 1 Ox Reaktionspuffer (Life Technologies), 0,25 , uM B2F5-Primer, 0,75 NM Oligo (dT) #8,0,2 mM dNTP's und 5U Taq Polymerase (rekombinant, Life Technologies) eingesetzt. Das PCR-Profil war : 94°C 3'/94°C 45"/56°C 1'/72°C 1'30", 29 Cyclen/72°C 5'.

Daran anschließend wurde eine weitere PCR mit den Primern Oligo (dT) #8 (Kit), B2F5 und dem 5'-gelegenen Primer B2F6 durchgeführt. In einem 50/il Ansatz wurden 1 pI PCR-Produkt, 5, ut 1 Ox Reaktionspuffer (Life Technologies), 0,25, uM B2F5-Primer, 0,25, uM B2F6-Primer, 0,75, uM Oligo (dT) #8,0,2mM dNTP's und 5U Taq Polymerase (rekombinant, Life Technologies) eingesetzt. Das PCR-Profil war : 94°C 3'/94°C 45"/60°C 1'/72°C 1'30" ; 29 Cyclen/72°C 5' B2F5 : 5'CCTCCCAATTCAAGGATTAGTG 3' (Seq ID No. 3) B2F6 : 5'CCTCGCATGCAGCATAGCAA 3' (Seq. ID No. 4) Die nach vorstehenden Verfahren erhaltenen PCR-Produkte wurden in einem Agarosegel aufgetrennt und die DNA-Fragmente mit einer Größe über 800bp isoliert. Die Klonierung der PCR-Fragmente erfolgte mit dem pCR-Script SK (+) Cloning Kit der Firma Stratagene (Heidelberg). Durch Sequenzanalyse der clonierten Subfragmente wurden ca. 150 bp bisher unbekannte Sequenz des SS I Clons identifiziert.

Aus dem 5'-Bereich dieser neuen Sequenz wurden die Oligonucleotide B2R00 und B2F6.2 zur Amplifikation eines DNA-Fragmentes (SS !-Sonde) ausgewähit, das anschließend mit Digoxygenin-11-dUTP wie beschrieben markiert und als Sonde zum Screenen der Weizen cDNA Bank eingesetzt wurde. Die Markierung der SS I-Sonde erfolgte mittels einer PCR-Reaktion mit den Primern B2ROO und B2F6.2 analog den Angaben in"The DIG System Users's Guide for Filter Hybridisation" (Boehringer Mannheim).

B2ROO : 5'TGTGGCTGCAAGTGAGGAGG 3' (Seq. ID No. 5) B2F6.2 5'CCAGTCACAAACACGTAGCTACG 3' (Seq. ID No. 6) Zum Durchmustern der Weizen cDNA Bank wurden ca. 700.000 Phagen ausplattiert. Ausplattieren der Phagen und Abziehen der Platten erfoigte nach Standardprotokollen. Die Prähybridisierung und Hybridisierung der Filter wurde in 5X SSC, 3 % Blocking (Boehringer Mannheim), 0,2 % Na-dodecylsulfat (SDS), 0.1 % Natrium Laurylsarcosin und 50, ug/ml Heringssperma DNA bei 65°C durchgeführt. Der Hybridisierungslösung wurde 1,3 ng/ml der DIG-markierten SS !-Sonde zugesetzt und die Hybridisierung über Nacht inkubiert. Gewaschen wurden die Filter gemäß dem Protokoll wie beschrieben in"The DIG System User's Guide for Filter Hybridisation" (Boehringer Mannheim) bei 65°C. Positive Clone wurden durch 2 weitere Screening Runden vereinzelt. Über in vivo Excision wurden vereinzelte Clone als pBluescript SK Phagemide erhalten (Durchführung analog den Angaben des Herstellers ; Stratagene, Heidelberg).

Nach Analyse der Clone über Minipräparierung und Restringierung der Plasmid- DNA wurde der Clon TaSSI 8/1 weiter analysiert.

Beispiel 2 : Sequenzanalyse der cDNA-Insertionen des Plasmids pTaSSI 8/1 Aus dem Clon TaSSI 8/1 wurd die Plasmid-DNA isoliert und die Sequenz der cDNA-lnsertionen mittels der Didesoxynukleotidmethode (Sanger et al., Proc.

Natl. Acad. Sci. USA 74 (1977), 5463-5467) bestimmt. Die Insertion des Clons TaSSI 8/1 ist 2805 bp lang und stellt eine vollständige cDNA dar. Die Nucleotidsequenz ist unter Seq ID No. 1 angegeben. Die entsprechende Aminosäuresequenz ist unter Seq ID No. 2 angegeben. Ein Vergleich mit bereits publizierten Sequenzen zeigte, daß die unter Seq ID No. 1 dargestellte Sequenz neu ist und eine vollständige codierende Region beinhaltet.

Beispiel 3 : Herstellung des Pflanzentransformationsvektors pTa-gamma-SSI-8/1 Zur Expression der unter Beispiel 1 isolierten cDNA wurden auf der Grundlage von pUC19 als Basisplasmid der Pflanzentransformationsvektor pTa-gamma-SSI- 8/1 konstruiert. Zur Konstruktion des Vektors wird die cDNA-Insertion des Plasmids TaSSI 8/1 vollständig in sense-Orientierung mit dem 3'Ende des Ubiquitin-Promotors verbunden. Dieser Promotor besteht aus dem ersten untranslatierten Exon und dem ersten Intron des ubiquitin1 Gens aus Mais (Christensen A. H. et al., Plant Molecular Biology 18 (1992), 675-689). Teile des Polylinkers und der NOS-Terminator stammen aus dem Plasmid pACT1. cas (CAMBIA, TG 0063 ; Cambia, GPO Box 3200, Canberra ACT 2601, Australia).

Vektorkonstrukte mit diesem Terminator und Konstruktionen, die auf pAct1. cas basieren, sind in MCElroy et al. (Molecular Breeding 1 (1995), 27-37) beschrieben. Der so entstandene Vektor wurde pUbi. cas genannt.

Die Klonierung des Expressionsvektors erfolgte durch Restriktion eines Fragmentes aus dem Klon TaSSI 8/1 mit den Restriktionsenzymen Xba I und Ssp. I. Das Fragment wurde an den Enden mittels einer Klenow Reaktion aufgefüllt und anschließend in die Sma I Klonierungsstelle des Expressionsvektors pUbi. cas ligiert. Der entstandene Expressionsvektor wurde pTA-gamma-SSI 8/1 bezeichnet. In einem zweiten Konstrukt wurde der 5'- untranslatierte Leader des Klons TaSSI-8/1 zunächst durch eine Behandlung mit Exonnuklease entfernt. Sodann erfolgte die Klonierung in den Expressionsvektor pUbi. cas. Dieses Konstrukt wurde Ta-gamma-SSI-8/1-2 bezeichnet.

Der Vektoren pTa-gamma-SSI-8/1 und pTa-gamma-SSI-8/1-2 werden anschließend zur Transformation von Weizen verwendet.

INTERNATIONALESFORMBLATT Hoechst Schering AgrEvo GmbH 65926 Frankfurt/Main EMPFANGSBESTATIGUNG BEI ERSTHINTERLEGUNG, ausgestellt gemma Regel 7.1 von der unten angegebenen INTERNATIONALENHINTERLEGUNGSSTELLE I. KENNZEICHNUNG DES MIKROORGANISMUS Vom HINTERLEGER zugeteiltes Bezugszeichen : Von der INTERNATIONALEN HINTERLEGUNGSSTELLE zugeteitte EINGANGSNUMMER : DSM 12794 Il. WISSENSCHAFTLICHE BESCHREIBUNG UND/ODER VORGESCHLAGENE TAXONOMISCHE BEZEICHNUNG Mit dem unter 1. bezeichneten Mikroorganismus wurde (X) eine wissenschaftliche Beschreibung () eine vorgeschlagene taxonomische Bezeichnung eingereichi (Zutreffendes anl ; razen). 111. EINGANG UND ANNAHME Diese intemationale Hinterlegungsstelle nimmt den unter I bezeichneten Mikroorganismus an, der bei ihr am 19 9 9-0 4-2 8 (Datum der Ersthinterlegung)'eingegangen ist. IV. EINGANG DES AN7RAGS AUF UMWANDLUNG Der unter I bezeichnete Mikroorganismus ist bei dieser intemationalen Hinterlegungsstelle am eingegangen (Datum der Erst- hinterlegung) und ein Antrag auf Umwandlung dieser Ersthinterlegung in eine Hinterlegung gemäß Budapester Vertrag ist am eingegangen (Datum des Eingangs des Antrags auf Umwandlung). V. INTERNATIONALE HINTERLEGUNGSSTELLE Name : DSMZ-DEUTSCHE SAMMLUNG VON Unterschrift (en) der zur Vertretung der intemationalen Hinterlegungsstelle MIKROORGANISMEN UND ZELLKULTUREN GmbH befugten Person (en) oder des (der) von ihr ermxchtigten Bediensteten : Anschrift : Mascheroder Weg 16 D-38124 Braunschweig Datum : 1999-05-03 'Falls Regel 6. Buchstabe d zutrifft, ist dies der Zeitpunkt, zu dem der Status einer intemationalen Hinteriegungsstelle erworben worden ist.