NUCLEIC ACID-POL YPEPTIDE COMPOSITIONS AND USES THEREOF

CROSS-REFERENCE

[0001] This application claims the benefit of U.S . Provisional Application No. 62/316,919, filed April 1, 2016, which application is incorporated herein by reference.

SEQUENCE LISTING

[0002] The instant application contains a Sequence listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 28, 2017, is named 45532-707_601_SL.txt and is 615,666 bytes in size.

BACKGROUND OF THE DISCLOSURE

[0003] Gene suppression by RNA-induced gene silencing provides several levels of control: transcription inactivation, small interfering RNA (siRNA)-induced mRNA degradation, and siRNA -induced

transcriptional attenuation. In some instances, RNA interference (RNAi) provides long lasting effect over multiple ceil divisions. As such, RNAi represents a viable method useful for drug target validation, gene function analysis, pathway analysis, and disease therapeutics.

SUMMARY OF THE DISCLOSURE

[0004] Disclosed herein, in certain embodiments, are compositions and pharmaceutical formulations that comprise a binding moiety conjugated to a polynucleic acid molecule and a polymer. In some embodiments, also described herein include methods for treating a disease or condition (e.g., cancer) that utilize a composition or a pharmaceutical formulation comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer.

[0005] Disclosed herein, in certain embodiments, is a molecule of Formula (I):

A-X-B-Y-C

Formula I

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker; and

Y is a bond or second linker; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety.

[0006] In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2 '-O-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2' -O-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide. In some embodiments, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some embodiments, the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the at least one inverted abasic moiety is at at least one terminus.

[0007] In some embodiments, the polynucleotide comprises a single strand. In some embodiments, the polynucleotide comprises two or more strands. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double -stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises at least one modification.

[0008] In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide and the second polynucleotide are siRNA molecules.

[0009] In some embodiments, the first polynucleotide comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117. In some embodiments, the first polynucleotide consists of a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

[0010] In some embodiments, the second polynucleotide comprises a sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117. In some embodiments, the second polynucleotide consists of a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

[0011] In some embodiments, X and Y are independently a bond or a non -polymeric linker group. In some embodiments, X is a bond. In some embodiments, X is a Ci-C ₆ alkyl group. In some embodiments, Y is a Ci-C<5 alkyl group. In some embodiments, X is a homobifuctional linker or a heterobifunctional linker, optionally conjugated to a Ci-C ₆ alkyl group. In some embodiments, Y is a homobifuctional linker or a heterobifunctional linker.

[0012] In some embodiments, the binding moiety is an antibody or binding fragment thereof. In some embodiments, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single -chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some embodiments, the antibody or binding fragment thereof is an anti-EGFR antibody or binding fragment thereof.

[0013] In some embodiments, C is polyethylene glycol. In some embodiments, C has a molecular weight of about 5000 Da. [0014] In some embodiments, A-X is conjugated to the 5' end of B and Y-C is conjugated to the 3' end of B. In some embodiments, Y-C is conjugated to the 5' end of B and A-X is conjugated to the 3' end of B. In some embodiments, A-X, Y-C or a combination thereof is conjugated to an intemucleotide linkage group.

[0015] In some embodiments, the molecule further comprises D. In some embodiments, D is conjugated to C or to A.

[0016] In some embodiments, D is conjugated to the molecule of Formula (I) according to Formula (II):

(A-X-B-Y-C _n )-L-D

Formula II

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomolytic moiety; and

n is an integer between 0 and 1 ; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and D is conjugated anywhere on A, B, or C.

[0017] In some embodiments, D is INF7 or melittin.

[0018] In some embodiments, D is an endosomolytic polymer.

[0019] In some embodiments, L is a Ci-C ₆ alkyl group. In some embodiments, L is a homobifuctional linker or a heterobifunctional linker.

[0020] In some embodiments, the molecule further comprises at least a second binding moiety A. In some embodiments, the at least second binding moiety A is conjugated to A, to B, or to C. In some embodiments, the at least second binding moiety A is cholesterol.

[0021] In some embodiments, the molecule further comprises at least an additional polynucleotide B. In some embodiments, the at least an additional polynucleotide B is conjugated to A, to B, or to C.

[0022] In some embodiments, the molecule further comprises at least an additional polymer C. In some embodiments, the at least an additional polymer C is conjugated to A, to B, or to C.

[0023] Disclosed herein, in certain embodiments, is a molecule of Formula (I): A-X-B-Y-C (Formula I), wherein A is an antibody or its binding fragments thereof; B is a polynucleotide; C is a polymer; X is a bond or first non-polymeric linker; and Y is a bond or second linker; wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified intemucleotide linkage, or at least one inverted abasic moiety; and wherein A and C are not attached to B at the same terminus. In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'- deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N- methylacetamido (2'-0-NMA) modified nucleotide. In some embodiments, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (EN A). In some embodiments, the at least one modified internucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the at least one inverted abasic moiety is at at least one terminus. In some embodiments, the polynucleotide comprises a single strand. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some embodiments, the second polynucleotide comprises at least one modification. In some embodiments, the first polynucleotide and the second polynucleotide are RNA molecules. In some embodiments, the first polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956- 1962, 1967-2002, 2013-2032, 2082-2109, or 21 17. In some embodiments, the second polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 21 17. In some embodiments, Y is a non-polymeric linker group. In some embodiments, X is a bond. In some embodiments, X is a Ci-C ₆ alkyl group. In some embodiments, Y is a Ci-C ₆ alkyl group. In some embodiments, X is a homobifuctional linker or a heterobifunctional linker, optionally conjugated to a Ci-C ₆ alkyl group. In some embodiments, Y is a homobifuctional linker or a heterobifunctional linker. In some embodiments, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single -chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some embodiments, C is polyethylene glycol. In some embodiments, C has a molecular weight of about 1000 Da, 2000 Da, or 5000 Da. In some embodiments, A-X is conjugated to the 5 ' end of B and Y-C is conjugated to the 3 ' end of B. In some embodiments, Y-C is conjugated to the 5 ' end of B and A-X is conjugated to the 3 ' end of B. In some embodiments, the molecule further comprises D. In some embodiments, D is conjugated to C or to A. In some embodiments, D is conjugated to the molecule of Formula (I) according to Formula (II): (A-X-B-Y-C _c )-L-D (Formula II), wherein A is an antibody or its binding fragments thereof; B is a polynucleotide; C is a polymer; X is a bond or first non-polymeric linker; Y is a bond or second linker; L is a bond or third linker; D is an endosomolytic moiety; and c is an integer between 0 and 1 ; wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety; wherein A and C are not attached to B at the same terminus; and wherein D is conjugated anywhere on A or C or to a terminus of B. In some embodiments, D is INF7 or melittin. In some embodiments, D is an endosomolytic polymer. In some embodiments, L is a Ci-C ₆ alkyl group. In some embodiments, L is a homobifuctional linker or a heterobifunctional linker. In some embodiments, the molecule further comprises at least a second binding moiety. In some embodiments, the at least second binding moiety is conjugated to A, to B, or to C. In some embodiments, the at least second binding moiety is cholesterol. In some embodiments, the molecule further comprises at least an additional polynucleotide B. In some embodiments, the at least an additional polynucleotide B is conjugated to A, to B, or to C. In some embodiments, the molecule further comprises at least an additional polymer C. In some embodiments, the at least an additional polymer C is conjugated to A, to B, or to C.

[0024] Disclosed herein, in certain embodiments, is a pharmaceutical composition comprising a molecule described above, and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition is formulated as a nanoparticle formulation. In some embodiments, the pharmaceutical composition is formulated for parenteral, oral, intranasal, buccal, rectal, or transdermal administration.

[0025] Disclosed herein, in certain embodiments, is a method of treating a disease or disorder in a patient in need thereof, comprising administering to the patient a composition comprising a molecule described above. In some embodiments, the disease or disorder is a cancer. In some embodiments, the cancer is a solid tumor. In some embodiments, the cancer is a hematologic malignancy. In some embodiments, the cancer comprises a KRAS-associated, an EGFR-associated, an AR-associated cancer, a β-catenin associated cancer, a PIK3C-associated cancer, or a MYC-associated cancer. In some embodiments, the cancer comprises bladder cancer, breast cancer, colorectal cancer, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, or thyroid cancer. In some embodiments, the cancer comprises acute myeloid leukemia, CLL, DLBCL, or multiple myeloma. In some embodiments, the method is an immuno -oncology therapy.

[0026] Disclosed herein, in certain embodiments, is a method of inhibiting the expression of a target gene in a primary cell of a patient, comprising administering a molecule described above to the primary cell. In some embodiments, the method is an in vivo method. In some embodiments, the patient is a human.

[0027] Disclosed herein, in certain embodiments, is an immuno-oncology therapy comprising a molecule described above for the treatment of a disease or disorder in a patient in need thereof.

[0028] Disclosed herein, in certain embodiments, is a kit comprising a molecule described above.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Various aspects of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0030] Fig. lA-Fig. 1C illustrate cartoon representations of molecules described herein.

[0031] Fig. 2 illustrates a structure of cholesterol conjugate passenger strand.

[0032] Fig. 3 shows an INF7 peptide sequence (SEQ ID NO: 2055) described herein.

[0033] Fig. 4 shows a melittin peptide sequence (SEQ ID NO: 2060) described herein.

[0034] Fig. 5 illustrates an analytical HPLC of EGFR antibody-PEG20kDa-EGFR. [0035] Fig. 6 illustrates a SDS-PAGE analysis of EGFR antibody-PEG20kDa-EGFR conjugate.

[0036] Fig. 7 illustrates an analytical chromatogram of EGFR antibody-PEGlOkDa-EGFR siRNA.

[0037] Fig. 8 shows an analytical chromatogram of EGFR antibody-PEG5kDa-EGFR siRNA.

[0038] Fig. 9 shows a SDS PAGE analysis of EGFR antibody-PEGlOkDa-EGFR siRNA and EGFR antibody-PEG5kDa-EGFR siRNA conjugates.

[0039] Fig. 10 illustrates the overlay of EGFR antibody-PEGlkDa-EGFR siRNA conjugates with siRNA loading of 1, 2 and 3.

[0040] Fig. 1 1 shows a HPLC chromatogram of EGFR antibody-KRAS-PEG5kDa.

[0041] Fig. 12 shows a HPLC chromatogram of Panitumumab-KRAS-PEG5kDa.

[0042] Fig. 13 shows a HPLC chromatogram of EGFR antibody-S-S-siRNA-PEG5kDa (DAR = 1)

[0043] Fig. 14 shows a HPLC chromatogram of EGFR antibody-PEG24-Melittin (loading =~1).

[0044] Fig. 15 illustrates a HPLC chromatogram of EGFR antibody-Melittin (n=~l).

[0045] Fig. 16 illustrates a mass spectrum of EGFR antibody-Melittin (n=l).

[0046] Fig. 17 shows a HIC chromatogram of EGFR antibody-PEGlkDa-INF7 (Peptide loading =

[0047] Fig. 18 shows a HPLC chromatogram of EGFR antibody-INF7 (Peptide Loading = ~1).

[0048] Fig. 19 shows INF7-PEG lkDa-(EGFR antibody-KRAS -PEG5kDa) .

[0049] Fig. 20 illustrates Melittin-PEGlkDa-(EGFR antibody-KRAS-PEG5kDa).

[0050] Fig. 21 illustrates plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (%ID).

[0051] Fig. 22 shows plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (%ID).

[0052] Fig. 23 shows plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (%ID).

[0053] Fig. 24 illustrates plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (%ID).

[0054] Fig. 25 illustrates plasma concentration-time profiles out to 24 h post-dose with the siRNA concentration expressed as a percent of injected dose (%ID).

[0055] Fig. 26A and Fig. 26B illustrate tissue concentration-time profiles in tumor or normal livers of mice. Fig. 26A shows tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors in a mice model. Fig. 26B shows tissue concentration-time profiles out to 168h post-dose measured in normal livers of mice.

[0056] Fig. 27 shows tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.

[0057] Fig. 28 illustrates tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice. [0058] Fig. 29 illustrates tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.

[0059] Fig. 30 shows tissue concentration-time profiles out to 168 h post-dose measured in s.c. flank H358 tumors and normal livers of mice.

[0060] Fig. 31A and Fig. 3 IB illustrate siR A -mediated mRNA knockdown of human KRAS in human s.c. flank H358 tumors (Fig. 31A) or mouse KRAS in normal mouse liver (Fig. 3 IB).

[0061] Fig. 32 illustrates siRNA-mediated mRNA knockdown of human EGFR in human s.c. flank H358 tumors.

[0062] Fig. 33 illustrates siRNA-mediated mRNA knockdown of human KRAS in human s.c. flank H358 tumors.

[0063] Fig. 34 illustrates siRNA-mediated mRNA knockdown of human EGFR in human s.c. flank H358 tumors.

[0064] Fig. 35 shows siRNA-mediated mRNA knockdown of mouse KRAS in mouse liver.

[0065] Fig. 36 illustrates plasma concentration-time profiles out to 96 h post-dose with the siRNA concentration expressed as a percent of injected dose (%ID).

[0066] Fig. 37 illustrates tissue concentration-time profiles out to 144 h post-dose measured in liver, kidneys, and lungs of wild-type CD-I mice.

[0067] Fig. 38A and Fig. 38B illustrate tissue concentration-time profiles out to 144 h post-dose measured in human s.c. flank H358 tumors for chol-KRAS mixed with either chol-INF7 peptide (Fig. 38A) or chol-melittin peptide (Fig. 38B).

[0068] Fig. 39A and Fig. 39B illustrate tissue concentration-time profiles out to 144 h post-dose measured in mouse liver for chol-KRAS mixed with either chol-INF7 peptide (Fig. 39A) or chol-melittin peptide (Fig. 39B).

[0069] Fig. 40A and Fig. 40B illustrate tissue concentration-time profiles out to 144 h post-dose measured in mouse kidneys for chol-KRAS mixed with either chol-INF7 peptide (Fig. 40A) or chol-melittin peptide (Fig. 40B).

[0070] Fig. 41A and Fig. 4 IB illustrate tissue concentration-time profiles out to 144 h post-dose measured in mouse lungs for chol-KRAS mixed with either chol-INF7 peptide (Fig. 41 A) or chol-melittin peptide (Fig. 4 IB).

[0071] Fig. 42 illustrates siRNA-mediated mRNA knockdown of mouse KRAS in mouse liver.

[0072] Fig. 43A and Fig. 43B illustrate tissue concentration-time profiles out to 96 h post-dose measured in human s.c. flank H358 tumors (Fig. 43A) or mouse liver (Fig. 43B).

[0073] Fig. 44A and Fig. 44B show tissue concentration -time profiles out to 96 h post-dose measured in mouse kidneys (Fig. 44A) or mouse lungs (Fig. 44B).

[0074] Fig. 45 shows siRNA-mediated mRNA knockdown of mouse KRAS in human s.c. flank H358 tumors. [0075] Fig. 46 shows tissue concentrations of siRNA at 96 h post-dose measured in human s.c. flank H358 tumors and mouse liver, kidneys, and lungs.

[0076] Fig. 47A and Fig. 47B show siRNA-mediated mRNA knockdown in human s.c. flank H358 tumors of EGFR (Fig. 47A) or KRAS (Fig. 47B).

[0077] Fig. 48 shows siRNA-mediated mRNA knockdown of human CTNNB l in Hep3B orthotopic liver tumors.

[0078] Fig. 49 shows human alpha-Fetoprotein in serum from mice with Hep3B orthotopic liver tumors.

[0079] Fig. 50A shows siRNA-mediated mRNA knockdown of human EGFR in LNCaP tumor.

[0080] Fig. 50B shows siRNA concentration in tumor or liver tissues at 96 hour post-dose.

[0081] Fig. 51A illustrates siRNA-mediated mRNA knockdown of human EGFR in LNCaP tumor at 96 hour.

[0082] Fig. 5 IB shows siRNA concentration in tumor or liver tissues at 96 hour post-dose.

[0083] Fig. 52 shows plasma siRNA concentration of exemplary molecules described herein.

[0084] Fig. 53A illustrates siRNA concentration of exemplary molecules described herein in HCC827 tumor or liver tissue.

[0085] Fig. 53B shows EGFR EGFR mRNA expression level of exemplary molecules described herein.

[0086] Fig. 54 illustrates exemplary As and Bs to generate molecules encompassed by Formula (I).

[0087] Fig. 55 illustrates EGFR mRNA expression level of exemplary molecules described herein.

[0088] Fig. 56A illustrates siRNA concentration of exemplary molecules described herein in HCC827 tumor or liver tissue.

[0089] Fig. 56B shows EGFR mRNA expression level of exemplary molecules described herein.

[0090] Fig. 57A-Fig. 57B illustrate siRNA concentration of exemplary molecules described herein in liver (Fig. 57A) and tumor (Fig. 57B).

[0091] Fig. 57C shows KRAS mRNA expression level of exemplary molecules described herein.

[0092] Fig. 58A illustrates plasma siRNA concentration of exemplary molecules described herein.

[0093] Fig. 58B shows plasma antibody concentration of exemplary molecules described herein.

[0094] Fig. 59A illustrates siRNA concentration of exemplary molecules described herein in tumor or liver tissue.

[0095] Fig. 59B shows mRNA expression level of exemplary molecules described herein in Hep3B tumor.

[0096] Fig. 60 shows CTNNB l mRNA expression level of an exemplary molecule described herein in liver.

[0097] Fig. 61 shows KRAS mRNA expression level of an exemplary molecule described herein in liver.

[0098] Fig. 62 illustrates plasma siRNA or monoclonal antibody (mAb) concentration of exemplary molecules described herein. [0099] Fig. 63A illustrates siRNA concentration of exemplary molecules described herein in tumor or liver tissue.

[0100] Fig. 63B shows EGFR mRNA expression level of exemplary molecules described herein in LNCaP tumor.

[0101] Fig. 64A-Fig. 64E illustrate HPRT mRNA expression level in heart (Fig. 64A), HPRT mRNA expression level in gastrointestinal tissue (Fig. 64B), HPRT mRNA expression level in liver (Fig. 64C), HPRT mRNA expression level in lung (Fig. 64D), and siRNA concentration in tissue (Fig. 64E) of exemplary molecules described herein.

[0102] Fig. 65A-Fig. 65E illustrate mRNA expression level in heart (Fig. 65A), mRNA expression level in gastrointestinal tissue (Fig. 65B), mRNA expression level in liver (Fig. 65C), mRNA expression level in lung (Fig. 65D), and siRNA concentration in tissue (Fig. 65E) of exemplary molecules described herein.

[0103] Fig. 66A-Fig. 66D illustrate siRNA concentration in heart (Fig. 66A), mRNA expression level in heart (Fig. 66B), mRNA expression level in gastrointestinal tissue (Fig. 66C), and siRNA concentration in muscle (Fig. 66D).

[0104] Fig. 67A illustrate mRNA expression level of exemplary molecules described herein.

[0105] Fig. 67B shows siRNA concentration of exemplary molecules described herein in tumor or liver tissues.

[0106] Fig. 68A-Fig. 68B illustrate anti-B cell antibody-siRNA conjugates which activate primary mouse B cells. Fig. 68A illustrates an anti-B cell Fab-siRNA conjugate. Fig. 68B shows an anti-B cell monoclonal antibody-siRNA conjugate.

[0107] Fig. 69A illustrates plasma siRNA concentration of exemplary molecules described herein.

[0108] Fig. 69B shows antibody zalutumumab concentration of exemplary molecules described herein in the plasma at a 5 mg/kg dose.

[0109] Fig. 70A shows mRNA expression level of exemplary molecules described herein.

[0110] Fig. 70B shows siRNA concentration of exemplary molecules described herein in tumor or liver tissues.

[0111] Fig. 70C shows plasma siRNA concentration of exemplary molecules described herein.

[0112] Fig. 71A illustrates siRNA concentration of exemplary molecules described herein in LNCaP tomor.

[0113] Fig. 7 IB-Fig. 71C illustrate mRNA expression level of exemplary molecules described herein in LNCaP tomor.

[0114] Fig. 72A illustrates siRNA concentration of exemplary molecules described herein in tissue.

[0115] Fig. 72B shows mRNA expression level of exemplary molecules described herein in HCC827 tumors at 96 h post-treatment.

[0116] Fig. 73A illustrates siRNA concentration of exemplary molecules described herein in the plasma at a 0.5 mg/kg dose. [0117] Fig. 73B shows antibody zalutumumab concentration of exemplary molecules described herein in the plasma at a 5 mg/kg dose.

[0118] Fig. 74 illustrates plasma clearance of exemplary molecules encompassed by Formula (I) which contains different linkers.

[0119] Fig. 75A illustrates the mRNA expression level of exemplary molecules described herein in HCC827 tumor at a 0.5 mg/kg dose.

[0120] Fig. 75B-Fig. 75D illustrate siRNA concentration in tumor (Fig. 75B), liver (Fig. 75C), and plasma (Fig. 75D).

[0121] Fig. 76A-Fig. 76D illustrate mRNA expression levels of exemplary molecules described herein targeting HPRT. Fig. 76A shows the mRNA expression level in heart. Fig. 76B shows the mRNA expression level in muscle. Fig. 76C shows the mRNA expression level in liver. Fig. 76D shows the mRNA expression level in lung.

[0122] Fig. 77A-Fig. 77D illustrate siRNA concentrations of exemplary molecules encompassed by Formula (I) in muscle (Fig. 77A), heart (Fig. 77B), liver (Fig. 77C), and lung (Fig. 77D).

[0123] Fig. 78A-Fig 78D illustrate mRNA expression levels of exemplary molecules encompassed by Formula (I) in heart (Fig. 78A), gastrointestinal tissue (Fig. 78B), liver (Fig. 78C), and lung (Fig. 78D) at 96 h post-treatment.

[0124] Fig. 79 illustrates plasma siRNA concentration of exemplary molecules encompassed by Formula (I).

[0125] Fig. 80A shows mRNA expression level of exemplary molecules encompassed by Formula (I) in LNCaP tumor at 96 h post-treatment.

[0126] Fig. 80B shows siRNA concentration of exemplary molecules encompassed by Formula (I) in LNCaP tumor, liver, kidney, lung, and spleen tissue samples.

[0127] Fig. 81A shows mRNA expression level of exemplary molecules encompassed by Formula (I) in HCC827 tumor at 96 h post-treatment.

[0128] Fig. 8 IB illustrates siRNA concentrations of exemplary molecules encompassed by Formula (I) in tumor, liver, kidney, lung, and spleen tissue samples.

[0129] Fig. 82 illustrates plasma siRNA concentration of exemplary molecules encompassed by Formula (I).

[0130] Fig. 83 illustrates plasma siRNA concentration of exemplary molecules encompassed by Formula (I).

[0131] Fig. 84 illustrates mRNA expression levels of exemplary molecules encompassed by Formula (I) in HCC827 tumor at 96 h post treatment.

[0132] Fig. 85 illustrates siRNA concentration in HCC827 tumor or liver tissues at 96 hour post-dose.

[0133] Fig. 86 illustrates the relative mRNA expression levels of exemplary molecules encompassed by Formula (I) in mouse splenic B cells 48 h post treatment. Each exemplary molecule is further denoted with a number. [0134] Fig. 87 illustrates stability of exemplary molecules encompassed by Formula (I) (or ASCs) in mouse plasma.

DETAILED DESCRIPTION OF THE DISCLOSURE

[0135] Nucleic acid (e.g., RNAi) therapy is a targeted therapy with high selectivity and specificity.

However, in some instances, nucleic acid therapy is also hindered by poor intracellular uptake, limited blood stability and non-specific immune stimulation. To address these issues, various modifications of the nucleic acid composition are explored, such as for example, novel linkers for better stabilizing and/or lower toxicity, optimization of binding moiety for increased target specificity and/or target delivery, and nucleic acid polymer modifications for increased stability and/or reduced off -target effect.

[0136] In some embodiments, the arrangement or order of the different components that make-up the nucleic acid composition further effects intracellular uptake, stability, toxicity, efficacy, and/or non-specific immune stimulation. For example, if the nucleic acid component includes a binding moiety, a polymer, and a polynucleic acid molecule (or polynucleotide), the order or arrangement of the binding moiety, the polymer, and/or the polynucleic acid molecule (or polynucleotide) (e.g., binding moiety-polynucleic acid molecule-polymer, binding moiety-polymer-polynucleic acid molecule, or polymer-binding moiety- polynucleic acid molecule) further effects intracellular uptake, stability, toxicity, efficacy, and/or nonspecific immune stimulation.

[0137] In some embodiments, described herein include a molecule those arrangement of the nucleic acid components effects intracellular uptake, stability, toxicity, efficacy, and/or non-specific immune stimulation. In some instances, the molecule comprises a binding moiety conjugated to a polynucleic acid molecule and a polymer. In some embodiments, the molecule comprises a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some instances, the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some instances, the molecule of Formula (I) further comprises D, an endosomolytic moiety.

[0138] In some embodiments, a molecule comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer arranged as described herein enhances intracellular uptake, stability, and/or efficacy. In some instances, a molecule comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer arranged as described herein reduces toxicity and/or non-specific immune stimulation. In some cases, the molecule comprises a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some instances, the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some instances, the molecule of Formula (I) further comprises D, an endosomolytic moiety.

[0139] In some embodiments, a molecule described herein is further used to treat a disease or disorder. In some instances, a molecule for the treatment of a disease or disorder is a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some instances, the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some instances, the molecule of Formula (I) further comprises D, an endosomolytic moiety.

[0140] In some embodiments, a molecule described herein is also used for inhibiting the expression of a target gene in a primary cell of a patient in need thereof. In such instances, a molecule for such use is a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some instances, the

polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some instances, the molecule of Formula (I) further comprises D, an endosomolytic moiety.

[0141] In some embodiments, a molecule described herein is additionally used as an immuno -oncology therapy for the treatment of a disease or disorder. In some instance, the molecule is a molecule according to Formula (I): A-X-B-Y-C; in which A is a binding moiety, B is a polynucleotide, C is a polymer, X is a bond or first linker, and Y is a bond or second linker. In some instances, the polynucleotide comprises at least one 2' modified nucleotide, at least one modified internucleotide linkage, or at least one inverted abasic moiety. In some instances, the molecule of Formula (I) further comprises D, an endosomolytic moiety.

[0142] In additional embodiments, described herein include a kit, which comprises one or more of the molecules described herein.

Therapeutic Molecule Platform

[0143] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a binding moiety conjugated to a polynucleic acid molecule and a polymer. In some embodiments, a molecule (e.g., a therapeutic molecule) comprises a molecule according to Formula (I):

A-X-B-Y-C

Formula I

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker; and

Y is a bond or second linker; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

internucleotide linkage, or at least one inverted abasic moiety.

[0144] In some instances, the molecule of Formula (I) further comprises D, an endosomolytic moiety.

[0145] In some embodiments, at least one A and/or at least one C are conjugated to the 5' terminus of B, the 3' terminus of B, an internal site on B, or in any combinations thereof. In some instances, at least one A is conjugated at one terminus of B while at least one C is conjugated at the opposite terminus of B. In some instances, at least one of A is conjugated at one terminus of B while at least one of C is conjugated at an internal site on B.

[0146] In some cases, A and C are not conjugated or attached to B at the same terminus. In some cases, A is attached or conjugated to B at a first terminus of B. In some cases, C is attached or conjugated to B at a second terminus of B, and the second terminus of B is different than the first terminus. In some cases, A is attached or conjugated to B at the 5' terminus of B, and C is attached or conjugated to B at the 3' terminus of B. In other cases, A is attached or conjugated to B at the 3' terminus of B, and C is attached or conjugated to B at the 5' terminus of B.

[0147] In some embodiments, A is an antibody or binding fragment thereof. In some cases, C is a polymer. In some cases, A and C are not conjugated or attached to B at the same terminus. In some cases, A is attached or conjugated to B at a first terminus of B. In some cases, C is attached or conjugated to B at a second terminus of B, and the second terminus of B is different than the first terminus. In some cases, A is attached or conjugated to B at the 5' terminus of B, and C is attached or conjugated to B at the 3' terminus of B. In other cases, A is attached or conjugated to B at the 3' terminus of B, and C is attached or conjugated to B at the 5' terminus of B. In some cases, X which connects A to B is a bond or a non -polymeric linker. In some cases, X is a non-peptide linker (or a linker that does not comprise an amino acid residue). In some cases, Y which connects B to C is a bond or a second linker. In some instances, X connects A to the 5 ' terminus of B, and Y connects C to the 3' terminus of B. In other instances, X connects A to the 3' terminus of B, and Y connects C to the 5' terminus of B.

[0148] In some embodiments, X-B is conjugated or attached to the N-terminus, C-terminus, a constant region, a hinge region, or a Fc region of A. In some instances, X-B is conjugated or attached to the N- terminus of A. In some instances, X-B is conjugated or attached to the C-terminus of A. In some instances, X-B is conjugated or attached to a hinge region of A. In some instances, X-B is conjugated or attached to a constant region of A. In some instances, X-B is conjugated or attached to the Fc region of A.

[0149] In some instances, at least one B and/or at least one C, and optionally at least one D are conjugated to a first A. In some instances, the at least one B is conjugated at a terminus (e.g., a 5' terminus or a 3' terminus) to the first A or are conjugated via an internal site to the first A. In some cases, the at least one C is conjugated either directly to the first A or indirectly via the two or more Bs. If indirectly via the two or more Bs, the two or more Cs are conjugated either at the same terminus as the first A on B, at opposing terminus from the first A, or independently at an internal site. In some instances, at least one additional A is further conjugated to the first A, to B, or to C. In additional instances, the at least one D is optionally conjugated either directly or indirectly to the first A, to the at least one B, or to the at least one C. If directly to the first A, the at least one D is also optionally conjugated to the at least one B to form a A-D-B conjugate or is optionally conjugated to the at least one B and the at least one C to form a A-D-B-C conjugate. In some cases, the at least one additional A is different than the first A. [0150] In some cases, two or more Bs and/or two or more Cs are conjugated to a first A. In some instances, the two or more Bs are conjugated at a terminus (e.g., a 5' terminus or a 3' terminus) to the first A or are conjugated via an internal site to the first A. In some instances, the two or more Cs are conjugated either directly to the first A or indirectly via the two or more Bs. If indirectly via the two or more Bs, the two or more Cs are conjugated either at the same terminus as the first A on B, at opposing terminus from the first A, or independently at an internal site. In some instances, at least one additional A is further conjugated to the first A, to two or more Bs, or to two or more Cs. In additional instances, at least one D is optionally conjugated either directly or indirectly to the first A, to the two or more Bs, or to the two or more Cs. If indirectly to the first A, the at least one D is conjugated to the first A through the two or more Bs, through the two or more Cs, through a B-C orientation to form a A-B-C-D type conjugate, or through a C-B orientation to form a A-C-B-D type conjugate. In some cases, the at least one additional A is different than the first A. In some cases, the two or more Bs are different. In other cases, the two or more Bs are the same. In some instances, the two or more Cs are different. In other instances, the two or more Cs are the same. In additional instances, the two or more Ds are different. In additional instances, the two or more Ds are the same.

[0151] In other cases, two or more Bs and/or two or more Ds, optionally two or more Cs are conjugated to a first A. In some instances, the two or more Bs are conjugated at a terminus (e.g., a 5' terminus or a 3' terminus) to the first A or are conjugated via an internal site to the first A. In some instances, the two or more Ds are conjugated either directly to the first A or indirectly via the two or more Bs. If indirectly via the two or more Bs, the two or more Ds are conjugated either at the same terminus as the first A on B, at opposing terminus from the first A, or independently at an internal site. In some instances, at least one additional A is further conjugated to the first A, to the two or more Bs, or to the two or more Ds. In additional instances, the two or more Cs are optionally conjugated either directly or indirectly to the first A, to the two or more Bs, or to the two or more Ds. In some cases, the at least one additional A is different than the first A. In some cases, the two or more Bs are different. In other cases, the two or more Bs are the same. In some instances, the two or more Cs are different. In other instances, the two or more Cs are the same. In additional instances, the two or more Ds are different. In additional instances, the two or more Ds are the same.

[0152] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a molecule according to Formula (II):

(A-X-B-Y-C _c )-L-D

Formula II

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker; Y is a bond or second linker;

L is a bond or third linker;

D is an endosomolytic moiety; and

c is an integer between 0 and 1 ; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety; and D is conjugated anywhere on A, B, or C.

[0153] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a molecule according to Formula (III):

A _a -X-B _b -Y-C _c -L-D _n

Formula III

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

D is an endosomolytic moiety;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

a and b are independently an integer between 1 -3;

c is an integer between 0 and 3; and

n is an integer between 0 and 10; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety; A is conjugated anywhere on B, C, or D; B is conjugated anywhere on A, C, or D; C is conjugated anywhere on A, B, or D; and D is conjugated anywhere on A, B, or C.

[0154] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a molecule according to Formula (Ilia): A-X-B-L-D-Y-C.

[0155] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a molecule according to Formula (Illb): A _a -X-B _b -L-D _n .

[0156] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a molecule according to Formula (IV):

A-X-(B _b -Y-C _c -L-D _n ) _m

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

D is an endosomolytic moiety; X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

a and b are independently an integer between 1 -3;

c is an integer between 0 and 3;

n is an integer between 0 and 10; and

m is an integer between 1-3; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety; C is conjugated anywhere on B or D; and D is conjugated anywhere on B or C.

[0157] In some embodiments, a molecule (e.g., a therapeutic molecule) described herein comprises a molecule according to Formula (IVa): A-X-(B _b - L-D _n -Y-C _c ) _m .

[0158] In some embodiment, a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in Fig. 1. In some instances, a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in Fig. 1A. In some cases, a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in Fig. IB. In additional cases, a molecule (e.g., a therapeutic molecule) described herein is a molecule as illustrated in Fig. 1C.

iments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

A-B-C

[0160] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

A-B-D-C

[0161] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

A-D-B-C diments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

D-A-B-C

[0164] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0165] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

A-C-B

diments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

A-B-(D) _n embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0168] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0170] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated: olecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0172] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated: [0173] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0174] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0175] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

[0176] In some embodiments, a molecule (e.g., a therapeutic molecule) is a molecule as illustrated:

for representation purposes only and encompasses a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single -chain variable fragment (scFv), diabody, minibody, nanobody, single-domain antibody (sdAb), or camelid antibody or binding fragment thereof.

Polynucleic Acid Molecule Targets

[0178] In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule (or polynucleotide) that hybridizes to a target region on an oncogene. In some instances, oncogenes are further classified into several categories: growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, and transcription factors. Exemplary growth factors include c-Sis. Exemplary receptor tyrosine kinases include epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR), and HER2/neu. Exemplary cytoplasmic tyrosine kinases include Src-family tyrosine kinases, Syk-ZAP-70 family of tyrosine kinases, BTK family of tyrosine kinases, and Abl gene in CML. Exemplary cytoplasmic serine/threonine kinases include Raf kinase and cyclin-dependent kinases. Exemplary regulatory GTPases include Ras family of proteins such as KRAS. Exemplary transcription factors include MYC gene. In some instances, an oncogene described herein comprises an oncogene selected from growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, or transcription factors. In some embodiments, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of an oncogene selected from growth factors or mitogens, receptor tyrosine kinases, cytoplasmic tyrosine kinases, cytoplasmic serine/threonine kinases, regulatory GTPases, or transcription factors.

[0179] In some embodiments, an oncogene described herein comprises Abl, AKT-2, ALK, AMLl (or RUNXl), AR, AXL, BCL-2, 3, 6, BRAF, c-MYC, EGFR, ErbB-2 (Her2, Neu), Fms, FOS, GLI1, HPRTl, IL-3, INTS2, JUN KIT, KS3, K-sam, LBC (AKAP13), LCK, LMOl, LM02, LYL1, MAS1, MDM2, MET, MLL (KMT 2 A), MOS, MYB, MYH11/CBFB, NOTCH 1 (TANl), NTRK1 (TRK), OST (SLC51B), PAX5, PIM1, PRAD-1, RAF, RAR/PML, HRAS, KRAS, NRAS, REL/NRG, RET, ROS, SKI, SRC, TIAMl, or TSC2. In some embodiments, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of Abl, AKT-2, ALK, AMLl (or RUNXl), AR, AXL, BCL-2, 3, 6, BRAF, c-MYC, EGFR, ErbB-2 (Her 2, Neu), Fms, FOS, GUI, HPRTl, IL-3, INTS2, JUN, KIT, KS3, K-sam, LBC (AKAP13), LCK, LMOl, LM02, LYL1, MAS1, MDM2, MET, MLL (KMT2A), MOS, MYB, MYH11/CBFB, NOTCH1 (TANl), NTRK1 (TRK), OST (SLC51B), PAX5, PIM1, PRAD-1, RAF, RAR/PML, HRAS, KRAS, NRAS, REL/NRG, RET, ROS, SKI, SRC, TIAMl, or TSC2.

[0180] In some embodiments, an oncogene described herein comprises KRAS, EGFR, AR, HPRTl, CNNTB1 (β-catenin), or β-catenin associated genes. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of KRAS, EGFR, AR, HPRTl, CNNTB1 (β- catenin), or β-catenin associated genes. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of KRAS. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of EGFR. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of AR. In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of CNNTB1 (β-catenin). In some embodiments, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of CNNTBl (β-catenin) associated genes. In some instances, the β-catenin associated genes comprise PIK3CA, PIK3CB, wAMyc. In some instances, the polynucleic acid molecule B is a polynucleic acid molecule that hybridizes to a target region of HPRTl . Polynucleic Acid Molecules That Target Kirsten Rat Sarcoma Viral Oncogene Homolog (KRAS)

[0181] Kirsten Rat Sarcoma Viral Oncogene Homolog (also known as GTPase KRas, V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog, or KRAS) is involved in regulating cell division. The K-Ras protein is a GTPase belonging to the Ras superfamily. In some instances, K-Ras modulates cell cycle progression, as well as induces growth arrest, apoptosis, and replicative senescence under different environmental triggers (e.g., cellular stress, ultraviolet, heat shock, or ionizing irradiation). In some cases, wild type KRAS gene has been shown to be frequently lost during tumor progression in different types of cancer, while mutations of KRAS gene have been linked to cancer development. In some instances, KRAS amplification has also been implicated in cancer development (see, for example, Valtorta et al. "KRAS gene amplification in colorectal cancer and impact on response to EGFR-targeted therapy," Int. J. Cancer 133: 1259-1266 (2013)). In such cases, the cancer pertains to a refractory cancer in which the patient has acquired resistance to a particular inhibitor or class of inhibitors.

[0182] In some embodiments, the KRAS gene is wild type or comprises a mutation. In some instances, KRAS mRNA is wild type or comprises a mutation. In some instances, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of wild type KRAS DNA or RNA In some instances, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of KRAS DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).

[0183] In some embodiments, KRAS DNA or RNA comprises one or more mutations. In some embodiments, KRAS DNA or RNA comprises one or more mutations at codons 12 or 13 in exon 1. In some instances, KRAS DNA or RNA comprises one or more mutations at codons 61, 63, 117, 119, or 146. In some instances, KRAS DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 12, 13, 18, 19, 20, 22, 24, 26, 36, 59, 61, 63, 64, 68, 110, 116, 117, 119, 146, 147, 158, 164, 176, or a combination thereof of the KRAS polypeptide. In some embodiments, KRAS DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from G12V, G12D, G12C, G12A, G12S, G12F, G13C, G13D, G13V, A18D, L19F, T20R, Q22K, I24N, N26K, I36L, I36M, A59G, A59E, Q61K, Q61H, Q61L, Q61R, E63K, Y64D, Y64N, R68S, P110S, K117N, C118S, A146T, A146P, A146V, K147N, T158A, R164Q, K176Q, or a combination thereof of the KRAS polypeptide.

[0184] In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at codons 12 or 13 in exon 1. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at codons 61, 63, 117, 119, or 146. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 12, 13, 18, 19, 20, 22, 24, 26, 36, 59, 61, 63, 64, 68, 110, 116, 117, 119, 146, 147, 158, 164, 176, or a combination thereof of the KRAS polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of KRAS DNA or RNA comprising one or more mutations corresponding to amino acid residues selected from G12V, G12D, G12C, G12A, G12S, G12F, G13C, G13D, G13V, A18D, L19F, T20R, Q22K, I24N, N26K, I36L, I36M, A59G, A59E, Q61K, Q61H, Q61L, Q61R, E63K, Y64D, Y64N, R68S, PI 10S, Kl 17N, CI 18S, A146T, A146P, A146V, K147N, T158A, R164Q, K176Q, or a combination thereof of the KRAS polypeptide.

Polynucleic Acid Molecules That Target Epidermal Growth Factor Receptor (EGFR)

[0185] Epidermal growth factor receptor (EGFR, ErbB-1, or HER1) is a transmembrane tyrosine kinase receptor and a member of the ErbB family of receptors, which also include HER2/c-neu (ErbB-2), Her3 (ErbB-3) and Her4 (ErbB-4). In some instances, EGFR mutations drive the downstream activation of RAS/RAF/MAPK, PI3K/AKT, and/or JAK/STAT pathways, leading to mitosis, cell proliferation, and suppression of apoptosis. In addition, amplification of wild-type EGFR gene has been implicated in the development of cancers such as glioblastomas and non-small cell lung cancer (Talasila, et al., "EGFR Wild- type Amplification and Activation Promote Invasion and Development of Glioblastoma Independent of Angiogenesis," Acta Neuropathol. 125(5): 683-698 (2013); Beli ef al, "Epidermal Growth Factor Receptor Mutations and Gene Amplification in Non-Small-Cell Lung Cancer: Molecular Analysis of the

IDEAL/INTACT Gefitinib Trials," J Clinical Oncology 23(31): 8081-8092 (2005)).

[0186] In some embodiments, EGFR DNA or RNA is wild type EGFR or EGFR comprising a mutation. In some instances, EGFR is wild type EGFR. In some instances, EGFR DNA or RNA comprises a mutation. In some instances, the polynucleic acid molecule hybridizes to a target region of wild type EGFR DNA or RNA. In some instances, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).

[0187] In some instances, EGFR DNA or RNA comprises one or more mutations. In some

embodiments, EGFR DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 18, exon 19, exon 20, exon 21 or exon 22. In some instances, EGFR DNA or RNA comprises one or more mutations in exon 18, exon 19, exon 20, exon 21, exon 22 or a combination thereof.

[0188] In some instances, EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 34, 38, 45, 62, 63, 77, 78, 108, 114, 120, 140, 148, 149, 160, 177, 178, 189, 191, 198, 220, 222, 223, 229, 237, 240, 244, 252, 254, 255, 256, 263, 270, 273, 276, 282, 288, 289, 301, 303, 304, 309, 314, 326, 331, 354, 363, 373, 337, 380, 384, 393, 427, 428, 437, 441, 447, 465, 475, 515, 526, 527, 531, 536, 541, 546, 571, 588, 589, 596, 596, 598, 602, 614, 620, 628, 636, 641, 645, 651, 671, 689, 694, 700, 709, 712, 714, 715, 716, 719, 720, 721, 731, 733, 739-744, 742, 746-750, 746-752, 746, 747, 747-749, 747-751, 747-753, 751, 752, 754, 752-759, 750, 761-762, 761, 763, 765, 767-768, 767-769, 768, 769, 769-770, 770-771, 772, 773-774, 773, 774, 774-775, 776, 779, 783, 784, 786, 790, 792, 794, 798, 803, 805, 807, 810, 826, 827, 831, 832, 833, 835, 837, 838, 839, 842, 843, 847, 850, 851, 853, 854, 856, 858, 861, 863, 894, 917, 967, 1006, 1019, 1042, 1100, 1129, 1141, 1153, 1164, 1167, or a combination thereof of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 747, 761, 790, 854, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 761, 790, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 747 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 761 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 790 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 854 of the EGFR polypeptide. In some embodiments, EGFR DNA or RNA comprises a mutation at a position corresponding to amino acid residue 858 of the EGFR polypeptide.

[0189] In some embodiments, EGFR DNA or RNA comprises one or more mutations selected from T34M, L38V, E45Q, L62R, G63R, G63K, S77F, F78L, R108K, R108G, E114K, A120P, L140V, V148M, R149W, E160K, S 177P, M178I, K189T, D191N, S198R, S220P, R222L, R222C, S223Y, S229C, A237Y, C240Y, R244G, R252C, R252P, F254I, R255 (nonsense mutation), D256Y, T263P, Y270C, T273A, Q276 (nonsense), E282K, G288 (frame shift), A289D, A289V, A289T, A289N, A289D, V301 (deletion), D303H, H304Y, R309Q, D314N, C326R, G331R, T354M, T363I, P373Q, R337S, S380 (frame shift), T384S, D393Y, R427L, G428S, S437Y, V441I, S447Y, G465R, I475V, C515S, C526S, R527L, R531 (nonsense), V536M, L541I, P546Q, C571S, G588S, P589L, P596L, P596S, P596R, P596L, G598V, G598A, E602G, G614D, C620Y, C620W, C628Y, C628F, C636Y, T638M, P641H, S645C, V651M, R671C, V689M, P694S, N700D, E709A, E709K, E709Q, E709K, F712L, K714N, I715S, K716R, G719A, G719C, G719D, G719S, S720C, S720F, G721V, W731Stop, P733L, K739-I744 (insertion), V742I, V742A, E746-A750 (deletion), E746K, L747S, L747-E749 (deletion), L747-T751 (deletion), L747-P753 (deletion), G746-S752 (deletion), T751I, S752Y, K754 (deletion), S752-I759 (deletion), A750P, D761-E762 (e.g., residues EAFQ insertion (SEQ ID NO: 2110)), D761N, D761Y, A763V, V765A, A767-S768 (e.g., residues TLA insertion), A767-V769 (e.g., residues ASV insertion), S768I, S768T, V769L, V769M, V769-D770 (e.g., residue Y insertion), 770-771 (e.g., residues GL insertion), 770-771 (e.g., residue G insertion), 770-771 (e.g., residues CV insertion), 770-771 (e.g., residues SVD insertion), P772R, 773-774 (e.g., residues NPH insertion), H773R, H773L, V774M, 774-775 (e.g., residues HV insertion), R776H, R776C, G779F, T783A, T784F, T854A, V786L, T790M, L792P, P794H, L798F, R803W, H805R, D807H, G810S, N826S, Y827

(nonsense), R831H, R832C, R832H, L833F, L833V, H835L, D837V, L838M, L838P, A839V, N842H, V843L, T847K, T847I, H850N, V851A, I853T, F856L, L858R, L858M, L861Q, L861R, G863D, Q894L, G917A, E967A, D1006Y, P1019L, S 1042N, Rl 100S, HI 129Y, T1141S, S I 1531, Q1164R, L1167M, or a combination thereof of the EGFR polypeptide.

[0190] In some instances, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations in exon 18, exon 19, exon 20, exon 21, exon 22 or a combination thereof.

[0191] In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 34, 38, 45, 62, 63, 77, 78, 108, 1 14, 120, 140, 148, 149, 160, 177, 178, 189, 191, 198, 220, 222, 223, 229, 237, 240, 244, 252, 254, 255, 256, 263, 270, 273, 276, 282, 288, 289, 301, 303, 304, 309, 314, 326, 331, 354, 363, 373, 337, 380, 384, 393, 427, 428, 437, 441, 447, 465, 475, 515, 526, 527, 531, 536, 541, 546, 571, 588, 589, 596, 596, 598, 602, 614, 620, 628, 636, 641, 645, 651, 671, 689, 694, 700, 709, 712, 714, 715, 716, 719, 720, 721, 731, 733, 739-744, 742, 746-750, 746-752, 746, 747, 747-749, 747-751, 747-753, 751, 752, 754, 752-759, 750, 761-762, 761, 763, 765, 767-768, 767-769, 768, 769, 769-770, 770-771, 772, 773-774, 773, 774, 774-775, 776, 779, 783, 784, 786, 790, 792, 794, 798, 803, 805, 807, 810, 826, 827, 831, 832, 833, 835, 837, 838, 839, 842, 843, 847, 850, 851, 853, 854, 856, 858, 861, 863, 894, 917, 967, 1006, 1019, 1042, 1 100, 1 129, 1 141, 1 153, 1 164, 1 167, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 747, 761, 790, 854, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 761, 790, 858, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 747 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 761 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 790 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 854 of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising a mutation at a position corresponding to amino acid residue 858 of the EGFR polypeptide.

[0192] In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from T34M, L38V, E45Q, L62R, G63R, G63K, S77F, F78L, R108K, R108G, E1 14K, A120P, L140V, V148M, R149W, E160K, S 177P, M178I, K189T, D 191N, S 198R, S220P, R222L, R222C, S223Y, S229C, A237Y, C240Y, R244G, R252C, R252P, F254I, R255 (nonsense mutation), D256Y, T263P, Y270C, T273A, Q276 (nonsense), E282K, G288 (frame shift), A289D, A289V, A289T, A289N, A289D, V301 (deletion), D303H, H304Y, R309Q, D314N, C326R, G331R, T354M, T363I, P373Q, R337S, S380 (frame shift), T384S, D393Y, R427L, G428S, S437Y, V441I, S447Y, G465R, I475V, C515S, C526S, R527L, R531 (nonsense), V536M, L541I, P546Q, C571 S, G588S, P589L, P596L, P596S, P596R, P596L, G598V, G598A, E602G, G614D, C620Y, C620W, C628Y, C628F, C636Y, T638M, P641H, S645C, V651M, R671C, V689M, P694S, N700D, E709A, E709K, E709Q, E709K, F712L, K714N, I715S, K716R, G719A, G719C, G719D, G719S, S720C, S720F, G721V, W731Stop, P733L, K739-I744 (insertion), V742I, V742A, E746-A750 (deletion), E746K, L747S, L747-E749

(deletion), L747-T751 (deletion), L747-P753 (deletion), G746-S752 (deletion), T751I, S752Y, K754 (deletion), S752-I759 (deletion), A750P, D761-E762 (e.g., residues EAFQ insertion (SEQ ID NO: 2110)), D761N, D761Y, A763V, V765A, A767-S768 (e.g., residues TLA insertion), A767-V769 (e.g., residues ASV insertion), S768I, S768T, V769L, V769M, V769-D770 (e.g., residue Y insertion), 770-771 (e.g., residues GL insertion), 770-771 (e.g., residue G insertion), 770-771 (e.g., residues CV insertion), 770-771 (e.g., residues SVD insertion), P772R, 773-774 (e.g., residues NPH insertion), H773R, H773L, V774M, 774-775 (e.g., residues HV insertion), R776H, R776C, G779F, T783A, T784F, T854A, V786L, T790M, L792P, P794H, L798F, R803W, H805R, D807H, G810S, N826S, Y827 (nonsense), R831H, R832C, R832H, L833F, L833V, H835L, D837V, L838M, L838P, A839V, N842H, V843L, T847K, T847I, H850N, V851A, I853T, F856L, L858R, L858M, L861Q, L861R, G863D, Q894L, G917A, E967A, D1006Y, P1019L, S1042N, R1100S, H1129Y, T1141S, S 1153I, Q1164R, L1167M, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from L747S, D761Y, T790M, T854A, L858R, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising one or more mutations selected from D761Y, T790M, L858R, or a combination thereof of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation L747S of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation D761Y of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation T790M of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation T854A of the EGFR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of EGFR DNA or RNA comprising mutation L858R of the EGFR polypeptide.

Polynucleic Acid Molecules That Target Androgen Receptor (AR)

[0193] Androgen receptor (AR) (also known as NR3C4, nuclear receptor subfamily 3, group C, gene 4) belongs to the steroid hormone group of nuclear receptor superfamily along with related members: estrogen receptor (ER), glucocorticoid receptor (GR), progesterone receptor (PR), and mineralocorticoid receptor (MR). Androgens, or steroid hormones, modulate protein synthesis and tissue remodeling through the androgen receptor. The AR protein is a ligand-inducible zinc finger transcription factor that regulates target gene expression. The presence of mutations in the AR gene has been observed in several types of cancers (e.g., prostate cancer, breast cancer, bladder cancer, or esophageal cancer), and in some instances, has been linked to metastatic progression.

[0194] In some embodiments, AR DNA or R A is wild type or comprises one or more mutations and/or splice variants. In some instances, AR DNA or RNA comprises one or more mutations. In some instances, AR DNA or RNA comprises one or more splice variants selected from AR splice variants including but not limited to ARl/2/2b, ARV2, ARV3, ARV4, ARl/2/3/2b, ARV5, ARV6, ARV7, ARV9, ARV10, ARV11, ARV12, ARV13, ARV14, ARV15, ARV16, and ARV(v567es). In some instances, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition) or a splice variant.

[0195] In some embodiments, AR DNA or RNA comprises one or more mutations. In some

embodiments, AR DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, or exon 8. In some embodiments, AR DNA or RNA comprises one or more mutations within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8 or a combination thereof. In some instances, AR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 2, 14, 16, 29, 45, 54, 57, 64, 106, 112, 176, 180, 184, 194, 198, 204, 214, 221, 222, 233, 243, 252, 255, 266, 269, 287, 288, 334, 335, 340, 363, 368, 369, 390, 403, 443, 491, 505, 513, 524, 524, 528, 533, 547, 548, 564, 567, 568, 574, 547, 559, 568, 571, 573, 575, 576, 577, 578, 579, 580, 581, 582, 585, 586, 587, 596, 597, 599, 601, 604, 607, 608, 609, 610, 611, 615, 616, 617, 619, 622, 629, 630, 638, 645, 647, 653, 662, 664, 670, 671, 672, 674, 677, 681, 682, 683, 684, 687, 688, 689, 690, 695, 700, 701, 702, 703, 705, 706, 707, 708, 710, 711, 712, 715, 717, 720, 721, 722, 723, 724, 725, 726, 727, 728, 730, 732, 733, 737, 739, 741, 742, 743, 744, 745, 746, 748, 749, 750, 751, 752, 754, 755, 756, 757, 758, 759, 762, 763, 764, 765, 766, 767, 768, 771, 772, 774, 777, 779, 786, 795, 780, 782, 784, 787, 788, 790, 791, 793, 794, 798, 802, 803, 804, 806, 807, 812, 813, 814, 819, 820, 821, 824, 827, 828, 830, 831, 834, 840, 841, 842, 846, 854, 855, 856, 863, 864, 866, 869, 870, 871, 874, 875, 877, 879, 880, 881, 886, 888, 889, 891, 892, 895, 896, 897, 898, 902, 903, 904, 907, 909, 910, 911, 913, 916, 919, or a combination thereof of the AR polypeptide. In some embodiments, AR DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from E2K, P14Q, K16N, V29M, S45T, L54S, L57Q, Q64R, Y106C, Q112H, S 176S, K180R, L184P, Q194R, E198G, G204S, G214R, K221N, N222D, D233K, S243L, A252V, L255P, M266T, P269S, A287D, E288K, S334P, S335T, P340L, Y363N, L368V, A369P, P390R, P390S, P390L, A403V, Q443R, G491S, G505D, P513S, G524D, G524S, D528G, P533S, L547F, P548S, D564Y, S567F, G568W, L574P, L547F, C559Y, G568W, G568V, Y571C, Y571H, A573D, T575A, C576R, C576F, G577R, S578T, C579Y, C579F, K580R, V581F, F582Y, F582S, R585K, A586V, A587S, A596T, A596S, S597G, S597I, N599Y, C601F, D604Y, R607Q, R608K, K609N, D610T, C611Y, R615H, R615P, R615G, R616C, L616R, L616P, R617P, C619Y, A622V, R629W, R629Q, K630T, L638M, A645D, S647N, E653K, S662 (nonsense), I664N, Q670L, Q670R, P671H, I672T, L674P, L677P, E681L, P682T, G683A, V684I, V684A, A687V, G688Q, H689P, D690V, D695N, D695V, D695H, L700M, L701P, L701I, H701H, S702A, S703G, N705S, N705Y, E706 (nonsense), L707R, G708A, R710T, Q711E, L712F, V715M, K717Q, K720E, A721T, L722F, P723S, G724S, G724D, G724N, F725L, R726L, N727K, L728S, L728I, V730M, D732N, D732Y, D732E, Q733H, I737T, Y739D, W741R, M742V, M742I, G743R, G743V, L744F, M745T, V746M, A748D, A748V, A748T, M749V, M749I, G750S, G750D, W751R, R752Q, F754V, F754L, T755A, N756S, N756D, V757A, N758T, S759F, S759P, L762F, Y763H, Y763C, F764L, A765T, A765V, P766A, P766S, D767E, L768P, L768M, N771H, E772G, E772A, R774H, R774C, K777T, R779W, R786Q, G795V, M780I, S782N, C784Y, M787V, R788S, L790F, S791P, E793D, F794S, Q798E, Q802R, G803L, F804L, C806Y, M807V, M807R, M807I, L812P, F813V, S814N, N819Q, G820A, L821V, Q824L, Q824R, F827L, F827V, D828H, L830V, L830P, R831Q, R831L, Y834C, R840C, R840H, I841S, I842T, R846G, R854K, R855C, R855H, F856L, L863R, D864N, D864E, D864G, V866L, V866M, V866E, I869M, A870G, A870V, R871G, H874Y, H874R, Q875K, T877S, T877A, D879T, D879G, L880Q, L881V, M886V, S888L, V889M, F891L, P892L, M895T, A896T, E897D, I898T, Q902R, V903M, P904S, P904H, L907F, G909R, G909E, K910R, V911L, P913S, F916L, Q919R, or a combination thereof of the AR polypeptide.

[0196] In some embodiments, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations. In some embodiments the polynucleic acid hybridizes to one or more AR splice variants. In some embodiments the polynucleic acid hybridizes to AR DNA or RNA comprising one or more AR splice variants including but not limited to ARl/2/2b, ARV2, ARV3, ARV4, ARl/2/3/2b, ARV5, ARV6, ARV7, ARV9, ARV10, ARV11, ARV12, ARV13, ARV14, ARV15, ARV16, and ARV(v567es). In some embodiments, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8 or a combination thereof. In some embodiments, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 2, 14, 16, 29, 45, 54, 57, 64, 106, 112, 176, 180, 184, 194, 198, 204, 214, 221, 222, 233, 243, 252, 255, 266, 269, 287, 288, 334, 335, 340, 363, 368, 369, 390, 403, 443, 491, 505, 513, 524, 524, 528, 533, 547, 548, 564, 567, 568, 574, 547, 559, 568, 571, 573, 575, 576, 577, 578, 579, 580, 581, 582, 585, 586, 587, 596, 597, 599, 601, 604, 607, 608, 609, 610, 611, 615, 616, 617, 619, 622, 629, 630, 638, 645, 647, 653, 662, 664, 670, 671, 672, 674, 677, 681, 682, 683, 684, 687, 688, 689, 690, 695, 700, 701, 702, 703, 705, 706, 707, 708, 710, 711, 712, 715, 717, 720, 721, 722, 723, 724, 725, 726, 727, 728, 730, 732, 733, 737, 739, 741, 742, 743, 744, 745, 746, 748, 749, 750, 751, 752, 754, 755, 756, 757, 758, 759, 762, 763, 764, 765, 766, 767, 768, 771, 772, 774, 777, 779, 786, 795, 780, 782, 784, 787, 788, 790, 791, 793, 794, 798, 802, 803, 804, 806, 807, 812, 813, 814, 819, 820, 821, 824, 827, 828, 830, 831, 834, 840, 841, 842, 846, 854, 855, 856, 863, 864, 866, 869, 870, 871, 874, 875, 877, 879, 880, 881, 886, 888, 889, 891, 892, 895, 896, 897, 898, 902, 903, 904, 907, 909, 910, 911, 913, 916, 919, or a combination thereof of the AR polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of AR DNA or RNA comprising one or more mutations selected from E2K, P14Q, K16N, V29M, S45T, L54S, L57Q, Q64R, Y106C, Q112H, S 176S, K180R, L184P, Q194R, E198G, G204S, G214R, K221N, N222D, D233K, S243L, A252V, L255P, M266T, P269S, A287D, E288K, S334P, S335T, P340L, Y363N, L368V, A369P, P390R, P390S, P390L, A403V, Q443R, G491S, G505D, P513S, G524D, G524S, D528G, P533S, L547F, P548S, D564Y, S567F, G568W, L574P, L547F, C559Y, G568W, G568V, Y571C, Y571H, A573D, T575A, C576R, C576F, G577R, S578T, C579Y, C579F, K580R, V581F, F582Y, F582S, R585K, A586V, A587S, A596T, A596S, S597G, S597I, N599Y, C601F, D604Y, R607Q, R608K, K609N, D610T, C611Y, R615H, R615P, R615G, R616C, L616R, L616P, R617P, C619Y, A622V, R629W, R629Q, K630T, L638M, A645D, S647N, E653K, S662 (nonsense), I664N, Q670L, Q670R, P671H, I672T, L674P, L677P, E681L, P682T, G683A, V684I, V684A, A687V, G688Q, H689P, D690V, D695N, D695V, D695H, L700M, L701P, L701I, H701H, S702A, S703G, N705S, N705Y, E706 (nonsense), L707R, G708A, R710T, Q711E, L712F, V715M, K717Q, K720E, A721T, L722F, P723S, G724S, G724D, G724N, F725L, R726L, N727K, L728S, L728I, V730M, D732N, D732Y, D732E, Q733H, I737T, Y739D, W741R, M742V, M742I, G743R, G743V, L744F, M745T, V746M, A748D, A748V, A748T, M749V, M749I, G750S, G750D, W751R, R752Q, F754V, F754L, T755A, N756S, N756D, V757A, N758T, S759F, S759P, L762F, Y763H, Y763C, F764L, A765T, A765V, P766A, P766S, D767E, L768P, L768M, N771H, E772G, E772A, R774H, R774C, K777T, R779W, R786Q, G795V, M780I, S782N, C784Y, M787V, R788S, L790F, S791P, E793D, F794S, Q798E, Q802R, G803L, F804L, C806Y, M807V, M807R, M807I, L812P, F813V, S814N, N819Q, G820A, L821V, Q824L, Q824R, F827L, F827V, D828H, L830V, L830P, R831Q, R831L, Y834C, R840C, R840H, I841S, I842T, R846G, R854K, R855C, R855H, F856L, L863R, D864N, D864E, D864G, V866L, V866M, V866E, I869M, A870G, A870V, R871G, H874Y, H874R, Q875K, T877S, T877A, D879T, D879G, L880Q, L881V, M886V, S888L, V889M, F891L, P892L, M895T, A896T, E897D, I898T, Q902R, V903M, P904S, P904H, L907F, G909R, G909E, K910R, V911L, P913S, F916L, Q919R, or a combination thereof of the AR polypeptide.

Polynucleic Acid Molecules That Target B-catenin and B-catenin-associated Genes

[0197] Catenin beta-1 (also known as CTN B 1, β-catenin, or beta-catenin) is a member of the catenin protein family. In humans, it is encoded by the CTNNB1 gene and is known for its dual functions - cell-cell adhesion and gene transcription. Beta-catenin is an integral structural component of cadherin-based adherens junctions and regulates cell growth and adhesion between cells and anchors the actin cytoskeleton. In some instance, beta-catenin is responsible for transmitting the contact inhibition signal that causes the cells to stop dividing once the epithelial sheet is complete. Beta-catenin is also a key nuclear effector of the Wnt signaling pathway. In some instances, imbalance in the structural and signaling properties of beta-catenin results in diseases and deregulated growth connected to malignancies such as cancer. For example, overexpression of beta-catenin has been linked to cancers such as gastric cancer (Suriano, et al., "Beta- catenin (CTNNB 1) gene amplification: a new mechanism of protein overexpression in cancer," Genes Chromosomes Cancer 42(3): 238-246 (2005)). In some cases, mutations in CTNNB1 gene have been linked to cancer development (e.g., colon cancer, melanoma, hepatocellular carcinoma, ovarian cancer, endometrial cancer, medulloblastoma pilomatricomas, or prostrate cancer), and in some instances, has been linked to metastatic progression. In additional cases, mutations in the CTNNB1 gene cause beta-catenin to translocate to the nucleus without any external stimulus and drive the transcription of its target genes continuously. In some cases, the potential of beta-catenin to change the previously epithelial phenotype of affected cells into an invasive, mesenchyme-like type contributes to metastasis formation.

[0198] In some embodiments, CTNNBl gene is wild type CTNNBl or CTNNBl comprising one or more mutations. In some instances, CTNNBl is wild type CTNNBl . In some instances, CTNNBl is CTNNBl comprising one or more mutations. In some instances, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of wild type CTNNBl . In some instances, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of CTNNBl comprising a mutation (e.g., a substitution, a deletion, or an addition).

[0199] In some embodiments, CTNNBl DNA or RNA comprises one or more mutations. In some embodiments, CTNNBl DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 3. In some instances, CTNNBl DNA or RNA comprises one or more mutations at codons 32, 33, 34, 37, 41, 45, 183, 245, 287 or a combination thereof. In some instances, CTNNBl DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 25, 31, 32, 33, 34, 35, 36, 37, 41, 45, 140, 162, 170, 199, 213, 215, 257, 303, 322, 334, 354, 367, 373, 383, 387, 402, 426, 453, 474, 486, 515, 517, 535, 553, 555, 582, 587, 619, 623, 641, 646, 688, 703, 710, 712, 714, 724, 738, 777, or a combination thereof of the CTNNB l polypeptide. In some embodiments, CTNNBl DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from W25 (nonsense mutation), L31M, D32A, D32N, D32Y, D32G, D32H, S33C, S33Y, S33F, S33P, G34R, G34E, G34V, I35S, H36Y, S37F, S37P, S37C, S37A, T41N, T41A, T41I, S45Y, S45F, S45C, I140T, D162E, K170M, V199I, C213F, A215T, T257I, I303M, Q322K, E334K, K354T, G367V, P373S, W383G, N387K, L402F, N426D, R453L, R453Q, R474 (nonsense mutation), R486C, R515Q, L517F, R535 (nonsense mutation), R535Q, M553V, G555A, R582Q, R587Q, C619Y, Q623E, T641 (frame shift), S646F, M688T, Q703H, R710H, D712N, P714R, Y724H, E738K, F777S, or a combination thereof of the CTNNB l polypeptide.

[0200] In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNBl DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNBl DNA or RNA comprising one or more mutations within exon 3. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNBl DNA or RNA comprising one or more mutations at codons 32, 33, 34, 37, 41, 45, 183, 245, 287 or a combination thereof. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNBl DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 25, 31, 32, 33, 34, 35, 36, 37, 41, 45, 140, 162, 170, 199, 213, 215, 257, 303, 322, 334, 354, 367, 373, 383, 387, 402, 426, 453, 474, 486, 515, 517, 535, 553, 555, 582, 587, 619, 623, 641, 646, 688, 703, 710, 712, 714, 724, 738, 777, or a combination thereof of the CTNNB 1 polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of CTNNBl DNA or RNA comprising one or more mutations selected from W25 (nonsense mutation), L31M, D32A, D32N, D32Y, D32G, D32H, S33C, S33Y, S33F, S33P, G34R, G34E, G34V, I35S, H36Y, S37F, S37P, S37C, S37A, T41N, T41A, T41I, S45Y, S45F, S45C, I140T, D162E, K170M, V199I, C213F, A215T, T257I, I303M, Q322K, E334K, K354T, G367V, P373S, W383G, N387K, L402F, N426D, R453L, R453Q, R474 (nonsense mutation), R486C, R515Q, L517F, R535 (nonsense mutation), R535Q, M553V, G555A, R582Q, R587Q, C619Y, Q623E, T641 (frame shift), S646F, M688T, Q703H, R710H, D712N, P714R, Y724H, E738K, F777S, or a combination thereof of the CTN B 1 polypeptide.

[0201] In some embodiments, beta-catenin associated genes further comprise PIK3CA, PIK3CB, and MYC. In some embodiments, beta-catenin associated genes further comprise PIK3CA DNA or RNA.

PIK3CA (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha or pi 10a protein) is a class i PI 3-kinase catalytic subunit that uses ATP to phosphorylate phosphatidylinositols. In some embodiments, PIK3CA gene is wild type PIK3CA or PIK3C Ά comprising one or more mutations. In some instances, PIK3CA DNA or RNA is wild type PIK3CA. In some instances, PIK3CA DNA or RNA comprises one or more mutations. In some instances, the polynucleic acid molecule hybridizes to a target region of wild type PIK3CA DNA or RNA. In some instances, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).

[0202] In some embodiments, PIK3CA DNA or RNA comprisesone or more mutations. In some embodiments, PIK3CA DNA or RNA comprises one or more mutation within one or more exons. In some instances, PIK3CA DNA or RNA comprises one or more mutation within exons 9 and/or 20. In some instances, PIK3CA DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 1, 4, 10-16, 11-18, 11, 12, 38, 39, 65, 72, 75, 79, 81, 83, 88, 90, 93, 102, 103, 103-104, 103-106, 104, 105-108, 106, 106-107, 106-108, 107, 108, 109-112, 110, 111, 113, 115, 137, 170, 258, 272, 279, 320, 328, 335, 342, 344, 345, 350, 357, 359, 363, 364, 365, 366, 378, 398, 401, 417, 420, 447-455, 449, 449-457, 451, 453, 454, 455, 455-460, 463-465, 471, 495, 522, 538, 539, 542, 545, 546, 547, 576, 604, 614, 617, 629, 643, 663, 682, 725, 726, 777, 791, 818, 866, 901, 909, 939, 951, 958, 970, 971, 975, 992, 1004, 1007, 1016, 1017, 1021, 1025, 1029, 1037, 1040, 1043, 1044, 1045, 1047, 1048, 1049, 1052, 1065, 1069, or a combination thereof of the PIK3CA polypeptide. In some embodiments, PIK3CA DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from M1V, R4 (nonsense mutation), L10-M16 (deletion), W11-P18 (deletion), W11L, G12D, R38L, R38H, R38C, R38S, E39K, E39G, E65K, S72G, Q75E, R79M, E81K, E81 (deletion), F83Y, R88Q, C90Y, C90G, R93Q, R93W, 1102 (deletion), E103G, E103-P104 (deletion), E103-G106 (deletion), P104L, V105-R108 (deletion), G106V, G106-N107 (deletion), G106-R108 (deletion), G106R, N107S, R108L, R108H, E109-I112 (deletion), El 10 (deletion), Kl 1 IE, Kl 11R, Kl 1 IN, Kl 11 (deletion), LI 13 (deletion), Rl 15L, Q137L, N170S, D258N, Y272 (nonsense mutation), L279I, G320V, W328S, R335G, T342S, V344G, V344M, V344A, N345K, N345I, N345T, D350N, D350G, R357Q, G359R, G363A, G364R, E365K, E365V, P366R, C378R, C378Y, R398H, R401Q, E417K, C420R, C420G, P447-L455 (deletion), P449L, P449-N457 (deletion), G451R, G451V, E453K, E453Q, E453D, D454Y, L455 (frame shift insertion), L455-G460 (deletion), G463-N465 (deletion), P471L, P471A, H495L, H495Y, E522A, D538N, P539R, E542K, E542V, E542G, E542Q, E542A, E545K, E545A, E545G, E545Q, E545D, Q546K, Q546R, Q546P, E547D, S576Y, C604R, F614I, A617W, S629C, Q643H, I663S, Q682 (deletion), D725N, W726K, R777M, E791Q, R818C, L866W, C901F, F909L, D939G, R951C, Q958R, E970K, C971R, R975S, R992P, M1004I, G1007R, F1016C, D1017H, Y1021H, Y1021C, T1025A, T1025S, D1029H, E1037K, M1040V, M1043V, M1043I, N1044K, N1044Y, D1045V, H1047R, H1047L, H1047Y, H1047Q, H1048R, G1049R, T1052K, H1065L, 1069W (nonstop mutation), or a combination thereof of the PIK3CA polypeptide.

[0203] In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations within exon 9 or exon 20. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 1, 4, 10-16, 11-18, 11, 12, 38, 39, 65, 72, 75, 79, 81, 83, 88, 90, 93, 102, 103, 103-104, 103-106, 104, 105-108, 106, 106-107, 106-108, 107, 108, 109-112, 110, 111, 113, 115, 137, 170, 258, 272, 279, 320, 328, 335, 342, 344, 345, 350, 357, 359, 363, 364, 365, 366, 378, 398, 401, 417, 420, 447-455, 449, 449-457, 451, 453, 454, 455, 455-460, 463-465, 471, 495, 522, 538, 539, 542, 545, 546, 547, 576, 604, 614, 617, 629, 643, 663, 682, 725, 726, 777, 791, 818, 866, 901, 909, 939, 951, 958, 970, 971, 975, 992, 1004, 1007, 1016, 1017, 1021, 1025, 1029, 1037, 1040, 1043, 1044, 1045, 1047, 1048, 1049, 1052, 1065, 1069, or a combination thereof of the PIK3CA polypeptide. In some embodiments, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of PIK3CA DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues selected from M1V, R4 (nonsense mutation), L10-M16 (deletion), W11-P18 (deletion), W11L, G12D, R38L, R38H, R38C, R38S, E39K, E39G, E65K, S72G, Q75E, R79M, E81K, E81 (deletion), F83Y, R88Q, C90Y, C90G, R93Q, R93W, 1102 (deletion), E103G, E103-P104 (deletion), E103-G106 (deletion), P104L, V105-R108 (deletion), G106V, G106-N107 (deletion), G106-R108 (deletion), G106R, N107S, R108L, R108H, E109-I112 (deletion), El 10 (deletion), K111E, K111R, K111N, Ki l l (deletion), LI 13 (deletion), R115L, Q137L, N170S, D258N, Y272 (nonsense mutation), L279I, G320V, W328S, R335G, T342S, V344G, V344M, V344A, N345K, N345I, N345T, D350N, D350G, R357Q, G359R, G363A, G364R, E365K, E365V, P366R, C378R, C378Y, R398H, R401Q, E417K, C420R, C420G, P447-L455 (deletion), P449L, P449-N457 (deletion), G451R, G451V, E453K, E453Q, E453D, D454Y, L455 (frame shift insertion), L455-G460 (deletion), G463-N465 (deletion), P471L, P471A, H495L, H495Y, E522A, D538N, P539R, E542K, E542V, E542G, E542Q, E542A, E545K, E545A, E545G, E545Q, E545D, Q546K, Q546R, Q546P, E547D, S576Y, C604R, F614I, A617W, S629C, Q643H, I663S, Q682 (deletion), D725N, W726K, R777M, E791Q, R818C, L866W, C901F, F909L, D939G, R951C, Q958R, E970K, C971R, R975S, R992P, M1004I, G1007R, F1016C, D1017H, Y1021H, Y1021C, T1025A, T1025S, D1029H, E1037K, M1040V, M1043V, M1043I, N1044K, N1044Y, D1045V, H1047R, H1047L, H1047Y, H1047Q, H1048R, G1049R, T1052K, H1065L, 1069W (nonstop mutation), or a combination thereof of the PIK3CB polypeptide.

[0204] In some embodiments, beta-catenin associated genes further comprise PIK3CB. In some embodiments, PIK3CB gene is wild type or comprises one or more mutations. In some instances, PIK3CB DNA or RNA is wild type PIK3CB DNA or RNA. In some instances, PIK3CB DNA or RNA comprises one or more mutations. In some instances, the polynucleic acid molecule hybridizes to a target region of wild type PIK3CB DNA or RNA. In some instances, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).

[0205] In some embodiments, PIK3CB DNA or RNA comprises one or more mutations. In some embodiments, PIK3CB DNA or RNA comprises one or more mutations within one or more exons. In some instances, PIK3CB DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 18, 19, 21, 28, 50, 61, 68, 103, 135, 140, 167, 252, 270, 290, 301, 304, 321, 369, 417, 442, 470, 497, 507, 512, 540, 551, 552, 554, 562, 567, 593, 595, 619, 628, 668, 768, 805, 824, 830, 887, 967, 992, 1005, 1020, 1036, 1046, 1047, 1048, 1049, 1051, 1055, 1067, or a combination thereof of the PIK3CB polypeptide. In some embodiments, PIK3CB DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from W18 (nonsense mutation), A19V, D21H, G28S, A50P, K61T, M68I, R103K, H135N, L140S, S 167C, G252W, R270W, K290N, E301V, I304R, R321Q, V369I, T417M, N442K, E470K, E497D, P507S, I512M, E540 (nonsense mutation), C551R, E552K, E554K, R562 (nonsense mutation), E567D, A593V, L595P, V619A, R628 (nonsense mutation), R668W, L768F, K805E, D824E, A830T, E887 (nonsense mutation), V967A, I992T, A1005V, D1020H, E1036K, D1046N, E1047K, A1048V, L1049R, E1051K, T1055A, D1067V, D1067A, or a combination thereof of the PIK3CB polypeptide.

[0206] In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 18, 19, 21, 28, 50, 61, 68, 103, 135, 140, 167, 252, 270, 290, 301, 304, 321, 369, 417, 442, 470, 497, 507, 512, 540, 551, 552, 554, 562, 567, 593, 595, 619, 628, 668, 768, 805, 824, 830, 887, 967, 992, 1005, 1020, 1036, 1046, 1047, 1048, 1049, 1051, 1055, 1067, or a combination thereof of the PIK3CB polypeptide.. In some embodiments, the polynucleic acid molecule hybridizes to a target region of PIK3CB DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues selected from W18 (nonsense mutation), A 19V, D21H, G28S, A50P, K61T, M68I, R103K, H135N, L140S, S 167C, G252W, R270W, K290N, E301V, I304R, R321Q, V369I, T417M, N442K, E470K, E497D, P507S, I512M, E540 (nonsense mutation), C551R, E552K, E554K, R562 (nonsense mutation), E567D, A593V, L595P, V619A, R628 (nonsense mutation), R668W, L768F, K805E, D824E, A830T, E887 (nonsense mutation), V967A, I992T, A1005V, D1020H, E1036K, D1046N, E1047K, A1048V, L1049R, E1051K, T1055A, D1067V, D1067A, or a combination thereof of the PIK3CB polypeptide.

[0207] In some embodiments, beta-catenin associated genes further comprise MYC. In some

embodiments, MYC gene is wild type MYC or MYC comprising one or more mutations. In some instances, MYC is wild type MYC DNA or RNA. In some instances, MYC DNA or RNA comprisesone or more mutations. In some instances, the polynucleic acid molecule hybridizes to a target region of wild type MYC DNA or RNA. In some instances, the polynucleic acid molecule is a polynucleic acid molecule that hybridizes to a target region of MYC DNA or RNA comprising a mutation (e.g., a substitution, a deletion, or an addition).

[0208] In some embodiments, MYC DNA or RNA comprises one or more mutations. In some embodiments, MYC DNA or RNA comprises one or more mutation within one or more exons. In some instances, MYC DNA or RNA comprises one or more mutations within exon 2 or exon 3. In some instances, MYC DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 2, 7, 17, 20, 32, 44, 58, 59, 76, 115, 138, 141, 145, 146, 169, 175, 188, 200, 202, 203, 248, 251, 298, 321, 340, 369, 373, 374, 389, 395, 404, 419, 431, 439, or a combination thereof. In some embodiments, MYC DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues selected from P2L, F7L, D17N, Q20E, Y32N, A44V, A44T, T58I, P59L, A76V, F115L, F138S, A141S, V145I, S 146L, S 169C, S 175N, C188F, N200S, S202N, S203T, T248S, D251E, S298Y, Q321E, V340D, V369D, T373K, H374R, F389L, Q395H, K404N, L419M, E431K, R439Q, or a combination thereof of the MYC polypeptide.

[0209] In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations within an exon. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations within exon 2 or exon 3. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 2, 7, 17, 20, 32, 44, 58, 59, 76, 115, 138, 141, 145, 146, 169, 175, 188, 200, 202, 203, 248, 251, 298, 321, 340, 369, 373, 374, 389, 395, 404, 419, 431, 439, or a combination thereof of the MYC polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of MYC DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues selected from P2L, F7L, D17N, Q20E, Y32N, A44V, A44T, T58I, P59L, A76V, Fl 15L, F138S, A141S, V145I, S 146L, S 169C, S175N, C188F, N200S, S202N, S203T, T248S, D251E, S298Y, Q321E, V340D, V369D, T373K, H374R, F389L, Q395H, K404N, L419M, E431K, R439Q, or a combination thereof of the MYC polypeptide.

Polynucleic Acid Molecules That Target Hypoxanthine Phosphoribosyltransferase 1 (HPRT1) [0210] Hypoxanthine-guanine phosphoribosyltransferase (HGPRT) is a transferase that catalyzes the conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate. HGPRT is encoded by the hypoxanthine Phosphoribosyltransferase 1 (HPRTl) gene.

[0211] In some embodiments, HPRTl DNA or RNA is wild type or comprises one or more mutations. In some instances, HPRTl DNA or RNA comprises one or more mutations within one or more exons. In some instances, the one or more exons comprise exon 2, exon 3, exon 4, exon 6, exon 8, or exon 9. In some instances, HPRTl DNA or RNA comprises one or more mutations at positions corresponding to amino acid residues 35, 48, 56, 74, 87, 129, 154, 162, 195, 200, 210, or a combination thereof of the HPRTl polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRTl DNA or RNA comprising one or more mutations selected from V35M, R48H, E56D, F74L, R87I, N129 (splice-site mutation), N154H, S 162 (splice-site mutation), Y195C, Y195N, R200M, E210K, or a combination thereof of the HPRTl polypeptide.

[0212] In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRTl DNA or RNA comprising one or more mutations. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRTl DNA or RNA comprising one or more mutations within exon 2, exon 3, exon 4, exon 6, exon 8, or exon 9. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRTl DNA or RNA comprising one or more mutations at positions corresponding to amino acid residues 35, 48, 56, 74, 87, 129, 154, 162, 195, 200, 210, or a combination thereof of the HPRTl polypeptide. In some embodiments, the polynucleic acid molecule hybridizes to a target region of HPRTl DNA or RNA comprising one or more mutations selected from V35M, R48H, E56D, F74L, R87I, N129 (splice-site mutation), N154H, S 162 (splice-site mutation), Y195C, Y195N, R200M, E210K, or a combination thereof of the HPRTl polypeptide.

Polynucleic Acid Molecule Sequences

[0213] In some embodiments, the polynucleic acid molecule comprises a sequence that hybridizes to a target sequence illustrated in Tables 1, 4, 7, 8, or 10. In some instances, the polynucleic acid molecule is B. In some instances, the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 1 (KRAS target sequences). In some instances, the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 4 (EGFR target sequences). In some cases, the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 7 (AR target sequences). In some cases, the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 8 (β-catenin target sequences). In additional cases, the polynucleic acid molecule B comprises a sequence that hybridizes to a target sequence illustrated in Table 10 (PIK3CA and PIK3CB target sequences).

[0214] In some embodiments, the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 2 or Table 3. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 16- 75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 16- 75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 16- 75. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 16-75. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 16-75.

[0215] In some embodiments, the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75. In some cases, the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75. In some cases, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75.

[0216] In some embodiments, the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 5 or Table 6. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 452-1955. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 452-1955.

[0217] In some embodiments, the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955. In some cases, the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955. In some cases, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 452-1955.

[0218] In some embodiments, the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 7. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 1956-1962. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 1956-1962.

[0219] In some embodiments, the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962. In some cases, the second polynucleotide comprises a sequence that is complementary to a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962. In some instances, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962, and a second polynucleotide that is complementary to a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1956-1962.

[0220] In some embodiments, the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 9. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 1967-2002. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 1967-2002.

[0221] In some embodiments, the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002. In some cases, the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002. In some cases, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 1967-2002.

[0222] In some embodiments, the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 11. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 2013-2032. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 2013-2032.

[0223] In some embodiments, the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032. In some cases, the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032. In some cases, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2013-2032.

[0224] In some embodiments, the polynucleic acid molecule B comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Table 12.

[0225] In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 60% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 70% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 75% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 80% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 85% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 90% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 95% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 96% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 97% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 98% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 99% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some embodiments, the polynucleic acid molecule consists of SEQ ID NOs: 2082-2109 or 2117.

[0226] In some embodiments, the polynucleic acid molecule B comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some cases, the second polynucleotide comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117. In some cases, the polynucleic acid molecule comprises a first polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117 and a second polynucleotide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2082-2109 or 2117.

Polynucleic Acid Molecules

[0227] In some embodiments, the polynucleic acid molecule described herein comprises RNA or DNA. In some cases, the polynucleic acid molecule comprises RNA. In some instances, RNA comprises short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), double-stranded RNA (dsRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), or heterogeneous nuclear RNA (hnRNA). In some instances, RNA comprises shRNA. In some instances, RNA comprises miRNA. In some instances, RNA comprises dsRNA. In some instances, RNA comprises tRNA. In some instances, RNA comprises rRNA. In some instances, RNA comprises hnRNA. In some instances, the RNA comprises siRNA. In some instances, the polynucleic acid molecule comprises siRNA. In some cases, B comprises siRNA.

[0228] In some embodiments, the polynucleic acid molecule is from about 10 to about 50 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, from about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.

[0229] In some embodiments, the polynucleic acid molecule is about 50 nucleotides in length. In some instances, the polynucleic acid molecule is about 45 nucleotides in length. In some instances, the polynucleic acid molecule is about 40 nucleotides in length. In some instances, the polynucleic acid molecule is about 35 nucleotides in length. In some instances, the polynucleic acid molecule is about 30 nucleotides in length. In some instances, the polynucleic acid molecule is about 25 nucleotides in length. In some instances, the polynucleic acid molecule is about 20 nucleotides in length. In some instances, the polynucleic acid molecule is about 19 nucleotides in length. In some instances, the polynucleic acid molecule is about 18 nucleotides in length. In some instances, the polynucleic acid molecule is about 17 nucleotides in length. In some instances, the polynucleic acid molecule is about 16 nucleotides in length. In some instances, the polynucleic acid molecule is about 15 nucleotides in length. In some instances, the polynucleic acid molecule is about 14 nucleotides in length. In some instances, the polynucleic acid molecule is about 13 nucleotides in length. In some instances, the polynucleic acid molecule is about 12 nucleotides in length. In some instances, the polynucleic acid molecule is about 11 nucleotides in length. In some instances, the polynucleic acid molecule is about 10 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 50 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 45 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 40 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 35 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 30 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 25 nucleotides in length. In some instances, the polynucleic acid molecule is from about 10 to about 20 nucleotides in length. In some instances, the polynucleic acid molecule is from about 15 to about 25 nucleotides in length. In some instances, the polynucleic acid molecule is from about 15 to about 30 nucleotides in length. In some instances, the polynucleic acid molecule is from about 12 to about 30 nucleotides in length.

[0230] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide. In some instances, the polynucleic acid molecule comprises a second polynucleotide. In some instances, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the first polynucleotide is a sense strand or passenger strand. In some instances, the second polynucleotide is an antisense strand or guide strand.

[0231] In some embodiments, the polynucleic acid molecule is a first polynucleotide. In some embodiments, the first polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the first polynucleotide is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, from about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.

[0232] In some instances, the first polynucleotide is about 50 nucleotides in length. In some instances, the first polynucleotide is about 45 nucleotides in length. In some instances, the first polynucleotide is about 40 nucleotides in length. In some instances, the first polynucleotide is about 35 nucleotides in length. In some instances, the first polynucleotide is about 30 nucleotides in length. In some instances, the first polynucleotide is about 25 nucleotides in length. In some instances, the first polynucleotide is about 20 nucleotides in length. In some instances, the first polynucleotide is about 19 nucleotides in length. In some instances, the first polynucleotide is about 18 nucleotides in length. In some instances, the first

polynucleotide is about 17 nucleotides in length. In some instances, the first polynucleotide is about 16 nucleotides in length. In some instances, the first polynucleotide is about 15 nucleotides in length. In some instances, the first polynucleotide is about 14 nucleotides in length. In some instances, the first

polynucleotide is about 13 nucleotides in length. In some instances, the first polynucleotide is about 12 nucleotides in length. In some instances, the first polynucleotide is about 11 nucleotides in length. In some instances, the first polynucleotide is about 10 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 45 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 40 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 35 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 30 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 25 nucleotides in length. In some instances, the first

polynucleotide is from about 10 to about 20 nucleotides in length. In some instances, the first

polynucleotide is from about 15 to about 25 nucleotides in length. In some instances, the first polynucleotide is from about 15 to about 30 nucleotides in length. In some instances, the first polynucleotide is from about 12 to about 30 nucleotides in length.

[0233] In some embodiments, the polynucleic acid molecule is a second polynucleotide. In some embodiments, the second polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 30, from about 15 to about 30, from about 18 to about 25, from about 18 to about 24, from about 19 to about 23, or from about 20 to about 22 nucleotides in length.

[0234] In some instances, the second polynucleotide is about 50 nucleotides in length. In some instances, the second polynucleotide is about 45 nucleotides in length. In some instances, the second polynucleotide is about 40 nucleotides in length. In some instances, the second polynucleotide is about 35 nucleotides in length. In some instances, the second polynucleotide is about 30 nucleotides in length. In some instances, the second polynucleotide is about 25 nucleotides in length. In some instances, the second polynucleotide is about 20 nucleotides in length. In some instances, the second polynucleotide is about 19 nucleotides in length. In some instances, the second polynucleotide is about 18 nucleotides in length. In some instances, the second polynucleotide is about 17 nucleotides in length. In some instances, the second polynucleotide is about 16 nucleotides in length. In some instances, the second polynucleotide is about 15 nucleotides in length. In some instances, the second polynucleotide is about 14 nucleotides in length. In some instances, the second polynucleotide is about 13 nucleotides in length. In some instances, the second polynucleotide is about 12 nucleotides in length. In some instances, the second polynucleotide is about 11 nucleotides in length. In some instances, the second polynucleotide is about 10 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 50 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 45 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 40 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 35 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 30 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 25 nucleotides in length. In some instances, the second polynucleotide is from about 10 to about 20 nucleotides in length. In some instances, the second polynucleotide is from about 15 to about 25 nucleotides in length. In some instances, the second polynucleotide is from about 15 to about 30 nucleotides in length. In some instances, the second polynucleotide is from about 12 to about 30 nucleotides in length.

[0235] In some embodiments, the polynucleic acid molecule comprises a first polynucleotide and a second polynucleotide. In some instances, the polynucleic acid molecule further comprises a blunt terminus, an overhang, or a combination thereof. In some instances, the blunt terminus is a 5' blunt terminus, a 3' blunt terminus, or both. In some cases, the overhang is a 5 ' overhang, 3 ' overhang, or both. In some cases, the overhang comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 non-base pairing nucleotides. In some cases, the overhang comprises 1, 2, 3, 4, 5, or 6 non-base pairing nucleotides. In some cases, the overhang comprises 1, 2, 3, or 4 non-base pairing nucleotides. In some cases, the overhang comprises 1 non-base pairing nucleotide. In some cases, the overhang comprises 2 non-base pairing nucleotides. In some cases, the overhang comprises 3 non-base pairing nucleotides. In some cases, the overhang comprises 4 non-base pairing nucleotides.

[0236] In some embodiments, the sequence of the polynucleic acid molecule is at least 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 99.5% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 50% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 60% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 70% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 80% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 90% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 95% complementary to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule is at least 99% complementary to a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule is 100% complementary to a target sequence described herein.

[0237] In some embodiments, the sequence of the polynucleic acid molecule has 5 or less mismatches to a target sequence described herein. In some embodiments, the sequence of the polynucleic acid molecule has 4 or less mismatches to a target sequence described herein. In some instances, the sequence of the polynucleic acid molecule may has 3 or less mismatches to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule may has 2 or less mismatches to a target sequence described herein. In some cases, the sequence of the polynucleic acid molecule may has 1 or less mismatches to a target sequence described herein.

[0238] In some embodiments, the specificity of the polynucleic acid molecule that hybridizes to a target sequence described herein is a 95%, 98%, 99%, 99.5%, or 100% sequence complementarity of the polynucleic acid molecule to a target sequence. In some instances, the hybridization is a high stringent hybridization condition.

[0239] In some embodiments, the polynucleic acid molecule hybridizes to at least 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, or more contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 8 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 9 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 10 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 1 1 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 12 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 13 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 14 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 15 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 16 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 17 contiguous bases of a target sequence described herein. In some

embodiments, the polynucleic acid molecule hybridizes to at least 18 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 19 contiguous bases of a target sequence described herein. In some embodiments, the polynucleic acid molecule hybridizes to at least 20 contiguous bases of a target sequence described herein.

[0240] In some embodiments, the polynucleic acid molecule has reduced off-target effect. In some instances, "off-target" or "off-target effects" refer to any instance in which a polynucleic acid polymer directed against a given target causes an unintended effect by interacting either directly or indirectly with another mR A sequence, a DNA sequence or a cellular protein or other moiety. In some instances, an "off- target effect" occurs when there is a simultaneous degradation of other transcripts due to partial homology or complementarity between that other transcript and the sense and/or antisense strand of the polynucleic acid molecule.

[0241] In some embodiments, the polynucleic acid molecule comprises natural, synthetic, or artificial nucleotide analogues or bases. In some cases, the polynucleic acid molecule comprises combinations of DNA, RNA and/or nucleotide analogues. In some instances, the synthetic or artificial nucleotide analogues or bases comprise modifications at one or more of ribose moiety, phosphate moiety, nucleoside moiety, or a combination thereof.

[0242] In some embodiments, a nucleotide analogue or artificial nucleotide base described above comprises a nucleic acid with a modification at a 2' hydroxyl group of the ribose moiety. In some instances, the modification includes an H, OR, R, halo, SH, SR, NH2, NHR, NR2, or CN, wherein R is an alkyl moiety. Exemplary alkyl moiety includes, but is not limited to, halogens, sulfurs, thiols, thioethers, thioesters, amines (primary, secondary, or tertiary), amides, ethers, esters, alcohols and oxygen. In some instances, the alkyl moiety further comprises a modification. In some instances, the modification comprises an azo group, a keto group, an aldehyde group, a carboxyl group, a nitro group, a nitroso, group, a nitrile group, a heterocycle (e.g., imidazole, hydrazino or hydroxylamino) group, an isocyanate or cyanate group, or a sulfur containing group (e.g., sulfoxide, sulfone, sulfide, or disulfide). In some instances, the alkyl moiety further comprises a hetero substitution. In some instances, the carbon of the heterocyclic group is substituted by a nitrogen, oxygen or sulfur. In some instances, the heterocyclic substitution includes but is not limited to, morpholino, imidazole, and pyrrolidine [0243] In some instances, the modification at the 2' hydroxyl group is a 2 '-O-methyl modification or a 2 '-O-methoxyethyl (2' -O-MOE) modification. In some cases, the 2 '-O-methyl modification adds a methyl group to the 2' hydroxyl group of the ribose moiety whereas the 2'0-methoxyethyl modification adds a methoxyethyl group to the 2' hydroxyl group of the ribose moiety. Exemplary chemical structures of a 2'- O-methyl modification of an adenosine molecule and 2'0-methoxyethyl modification of an uridine are illustrated below.

-O-methyl-adenosine -O-methoxyethyl uridine

[0244] In some instances, the modification at the 2' hydroxyl group is a 2' -0-aminopropyl modification in which an extended amine group comprising a propyl linker binds the amine group to the 2' oxygen. In some instances, this modification neutralizes the phosphate-derived overall negative charge of the oligonucleotide molecule by introducing one positive charge from the amine group per sugar and thereby improves cellular uptake properties due to its zwitterionic properties. An exemplary chemical structure of a 2'-0-aminopropyl nucleoside phosphoramidite is illustrated below.

2'-0-aminopropyl nucleoside phosphoramidite

[0245] In some instances, the modification at the 2' hydroxyl group is a locked or bridged ribose modification (e.g., locked nucleic acid or LNA) in which the oxygen molecule bound at the 2' carbon is linked to the 4' carbon by a methylene group, thus forming a 2'-C,4'-C-oxy-methylene-linked bicyclic ribonucleotide monomer. Exemplary representations of the chemical structure of LNA are illustrated below. The representation shown to the left highlights the chemical connectivities of an LNA monomer. The representation shown to the right highlights the locked 3'-endo (¾) conformation of the furanose ring of an LNA monomer.

LNA (Locked Nucleic Acids)

[0246] In some instances, the modification at the 2' hydroxyl group comprises ethylene nucleic acids (ENA) such as for example 2'-4'-ethylene-bridged nucleic acid, which locks the sugar conformation into a C ₃ '-endo sugar puckering conformation. ENA are part of the bridged nucleic acids class of modified nucleic acids that also comprises LNA. Exemplary chemical structures of the ENA and bridged nucleic acids are illustrated below.

[0247] In some embodiments, additional modifications at the 2' hydroxyl group include 2'-deoxy, T- deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N- methylacetamido (2'-0-NMA).

[0248] In some embodiments, a nucleotide analogue comprises a modified base such as, but not limited to, 5-propynyluridine, 5-propynylcytidine, 6- methyladenine, 6-methylguanine, N, N, -dimethyladenine, 2- propyladenine, 2propylguanine, 2-aminoadenine, 1 -methylinosine, 3-methyluridine, 5 -methyl cytidine, 5- methyluridine and other nucleotides having a modification at the 5 position, 5 - (2- amino) propyl uridine, 5- halocytidine, 5-halouridine, 4-acetylcytidine, 1- methyladenosine, 2-methyladenosine, 3 -methyl cytidine, 6- methyluridine, 2- methylguanosine, 7-methylguanosine, 2, 2-dimethylguanosine, 5- methylaminoethyluridine, 5 -methyl oxyuri dine, deazanucleotides (such as 7-deaza- adenosine, 6-azouridine, 6-azocytidine, or 6-azothymidine), 5-methyl-2-thiouridine, other thio bases (such as 2-thiouridine, 4- thiouridine, and 2-thiocytidine), dihydrouridine, pseudouridine, queuosine, archaeosine, naphthyl and substituted naphthyl groups, any O-and N-alkylated purines and pyrimi dines (such as N6-methyladenosine, 5 -methyl carbonylmethyluri dine, uridine 5-oxyacetic acid, pyridine-4-one, or pyridine-2-one), phenyl and modified phenyl groups such as aminophenol or 2,4, 6-trimethoxy benzene, modified cytosines that act as G- clamp nucleotides, 8-substituted adenines and guanines, 5 -substituted uracils and thymines, azapyrimidines, carboxyhydroxyalkyl nucleotides, carboxyalkylaminoalkyi nucleotides, and alkylcarbonylalkylated nucleotides. Modified nucleotides also include those nucleotides that are modified with respect to the sugar moiety, as well as nucleotides having sugars or analogs thereof that are not ribosyl. For example, the sugar moieties, in some cases are or are based on, mannoses, arabinoses, glucopyranoses, galactopyranoses, 4'- thioribose, and other sugars, heterocycles, or carbocycles. The term nucleotide also includes what are known in the art as universal bases. By way of example, universal bases include but are not limited to 3- nitropyrrole, 5-nitroindole, or nebularine.

[0249] In some embodiments, a nucleotide analogue further comprises a morpholino, a peptide nucleic acid (PNA), a methylphosphonate nucleotide, a thiolphosphonate nucleotide, a 2'-fluoro N3-P5'- phosphoramidite, or a Γ, 5'- anhydrohexitol nucleic acid (UNA). Morpholino or phosphorodiamidate morpholino oligo (PMO) comprises synthetic molecules whose structure mimics natural nucleic acid structure but deviates from the normal sugar and phosphate structures. In some instances, the five member ribose ring is substituted with a six member morpholino ring containing four carbons, one nitrogen, and one oxygen. In some cases, the ribose monomers are linked by a phosphordiamidate group instead of a phosphate group. In such cases, the backbone alterations remove all positive and negative charges making morpholinos neutral molecules capable of crossing cellular membranes without the aid of cellular delivery agents such as those used by charged oli onucleotides.

[0250] In some embodiments, a morpholino or PMO described above is a PMO comprising a positive or cationic charge. In some instances, the PMO is FMOplus (Sarepta). FMOplus refers to phosphorodiamidate morpholino oligomers comprising any number of (I -piperazino)phosphinyiideneoxy, (l-(4-(omega - guanidino-alkaiioy3))-piperazino)phosphinylideneoxy linkages (e.g., as such those described in PCT Publication No. WO2008/036I27. In some cases, the PMO is a PMO described in U.S. Patent No. 7943762.

[0251] In some embodiments, a morpholino or PMO described above is a PMO-X (Sarepta). In some cases, PMO-X refers to phosphorodiamidate morpholino oligomers comprising at least one linkage or at least one of the disclosed terminal modifications, such as those disclosed in PCT Publication No.

WO2011/150408 and U.S. Publication No. 2012/0065169. [0252] In some embodiments, a morpholino or PMO described above is a PMO as described in Table 5 of U.S. Publication No. 2014/0296321.

[0253] In some embodiments, peptide nucleic acid (PNA) does not contain sugar ring or phosphate linkage and the bases are attached and appropriately spaced by oligoglycine-like molecules, therefore, eliminating a backbone charge.

PNA

[0254] In some embodiments, one or more modifications optionally occur at the internucleotide linkage. In some instances, modified internucleotide linkage includes, but is not limited to, phosphorothioates;

phosphorodithioates; methylphosphonates; 5'- alkylenephosphonates; 5'-methylphosphonate; 3'-alkylene phosphonates; borontrifluoridates; borano phosphate esters and selenophosphates of 3' -5'linkage or 2'- 5'linkage; phosphotriesters; thionoalkylphosphotriesters; hydrogen phosphonate linkages; alkyl

phosphonates; alkylphosphonothioates; arylphosphonothioates; phosphoroselenoates;

phosphorodiselenoates; phosphinates; phosphorami dates; 3'- alkylphosphorami dates;

aminoalkylphosphoramidates; thionophosphorami dates; phosphoropiperazidates; phosphoroanilothioates; phosphoroanilidates; ketones; sulfones; sulfonamides; carbonates; carbamates; methylenehydrazos;

methylenedimethylhydrazos; formacetals; thioformacetals; oximes; methyleneiminos;

methylenemethyliminos; thioamidates; linkages with riboacetyl groups; aminoethyl glycine; silyl or siloxane linkages; alkyl or cycloalkyl linkages with or without heteroatoms of, for example, 1 to 10 carbons that are saturated or unsaturated and/or substituted and/or contain heteroatoms; linkages with morpholino structures, amides, or polyamides wherein the bases are attached to the aza nitrogens of the backbone directly or indirectly; and combinations thereof.

[0255] In some instances, the modification is a methyl or thiol modification such as methylphosphonate or thiolphosphonate modification. Exemplary thiolphosphonate nucleotide (left) and methylphosphonate nucleotide (right) are illustrated below.

[0256] In some instances, a modified nucleotide includes, but is not limited to, 2'-fluoro N3-P5 '- phosphoramidites illustrated as:

[0257] In some instances, a modified nucleotide includes, but is not limited to, hexitol nucleic acid (or Γ, 5 '- anhydrohexitol nucleic acids (HNA)) illustrated as:

HNA

[0258] In some embodiments, one or more modifications comprise a modified phosphate backbone in which the modification generates a neutral or uncharged backbone. In some instances, the phosphate backbone is modified by alkylation to generate an uncharged or neutral phosphate backbone. As used herein, alkylation includes methylation, ethylation, and propylation. In some cases, an alkyl group, as used herein in the context of alkylation, refers to a linear or branched saturated hydrocarbon group containing from 1 to 6 carbon atoms. In some instances, exemplary alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n- pentyl, isopentyl, neopentyl, hexyl, isohexyl, 1, 1 -dimethylbutyl, 2,2-dimethylbutyl, 3.3- dimethylbutyl, and 2-ethylbutyl groups. In some cases, a modified phosphate is a phosphate group as described in U.S. Patent No. 9481905.

[0259] In some embodiments, additional modified phosphate backbones comprise methylphosphonate, ethylphosphonate, methylthiophosphonate, or methoxyphosphonate. In some cases, the modified phosphate is methylphosphonate. In some cases, the modified phosphate is ethylphosphonate. In some cases, the modified phosphate is methylthiophosphonate. In some cases, the modified phosphate is

methoxyphosphonate .

[0260] In some embodiments, one or more modifications further optionally include modifications of the ribose moiety, phosphate backbone and the nucleoside, or modifications of the nucleotide analogues at the 3 ' or the 5 ' terminus. For example, the 3 ' terminus optionally include a 3 ' catiomc group, or by inverting the nucleoside at the 3 '-terminus with a 3 '~3 ' linkage. In another alternative, the 3 '-terminus is optionally conjugated with an aminoalkyl group, e.g., a 3 ' C5 -aminoalkyl dT. In an additional alternative, the 3 '- terminus is optionally conjugated with an abasic site, e.g. , with an apurinic or apyrimidinic site. In some instances, the 5 '-terminus is conjugated with an aminoalkyl group, e.g., a 5 '-0-alkylamino substituent. In some cases, the 5 '-terminus is conjugated with an abasic site, e.g. , with an apurinic or apyri midinic site.

[0261] In some embodiments, the polynucleic acid molecule comprises one or more of the artificial nucleotide analogues described herein. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of the artificial nucleotide analogues described herein. In some embodiments, the artificial nucleotide analogues include 2' -0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2' -fluoro N3- P5 '-phosphoramidites, or a combination thereof. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of the artificial nucleotide analogues selected from 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T- deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N- methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2 '-fluoro N3-P5 ' -phosphoramidites, or a combination thereof. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of 2'-0-methyl modified nucleotides. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of 2' -0- methoxyethyl (2'-0-MOE) modified nucleotides. In some instances, the polynucleic acid molecule comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 20, 25, or more of thiolphosphonate nucleotides.

[0262] In some embodiments, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 1 1, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, or more modifications. In some instances, the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 21 17. [0263] In some instances, the polynucleic acid molecule comprises at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, or more modified nucleotides. In some instances, the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452- 1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

[0264] In some instances, the polynucleic acid molecule comprises at least one of: from about 5% to about 100% modification, from about 10% to about 100% modification, from about 20% to about 100% modification, from about 30% to about 100% modification, from about 40% to about 100% modification, from about 50% to about 100% modification, from about 60% to about 100% modification, from about 70% to about 100% modification, from about 80% to about 100% modification, and from about 90% to about 100% modification. In some instances, the polynucleic acid molecule is a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 2117.

[0265] In some instances, about 5 to about 100% of the polynucleic acid molecule comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of the polynucleic acid molecule comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082- 2109, or 2117 comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 16-45 comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 452- 1203 comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 1956-1962 comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 1967-2002 comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 2013-2032 comprise the artificial nucleotide analogues described herein. In some instances, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of a polynucleic acid molecule of SEQ ID NOs: 2082-2109 or 2117 comprise the artificial nucleotide analogues described herein. In some embodiments, the artificial nucleotide analogues include 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'- deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0- dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N- methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2 '-fluoro N3-P5 '-phosphoramidites, or a combination thereof.

[0266] In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 46-75. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 1204-1955. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 1967-2002. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 2013- 2032. In some instances, the polynucleic acid molecule that comprises an artificial nucleotide analogue comprises SEQ ID NOs: 2082-2109 or 21 17.

[0267] In some cases, one or more of the artificial nucleotide analogues described herein are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribunuclease such as DNase, or exonuclease such as 5 '-3 ' exonuclease and 3 '-5 ' exonuclease when compared to natural polynucleic acid molecules. In some instances, artificial nucleotide analogues comprising 2'-0-methyl, 2'-0-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2' -fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0- dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, morpholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, 2' -fluoro N3- P5 '-phosphoramidites, or combinations thereof are resistant toward nucleases such as for example ribonuclease such as RNase H, deoxyribunuclease such as DNase, or exonuclease such as 5 ' -3 ' exonuclease and 3 '-5 ' exonuclease. In some instances, 2'-0-methyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5' exonuclease resistant). In some instances, 2Ό- methoxyethyl (2'-0-MOE) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5 ' exonuclease resistant). In some instances, 2'-0-aminopropyl modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5 ' exonuclease resistant). In some instances, 2'-deoxy modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5' exonuclease resistant). In some instances, T-deoxy-2'- fluoro modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5 ' exonuclease resistant). In some instances, 2'-0-aminopropyl (2'-0-AP) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3 '-5 ' exonuclease resistant). In some instances, 2'-0-dimethylaminoethyl (2'-0-DMAOE) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5' exonuclease resistant). In some instances, 2'-0- dimethylaminopropyl (2'-0-DMAP) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5 ' exonuclease resistant). In some instances, T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5' exonuclease resistant). In some instances, 2'-0-N- methylacetamido (2'-0-NMA) modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5 '-3 ' exonuclease or 3 '-5 ' exonuclease resistant). In some instances, LNA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some instances, ENA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'- 3' exonuclease or 3 '-5' exonuclease resistant). In some instances, HNA-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5 ' exonuclease resistant). Morpholinos may be nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some instances, PNA-modified polynucleic acid molecule is resistant to nucleases (e.g., RNase H, DNase, 5'-3' exonuclease or 3 '-5' exonuclease resistant). In some instances, methylphosphonate nucleotide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some instances, thiolphosphonate nucleotide-modified polynucleic acid molecule is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5 ' exonuclease resistant). In some instances, polynucleic acid molecule comprising 2'-fluoro N3-P5'-phosphoramidites is nuclease resistant (e.g., RNase H, DNase, 5'-3' exonuclease or 3'-5' exonuclease resistant). In some instances, the 5' conjugates described herein inhibit 5'-3' exonucleolytic cleavage. In some instances, the 3' conjugates described herein inhibit 3'-5' exonucleolytic cleavage.

[0268] In some embodiments, one or more of the artificial nucleotide analogues described herein have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. The one or more of the artificial nucleotide analogues comprising 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'- O-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified, LNA, ENA, PNA, HNA, moφholino, methylphosphonate nucleotides, thiolphosphonate nucleotides, or 2' -fluoro N3-P5'-phosphoramidites can have increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-methyl modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-methoxyethyl (2'-0-MOE) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-aminopropyl modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-deoxy modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, T- deoxy-2'-fluoro modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-aminopropyl (2'- O-AP) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-dimethylaminoethyl (2'-0- DMAOE) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-dimethylaminopropyl (2'-0-DMAP) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, 2'-0-N-methylacetamido (2'-0-NMA) modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, LNA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, ENA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, PNA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, HNA-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, morpholino-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, methylphosphonate nucleotide-modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, thiolphosphonate nucleotide- modified polynucleic acid molecule has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some instances, polynucleic acid molecule comprising 2'- fluoro N3-P5'-phosphoramidites has increased binding affinity toward their mRNA target relative to an equivalent natural polynucleic acid molecule. In some cases, the increased affinity is illustrated with a lower Kd, a higher melt temperature (Tm), or a combination thereof.

[0269] In some embodiments, a polynucleic acid molecule described herein is a chirally pure (or stereo pure) polynucleic acid molecule, or a polynucleic acid molecule comprising a single enantiomer. In some instances, the polynucleic acid molecule comprises L-nucleotide. In some instances, the polynucleic acid molecule comprises D-nucleotides. In some instance, a polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of its mirror enantiomer. In some cases, a polynucleic acid molecule composition comprises less than 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, 1%, or less of a racemic mixture. In some instances, the polynucleic acid molecule is a polynucleic acid molecule described in: U.S. Patent Publication Nos: 2014/194610 and 2015/211006; and PCT Publication No.: WO2015107425.

[0270] In some embodiments, a polynucleic acid molecule described herein is further modified to include an aptamer-conjugating moiety. In some instances, the aptamer conjugating moiety is a DNA aptamer- conjugating moiety. In some instances, the aptamer-conjugating moiety is Alphamer (Centauri

Therapeutics), which comprises an aptamer portion that recognizes a specific cell-surface target and a portion that presents a specific epitopes for attaching to circulating antibodies. In some instance, a polynucleic acid molecule described herein is further modified to include an aptamer-conjugating moiety as described in: U.S. Patent Nos: 8,604, 184, 8,591,910, and 7,850,975. [0271] In additional embodiments, a polynucleic acid molecule described herein is modified to increase its stability. In some embodiment, the polynucleic acid molecule is RNA (e.g., siRNA), the polynucleic acid molecule is modified to increase its stability. In some instances, the polynucleic acid molecule is modified by one or more of the modifications described above to increase its stability. In some cases, the polynucleic acid molecule is modified at the 2' hydroxyl position, such as by 2'-0-methyl, 2'-0-methoxyethyl (2'-0- MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0- dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2' -O-DMAEOE), or 2' -O-N-methylacetamido (2'-0-NMA) modification or by a locked or bridged ribose conformation (e.g., LNA or ENA). In some cases, the polynucleic acid molecule is modified by 2'-0-methyl and/or 2'-0-methoxyethyl ribose. In some cases, the polynucleic acid molecule also includes morpholinos, PNAs, HNA, methylphosphonate nucleotides, thiolphosphonate nucleotides, and/or 2'-fluoro N3-P5'-phosphoramidites to increase its stability. In some instances, the polynucleic acid molecule is a chirally pure (or stereo pure) polynucleic acid molecule. In some instances, the chirally pure (or stereo pure) polynucleic acid molecule is modified to increase its stability. Suitable modifications to the RNA to increase stability for delivery will be apparent to the skilled person.

[0272] In some embodiments, a polynucleic acid molecule described herein has RNAi activity that modulates expression of RNA encoded by a gene described supra. In some instances, a polynucleic acid molecule described herein is a double-stranded siRNA molecule that down-regulates expression of a gene, wherein one of the strands of the double-stranded siRNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of the gene or RNA encoded by the gene or a portion thereof, and wherein the second strand of the double-stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the gene or RNA encoded by the gene or a portion thereof. In some cases, a polynucleic acid molecule described herein is a double -stranded siRNA molecule that down-regulates expression of a gene, wherein each strand of the siRNA molecule comprises about 15 to 25, 18 to 24, or 19 to about 23 nucleotides, and wherein each strand comprises at least about 14, 17, or 19 nucleotides that are complementary to the nucleotides of the other strand. In some cases, a polynucleic acid molecule described herein is a double-stranded siRNA molecule that down-regulates expression of a gene, wherein each strand of the siRNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand. In some instances, the gene is KRAS, EGFR, AR HPRT1, CNNTB1 (β-catenin), or β-catenin associated genes.

[0273] In some embodiments, a polynucleic acid molecule described herein is constructed using chemical synthesis and/or enzymatic ligation reactions using procedures known in the art. For example, a polynucleic acid molecule is chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the polynucleic acid molecule and target nucleic acids. Exemplary methods include those described in: U.S. Patent Nos. 5, 142,047: 5, 185,444: 5,889,136: 6,008,400; and 6, 111,086; PCX Publication No. WO2009099942; or European Publication No. 1579015. Additional exemplary methods include those described in: Griffey et al., "2 ^" -Q-ammopropyl ribonucleotides: a zwitteriomc modification that enhances the exonuclease resistance and biological activity of antisense oligonucleotides," J. Med. Chem. 39(26):5100-5109 (1 97)); Obika, et al. "Synthesis of 2'-0,4'-C-methyleneuridine and - cytidine. Novel bicyclic nucleosides having a fixed C3, -endo sugar puckering". Tetrahedron Letters 38 (50): 8735 (1997); Koizumi, M. "ENA oligonucleotides as therapeutics". Current opinion in molecular therapeutics 8 (2): 144-149 (2006); and Abramova et al., "Novel oligonucleotide analogues based on morpholino nucleoside subunits-antisense technologies: new chemical possibilities," Indian Journal of Chemistry 48B: 1721-1726 (2009). Alternatively, the polynucleic acid molecule is produced biologically using an expression vector into which a polynucleic acid molecule has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted polynucleic acid molecule will be of an antisense orientation to a target polynucleic acid molecule of interest).

Conjugation Chemistry

[0274] In some embodiments, a polynucleic acid molecule is conjugated to a binding moiety. In some instances, the binding moiety comprises amino acids, peptides, polypeptides, proteins, antibodies, antigens, toxins, hormones, lipids, nucleotides, nucleosides, sugars, carbohydrates, polymers such as polyethylene glycol and polypropylene glycol, as well as analogs or derivatives of all of these classes of substances. Additional examples of binding moiety also include steroids, such as cholesterol, phospholipids, di-and triacylglycerols, fatty acids, hydrocarbons (e.g., saturated, unsaturated, or contains substitutions), enzyme substrates, biotin, digoxigenin, and polysaccharides. In some instances, the binding moiety is an antibody or binding fragment thereof. In some instances, the polynucleic acid molecule is further conjugated to a polymer, and optionally an endosomolytic moiety.

[0275] In some embodiments, the polynucleic acid molecule is conjugated to the binding moiety by a chemical ligation process. In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a native ligation. In some instances, the conjugation is as described in: Dawson, et al. "Synthesis of proteins by native chemical ligation," Science 1994, 266, 776-779; Dawson, et al. "Modulation of Reactivity in Native Chemical Ligation through the Use of Thiol Additives," J. Am. Chem. Soc. 1997, 119, 4325-4329; Hackeng, et al. "Protein synthesis by native chemical ligation: Expanded scope by using straightforward methodology," Proc. Natl. Acad. Sci. USA 1999, 96, 10068-10073; or Wu, et al. "Building complex glycopeptides: Development of a cysteine-free native chemical ligation protocol," Angew. Chem. Int. Ed. 2006, 45, 4116-4125. In some instances, the conjugation is as described in U.S. Patent No.

8,936,910. In some embodiments, the polynucleic acid molecule is conjugated to the binding moiety either site-specifically or non-specifically via native ligation chemistry.

[0276] In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a site- directed method utilizing a "traceless" coupling technology (Philochem). In some instances, the "traceless" coupling technology utilizes an N-terminal 1,2-aminothiol group on the binding moiety which is then conjugate with a polynucleic acid molecule containing an aldehyde group, (see Casi et al, "Site-specific traceless coupling of potent cytotoxic drugs to recombinant antibodies for pharmacodelivery, " JACS

134(13): 5887-5892 (2012))

[0277] In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a site- directed method utilizing an unnatural amino acid incorporated into the binding moiety. In some instances, the unnatural amino acid comprises /J>-acetylphenylalanine (pAcPhe). In some instances, the keto group of pAcPhe is selectively coupled to an alkoxy-amine derivatived conjugating moiety to form an oxime bond. (see Axup et al, "Synthesis of site-specific antibody-drug conjugates using unnatural amino acids," PNAS 109(40): 16101-16106 (2012)).

[0278] In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a site- directed method utilizing an enzyme-catalyzed process. In some instances, the site-directed method utilizes SMARTag™ technology (Redwood). In some instances, the SMARTag™ technology comprises generation of a formylglycine (FGly) residue from cysteine by formylglycine-generating enzyme (FGE) through an oxidation process under the presence of an aldehyde tag and the subsequent conjugation of FGly to an alkylhydraine-functionalized polynucleic acid molecule via hydrazino-Pictet-Spengler (HIPS) ligation, (see Wu et al, "Site-specific chemical modification of recombinant proteins produced in mammalian cells by using the genetically encoded aldehyde tag," PNAS 106(9): 3000-3005 (2009); Agarwal, et al., "A Pictet- Spengler ligation for protein chemical modification," PNAS 110(1): 46-51 (2013))

[0279] In some instances, the enzyme-catalyzed process comprises microbial transglutaminase (mTG). In some cases, the polynucleic acid molecule is conjugated to the binding moiety utilizing a microbial transglutaminze catalyzed process. In some instances, mTG catalyzes the formation of a covalent bond between the amide side chain of a glutamine within the recognition sequence and a primary amine of a functionalized polynucleic acid molecule. In some instances, mTG is produced from Streptomyces mobarensis . (see Strop et al, "Location matters: site of conjugation modulates stability and

pharmacokinetics of antibody drug conjugates," Chemistry and Biology 20(2) 161-167 (2013))

[0280] In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a method as described in PCT Publication No. WO2014/140317, which utilizes a sequence -specific transpeptidase.

[0281] In some instances, the polynucleic acid molecule is conjugated to the binding moiety by a method as described in U.S. Patent Publication Nos. 2015/0105539 and 2015/0105540.

Binding Moiety

[0282] In some embodiments, the binding moiety A is a polypeptide. In some instances, the polypeptide is an antibody or its fragment thereof. In some cases, the fragment is a binding fragment. In some instances, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab ₂ , F(ab)' ₃ fragments, single-chain variable fragment (scFv), bis-scFv, (scFv) ₂ , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein (dsFv), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof.

[0283] In some instances, A is an antibody or binding fragment thereof. In some instances, A is a humanized antibody or binding fragment thereof, murine antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab ₂ , F(ab)' ₃ fragments, single-chain variable fragment (scFv), bis-scFv, (scFv) ₂ , diabody, minibody, nanobody, triabody, tetrabody, disulfide stabilized Fv protein ("dsFv"), single-domain antibody (sdAb), Ig NAR, camelid antibody or binding fragment thereof, bispecific antibody or biding fragment thereof, or a chemically modified derivative thereof. In some instances, A is a humanized antibody or binding fragment thereof. In some instances, A is a murine antibody or binding fragment thereof. In some instances, A is a chimeric antibody or binding fragment thereof. In some instances, A is a monoclonal antibody or binding fragment thereof. In some instances, A is a monovalent Fab'. In some instances, A is a diavalent Fab ₂ . In some instances, A is a single-chain variable fragment (scFv).

[0284] In some embodiments, the binding moiety A is a bispecific antibody or binding fragment thereof. In some instances, the bispecific antibody is a trifunctional antibody or a bispecific mini -antibody. In some cases, the bispecific antibody is a trifunctional antibody. In some instances, the trifunctional antibody is a full length monoclonal antibody comprising binding sites for two different antigens. Exemplary trifunctional antibodies include catumaxomab (which targets EpCAM and CD3; Fresenius Biotech/Trion Pharma), ertumaxomab (targets HER2/neu/CD3; Fresenius Biotech/Trion Pharma), lymphomun FBTA05 (targets CD20/CD3; Fresenius Biotech/Trion Pharma), RG7221 (RO5520985; targets Angiopoietin 2/VEGF; Roche), RG7597 (targets Herl/Her3; Genentech Roche), MM141 (targets IGF1R Her3;

Merrimack), ABT122 (targets TNFa/IL17; Abbvie), ABT981 (targets ILla/ILi ; Abbott), LY3164530 (targets Herl/cMET; Eli Lilly), and TRBS07 (Ektomab; targets GD2/CD3; Trion Research Gmbh).

Additional exemplary trifunctional antibodies include mAb ² from F-star Biotechnology Ltd. In some instances, A is a bispecific trifunctional antibody. In some embodiments, A is a bispecific trifunctional antibody selected from: catumaxomab (which targets EpCAM and CD3; Fresenius Biotech/Trion Pharma), ertumaxomab (targets HER2/neu/CD3; Fresenius Biotech/Trion Pharma), lymphomun FBTA05 (targets CD20/CD3; Fresenius Biotech/Trion Pharma), RG7221 (RO5520985; targets Angiopoietin 2/VEGF;

Roche), RG7597 (targets Herl/Her3; Genentech/Roche), MM141 (targets IGF1R Her3; Merrimack), ABT122 (targets TNFa/IL17; Abbvie), ABT981 (targets ILla/ILi ; Abbott), LY3164530 (targets

Herl/cMET; Eli Lilly), TRBS07 (Ektomab; targets GD2/CD3; Trion Research Gmbh), and a mAb ² from F- star Biotechnology Ltd.

[0285] In some cases, the bispecific antibody is a bispecific mini -antibody. In some instances, the bispecific mini-antibody comprises divalent Fab ₂ , F(ab)' ₃ fragments, bis-scFv, (scFv) ₂ , diabody, minibody, triabody, tetrabody or a bi-specific T-cell engager (BiTE). In some embodiments, the bi-specific T-cell engager is a fusion protein that contains two single-chain variable fragments (scFvs) in which the two scFvs target epitopes of two different antigens. Exemplary bispecific mini -antibodies include, but are not limited to, DART (dual-affinity re-targeting platform; MacroGenics), blinatumomab (MT103 or AMG103; which targets CD19/CD3; Micromet), MT111 (targets CEA/CD3; Micromet/Amegen), MT112 (BAY2010112; targets PSMA/CD3; Micromet/Bayer), MT110 (AMG 110; targets EPCAM/CD3; Amgen/Micromet), MGD006 (targets CD123/CD3; MacroGenics), MGD007 (targets GPA33/CD3; MacroGenics), BI1034020 (targets two different epitopes on β-amyloid; Ablynx), ALX0761 (targets IL17A/IL17F; Ablynx), TF2 (targets CEA/hepten; Immunomedics), IL-17/IL-34 biAb (BMS), AFM13 (targets CD30/CD16; Affimed), AFM11 (targets CD19/CD3; Affimed), and domain antibodies (dAbs from Domantis/GSK).

[0286] In some embodiments, the binding moiety A is a bispecific mini -antibody. In some instances, A is a bispecific Fab ₂ . In some instances, A is a bispecific F(ab)' ₃ fragment. In some cases, A is a bispecific bis- scFv. In some cases, A is a bispecific (scFv) ₂ . In some embodiments, A is a bispecific diabody. In some embodiments, A is a bispecific minibody. In some embodiments, A is a bispecific triabody. In other embodiments, A is a bispecific tetrabody. In other embodiments, A is a bi-specific T-cell engager (BiTE). In additional embodiments, A is a bispecific mini -antibody selected from: DART (dual -affinity re-targeting platform; MacroGenics), blinatumomab (MT103 or AMG 103; which targets CD19/CD3; Micromet), MT111 (targets CEA/CD3; Micromet/Amegen), MT112 (BAY2010112; targets PSMA CD3;

Micromet/Bayer), MT110 (AMG 110; targets EPCAM/CD3; Amgen Micromet), MGD006 (targets

CD123/CD3; MacroGenics), MGD007 (targets GPA33/CD3; MacroGenics), BI1034020 (targets two different epitopes on β-amyloid; Ablynx), ALX0761 (targets IL17A/IL17F; Ablynx), TF2 (targets

CEA/hepten; Immunomedics), IL-17/IL-34 biAb (BMS), AFM13 (targets CD30/CD16; Affimed), AFM11 (targets CD19/CD3; Affimed), and domain antibodies (dAbs from Domantis/GSK).

[0287] In some embodiments, the binding moiety A is a trispecific antibody. In some instances, the trispecific antibody comprises F(ab)' ₃ fragments or a triabody. In some instances, A is a trispecific F(ab)' ₃ fragment. In some cases, A is a triabody. In some embodiments, A is a trispecific antibody as described in Dimas, et al., "Development of a trispecific antibody designed to simultaneously and efficiently target three different antigens on tumor cells," Mol. Pharmaceutics, 12(9): 3490-3501 (2015).

[0288] In some embodiments, the binding moiety A is an antibody or binding fragment thereof that recognizes a cell surface protein. In some instances, the cell surface protein is an antigen expressed by a cancerous cell. Exemplary cancer antigens include, but are not limited to, alpha fetoprotein, ASLG659, B7- H3, BAFF-R, Brevican, CA125 (MUC16), CA15-3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (SH2 domain containing phosphatase anchor protein la), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRHl), GEDA, HLA-DOB (Beta subunit of MHC class II molecule (la antigen), human chorionic gonadotropin, ICOS, IL-2 receptor, IL20Ra, Immunoglobulin superfamily receptor translocation associated 2 (IRTA2), L6, Lewis Y, Lewis X, MAGE-1, MAGE-2, MAGE-3, MAGE 4, MARTI, mesothelin, MDP, MPF (SMR, MSLN), MCPl (CCL2), macrophage inhibitory factor (MIF), MPG, MSG783, mucin, MUCl-KLH, Napi3b (SLC34A2), nectin-4, Neu oncogene product, NCA, placental alkaline phosphatase, prostate specific membrane antigen (PMSA), prostatic acid phosphatase, PSCA hlg, p97, Purinergic receptor P2X ligand- gated ion channel 5 (P2X5), LY64 (Lymphocyte antigen 64 (RP105), gplOO, P21, six transmembrane epithelial antigen of prostate (STEAP1), STEAP2, Sema 5b, tumor-associated glycoprotein 72 (TAG-72), TrpM4 (BR22450, FLJ20041, TRPM4, TRPM4B, transient receptor potential cation channel, subfamily M, member 4) and the like.

[0289] In some instances, the cell surface protein comprises clusters of differentiation (CD) cell surface markers. Exemplary CD cell surface markers include, but are not limited to, CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CDl la, CDl lb, CDl lc, CDl ld, CDwl2, CD13, CD14, CD15, CD15s, CD16, CDwl7, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g., CD79a, CD79b), CD90, CD95 (Fas), CD103, CD104, CD125 (IL5RA), CD134 (OX40), CD137 (4-1BB), CD152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), CD326 (EpCAM), and the like.

[0290] In some instances, the binding moiety A is an antibody or binding fragment thereof that recognizes a cancer antigen. In some instances, the binding moiety A is an antibody or binding fragment thereof that recognizes alpha fetoprotein, ASLG659, B7-H3, BAFF-R, Brevican, CA125 (MUC16), CA15- 3, CA19-9, carcinoembryonic antigen (CEA), CA242, CRIPTO (CR, CR1, CRGF, CRIPTO, TDGF1, teratocarcinoma-derived growth factor), CTLA-4, CXCR5, E16 (LAT1, SLC7A5), FcRH2 (IFGP4, IRTA4, SPAP1A (SH2 domain containing phosphatase anchor protein la), SPAP1B, SPAP1C), epidermal growth factor, ETBR, Fc receptor-like protein 1 (FCRH1), GEDA, HLA-DOB (Beta subunit of MHC class II molecule (la antigen), human chorionic gonadotropin, ICOS, IL-2 receptor, IL20Ra, Immunoglobulin superfamily receptor translocation associated 2 (IRTA2), L6, Lewis Y, Lewis X, MAGE-1, MAGE-2, MAGE-3, MAGE 4, MARTI, mesothelin, MCPl (CCL2), MDP, macrophage inhibitory factor (MIF), MPF (SMR, MSLN), MPG, MSG783, mucin, MUCl -KLH, Napi3b (SLC34A2), nectin-4, Neu oncogene product, NCA, placental alkaline phosphatase, prostate specific membrane antigen (PMSA), prostatic acid phosphatase, PSCA hlg, p97, Purinergic receptor P2X ligand-gated ion channel 5 (P2X5), LY64

(Lymphocyte antigen 64 (RP105), gplOO, P21, six transmembrane epithelial antigen of prostate (STEAP1), STEAP2, Sema 5b, tumor-associated glycoprotein 72 (TAG-72), TrpM4 (BR22450, FLJ20041, TRPM4, TRPM4B, transient receptor potential cation channel, subfamily M, member 4) or a combination thereof.

[0291] In some instances, the binding moiety A is an antibody or binding fragment thereof that recognizes a CD cell surface marker. In some instances, the binding moiety A is an antibody or binding fragment thereof that recognizes CD1, CD2, CD3, CD4, CD5, CD6, CD7, CD8, CD9, CD10, CDl la, CDl lb, CDl lc, CDl ld, CDwl2, CD13, CD14, CD15, CD15s, CD16, CDwl7, CD18, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD26, CD27, CD28, CD29, CD30, CD31, CD32, CD33, CD34, CD35, CD36, CD37, CD38, CD39, CD40, CD41, CD42, CD43, CD44, CD45, CD45RO, CD45RA, CD45RB, CD46, CD47, CD48, CD49a, CD49b, CD49c, CD49d, CD49e, CD49f, CD50, CD51, CD52, CD53, CD54, CD55, CD56, CD57, CD58, CD59, CDw60, CD61, CD62E, CD62L (L-selectin), CD62P, CD63, CD64, CD65, CD66a, CD66b, CD66c, CD66d, CD66e, CD79 (e.g., CD79a, CD79b), CD90, CD95 (Fas), CD 103, CD 104, CD 125 (IL5RA), CD 134 (OX40), CD 137 (4-1BB), CD 152 (CTLA-4), CD221, CD274, CD279 (PD-1), CD319 (SLAMF7), CD326 (EpCAM), or a combination thereof.

[0292] In some embodiments, the antibody or binding fragment thereof comprises zalutumumab

(HuMax-EFGr, Genmab), abagovomab (Menarini), abituzumab (Merck), adecatumumab (MT201), alacizumab pegol, alemtuzumab (Campath®, MabCampath, or Campath-IH; Leukosite), AlloMune (BioTransplant), amatuximab (Morphotek, Inc.), anti-VEGF (Genetech), anatumomab mafenatox, apolizumab (hulD IO), ascrinvacumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech/Roche), B43.13 (OvaRex, AltaRex Coφoration), basiliximab (Simulect®, Novartis), belimumab (Benlysta®, GlaxoSmithKline), bevacizumab (Avastin®, Genentech), blinatumomab (Blincyto, AMG103; Amgen), BEC2 (ImGlone Systems Inc.), carlumab (Janssen Biotech), catumaxomab (Removab, Trion Pharma), CEAcide (Immunomedics), Cetuximab (Erbitux®, ImClone), citatuzumab bogatox (VB6-845),

cixutumumab (IMC-A12, ImClone Systems Inc.), conatumumab (AMG 655, Amgen), dacetuzumab (SGN- 40, huS2C6; Seattle Genetics, Inc.), daratumumab (Darzalex®, Janssen Biotech), detumomab, drozitumab (Genentech), durvalumab (Medlmmune), dusigitumab (Medlmmune), edrecolomab (MAM7-1A, Panorex, Glaxo Wellcome), elotuzumab (Empliciti™, Bristol-Myers Squibb), emibetuzumab (Eli Lilly),

enavatuzumab (Facet Biotech Corp.), enfortumab vedotin (Seattle Genetics, Inc.), enoblituzumab (MGA271, MacroGenics, Inc.), ensituxumab (Neogenix Oncology, Inc.), epratuzumab (LymphoCide, Immunomedics, Inc.), ertumaxomab (Rexomun®, Trion Pharma), etaracizumab (Abegrin, Medlmmune), farletuzumab (MORAb-003, Morphotek, Inc), FBTA05 (Lymphomun, Trion Pharma), ficlatuzumab (AVEO

Pharmaceuticals), figitumumab (CP-751871, Pfizer), flanvotumab (ImClone Systems), fresolimumab (GC 1008, Aanofi-Aventis), futuximab, glaximab, ganitumab (Amgen), girentuximab (Rencarex®, Wilex AG), IMAB362 (Claudiximab, Ganymed Pharmaceuticals AG), imalumab (Baxalta), IMC-1C 1 1 (ImClone Systems), IMC-C225 (Imclone Systems Inc.), imgatuzumab (Genentech/Roche), intetumumab (Centocor, Inc.), ipilimumab (Y ervoy®, Bristol-Myers Squibb), iratumumab (Medarex, Inc.), isatuximab (SAR650984, Sanofi-Aventis), labetuzumab (CEA-CIDE, Immunomedics), lexatumumab (ETR2-ST01, Cambridge Antibody Technology), lintuzumab (SGN-33, Seattle Genetics), lucatumumab (Novartis), lumiliximab, mapatumumab (HGS-ETR1, Human Genome Sciences), matuzumab (EMD 72000, Merck), milatuzumab (hLLl, Immunomedics, Inc.), mitumomab (BEC-2, ImClone Systems), narnatumab (ImClone Systems), necitumumab (Portrazza™, Eli Lilly), nesvacumab (Regeneron Pharmaceuticals), nimotuzumab (h-R3, BIOMAb EGFR, TheraCIM, Theraloc, or CIMAher; Biotech Pharmaceutical Co.), nivolumab (Opdivo®, Bristol-Myers Squibb), obinutuzumab (Gazyva or Gazyvaro; Hoffmann-La Roche), ocaratuzumab (AME- 133v, LY2469298; Mentrik Biotech, LLC), ofatumumab (Arzerra®, Genmab), onartuzumab (Genentech), Ontuxizumab (Moφhotek, Inc.), oregovomab (OvaRex®, AltaRex Corp.), otlertuzumab (Emergent BioSolutions), panitumumab (ABX-EGF, Amgen), pankomab (Glycotope GMBH), parsatuzumab (Genentech), patritumab, pembrolizumab (Keytruda®, Merck), pemtumomab (Theragyn, Antisoma), pertuzumab (Perjeta, Genentech), pidilizumab (CT-01 1, Medivation), polatuzumab vedotin

(Genentech/Roche), pritumumab, racotumomab (Vaxira®, Recombio), ramucirumab (Cyramza®, ImClone Systems Inc.), rituximab (Rituxan®, Genentech), robatumumab (Schering-Plough), Seribantumab

(Sanofi/Merrimack Pharmaceuticals, Inc.), sibrotuzumab, siltuximab (Sylvant™, Janssen Biotech), Smart MI95 (Protein Design Labs, Inc.), Smart ID 10 (Protein Design Labs, Inc.), tabalumab (LY2127399, Eli Lilly), taplitumomab paptox, tenatumomab, teprotumumab (Roche), tetulomab, TGN1412 (CD28- SuperMAB or TAB08), tigatuzumab (CD- 1008, Daiichi Sankyo), tositumomab, trastuzumab (Herceptin®), tremelimumab (CP-672,206; Pfizer), tucotuzumab celmoleukin (EMD Pharmaceuticals), ublituximab, urelumab (BMS-663513, Bristol-Myers Squibb), volociximab (M200, Biogen Idee), zatuximab, and the like.

[0293] In some embodiments, the binding moiety A comprises zalutumumab (HuMax-EFGr, Genmab), abagovomab (Menarini), abituzumab (Merck), adecatumumab (MT201), alacizumab pegol, alemtuzumab (Campath®, MabCampath, or Campath-IH; Leukosite), AlloMune (BioTransplant), amatuximab

(Morphotek, Inc.), anti-VEGF (Genetech), anatumomab mafenatox, apolizumab (hulD IO), ascrinvacumab (Pfizer Inc.), atezolizumab (MPDL3280A; Genentech/Roche), B43.13 (OvaRex, AltaRex Coφoration), basiliximab (Simulect®, Novartis), belimumab (Benlysta®, GlaxoSmithKline), bevacizumab (Avastin®, Genentech), blinatumomab (Blincyto, AMG103; Amgen), BEC2 (ImGlone Systems Inc.), carlumab (Janssen Biotech), catumaxomab (Removab, Trion Pharma), CEAcide (Immunomedics), Cetuximab (Erbitux®, ImClone), citatuzumab bogatox (VB6-845), cixutumumab (IMC-A12, ImClone Systems Inc.), conatumumab (AMG 655, Amgen), dacetuzumab (SGN-40, huS2C6; Seattle Genetics, Inc.), daratumumab (Darzalex®, Janssen Biotech), detumomab, drozitumab (Genentech), durvalumab (Medlmmune), dusigitumab (Medlmmune), edrecolomab (MAM7-1A, Panorex, Glaxo Wellcome), elotuzumab

(Empliciti™, Bristol-Myers Squibb), emibetuzumab (Eli Lilly), enavatuzumab (Facet Biotech Corp.), enfortumab vedotin (Seattle Genetics, Inc.), enoblituzumab (MGA271, MacroGenics, Inc.), ensituxumab (Neogenix Oncology, Inc.), epratuzumab (LymphoCide, Immunomedics, Inc.), ertumaxomab (Rexomun®, Trion Pharma), etaracizumab (Abegrin, Medlmmune), farletuzumab (MORAb-003, Morphotek, Inc), FBTA05 (Lymphomun, Trion Pharma), ficlatuzumab (AVEO Pharmaceuticals), figitumumab (CP -751871, Pfizer), flanvotumab (ImClone Systems), fresolimumab (GC 1008, Aanofi-Aventis), futuximab, glaximab, ganitumab (Amgen), girentuximab (Rencarex®, Wilex AG), IMAB362 (Claudiximab, Ganymed

Pharmaceuticals AG), imalumab (Baxalta), IMC-1C 1 1 (ImClone Systems), IMC-C225 (Imclone Systems Inc.), imgatuzumab (Genentech/Roche), intetumumab (Centocor, Inc.), ipilimumab (Y ervoy®, Bristol- Myers Squibb), iratumumab (Medarex, Inc.), isatuximab (SAR650984, Sanofi-Aventis), labetuzumab (CEACIDE, Immunomedics), lexatumumab (ETR2-ST01, Cambridge Antibody Technology), lintuzumab (SGN- 33, Seattle Genetics), lucatumumab (Novartis), lumiliximab, mapatumumab (HGS-ETR1, Human Genome Sciences), matuzumab (EMD 72000, Merck), milatuzumab (hLLl, Immunomedics, Inc.), mitumomab (BEC-2, ImClone Systems), narnatumab (ImClone Systems), necitumumab (Portrazza™, Eli Lilly), nesvacumab (Regeneron Pharmaceuticals), nimotuzumab (h-R3, BIOMAb EGFR, TheraCIM, Theraloc, or CIMAher; Biotech Pharmaceutical Co.), nivolumab (Opdivo®, Bristol-Myers Squibb), obinutuzumab (Gazyva or Gazyvaro; Hoffmann-La Roche), ocaratuzumab (AME-133v, LY2469298; Mentrik Biotech, LLC), ofatumumab (Arzerra®, Genmab), onartuzumab (Genentech), Ontuxizumab (Moφhotek, Inc.), oregovomab (OvaRex®, AltaRex Corp.), otlertuzumab (Emergent BioSolutions), panitumumab (ABX-EGF, Amgen), pankomab (Glycotope GMBH), parsatuzumab (Genentech), patritumab, pembrolizumab

(Keytruda®, Merck), pemtumomab (Theragyn, Antisoma), pertuzumab (Perjeta, Genentech), pidilizumab (CT-01 1, Medivation), polatuzumab vedotin (Genentech/Roche), pritumumab, racotumomab (Vaxira®, Recombio), ramucirumab (Cyramza®, ImClone Systems Inc.), rituximab (Rituxan®, Genentech), robatumumab (Schering-Plough), Seribantumab (Sanofi/Merrimack Pharmaceuticals, Inc.), sibrotuzumab, siltuximab (Sylvant™, Janssen Biotech), Smart MI95 (Protein Design Labs, Inc.), Smart ID 10 (Protein Design Labs, Inc.), tabalumab (LY2127399, Eli Lilly), taplitumomab paptox, tenatumomab, teprotumumab (Roche), tetulomab, TGN1412 (CD28-SuperMAB or TAB08), tigatuzumab (CD-1008, Daiichi Sankyo), tositumomab, trastuzumab (Herceptin®), tremelimumab (CP -672,206; Pfizer), tucotuzumab celmoleukin (EMD Pharmaceuticals), ublituximab, urelumab (BMS-663513, Bristol-Myers Squibb), volociximab (M200, Biogen Idee), or zatuximab. In some embodiments, the binding moiety A is zalutumumab (HuMax-EFGr, by Genmab).

[0294] In some embodiments, the binding moiety A is conjugated according to Formula (I) to a polynucleic acid molecule (B), and a polymer (C), and optionally an endosomolytic moiety (D) according to Formula (II) described herein. In some instances, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence listed in Tables 2, 3, 5, 6, 7, 9, or 1 1. In some embodiments, the polynucleic acid molecule comprises a sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 21 17. In some instances, the polynucleic acid molecule comprises a sequence selected from SEQ ID NOs: 16-75, 452-1955, 1956-1962, 1967-2002, 2013-2032, 2082-2109, or 21 17. In some instances, the polymer C comprises polyalkylen oxide (e.g., polyethylene glycol). In some embodiments, the endosomolytic moiety D comprises INF7 or melittin, or their respective derivatives.

[0295] In some embodiments, the binding moiety A is conjugated to a polynucleic acid molecule (B), and a polymer (C), and optionally an endosomolytic moiety (D) as illustrated in Fig. 1. In some instances, the binding moiety A is an antibody or binding fragment thereof.

[0296] In some embodiments, the binding moiety A is conjugated to a polynucleic acid molecule (B) non- specifically. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a lysine residue or a cysteine residue, in a non-site specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a lysine residue in a non-site specific manner. In some cases, the binding moiety A is conjugated to a polynucleic acid molecule (B) via a cysteine residue in a non- site specific manner. In some instances, the binding moiety A is an antibody or binding fragment thereof. [0297] In some embodiments, the binding moiety A is conjugated to a polynucleic acid molecule (B) in a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a lysine residue, a cysteine residue, at the 5 '-terminus, at the 3 '-terminus, an unnatural amino acid, or an enzyme-modified or enzyme-catalyzed residue, via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a lysine residue via a site- specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through a cysteine residue via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) at the 5 '-terminus via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) at the 3 ' -terminus via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through an unnatural amino acid via a site-specific manner. In some instances, the binding moiety A is conjugated to a polynucleic acid molecule (B) through an enzyme -modified or enzyme-catalyzed residue via a site-specific manner. In some instances, the binding moiety A is an antibody or binding fragment thereof.

[0298] In some embodiments, one or more regions of a binding moiety A (e.g., an antibody or binding fragment thereof) is conjugated to a polynucleic acid molecule (B). In some instances, the one or more regions of a binding moiety A comprise the N-terminus, the C-terminus, in the constant region, at the hinge region, or the Fc region of the binding moiety A. In some instances, the polynucleic acid molecule (B) is conjugated to the N-terminus of the binding moiety A (e.g., the N-terminus of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the C-terminus of the binding moiety A (e.g., the N-terminus of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the constant region of the binding moiety A (e.g., the constant region of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the hinge region of the binding moiety A (e.g., the constant region of an antibody or binding fragment thereof). In some instances, the polynucleic acid molecule (B) is conjugated to the Fc region of the binding moiety A (e.g., the constant region of an antibody or binding fragment thereof).

[0299] In some embodiments, one or more polynucleic acid molecule (B) is conjugated to a binding moiety A. In some instances, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, or more polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 1 polynucleic acid molecule is conjugated to one binding moiety A. In some instances, about 2 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 3 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 4 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 5 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 6 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 7 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 8 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 9 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 10 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 1 1 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 12 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 13 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 14 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 15 polynucleic acid molecules are conjugated to one binding moiety A. In some instances, about 16 polynucleic acid molecules are conjugated to one binding moiety A. In some cases, the one or more polynucleic acid molecules are the same. In other cases, the one or more polynucleic acid molecules are different. In some instances, the binding moiety A is an antibody or binding fragment thereof.

[0300] In some embodiments, the number of polynucleic acid molecule (B) conjugated to a binding moiety A (e.g., an antibody or binding fragment thereof) forms a ratio. In some instances, the ratio is referred to as a DAR (drug-to-antibody) ratio, in which the drug as referred to herein is the polynucleic acid molecule (B). In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 11 or greater. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12 or greater.

[0301] In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A (e.g., an antibody or binding fragment thereof) is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 3. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 4. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 5. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 6. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 7. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 9. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 10. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 1 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 12. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 13. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 14. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 15. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is about 16.

[0302] In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, or 16. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 1. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 2. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 4. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 6. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 8. In some instances, the DAR ratio of the polynucleic acid molecule (B) to binding moiety A is 12.

[0303] In some embodiments, an antibody or its binding fragment is further modified using conventional techniques known in the art, for example, by using amino acid deletion, insertion, substitution, addition, and/or by recombination and/or any other modification (e.g. posttranslational and chemical modifications, such as glycosylation and phosphorylation) known in the art either alone or in combination. In some instances, the modification further comprises a modification for modulating interaction with Fc receptors. In some instances, the one or more modifications include those described in, for example, International Publication No. W097/34631, which discloses amino acid residues involved in the interaction between the Fc domain and the FcRn receptor. Methods for introducing such modifications in the nucleic acid sequence underlying the amino acid sequence of an antibody or its binding fragment is well known to the person skilled in the art.

[0304] In some instances, an antibody binding fragment further encompasses its derivatives and includes polypeptide sequences containing at least one CDR.

[0305] In some instances, the term "single-chain" as used herein means that the first and second domains of a bi-specific single chain construct are covalently linked, preferably in the form of a co-linear amino acid sequence encodable by a single nucleic acid molecule.

[0306] In some instances, a bispecific single chain antibody construct relates to a construct comprising two antibody derived binding domains. In such embodiments, bi-specific single chain antibody construct is tandem bi-scFv or diabody. In some instances, a scFv contains a VH and VL domain connected by a linker peptide. In some instances, linkers are of a length and sequence sufficient to ensure that each of the first and second domains can, independently from one another, retain their differential binding specificities.

[0307] In some embodiments, binding to or interacting with as used herein defines a binding/interaction of at least two antigen-interaction-sites with each other. In some instances, antigen-interaction-site defines a motif of a polypeptide that shows the capacity of specific interaction with a specific antigen or a specific group of antigens. In some cases, the binding/interaction is also understood to define a specific recognition. In such cases, specific recognition refers to that the antibody or its binding fragment is capable of specifically interacting with and/or binding to at least two amino acids of each of a target molecule. For example, specific recognition relates to the specificity of the antibody molecule, or to its ability to discriminate between the specific regions of a target molecule. In additional instances, the specific interaction of the antigen-interaction-site with its specific antigen results in an initiation of a signal, e.g. due to the induction of a change of the conformation of the antigen, an oligomerization of the antigen, etc. In further embodiments, the binding is exemplified by the specificity of a "key-lock-principle". Thus in some instances, specific motifs in the amino acid sequence of the antigen-interaction-site and the antigen bind to each other as a result of their primary, secondary or tertiary structure as well as the result of secondary modifications of said structure. In such cases, the specific interaction of the antigen -interaction-site with its specific antigen results as well in a simple binding of the site to the antigen.

[0308] In some instances, specific interaction further refers to a reduced cross -reactivity of the antibody or its binding fragment or a reduced off-target effect. For example, the antibody or its binding fragment that bind to the polypeptide/protein of interest but do not or do not essentially bind to any of the other polypeptides are considered as specific for the polypeptide/protein of interest. Examples for the specific interaction of an antigen-interaction-site with a specific antigen comprise the specificity of a ligand for its receptor, for example, the interaction of an antigenic determinant (epitope) with the antigenic binding site of an antibody.

Additional Binding Moieties

[0309] In some embodiments, the binding moiety is a plasma protein. In some instances, the plasma protein comprises albumin. In some instances, the binding moiety A is albumin. In some instances, albumin is conjugated by one or more of a conjugation chemistry described herein to a polynucleic acid molecule. In some instances, albumin is conjugated by native ligation chemistry to a polynucleic acid molecule. In some instances, albumin is conjugated by lysine conjugation to a polynucleic acid molecule.

[0310] In some instances, the binding moiety is a steroid. Exemplary steroids include cholesterol, phospholipids, di-and triacylglycerols, fatty acids, hydrocarbons that are saturated, unsaturated, comprise substitutions, or combinations thereof. In some instances, the steroid is cholesterol. In some instances, the binding moiety is cholesterol. In some instances, cholesterol is conjugated by one or more of a conjugation chemistry described herein to a polynucleic acid molecule. In some instances, cholesterol is conjugated by native ligation chemistry to a polynucleic acid molecule. In some instances, cholesterol is conjugated by lysine conjugation to a polynucleic acid molecule.

[0311] In some instances, the binding moiety is a polymer, including but not limited to poly nucleic acid molecule aptamers that bind to specific surface markers on cells. In this instance the binding moiety is a polynucleic acid that does not hybridize to a target gene or mR A, but instead is capable of selectively binding to a cell surface marker similarly to an antibody binding to its specific epitope of a cell surface marker.

[0312] In some cases, the binding moiety is a peptide. In some cases, the peptide comprises between about 1 and about 3 kDa. In some cases, the peptide comprises between about 1.2 and about 2.8 kDa, about 1.5 and about 2.5 kDa, or about 1.5 and about 2 kDa. In some instances, the peptide is a bicyclic peptide. In some cases, the bicyclic peptide is a constrained bicyclic peptide. In some instances, the binding moiety is a bicyclic peptide (e.g., bicycles from Bicycle Therapeutics).

[0313] In additional cases, the binding moiety is a small molecule. In some instances, the small molecule is an antibody-recruiting small molecule. In some cases, the antibody-recruiting small molecule comprises a target-binding terminus and an antibody-binding terminus, in which the target-binding terminus is capable of recognizing and interacting with a cell surface receptor. For example, in some instances, the target -binding terminus comprising a glutamate urea compound enables interaction with PSMA, thereby, enhances an antibody interaction with a cell (e.g., a cancerous cell) that expresses PSMA. In some instances, a binding moiety is a small molecule described in Zhang et al., "A remote arene -binding site on prostate specific membrane antigen revealed by antibody-recruiting small molecules," J Am Chem Soc. 132(36): 12711 - 12716 (2010); or McEnaney, et al., "Antibody-recruiting molecules: an emerging paradigm for engaging immune function in treating human disease," ACS Chem Biol. 7(7): 1139-1151 (2012).

Production of Antibodies or Binding Fragments Thereof

[0314] In some embodiments, polypeptides described herein (e.g., antibodies and its binding fragments) are produced using any method known in the art to be useful for the synthesis of polypeptides (e.g., antibodies), in particular, by chemical synthesis or by recombinant expression, and are preferably produced by recombinant expression techniques.

[0315] In some instances, an antibody or its binding fragment thereof is expressed recombinantly, and the nucleic acid encoding the antibody or its binding fragment is assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., 1994, BioTechniques 17:242), which involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligation of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.

[0316] Alternatively, a nucleic acid molecule encoding an antibody is optionally generated from a suitable source (e.g., an antibody cDNA library, or cDNA library generated from any tissue or cells expressing the immunoglobulin) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence.

[0317] In some instances, an antibody or its binding is optionally generated by immunizing an animal, such as a rabbit, to generate polyclonal antibodies or, more preferably, by generating monoclonal antibodies, e.g., as described by Kohler and Milstein (1975, Nature 256:495-497) or, as described by Kozbor et al. (1983, Immunology Today 4:72) or Cole et al. (1985 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Alternatively, a clone encoding at least the Fab portion of the antibody is optionally obtained by screening Fab expression libraries (e.g., as described in Huse et al., 1989, Science 246: 1275-1281) for clones of Fab fragments that bind the specific antigen or by screening antibody libraries (See, e.g., Clackson et al, 1991, Nature 352:624; Hane et al., 1997 Proc. Natl. Acad. Sci. USA 94:4937).

[0318] In some embodiments, techniques developed for the production of "chimeric antibodies"

(Morrison et al., 1984, Proc. Natl. Acad. Sci. 81 :851-855; Neuberger et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity are used. A chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region, e.g., humanized antibodies.

[0319] In some embodiments, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,694,778; Bird, 1988, Science 242:423-42; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-54) are adapted to produce single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli are also optionally used (Skerra et al., 1988, Science 242: 1038-1041).

[0320] In some embodiments, an expression vector comprising the nucleotide sequence of an antibody or the nucleotide sequence of an antibody is transferred to a host cell by conventional techniques (e.g., electroporation, liposomal transfection, and calcium phosphate precipitation), and the transfected cells are then cultured by conventional techniques to produce the antibody. In specific embodiments, the expression of the antibody is regulated by a constitutive, an inducible or a tissue, specific promoter.

[0321] In some embodiments, a variety of host-expression vector systems is utilized to express an antibody or its binding fragment described herein. Such host-expression systems represent vehicles by which the coding sequences of the antibody is produced and subsequently purified, but also represent cells that are, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody or its binding fragment in situ. These include, but are not limited to, microorganisms such as bacteria (e.g., E. coli and B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing an antibody or its binding fragment coding sequences; yeast (e.g.,

Saccharomyces Pichia) transformed with recombinant yeast expression vectors containing an antibody or its binding fragment coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing an antibody or its binding fragment coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing an antibody or its binding fragment coding sequences; or mammalian cell systems (e.g., COS, CHO, BH, 293, 293T, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g. the adenovirus late promoter; the vaccinia virus 7.5K promoter).

[0322] For long-term, high-yield production of recombinant proteins, stable expression is preferred. In some instances, cell lines that stably express an antibody are optionally engineered. Rather than using expression vectors that contain viral origins of replication, host cells are transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells are then allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci that in turn are cloned and expanded into cell lines. This method can advantageously be used to engineer cell lines which express the antibody or its binding fragments.

[0323] In some instances, a number of selection systems are used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11 :223), hypoxanthine-guanine

phosphoribosyltransferase (Szybalska & Szybalski, 192, Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22: 817) genes are employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance are used as the basis of selection for the following genes: dhfir, which confers resistance to methotrexate (Wigler et al., 1980, Proc. Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid

(Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 {Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3 : 87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62: 191-217; May, 1993, TIB TECH 1 1(5): 155-215) and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene 30: 147). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds., 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY; and in Chapters 12 and 13, Dracopoli et al. (eds), 1994, Current Protocols in Human Genetics, John Wiley & Sons, NY.; Colberre-Garapin et al., 1981, J. Mol. Biol. 150: 1).

[0324] In some instances, the expression levels of an antibody are increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). When a marker in the vector system expressing an antibody is amplifiable, an increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the nucleotide sequence of the antibody, production of the antibody will also increase (Crouse et al., 1983, Mol. Cell Biol. 3 :257).

[0325] In some instances, any method known in the art for purification of an antibody is used, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.

Polymer Conjugating Moiety

[0326] In some embodiments, a polymer moiety C is further conjugated to a polynucleic acid molecule described herein, a binding moiety described herein, or in combinations thereof. In some instances, a polymer moiety C is conjugated a polynucleic acid molecule. In some cases, a polymer moiety C is conjugated to a binding moiety. In other cases, a polymer moiety C is conjugated to a polynucleic acid molecule-binding moiety molecule. In additional cases, a polymer moiety C is conjugated, as illustrated in Figure 1, and as discussed under the Therapeutic Molecule Platform section.

[0327] In some instances, the polymer moiety C is a natural or synthetic polymer, consisting of long chains of branched or unbranched monomers, and/or cross-linked network of monomers in two or three dimensions. In some instances, the polymer moiety C includes a polysaccharide, lignin, rubber, or polyalkylen oxide (e.g., polyethylene glycol). In some instances, the at least one polymer moiety C includes, but is not limited to, alpha-, omega-dihydroxylpolyethyleneglycol, biodegradable lactone-based polymer, e.g. polyacrylic acid, polylactide acid (PLA), poly(glycolic acid) (PGA), polypropylene, polystyrene, polyolefin, polyamide, polycyanoacrylate, polyimide, polyethylenterephthalat (PET, PETG), polyethylene terephthalate (PETE), polytetramethylene glycol (PTG), or polyurethane as well as mixtures thereof. As used herein, a mixture refers to the use of different polymers within the same compound as well as in reference to block copolymers. In some cases, block copolymers are polymers wherein at least one section of a polymer is build up from monomers of another polymer. In some instances, the polymer moiety C comprises polyalkylene oxide. In some instances, the polymer moiety C comprises PEG. In some instances, the polymer moiety C comprises polyethylene imide (PEI) or hydroxy ethyl starch (HES).

[0328] In some instances, C is a PEG moiety. In some instances, the PEG moiety is conjugated at the 5' terminus of the polynucleic acid molecule while the binding moiety is conjugated at the 3' terminus of the polynucleic acid molecule. In some instances, the PEG moiety is conjugated at the 3' terminus of the polynucleic acid molecule while the binding moiety is conjugated at the 5' terminus of the polynucleic acid molecule. In some instances, the PEG moiety is conjugated to an internal site of the polynucleic acid molecule. In some instances, the PEG moiety, the binding moiety, or a combination thereof, are conj ugated to an internal site of the polynucleic acid molecule. In some instances, the conjugation is a direct conjugation. In some instances, the conjugation is via native ligation.

[0329] In some embodiments, the polyalkylene oxide (e.g., PEG) is a polydispers or monodispers compound. In some instances, polydispers material comprises disperse distribution of different molecular weight of the material, characterized by mean weight (weight average) size and dispersity. In some instances, the monodisperse PEG comprises one size of molecules. In some embodiments, C is poly- or monodispersed polyalkylene oxide (e.g., PEG) and the indicated molecular weight represents an average of the molecular weight of the polyalkylene oxide, e.g., PEG, molecules. [0330] In some embodiments, the molecular weight of the polyalkylene oxide (e.g., PEG) is about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da.

[0331] In some embodiments, C is polyalkylene oxide (e.g., PEG) and has a molecular weight of about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some embodiments, C is PEG and has a molecular weight of about 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1 100, 1200, 1300, 1400, 1450, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3250, 3350, 3500, 3750, 4000, 4250, 4500, 4600, 4750, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 10,000, 12,000, 20,000, 35,000, 40,000, 50,000, 60,000, or 100,000 Da. In some instances, the molecular weight of C is about 200 Da. In some instances, the molecular weight of C is about 300 Da. In some instances, the molecular weight of C is about 400 Da. In some instances, the molecular weight of C is about 500 Da. In some instances, the molecular weight of C is about 600 Da. In some instances, the molecular weight of C is about 700 Da. In some instances, the molecular weight of C is about 800 Da. In some instances, the molecular weight of C is about 900 Da. In some instances, the molecular weight of C is about 1000 Da. In some instances, the molecular weight of C is about 1 100 Da. In some instances, the molecular weight of C is about 1200 Da. In some instances, the molecular weight of C is about 1300 Da. In some instances, the molecular weight of C is about 1400 Da. In some instances, the molecular weight of C is about 1450 Da. In some instances, the molecular weight of C is about 1500 Da. In some instances, the molecular weight of C is about 1600 Da. In some instances, the molecular weight of C is about 1700 Da. In some instances, the molecular weight of C is about 1800 Da. In some instances, the molecular weight of C is about 1900 Da. In some instances, the molecular weight of C is about 2000 Da. In some instances, the molecular weight of C is about 2100 Da. In some instances, the molecular weight of C is about 2200 Da. In some instances, the molecular weight of C is about 2300 Da. In some instances, the molecular weight of C is about 2400 Da. In some instances, the molecular weight of C is about 2500 Da. In some instances, the molecular weight of C is about 2600 Da. In some instances, the molecular weight of C is about 2700 Da. In some instances, the molecular weight of C is about 2800 Da. In some instances, the molecular weight of C is about 2900 Da. In some instances, the molecular weight of C is about 3000 Da. In some instances, the molecular weight of C is about 3250 Da. In some instances, the molecular weight of C is about 3350 Da. In some instances, the molecular weight of C is about 3500 Da. In some instances, the molecular weight of C is about 3750 Da. In some instances, the molecular weight of C is about 4000 Da. In some instances, the molecular weight of C is about 4250 Da. In some instances, the molecular weight of C is about 4500 Da. In some instances, the molecular weight of C is about 4600 Da. In some instances, the molecular weight of C is about 4750 Da. In some instances, the molecular weight of C is about 5000 Da. In some instances, the molecular weight of C is about 5500 Da. In some instances, the molecular weight of C is about 6000 Da. In some instances, the molecular weight of C is about 6500 Da. In some instances, the molecular weight of C is about 7000 Da. In some instances, the molecular weight of C is about 7500 Da. In some instances, the molecular weight of C is about 8000 Da. In some instances, the molecular weight of C is about 10,000 Da. In some instances, the molecular weight of C is about 12,000 Da. In some instances, the molecular weight of C is about 20,000 Da. In some instances, the molecular weight of C is about 35,000 Da. In some instances, the molecular weight of C is about 40,000 Da. In some instances, the molecular weight of C is about 50,000 Da. In some instances, the molecular weight of C is about 60,000 Da. In some instances, the molecular weight of C is about 100,000 Da.

[0332] In some embodiments, the polyalkylene oxide (e.g., PEG) is a discrete PEG, in which the discrete PEG is a polymeric PEG comprising more than one repeating ethylene oxide units. In some instances, a discrete PEG (dPEG) comprises from 2 to 60, from 2 to 50, or from 2 to 48 repeating ethylene oxide units. In some instances, a dPEG comprises about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 24, 26, 28, 30, 35, 40, 42, 48, 50 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 2 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 3 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 4 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 5 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 6 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 7 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 8 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 9 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 10 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 11 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 12 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 13 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 14 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 15 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 16 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 17 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 18 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 19 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 20 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 22 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 24 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 26 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 28 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 30 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 35 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 40 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 42 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 48 or more repeating ethylene oxide units. In some instances, a dPEG comprises about 50 or more repeating ethylene oxide units. In some cases, a dPEG is synthesized as a single molecular weight compound from pure (e.g., about 95%, 98%, 99%, or 99.5%) staring material in a step-wise fashion. In some cases, a dPEG has a specific molecular weight, rather than an average molecular weight. In some cases, a dPEG described herein is a dPEG from Quanta Biodesign, LMD.

[0333] In some embodiments, the polymer moiety C comprises a cationic mucic acid-based polymer (cMAP). In some instances, cMPA comprises one or more subunit of at least one repeating subunit, and the subunit structure is represented as Formula (III):

Formula III

[0334] wherein m is independently at each occurrence 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, preferably 4-6 or 5; and n is independently at each occurrence 1, 2, 3, 4, or 5. In some embodiments, m and n are, for example, about 10.

[0335] In some instances, cMAP is further conjugated to a PEG moiety, generating a cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer. In some instances, the PEG moiety is in a range of from about 500 Da to about 50,000 Da. In some instances, the PEG moiety is in a range of from about 500 Da to about 1000 Da, greater than 1000 Da to about 5000 Da, greater than 5000 Da to about 10,000 Da, greater than 10,000 to about 25,000 Da, greater than 25,000 Da to about 50,000 Da,or any combination of two or more of these ranges.

[0336] In some instances, the polymer moiety C is cMAP-PEG copolymer, an mPEG-cMAP-PEGm triblock polymer, or a cMAP-PEG-cMAP triblock polymer. In some cases, the polymer moiety C is cMAP- PEG copolymer. In other cases, the polymer moiety C is an mPEG-cMAP-PEGm triblock polymer. In additional cases, the polymer moiety C is a cMAP-PEG-cMAP triblock polymer.

[0337] In some embodiments, the polymer moiety C is conjugated to the polynucleic acid molecule, the binding moiety, and optionally to the endosomolytic moiety as illustrated in Fig. 1.

Endosomolytic Moiety

[0338] In some embodiments, a molecule of Formula (I): A-X-B-Y-C, further comprises an additional conjugating moiety. In some instances, the additional conjugating moiety is an endosomolytic moiety. In some cases, the endosomolytic moiety is a cellular compartmental release component, such as a compound capable of releasing from any of the cellular compartments known in the art, such as the endosome, lysosome, endoplasmic reticulum (ER), golgi apparatus, microtubule, peroxisome, or other vesicular bodies with the cell. In some cases, the endosomolytic moiety comprises an endosomolytic polypeptide, an endosomolytic polymer, an endosomolytic lipid, or an endosomolytic small molecule. In some cases, the endosomolytic moiety comprises an endosomolytic polypeptide. In other cases, the endosomolytic moiety comprises an endosomolytic polymer.

Endosomolytic Polypeptides

[0339] In some embodiments, a molecule of Formula (I): A-X-B-Y-C, is further conjugated with an endosomolytic polypeptide. In some cases, the endosomolytic polypeptide is a pH-dependent membrane active peptide. In some cases, the endosomolytic polypeptide is an amphipathic polypeptide. In additional cases, the endosomolytic polypeptide is a peptidomimetic. In some instances, the endosomolytic

polypeptide comprises INF, melittin, meucin, or their respective derivatives thereof. In some instances, the endosomolytic polypeptide comprises INF or its derivatives thereof. In other cases, the endosomolytic polypeptide comprises melittin or its derivatives thereof. In additional cases, the endosomolytic polypeptide comprises meucin or its derivatives thereof.

[0340] In some instances, INF7 is a 24 residue polypeptide those sequence comprises

CGIFGEIEELIEEGLENLIDWGNA (SEQ ID NO: 2055), or GLFEAIEGFIENGWEGMIDGWYGC (SEQ ID NO: 2056). In some instances, INF7 or its derivatives comprise a sequence of:

GLFEAIEGFIENGWEGMIWDYGSGSCG (SEQ ID NO: 2057), GLFEAIEGFIENGWEGMIDG WYG- (PEG)6-NH2 (SEQ ID NO: 2058), or GLFEAIEGFIENGWEGMIWDYG-SGSC-K(GalNAc)2 (SEQ ID NO: 2059).

[0341] In some cases, melittin is a 26 residue polypeptide those sequence comprises

CLIGAILKVLATGLPTLISWIKN ^' KRKQ (SEQ ID NO: 2060), or GIGAVLKVLTTGLPALISWIKRKRQQ

(SEQ ID NO: 2061). In some instances, melittin comprises a polypeptide sequence as described in U.S. Patent No. 8,501 ,930.

[0342] In some instances, meucin is an antimicrobial peptide (AMP) derived from the venom gland of the scorpion Mesobuthus eupeus. In some instances, meucin comprises of meucin- 13 those sequence comprises IFGAIAGLLKNIF-NH ₂ (SEQ ID NO: 2062) and meucin- 18 those sequence comprises

FFGHLFKLATKIIPSLFQ (SEQ ID NO: 2063).

[0343] In some instances, the endosomolytic polypeptide comprises a polypeptide in which its sequence is at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence identity to INF7 or its derivatives thereof, melittin or its derivatives thereof, or meucin or its derivatives thereof. In some instances, the endosomolytic moiety comprises INF7 or its derivatives thereof, melittin or its derivatives thereof, or meucin or its derivatives thereof.

[0344] In some instances, the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055-2059. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2055. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2056-2059. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2055. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2056-2059. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2055. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2056-2059.

[0345] In some instances, the endosomolytic moiety is melittin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060 or 2061. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2060. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2061. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2060. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2061. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2060. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2061.

[0346] In some instances, the endosomolytic moiety is meucin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2062 or 2063. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2062. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2063. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2062. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2063. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2062. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2063.

[0347] In some instances, the endosomolytic moiety comprises a sequence as illustrated in Table 62.

Table 62.

A hydrofobic domain

from the fusion

MPG β-sheet sequence of HIV gp41 GALFLGFLGAAGSTMGA 2070

amphipathic and NLS of SV40 T

antigen

Secondary

Glycoprotein gH of

gH625 HGLASTLTRWAHYNALIRAF 2071 amphipathic

HSV type I

a-helical

Secondary

CADY PPTG1 peptide GLWPvALWRLLPvSLWRLLWRA 2072 amphipathic a-helical

Secondary

WEAALAEALAEALAEHLAEALAE

GALA Synthetic peptide 2073 amphipathic

ALEALAA

a-helical

Secondary amphipathic a-helical/

Influenza HA2 fusion pH-

INF GLFEAIEGFIENGWEGMIDGWYGC 2074

peptide dependent membrane active peptide

Secondary amphipathic a-helical/

Influenza HA2 subunit

HA2E5- pH- of influenza virus X31 GLFGAIAGFIENGWEGMIDGWYG 2075 TAT dependent strain fusion peptide

membrane active peptide pH-

Influenza HA2 subunit GLFGAIAGFIENGWEGMIDGRQIKI dependent

HA2- of influenza virus X31 WFQNRRMKW 2076 membrane penetratin

strain fusion peptide KK-amide active peptide pH-

Influenza HA2 subunit dependent

GLFGAIAGFIENGWEGMIDG-

HA-K4 of influenza virus X31 2077 membrane

SSKKKK

strain fusion peptide active peptide pH-

Influenza HA2 subunit dependent

HA2E4 of influenza virus X31 GLFEAIAGFIENGWEGMIDGGGYC 2078 membrane strain fusion peptide active peptide pH- dependent

GLFHAIAHFIHGGWH

H5WYG HA2 analogue 2079 membrane

GLIHGWYG

active peptide pH-

GALA- GLFEAIEGFIENGWEGLAEALAEAL dependent INF3- INF3 fusion peptide EALAA- 2080 membrane (PEG)6-NH (PEG)6-NH2 active peptide pH- dependent

CM18- Cecropin-A-Melittin ₂ -i2 KWKLFKKIGAVLKVLTTG-

2081 membrane TAT11 (CMis) fusion peptide YGRKKRRQRRR

active peptide

[0348] In some cases, the endosomolytic moiety comprises a Bak BH3 polypeptide which induces apoptosis through antagonization of suppressor targets such as Bel -2 and/or Bcl-x _L . In some instances, the endosomolytic moiety comprises a Bak BH3 polypeptide described in Albarran, et al, "Efficient intracellular delivery of a pro-apoptotic peptide with a pH-responsive carrier," Reactive & Functional Polymers 71: 261-265 (2011).

[0349] In some instances, the endosomolytic moiety comprises a polypeptide (e.g., a cell -penetrating polypeptide) as described in PCT Publication Nos. WO2013/166155 or WO2015/069587.

Endosomolytic Polymers

[0350] In some embodiments, a molecule of Formula (I): A-X-B-Y-C, is further conjugated with an endosomolytic polymer. As used herein, an endosomolytic polymer comprises a linear, a branched network, a star, a comb, or a ladder type of polymer. In some instances, an endosomolytic polymer is a homopolymer or a copolymer comprising two ro more different types of monomers. In some cases, an endosomolytic polymer is a polycation polymer. In other cases, an endosomolytic polymer is a polyanion polymer.

[0351] In some instances, a polycation polymer comprises monomer units that are charge positive, charge neutral, or charge negative, with a net charge being positive. In other cases, a polycation polymer comprises a non-polymeric molecule that contains two or more positive charges. Exemplary cationic polymers include, but are not limited to, poly(L-lysine) (PLL), poly(L-arginine) (PLA), polyethyleneimine (PEI), poly[a-(4- aminobutyl)-L-glycolic acid] (PAGA), 2-(dimethylamino)ethyl methacrylate (DMAEMA), or N,N- Diethylaminoethyl Methacrylate (DEAEMA).

[0352] In some cases, a polyanion polymer comprises monomer units that are charge positive, charge neutral, or charge negative, with a net charge being negative. In other cases, a polyanion polymer comprises a non-polymeric molecule that contains two or more negative charges. Exemplary anionic polymers include p(alkylacrylates) (e.g., poly(propyl acrylic acid) (PPAA)) or poly(N-isopropylacrylamide) (NIP AM).

Additional examples include PP75, a L-phenylalanine-poly(L-lysine isophthalamide) polymer described in Khormaee, et al., "Edosomolytic anionic polymer for the cytoplasmic delivery of siRNAs in localized in vivo applications," Advanced Functional Materials 23: 565-574 (2013).

[0353] In some embodiments, an endosomolytic polymer described herein is a pH-responsive endosomolytic polymer. A pH-responsive polymer comprises a polymer that increases in size (swell) or collapses depending on the pH of the environment. Polyacrylic acid and chitosan are examples of pH- responsive polymers.

[0354] In some instances, an endosomolytic moiety described herein is a membrane-disruptive polymer. In some cases, the membrane-disruptive polymer comprises a cationic polymer, a neutral or hydrophobic polymer, or an anionic polymer. In some instances, the membrane-disruptive polymer is a hydrophilic polymer.

[0355] In some instances, an endosomolytic moiety described herein is a pH -responsive membrane- disruptive polymer. Exemplary pH -responsive membrane-disruptive polymers include p(alkylacrylic acids), poly(N-isopropylacrylamide) (NIP AM) copolymers, succinylated p(glycidols), and p( -malic acid) polymers.

[0356] In some instances, p(alkylacrylic acids) include poly(propylacrylic acid) (polyPAA),

poly(methacrylic acid) (PMAA), poly(ethylacrylic acid) (PEAA), and poly(propyl acrylic acid) (PPAA). In some instances, a p(alkylacrylic acid) include a p(alkylacrylic acid) described in Jones, et al, Biochemistry Journal 372: 65-75 (2003).

[0357] In some embodiments, a pH-responsive membrane-disruptive polymer comprises p(butyl acrylate- co-methacrylic acid), (see Bulmus, et al., Journal of Controlled Release 93: 105-120 (2003); and Yessine, et al., Biochimica et Biophysica Acta 1613: 28-38 (2003))

[0358] In some embodiments, a pH-responsive membrane-disruptive polymer comprises p(styrene-alt- maleic anhydride), (see Henry, et al., Biomacromolecules 7: 2407-2414 (2006))

[0359] In some embodiments, a pH-responsive membrane-disruptive polymer comprises pyridyldisulfide acrylate (PDSA) polymers such as poly(MAA-co-PDSA), poly(EAA-co-PDSA), poly(PAA-co-PDSA), poly(MAA-co-BA-co-PDSA), poly(EAA-co-BA-co-PDSA), or poly(PAA-co-BA-co-PDSA) polymers, (see El-Sayed, et al., "Rational design of composition and activity correlations for pH -responsive and glutathione-reactive polymer therapeutics," Journal of Controlled Release 104: 417-427 (2005); or Flanary et al., "Antigen delivery with poly(propylacrylic acid) conjugation enhanced MHC-1 presentation and T-cell activation," Bioconjugate Chem. 20: 241-248 (2009))

[0360] In some embodiments, a pH-responsive membrane-disruptive polymer comprises a lytic polymer comprising the base structure of:

[0361] In some instances, an endosomolytic moiety described herein is further conjugated to an additional conjugate, e.g., a polymer (e.g., PEG), or a modified polymer (e.g., cholesterol -modified polymer).

[0362] In some instances, the additional conjugate comprises a detergent (e.g., Triton X-100). In some instances, an endosomolytic moiety described herein comprises a polymer (e.g., a poly(amidoamine)) conjugated with a detergent (e.g., Triton X-100). In some instances, an endosomolytic moiety described herein comprises poly(amidoamine)-Triton X-100 conjugate (Duncan, et al., "A polymer-Triton X-100 conjugate capable of pH-dependent red blood cell lysis: a model system illustrating the possibility of drug delivery within acidic intracellular compartments," Journal of Drug Targeting 2: 341-347 (1994)).

Endosomolytic Lipids

[0363] In some embodiments, the endosomolytic moiety is a lipid (e.g., a fusogenic lipid). In some embodiments, a molecule of Formula (I): A-X-B-Y-C, is further conjugated with an endosomolytic lipid (e.g., fusogenic lipid). Exemplary fusogenic lipids include l,2-dileoyl-sn-3-phosphoethanolamine (DOPE), phosphatidylethanolamine (POPE), palmitoyloleoylphosphatidylcholine (POPC), (6Z,9Z,28Z,31Z)- heptatriaconta-6,9,28,3 l-tetraen-19-ol (Di-Lin), N-methyl(2,2-di((9Z, 12Z)-octadeca-9, 12-dienyl)-l,3- dioxolan-4-yl)methanamine (DLin-k-DMA) and N-methyl-2-(2,2-di((9Z, 12Z)-octadeca-9, 12-dienyl)-l,3- dioxolan-4-yl)ethanamine (XTC).

[0364] In some instances, an endosomolytic moiety is a lipid (e.g., a fusogenic lipid) described in PCT Publication No. WO09/126,933.

Endosomolytic Small Molecules

[0365] In some embodiments, the endosomolytic moiety is a small molecule. In some embodiments, a molecule of Formula (I): A-X-B-Y-C, is further conjugated with an endosomolytic small molecule.

Exemplary small molecules suitable as endosomolytic moieties include, but are not limited to, quinine, chloroquine, hydroxychloroquines, amodiaquins (carnoquines), amopyroquines, primaquines, mefloquines, nivaquines, halofantrines, quinone imines, or a combination thereof. In some instances, quinoline endosomolytic moieties include, but are not limited to, 7-chloro-4-(4-diethylamino-l-methylbutyl- amino)quinoline (chloroquine); 7-chloro-4-(4-ethyl-(2-hydroxyethyl)-amino- 1 -methylbutyl-amino)quinoline (hydroxychloroquine); 7-fluoro-4-(4-diethylamino- 1 -methylbutyl-amino)quinoline; 4-(4-diethylamino- 1 - methylbutylamino) quinoline; 7-hydroxy-4-(4-diethyl-amino- 1 -methylbutylamino)quinoline; 7-chloro-4-(4- diethylamino- 1 -butylamino)quinoline (desmethyl chloroquine); 7-fluoro-4-(4-diethylamino- 1 - butylamino)quinoline); 4-(4-di ethyl -amino- 1 -butylamino)quinoline; 7-hydroxy-4-(4-diethylamino- 1 - butylamino)quinoline; 7-chloro-4-( 1 -carboxy-4-diethylamino- 1 -butylamino)quinoline; 7-fluoro-4-( 1 - carboxy-4-di ethyl -amino- 1 -butylamino)quinoline; 4-( 1 -carboxy-4-diethylamino- 1 -butylamino) quinoline; 7- hydroxy-4-( 1 -carboxy-4-diethylamino- 1 -butylamino)quinoline; 7-chloro-4-( 1 -carboxy-4-diethylamino- 1 - methylbutylamino)quinoline; 7-fluoro-4-( 1 -carboxy-4-di ethyl -amino- 1 -methylbutylamino)quinoline; 4-( 1 - carboxy-4-diethylamino- 1 -methylbutylamino)quinoline; 7-hydroxy-4-( 1 -carboxy-4-diethylamino- 1 - methylbutylamino)quinoline; 7-fluoro-4-(4-ethyl-(2-hydroxyethyl)-amino- 1 -methylbutylamino)quinoline; 4- (4-ethyl-(2-hydroxy-ethyl)-amino-l-methylbutylamino-)quinoli ne; 7-hydroxy-4-(4-ethyl-(2-hydroxyethyl)- amino- 1 -methylbutylamino)quinoline; hydroxychloroquine phosphate; 7-chloro-4-(4-ethyl-(2-hydroxyethyl- l)-amino-l-butylamino)quinoline (desmethylhydroxychloroquine); 7-fluoro-4-(4-ethyl-(2-hydroxyethyl)- amino- 1 -butylamino)quinoline; 4-(4-ethyl-(2-hydroxyethyl)-amino- 1 -butylamino)quinoline; 7-hydroxy-4- (4-ethyl-(2-hydroxyethyl)-amino- 1 -butylamino) quinoline; 7-chloro-4-( 1 -carboxy-4-ethyl-(2-hydroxyethyl)- amino- 1 -butylamino)quinoline; 7-fluoro-4-( 1 -carboxy-4-ethyl-(2-hydroxyethyl)-amino- 1 - butylamino)quinoline; 4-( 1 -carboxy-4-ethyl-(2-hydroxyethyl)-amino- 1 -butylamino)quinoline; 7-hydroxy-4- ( 1 -carboxy-4-ethyl-(2-hydroxyethyl)-amino- 1 -butylamino)quinoline; 7-chloro-4-( 1 -carboxy-4-ethyl-(2- hydroxyethyl)-amino- 1 -methylbutylamino)quinoline; 7-fluoro-4-( 1 -carboxy-4-ethyl-(2-hydroxyethyl)- amino- 1 -methylbutylamino)quinoline; 4-( 1 -carboxy-4-ethyl-(2-hydroxyethyl)-amino- 1 - methylbutylamino)quinoline; 7-hydroxy-4-( 1 -carboxy-4-ethyl-(2-hydroxyethyl)-amino- 1 - methylbutylamino)quinoline; 8-[(4-aminopentyl)amino-6-methoxydihydrochloride quinoline; 1 -acetyl- 1 ,2,3,4-tetrahydroquinoline; 8-[(4-aminopentyl)amino] -6-methoxyquinoline dihydrochloride; 1 -butyryl- 1,2,3,4-tetrahydroquinoline; 3-chloro-4-(4-hydroxy-alpha,alpha'-bis(2-methyl-l-pyrrolidin yl)-2,5- xylidinoquinoline, 4-[(4-diethyl-amino)- 1 -methylbutyl -amino] -6-methoxyquinoline; 3 -fluoro-4-(4-hydroxy- alpha,alpha'-bis(2-methyl-l-pyrrolidinyl)-2,5-xylidinoquinol ine, 4-[(4-diethylamino)-l-methylbutyl-amino]- 6-methoxyquinoline; 4-(4-hydroxy-alpha,alpha'-bis(2-methyl-l-pyrrolidinyl)-2,5-x ylidinoquinoline; 4-[(4- diethylamino)-l -methylbutyl-amino] -6-methoxyquinoline; 3,4-dihydro-l-(2H)-quinolinecarboxyaldehyde; Ι, Γ-pentamethylene diquinoleinium diiodide; 8-quinolinol sulfate and amino, aldehyde, carboxylic, hydroxyl, halogen, keto, sulfhydryl and vinyl derivatives or analogs thereof. In some instances, an endosomolytic moiety is a small molecule described in Naisbitt et al (1997, J Pharmacol Exp Therapy 280: 884-893) and in U.S. Patent No. 5,736,557.

Formula (I) Molecule -Endosomolytic Moiety Conjugates

[0366] In some embodiments, one or more endosomolytic moieties are conjugated to a molecule comprising at least one binding moiety, at least one polynucleotide, at least one polymer, or any

combinations thereof. In some instances, the endosomolytic moiety is conjugated according to Formula (II):

Formula II

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomolytic moiety; and

c is an integer between 0 and 1 ; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety; and D is conjugated anywhere on A, B, or C.

[0367] In some embodiments, A and C are not attached to B at the same terminus. [0368] In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide. In some instances, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some cases, the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some instances, the second polynucleotide comprises at least one modification. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently a bond or a non -polymeric linker group. In some instances, A is an antibody or binding fragment thereof. In some instances, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single -chain variable fragment (scFv), diabody, minibody, nanobody, single -domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some cases, C is polyethylene glycol.

[0369] In some instances, the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.

[0370] In some instances, the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2055. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2055.

[0371] In some instances, the endosomolytic moiety is melittin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2060. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2060.

[0372] In some instances, the endosomolytic moiety is a sequence as illustrated in Table 62.

[0373] In additional cases, the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane -disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof. In additional cases, the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.

[0374] In some embodiments, the endosomolytic moiety conjugate is according to Formula (Ila):

D-L-A-X-B-Y-C _c

Formula Ila

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomolytic moiety; and

c is an integer of 1 ; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety.

[0375] In some embodiments, A and C are not attached to B at the same terminus .

[0376] In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide. In some instances, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some cases, the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some instances, the second polynucleotide comprises at least one modification. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently a bond or a non -polymeric linker group. In some instances, A is an antibody or binding fragment thereof. In some instances, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single -domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some cases, C is polyethylene glycol.

[0377] In some instances, the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.

[0378] In some instances, the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2055. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2055.

[0379] In some instances, the endosomolytic moiety is melittin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2060. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2060.

[0380] In some instances, the endosomolytic moiety is a sequence as illustrated in Table 62.

[0381] In additional cases, the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane -disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof. In additional cases, the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.

[0382] In some instances, the endosomolytic moiety conjugate is according to Formula (lib):

A-X-B-L-D

Formula lib

wherein,

A is a binding moiety;

B is a polynucleotide;

X is a bond or first linker;

L is a bond or third linker; and

D is an endosomolytic moiety; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety.

[0383] In some embodiments, A and C are not attached to B at the same terminus .

[0384] In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide. In some instances, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some cases, the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some instances, the second polynucleotide comprises at least one modification. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X and L are independently a bond or a non-polymeric linker group. In some instances, A is an antibody or binding fragment thereof. In some instances, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single -domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some cases, C is polyethylene glycol.

[0385] In some instances, the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.

[0386] In some instances, the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2055. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2055.

[0387] In some instances, the endosomolytic moiety is melittin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2060. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2060.

[0388] In some instances, the endosomolytic moiety is a sequence as illustrated in Table 62.

[0389] In additional cases, the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane -disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof. In additional cases, the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.

[0390] In some instances, the endosomolytic moiety conjugate is according to Formula (lie):

A-X-B-Y-C _c -L-D

Formula lie

wherein,

A is a binding moiety; B is a polynucleotide;

C is a polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomolytic moiety; and

c is an integer of 1 ; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety.

[0391] In some embodiments, A and C are not attached to B at the same terminus .

[0392] In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide. In some instances, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some cases, the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some instances, the second polynucleotide comprises at least one modification. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siRNA molecules. In some embodiments, X, Y, and L are independently a bond or a non -polymeric linker group. In some instances, A is an antibody or binding fragment thereof. In some instances, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single -chain variable fragment (scFv), diabody, minibody, nanobody, single -domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some cases, C is polyethylene glycol.

[0393] In some instances, the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.

[0394] In some instances, the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2055. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2055. [0395] In some instances, the endosomolytic moiety is melittin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2060. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2060.

[0396] In some instances, the endosomolytic moiety is a sequence as illustrated in Table 62.

[0397] In additional cases, the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane -disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof. In additional cases, the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.

[0398] In some instances, the endosomolytic moiety conjugate is according to Formula (lid):

A-L-D-X-B-Y-C _c

Formula lid

wherein,

A is a binding moiety;

B is a polynucleotide;

C is a polymer;

X is a bond or first linker;

Y is a bond or second linker;

L is a bond or third linker;

D is an endosomolytic moiety; and

c is an integer of 1 ; and

wherein the polynucleotide comprises at least one 2' modified nucleotide, at least one modified

intemucleotide linkage, or at least one inverted abasic moiety.

[0399] In some embodiments, A and C are not attached to B at the same terminus .

[0400] In some embodiments, the at least one 2' modified nucleotide comprises 2'-0-methyl, 2'-0- methoxyethyl (2'-0-MOE), 2'-0-aminopropyl, 2'-deoxy, T-deoxy-2'-fluoro, 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), T-O- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0-NMA) modified nucleotide. In some instances, the at least one 2' modified nucleotide comprises locked nucleic acid (LNA) or ethylene nucleic acid (ENA). In some cases, the at least one modified intemucleotide linkage comprises a phosphorothioate linkage or a phosphorodithioate linkage. In some embodiments, the polynucleotide comprises a first polynucleotide and a second polynucleotide hybridized to the first polynucleotide to form a double-stranded polynucleic acid molecule. In some instances, the second polynucleotide comprises at least one modification. In some cases, the first polynucleotide and the second polynucleotide are RNA molecules. In some cases, the first polynucleotide and the second polynucleotide are siR A molecules. In some embodiments, X, Y, and L are independently a bond or a non -polymeric linker group. In some instances, A is an antibody or binding fragment thereof. In some instances, the antibody or binding fragment thereof comprises a humanized antibody or binding fragment thereof, chimeric antibody or binding fragment thereof, monoclonal antibody or binding fragment thereof, monovalent Fab', divalent Fab2, single-chain variable fragment (scFv), diabody, minibody, nanobody, single -domain antibody (sdAb), or camelid antibody or binding fragment thereof. In some cases, C is polyethylene glycol.

[0401] In some instances, the endosomolytic moiety comprises a polypeptide, a polymer, a lipid, or a small molecule. In some instances, the endosomolytic moiety is an endosomolytic polypeptide. In some cases, the endosomolytic moiety is an endosomolytic polymer. In other cases, the endosomolytic moiety is an endosomolytic lipid. In additional cases, the endosomolytic moiety is an endosomolytic small molecule.

[0402] In some instances, the endosomolytic moiety is INF7 or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2055. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2055. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2055.

[0403] In some instances, the endosomolytic moiety is melittin or its derivatives thereof. In some cases, the endosomolytic moiety comprises a polypeptide having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs: 2060. In some cases, the endosomolytic moiety comprises SEQ ID NO: 2060. In some cases, the endosomolytic moiety consists of SEQ ID NO: 2060.

[0404] In some instances, the endosomolytic moiety is a sequence as illustrated in Table 62.

[0405] In additional cases, the endosomolytic moiety is an endosomolytic polymer, such as for example, a pH-responsive endosomolytic polymer, a membrane -disruptive polymer, a polycation polymer, a polyanion polymer, a pH-responsive membrane-disruptive polymer, or a combination thereof. In additional cases, the endosomolytic moiety comprises a p(alkylacrylic acid) polymer, a p(butyl acrylate-co-methacrylic acid) polymer, a p(styrene-alt-maleic anhydride) polymer, a pyridyldisulfide acrylate (PDSA) polymer, a polymer-PEG conjugate, a polymer-detergent conjugate, or a combination thereof.

Linkers

[0406] In some embodiments, a linker described herein is a cleavable linker or a non-cleavable linker. In some instances, the linker is a cleavable linker. In some instances, the linker is an acid cleavable linker. In some instances, the linker is a non-cleavable linker. In some instances, the linker includes a Ci-C ₆ alkyl group (e.g., a C ₅ , C ₄ , C ₃ , C ₂ , or Ci alkyl group). In some instances, the linker includes homobifunctional cross linkers, heterobifunctional cross linkers, and the like. In some instances, the liker is a traceless linker (or a zero-length linker). In some instances, the linker is a non-polymeric linker. In some cases, the linker is a non-peptide linker or a linker that does not contain an amino acid residue. [0407] In some instances, the linker comprises a homobifuctional linker. Exemplary homobifuctional linkers include, but are not limited to, Lomant's reagent dithiobis (succinimidylpropionate) DSP, 3 '3'- dithiobis(sulfosuccinimidyl proprionate (DTSSP), disuccinimidyl suberate (DSS),

bis(sulfosuccinimidyl)suberate (BS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo DST), ethylene glycobis(succinimidylsuccinate) (EGS), disuccinimidyl glutarate (DSG), N,N'-disuccinimidyl carbonate (DSC), dimethyl adipimidate (DMA), dimethyl pimelimidate (DMP), dimethyl suberimidate (DMS), dimethyl-3,3'-dithiobispropionimidate (DTBP), l,4-di-3'-(2'-pyridyldithio)propionamido)butane (DPDPB), bismaleimidohexane (BMH), aryl halide -containing compound (DFDNB), such as e.g. 1,5- difluoro-2,4-dinitrobenzene or l,3-difluoro-4,6-dinitrobenzene, 4,4'-difluoro-3,3'-dinitrophenylsulfone (DFDNPS), bis-[ -(4-azidosalicylamido)ethyl]disulfide (BASED), formaldehyde, glutaraldehyde, 1,4- butanediol diglycidyl ether, adipic acid dihydrazide, carbohydrazide, o-toluidine, 3,3'-dimethylbenzidine, benzidine, α,α'-ρ-diaminodiphenyl, diiodo-p-xylene sulfonic acid, N,N'-ethylene-bis(iodoacetamide), or N,N'-hexamethylene-bis(iodoacetamide).

[0408] In some embodiments, the linker comprises a heterobiiunctional linker. Exemplary

heterobiiunctional linker include, but are not limited to, amine -reactive and sulfhydryl cross-linkers such as N-succinimidyl 3-(2-pyridyldithio)propionate (sPDP), long-chain N-succinimidyl 3-(2- pyridyldithio)propionate (LC-sPDP), water-soluble-long-chain N-succinimidyl 3-(2-pyridyldithio) propionate (sulfo-LC-sPDP), succinimidyloxycarbonyl-a-methyl-a-(2-pyridyldithio)toluene (sMPT), sulfosuccinimidyl-6-[a-methyl-a-(2-pyridyldithio)toluamido]h exanoate (sulfo-LC-sMPT), succinimidyl -4- (N-maleimidomethyl)cyclohexane- 1 -carboxylate (sMCC), sulfosuccinimidyl-4-(N- maleimidomethyl)cyclohexane- 1 -carboxylate (sulfo-sMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBs), m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBs), N-succinimidyl(4- iodoacteyl)aminobenzoate (sIAB), sulfosuccinimidyl(4-iodoacteyl)aminobenzoate (sulfo-sIAB), succinimidyl-4-(p-maleimidophenyl)butyrate (sMPB), sulfosuccinimidyl-4-(p-maleimidophenyl)butyrate (sulfo-sMPB), N-(y-maleimidobutyryloxy)succinimide ester (GMBs), Ν-(γ- maleimidobutyryloxy)sulfosuccinimide ester (sulfo-GMBs), succinimidyl 6-((iodoacetyl)amino)hexanoate (sIAX), succinimidyl 6-[6-(((iodoacetyl)amino)hexanoyl)amino]hexanoate (sIAXX), succinimidyl 4- (((iodoacetyl)amino)methyl)cyclohexane-l -carboxylate (sIAC), succinimidyl 6-((((4- iodoacetyl)amino)methyl)cyclohexane-l-carbonyl)amino) hexanoate (sIACX), p-nitrophenyl iodoacetate (NPIA), carbonyl-reactive and sulfhydryl-reactive cross-linkers such as 4-(4-N-maleimidophenyl)butyric acid hydrazide (MPBH), 4-(N-maleimidomethyl)cyclohexane-l-carboxyl-hydrazide-8 (M ₂ C ₂ H), 3-(2- pyridyldithio)propionyl hydrazide (PDPH), amine -reactive and photoreactive cross-linkers such as N- hydroxysuccinimidyl-4-azidosalicylic acid (NHs-AsA), N-hydroxysulfosuccinimidyl-4-azidosalicylic acid (sulfo-NHs-AsA), sulfosuccinimidyl-(4-azidosalicylamido)hexanoate (sulfo-NHs-LC-AsA),

sulfosuccinimidyl-2-(p-azidosalicylamido)ethyl-l,3'-dithi opropionate (sAsD), N-hydroxysuccinimidyl-4- azidobenzoate (HsAB), N-hydroxysulfosuccinimidyl-4-azidobenzoate (sulfo-HsAB), N-succinimidyl-6-(4'- azido-2'-nitrophenylamino)hexanoate (sANPAH), sulfosuccinimidyl-6-(4'-azido-2'- nitrophenylamino)hexanoate (sulfo-sANPAH), N-5-azido-2-nitrobenzoyloxysuccinimide (ANB-NOs), sulfosuccinimidyl-2-(m-azido-o-nitrobenzamido)-ethyl-l,3'-di thiopropionate (sAND), N-succinimidyl-4(4- azidophenyl) 1 ,3 '-dithiopropionate (sADP), N-sulfosuccinimidyl(4-azidophenyl)- 1 ,3 '-dithiopropionate (sulfo-sADP), sulfosuccinimidyl 4-(p-azidophenyl)butyrate (sulfo-sAPB), sulfosuccinimidyl 2-(7-azido-4- methylcoumarin-3-acetamide)ethyl-l,3'-dithiopropionate (sAED), sulfosuccinimidyl 7-azido-4- methylcoumain-3 -acetate (sulfo-sAMCA), p-nitrophenyl diazopyruvate (pNPDP), p-nitrophenyl-2-diazo- 3,3,3-trifluoropropionate (PNP-DTP), sulfhydryl -reactive and photoreactive cross-linkers such asl -(p- Azidosalicylamido)-4-(iodoacetamido)butane (AsIB), N-[4-(p-azidosalicylamido)butyl] -3 '-(2'- pyridyldithio)propionamide (APDP), benzophenone-4-iodoacetamide, benzophenone-4-maleimide carbonyl- reactive and photoreactive cross-linkers such as p-azidobenzoyl hydrazide (ABH), carboxylate-reactive and photoreactive cross-linkers such as 4-(p-azidosalicylamido)butylamine (AsBA), and arginine -reactive and photoreactive cross-linkers such as p-azidophenyl glyoxal (APG).

[0409] In some instances, the linker comprises a reactive functional group. In some cases, the reactive functional group comprises a nucleophilic group that is reactive to an electrophilic group present on a binding moiety. Exemplary electrophilic groups include carbonyl groups— such as aldehyde, ketone, carboxylic acid, ester, amide, enone, acyl halide or acid anhydride. In some embodiments, the reactive functional group is aldehyde. Exemplary nucleophilic groups include hydrazide, oxime, amino, hydrazine, thiosemicarbazone, hydrazine carboxylate, and arylhydrazide.

[0410] In some embodiments, the linker comprises a maleimide goup. In some instances, the maleimide group is also referred to as a maleimide spacer. In some instances, the maleimide group further

encompasses a caproic acid, forming maleimidocaproyl (mc). In some cases, the linker comprises maleimidocaproyl (mc). In some cases, the linker is maleimidocaproyl (mc). In other instances, the maleimide group comprises a maleimidomethyl group, such as succinimidyl-4-(N- maleimidomethyl)cyclohexane-l -carboxylate (sMCC) or sulfosuccinimidyl -4-(N- maleimidomethyl)cyclohexane-l -carboxylate (sulfo-sMCC) described above.

[0411] In some embodiments, the maleimide group is a self-stabilizing maleimide. In some instances, the self-stabilizing maleimide utilizes diaminopropionic acid (DPR) to incorporate a basic amino group adjacent to the maleimide to provide intramolecular catalysis of tiosuccinimide ring hydrolysis, thereby eliminating maleimide from undergoing an elimination reaction through a retro -Michael reaction. In some instances, the self-stabilizing maleimide is a maleimide group described in Lyon, et al, "Self-hydrolyzing maleimides improve the stability and pharmacological properties of antibody-drug conjugates," Nat. Biotechnol.

32(10): 1059-1062 (2014). In some instances, the linker comprises a self-stabilizing maleimide. In some instances, the linker is a self-stabilizing maleimide.

[0412] In some embodiments, the linker comprises a peptide moiety. In some instances, the peptide moiety comprises at least 2, 3, 4, 5, 6, 7, 8, or more aminoa cid residues. In some instances, the peptide moiety is a cleavable peptide moiety (e.g., either enzymatically or chemically). In some instances, the peptide moiety is a non-cleavable peptide moiety. In some instances, the peptide moiety comprises Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 21 11), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Τφ-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 21 12), or Gly-Phe-Leu-Gly (SEQ ID NO: 21 13). In some instances, the linker comprises a peptide moiety such as: Val-Cit (valine-citrulline), Gly-Gly-Phe-Gly (SEQ ID NO: 21 1 1), Phe-Lys, Val-Lys, Gly-Phe-Lys, Phe-Phe-Lys, Ala-Lys, Val-Arg, Phe-Cit, Phe-Arg, Leu-Cit, Ile-Cit, Trp-Cit, Phe-Ala, Ala-Leu-Ala-Leu (SEQ ID NO: 21 12), or Gly-Phe-Leu-Gly (SEQ ID NO: 21 13). In some cases, the linker comprises Val-Cit. In some cases, the linker is Val-Cit.

[0413] In some embodiments, the linker comprises a benzoic acid group, or its derivatives thereof. In some instances, the benzoic acid group or its derivatives thereof comprise paraaminobenzoic acid (PABA). In some instances, the benzoic acid group or its derivatives thereof comprise gamma-aminobutyric acid (GAB A).

[0414] In some embodiments, the linker comprises one or more of a maleimide group, a peptide moiety, and/or a benzoic acid group, in any combination. In some embodiments, the linker comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group. In some instances, the maleimide group is maleimidocaproyl (mc). In some instances, the peptide group is val-cit. In some instances, the benzoic acid group is PABA. In some instances, the linker comprises a mc-val-cit group. In some cases, the linker comprises a val-cit-PABA group. In additional cases, the linker comprises a mc-val-cit-PABA group.

[0415] In some embodiments, the linker is a self-immolative linker or a self-elimination linker. In some cases, the linker is a self-immolative linker. In other cases, the linker is a self-elimination linker (e.g., a cyclization self-elimination linker). In some instances, the linker comprises a linker described in U.S. Patent No. 9,089,614 or PCT Publication No. WO2015038426.

[0416] In some embodiments, the linker is a dendritic type linker. In some instances, the dendritic type linker comprises a branching, multifunctional linker moiety. In some instances, the dendritic type linker is used to increase the molar ratio of polynucleotide B to the binding moiety A. In some instances, the dendritic type linker comprises PAMAM dendrimers.

[0417] In some embodiments, the linker is a traceless linker or a linker in which after cleavage does not leave behind a linker moiety (e.g., an atom or a linker group) to a binding moiety A, a polynucleotide B, a polymer C, or an endosomolytic moiety D. Exemplary traceless linkers include, but are not limited to, germanium linkers, silicium linkers, sulfur linkers, selenium linkers, nitrogen linkers, phosphorus linkers, boron linkers, chromium linkers, or phenylhydrazide linker. In some cases, the linker is a traceless aryl- triazene linker as described in Hejesen, et al., "A traceless aryl-triazene linker for DNA-directed chemistry," Org Biomol Chem 11(15): 2493-2497 (2013). In some instances, the linker is a traceless linker described in Blaney, et al., 'Traceless solid-phase organic synthesis," Chem. Rev. 102: 2607-2024 (2002). In some instances, a linker is a traceless linker as described in U.S. Patent No. 6,821,783.

[0418] In some instances, the linker comprises a functional group that exerts steric hinderance at the site of bonding between the linker and a conjugating moiety (e.g., A, B, C, or D described herein). In some instances, the steric hinderance is a steric hindrance around a disulfide bond. Exemplary linkers that exhibit steric hinderance comprises a heterobiiuctional linker, such as a heterobiiuctional linker described above. In some cases, a linker that exhibits steric hinderance comprises SMCC and SPDB.

[0419] In some instances, the linker is an acid cleavable linker. In some instances, the acid cleavable linker comprises a hydrazone linkage, which is susceptible to hydrolytic cleavage. In some cases, the acid cleavable linker comprises a thiomaleamic acid linker. In some cases, the acid cleavable linker is a thiomaleamic acid linker as described in Castaneda, et al, "Acid-cleavable thiomaleamic acid linker for homogeneous antibody-drug conjugation," Chem. Commun. 49: 8187-8189 (2013).

[0420] In some instances, the linker is a linker described in U.S. Patent Nos. 6,884,869; 7,498,298;

8,288,352; 8,609, 105; or 8,697,688; U.S. Patent Publication Nos. 2014/0127239; 2013/028919;

2014/286970; 2013/0309256; 2015/037360; or 2014/0294851; or PCT Publication Nos. WO2015057699;

WO2014080251; WO2014197854; WO2014145090; or WO2014177042.

[0421] In some embodiments, X, Y, and L are independently a bond or a linker. In some instances, X, Y, and L are independently a bond. In some cases, X, Y, and L are independently a linker.

[0422] In some instances, X is a bond or a linker. In some instances, X is a bond. In some instances, X is a linker. In some instances, the linker is a Ci-C ₆ alkyl group. In some cases, X is a Ci-C ₆ alkyl group, such as for example, a C ₅ , C ₄ , C ₃ , C ₂ , or Ci alkyl group. In some cases, the Ci-C ₆ alkyl group is an unsubstituted Ci-C<5 alkyl group. As used in the context of a linker, and in particular in the context of X, alkyl means a saturated straight or branched hydrocarbon radical containing up to six carbon atoms. In some instances, X is a non-polymeric linker. In some instances, X includes a homobifuctional linker or a heterobiiuctional linker described supra. In some cases, X includes a heterobifunctional linker. In some cases, X includes sMCC. In other instances, X includes a heterobiiuctional linker optionally conjugated to a Ci-C ₆ alkyl group. In other instances, X includes sMCC optionally conjugated to a Ci-C ₆ alkyl group. In additional instances, X does not include a homobifuctional linker or a heterobifunctional linker described supra.

[0423] In some instances, Y is a bond or a linker. In some instances, Y is a bond. In other cases, Y is a linker. In some embodiments, Y is a Ci-C ₆ alkyl group. In some instances, Y is a homobifuctional linker or a heterobifunctional linker described supra. In some instances, Y is a homobifuctional linker described supra. In some instances, Y is a heterobifunctional linker described supra. In some instances, Y comprises a maleimide group, such as maleimidocaproyl (mc) or a self-stabilizing maleimide group described above. In some instances, Y comprises a peptide moiety, such as Val-Cit. In some instances, Y comprises a benzoic acid group, such as PABA. In additional instances, Y comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group. In additional instances, Y comprises a mc group. In additional instances, Y comprises a mc-val-cit group. In additional instances, Y comprises a val-cit-PABA group. In additional instances, Y comprises a mc-val-cit-PABA group.

[0424] In some instances, L is a bond or a linker. In some cases, L is a bond. In other cases, L is a linker. In some embodiments, L is a Ci-C ₆ alkyl group. In some instances, L is a homobifuctional linker or a heterobifunctional linker described supra. In some instances, L is a homobifuctional linker described supra. In some instances, L is a heterobifunctional linker described supra. In some instances, L comprises a maleimide group, such as maleimidocaproyl (mc) or a self-stabilizing maleimide group described above. In some instances, L comprises a peptide moiety, such as Val-Cit. In some instances, L comprises a benzoic acid group, such as PABA. In additional instances, L comprises a combination of a maleimide group, a peptide moiety, and/or a benzoic acid group. In additional instances, L comprises a mc group. In additional instances, L comprises a mc-val-cit group. In additional instances, L comprises a val-cit-PABA group. In additional instances, L comprises a mc- val-cit-PABA group.

Methods of Use

[0425] In some embodiments, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a disease or disorder. In some instances, the disease or disorder is a cancer. In some embodiments, a composition or a pharmaceutical formulation described herein is used as an immunotherapy for the treatment of a disease or disorder. In some instances, the immunotherapy is an immuno-oncology therapy.

Cancer

[0426] In some embodiments, a composition or a pharmaceutical formulation described herein is used for the treatment of cancer. In some instances, the cancer is a solid tumor. In some instances, the cancer is a hematologic malignancy. In some instances, the cancer is a relapsed or refractory cancer, or a metastatic cancer. In some instances, the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor. In some cases, the hematologic malignancy is a relapsed or refractory hematologic malignancy, or a metastatic hematologic malignancy.

[0427] In some embodiments, the cancer is a solid tumor. Exemplary solid tumor includes, but is not limited to, anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer.

[0428] In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a solid tumor. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of anal cancer, appendix cancer, bile duct cancer (i.e., cholangiocarcinoma), bladder cancer, brain tumor, breast cancer, cervical cancer, colon cancer, cancer of Unknown Primary (CUP), esophageal cancer, eye cancer, fallopian tube cancer, gastroenterological cancer, kidney cancer, liver cancer, lung cancer, medulloblastoma, melanoma, oral cancer, ovarian cancer, pancreatic cancer, parathyroid disease, penile cancer, pituitary tumor, prostate cancer, rectal cancer, skin cancer, stomach cancer, testicular cancer, throat cancer, thyroid cancer, uterine cancer, vaginal cancer, or vulvar cancer. In some instances, the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor.

[0429] In some instances, the cancer is a hematologic malignancy. In some instances, the hematologic malignancy is a leukemia, a lymphoma, a myeloma, a non-Hodgkin's lymphoma, or a Hodgkin's lymphoma. In some instances, the hematologic malignancy comprises chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, a non-CLL/SLL lymphoma, prolymphocyte leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt's lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B -lymphoblastic lymphoma, B cell prolymphocyte leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis.

[0430] In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a hematologic malignancy. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a leukemia, a lymphoma, a myeloma, a non-Hodgkin's lymphoma, or a Hodgkin's lymphoma. In some instances, the hematologic malignancy comprises chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, a non-CLL/SLL lymphoma, prolymphocyte leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt's lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B -lymphoblastic lymphoma, B cell prolymphocyte leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some cases, the hematologic malignancy is a relapsed or refractory hematologic malignancy, or a metastatic hematologic malignancy.

[0431] In some instances, the cancer is a KRAS -associated, EGFR-associated, AR-associated cancer, HPRT1 -associated cancer, or β-catenin associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a KRAS -associated, EGFR-associated, AR-associated cancer, HPRT1 -associated cancer, or β-catenin associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a KRAS -associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of an EGFR-associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of an AR-associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of an HPRT1 -associated cancer. In some instances, a composition or a pharmaceutical formulation described herein comprising a binding moiety conjugated to a polynucleic acid molecule and a polymer is used for the treatment of a β-catenin associated cancer. In some instances, the cancer is a solid tumor. In some instances, the cancer is a hematologic malignancy. In some instances, the solid tumor is a relapsed or refractory solid tumor, or a metastatic solid tumor. In some cases, the hematologic malignancy is a relapsed or refractory hematologic malignancy, or a metastatic hematologic malignancy. In some instances, the cancer comprises bladder cancer, breast cancer, colorectal cancer, endometrial cancer, esophageal cancer, glioblastoma multiforme, head and neck cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, thyroid cancer, acute myeloid leukemia, CLL, DLBCL, or multiple myeloma. In some instances, the β-catenin associated cancer further comprises PIK3C-associated cancer and/or MYC- associated cancer.

Immunotherapy

[0432] In some embodiments, a composition or a pharmaceutical formulation described herein is used as an immunotherapy for the treatment of a disease or disorder. In some instances, the immunotherapy is an immuno-oncology therapy. In some instances, immuno-oncology therapy is categorized into active, passive, or combinatory (active and passive) methods. In active immuno-oncology therapy method, for example, tumor-associated antigens (TAAs) are presented to the immune system to trigger an attack on cancer cells presenting these TAAs. In some instances, the active immune -oncology therapy method includes tumor- targeting and/or immune-targeting agents (e.g., checkpoint inhibitor agents such as monoclonal antibodies), and/or vaccines, such as in situ vaccination and/or cell-based or non-cell based (e.g., dendritic cell-based, tumor cell-based, antigen, anti-idiotype, DNA, or vector-based) vaccines. In some instances, the cell-based vaccines are vaccines which are generated using activated immune cells obtained from a patient's own immune system which are then activated by the patient's own cancer. In some instances, the active immune- oncology therapy is further subdivided into non-specific active immunotherapy and specific active immunotherapy. In some instances, non-specific active immunotherapy utilizes cytokines and/or other cell signaling components to induce a general immune system response. In some cases, specific active immunotherapy utilizes specific TAAs to elicite an immune response.

[0433] In some embodiments, a composition or a pharmaceutical formulation described herein is used as an active immuno-oncology therapy method for the treatment of a disease or disorder (e.g., cancer). In some embodiments, the composition or a pharmaceutical formulation described herein comprises a tumor- targeting agent. In some instances, the tumor-targeting agent is encompassed by a binding moiety A. In other instances, the tumor-targeting agent is an additional agent used in combination with a molecule of Formula (I). In some instances, the tumor-targeting agent is a tumor-directed polypeptide (e.g., a tumor- directed antibody). In some instances, the tumor-targeting agent is a tumor-directed antibody, which exerts its antitumor activity through mechanisms such as direct killing (e.g., signaling-induced apoptosis), complement-dependent cytotoxicity (CDC), and/or antibody-dependent cell-mediated cytotoxicity (ADCC). In additional instances, the tumor-targeting agent elicits an adaptive immune response, with the induction of antitumor T cells.

[0434] In some embodiments, the binding moiety A is a tumor -directed polypeptide (e.g., a tumor- directed antibody). In some instances, the binding moiety A is a tumor -directed antibody, which exerts its antitumor activity through mechanisms such as direct killing (e.g., signaling-induced apoptosis), complement-dependent cytotoxicity (CDC), and/or antibody-dependent cell-mediated cytotoxicity (ADCC). In additional instances, the binding moiety A elicits an adaptive immune response, with the induction of antitumor T cells.

[0435] In some embodiments, the composition or a pharmaceutical formulation described herein comprises an immune-targeting agent. In some instances, the immune -targeting agent is encompassed by a binding moiety A. In other instances, the immune -targeting agent is an additional agent used in combination with a molecule of Formula (I). In some instances, the immune -targeting agent comprises cytokines, checkpoint inhibitors, or a combination thereof.

[0436] In some embodiments, the immune-targeting agent is a checkpoint inhibitor. In some cases, an immune checkpoint molecule is a molecule presented on the cell surface of CD4 and/or CD8 T cells.

Exemplary immune checkpoint molecules include, but are not limited to, Programmed Death-Ligand 1 (PD- Ll, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, B7H1, B7H4, OX- 40, CD137, CD40, 2B4, IDOl, ID02, VISTA, CD27, CD28, PD-L2 (B7-DC, CD273), LAG3, CD80, CD86, PDL2, B7H3, HVEM, BTLA, KIR, GAL9, TIM3, A2aR, MARCO (macrophage receptor with collagenous structure), PS (phosphatidylserine), ICOS (inducible T cell costimulator), HAVCR2, CD276, VTCN1, CD70, and CD160.

[0437] In some instances, an immune checkpoint inhibitor refers to any molecule that modulates or inhibits the activity of an immune checkpoint molecule. In some instances, immune checkpoint inhibitors include antibodies, antibody-derivatives (e.g., Fab fragments, scFvs, minobodies, diabodies), antisense oligonucleotides, siRNA, aptamers, or peptides. In some embodiments, an immune checkpoint inhibitor is an inhibitor of Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137,CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDOl, ID02, ICOS (inducible T cell costimulator), KIR, LAIR1, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX- 40, SLAM, TIGHT, VISTA, VTCN1, or any combinations thereof.

[0438] In some embodiments, exemplary checkpoint inhibitors include: [0439] PD-L1 inhibitors such as Genentech's MPDL3280A (RG7446), Anti-mouse PD-L1 antibody Clone 10F.9G2 (Cat # BE0101) from BioXcell, anti-PD-Ll monoclonal antibody MDX-1 105 (BMS- 936559) and BMS-935559 from Bristol-Meyer's Squibb, MSB0010718C, mouse anti-PD-Ll Clone 29E.2A3, and AstraZeneca's MEDI4736;

[0440] PD-L2 inhibitors such as GlaxoSmithKline's AMP -224 (Amplimmune), and rHIgM12B7;

[0441] PD-1 inhibitors such as anti-mouse PD-1 antibody Clone J43 (Cat # BE0033-2) from BioXcell, anti-mouse PD-1 antibody Clone RMP 1-14 (Cat # BE0146) from BioXcell, mouse anti-PD-1 antibody Clone EH12, Merck's MK-3475 anti-mouse PD-1 antibody (Keytruda, pembrolizumab, lambrolizumab), AnaptysBio's anti-PD-1 antibody known as ANB01 1, antibody MDX-1 106 (ONO-4538), Bristol-Myers Squibb 's human IgG4 monoclonal antibody nivolumab (Opdivo®, BMS-936558, MDX1 106),

AstraZeneca's AMP-514 and AMP-224, and Pidilizumab (CT-01 1) from CureTech Ltd;

[0442] CTLA-4 inhibitors such as Bristol Meyers Squibb's anti-CTLA-4 antibody ipilimumab (also known as Yervoy®, MDX-010, BMS-734016 and MDX-101), anti-CTLA4 Antibody, clone 9H10 from Millipore, Pfizer's tremelimumab (CP-675,206, ticilimumab), and anti-CTLA4 antibody clone BNI3 from Abeam;

[0443] LAG3 inhibitors such as anti-Lag-3 antibody clone eBioC9B7W (C9B7W) from eBioscience, anti-Lag3 antibody LS-B2237 from LifeSpan Biosciences, IMP321 (ImmuFact) from Immutep, anti-Lag3 antibody BMS-986016, and the LAG-3 chimeric antibody A9H12;

[0444] B7-H3 inhibitors such as MGA271 ;

[0445] KIR inhibitors such as Lirilumab (IPH2101);

[0446] CD 137 (41BB) inhibitors such as urelumab (BMS-663513, Bristol-Myers Squibb), PF-05082566 (anti-4-lBB, PF-2566, Pfizer), or XmAb-5592 (Xencor);

[0447] PS inhibitors such as Bavituximab;

[0448] and inhibitors such as an antibody or fragments (e.g., a monoclonal antibody, a human, humanized, or chimeric antibody) thereof, RNAi molecules, or small molecules to TIM3, CD52, CD30, CD20, CD33, CD27, OX40 (CD 134), GITR, ICOS, BTLA (CD272), CD 160, 2B4, LAIRl, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM.

[0449] In some embodiments, a binding moiety A comprising an immune checkpoint inhibitor is used for the treatment of a disease or disorder (e.g., cancer). In some instances, the binding moiety A is a bispecific antibody or a binding fragment thereof that comprises an immune checkpoint inhibitor. In some cases, a binding moiety A comprising an inhibitor of Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD 137,CD 160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDO l, ID02, ICOS (inducible T cell costimulator), KIR, LAIRl, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX- 40, SLAM, TIGHT, VISTA, VTCN1, or any combinations thereof, is used for the treatment of a disease or disorder (e.g., cancer). [0450] In some embodiments, a molecule of Formula (I) in combination with an immune checkpoint inhibitor is used for the treatment of a disease or disorder (e.g., cancer). In some instances, the immune checkpoint inhibitor comprises an inhibitor of Programmed Death-Ligand 1 (PD-L1, also known as B7-H1, CD274), Programmed Death 1 (PD-1), CTLA-4, PD-L2 (B7-DC, CD273), LAG3, TIM3, 2B4, A2aR, B7H1, B7H3, B7H4, BTLA, CD2, CD27, CD28, CD30, CD40, CD70, CD80, CD86, CD137,CD160, CD226, CD276, DR3, GAL9, GITR, HAVCR2, HVEM, IDOl, ID02, ICOS (inducible T cell costimulator), KIR, LAIRl, LIGHT, MARCO (macrophage receptor with collageneous structure), PS (phosphatidylserine), OX- 40, SLAM, TIGHT, VISTA, VTCN1, or any combinations thereof. In some cases, a molecule of Formula (I) is used in combination with ipilimumab, tremelimumab, nivolumab, pemrolizumab, pidilizumab, MPDL3280A, MEDI4736, MSB0010718C, MK-3475, or BMS-936559, for the treatment of a disease or disorder (e.g., cancer).

[0451] In some embodiments, the immune-targeting agent is a cytokine. In some cases, cytokine is further subgrouped into chemokine, interferon, interleukin, and tumor necrosis factor. In some embodiments, chemokine plays a role as a chemoattractant to guide the migration of cells, and is classified into four subfamilies: CXC, CC, CX3C, and XC. Exemplary chemokines include chemokines from the CC subfamily: CCL1, CCL2 (MCP-1), CCL3, CCL4, CCL5 (RANTES), CCL6, CCL7, CCL8, CCL9 (or CCL10), CCL11 , ( CI.12. CCL I . (CI . 14. CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, i t 1.21 ( CI .23. CCL24, CCL25, CCL26, CCL27, and CCL28; the CXC subfamily: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCLIO, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, and CXCL17: the XC subfamily: XCL1 and XCL2; and the CX3C subfamily CX3CL1.

[0452] Interferon (IFNs) comprises interferon type I (e.g. IFN-a, IFN-β, IFN-ε, IFN-κ, and IFN-ω), interferon type II (e.g. IFN-γ), and interferon type ITT. In some embodiments, IFN-a is further classified into about 13 subtypes which include IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IF A13, IF A14, IF A16, IF A17, and IFNA21.

[0453] interleukin is expressed by leukocyte or white blood cell and promote the development and differentiation of T and B lymphocytes and hematopoietic cells. Exemplary interleukins include IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 (CXCL8), IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL- 18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-3 L IL-32, IL-33, IL-35, and IL-36.

[0454] Tumor necrosis factors (TNFs) are a group of cytokines that modulate apoptosis. In some instances, there are about 19 members within the TNF family, including, not limited to, TNFcc, lymphotoxin- aipha (LT-alpha), lymphotoxin-beta (LT-beta), T cell antigen gp39 (CD40L), CD27L, CD30L, FASL, 4- 1BBL, OX40L, and TNF-related apoptosis inducing ligand (TRAIL).

[0455] In some embodiments, a molecule of Formula (I) in combination with a cytokine is used for the treatment of a disease or disorder (e.g., cancer). In some cases, a molecule of Formula (I) in combination with a chemokine is used for the treatment of a disease or disorder (e.g., cancer). In some cases, a molecule of Formula (I) in combination with an interferon is used for the treatment of a disease or disorder (e.g., cancer). In some cases, a molecule of Formula (I) in combination with an interleukin is used for the treatment of a disease or disorder (e.g., cancer). In some cases, a molecule of Formula (I) in combination with a tumor necrosis factor is used for the treatment of a disease or disorder (e.g., cancer). In some instances, a molecule of Formula (I) in combination with IL-Ιβ, IL-2, IL-7, IL-8, IL-15, MCP-1 (CCL2), MIP-la, RANTES, MCP-3, MIP5, CCL19, CCL21, CXCL2, CXCL9, CXCLIO, or CXCLl l is used for the treatment of a disease or disorder (e.g., cancer).

[0456] In some embodiments, the composition or a pharmaceutical formulation described herein comprises a vaccine. In some instances, the vaccine is an in situ vaccination. In some instances, the vaccine is a cell-based vaccine. In some instances, the vaccine is a non-cell based vaccine. In some instances, a molecule of Formula (I) in combination with dendritic cell-based vaccine is used for the treatment of a disease or disorder (e.g., cancer). In some instances, a molecule of Formula (I) in combination with tumor cell-based vaccine is used for the treatment of a disease or disorder (e.g., cancer). In some instances, a molecule of Formula (I) in combination with antigen vaccine is used for the treatment of a disease or disorder (e.g., cancer). In some instances, a molecule of Formula (I) in combination with anti-idiotype vaccine is used for the treatment of a disease or disorder (e.g., cancer). In some instances, a molecule of Formula (I) in combination with DNA vaccine is used for the treatment of a disease or disorder (e.g., cancer). In some instances, a molecule of Formula (I) in combination with vector-based vaccine is used for the treatment of a disease or disorder (e.g., cancer).

[0457] In some embodiments, a composition or a pharmaceutical formulation described herein is used as a passive immuno-oncology therapy method for the treatment of a disease or disorder (e.g., cancer). The passive method, in some instances, utilizes adoptive immune system components such as T cells, natural killer (NK) T cells, and/or chimeric antigen receptor (CAR) T cells generated exogenously to attack cancer cells.

[0458] In some embodiments, a molecule of Formula (I) in combination with a T-cell based therapeutic agent is used for the treatment of a disease or disorder (e.g., cancer). In some cases, the T-cell based therapeutic agent is an activated T-cell agent that recognizes one or more of a CD cell surface marker described above. In some instances, the T-cell based therapeutic agent comprises an activated T-cell agent that recognizes one or more of CD2, CD3, CD4, CD5, CD8, CD27, CD28, CD80, CD134, CD137, CD152, CD 154, CD 160, CD200R, CD223, CD226, CD244, CD258, CD267, CD272, CD274, CD278, CD279, or CD357. In some instances, a molecule of Formula (I) in combination with an activated T-cell agent recognizing one or more of CD2, CD3, CD4, CD5, CD8, CD27, CD28, CD80, CD134, CD137, CD152, CD 154, CD 160, CD200R, CD223, CD226, CD244, CD258, CD267, CD272, CD274, CD278, CD279, or CD357 is used for the treatment of a disease or disorder (e.g., cancer).

[0459] In some embodiments, a molecule of Formula (I) in combination with natural killer (NK) T cell- based therapeutic agent is used for the treatment of a disease or disorder (e.g., cancer). In some instances, the NK-based therapeutic agent is an activated NK agent that recognizes one or more of a CD cell surface marker described above. In some cases, the NK-based therapeutic agent is an activated NK agent that recognizes one or more of CD2, CDl la, CDl lb, CD16, CD56, CD58, CD62L, CD85j, CD158a/b, CD158c, CD158e/f/k, CD158h/j, CD159a, CD162, CD226, CD314, CD335, CD337, CD244, or CD319. In some instances, a molecule of Formula (I) in combination with an activated NK agent recognizing one or more of CD2, CDl la, CDl lb, CD16, CD56, CD58, CD62L, CD85j, CD158a/b, CD158c, CD158e/f/k, CD158h/j, CD159a, CD162, CD226, CD314, CD335, CD337, CD244, or CD319 is used for the treatment of a disease or disorder (e.g., cancer).

[0460] In some embodiments, a molecule of Formula (I) in combination with CAR-T cell-based therapeutic agent is used for the treatment of a disease or disorder (e.g., cancer).

[0461] In some embodiments, a molecule of Formula (I) in combination with an additional agent that destabilizes the endosomal membrane (or disrupts the endosomal -lysosomal membrane trafficking) is used for the treatment of a disease or disorder (e.g., cancer). In some instances, the additional agent comprises an antimitotic agent. Exemplary antimitotic agents include, but are not limited to, taxanes such as paclitaxel and docetaxel; vinca alkaloids such as vinblastine, vincristine, vindesine, and vinorelbine; cabazitaxel;

colchicine; eribulin; estramustine; etoposide; ixabepilone; podophyllotoxin; teniposide; or griseofulvin. In some instances, the additional agent comprises paclitaxel, docetaxel, vinblastine, vincristine, vindesine, vinorelbine, cabazitaxel, colchicine, eribulin, estramustine, etoposide, ixabepilone, podophyllotoxin, teniposide, or griseofulvin. In some instances, the additional agent comprises taxol. In some instances, the additional agent comprises paclitaxel. In some instances, the additional agent comprises etoposide. In other instances, the additional agent comprises vitamin K3.

[0462] In some embodiments, a composition or a pharmaceutical formulation described herein is used as a combinatory method (including for both active and passive methods) in the treatment of a disease or disorder (e.g., cancer).

Pharmaceutical Formulation

[0463] In some embodiments, the pharmaceutical formulations described herein are administered to a subject by multiple administration routes, including but not limited to, parenteral (e.g., intravenous, subcutaneous, intramuscular), oral, intranasal, buccal, rectal, or transdermal administration routes. In some instances, the pharmaceutical composition describe herein is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular) administration. In other instances, the pharmaceutical composition describe herein is formulated for oral administration. In still other instances, the pharmaceutical composition describe herein is formulated for intranasal administration.

[0464] In some embodiments, the pharmaceutical formulations include, but are not limited to, aqueous liquid dispersions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid dosage forms, powders, immediate-release formulations, controlled-release formulations, fast melt formulations, tablets, capsules, pills, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations (e.g., nanoparticle formulations), and mixed immediate and controlled release formulations. [0465] In some instances, the pharmaceutical formulation includes multiparticulate formulations. In some instances, the pharmaceutical formulation includes nanoparticle formulations. In some instances, nanoparticles comprise cMAP, cyclodextrin, or lipids. In some cases, nanoparticles comprise solid lipid nanoparticles, polymeric nanoparticles, self-emulsifying nanoparticles, liposomes, microemulsions, or mi cellar solutions. Additional exemplary nanoparticles include, but are not limited to, paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanofibers, nanohorns, nano- onions, nanorods, nanoropes and quantum dots. In some instances, a nanoparticle is a metal nanoparticle, e.g., a nanoparticle of scandium, titanium, vanadium, chromium, manganese, iron, cobalt, nickel, copper, zinc, yttrium, zirconium, niobium, molybdenum, ruthenium, rhodium, palladium, silver, cadmium, hafnium, tantalum, tungsten, rhenium, osmium, iridium, platinum, gold, gadolinium, aluminum, gallium, indium, tin, thallium, lead, bismuth, magnesium, calcium, strontium, barium, lithium, sodium, potassium, boron, silicon, phosphorus, germanium, arsenic, antimony, and combinations, alloys or oxides thereof.

[0466] In some instances, a nanoparticle includes a core or a core and a shell, as in a core-shell nanoparticle.

[0467] In some instances, a nanoparticle is further coated with molecules for attachment of functional elements (e.g., with one or more of a polynucleic acid molecule or binding moiety described herein). In some instances, a coating comprises chondroitin sulfate, dextran sulfate, carboxymethyl dextran, alginic acid, pectin, carragheenan, fucoidan, agaropectin, porphyran, karaya gum, gellan gum, xanthan gum, hyaluronic acids, glucosamine, galactosamine, chitin (or chitosan), polyglutamic acid, polyaspartic acid, lysozyme, cytochrome C, ribonuclease, trypsinogen, chymotrypsinogen, a-chymotrypsin, polylysine, polyarginine, histone, protamine, ovalbumin, dextrin, or cyclodextrin. In some instances, a nanoparticle comprises a graphene-coated nanoparticle.

[0468] In some cases, a nanoparticle has at least one dimension of less than about 500nm, 400nm, 300nm, 200nm, or lOOnm.

[0469] In some instances, the nanoparticle formulation comprises paramagnetic nanoparticles, superparamagnetic nanoparticles, metal nanoparticles, fullerene-like materials, inorganic nanotubes, dendrimers (such as with covalently attached metal chelates), nanofibers, nanohorns, nano -onions, nanorods, nanoropes or quantum dots. In some instances, a polynucleic acid molecule or a binding moiety described herein is conjugated either directly or indirectly to the nanoparticle. In some instances, at least 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more polynucleic acid molecules or binding moieties described herein are conjugated either directly or indirectly to a nanoparticle.

[0470] In some embodiments, the pharmaceutical formulations include a carrier or carrier materials selected on the basis of compatibility with the composition disclosed herein, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like. Pharmaceutically compatible carrier materials include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrolidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of

Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington 's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage .Forms and Drug Delivery Systems, Seventh Ed. (Lippincott Williams & Wilkinsl999).

[0471] In some instances, the pharmaceutical formulations further include pH-adjusting agents or buffering agents which include acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.

[0472] In some instances, the pharmaceutical formulation includes one or more salts in an amount required to bring osmolality of the composition into an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.

[0473] In some instances, the pharmaceutical formulations further include diluent which are used to stabilize compounds because they can provide a more stable environment. Salts dissolved in buffered solutions (which also can provide pH control or maintenance) are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution. In certain instances, diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling. Such compounds can include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as Avicel ^® ; dibasic calcium phosphate, dicalcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugar, such as Di- Pac ^® (Amstar); mannitol, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner's sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like.

[0474] In some cases, the pharmaceutical formulations include disintegration agents or disintegrants to facilitate the breakup or disintegration of a substance. The term "disintegrate" include both the dissolution and dispersion of the dosage form when contacted with gastrointestinal fluid. Examples of disintegration agents include a starch, e.g., a natural starch such as corn starch or potato starch, a pregelatinized starch such as National 1551 or Amijel ^® , or sodium starch glycolate such as Promogel ^® or Explotab ^® , a cellulose such as a wood product, methylcrystalline cellulose, e.g., Avicel , Avicel ^® PHlO l, Avicel ^® PH102, Avicel ^® PH105, Elcema ^® P I 00, Emcocel ^® , Vivacel ^® , Ming Tia ^® , and Solka-Floc ^® , methyl cellulose, croscarmellose, or a cross-linked cellulose, such as cross-linked sodium carboxymethylcellulose (Ac-Di-Sol ^® ), cross-linked carboxymethylcellulose, or cross-linked croscarmellose, a cross-linked starch such as sodium starch glycolate, a cross-linked polymer such as crospovidone, a cross -linked polyvinylpyrrolidone, alginate such as alginic acid or a salt of alginic acid such as sodium alginate, a clay such as Veegum ^® HV (magnesium aluminum silicate), a gum such as agar, guar, locust bean, Karaya, pectin, or tragacanth, sodium starch glycolate, bentonite, a natural sponge, a surfactant, a resin such as a cation-exchange resin, citrus pulp, sodium lauryl sulfate, sodium lauryl sulfate in combination starch, and the like.

[0475] In some instances, the pharmaceutical formulations include filling agents such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like.

[0476] Lubricants and glidants are also optionally included in the pharmaceutical formulations described herein for preventing, reducing or inhibiting adhesion or friction of materials. Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (Sterotex ^® ), higher fatty acids and their alkali- metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, Stearowet ^® , boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a methoxypolyethylene glycol such as Carbowax™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as Syloid™, Cab-O-Sil ^® , a starch such as corn starch, silicone oil, a surfactant, and the like.

[0477] Plasticizers include compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. Plasticizers can also function as dispersing agents or wetting agents.

[0478] Solubilizers include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium doccusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N- hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, dimethyl isosorbide, and the like.

[0479] Stabilizers include compounds such as any antioxidation agents, buffers, acids, preservatives and the like.

[0480] Suspending agents include compounds such as polyvinylpyrrolidone, e.g., polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate,

polyethoxylated sorbitan monolaurate, povidone and the like.

[0481] Surfactants include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., Pluronic ^® (BASF), and the like. Additional surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g. , polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkyl ethers and alkylphenyl ethers, e.g. , octoxynol 10, octoxynol 40. Sometimes, surfactants is included to enhance physical stability or for other purposes.

[0482] Viscosity enhancing agents include, e.g., methyl cellulose, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.

[0483] Wetting agents include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium doccusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.

Therapeutic Regimens

[0484] In some embodiments, the pharmaceutical compositions described herein are administered for therapeutic applications. In some embodiments, the pharmaceutical composition is administered once per day, twice per day, three times per day or more. The pharmaceutical composition is administered daily, every day, every alternate day, five days a week, once a week, every other week, two weeks per month, three weeks per month, once a month, twice a month, three times per month, or more. The pharmaceutical composition is administered for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 1 1 months, 12 months, 18 months, 2 years, 3 years, or more.

[0485] In some embodiments, one or more pharmaceutical compositions are administered simutaneously, sequentially, or at an interval period of time. In some embodiments, one or more pharmaceutical compositions are administered simutaneously. In some cases, one or more pharmaceutical compositions are administered sequentially. In additional cases, one or more pharmaceutical compositions are administered at an interval period of time (e.g., the first administration of a first pharmaceutical composition is on day one followed by an interval of at least 1, 2, 3, 4, 5, or more days prior to the administration of at least a second pharmaceutical composition).

[0486] In some embodiments, two or more different pharmaceutical compositions are coadministered. In some instances, the two or more different pharmaceutical compositions are coadministered simutaneously. In some cases, the two or more different pharmaceutical compositions are coadministered sequentially without a gap of time between administrations. In other cases, the two or more different pharmaceutical compositions are coadministered sequentially with a gap of about 0.5 hour, 1 hour, 2 hour, 3 hour, 12 hours, 1 day, 2 days, or more between administrations.

[0487] In the case wherein the patient's status does improve, upon the doctor's discretion the administration of the composition is given continuously; alternatively, the dose of the composition being administered is temporarily reduced or temporarily suspended for a certain length of time (i.e., a "drug holiday"). In some instances, the length of the drug holiday varies between 2 days and 1 year, including by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, 35 days, 50 days, 70 days, 100 days, 120 days, 150 days, 180 days, 200 days, 250 days, 280 days, 300 days, 320 days, 350 days, or 365 days. The dose reduction during a drug holiday is from 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0488] Once improvement of the patient's conditions has occurred, a maintenance dose is administered if necessary. Subsequently, the dosage or the frequency of administration, or both, are optionally reduced, as a function of the symptoms, to a level at which the improved disease, disorder or condition is retained.

[0489] In some embodiments, the amount of a given agent that correspond to such an amount varies depending upon factors such as the particular compound, the severity of the disease, the identity (e.g., weight) of the subject or host in need of treatment, but nevertheless is routinely determined in a manner known in the art according to the particular circumstances surrounding the case, including, e.g., the specific agent being administered, the route of administration, and the subject or host being treated. In some instances, the desired dose is conveniently presented in a single dose or as divided doses administered simultaneously (or over a short period of time) or at appropriate intervals, for example as two, three, four or more sub-doses per day.

[0490] The foregoing ranges are merely suggestive, as the number of variables in regard to an individual treatment regime is large, and considerable excursions from these recommended values are not uncommon. Such dosages are altered depending on a number of variables, not limited to the activity of the compound used, the disease or condition to be treated, the mode of administration, the requirements of the individual subject, the severity of the disease or condition being treated, and the judgment of the practitioner.

[0491] In some embodiments, toxicity and therapeutic efficacy of such therapeutic regimens are determined by standard pharmaceutical procedures in cell cultures or experimental animals, including, but not limited to, the determination of the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between the toxic and therapeutic effects is the therapeutic index and it is expressed as the ratio between LD50 and ED50. Compounds exhibiting high therapeutic indices are preferred. The data obtained from cell culture assays and animal studies are used in formulating a range of dosage for use in human. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with minimal toxicity. The dosage varies within this range depending upon the dosage form employed and the route of administration utilized.

Kits/Article of Manufacture

[0492] Disclosed herein, in certain embodiments, are kits and articles of manufacture for use with one or more of the compositions and methods described herein. Such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the containers are formed from a variety of materials such as glass or plastic.

[0493] The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.

[0494] For example, the container(s) include a molecule of Formula (I): A-X-B-Y-C, optionally conjugated to an endosomolytic moiety D as disclosed herein. Such kits optionally include an identifying description or label or instructions relating to its use in the methods described herein.

[0495] A kit typically includes labels listing contents and/or instructions for use and package inserts with instructions for use. A set of instructions will also typically be included.

[0496] In one embodiment, a label is on or associated with the container. In one embodiment, a label is on a container when letters, numbers, or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. In one embodiment, a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.

[0497] In certain embodiments, the pharmaceutical compositions are presented in a pack or dispenser device which contains one or more unit dosage forms containing a compound provided herein. The pack, for example, contains metal or plastic foil, such as a blister pack. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser is also accompanied with a notice associated with the container in form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the drug for human or veterinary administration. Such notice, for example, is the labeling approved by the U.S. Food and Drug Administration for prescription drugs, or the approved product insert. In one embodiment, compositions containing a compound provided herein formulated in a compatible pharmaceutical carrier are also prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.

Certain Terminology

[0498] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subject matter belongs. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of any subject matter claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. In this application, the use of "or" means "and/or" unless stated otherwise. Furthermore, use of the term "including" as well as other forms, such as "include", "includes," and "included," is not limiting.

[0499] As used herein, ranges and amounts can be expressed as "about" a particular value or range. About also includes the exact amount. Hence "about 5 μΙ ' means "about 5 μΙ ' and also "5 μί." Generally, the term "about" includes an amount that is expected to be within experimental error.

[0500] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0501] As used herein, the terms "individual(s)", "subject(s)" and "patient(s)" mean any mammal. In some embodiments, the mammal is a human. In some embodiments, the mammal is a non -human. None of the terms require or are limited to situations characterized by the supervision (e.g. constant or intermittent) of a health care worker (e.g. a doctor, a registered nurse, a nurse practitioner, a physician's assistant, an orderly or a hospice worker).

EXAMPLES

[0502] These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.

Example 1. Sequences

[0503] Tables 1, 4, 7, 8, and 10 illustrate target sequences described herein. Tables 2, 3, 5, 6, 9, 11 , and 12 illustrate polynucleic acid molecule sequences described herein.

Table 1. KRAS Tar et Se uences

226 226-244 GGCAAGAGUGCCUUGACGAUACA 5

227 227-245 GCAAGAGUGCCUUGACGAUACAG 6

228 228-246 CAAGAGUGCCUUGACGAUACAGC 7

232 232-250 AGUGCCUUGACGAUACAGCUAAU 8

233 233-251 GUGCCUUGACGAUACAGCUAAUU 9

236 236-254 CCUUGACGAUACAGCUAAUUCAG 10

237 237-255 CUUGACGAUACAGCUAAUUCAGA 11

245 245-263 UACAGCUAAUUCAGAAUCAUUUU 12

266 266-284 UUGUGGACGAAUAUGAUCCAACA 13

269 269-287 UGGACGAAUAUGAUCCAACAAUA 14

270 270-288 GGACGAAUAUGAUCCAACAAUAG 15

Table 2. KRAS siRNA sequences

Table 3. KRAS siRNA Se uences with Chemical Modification

AfcUfuGfdTsdT cAfudTsdT

ugAfcUfgAfaUfaUfaAfa AfCfaAfgUfiiUfaUfaUfuCfaGf

183 183-201 48 49

CfuUfgUfdTsdT uCfadTsdT

cuUfgUfgGfuAfgUfuGf CfAfgCfuCfcAfaCfuAfcCfaCfa

197 197-215 50 51 gAfgCfuGfdTsdT AfgdTsdT

ggCfaAfgAfgUfgCfcUfu UfCfgUfcAfaGfgCfaCfuCfuUfg

224 224-242 52 53

GfaCfgAfdTsdT CfcdTsdT

caAfgAfgUfgCfcUfuGfa UfAfiiCfgUfcAfaGfgCfaCfiiCfu

226 226-244 54 55

CfgAfuAfdTsdT UfgdTsdT

aaGfaGfuGfcCfuUfgAfc GfUfaUfcGfiiCfaAfgGfcAfcUfc

227 227-245 56 57

GfaUfaCfdTsdT UfudTsdT

agAfgUfgCfcUfuGfaCfg UfGfiiAfuCfgUfcAfaGfgCfaCf

228 228-246 58 59

AfuAfcAfdTsdT uCfudTsdT

ugCfcUfuGfaCfgAfuAfc UfAfgCfiiGfiiAfuCfgUfcAfaGf

232 232-250 60 61

AfgCfuAfdTsdT gCfadTsdT

gcCfuUfgAfcGfaUfaCfa UfUfaGfcUfgUfaUfcGfuCfaAf

233 233-251 62 63

GfcUfaAfdTsdT gGfcdTsdT

uuGfaCfgAfuAfcAfgCfu GfAfaUfuAfgCfuGfuAfuCfgUf

236 236-254 64 65

AfaUfuCfdTsdT cAfadTsdT

ugAfcGfaUfaCfaGfcUfa UfGfaAfuUfaGfcUfgUfaUfcGf

237 237-255 66 67

AfuUfcAfdTsdT uCfadTsdT

caGfcUfaAfuUfcAfgAfa AfAfuGfaUfuCfuGfaAfuUfaGf

245 245-263 68 69

UfcAfuUfdTsdT cUfgdTsdT

guGfgAfcGfaAfuAfuGfa UfUfgGfaUfcAfiiAfiiUfcGfuCf

266 266-284 70 71

UfcCfaAfdTsdT cAfcdTsdT

gaCfgAfaUfaUfgAfuCfc UfUfgUfuGfgAfuCfaUfaUfuCf

269 269-287 72 73

AfaCfaAfdTsdT gUfcdTsdT

acGfaAfuAfuGfaUfcCfa AfUfiiGfiiUfgGfaUfcAfuAfuUf

270 270-288 74 75

AfcAfaUfdTsdT cGfudTsdT

siR A Sequence with Chemica Modification Info

lower case (n) = 2'-0-Me; Nf = 2'-F; dT = deoxy-T residue;

s = phosphorothioate backbone modification; iB = inverted abasic

Table 4 EGFR Target Seq uences

124 124-142 GGCCACCUCGUCGGCGUCCGCCC 93

125 125-143 GCCACCUCGUCGGCGUCCGCCCG 94

126 126-144 CCACCUCGUCGGCGUCCGCCCGA 95

127 127-145 CACCUCGUCGGCGUCCGCCCGAG 96

128 128-146 ACCUCGUCGGCGUCCGCCCGAGU 97

129 129-147 CCUCGUCGGCGUCCGCCCGAGUC 98

130 130-148 CUCGUCGGCGUCCGCCCGAGUCC 99

131 131-149 UCGUCGGCGUCCGCCCGAGUCCC 100

132 132-150 CGUCGGCGUCCGCCCGAGUCCCC 101

135 135-153 CGGCGUCCGCCCGAGUCCCCGCC 102

136 136-154 GGCGUCCGCCCGAGUCCCCGCCU 103

141 141-159 CCGCCCGAGUCCCCGCCUCGCCG 104

164 164-182 CCAACGCCACAACCACCGCGCAC 105

165 165-183 CAACGCCACAACCACCGCGCACG 106

166 166-184 AACGCCACAACCACCGCGCACGG 107

168 168-186 CGCCACAACCACCGCGCACGGCC 108

169 169-187 GCCACAACCACCGCGCACGGCCC 109

170 170-188 CCACAACCACCGCGCACGGCCCC 110

247 247-265 CGAUGCGACCCUCCGGGACGGCC 111

248 248-266 GAUGCGACCCUCCGGGACGGCCG 112

249 249-267 AUGCGACCCUCCGGGACGGCCGG 113

251 251-269 GCGACCCUCCGGGACGGCCGGGG 114

252 252-270 CGACCCUCCGGGACGGCCGGGGC 115

254 254-272 ACCCUCCGGGACGGCCGGGGCAG 116

329 329-347 AAAGAAAGUUUGCCAAGGCACGA 117

330 330-348 AAGAAAGUUUGCCAAGGCACGAG 118

332 332-350 GAAAGUUUGCCAAGGCACGAGUA 119

333 333-351 AAAGUUUGCCAAGGCACGAGUAA 120

334 334-352 AAGUUUGCCAAGGCACGAGUAAC 121

335 335-353 AGUUUGCCAAGGCACGAGUAACA 122

336 336-354 GUUUGCCAAGGCACGAGUAACAA 123

337 337-355 UUUGCCAAGGCACGAGUAACAAG 124

338 338-356 UUGCCAAGGCACGAGUAACAAGC 125

361 361-379 UCACGCAGUUGGGCACUUUUGAA 126

362 362-380 CACGCAGUUGGGCACUUUUGAAG 127

363 363-381 ACGCAGUUGGGCACUUUUGAAGA 128

364 364-382 CGCAGUUGGGCACUUUUGAAGAU 129

365 365-383 GCAGUUGGGCACUUUUGAAGAUC 130

366 366-384 CAGUUGGGCACUUUUGAAGAUCA 131

367 367-385 AGUUGGGCACUUUUGAAGAUCAU 132

368 368-386 GUUGGGCACUUUUGAAGAUCAUU 133

369 369-387 UUGGGCACUUUUGAAGAUCAUUU 134

377 377-395 UUUUGAAGAUCAUUUUCUCAGCC 135

379 379-397 UUGAAGAUCAUUUUCUCAGCCUC 136

380 380-398 UGAAGAUCAUUUUCUCAGCCUCC 137

385 385-403 AUCAUUUUCUCAGCCUCCAGAGG 138

394 394-412 UCAGCCUCCAGAGGAUGUUCAAU 139

396 396-414 AGCCUCCAGAGGAUGUUCAAUAA 140

397 397-415 GCCUCCAGAGGAUGUUCAAUAAC 141

401 401-419 CCAGAGGAUGUUCAAUAACUGUG 142

403 403-421 AGAGGAUGUUCAAUAACUGUGAG 143

407 407-425 GAUGUUCAAUAACUGUGAGGUGG 144 409 409-427 UGUUCAAUAACUGUGAGGUGGUC 145

410 410-428 GUUCAAUAACUGUGAGGUGGUCC 146

411 411-429 UUCAAUAACUGUGAGGUGGUCCU 147

412 412-430 UCAAUAACUGUGAGGUGGUCCUU 148

413 413-431 CAAUAACUGUGAGGUGGUCCUUG 149

414 414-432 AAUAACUGUGAGGUGGUCCUUGG 150

416 416-434 UAACUGUGAGGUGGUCCUUGGGA 151

418 418-436 ACUGUGAGGUGGUCCUUGGGAAU 152

419 419-437 CUGUGAGGUGGUCCUUGGGAAUU 153

425 425-443 GGUGGUCCUUGGGAAUUUGGAAA 154

431 431-449 CCUUGGGAAUUUGGAAAUUACCU 155

432 432-450 CUUGGGAAUUUGGAAAUUACCUA 156

433 433-451 UUGGGAAUUUGGAAAUUACCUAU 157

434 434-452 UGGGAAUUUGGAAAUUACCUAUG 158

458 458-476 GCAGAGGAAUUAUGAUCUUUCCU 159

459 459-477 CAGAGGAAUUAUGAUCUUUCCUU 160

463 463-481 GGAAUUAUGAUCUUUCCUUCUUA 161

464 464-482 GAAUUAUGAUCUUUCCUUCUUAA 162

466 466-484 AUUAUGAUCUUUCCUUCUUAAAG 163

468 468-486 UAUGAUCUUUCCUUCUUAAAGAC 164

471 471-489 GAUCUUUCCUUCUUAAAGACCAU 165

476 476-494 UUCCUUCUUAAAGACCAUCCAGG 166

477 477-495 UCCUUCUUAAAGACCAUCCAGGA 167

479 479-497 CUUCUUAAAGACCAUCCAGGAGG 168

481 481-499 UCUUAAAGACCAUCCAGGAGGUG 169

482 482-500 CUUAAAGACCAUCCAGGAGGUGG 170

492 492-510 AUCCAGGAGGUGGCUGGUUAUGU 171

493 493-511 UCCAGGAGGUGGCUGGUUAUGUC 172

494 494-512 CCAGGAGGUGGCUGGUUAUGUCC 173

495 495-513 CAGGAGGUGGCUGGUUAUGUCCU 174

496 496-514 AGGAGGUGGCUGGUUAUGUCCUC 175

497 497-515 GGAGGUGGCUGGUUAUGUCCUCA 176

499 499-517 AGGUGGCUGGUUAUGUCCUCAUU 177

520 520-538 UUGCCCUCAACACAGUGGAGCGA 178

542 542-560 AAUUCCUUUGGAAAACCUGCAGA 179

543 543-561 AUUCCUUUGGAAAACCUGCAGAU 180

550 550-568 UGGAAAACCUGCAGAUCAUCAGA 181

551 551-569 GGAAAACCUGCAGAUCAUCAGAG 182

553 553-571 AAAACCUGCAGAUCAUCAGAGGA 183

556 556-574 ACCUGCAGAUCAUCAGAGGAAAU 184

586 586-604 ACGAAAAUUCCUAUGCCUUAGCA 185

587 587-605 CGAAAAUUCCUAUGCCUUAGCAG 186

589 589-607 AAAAUUCCUAUGCCUUAGCAGUC 187

592 592-610 AUUCCUAUGCCUUAGCAGUCUUA 188

593 593-611 UUCCUAUGCCUUAGCAGUCUUAU 189

594 594-612 UCCUAUGCCUUAGCAGUCUUAUC 190

596 596-614 CUAUGCCUUAGCAGUCUUAUCUA 191

597 597-615 UAUGCCUUAGCAGUCUUAUCUAA 192

598 598-616 AUGCCUUAGCAGUCUUAUCUAAC 193

599 599-617 UGCCUUAGCAGUCUUAUCUAACU 194

600 600-618 GCCUUAGCAGUCUUAUCUAACUA 195

601 601-619 CCUUAGCAGUCUUAUCUAACUAU 196 602 602-620 CUUAGCAGUCUUAUCUAACUAUG 197

603 603-621 UUAGCAGUCUUAUCUAACUAUGA 198

604 604-622 UAGCAGUCUUAUCUAACUAUGAU 199

605 605-623 AGCAGUCUUAUCUAACUAUGAUG 200

608 608-626 AGUCUUAUCUAACUAUGAUGCAA 201

609 609-627 GUCUUAUCUAACUAUGAUGCAAA 202

610 610-628 UCUUAUCUAACUAUGAUGCAAAU 203

611 611-629 CUUAUCUAACUAUGAUGCAAAUA 204

612 612-630 UUAUCUAACUAUGAUGCAAAUAA 205

613 613-631 UAUCUAACUAUGAUGCAAAUAAA 206

614 614-632 AUCUAACUAUGAUGCAAAUAAAA 207

616 616-634 CUAACUAUGAUGCAAAUAAAACC 208

622 622-640 AUGAUGCAAAUAAAACCGGACUG 209

623 623-641 UGAUGCAAAUAAAACCGGACUGA 210

624 624-642 GAUGCAAAUAAAACCGGACUGAA 211

626 626-644 UGCAAAUAAAACCGGACUGAAGG 212

627 627-645 GCAAAUAAAACCGGACUGAAGGA 213

628 628-646 CAAAUAAAACCGGACUGAAGGAG 214

630 630-648 AAUAAAACCGGACUGAAGGAGCU 215

631 631-649 AUAAAACCGGACUGAAGGAGCUG 216

632 632-650 UAAAACCGGACUGAAGGAGCUGC 217

633 633-651 AAAACCGGACUGAAGGAGCUGCC 218

644 644-662 GAAGGAGCUGCCCAUGAGAAAUU 219

665 665-683 UUUACAGGAAAUCCUGCAUGGCG 220

668 668-686 ACAGGAAAUCCUGCAUGGCGCCG 221

669 669-687 CAGGAAAUCCUGCAUGGCGCCGU 222

670 670-688 AGGAAAUCCUGCAUGGCGCCGUG 223

671 671-689 GGAAAUCCUGCAUGGCGCCGUGC 224

672 672-690 GAAAUCCUGCAUGGCGCCGUGCG 225

674 674-692 AAUCCUGCAUGGCGCCGUGCGGU 226

676 676-694 UCCUGCAUGGCGCCGUGCGGUUC 227

677 677-695 CCUGCAUGGCGCCGUGCGGUUCA 228

678 678-696 CUGCAUGGCGCCGUGCGGUUCAG 229

680 680-698 GCAUGGCGCCGUGCGGUUCAGCA 230

681 681-699 CAUGGCGCCGUGCGGUUCAGCAA 231

682 682-700 AUGGCGCCGUGCGGUUCAGCAAC 232

683 683-701 UGGCGCCGUGCGGUUCAGCAACA 233

684 684-702 GGCGCCGUGCGGUUCAGCAACAA 234

685 685-703 GCGCCGUGCGGUUCAGCAACAAC 235

686 686-704 CGCCGUGCGGUUCAGCAACAACC 236

688 688-706 CCGUGCGGUUCAGCAACAACCCU 237

690 690-708 GUGCGGUUCAGCAACAACCCUGC 238

692 692-710 GCGGUUCAGCAACAACCCUGCCC 239

698 698-716 CAGCAACAACCCUGCCCUGUGCA 240

700 700-718 GCAACAACCCUGCCCUGUGCAAC 241

719 719-737 CAACGUGGAGAGCAUCCAGUGGC 242

720 720-738 AACGUGGAGAGCAUCCAGUGGCG 243

721 721-739 ACGUGGAGAGCAUCCAGUGGCGG 244

724 724-742 UGGAGAGCAUCCAGUGGCGGGAC 245

725 725-743 GGAGAGCAUCCAGUGGCGGGACA 246

726 726-744 GAGAGCAUCCAGUGGCGGGACAU 247

733 733-751 UCCAGUGGCGGGACAUAGUCAGC 248 734 734-752 CCAGUGGCGGGACAUAGUCAGCA 249

736 736-754 AGUGGCGGGACAUAGUCAGCAGU 250

Til 737-755 GUGGCGGGACAUAGUCAGCAGUG 251

763 763-781 UUCUCAGCAACAUGUCGAUGGAC 252

765 765-783 CUCAGCAACAUGUCGAUGGACUU 253

766 766-784 UCAGCAACAUGUCGAUGGACUUC 254

767 767-785 CAGCAACAUGUCGAUGGACUUCC 255

769 769-787 GCAACAUGUCGAUGGACUUCCAG 256

770 770-788 CAACAUGUCGAUGGACUUCCAGA 257

771 771-789 AACAUGUCGAUGGACUUCCAGAA 258

772 772-790 ACAUGUCGAUGGACUUCCAGAAC 259

775 775-793 UGUCGAUGGACUUCCAGAACCAC 260

789 789-807 CAGAACCACCUGGGCAGCUGCCA 261

798 798-816 CUGGGCAGCUGCCAAAAGUGUGA 262

800 800-818 GGGCAGCUGCCAAAAGUGUGAUC 263

805 805-823 GCUGCCAAAAGUGUGAUCCAAGC 264

806 806-824 CUGCCAAAAGUGUGAUCCAAGCU 265

807 807-825 UGCCAAAAGUGUGAUCCAAGCUG 266

810 810-828 CAAAAGUGUGAUCCAAGCUGUCC 267

814 814-832 AGUGUGAUCCAAGCUGUCCCAAU 268

815 815-833 GUGUGAUCCAAGCUGUCCCAAUG 269

817 817-835 GUGAUCCAAGCUGUCCCAAUGGG 270

818 818-836 UGAUCCAAGCUGUCCCAAUGGGA 271

819 819-837 GAUCCAAGCUGUCCCAAUGGGAG 272

820 820-838 AUCCAAGCUGUCCCAAUGGGAGC 273

821 821-839 UCCAAGCUGUCCCAAUGGGAGCU 274

823 823-841 CAAGCUGUCCCAAUGGGAGCUGC 275

826 826-844 GCUGUCCCAAUGGGAGCUGCUGG 276

847 847-865 GGGGUGCAGGAGAGGAGAACUGC 277

871 871-889 AGAAACUGACCAAAAUCAUCUGU 278

872 872-890 GAAACUGACCAAAAUCAUCUGUG 279

873 873-891 AAACUGACCAAAAUCAUCUGUGC 280

877 877-895 UGACCAAAAUCAUCUGUGCCCAG 281

878 878-896 GACCAAAAUCAUCUGUGCCCAGC 282

881 881-899 CAAAAUCAUCUGUGCCCAGCAGU 283

890 890-908 CUGUGCCCAGCAGUGCUCCGGGC 284

892 892-910 GUGCCCAGCAGUGCUCCGGGCGC 285

929 929-947 CCCCAGUGACUGCUGCCACAACC 286

930 930-948 CCCAGUGACUGCUGCCACAACCA 287

979 979-997 GGGAGAGCGACUGCCUGGUCUGC 288

980 980-998 GGAGAGCGACUGCCUGGUCUGCC 289

981 981-999 GAGAGCGACUGCCUGGUCUGCCG 290

982 982-1000 AGAGCGACUGCCUGGUCUGCCGC 291

983 983-1001 GAGCGACUGCCUGGUCUGCCGCA 292

984 984-1002 AGCGACUGCCUGGUCUGCCGCAA 293

989 989-1007 CUGCCUGGUCUGCCGCAAAUUCC 294

990 990-1008 UGCCUGGUCUGCCGCAAAUUCCG 295

991 991-1009 GCCUGGUCUGCCGCAAAUUCCGA 296

992 992-1010 CCUGGUCUGCCGCAAAUUCCGAG 297

994 994-1012 UGGUCUGCCGCAAAUUCCGAGAC 298

995 995-1013 GGUCUGCCGCAAAUUCCGAGACG 299

996 996-1014 GUCUGCCGCAAAUUCCGAGACGA 300 997 997-1015 UCUGCCGCAAAUUCCGAGACGAA 301

999 999-1017 UGCCGCAAAUUCCGAGACGAAGC 302

1004 1004-1022 CAAAUUCCGAGACGAAGCCACGU 303

1005 1005-1023 AAAUUCCGAGACGAAGCCACGUG 304

1006 1006-1024 AAUUCCGAGACGAAGCCACGUGC 305

1007 1007-1025 AUUCCGAGACGAAGCCACGUGCA 306

1008 1008-1026 UUCCGAGACGAAGCCACGUGCAA 307

1010 1010-1028 CCGAGACGAAGCCACGUGCAAGG 308

1013 1013-1031 AGACGAAGCCACGUGCAAGGACA 309

1014 1014-1032 GACGAAGCCACGUGCAAGGACAC 310

1015 1015-1033 ACGAAGCCACGUGCAAGGACACC 311

1016 1016-1034 CGAAGCCACGUGCAAGGACACCU 312

1040 1040-1058 CCCCCCACUCAUGCUCUACAACC 313

1042 1042-1060 CCCCACUCAUGCUCUACAACCCC 314

1044 1044-1062 CCACUCAUGCUCUACAACCCCAC 315

1047 1047-1065 CUCAUGCUCUACAACCCCACCAC 316

1071 1071-1089 UACCAGAUGGAUGUGAACCCCGA 317

1073 1073-1091 CCAGAUGGAUGUGAACCCCGAGG 318

1074 1074-1092 CAGAUGGAUGUGAACCCCGAGGG 319

1075 1075-1093 AGAUGGAUGUGAACCCCGAGGGC 320

1077 1077-1095 AUGGAUGUGAACCCCGAGGGCAA 321

1078 1078-1096 UGGAUGUGAACCCCGAGGGCAAA 322

1080 1080-1098 GAUGUGAACCCCGAGGGCAAAUA 323

1084 1084-1102 UGAACCCCGAGGGCAAAUACAGC 324

1085 1085-1103 GAACCCCGAGGGCAAAUACAGCU 325

1087 1087-1105 ACCCCGAGGGCAAAUACAGCUUU 326

1088 1088-1106 CCCCGAGGGCAAAUACAGCUUUG 327

1089 1089-1107 CCCGAGGGCAAAUACAGCUUUGG 328

1096 1096-1114 GCAAAUACAGCUUUGGUGCCACC 329

1097 1097-1115 CAAAUACAGCUUUGGUGCCACCU 330

1098 1098-1116 AAAUACAGCUUUGGUGCCACCUG 331

1104 1104-1122 AGCUUUGGUGCCACCUGCGUGAA 332

1106 1106-1124 CUUUGGUGCCACCUGCGUGAAGA 333

1112 1112-1130 UGCCACCUGCGUGAAGAAGUGUC 334

1116 1116-1134 ACCUGCGUGAAGAAGUGUCCCCG 335

1117 1117-1135 CCUGCGUGAAGAAGUGUCCCCGU 336

1118 1118-1136 CUGCGUGAAGAAGUGUCCCCGUA 337

1119 1119-1137 UGCGUGAAGAAGUGUCCCCGUAA 338

1120 1120-1138 GCGUGAAGAAGUGUCCCCGUAAU 339

1121 1121-1139 CGUGAAGAAGUGUCCCCGUAAUU 340

1122 1122-1140 GUGAAGAAGUGUCCCCGUAAUUA 341

1123 1123-1141 UGAAGAAGUGUCCCCGUAAUUAU 342

1124 1124-1142 GAAGAAGUGUCCCCGUAAUUAUG 343

1125 1125-1143 AAGAAGUGUCCCCGUAAUUAUGU 344

1126 1126-1144 AGAAGUGUCCCCGUAAUUAUGUG 345

1127 1127-1145 GAAGUGUCCCCGUAAUUAUGUGG 346

1128 1128-1146 AAGUGUCCCCGUAAUUAUGUGGU 347

1129 1129-1147 AGUGUCCCCGUAAUUAUGUGGUG 348

1130 1130-1148 GUGUCCCCGUAAUUAUGUGGUGA 349

1132 1132-1150 GUCCCCGUAAUUAUGUGGUGACA 350

1134 1134-1152 CCCCGUAAUUAUGUGGUGACAGA 351

1136 1136-1154 CCGUAAUUAUGUGGUGACAGAUC 352 1137 1137-1155 CGUAAUUAUGUGGUGACAGAUCA 353

1138 1138-1156 GUAAUUAUGUGGUGACAGAUCAC 354

1139 1139-1157 UAAUUAUGUGGUGACAGAUCACG 355

1140 1140-1158 AAUUAUGUGGUGACAGAUCACGG 356

1142 1142-1160 UUAUGUGGUGACAGAUCACGGCU 357

1145 1145-1163 UGUGGUGACAGAUCACGGCUCGU 358

1147 1147-1165 UGGUGACAGAUCACGGCUCGUGC 359

1148 1148-1166 GGUGACAGAUCACGGCUCGUGCG 360

1149 1149-1167 GUGACAGAUCACGGCUCGUGCGU 361

1150 1150-1168 UGACAGAUCACGGCUCGUGCGUC 362

1151 1151-1169 GACAGAUCACGGCUCGUGCGUCC 363

1152 1152-1170 ACAGAUCACGGCUCGUGCGUCCG 364

1153 1153-1171 CAGAUCACGGCUCGUGCGUCCGA 365

1154 1154-1172 AGAUCACGGCUCGUGCGUCCGAG 366

1155 1155-1173 GAUCACGGCUCGUGCGUCCGAGC 367

1156 1156-1174 AUCACGGCUCGUGCGUCCGAGCC 368

1157 1157-1175 UCACGGCUCGUGCGUCCGAGCCU 369

1160 1160-1178 CGGCUCGUGCGUCCGAGCCUGUG 370

1200 1200-1218 AUGGAGGAAGACGGCGUCCGCAA 371

1201 1201-1219 UGGAGGAAGACGGCGUCCGCAAG 372

1203 1203-1221 GAGGAAGACGGCGUCCGCAAGUG 373

1204 1204-1222 AGGAAGACGGCGUCCGCAAGUGU 374

1205 1205-1223 GGAAGACGGCGUCCGCAAGUGUA 375

1207 1207-1225 AAGACGGCGUCCGCAAGUGUAAG 376

1208 1208-1226 AGACGGCGUCCGCAAGUGUAAGA 377

1211 1211-1229 CGGCGUCCGCAAGUGUAAGAAGU 378

1212 1212-1230 GGCGUCCGCAAGUGUAAGAAGUG 379

1213 1213-1231 GCGUCCGCAAGUGUAAGAAGUGC 380

1214 1214-1232 CGUCCGCAAGUGUAAGAAGUGCG 381

1215 1215-1233 GUCCGCAAGUGUAAGAAGUGCGA 382

1216 1216-1234 UCCGCAAGUGUAAGAAGUGCGAA 383

1217 1217-1235 CCGCAAGUGUAAGAAGUGCGAAG 384

1219 1219-1237 GCAAGUGUAAGAAGUGCGAAGGG 385

1220 1220-1238 CAAGUGUAAGAAGUGCGAAGGGC 386

1221 1221-1239 AAGUGUAAGAAGUGCGAAGGGCC 387

1222 1222-1240 AGUGUAAGAAGUGCGAAGGGCCU 388

1223 1223-1241 GUGUAAGAAGUGCGAAGGGCCUU 389

1224 1224-1242 UGUAAGAAGUGCGAAGGGCCUUG 390

1225 1225-1243 GUAAGAAGUGCGAAGGGCCUUGC 391

1226 1226-1244 UAAGAAGUGCGAAGGGCCUUGCC 392

1229 1229-1247 GAAGUGCGAAGGGCCUUGCCGCA 393

1230 1230-1248 AAGUGCGAAGGGCCUUGCCGCAA 394

1231 1231-1249 AGUGCGAAGGGCCUUGCCGCAAA 395

1232 1232-1250 GUGCGAAGGGCCUUGCCGCAAAG 396

1233 1233-1251 UGCGAAGGGCCUUGCCGCAAAGU 397

1235 1235-1253 CGAAGGGCCUUGCCGCAAAGUGU 398

1236 1236-1254 GAAGGGCCUUGCCGCAAAGUGUG 399

1237 1237-1255 AAGGGCCUUGCCGCAAAGUGUGU 400

1238 1238-1256 AGGGCCUUGCCGCAAAGUGUGUA 401

1239 1239-1257 GGGCCUUGCCGCAAAGUGUGUAA 402

1241 1241-1259 GCCUUGCCGCAAAGUGUGUAACG 403

1261 1261-1279 ACGGAAUAGGUAUUGGUGAAUUU 404 1262 1262-1280 CGGAAUAGGUAUUGGUGAAUUUA 405

1263 1263-1281 GGAAUAGGUAUUGGUGAAUUUAA 406

1264 1264-1282 GAAUAGGUAUUGGUGAAUUUAAA 407

1266 1266-1284 AUAGGUAUUGGUGAAUUUAAAGA 408

1267 1267-1285 UAGGUAUUGGUGAAUUUAAAGAC 409

1289 1289-1307 CUCACUCUCCAUAAAUGCUACGA 410

1313 1313-1331 UAUUAAACACUUCAAAAACUGCA 411

1320 1320-1338 CACUUCAAAAACUGCACCUCCAU 412

1321 1321-1339 ACUUCAAAAACUGCACCUCCAUC 413

1322 1322-1340 CUUCAAAAACUGCACCUCCAUCA 414

1323 1323-1341 UUCAAAAACUGCACCUCCAUCAG 415

1324 1324-1342 UCAAAAACUGCACCUCCAUCAGU 416

1328 1328-1346 AAACUGCACCUCCAUCAGUGGCG 417

1332 1332-1350 UGCACCUCCAUCAGUGGCGAUCU 418

1333 1333-1351 GCACCUCCAUCAGUGGCGAUCUC 419

1335 1335-1353 ACCUCCAUCAGUGGCGAUCUCCA 420

1338 1338-1356 UCCAUCAGUGGCGAUCUCCACAU 421

1344 1344-1362 AGUGGCGAUCUCCACAUCCUGCC 422

1345 1345-1363 GUGGCGAUCUCCACAUCCUGCCG 423

1346 1346-1364 UGGCGAUCUCCACAUCCUGCCGG 424

1347 1347-1365 GGCGAUCUCCACAUCCUGCCGGU 425

1348 1348-1366 GCGAUCUCCACAUCCUGCCGGUG 426

1353 1353-1371 CUCCACAUCCUGCCGGUGGCAUU 427

1354 1354-1372 UCCACAUCCUGCCGGUGGCAUUU 428

1355 1355-1373 CCACAUCCUGCCGGUGGCAUUUA 429

1357 1357-1375 ACAUCCUGCCGGUGGCAUUUAGG 430

1360 1360-1378 UCCUGCCGGUGGCAUUUAGGGGU 431

1361 1361-1379 CCUGCCGGUGGCAUUUAGGGGUG 432

1362 1362-1380 CUGCCGGUGGCAUUUAGGGGUGA 433

1363 1363-1381 UGCCGGUGGCAUUUAGGGGUGAC 434

1366 1366-1384 CGGUGGCAUUUAGGGGUGACUCC 435

1369 1369-1387 UGGCAUUUAGGGGUGACUCCUUC 436

1370 1370-1388 GGCAUUUAGGGGUGACUCCUUCA 437

1371 1371-1389 GCAUUUAGGGGUGACUCCUUCAC 438

1372 1372-1390 CAUUUAGGGGUGACUCCUUCACA 439

1373 1373-1391 AUUUAGGGGUGACUCCUUCACAC 440

1374 1374-1392 UUUAGGGGUGACUCCUUCACACA 441

1404 1404-1422 CCUCUGGAUCCACAGGAACUGGA 442

1408 1408-1426 UGGAUCCACAGGAACUGGAUAUU 443

1409 1409-1427 GGAUCCACAGGAACUGGAUAUUC 444

1411 1411-1429 AUCCACAGGAACUGGAUAUUCUG 445

1412 1412-1430 UCCACAGGAACUGGAUAUUCUGA 446

1419 1419-1437 GAACUGGAUAUUCUGAAAACCGU 447

1426 1426-1444 AUAUUCUGAAAACCGUAAAGGAA 448

1427 1427-1445 UAUUCUGAAAACCGUAAAGGAAA 449

1430 1430-1448 UCUGAAAACCGUAAAGGAAAUCA 450

1431 1431-1449 CUGAAAACCGUAAAGGAAAUCAC 451 Table 5. EGFR siRNA Sequences

UCTT CTT

UCGGCGUCCGCCCGAGU GGACUCGGGCGGACGCCG

132 132-150 502 503

CCTT ATT

GCGUCCGCCCGAGUCCC CGGGGACUCGGGCGGACG

135 135-153 504 505

CGTT CTT

CGUCCGCCCGAGUCCCC GCGGGGACUCGGGCGGAC

136 136-154 506 507

GCTT GTT

GCCCGAGUCCCCGCCUC GCGAGGCGGGGACUCGG

141 141-159 508 509

GCTT GCTT

AACGCCACAACCACCGC GCGCGGUGGUUGUGGCG

164 164-182 510 511

GCTT UUTT

ACGCCACAACCACCGCG UGCGCGGUGGUUGUGGC

165 165-183 512 513

CATT GUTT

CGCCACAACCACCGCGC GUGCGCGGUGGUUGUGG

166 166-184 514 515

ACTT CGTT

CCACAACCACCGCGCAC CCGUGCGCGGUGGUUGU

168 168-186 516 517

GGTT GGTT

CACAACCACCGCGCACG GCCGUGCGCGGUGGUUG

169 169-187 518 519

GCTT UGTT

ACAACCACCGCGCACGG GGCCGUGCGCGGUGGUU

170 170-188 520 521

CCTT GUTT

AUGCGACCCUCCGGGAC CCGUCCCGGAGGGUCGCA

247 247-265 522 523

GGTT UTT

UGCGACCCUCCGGGACG GCCGUCCCGGAGGGUCGC

248 248-266 524 525

GCTT ATT

GCGACCCUCCGGGACGG GGCCGUCCCGGAGGGUCG

249 249-267 526 527

CCTT CTT

GACCCUCCGGGACGGCC CCGGCCGUCCCGGAGGGU

251 251-269 528 529

GGTT CTT

ACCCUCCGGGACGGCCG CCCGGCCGUCCCGGAGGG

252 252-270 530 531

GGTT UTT

CCUCCGGGACGGCCGGG GCCCCGGCCGUCCCGGAG

254 254-272 532 533

GCTT GTT

AGAAAGUUUGCCAAGG GUGCCUUGGCAAACUUUC

329 329-347 534 535

CACTT UTT

GAAAGUUUGCCAAGGC CGUGCCUUGGCAAACUUU

330 330-348 536 537

ACGTT CTT

AAGUUUGCCAAGGCAC CUCGUGCCUUGGCAAACU

332 332-350 538 539

GAGTT UTT

AGUUUGCCAAGGCACG ACUCGUGCCUUGGCAAAC

333 333-351 540 541

AGUTT UTT

GUUUGCCAAGGCACGA UACUCGUGCCUUGGCAAA

334 334-352 542 543

GUATT CTT

UUUGCCAAGGCACGAG UUACUCGUGCCUUGGCAA

335 335-353 544 545

UAATT ATT

UUGCCAAGGCACGAGU GUUACUCGUGCCUUGGCA

336 336-354 546 547

AACTT ATT

UGCCAAGGCACGAGUA UGUUACUCGUGCCUUGGC

337 337-355 548 549

ACATT ATT

GCCAAGGCACGAGUAA UUGUUACUCGUGCCUUG

338 338-356 550 551

CAATT GCTT

ACGCAGUUGGGCACUU CAAAAGUGCCCAACUGCG

361 361-379 552 553

UUGTT UTT CGCAGUUGGGCACUUU UCAAAAGUGCCCAACUGC

362 362-380 554 555

UGATT GTT

GCAGUUGGGCACUUUU UUCAAAAGUGCCCAACUG

363 363-381 556 557

GAATT CTT

CAGUUGGGCACUUUUG CUUCAAAAGUGCCCAACU

364 364-382 558 559

AAGTT GTT

AGUUGGGCACUUUUGA UCUUCAAAAGUGCCCAAC

365 365-383 560 561

AGATT UTT

GUUGGGCACUUUUGAA AUCUUCAAAAGUGCCCAA

366 366-384 562 563

GAUTT CTT

UUGGGCACUUUUGAAG GAUCUUCAAAAGUGCCCA

367 367-385 564 565

AUCTT ATT

UGGGCACUUUUGAAGA UGAUCUUCAAAAGUGCCC

368 368-386 566 567

UCATT ATT

GGGCACUUUUGAAGAU AUGAUCUUCAAAAGUGC

369 369-387 568 569

CAUTT CCTT

UUGAAGAUCAUUUUCU CUGAGAAAAUGAUCUUC

377 377-395 570 571

CAGTT AATT

GAAGAUCAUUUUCUCA GGCUGAGAAAAUGAUCU

379 379-397 572 573

GCCTT UCTT

AAGAUCAUUUUCUCAG AGGCUGAGAAAAUGAUC

380 380-398 574 575

CCUTT UUTT

CAUUUUCUCAGCCUCCA UCUGGAGGCUGAGAAAA

385 385-403 576 577

GATT UGTT

AGCCUCCAGAGGAUGU UGAACAUCCUCUGGAGGC

394 394-412 578 579

UCATT UTT

CCUCCAGAGGAUGUUC AUUGAACAUCCUCUGGA

396 396-414 580 581

AAUTT GGTT

CUCCAGAGGAUGUUCA UAUUGAACAUCCUCUGG

397 397-415 582 583

AUATT AGTT

AGAGGAUGUUCAAUAA CAGUUAUUGAACAUCCUC

401 401-419 584 585

CUGTT UTT

AGGAUGUUCAAUAACU CACAGUUAUUGAACAUCC

403 403-421 586 587

GUGTT UTT

UGUUCAAUAACUGUGA ACCUCACAGUUAUUGAAC

407 407-425 588 589

GGUTT ATT

UUCAAUAACUGUGAGG CCACCUCACAGUUAUUGA

409 409-427 590 591

UGGTT ATT

UCAAUAACUGUGAGGU ACCACCUCACAGUUAUUG

410 410-428 592 593

GGUTT ATT

CAAUAACUGUGAGGUG GACCACCUCACAGUUAUU

411 411-429 594 595

GUCTT GTT

AAUAACUGUGAGGUGG GGACCACCUCACAGUUAU

412 412-430 596 597

UCCTT UTT

AUAACUGUGAGGUGGU AGGACCACCUCACAGUUA

413 413-431 598 599

CCUTT UTT

UAACUGUGAGGUGGUC AAGGACCACCUCACAGUU

414 414-432 600 601

CUUTT ATT

ACUGUGAGGUGGUCCU CCAAGGACCACCUCACAG

416 416-434 602 603

UGGTT UTT

UGUGAGGUGGUCCUUG UCCCAAGGACCACCUCAC

418 418-436 604 605

GGATT ATT

GUGAGGUGGUCCUUGG UUCCCAAGGACCACCUCA

419 419-437 606 607

GAATT CTT UGGUCCUUGGGAAUUU UCCAAAUUCCCAAGGACC

425 425-443 608 609

GGATT ATT

UUGGGAAUUUGGAAAU GUAAUUUCCAAAUUCCCA

431 431-449 610 611

UACTT ATT

UGGGAAUUUGGAAAUU GGUAAUUUCCAAAUUCCC

432 432-450 612 613

ACCTT ATT

GGGAAUUUGGAAAUUA AGGUAAUUUCCAAAUUC

433 433-451 614 615

CCUTT CCTT

GGAAUUUGGAAAUUAC UAGGUAAUUUCCAAAUU

434 434-452 616 617

CUATT CCTT

AGAGGAAUUAUGAUCU GAAAGAUCAUAAUUCCU

458 458-476 618 619

UUCTT CUTT

GAGGAAUUAUGAUCUU GGAAAGAUCAUAAUUCC

459 459-477 620 621

UCCTT UCTT

AAUUAUGAUCUUUCCU AGAAGGAAAGAUCAUAA

463 463-481 622 623

UCUTT UUTT

AUUAUGAUCUUUCCUU AAGAAGGAAAGAUCAUA

464 464-482 624 625

CUUTT AUTT

UAUGAUCUUUCCUUCU UUAAGAAGGAAAGAUCA

466 466-484 626 627

UAATT UATT

UGAUCUUUCCUUCUUA CUUUAAGAAGGAAAGAU

468 468-486 628 629

AAGTT CATT

UCUUUCCUUCUUAAAG GGUCUUUAAGAAGGAAA

471 471-489 630 631

ACCTT GATT

CCUUCUUAAAGACCAUC UGGAUGGUCUUUAAGAA

476 476-494 632 633

CATT GGTT

CUUCUUAAAGACCAUCC CUGGAUGGUCUUUAAGA

477 477-495 634 635

AGTT AGTT

UCUUAAAGACCAUCCA UCCUGGAUGGUCUUUAA

479 479-497 636 637

GGATT GATT

UUAAAGACCAUCCAGG CCUCCUGGAUGGUCUUUA

481 481-499 638 639

AGGTT ATT

UAAAGACCAUCCAGGA ACCUCCUGGAUGGUCUUU

482 482-500 640 641

GGUTT ATT

CCAGGAGGUGGCUGGU AUAACCAGCCACCUCCUG

492 492-510 642 643

UAUTT GTT

CAGGAGGUGGCUGGUU CAUAACCAGCCACCUCCU

493 493-511 644 645

AUGTT GTT

AGGAGGUGGCUGGUUA ACAUAACCAGCCACCUCC

494 494-512 646 647

UGUTT UTT

GGAGGUGGCUGGUUAU GACAUAACCAGCCACCUC

495 495-513 648 649

GUCTT CTT

GAGGUGGCUGGUUAUG GGACAUAACCAGCCACCU

496 496-514 650 651

UCCTT CTT

AGGUGGCUGGUUAUGU AGGACAUAACCAGCCACC

497 497-515 652 653

CCUTT UTT

GUGGCUGGUUAUGUCC UGAGGACAUAACCAGCCA

499 499-517 654 655

UCATT CTT

GCCCUCAACACAGUGGA GCUCCACUGUGUUGAGG

520 520-538 656 657

GCTT GCTT

UUCCUUUGGAAAACCU UGCAGGUUUUCCAAAGG

542 542-560 658 659

GCATT AATT

UCCUUUGGAAAACCUG CUGCAGGUUUUCCAAAG

543 543-561 660 661

CAGTT GATT GAAAACCUGCAGAUCA UGAUGAUCUGCAGGUUU

550 550-568 662 663

UCATT UCTT

AAAACCUGCAGAUCAU CUGAUGAUCUGCAGGUU

551 551-569 664 665

CAGTT UUTT

AACCUGCAGAUCAUCA CUCUGAUGAUCUGCAGG

553 553-571 666 667

GAGTT UUTT

CUGCAGAUCAUCAGAG UUCCUCUGAUGAUCUGCA

556 556-574 668 669

GAATT GTT

GAAAAUUCCUAUGCCU CUAAGGCAUAGGAAUUU

586 586-604 670 671

UAGTT UCTT

AAAAUUCCUAUGCCUU GCUAAGGCAUAGGAAUU

587 587-605 672 673

AGCTT UUTT

AAUUCCUAUGCCUUAG CUGCUAAGGCAUAGGAA

589 589-607 674 675

CAGTT UUTT

UCCUAUGCCUUAGCAG AGACUGCUAAGGCAUAG

592 592-610 676 677

UCUTT GATT

CCUAUGCCUUAGCAGUC AAGACUGCUAAGGCAUA

593 593-611 678 679

UUTT GGTT

CUAUGCCUUAGCAGUC UAAGACUGCUAAGGCAU

594 594-612 680 681

UUATT AGTT

AUGCCUUAGCAGUCUU GAUAAGACUGCUAAGGC

596 596-614 682 683

AUCTT AUTT

UGCCUUAGCAGUCUUA AGAUAAGACUGCUAAGG

597 597-615 684 685

UCUTT CATT

GCCUUAGCAGUCUUAU UAGAUAAGACUGCUAAG

598 598-616 686 687

CUATT GCTT

CCUUAGCAGUCUUAUC UUAGAUAAGACUGCUAA

599 599-617 688 689

UAATT GGTT

CUUAGCAGUCUUAUCU GUUAGAUAAGACUGCUA

600 600-618 690 691

AACTT AGTT

UUAGCAGUCUUAUCUA AGUUAGAUAAGACUGCU

601 601-619 692 693

ACUTT AATT

UAGCAGUCUUAUCUAA UAGUUAGAUAAGACUGC

602 602-620 694 695

CUATT UATT

AGCAGUCUUAUCUAAC AUAGUUAGAUAAGACUG

603 603-621 696 697

UAUTT CUTT

GCAGUCUUAUCUAACU CAUAGUUAGAUAAGACU

604 604-622 698 699

AUGTT GCTT

CAGUCUUAUCUAACUA UCAUAGUUAGAUAAGAC

605 605-623 700 701

UGATT UGTT

UCUUAUCUAACUAUGA GCAUCAUAGUUAGAUAA

608 608-626 702 703

UGCTT GATT

CUUAUCUAACUAUGAU UGCAUCAUAGUUAGAUA

609 609-627 704 705

GCATT AGTT

UUAUCUAACUAUGAUG UUGCAUCAUAGUUAGAU

610 610-628 706 707

CAATT AATT

UAUCUAACUAUGAUGC UUUGCAUCAUAGUUAGA

611 611-629 708 709

AAATT UATT

AUCUAACUAUGAUGCA AUUUGCAUCAUAGUUAG

612 612-630 710 711

AAUTT AUTT

UCUAACUAUGAUGCAA UAUUUGCAUCAUAGUUA

613 613-631 712 713

AUATT GATT

CUAACUAUGAUGCAAA UUAUUUGCAUCAUAGUU

614 614-632 714 715

UAATT AGTT AACUAUGAUGCAAAUA UUUUAUUUGCAUCAUAG

616 616-634 716 717

AAATT UUTT

GAUGCAAAUAAAACCG GUCCGGUUUUAUUUGCA

622 622-640 718 719

GACTT UCTT

AUGCAAAUAAAACCGG AGUCCGGUUUUAUUUGC

623 623-641 720 721

ACUTT AUTT

UGCAAAUAAAACCGGA CAGUCCGGUUUUAUUUG

624 624-642 722 723

CUGTT CATT

CAAAUAAAACCGGACU UUCAGUCCGGUUUUAUU

626 626-644 724 725

GAATT UGTT

AAAUAAAACCGGACUG CUUCAGUCCGGUUUUAU

627 627-645 726 727

AAGTT UUTT

AAUAAAACCGGACUGA CCUUCAGUCCGGUUUUAU

628 628-646 728 729

AGGTT UTT

UAAAACCGGACUGAAG CUCCUUCAGUCCGGUUUU

630 630-648 730 731

GAGTT ATT

AAAACCGGACUGAAGG GCUCCUUCAGUCCGGUUU

631 631-649 732 733

AGCTT UTT

AAACCGGACUGAAGGA AGCUCCUUCAGUCCGGUU

632 632-650 734 735

GCUTT UTT

AACCGGACUGAAGGAG CAGCUCCUUCAGUCCGGU

633 633-651 736 737

CUGTT UTT

AGGAGCUGCCCAUGAG UUUCUCAUGGGCAGCUCC

644 644-662 738 739

AAATT UTT

UACAGGAAAUCCUGCA CCAUGCAGGAUUUCCUGU

665 665-683 740 741

UGGTT ATT

AGGAAAUCCUGCAUGG GCGCCAUGCAGGAUUUCC

668 668-686 742 743

CGCTT UTT

GGAAAUCCUGCAUGGC GGCGCCAUGCAGGAUUUC

669 669-687 744 745

GCCTT CTT

GAAAUCCUGCAUGGCG CGGCGCCAUGCAGGAUUU

670 670-688 746 747

CCGTT CTT

AAAUCCUGCAUGGCGCC ACGGCGCCAUGCAGGAUU

671 671-689 748 749

GUTT UTT

AAUCCUGCAUGGCGCCG CACGGCGCCAUGCAGGAU

672 672-690 750 751

UGTT UTT

UCCUGCAUGGCGCCGUG CGCACGGCGCCAUGCAGG

674 674-692 752 753

CGTT ATT

CUGCAUGGCGCCGUGCG ACCGCACGGCGCCAUGCA

676 676-694 754 755

GUTT GTT

UGCAUGGCGCCGUGCG AACCGCACGGCGCCAUGC

677 677-695 756 757

GUUTT ATT

GCAUGGCGCCGUGCGG GAACCGCACGGCGCCAUG

678 678-696 758 759

UUCTT CTT

AUGGCGCCGUGCGGUU CUGAACCGCACGGCGCCA

680 680-698 760 761

CAGTT UTT

UGGCGCCGUGCGGUUC GCUGAACCGCACGGCGCC

681 681-699 762 763

AGCTT ATT

GGCGCCGUGCGGUUCA UGCUGAACCGCACGGCGC

682 682-700 764 765

GCATT CTT

GCGCCGUGCGGUUCAGC UUGCUGAACCGCACGGCG

683 683-701 766 767

AATT CTT

CGCCGUGCGGUUCAGCA GUUGCUGAACCGCACGGC

684 684-702 768 769

ACTT GTT GCCGUGCGGUUCAGCA UGUUGCUGAACCGCACGG

685 685-703 770 771

ACATT CTT

CCGUGCGGUUCAGCAAC UUGUUGCUGAACCGCACG

686 686-704 772 773

AATT GTT

GUGCGGUUCAGCAACA GGUUGUUGCUGAACCGC

688 688-706 774 775

ACCTT ACTT

GCGGUUCAGCAACAACC AGGGUUGUUGCUGAACC

690 690-708 776 777

CUTT GCTT

GGUUCAGCAACAACCCU GCAGGGUUGUUGCUGAA

692 692-710 778 779

GCTT CCTT

GCAACAACCCUGCCCUG CACAGGGCAGGGUUGUU

698 698-716 780 781

UGTT GCTT

AACAACCCUGCCCUGUG UGCACAGGGCAGGGUUG

700 700-718 782 783

CATT UUTT

ACGUGGAGAGCAUCCA CACUGGAUGCUCUCCACG

719 719-737 784 785

GUGTT UTT

CGUGGAGAGCAUCCAG CCACUGGAUGCUCUCCAC

720 720-738 786 787

UGGTT GTT

GUGGAGAGCAUCCAGU GCCACUGGAUGCUCUCCA

721 721-739 788 789

GGCTT CTT

GAGAGCAUCCAGUGGC CCCGCCACUGGAUGCUCU

724 724-742 790 791

GGGTT CTT

AGAGCAUCCAGUGGCG UCCCGCCACUGGAUGCUC

725 725-743 792 793

GGATT UTT

GAGCAUCCAGUGGCGG GUCCCGCCACUGGAUGCU

726 726-744 794 795

GACTT CTT

CAGUGGCGGGACAUAG UGACUAUGUCCCGCCACU

733 733-751 796 797

UCATT GTT

AGUGGCGGGACAUAGU CUGACUAUGUCCCGCCAC

734 734-752 798 799

CAGTT UTT

UGGCGGGACAUAGUCA UGCUGACUAUGUCCCGCC

736 736-754 800 801

GCATT ATT

GGCGGGACAUAGUCAG CUGCUGACUAUGUCCCGC

737 737-755 802 803

CAGTT CTT

CUCAGCAACAUGUCGA CCAUCGACAUGUUGCUGA

763 763-781 804 805

UGGTT GTT

CAGCAACAUGUCGAUG GUCCAUCGACAUGUUGCU

765 765-783 806 807

GACTT GTT

AGCAACAUGUCGAUGG AGUCCAUCGACAUGUUGC

766 766-784 808 809

ACUTT UTT

GCAACAUGUCGAUGGA AAGUCCAUCGACAUGUU

767 767-785 810 811

CUUTT GCTT

AACAUGUCGAUGGACU GGAAGUCCAUCGACAUG

769 769-787 812 813

UCCTT UUTT

ACAUGUCGAUGGACUU UGGAAGUCCAUCGACAU

770 770-788 814 815

CCATT GUTT

CAUGUCGAUGGACUUC CUGGAAGUCCAUCGACAU

771 771-789 816 817

CAGTT GTT

AUGUCGAUGGACUUCC UCUGGAAGUCCAUCGACA

772 772-790 818 819

AGATT UTT

UCGAUGGACUUCCAGA GGUUCUGGAAGUCCAUC

775 775-793 820 821

ACCTT GATT

GAACCACCUGGGCAGCU GCAGCUGCCCAGGUGGUU

789 789-807 822 823

GCTT CTT GGGCAGCUGCCAAAAG ACACUUUUGGCAGCUGCC

798 798-816 824 825

UGUTT CTT

GCAGCUGCCAAAAGUG UCACACUUUUGGCAGCUG

800 800-818 826 827

UGATT CTT

UGCCAAAAGUGUGAUC UUGGAUCACACUUUUGG

805 805-823 828 829

CAATT CATT

GCCAAAAGUGUGAUCC CUUGGAUCACACUUUUG

806 806-824 830 831

AAGTT GCTT

CCAAAAGUGUGAUCCA GCUUGGAUCACACUUUU

807 807-825 832 833

AGCTT GGTT

AAAGUGUGAUCCAAGC ACAGCUUGGAUCACACUU

810 810-828 834 835

UGUTT UTT

UGUGAUCCAAGCUGUC UGGGACAGCUUGGAUCA

814 814-832 836 837

CCATT CATT

GUGAUCCAAGCUGUCCC UUGGGACAGCUUGGAUC

815 815-833 838 839

AATT ACTT

GAUCCAAGCUGUCCCAA CAUUGGGACAGCUUGGA

817 817-835 840 841

UGTT UCTT

AUCCAAGCUGUCCCAAU CCAUUGGGACAGCUUGG

818 818-836 842 843

GGTT AUTT

UCCAAGCUGUCCCAAUG CCCAUUGGGACAGCUUGG

819 819-837 844 845

GGTT ATT

CCAAGCUGUCCCAAUGG UCCCAUUGGGACAGCUUG

820 820-838 846 847

GATT GTT

CAAGCUGUCCCAAUGG CUCCCAUUGGGACAGCUU

821 821-839 848 849

GAGTT GTT

AGCUGUCCCAAUGGGA AGCUCCCAUUGGGACAGC

823 823-841 850 851

GCUTT UTT

UGUCCCAAUGGGAGCU AGCAGCUCCCAUUGGGAC

826 826-844 852 853

GCUTT ATT

GGUGCAGGAGAGGAGA AGUUCUCCUCUCCUGCAC

847 847-865 854 855

ACUTT CTT

AAACUGACCAAAAUCA AGAUGAUUUUGGUCAGU

871 871-889 856 857

UCUTT UUTT

AACUGACCAAAAUCAU CAGAUGAUUUUGGUCAG

872 872-890 858 859

CUGTT UUTT

ACUGACCAAAAUCAUC ACAGAUGAUUUUGGUCA

873 873-891 860 861

UGUTT GUTT

ACCAAAAUCAUCUGUG GGGCACAGAUGAUUUUG

877 877-895 862 863

CCCTT GUTT

CCAAAAUCAUCUGUGCC UGGGCACAGAUGAUUUU

878 878-896 864 865

CATT GGTT

AAAUCAUCUGUGCCCA UGCUGGGCACAGAUGAU

881 881-899 866 867

GCATT UUTT

GUGCCCAGCAGUGCUCC CCGGAGCACUGCUGGGCA

890 890-908 868 869

GGTT CTT

GCCCAGCAGUGCUCCGG GCCCGGAGCACUGCUGGG

892 892-910 870 871

GCTT CTT

CCAGUGACUGCUGCCAC UUGUGGCAGCAGUCACU

929 929-947 872 873

AATT GGTT

CAGUGACUGCUGCCACA GUUGUGGCAGCAGUCAC

930 930-948 874 875

ACTT UGTT

GAGAGCGACUGCCUGG AGACCAGGCAGUCGCUCU

979 979-997 876 877

UCUTT CTT AGAGCGACUGCCUGGU CAGACCAGGCAGUCGCUC

980 980-998 878 879

CUGTT UTT

GAGCGACUGCCUGGUC GCAGACCAGGCAGUCGCU

981 981-999 880 881

UGCTT CTT

AGCGACUGCCUGGUCU GGCAGACCAGGCAGUCGC

982 982-1000 882 883

GCCTT UTT

GCGACUGCCUGGUCUGC CGGCAGACCAGGCAGUCG

983 983-1001 884 885

CGTT CTT

CGACUGCCUGGUCUGCC GCGGCAGACCAGGCAGUC

984 984-1002 886 887

GCTT GTT

GCCUGGUCUGCCGCAAA AAUUUGCGGCAGACCAG

989 989-1007 888 889

UUTT GCTT

CCUGGUCUGCCGCAAAU GAAUUUGCGGCAGACCA

990 990-1008 890 891

UCTT GGTT

CUGGUCUGCCGCAAAU GGAAUUUGCGGCAGACC

991 991-1009 892 893

UCCTT AGTT

UGGUCUGCCGCAAAUU CGGAAUUUGCGGCAGACC

992 992-1010 894 895

CCGTT ATT

GUCUGCCGCAAAUUCCG CUCGGAAUUUGCGGCAG

994 994-1012 896 897

AGTT ACTT

UCUGCCGCAAAUUCCGA UCUCGGAAUUUGCGGCA

995 995-1013 898 899

GATT GATT

CUGCCGCAAAUUCCGAG GUCUCGGAAUUUGCGGC

996 996-1014 900 901

ACTT AGTT

UGCCGCAAAUUCCGAG CGUCUCGGAAUUUGCGGC

997 997-1015 902 903

ACGTT ATT

CCGCAAAUUCCGAGACG UUCGUCUCGGAAUUUGC

999 999-1017 904 905

AATT GGTT

AAUUCCGAGACGAAGC GUGGCUUCGUCUCGGAA

1004 1004-1022 906 907

CACTT UUTT

AUUCCGAGACGAAGCC CGUGGCUUCGUCUCGGAA

1005 1005-1023 908 909

ACGTT UTT

UUCCGAGACGAAGCCAC ACGUGGCUUCGUCUCGGA

1006 1006-1024 910 911

GUTT ATT

UCCGAGACGAAGCCACG CACGUGGCUUCGUCUCGG

1007 1007-1025 912 913

UGTT ATT

CCGAGACGAAGCCACGU GCACGUGGCUUCGUCUCG

1008 1008-1026 914 915

GCTT GTT

GAGACGAAGCCACGUG UUGCACGUGGCUUCGUCU

1010 1010-1028 916 917

CAATT CTT

ACGAAGCCACGUGCAA UCCUUGCACGUGGCUUCG

1013 1013-1031 918 919

GGATT UTT

CGAAGCCACGUGCAAG GUCCUUGCACGUGGCUUC

1014 1014-1032 920 921

GACTT GTT

GAAGCCACGUGCAAGG UGUCCUUGCACGUGGCUU

1015 1015-1033 922 923

ACATT CTT

AAGCCACGUGCAAGGA GUGUCCUUGCACGUGGCU

1016 1016-1034 924 925

CACTT UTT

CCCCACUCAUGCUCUAC UUGUAGAGCAUGAGUGG

1040 1040-1058 926 927

AATT GGTT

CCACUCAUGCUCUACAA GGUUGUAGAGCAUGAGU

1042 1042-1060 928 929

CCTT GGTT

ACUCAUGCUCUACAACC GGGGUUGUAGAGCAUGA

1044 1044-1062 930 931

CCTT GUTT CAUGCUCUACAACCCCA GGUGGGGUUGUAGAGCA

1047 1047-1065 932 933

CCTT UGTT

CCAGAUGGAUGUGAAC GGGGUUCACAUCCAUCUG

1071 1071-1089 934 935

CCCTT GTT

AGAUGGAUGUGAACCC UCGGGGUUCACAUCCAUC

1073 1073-1091 936 937

CGATT UTT

GAUGGAUGUGAACCCC CUCGGGGUUCACAUCCAU

1074 1074-1092 938 939

GAGTT CTT

AUGGAUGUGAACCCCG CCUCGGGGUUCACAUCCA

1075 1075-1093 940 941

AGGTT UTT

GGAUGUGAACCCCGAG GCCCUCGGGGUUCACAUC

1077 1077-1095 942 943

GGCTT CTT

GAUGUGAACCCCGAGG UGCCCUCGGGGUUCACAU

1078 1078-1096 944 945

GCATT CTT

UGUGAACCCCGAGGGC UUUGCCCUCGGGGUUCAC

1080 1080-1098 946 947

AAATT ATT

AACCCCGAGGGCAAAU UGUAUUUGCCCUCGGGG

1084 1084-1102 948 949

ACATT UUTT

ACCCCGAGGGCAAAUAC CUGUAUUUGCCCUCGGGG

1085 1085-1103 950 951

AGTT UTT

CCCGAGGGCAAAUACA AGCUGUAUUUGCCCUCGG

1087 1087-1105 952 953

GCUTT GTT

CCGAGGGCAAAUACAG AAGCUGUAUUUGCCCUCG

1088 1088-1106 954 955

CUUTT GTT

CGAGGGCAAAUACAGC AAAGCUGUAUUUGCCCUC

1089 1089-1107 956 957

UUUTT GTT

AAAUACAGCUUUGGUG UGGCACCAAAGCUGUAU

1096 1096-1114 958 959

CCATT UUTT

AAUACAGCUUUGGUGC GUGGCACCAAAGCUGUA

1097 1097-1115 960 961

CACTT UUTT

AUACAGCUUUGGUGCC GGUGGCACCAAAGCUGU

1098 1098-1116 962 963

ACCTT AUTT

CUUUGGUGCCACCUGCG CACGCAGGUGGCACCAAA

1104 1104-1122 964 965

UGTT GTT

UUGGUGCCACCUGCGU UUCACGCAGGUGGCACCA

1106 1106-1124 966 967

GAATT ATT

CCACCUGCGUGAAGAA CACUUCUUCACGCAGGUG

1112 1112-1130 968 969

GUGTT GTT

CUGCGUGAAGAAGUGU GGGACACUUCUUCACGCA

1116 1116-1134 970 971

CCCTT GTT

UGCGUGAAGAAGUGUC GGGGACACUUCUUCACGC

1117 1117-1135 972 973

CCCTT ATT

GCGUGAAGAAGUGUCC CGGGGACACUUCUUCACG

1118 1118-1136 974 975

CCGTT CTT

CGUGAAGAAGUGUCCC ACGGGGACACUUCUUCAC

1119 1119-1137 976 977

CGUTT GTT

GUGAAGAAGUGUCCCC UACGGGGACACUUCUUCA

1120 1120-1138 978 979

GUATT CTT

UGAAGAAGUGUCCCCG UUACGGGGACACUUCUUC

1121 1121-1139 980 981

UAATT ATT

GAAGAAGUGUCCCCGU AUUACGGGGACACUUCU

1122 1122-1140 982 983

AAUTT UCTT

AAGAAGUGUCCCCGUA AAUUACGGGGACACUUC

1123 1123-1141 984 985

AUUTT UUTT AGAAGUGUCCCCGUAA UAAUUACGGGGACACUU

1124 1124-1142 986 987

UUATT CUTT

GAAGUGUCCCCGUAAU AUAAUUACGGGGACACU

1125 1125-1143 988 989

UAUTT UCTT

AAGUGUCCCCGUAAUU CAUAAUUACGGGGACAC

1126 1126-1144 990 991

AUGTT UUTT

AGUGUCCCCGUAAUUA ACAUAAUUACGGGGACA

1127 1127-1145 992 993

UGUTT CUTT

GUGUCCCCGUAAUUAU CACAUAAUUACGGGGAC

1128 1128-1146 994 995

GUGTT ACTT

UGUCCCCGUAAUUAUG CCACAUAAUUACGGGGAC

1129 1129-1147 996 997

UGGTT ATT

GUCCCCGUAAUUAUGU ACCACAUAAUUACGGGG

1130 1130-1148 998 999

GGUTT ACTT

CCCCGUAAUUAUGUGG UCACCACAUAAUUACGGG

1132 1132-1150 1000 1001

UGATT GTT

CCGUAAUUAUGUGGUG UGUCACCACAUAAUUACG

1134 1134-1152 1002 1003

ACATT GTT

GUAAUUAUGUGGUGAC UCUGUCACCACAUAAUUA

1136 1136-1154 1004 1005

AGATT CTT

UAAUUAUGUGGUGACA AUCUGUCACCACAUAAUU

1137 1137-1155 1006 1007

GAUTT ATT

AAUUAUGUGGUGACAG GAUCUGUCACCACAUAAU

1138 1138-1156 1008 1009

AUCTT UTT

AUUAUGUGGUGACAGA UGAUCUGUCACCACAUAA

1139 1139-1157 1010 1011

UCATT UTT

UUAUGUGGUGACAGAU GUGAUCUGUCACCACAUA

1140 1140-1158 1012 1013

CACTT ATT

AUGUGGUGACAGAUCA CCGUGAUCUGUCACCACA

1142 1142-1160 1014 1015

CGGTT UTT

UGGUGACAGAUCACGG GAGCCGUGAUCUGUCACC

1145 1145-1163 1016 1017

CUCTT ATT

GUGACAGAUCACGGCU ACGAGCCGUGAUCUGUCA

1147 1147-1165 1018 1019

CGUTT CTT

UGACAGAUCACGGCUC CACGAGCCGUGAUCUGUC

1148 1148-1166 1020 1021

GUGTT ATT

GACAGAUCACGGCUCG GCACGAGCCGUGAUCUGU

1149 1149-1167 1022 1023

UGCTT CTT

ACAGAUCACGGCUCGU CGCACGAGCCGUGAUCUG

1150 1150-1168 1024 1025

GCGTT UTT

CAGAUCACGGCUCGUGC ACGCACGAGCCGUGAUCU

1151 1151-1169 1026 1027

GUTT GTT

AGAUCACGGCUCGUGC GACGCACGAGCCGUGAUC

1152 1152-1170 1028 1029

GUCTT UTT

GAUCACGGCUCGUGCG GGACGCACGAGCCGUGAU

1153 1153-1171 1030 1031

UCCTT CTT

AUCACGGCUCGUGCGUC CGGACGCACGAGCCGUGA

1154 1154-1172 1032 1033

CGTT UTT

UCACGGCUCGUGCGUCC UCGGACGCACGAGCCGUG

1155 1155-1173 1034 1035

GATT ATT

CACGGCUCGUGCGUCCG CUCGGACGCACGAGCCGU

1156 1156-1174 1036 1037

AGTT GTT

ACGGCUCGUGCGUCCGA GCUCGGACGCACGAGCCG

1157 1157-1175 1038 1039

GCTT UTT GCUCGUGCGUCCGAGCC CAGGCUCGGACGCACGAG

1160 1160-1178 1040 1041

UGTT CTT

GGAGGAAGACGGCGUC GCGGACGCCGUCUUCCUC

1200 1200-1218 1042 1043

CGCTT CTT

GAGGAAGACGGCGUCC UGCGGACGCCGUCUUCCU

1201 1201-1219 1044 1045

GCATT CTT

GGAAGACGGCGUCCGC CUUGCGGACGCCGUCUUC

1203 1203-1221 1046 1047

AAGTT CTT

GAAGACGGCGUCCGCA ACUUGCGGACGCCGUCUU

1204 1204-1222 1048 1049

AGUTT CTT

AAGACGGCGUCCGCAA CACUUGCGGACGCCGUCU

1205 1205-1223 1050 1051

GUGTT UTT

GACGGCGUCCGCAAGU UACACUUGCGGACGCCGU

1207 1207-1225 1052 1053

GUATT CTT

ACGGCGUCCGCAAGUG UUACACUUGCGGACGCCG

1208 1208-1226 1054 1055

UAATT UTT

GCGUCCGCAAGUGUAA UUCUUACACUUGCGGACG

1211 1211-1229 1056 1057

GAATT CTT

CGUCCGCAAGUGUAAG CUUCUUACACUUGCGGAC

1212 1212-1230 1058 1059

AAGTT GTT

GUCCGCAAGUGUAAGA ACUUCUUACACUUGCGGA

1213 1213-1231 1060 1061

AGUTT CTT

UCCGCAAGUGUAAGAA CACUUCUUACACUUGCGG

1214 1214-1232 1062 1063

GUGTT ATT

CCGCAAGUGUAAGAAG GCACUUCUUACACUUGCG

1215 1215-1233 1064 1065

UGCTT GTT

CGCAAGUGUAAGAAGU CGCACUUCUUACACUUGC

1216 1216-1234 1066 1067

GCGTT GTT

GCAAGUGUAAGAAGUG UCGCACUUCUUACACUUG

1217 1217-1235 1068 1069

CGATT CTT

AAGUGUAAGAAGUGCG CUUCGCACUUCUUACACU

1219 1219-1237 1070 1071

AAGTT UTT

AGUGUAAGAAGUGCGA CCUUCGCACUUCUUACAC

1220 1220-1238 1072 1073

AGGTT UTT

GUGUAAGAAGUGCGAA CCCUUCGCACUUCUUACA

1221 1221-1239 1074 1075

GGGTT CTT

UGUAAGAAGUGCGAAG GCCCUUCGCACUUCUUAC

1222 1222-1240 1076 1077

GGCTT ATT

GUAAGAAGUGCGAAGG GGCCCUUCGCACUUCUUA

1223 1223-1241 1078 1079

GCCTT CTT

UAAGAAGUGCGAAGGG AGGCCCUUCGCACUUCUU

1224 1224-1242 1080 1081

CCUTT ATT

AAGAAGUGCGAAGGGC AAGGCCCUUCGCACUUCU

1225 1225-1243 1082 1083

CUUTT UTT

AGAAGUGCGAAGGGCC CAAGGCCCUUCGCACUUC

1226 1226-1244 1084 1085

UUGTT UTT

AGUGCGAAGGGCCUUG CGGCAAGGCCCUUCGCAC

1229 1229-1247 1086 1087

CCGTT UTT

GUGCGAAGGGCCUUGC GCGGCAAGGCCCUUCGCA

1230 1230-1248 1088 1089

CGCTT CTT

UGCGAAGGGCCUUGCC UGCGGCAAGGCCCUUCGC

1231 1231-1249 1090 1091

GCATT ATT

GCGAAGGGCCUUGCCGC UUGCGGCAAGGCCCUUCG

1232 1232-1250 1092 1093

AATT CTT CGAAGGGCCUUGCCGCA UUUGCGGCAAGGCCCUUC

1233 1233-1251 1094 1095

AATT GTT

AAGGGCCUUGCCGCAA ACUUUGCGGCAAGGCCCU

1235 1235-1253 1096 1097

AGUTT UTT

AGGGCCUUGCCGCAAA CACUUUGCGGCAAGGCCC

1236 1236-1254 1098 1099

GUGTT UTT

GGGCCUUGCCGCAAAG ACACUUUGCGGCAAGGCC

1237 1237-1255 1100 1101

UGUTT CTT

GGCCUUGCCGCAAAGU CACACUUUGCGGCAAGGC

1238 1238-1256 1102 1103

GUGTT CTT

GCCUUGCCGCAAAGUG ACACACUUUGCGGCAAGG

1239 1239-1257 1104 1105

UGUTT CTT

CUUGCCGCAAAGUGUG UUACACACUUUGCGGCAA

1241 1241-1259 1106 1107

UAATT GTT

GGAAUAGGUAUUGGUG AUUCACCAAUACCUAUUC

1261 1261-1279 1108 1109

AAUTT CTT

GAAUAGGUAUUGGUGA AAUUCACCAAUACCUAUU

1262 1262-1280 1110 1111

AUUTT CTT

AAUAGGUAUUGGUGAA AAAUUCACCAAUACCUAU

1263 1263-1281 1112 1113

UUUTT UTT

AUAGGUAUUGGUGAAU UAAAUUCACCAAUACCUA

1264 1264-1282 1114 1115

UUATT UTT

AGGUAUUGGUGAAUUU UUUAAAUUCACCAAUACC

1266 1266-1284 1116 1117

AAATT UTT

GGUAUUGGUGAAUUUA CUUUAAAUUCACCAAUAC

1267 1267-1285 1118 1119

AAGTT CTT

CACUCUCCAUAAAUGCU GUAGCAUUUAUGGAGAG

1289 1289-1307 1120 1121

ACTT UGTT

UUAAACACUUCAAAAA CAGUUUUUGAAGUGUUU

1313 1313-1331 1122 1123

CUGTT AATT

CUUCAAAAACUGCACCU GGAGGUGCAGUUUUUGA

1320 1320-1338 1124 1125

CCTT AGTT

UUCAAAAACUGCACCUC UGGAGGUGCAGUUUUUG

1321 1321-1339 1126 1127

CATT AATT

UCAAAAACUGCACCUCC AUGGAGGUGCAGUUUUU

1322 1322-1340 1128 1129

AUTT GATT

CAAAAACUGCACCUCCA GAUGGAGGUGCAGUUUU

1323 1323-1341 1130 1131

UCTT UGTT

AAAAACUGCACCUCCAU UGAUGGAGGUGCAGUUU

1324 1324-1342 1132 1133

CATT UUTT

ACUGCACCUCCAUCAGU CCACUGAUGGAGGUGCA

1328 1328-1346 1134 1135

GGTT GUTT

CACCUCCAUCAGUGGCG AUCGCCACUGAUGGAGG

1332 1332-1350 1136 1137

AUTT UGTT

ACCUCCAUCAGUGGCGA GAUCGCCACUGAUGGAG

1333 1333-1351 1138 1139

UCTT GUTT

CUCCAUCAGUGGCGAUC GAGAUCGCCACUGAUGG

1335 1335-1353 1140 1141

UCTT AGTT

CAUCAGUGGCGAUCUCC GUGGAGAUCGCCACUGA

1338 1338-1356 1142 1143

ACTT UGTT

UGGCGAUCUCCACAUCC CAGGAUGUGGAGAUCGC

1344 1344-1362 1144 1145

UGTT CATT

GGCGAUCUCCACAUCCU GCAGGAUGUGGAGAUCG

1345 1345-1363 1146 1147

GCTT CCTT GCGAUCUCCACAUCCUG GGCAGGAUGUGGAGAUC

1346 1346-1364 1148 1149

CCTT GCTT

CGAUCUCCACAUCCUGC CGGCAGGAUGUGGAGAU

1347 1347-1365 1150 1151

CGTT CGTT

GAUCUCCACAUCCUGCC CCGGCAGGAUGUGGAGA

1348 1348-1366 1152 1153

GGTT UCTT

CCACAUCCUGCCGGUGG UGCCACCGGCAGGAUGUG

1353 1353-1371 1154 1155

CATT GTT

CACAUCCUGCCGGUGGC AUGCCACCGGCAGGAUGU

1354 1354-1372 1156 1157

AUTT GTT

ACAUCCUGCCGGUGGCA AAUGCCACCGGCAGGAUG

1355 1355-1373 1158 1159

UUTT UTT

AUCCUGCCGGUGGCAU UAAAUGCCACCGGCAGGA

1357 1357-1375 1160 1161

UUATT UTT

CUGCCGGUGGCAUUUA CCCUAAAUGCCACCGGCA

1360 1360-1378 1162 1163

GGGTT GTT

UGCCGGUGGCAUUUAG CCCCUAAAUGCCACCGGC

1361 1361-1379 1164 1165

GGGTT ATT

GCCGGUGGCAUUUAGG ACCCCUAAAUGCCACCGG

1362 1362-1380 1166 1167

GGUTT CTT

CCGGUGGCAUUUAGGG CACCCCUAAAUGCCACCG

1363 1363-1381 1168 1169

GUGTT GTT

GUGGCAUUUAGGGGUG AGUCACCCCUAAAUGCCA

1366 1366-1384 1170 1171

ACUTT CTT

GCAUUUAGGGGUGACU AGGAGUCACCCCUAAAUG

1369 1369-1387 1172 1173

CCUTT CTT

CAUUUAGGGGUGACUC AAGGAGUCACCCCUAAAU

1370 1370-1388 1174 1175

CUUTT GTT

AUUUAGGGGUGACUCC GAAGGAGUCACCCCUAAA

1371 1371-1389 1176 1177

UUCTT UTT

UUUAGGGGUGACUCCU UGAAGGAGUCACCCCUAA

1372 1372-1390 1178 1179

UCATT ATT

UUAGGGGUGACUCCUU GUGAAGGAGUCACCCCUA

1373 1373-1391 1180 1181

CACTT ATT

UAGGGGUGACUCCUUC UGUGAAGGAGUCACCCCU

1374 1374-1392 1182 1183

ACATT ATT

UCUGGAUCCACAGGAA CAGUUCCUGUGGAUCCAG

1404 1404-1422 1184 1185

CUGTT ATT

GAUCCACAGGAACUGG UAUCCAGUUCCUGUGGA

1408 1408-1426 1186 1187

AUATT UCTT

AUCCACAGGAACUGGA AUAUCCAGUUCCUGUGG

1409 1409-1427 1188 1189

UAUTT AUTT

CCACAGGAACUGGAUA GAAUAUCCAGUUCCUGU

1411 1411-1429 1190 1191

UUCTT GGTT

CACAGGAACUGGAUAU AGAAUAUCCAGUUCCUG

1412 1412-1430 1192 1193

UCUTT UGTT

ACUGGAUAUUCUGAAA GGUUUUCAGAAUAUCCA

1419 1419-1437 1194 1195

ACCTT GUTT

AUUCUGAAAACCGUAA CCUUUACGGUUUUCAGA

1426 1426-1444 1196 1197

AGGTT AUTT

UUCUGAAAACCGUAAA UCCUUUACGGUUUUCAG

1427 1427-1445 1198 1199

GGATT AATT

UGAAAACCGUAAAGGA AUUUCCUUUACGGUUUU

1430 1430-1448 1200 1201

AAUTT CATT

Table 6. EGFR siRNA Se uences with Chemical Modifications cgUfcGfgCfgUfcCfgCfcCfgA AfCfaCfgGfgCfgGfaCfgCfcGfa

130 130-148 1250 1251 fgUfdTsdT CfgdTsdT

guCfgGfcGfaCfcGfcCfcGfaG GfAfcUfcGfgGfcGfgAfcGfcCfg

131 131-149 1252 1253 faCfdTsdT AfcdTsdT

ucGfgCfgUfcCfgCfcCfgAfgU GfGfaCfuCfgGfgCfgGfaCfgCfc

132 132- 150 1254 1255 fcCfdTsdT GfadTsdT

gcGfaCfcGfcCfcGfaGfaCfcC CfGfgGfgAfcUfcGfgGfcGfgAf

135 135-153 1256 1257 fcGfdTsdT cGfcdTsdT

cgUfcCfgCfcCfgAfgUfcCfcC GfCfgGfgGfaCfuCfgGfgCfgGfa

136 136-154 1258 1259 fgCfdTsdT CfgdTsdT

gcCfcGfaGfaCfcCfcGfcCfaCf GfCfgAfgGfcGfgGfgAfcUfcGf

141 141-159 1260 1261 gCfdTsdT gGfcdTsdT

aaCfgCfcAfcAfaCfcAfcCfgCf GfCfgCfgGfuGfgUfuGfuGfgCf

164 164- 182 1262 1263 gCfdTsdT gUfadTsdT

acGfcCfaCfaAfcCfaCfcGfcGf UfGfcGfcGfgUfgGfuUfgUfgGf

165 165-183 1264 1265 cAfdTsdT cGfadTsdT

cgCfcAfcAfaCfcAfcCfgCfgCf GfUfgCfgCfgGfuGfgUfuGfuGf

166 166-184 1266 1267 aCfdTsdT gCfgdTsdT

ccAfcAfaCfcAfcCfgCfgCfaCf CfCfgUfgCfgCfgGfuGfgUfuGf

168 168-186 1268 1269 gGfdTsdT uGfgdTsdT

caCfaAfcCfaCfcGfcGfcAfcGf GfCfcGfuGfcGfcGfgUfgGfuUf

169 169- 187 1270 1271 gCfdTsdT gUfgdTsdT

acAfaCfcAfcCfgCfgCfaCfgGf GfGfcCfgUfgCfgCfgGfuGfgUf

170 170-188 1272 1273 cCfdTsdT uGfadTsdT

auGfcGfaCfcCfuCfcGfgGfaC CfCfgUfcCfcGfgAfgGfgUfcGfc

247 247-265 1274 1275 fgGfdTsdT AfudTsdT

ugCfgAfcCfcUfcCfgGfgAfcG GfCfcGfuCfcCfgGfaGfgGfuCfg

248 248-266 1276 1277 fgCfdTsdT CfadTsdT

gcGfaCfcCfuCfcGfgGfaCfgG GfGfcCfgUfcCfcGfgAfgGfgUfc

249 249-267 1278 1279 fcCfdTsdT GfcdTsdT

gaCfcCfuCfcGfgGfaCfgGfcC CfCfgGfcCfgUfcCfcGfgAfgGfg

251 251 -269 1280 1281 fgGfdTsdT UfcdTsdT

acCfcUfcCfgGfgAfcGfgCfcG CfCfcGfgCfcGfuCfcCfgGfaGfg

252 252-270 1282 1283 fgGfdTsdT GfudTsdT

ccUfcCfgGfgAfcGfgCfcGfgG GfCfcCfcGfgCfcGfuCfcCfgGfa

254 254-272 1284 1285 fgCfdTsdT GfgdTsdT

agAfaAfgUfaUfgCfcAfaGfgC GfUfgCfcUfuGfgCfaAfaCfuUfu

329 329-347 1286 1287 faCfdTsdT CfadTsdT

gaAfaGfuUfuGfcCfaAfgGfcA CfGfaGfcCfaUfgGfcAfaAfcUfa

330 330-348 1288 1289 fcGfdTsdT UfcdTsdT

aaGfuUfuGfcCfaAfgGfcAfcG CfUfcGfaGfcC&UfgGfcAfaAfc

332 332-350 1290 1291 faGfdTsdT UfadTsdT

agUfuUfgCfcAfaGfgCfaCfgA AfCfaCfgUfgCfcUfuGfgCfaAfa

333 333-351 1292 1293 fgUfdTsdT CfadTsdT

guUfuGfcCfaAfgGfcAfcGfaG UfAfcUfcGfaGfcCfaUfgGfcAfa

334 334-352 1294 1295 fuAfdTsdT AfcdTsdT

uuUfgCfcAfaGfgCfaCfgAfgU UfUfaCfaCfgUfgCfcUfuGfgCfa

335 335-353 1296 1297 faAfdTsdT AfadTsdT

uuGfcCfaAfgGfcAfcGfaGfuA GfUfaAfcUfcG&GfcCfaUfgGf

336 336-354 1298 1299 faCfdTsdT cAfadTsdT

ugCfcAfaGfgCfaCfgAfgUfaA UfGfaUfaCfuCfgUfgCfcUfaGf

337 337-355 1300 1301 fcAfdTsdT gCfadTsdT

gcCfaAfgGfcAfcGfaGfuAfaC UfUfgUfuAfcUfcGfuGfcCfaUf

338 338-356 1302 1303 faAfdTsdT gGfcdTsdT acGfcAfgUfuGfgGfcAfcUfuU CfAfaAfaGfuGfcCfcAfaCfuGfc

361 361-379 1304 1305 fuGfdTsdT GfudTsdT

cgCfaGfLiUfgGfgCfaCfuUfuU UfCfaAfaAfgUfgCfcCfaAfcUfg

362 362-380 1306 1307 fgAfdTsdT CfgdTsdT

gcAfgUfuGfgGfcAfcUfuUfu UfUfcAfaAfaGfuGfcCfcAfaCfu

363 363-381 1308 1309

GfaAfdTsdT GfcdTsdT

caGfuUfgGfgCfaCfuUfuUfgA CfUfuCfaAfaAfgUfgCfcCfaAfc

364 364-382 1310 1311 faGfdTsdT UfgdTsdT

agUfuGfgGfcAfcUfuUfuGfa UfCfuUfcAfaAfaGfuGfcCfcAfa

365 365-383 1312 1313

AfgAfdTsdT CfudTsdT

guUfgGfgCfaCfuUfuUfgAfa AfUfcUfuCfaAfaAfgUfgCfcCfa

366 366-384 1314 1315

GfaUfdTsdT AfcdTsdT

uuGfgGfcAfcUfuUfuGfaAfg GfAftiCfuUfcAfaAfaGfuGfcCfc

367 367-385 1316 1317

AfuCfdTsdT AfadTsdT

ugGfgCfaCfuUfuUfgAfaGfaU UfGfaUfcUfuCfaAfaAfgUfgCfc

368 368-386 1318 1319 fcAfdTsdT CfadTsdT

ggGfcAfcUfuUfuGfaAfgAfu AfUfgAfuCfuUfcAfaAfaGfuGf

369 369-387 1320 1321

CfaUfdTsdT cCfcdTsdT

uuGfaAfgAfuCfaUfuUfuCfuC CfUfgAfgAfaAfaUfgA&CfuUf

377 377-395 1322 1323 faGfdTsdT cAfadTsdT

gaAfgAfuCfaUfuUfuCfuCfaG GfGfcUfgAfgAfaAfaUfgAfuCf

379 379-397 1324 1325 fcCfdTsdT uUfcdTsdT

aaGfaUfcAfuUfuUfcUfcAfgC AfGfgCfLiGfaGfaAfaAfuGfaUfc

380 380-398 1326 1327 fcUfdTsdT UfudTsdT

caUfoUfiiCfuCfaGfcCfuCfcA UfC&GfgAfgGfcUfgAfgAfaAf

385 385-403 1328 1329 fgAfdTsdT aUfgdTsdT

agCfcUfcCfaGfaGfgAfuGfuU UfGfaAfcAfuCfcUfcUfgGfaGfg

394 394-412 1330 1331 fcAfdTsdT CfudTsdT

ccUfcCfaGfaGfgAfuGfuUfcA AfUfuGfaAfcAfuCfcUfcUfgGfa

396 396-414 1332 1333 faUfdTsdT GfgdTsdT

cuCfcAfgAfgGfaUfgUfuCfaA UfAfuUfgAfaCfaUfcCftiCfuGfg

397 397-415 1334 1335 fuAfdTsdT AfgdTsdT

agAfgGfaUfgUfuCfaAfuAfaC CfAfgUfuAfuUfgAfaCfaUfcCfu

401 401-419 1336 1337 fuGfdTsdT CfudTsdT

agGfaUfgUfuCfaAfuAfaCfuG CfAfcAfgUfuAfuUfgAfaCfaUfc

403 403-421 1338 1339 fuGfdTsdT CfudTsdT

ugUfuCfaAfuAfaCfuGfuGfaG AfCfcUfcAfcAfgUfuAfuUfgAf

407 407-425 1340 1341 fgUfdTsdT aCfadTsdT

uuCfaAfuAfaCfuGfuGfaGfgU CfCfaCfcUfcAfcAfgU&AfuUfg

409 409-427 1342 1343 fgGfdTsdT AfadTsdT

ucAfaUfaAfcUfgUfgAfgGfu AfCfcAfcCfuCfaCfaGfuUfaUfu

410 410-428 1344 1345

GfgUfdTsdT GfadTsdT

caAfuAfaCfuGfuGfaGfgUfgG GfAfcCfaCfcUfcAfcAfgUfuAfu

411 41 1-429 1346 1347 fuCfdTsdT UfgdTsdT

aaUfaAfcUfgUfgAfgGfuGfg GfGfaCfcAfcCfuCfaCfaGfuUfa

412 412-430 1348 1349

UfcCfdTsdT U&dTsdT

auAfaCfuGfuGfaGfgUfgGfuC AfGfgAfcCfaCfcUfcAfcAfgUfu

413 413-431 1350 1351 fcUfdTsdT AfudTsdT

uaAfcUfgUfgAfgGfuGfgUfc AfAfgGfaCfcAfcCfuCfaCfaGfu

414 414-432 1352 1353

CfuUfdTsdT UfadTsdT

acUfgUfgAfgGfuGfgUfcCfu CfCfaAfgGfaCfcAfcCfuCfaCfa

416 416-434 1354 1355

UfgGfdTsdT GfudTsdT

ugUfgAfgGfuGfgUfcCfuUfg UfCfcCfaAfgGfaCfcAfcCfuCfa

418 418-436 1356 1357

GfgAfdTsdT CfadTsdT guGfaGfgUfgGfuCfcUfuGfg UfUfcCfcAfaGfgAfcCfaCfcUfc

419 419-437 1358 1359

GfaAfdTsdT AfcdTsdT

ugGfuCfcUfuGfgGfaAfuUfu UfCfcAfaAfuUfcCfcAfaGfgAfc

425 425-443 1360 1361

GfgAfdTsdT CfadTsdT

uuGfgGfaAfuUfuGfgAfaAfu GfUfaAfuUfuCfcAfaAfuUfcCfc

431 431-449 1362 1363

UfaCfdTsdT AfadTsdT

ugGfgAfaUfuUfgGfaAfaUfu GfGfuAfaU&UfcCfaAfaUfuCfc

432 432-450 1364 1365

AfcCfdTsdT CfadTsdT

ggGfaAfuUfuGfgAfaAfuUfa AfGfgUfaAfuUfuCfcAfaAfuUf

433 433-451 1366 1367

CfcUfdTsdT cCfcdTsdT

ggAfaUfuUfgGfaAfaUfuAfcC UfAfgGfuAfaUfuUfcCfaAfaUf

434 434-452 1368 1369 fuAfdTsdT uCfcdTsdT

agAfgGfaAfuUfaUfgAfuCfu GfAfaAfgAfuCfaUfaAfuUfcCfu

458 458-476 1370 1371

UfuCfdTsdT CfudTsdT

gaGfgAfaUfuAfuGfaUfcUfu GfGfaAfaGfaUfcAfuAfaUfuCfc

459 459-477 1372 1373

UfcCfdTsdT UfcdTsdT

aaUfuAfuGfaUfcUfuUfcCfuU AfGfaAfgGfaAfaGfaUfcAfuAfa

463 463-481 1374 1375 fcUfdTsdT UfudTsdT

auUfaUfgAfuCfuUfuCfcUfuC AfAfgAfaGfgAfaAfgAfuCfaUf

464 464-482 1376 1377 fuUfdTsdT aAfiidTsdT

uaUfgAfuCfoUftiCfcUfuCfuU UfUfaAfgAfaGfgAfaAfgAfuCf

466 466-484 1378 1379 faAfdTsdT aUfadTsdT

ugAfuCfuUfuCfcUfuCfuUfaA CfUfuUfaAfgAfaGfgAfaAfgAf

468 468-486 1380 1381 faGfdTsdT uCfadTsdT

ucUfuUfcCfuUfcUfuAfaAfgA GfGfuCfuUfuAfaGfaAfgGfaAf

471 471-489 1382 1383 fcCfdTsdT aGfadTsdT

ccUfuCfuUfaAfaGfaCfcAfuC UfGfgAfuGfgUfcUfuUfaAfgAf

476 476-494 1384 1385 fcAfdTsdT aGfgdTsdT

cuUfcUfuAfaAfgAfcCfaUfcC CfUfgGfaUfgGfoCfuUfuAfaGf

477 477-495 1386 1387 faGfdTsdT aAfgdTsdT

ucUfuAfaAfgAfcCfaUfcCfaG UfCfcUfgGfaUfgGfuCfuUfuAf

479 479-497 1388 1389 fgAfdTsdT aGfadTsdT

uuAfaAfgAfcCfaUfcCfaGfgA CfCfuCfcUfgGfaUfgGfuCfuUfu

481 481-499 1390 1391 fgGfdTsdT AfadTsdT

uaAfaGfaCfcAfuCfcAfgGfaG AfCfcUfcCfuGfgAfuGfgUfcUf

482 482-500 1392 1393 fgUfdTsdT uUfadTsdT

ccAfgGfaGfgUfgGfcUfgGfu AfUfaAfcCfaGfcCfaCfcUfcCfu

492 492-510 1394 1395

UfaUfdTsdT GfgdTsdT

caGfgAfgGfuGfgCfuGfgUfu CfAfuAfaCfcAfgCfcAfcCfuCfc

493 493-511 1396 1397

AfuGfdTsdT UfgdTsdT

agGfaGfgUfgGfcUfgGfuUfa AfCfaUfaAfcCfaGfcCfaCfcUfc

494 494-512 1398 1399

UfgUfdTsdT CfudTsdT

ggAfgGfuGfgCfuGfgUfuAfu GfAfcAfuAfaCfcAfgCfcAfcCfu

495 495-513 1400 1401

GfuCfdTsdT CfcdTsdT

gaGfgUfgGfcUfgGfuUfaUfg GfGfaCfaUfaAfcCfaGfcCfaCfc

496 496-514 1402 1403

UfcCfdTsdT UfcdTsdT

agGfuGfgCfuGfgUfuAfuGfu AfGfgAfcAfuAfaCfcAfgCfcAfc

497 497-515 1404 1405

CfcUfdTsdT CfudTsdT

guGfgCfuGfgUfuAfuGfuCfc UfGfaGfgAfcAfuAfaCfcAfgCfc

499 499-517 1406 1407

UfcAfdTsdT AfcdTsdT

gcCfcUfcAfaCfaCfaGfuGfgA GfCfuCfcAfcUfgUfgUfuGfaGf

520 520-538 1408 1409 fgCfdTsdT gGfcdTsdT

uuCfcUfuUfgGfaAfaAfcCfuG UfGfcAfgGfuUfuUfcCfaAfaGf

542 542-560 1410 1411 fcAfdTsdT gAfadTsdT ucCfuUfuGfgAfaAfaCfcUfgC CfUfgCfaGfgUfuUfuCfcAfaAfg

543 543-561 1412 1413 faGfdTsdT GfadTsdT

gaAfaAfcCfuGfcAfgAfuCfaU UfGfaUfgAfuCfuGfcAfgGfuUf

550 550-568 1414 1415 fcAfdTsdT uUfcdTsdT

aaAfaCfcUfgCfaGfaUfcAfuC CfUfgAfuGfaUfcUfgCfaGfgUf

551 551-569 1416 1417 faGfdTsdT uUfudTsdT

aaCfcUfgCfaGfaUfcAfuCfaG CfUfcUfgAfuGfaUfcUfgCfaGfg

553 553-571 1418 1419 faGfdTsdT UfudTsdT

cuGfcAfgAfuCfaUfcAfgAfgG UfUfcCfuCfuGfaUfgAfuCfuGfc

556 556-574 1420 1421 faAfdTsdT AfgdTsdT

gaAfaAfuUfcCfuAfuGfcCfuU CfUfaAfgGfcAfuAfgGfaAfuUf

586 586-604 1422 1423 faGfdTsdT uUfcdTsdT

aaAfaUfuCfcUfaUfgCfcUfuA GfCfuAfaGfgCfaUfaGfgAfaUfu

587 587-605 1424 1425 fgCfdTsdT UfudTsdT

aaUfuCfcUfaUfgCfcUfuAfgC CfUfgCfuAfaGfgCfaUfaGfgAfa

589 589-607 1426 1427 faGfdTsdT UfudTsdT

ucCfuAfuGfcCfuUfaGfcAfgU AfGfaCfuGfcUfaAfgGfcAfuAf

592 592-610 1428 1429 fcUfdTsdT gGfadTsdT

ccUfaUfgCfcUfuAfgCfaGfuC AfAfgAfcUfgCfuAfaGfgCfaUfa

593 593-611 1430 1431 fuUfdTsdT GfgdTsdT

cuAfuGfcCfuUfaGfcAfgUfcU UfAfaGfaCfuGfcUfaAfgGfcAfu

594 594-612 1432 1433 fuAfdTsdT AfgdTsdT

auGfcCfuUfaGfcAfgUfcUfuA GfAfuAfaGfaCfuGfcUfaAfgGfc

596 596-614 1434 1435 fuCfdTsdT AfudTsdT

ugCfcUfuAfgCfaGfuC&UfaU AfGfaUfaAfgAfcUfgC&AfaGf

597 597-615 1436 1437 fcUfdTsdT gCfadTsdT

gcCfuUfaGfcAfgUfcUfuAfuC UfAfgAfuAfaGfaCfuGfcUfaAf

598 598-616 1438 1439 fuAfdTsdT gGfcdTsdT

ccUfuAfgCfaGfuCfuUfaUfcU UfUfaGfaUfaAfgAfcUfgCfuAfa

599 599-617 1440 1441 faAfdTsdT GfgdTsdT

cuUfaGfcAfgUfcUfuAfuCfuA GfUfuAfgAfuAfaGfaCfuGfcUf

600 600-618 1442 1443 faCfdTsdT aAfgdTsdT

uuAfgCfaGfuCfuUfaUfcUfaA AfGfuUfaGfaUfaAfgAfcUfgCf

601 601-619 1444 1445 fcUfdTsdT uAfadTsdT

uaGfcAfgUfcUfuAfuCfuAfaC UfAfgUfuAfgAfuAfaGfaCfuGf

602 602-620 1446 1447 fuAfdTsdT cUfadTsdT

agCfaGfuCfuUfaUfcUfaAfcU AfUfaGfuUfaGfaUfaAfgAfcUf

603 603-621 1448 1449 faUfdTsdT gCfudTsdT

gcAfgUfcUfuAfuCfuAfaCfuA CfAfuAfgUfuAfgAfuAfaGfaCf

604 604-622 1450 1451 fuGfdTsdT uGfcdTsdT

caGfuCfiiUfaUfcUfaAfcUfaU UfCfaUfaGfuUfaGfaUfaAfgAfc

605 605-623 1452 1453 fgAfdTsdT UfgdTsdT

ucUfuAfuCfuAfaCfuAfuGfaU GfCfaUfcAfuAfgUfuAfgAfuAf

608 608-626 1454 1455 fgCfdTsdT aGfadTsdT

cuUfaUfcUfaAfcUfaUfgAfuG UfGfcAfuCfaUfaG&UfaGfaUfa

609 609-627 1456 1457 fcAfdTsdT AfgdTsdT

uuAfuCfuAfaCfuAfuGfaUfgC UfUfgCfaUfcAfuAfgUfuAfgAf

610 610-628 1458 1459 faAfdTsdT uAfadTsdT

uaUfcUfaAfcUfaUfgAfuGfcA UfUftiGfcAfuCfaUfaGfuUfaGfa

611 61 1-629 1460 1461 faAfdTsdT UfadTsdT

auCfuAfaCfuAfuGfaUfgCfaA AfUfuUfgCfaUfcA&AfgUfuAf

612 612-630 1462 1463 faUfdTsdT gAfudTsdT

ucUfaAfcUfaUfgAfuGfcAfaA UfAfuUfuGfcAfuCfaUfaGfuUf

613 613-631 1464 1465 fuAfdTsdT aGfadTsdT cuAfaCfuAfuGfaUfgCfaAfaU UfUfaUfuUfgCfaUfcAfuAfgUf

614 614-632 1466 1467 faAfdTsdT uAfgdTsdT

aaCfoAfuGfaUfgCfaAfaUfaA UfUfuUfaUfuUfgCfaUfcAfuAf

616 616-634 1468 1469 faAfdTsdT gUfudTsdT

gaUfgCfaAfaUfaAfaAfcCfgG GfUfcCfgGfuUfuUfaUfuUfgCf

622 622-640 1470 1471 faCfdTsdT aUfcdTsdT

auGfcAfaAfuAfaAfaCfcGfgA AfGfuCfcGfgUfuUfuAfuUfuGf

623 623-641 1472 1473 fcUfdTsdT cAfudTsdT

ugCfaAfaUfaAfaAfcCfgGfaC CfAfgUfcCfgGfuUfuUfaUfiiUf

624 624-642 1474 1475 fuGfdTsdT gCfadTsdT

caAfaUfaAfaAfcCfgGfaCfuG UfUfcAfgUfcCfgGfuUfuUfaUf

626 626-644 1476 1477 faAfdTsdT uUfgdTsdT

aaAfuAfaAfaCfcGfgAfcUfgA CfUfuCfaGfuCfcGfgUfuUfuAf

627 627-645 1478 1479 faGfdTsdT uUfudTsdT

aaUfaAfaAfcCfgGfaCfuGfaA CfCfuUfcAfgUfcCfgGfuUfuUfa

628 628-646 1480 1481 fgGfdTsdT UfudTsdT

uaAfaAfcCfgGfaCfuGfaAfgG CfUfcCfuUfcAfgUfcCfgGfuUfu

630 630-648 1482 1483 faGfdTsdT UfadTsdT

aaAfaCfcGfgAfcUfgAfaGfgA GfCfuCfcUfuCfaGfuCfcGfgUfu

631 631-649 1484 1485 fgCfdTsdT UfudTsdT

aaAfcCfgGfaCfiiGfaAfgGfaG AfGfcUfcCfuUfcAfgUfcCfgGfu

632 632-650 1486 1487 fcUfdTsdT UfudTsdT

aaCfcGfgAfcUfgAfaGfgAfgC CfAfgCfuCfcUfuCfaGfuCfcGfg

633 633-651 1488 1489 fuGfdTsdT UfudTsdT

agGfaGfcUfgCfcCfaUfgAfgA UfUfuCfuCfaUfgGfgCfaGfcUfc

644 644-662 1490 1491 faAfdTsdT CfudTsdT

uaCfaGfgAfaAfuCfcUfgCfaU CfCfaUfgCfaGfgAfuUfuCfcUfg

665 665-683 1492 1493 fgGfdTsdT UfadTsdT

agGfaAfaUfcCfuGfcAfuGfgC GfCfgCfcAfuGfcAfgGfaUfuUfc

668 668-686 1494 1495 fgCfdTsdT CfudTsdT

ggAfaAfuCfcUfgCfaUfgGfcG GfGfcGfcCfaUfgCfaGfgAfuUfu

669 669-687 1496 1497 fcCfdTsdT CfcdTsdT

gaAfaUfcCfiiGfcAfuGfgCfgC CfGfgCfgCfcAfuGfcAfgGfaUfu

670 670-688 1498 1499 fcGfdTsdT UfcdTsdT

aaAfuCfcUfgCfaUfgGfcGfcC AfCfgGfcGfcCfaUfgCfaGfgAfu

671 671-689 1500 1501 fgUfdTsdT UfudTsdT

aaUfcCfuGfcAfuGfgCfgCfcG CfAfcGfgCfgCfcAfuGfcAfgGfa

672 672-690 1502 1503 fuGfdTsdT UfudTsdT

ucCfuGfcAfuGfgCfgCfcGftiG CfGfcAfcGfgCfgCfcAfuGfcAfg

674 674-692 1504 1505 fcGfdTsdT GfadTsdT

cuGfcA&GfgCfgCfcGfuGfcG AfCfcGfcAfcGfgCfgCfcAfuGfc

676 676-694 1506 1507 fgUfdTsdT AfgdTsdT

ugCfaUfgGfcGfcCfgUfgCfgG AfAfcCfgCfaCfgGfcGfcCfaUfg

677 677-695 1508 1509 fuUfdTsdT CfadTsdT

gcAfuGfgCfgCfcGfuGfcGfgU GfAfaCfcGfcAfcGfgCfgCfcAfu

678 678-696 1510 151 1 fuCfdTsdT GfcdTsdT

auGfgCfgCfcGfuGfcGfgUfuC CfUfgAfaCfcGfcAfcGfgCfgCfc

680 680-698 1512 1513 faGfdTsdT AfudTsdT

ugGfcGfcCfgUfgCfgGfuUfcA GfCfuGfaAfcCfgCfaCfgGfcGfc

681 681-699 1514 1515 fgCfdTsdT CfadTsdT

ggCfgCfcGfuGfcGfgUfuCfaG UfGfcUfgAfaCfcGfcAfcGfgCfg

682 682-700 1516 1517 fcAfdTsdT CfcdTsdT

gcGfcCfgUfgCfgGfuUfcAfgC UfUfgCfuGfaAfcCfgCfaCfgGfc

683 683-701 1518 1519 faAfdTsdT GfcdTsdT cgCfcGfuGfcGfgUfuCfaGfcA GfUfuGfcUfgAfaCfcGfcAfcGfg

684 684-702 1520 1521 faCfdTsdT CfgdTsdT

gcCfgUfgCfgGfuUfcAfgCfaA UfGfuUfgCfuGfaAfcCfgCfaCfg

685 685-703 1522 1523 fcAfdTsdT GfcdTsdT

ccGfuGfcGfgUfuCfaGfcAfaC UfUfgUfuGfcUfgAfaCfcGfcAfc

686 686-704 1524 1525 faAfdTsdT GfgdTsdT

guGfcGfgUfuCfaGfcAfaCfaA GfGfuUfgUfuGfcUfgAfaCfcGf

688 688-706 1526 1527 fcCfdTsdT cAfcdTsdT

gcGfgUfuCfaGfcAfaCfaAfcC AfGfgGfuUfgUfuGfcUfgAfaCf

690 690-708 1528 1529 fcUfdTsdT cGfcdTsdT

ggUfuCfaGfcAfaCfaAfcCfcU GfCfaGfgGfuUfgUfuGfcUfgAf

692 692-710 1530 1531 fgCfdTsdT aCfcdTsdT

gcAfaCfaAfcCfcUfgCfcCfuG CfAfcAfgGfgCfaGfgGfuUfgUf

698 698-716 1532 1533 fuGfdTsdT uGfcdTsdT

aaCfaAfcCfcUfgCfcCfuGfuG UfGfcAfcAfgGfgCfaGfgGfuUf

700 700-718 1534 1535 fcAfdTsdT gUfudTsdT

acGfuGfgAfgAfgCfaUfcCfaG CfAfcUfgGfaUfgCfuCfuCfcAfc

719 719-737 1536 1537 fuGfdTsdT GfudTsdT

cgUfgGfaGfaGfcAfuCfcAfgU CfCfaCftiGfgAfuGfcUfcUfcCfa

720 720-738 1538 1539 fgGfdTsdT CfgdTsdT

guGfgAfgAfgCfaUfcCfaGfuG GfCfcAfcUfgGfaUfgCfuCfuCfc

721 721-739 1540 1541 fgCfdTsdT AfcdTsdT

gaGfaGfcAfuCfcAfgUfgGfcG CfCfcGfcCfaCfuGfgAfuGfcUfc

724 724-742 1542 1543 fgGfdTsdT UfcdTsdT

agAfgCfaUfcCfaGfuGfgCfgG UfCfcCfgCfcAfcUfgGfaUfgCfu

725 725-743 1544 1545 fgAfdTsdT CfudTsdT

gaGfcAfiiCfcAfgUfgGfcGfgG GfUfcCfcGfcCfaCfuGfgAfuGfc

726 726-744 1546 1547 faCfdTsdT UfcdTsdT

caGfuGfgCfgGfgAfcAfuAfg UfGfaC&AfuGfuCfcCfgCfcAfc

733 733-751 1548 1549

UfcAfdTsdT UfgdTsdT

agUfgGfcGfgGfaCfaUfaGfuC CfUfgAfcUfaUfgUfcCfcGfcCfa

734 734-752 1550 1551 faGfdTsdT CfudTsdT

ugGfcGfgGfaCfaUfaGfuCfaG UfGfcUfgAfcUfaUfgUfcCfcGfc

736 736-754 1552 1553 fcAfdTsdT CfadTsdT

ggCfgGfgAfcAfuAfgUfcAfg CfUfgCfuGfaCfuAfuGfuCfcCfg

737 737-755 1554 1555

CfaGfdTsdT CfcdTsdT

cuCfaGfcAfaCfaUfgUfcGfaU CfCfaUfcGfaCfaUfgUfuGfcUfg

763 763-781 1556 1557 fgGfdTsdT AfgdTsdT

caGfcAfaCfaUfgUfcGfaUfgG GfUfcCfaUfcGfaCfaUfgUfuGfc

765 765-783 1558 1559 faCfdTsdT UfgdTsdT

agCfaAfcAfuGfuCfgAfuGfgA AfGfuCfcAfuCfgAfcAfuGfuUf

766 766-784 1560 1561 fcUfdTsdT gCfudTsdT

gcAfaCfaUfgUfcGfaUfgGfaC AfAfgUfcCfaUfcGfaCfaUfgUfu

767 767-785 1562 1563 fuUfdTsdT GfcdTsdT

aaCfaUfgUfcGfaUfgGfaCfuU GfGfaAfgUfcCfaUfcGfaCfaUfg

769 769-787 1564 1565 fcCfdTsdT UfudTsdT

acAfuGfuCfgAfuGfgAfcUfuC UfGfgAfaGfuCfcAfuCfgAfcAf

770 770-788 1566 1567 fcAfdTsdT uGfudTsdT

caUfgUfcGfaUfgGfaCfuUfcC CfUfgGfaAfgUfcCfaUfcGfaCfa

771 771-789 1568 1569 faGfdTsdT UfgdTsdT

auGfuCfgAfuGfgAfcUfuCfcA UfCfuGfgAfaGfuCfcAfuCfgAfc

772 772-790 1570 1571 fgAfdTsdT AfudTsdT

ucGfaUfgGfaCfuUfcCfaGfaA GfGfuUfcUfgGfaAfgUfcCfaUfc

775 775-793 1572 1573 fcCfdTsdT GfadTsdT gaAfcCfaCfcUfgGfgCfaGfcU GfCfaGfcUfgCfcCfaGfgUfgGfu

789 789-807 1574 1575 fgCfdTsdT UfcdTsdT

ggGfcAfgCfuGfcCfaAfaAfgU AfCfaCfLiUfuUfgGfcAfgCfLiGfc

798 798-816 1576 1577 fgUfdTsdT CfcdTsdT

gcAfgCfuGfcCfaAfaAfgUfgU UfCfaCfaCfuUfuUfgGfcAfgCfu

800 800-818 1578 1579 fgAfdTsdT GfcdTsdT

ugCfcAfaAfaGfuGfuGfaUfcC UfUfgGfaUfcAfcAfcUfuUfuGf

805 805-823 1580 1581 faAfdTsdT gCfadTsdT

gcCfaAfaAfgUfgUfgAfuCfcA CfUfuGfgAfuCfaCfaCfuUfuUfg

806 806-824 1582 1583 faGfdTsdT GfcdTsdT

ccAfaAfaGfuGfuGfaUfcCfaA GfCfuUfgGfaUfcAfcAfcUfuUf

807 807-825 1584 1585 fgCfdTsdT uGfgdTsdT

aaAfgUfgUfgAfuCfcAfaGfcU AfCfaGfcUfuGfgAfuCfaCfaCfu

810 810-828 1586 1587 fgUfdTsdT UfudTsdT

ugUfgAfuCfcAfaGfcUfgUfcC UfGfgGfaCfaGfcUfuGfgAfuCfa

814 814-832 1588 1589 fcAfdTsdT CfadTsdT

guGfaUfcCfaAfgCfuGfuCfcC UfUfgGfgAfcAfgCfuUfgGfaUf

815 815-833 1590 1591 faAfdTsdT cAfcdTsdT

gaUfcCfaAfgCfuGfuCfcCfaA CfA&UfgGfgAfcAfgC&UfgGf

817 817-835 1592 1593 fuGfdTsdT aUfcdTsdT

auCfcAfaGfcUfgUfcCfcAfaU CfCfaUfuGfgGfaCfaGfcUfuGfg

818 818-836 1594 1595 fgGfdTsdT AfudTsdT

ucCfaAfgCfuGfuCfcCfaAfuG CfCfcAfLiUfgGfgAfcAfgCfLiUf

819 819-837 1596 1597 fgGfdTsdT gGfadTsdT

ccAfaGfcUfgUfcCfcAfaUfgG UfCfcCfaUfuGfgGfaCfaGfcUfu

820 820-838 1598 1599 fgAfdTsdT GfgdTsdT

caAfgCfuGfuCfcCfaAfuGfgG CfUfcCfcAfuUfgGfgAfcAfgCfu

821 821-839 1600 1601 faGfdTsdT UfgdTsdT

agCfuGfuCfcCfaAfuGfgGfaG AfGfcUfcCfcAfuUfgGfgAfcAf

823 823-841 1602 1603 fcUfdTsdT gCfudTsdT

ugUfcCfcAfaUfgGfgAfgCfuG AfGfcAfgCfuCfcCfaUfuGfgGfa

826 826-844 1604 1605 fcUfdTsdT CfadTsdT

ggUfgCfaGfgAfgAfgGfaGfa AfGfuUfcUfcCfuCfuCfcUfgCfa

847 847-865 1606 1607

AfcUfdTsdT CfcdTsdT

aaAfcUfgAfcCfaAfaAfuCfaU AfGfaUfgAfuUfuUfgGfuCfaGf

871 871-889 1608 1609 fcUfdTsdT uUfudTsdT

aaCfuGfaCfcAfaAfaUfcAfuC CfAfgAfLiGfaUfuUfuGfgUfcAf

872 872-890 1610 161 1 fuGfdTsdT gUfudTsdT

acUfgAfcCfaAfaAfuCfaUfcU AfCfaGfaUfgAfuUfuUfgGfuCf

873 873-891 1612 1613 fgUfdTsdT aGfudTsdT

acCfaAfaAfuCfaUfcUfgUfgC GfGfgCfaCfaGfaUfgAfuUfuUf

877 877-895 1614 1615 fcCfdTsdT gGfudTsdT

ccAfaAfaUfcAfuCfuGfuGfcC UfGfgGfcAfcAfgAfuGfaUfuUf

878 878-896 1616 1617 fcAfdTsdT uGfgdTsdT

aaAfuCfaUfcUfgUfgCfcCfaG UfGfcUfgGfgCfaCfaGfaUfgAfu

881 881-899 1618 1619 fcAfdTsdT UfudTsdT

guGfcCfcAfgCfaGfuGfcUfcC CfCfgGfaGfcAfcUfgCfuGfgGfc

890 890-908 1620 1621 fgGfdTsdT AfcdTsdT

gcCfcAfgCfaGfuGfcUfcCfgG GfCfcCfgGfaGfcAfcUfgCfLiGfg

892 892-910 1622 1623 fgCfdTsdT GfcdTsdT

ccAfgUfgAfcUfgCfuGfcCfaC UfUfgUfgGfcAfgCfaGfuCfaCfu

929 929-947 1624 1625 faAfdTsdT GfgdTsdT

caGfuGfaCfuGfcUfgCfcAfcA GfUfiiGfuGfgCfaGfcAfgUfcAf

930 930-948 1626 1627 faCfdTsdT cUfgdTsdT gaGfaGfcGfaCfuGfcCfuGfgU AfGfaCfcAfgGfcAfgUfcGfcUfc

979 979-997 1628 1629 fcUfdTsdT UfcdTsdT

agAfgCfgAfcUfgCfcUfgGfuC CfAfgAfcCfaGfgCfaGfuCfgCfu

980 980-998 1630 1631 fuGfdTsdT CfudTsdT

gaGfcGfaCfuGfcCfuGfgUfcU GfCfaGfaCfcAfgGfcAfgUfcGfc

981 981-999 1632 1633 fgCfdTsdT UfcdTsdT

agCfgAfcUfgCfcUfgGfuCfuG GfGfcAfgAfcCfaGfgCfaGfuCfg

982 982-1000 1634 1635 fcCfdTsdT CfudTsdT

gcGfaCfuGfcCfuGfgUfcUfgC CfGfgCfaGfaCfcAfgGfcAfgUfc

983 983-1001 1636 1637 fcGfdTsdT GfcdTsdT

cgAfcUfgCfcUfgGfuCfuGfcC GfCfgGfcAfgAfcCfaGfgCfaGfu

984 984-1002 1638 1639 fgCfdTsdT CfgdTsdT

gcCfuGfgUfcUfgCfcGfcAfaA AfAfuUfuGfcGfgCfaGfaCfcAfg

989 989-1007 1640 1641 fuUfdTsdT GfcdTsdT

ccUfgGfuCfuGfcCfgCfaAfaU GfAfaUfuUfgCfgGfcAfgAfcCfa

990 990-1008 1642 1643 fuCfdTsdT GfgdTsdT

cuGfgUfcUfgCfcGfcAfaAfuU GfGfaAfuUfuGfcGfgCfaGfaCfc

991 991-1009 1644 1645 fcCfdTsdT AfgdTsdT

ugGfuCfuGfcCfgCfaAfaUfuC CfGfgAfaUfuUfgCfgGfcAfgAf

992 992-1010 1646 1647 fcGfdTsdT cCfadTsdT

guCfuGfcCfgCfaAfaUfuCfcG CfUfcGfgAfaUfuUfgCfgGfcAf

994 994-1012 1648 1649 faGfdTsdT gAfcdTsdT

ucUfgCfcGfcAfaAfiiUfcCfgA UfCfLiCfgGfaAfuUfuGfcGfgCfa

995 995-1013 1650 1651 fgAfdTsdT GfadTsdT

cuGfcCfgCfaAfaUfuCfcGfaG GfUfcUfcGfgAfaUfuUfgCfgGf

996 996-1014 1652 1653 faCfdTsdT cAfgdTsdT

ugCfcGfcAfaAfuUfcCfgAfgA CfGfuCfuCfgGfaAfuUfuGfcGf

997 997-1015 1654 1655 fcGfdTsdT gCfadTsdT

ccGfcAfaAfuUfcCfgAfgAfcG UfUfcGfuCfuCfgGfaAfuUfuGf

999 999-1017 1656 1657 faAfdTsdT cGfgdTsdT

aaUfuCfcGfaGfaCfgAfaGfcC GfUfgGfcUfuCfgUfcUfcGfgAf

1004 1004-1022 1658 1659 faCfdTsdT aUfudTsdT

auUfcCfgAfgAfcGfaAfgCfcA CfGfuGfgCfuUfcG&CfuCfgGfa

1005 1005-1023 1660 1661 fcGfdTsdT AfudTsdT

uuCfcGfaGfaCfgAfaGfcCfaC AfCfgUfgGfcUfuCfgUfcUfcGf

1006 1006-1024 1662 1663 fgUfdTsdT gAfadTsdT

ucCfgAfgAfcGfaAfgCfcAfcG CfAfcGfuGfgCfuUfcGfLiCfuCfg

1007 1007-1025 1664 1665 fuGfdTsdT GfadTsdT

ccGfaGfaCfgAfaGfcCfaCfgU GfCfaCfgUfgGfcUfuCfgUfcUfc

1008 1008-1026 1666 1667 fgCfdTsdT GfgdTsdT

gaGfaCfgAfaGfcCfaCfgUfgC UfUfgCfaCfgUfgGfcUfuCfgUfc

1010 1010-1028 1668 1669 faAfdTsdT UfcdTsdT

acGfaAfgCfcAfcGfuGfcAfaG UfCfcUfuGfcAfcGfuGfgCfuUfc

1013 1013-1031 1670 1671 fgAfdTsdT GfudTsdT

cgAfaGfcCfaCfgUfgCfaAfgG GfUfcCfuUfgCfaCfgUfgGfcUfu

1014 1014-1032 1672 1673 faCfdTsdT CfgdTsdT

gaAfgCfcAfcGfuGfcAfaGfgA UfGfuCfcUfuGfcAfcGfuGfgCf

1015 1015-1033 1674 1675 fcAfdTsdT uUfcdTsdT

aaGfcCfaCfgUfgCfaAfgGfaC GfUfgUfcCfuUfgCfaCfgUfgGfc

1016 1016-1034 1676 1677 faCfdTsdT UfudTsdT

ccCfcAfcUfcAfuGfcUfcUfaC UfUfgUfaGfaGfcAfuGfaGfuGf

1040 1040-1058 1678 1679 faAfdTsdT gGfgdTsdT ccAfcUfcAfuGfcUfcUfaCfaA GfGfuUfgUfaGfaGfcAfuGfaGf

1042 1042-1060 1680 1681 fcCfdTsdT uGfgdTsdT

acUfcAfuGfcUfcUfaCfaAfcC GfGfgGfuUfgUfaGfaGfcAfuGf

1044 1044-1062 1682 1683 fcCfdTsdT aGfudTsdT

caUfgCfuCfuAfcAfaCfcCfcA GfGfuGfgGfgUfuGfuAfgAfgCf

1047 1047-1065 1684 1685 fcCfdTsdT aUfgdTsdT

ccAfgAfuGfgAfuGfuGfaAfcC GfGfgGfuUfcAfcAfuCfcAfuCf

1071 1071-1089 1686 1687 fcCfdTsdT uGfgdTsdT

agAfuGfgAfuGfuGfaAfcCfcC UfCfgGfgGfuUfcAfcAfuCfcAf

1073 1073-1091 1688 1689 fgAfdTsdT uCfudTsdT

gaUfgGfaUfgUfgAfaCfcCfcG CfUfcGfgGfgUfuCfaCfaUfcCfa

1074 1074-1092 1690 1691 faGfdTsdT UfcdTsdT

auGfgAfuGfuGfaAfcCfcCfgA CfCfuCfgGfgGfuUfcAfcAfuCfc

1075 1075-1093 1692 1693 fgGfdTsdT AfudTsdT

ggAfuGfuGfaAfcCfcCfgAfgG GfCfcCfuCfgGfgGfuUfcAfcAfu

1077 1077-1095 1694 1695 fgCfdTsdT CfcdTsdT

gaUfgUfgAfaCfcCfcGfaGfgG UfGfcCfcUfcGfgGfgUfuCfaCfa

1078 1078-1096 1696 1697 fcAfdTsdT UfcdTsdT

ugUfgAfaCfcCfcGfaGfgGfcA UfUfuGfcCfcUfcGfgGfgUfuCfa

1080 1080-1098 1698 1699 faAfdTsdT CfadTsdT

aaCfcCfcGfaGfgGfcAfaAfuA UfGfuAfuUfuGfcCfcUfcGfgGf

1084 1084-1102 1700 1701 fcAfdTsdT gUfudTsdT

acCfcCfgAfgGfgCfaAfaUfaC CfUfgUfaUfuUfgCfcCfuCfgGfg

1085 1085-1103 1702 1703 faGfdTsdT GfudTsdT

ccCfgAfgGfgCfaAfaUfaCfaG AfGfcUfgUfaUfuUfgCfcCfuCfg

1087 1087-1105 1704 1705 fcUfdTsdT GfgdTsdT

ccGfaGfgGfcAfaAfuAfcAfgC AfAfgCfuGfuAfuUfuGfcCfcUf

1088 1088-1106 1706 1707 fuUfdTsdT cGfgdTsdT

cgAfgGfgCfaAfaUfaCfaGfcU AfAfaGfcUfgUfaUfuUfgCfcCfu

1089 1089-1107 1708 1709 fuUfdTsdT CfgdTsdT

aaAfuAfcAfgCfuUfuGfgUfgC UfGfgCfaCfcAfaAfgCfuGfuAfu

1096 1096-1114 1710 1711 fcAfdTsdT UfudTsdT

aaUfaCfaGfcUfuUfgGfuGfcC GfUfgGfcAfcCfaAfaGfcUfgUfa

1097 1097-1115 1712 1713 faCfdTsdT UfudTsdT

auAfcAfgCfuUfuGfgUfgCfcA GfGfuGfgCfaCfcAfaAfgCfuGfu

1098 1098-1116 1714 1715 fcCfdTsdT AfudTsdT

cuUfuGfgUfgCfcAfcCfuGfcG CfAfcGfcAfgGfuGfgCfaCfcAfa

1104 1104-1122 1716 1717 fuGfdTsdT AfgdTsdT

uuGfgUfgCfcAfcCfuGfcGfuG UfUfcAfcGfcAfgGfuGfgCfaCfc

1106 1106-1124 1718 1719 faAfdTsdT AfadTsdT

ccAfcCfuGfcGfuGfaAfgAfaG CfAfcUfuCfuUfcAfcGfcAfgGfu

1112 1112-1130 1720 1721 fuGfdTsdT GfgdTsdT

cuGfcGfuGfaAfgAfaGfuGfuC GfGfgAfcAfcUfuCfuUfcAfcGfc

1116 1116-1134 1722 1723 fcCfdTsdT AfgdTsdT

ugCfgUfgAfaGfaAfgUfgUfcC GfGfgGfaCfaCfuUfcUfuCfaCfg

1117 1117-1135 1724 1725 fcCfdTsdT CfadTsdT

gcGfuGfaAfgAfaGfuGfuCfcC CfGfgGfgAfcAfcUfuCfuUfcAfc

1118 1118-1136 1726 1727 fcGfdTsdT GfcdTsdT cgUfgAfaGfaAfgUfgUfcCfcC AfCfgGfgGfaCfaCfuUfcUfuCfa

1119 1119-1137 1728 1729 fgUfdTsdT CfgdTsdT

guGfaAfgAfaGfuGfuCfcCfcG UfAfcGfgGfgAfcAfcUfuCfuUf

1120 1120-1138 1730 1731 fuAfdTsdT cAfcdTsdT

ugAfaGfaAfgUfgUfcCfcCfgU UfUfaCfgGfgGfaCfaCfuUfcUfu

1121 1121-1139 1732 1733 faAfdTsdT CfadTsdT

gaAfgAfaGfuGfuCfcCfcGfuA AfUfuAfcGfgGfgAfcAfcUfuCf

1122 1122-1140 1734 1735 faUfdTsdT uUfcdTsdT

aaGfaAfgUfgUfcCfcCfgUfaA AfAfuUfaCfgGfgGfaCfaCfuUfc

1123 1123-1141 1736 1737 fuUfdTsdT UfudTsdT

agAfaGfuGfuCfcCfcGfuAfaU UfAfaUfuAfcGfgGfgAfcAfcUf

1124 1124-1142 1738 1739 fuAfdTsdT uCfudTsdT

gaAfgUfgUfcCfcCfgUfaAfuU AfUfaAfuUfaCfgGfgGfaCfaCfu

1125 1125-1143 1740 1741 faUfdTsdT UfcdTsdT

aaGfuGfuCfcCfcGfuAfaUfuA CfAfuAfaUfuAfcGfgGfgAfcAf

1126 1126-1144 1742 1743 fuGfdTsdT cUfudTsdT

agUfgUfcCfcCfgUfaAfuUfaU AfCfaUfaAfuUfaCfgGfgGfaCfa

1127 1127-1145 1744 1745 fgUfdTsdT CfudTsdT

guGfuCfcCfcGfuAfaUfuAfuG CfAfcAfuAfaUfuAfcGfgGfgAf

1128 1128-1146 1746 1747 fuGfdTsdT cAfcdTsdT

ugUfcCfcCfgUfaAfuUfaUfgU CfCfaCfaUfaAfuUfaCfgGfgGfa

1129 1129-1147 1748 1749 fgGfdTsdT CfadTsdT

guCfcCfcGfuAfaUfuAfuGfuG AfCfcAfcAfuAfaUfuAfcGfgGf

1130 1130-1148 1750 1751 fgUfdTsdT gAfcdTsdT

ccCfcGfuAfaUfuAfuGfuGfgU UfCfaCfcAfcAfuAfaUfuAfcGfg

1132 1132-1150 1752 1753 fgAfdTsdT GfgdTsdT

ccGfuAfaUfuAfuGfuGfgUfg UfGfuCfaCfcAfcAfuAfaUfuAfc

1134 1134-1152 1754 1755

AfcAfdTsdT GfgdTsdT

guAfaUfuAfuGfuGfgUfgAfc UfCfuGfuCfaCfcAfcAfuAfaUfu

1136 1136-1154 1756 1757

AfgAfdTsdT AfcdTsdT

uaAfuUfaUfgUfgGfuGfaCfaG AfUfcUfgUfcAfcCfaCfaUfaAfu

1137 1137-1155 1758 1759 faUfdTsdT UfadTsdT

aaUfuAfuGfuGfgUfgAfcAfg GfAfuCfuGfuCfaCfcAfcAfuAfa

1138 1138-1156 1760 1761

AfuCfdTsdT UfudTsdT

auUfaUfgUfgGfuGfaCfaGfaU UfGfaUfcUfgUfcAfcCfaCfaUfa

1139 1139-1157 1762 1763 fcAfdTsdT AfudTsdT

uuAfuGfuGfgUfgAfcAfgAfu GfUfgAfuCfuGfuCfaCfcAfcAfu

1140 1140-1158 1764 1765

CfaCfdTsdT AfadTsdT

auGfuGfgUfgAfcAfgAfuCfaC CfCfgUfgAfuCfuGfuCfaCfcAfc

1142 1142-1160 1766 1767 fgGfdTsdT AfudTsdT

ugGfuGfaCfaGfaUfcAfcGfgC GfAfgCfcGfuGfaUfcUfgUfcAfc

1145 1145-1163 1768 1769 fuCfdTsdT CfadTsdT

guGfaCfaGfaUfcAfcGfgCfuC AfCfgAfgCfcGfuGfaUfcUfgUfc

1147 1147-1165 1770 1771 fgUfdTsdT AfcdTsdT

ugAfcAfgAfuCfaCfgGfcUfcG CfAfcGfaGfcCfgUfgAfuCfuGfu

1148 1148-1166 1772 1773 fuGfdTsdT CfadTsdT

gaCfaGfaUfcAfcGfgCfuCfgU GfCfaCfgAfgCfcGfuGfaUfcUfg

1149 1149-1167 1774 1775 fgCfdTsdT UfcdTsdT acAfgAfuCfaCfgGfcUfcGfuG CfGfcAfcGfaGfcCfgUfgAfuCfu

1150 1150-1168 1776 1777 fcGfdTsdT GfudTsdT

caGfaUfcAfcGfgCfuCfgUfgC AfCfgCfaCfgAfgCfcGfuGfaUfc

1151 1151-1169 1778 1779 fgUfdTsdT UfgdTsdT

agAfuCfaCfgGfcUfcGfuGfcG GfAfcGfcAfcGfaGfcCfgUfgAfu

1152 1152-1170 1780 1781 fuCfdTsdT CfudTsdT

gaUfcAfcGfgCfuCfgUfgCfgU GfGfaCfgCfaCfgAfgCfcGfuGfa

1153 1153-1171 1782 1783 fcCfdTsdT UfcdTsdT

auCfaCfgGfcUfcGfuGfcGfuC CfGfgAfcGfcAfcGfaGfcCfgUfg

1154 1154-1172 1784 1785 fcGfdTsdT AfudTsdT

ucAfcGfgCfuCfgUfgCfgUfcC UfCfgGfaCfgCfaCfgAfgCfcGfu

1155 1155-1173 1786 1787 fgAfdTsdT GfadTsdT

caCfgGfcUfcGfuGfcGfuCfcG CfUfcGfgAfcGfcAfcGfaGfcCfg

1156 1156-1174 1788 1789 faGfdTsdT UfgdTsdT

acGfgCfuCfgUfgCfgUfcCfgA GfCfuCfgGfaCfgCfaCfgAfgCfc

1157 1157-1175 1790 1791 fgCfdTsdT GfudTsdT

gcUfcGfuGfcGfuCfcGfaGfcC CfAfgGfcUfcGfgAfcGfcAfcGfa

1160 1160-1178 1792 1793 fuGfdTsdT GfcdTsdT

ggAfgGfaAfgAfcGfgCfgUfcC GfCfgGfaCfgCfcGfuCfuUfcCfu

1200 1200-1218 1794 1795 fgCfdTsdT CfcdTsdT

gaGfgAfaGfaCfgGfcGfuCfcG UfGfcGfgAfcGfcCfgUfcUfuCfc

1201 1201-1219 1796 1797 fcAfdTsdT UfcdTsdT

ggAfaGfaCfgGfcGfuCfcGfcA CfUfuGfcGfgAfcGfcCfgUfcUfu

1203 1203-1221 1798 1799 faGfdTsdT CfcdTsdT

gaAfgAfcGfgCfgUfcCfgCfaA AfCfuUfgCfgGfaCfgCfcGfuCfu

1204 1204-1222 1800 1801 fgUfdTsdT UfcdTsdT

aaGfaCfgGfcGfuCfcGfcAfaG CfAfcUfuGfcGfgAfcGfcCfgUfc

1205 1205-1223 1802 1803 fuGfdTsdT UfudTsdT

gaCfgGfcGfuCfcGfcAfaGfuG UfAfcAfcUfuGfcGfgAfcGfcCfg

1207 1207-1225 1804 1805 fuAfdTsdT UfcdTsdT

acGfgCfgUfcCfgCfaAfgUfgU UfUfaCfaCfuUfgCfgGfaCfgCfc

1208 1208-1226 1806 1807 faAfdTsdT GfudTsdT

gcGfuCfcGfcAfaGfuGfuAfaG UfUfcUfuAfcAfcUfuGfcGfgAf

1211 1211-1229 1808 1809 faAfdTsdT cGfcdTsdT

cgUfcCfgCfaAfgUfgUfaAfgA CfUfuCfuUfaCfaCfuUfgCfgGfa

1212 1212-1230 1810 1811 faGfdTsdT CfgdTsdT

guCfcGfcAfaGfuGfuAfaGfaA AfCfuUfcUfuAfcAfcUfuGfcGf

1213 1213-1231 1812 1813 fgUfdTsdT gAfcdTsdT

ucCfgCfaAfgUfgUfaAfgAfaG CfAfcUfuCfuUfaCfaCfuUfgCfg

1214 1214-1232 1814 1815 fuGfdTsdT GfadTsdT

ccGfcAfaGfuGfuAfaGfaAfgU GfCfaCfuUfcUfuAfcAfcUfuGfc

1215 1215-1233 1816 1817 fgCfdTsdT GfgdTsdT

cgCfaAfgUfgUfaAfgAfaGfuG CfGfcAfcUfuCfuUfaCfaCfuUfg

1216 1216-1234 1818 1819 fcGfdTsdT CfgdTsdT

gcAfaGfuGfuAfaGfaAfgUfgC UfCfgCfaCfuUfcUfuAfcAfcUfu

1217 1217-1235 1820 1821 fgAfdTsdT GfcdTsdT

aaGfuGfuAfaGfaAfgUfgCfgA CfUfuCfgCfaCfuUfcUfuAfcAfc

1219 1219-1237 1822 1823 faGfdTsdT UfudTsdT agUfgUfaAfgAfaGfuGfcGfaA CfCfuUfcGfcAfcUfuCfuUfaCfa

1220 1220-1238 1824 1825 fgGfdTsdT CfudTsdT

guGfuAfaGfaAfgUfgCfgAfa CfCfcUfuCfgCfaCfuUfcUfuAfc

1221 1221-1239 1826 1827

GfgGfdTsdT AfcdTsdT

ugUfaAfgAfaGfuGfcGfaAfg GfCfcCfuUfcGfcAfcUfuCfuUfa

1222 1222-1240 1828 1829

GfgCfdTsdT CfadTsdT

guAfaGfaAfgUfgCfgAfaGfg GfGfcCfcUfuCfgCfaCfuUfcUfu

1223 1223-1241 1830 1831

GfcCfdTsdT AfcdTsdT

uaAfgAfaGfuGfcGfaAfgGfgC AfGfgCfcCfuUfcGfcAfcUfuCfu

1224 1224-1242 1832 1833 fcUfdTsdT UfadTsdT

aaGfaAfgUfgCfgAfaGfgGfcC AfAfgGfcCfcUfuCfgCfaCfuUfc

1225 1225-1243 1834 1835 fuUfdTsdT UfudTsdT

agAfaGfuGfcGfaAfgGfgCfcU CfAfaGfgCfcCfuUfcGfcAfcUfu

1226 1226-1244 1836 1837 fuGfdTsdT CfudTsdT

agUfgCfgAfaGfgGfcCfuUfgC CfGfgCfaAfgGfcCfcUfuCfgCfa

1229 1229-1247 1838 1839 fcGfdTsdT CfudTsdT

guGfcGfaAfgGfgCfcUfuGfcC GfCfgGfcAfaGfgCfcCfuUfcGfc

1230 1230-1248 1840 1841 fgCfdTsdT AfcdTsdT

ugCfgAfaGfgGfcCfuUfgCfcG UfGfcGfgCfaAfgGfcCfcUfuCfg

1231 1231-1249 1842 1843 fcAfdTsdT CfadTsdT

gcGfaAfgGfgCfcUfuGfcCfgC UfUfgCfgGfcAfaGfgCfcCfuUfc

1232 1232-1250 1844 1845 faAfdTsdT GfcdTsdT

cgAfaGfgGfcCfuUfgCfcGfcA UfUfuGfcGfgCfaAfgGfcCfcUfu

1233 1233-1251 1846 1847 faAfdTsdT CfgdTsdT

aaGfgGfcCfuUfgCfcGfcAfaA AfCfuUfuGfcGfgCfaAfgGfcCfc

1235 1235-1253 1848 1849 fgUfdTsdT UfudTsdT

agGfgCfcUfuGfcCfgCfaAfaG CfAfcUfuUfgCfgGfcAfaGfgCfc

1236 1236-1254 1850 1851 fuGfdTsdT CfudTsdT

ggGfcCfuUfgCfcGfcAfaAfgU AfCfaCfuUfuGfcGfgCfaAfgGfc

1237 1237-1255 1852 1853 fgUfdTsdT CfcdTsdT

ggCfcUfuGfcCfgCfaAfaGfuG CfAfcAfcUfuUfgCfgGfcAfaGfg

1238 1238-1256 1854 1855 fuGfdTsdT CfcdTsdT

gcCfuUfgCfcGfcAfaAfgUfgU AfCfaCfaCfuUfuGfcGfgCfaAfg

1239 1239-1257 1856 1857 fgUfdTsdT GfcdTsdT

cuUfgCfcGfcAfaAfgUfgUfgU UfUfaCfaCfaCfuUfuGfcGfgCfa

1241 1241-1259 1858 1859 faAfdTsdT AfgdTsdT

ggAfaUfaGfgUfaUfuGfgUfg AfUfuCfaCfcAfaUfaCfcUfaUfu

1261 1261-1279 1860 1861

AfaUfdTsdT CfcdTsdT

gaAfuAfgGfuAfuUfgGfuGfa AfAfuUfcAfcCfaAfuAfcCfuAfu

1262 1262-1280 1862 1863

AfuUfdTsdT UfcdTsdT

aaUfaGfgUfaUfuGfgUfgAfaU AfAfaUfuCfaCfcAfaUfaCfcUfa

1263 1263-1281 1864 1865 fuUfdTsdT UfudTsdT

auAfgGfuAfuUfgGfuGfaAfu UfAfaAfuUfcAfcCfaAfuAfcCfu

1264 1264-1282 1866 1867

UfuAfdTsdT AfudTsdT

agGfuAfuUfgGfuGfaAfuUfu UfUfuAfaAfuUfcAfcCfaAfuAfc

1266 1266-1284 1868 1869

AfaAfdTsdT CfudTsdT

ggUfaUfuGfgUfgAfaUfuUfa CfUfuUfaAfaUfuCfaCfcAfaUfa

1267 1267-1285 1870 1871

AfaGfdTsdT CfcdTsdT caCfuCfuCfcAfuAfaAfuGfcU GfUfaGfcAfuUfuAfuGfgAfgAf

1289 1289-1307 1872 1873 faCfdTsdT gUfgdTsdT

uuAfaAfcAfcUfuCfaAfaAfaC CfAfgUfuUfuUfgAfaGfuGfuUf

1313 1313-1331 1874 1875 fuGfdTsdT uAfadTsdT

cuUfcAfaAfaAfcUfgCfaCfcU GfGfaGfgUfgCfaGfuUfuUfuGf

1320 1320-1338 1876 1877 fcCfdTsdT aAfgdTsdT

uuCfaAfaAfaCfuGfcAfcCfuC UfGfgAfgGfuGfcAfgUfuUfuUf

1321 1321-1339 1878 1879 fcAfdTsdT gAfadTsdT

ucAfaAfaAfcUfgCfaCfcUfcC AfUfgGfaGfgUfgCfaGfuUfuUf

1322 1322-1340 1880 1881 faUfdTsdT uGfadTsdT

caAfaAfaCfuGfcAfcCfuCfcA GfAfuGfgAfgGfuGfcAfgUfuUf

1323 1323-1341 1882 1883 fuCfdTsdT uUfgdTsdT

aaAfaAfcUfgCfaCfcUfcCfaUf UfGfaUfgGfaGfgUfgCfaGfuUf

1324 1324-1342 1884 1885 cAfdTsdT uUfudTsdT

acUfgCfaCfcUfcCfaUfcAfgU CfCfaCfuGfaUfgGfaGfgUfgCfa

1328 1328-1346 1886 1887 fgGfdTsdT GfudTsdT

caCfcUfcCfaUfcAfgUfgGfcG AfUfcGfcCfaCfuGfaUfgGfaGfg

1332 1332-1350 1888 1889 faUfdTsdT UfgdTsdT

acCfuCfcAfuCfaGfuGfgCfgA GfAfuCfgCfcAfcUfgAfuGfgAf

1333 1333-1351 1890 1891 fuCfdTsdT gGfudTsdT

cuCfcAfuCfaGfuGfgCfgAfuC GfAfgAfuCfgCfcAfcUfgAfuGf

1335 1335-1353 1892 1893 fuCfdTsdT gAfgdTsdT

caUfcAfgUfgGfcGfaUfcUfcC GfUfgGfaGfaUfcGfcCfaCfuGfa

1338 1338-1356 1894 1895 faCfdTsdT UfgdTsdT

ugGfcGfaUfcUfcCfaCfaUfcC CfAfgGfaUfgUfgGfaGfaUfcGfc

1344 1344-1362 1896 1897 fuGfdTsdT CfadTsdT

ggCfgAfuCfuCfcAfcAfuCfcU GfCfaGfgAfuGfuGfgAfgAfuCf

1345 1345-1363 1898 1899 fgCfdTsdT gCfcdTsdT

gcGfaUfcUfcCfaCfaUfcCfuG GfGfcAfgGfaUfgUfgGfaGfaUf

1346 1346-1364 1900 1901 fcCfdTsdT cGfcdTsdT

cgAfuCfuCfcAfcAfuCfcUfgC CfGfgCfaGfgAfuGfuGfgAfgAf

1347 1347-1365 1902 1903 fcGfdTsdT uCfgdTsdT

gaUfcUfcCfaCfaUfcCfuGfcCf CfCfgGfcAfgGfaUfgUfgGfaGfa

1348 1348-1366 1904 1905 gGfdTsdT UfcdTsdT

ccAfcAfuCfcUfgCfcGfgUfgG UfGfcCfaCfcGfgCfaGfgAfuGfu

1353 1353-1371 1906 1907 fcAfdTsdT GfgdTsdT

caCfaUfcCfuGfcCfgGfuGfgC AfUfgCfcAfcCfgGfcAfgGfaUfg

1354 1354-1372 1908 1909 faUfdTsdT UfgdTsdT

acAfuCfcUfgCfcGfgUfgGfcA AfAfuGfcCfaCfcGfgCfaGfgAfu

1355 1355-1373 1910 1911 fuUfdTsdT GfudTsdT

auCfcUfgCfcGfgUfgGfcAfuU UfAfaAfuGfcCfaCfcGfgCfaGfg

1357 1357-1375 1912 1913 fuAfdTsdT AfudTsdT

cuGfcCfgGfuGfgCfaUfuUfaG CfCfcUfaAfaUfgCfcAfcCfgGfc

1360 1360-1378 1914 1915 fgGfdTsdT AfgdTsdT

ugCfcGfgUfgGfcAfuUfuAfg CfCfcCfuAfaAfuGfcCfaCfcGfg

1361 1361-1379 1916 1917

GfgGfdTsdT CfadTsdT

gcCfgGfuGfgCfaUfuUfaGfgG AfCfcCfcUfaAfaUfgCfcAfcCfg

1362 1362-1380 1918 1919 fgUfdTsdT GfcdTsdT ccGfgUfgGfcAfuUfuAfgGfg CfAfcCfcCfuAfaAfuGfcCfaCfc

1363 1363-1381 1920 1921

GfuGfdTsdT GfgdTsdT

guGfgCfaUfuUfaGfgGfgUfg AfGfuCfaCfcCfcUfaAfaUfgCfc

1366 1366-1384 1922 1923

AfcUfdTsdT AfcdTsdT

gcAfuUfuAfgGfgGfuGfaCfu AfGfgAfgUfcAfcCfcCfuAfaAfu

1369 1369-1387 1924 1925

CfcUfdTsdT GfcdTsdT

caUfuUfaGfgGfgUfgAfcUfcC AfAfgGfaGfuCfaCfcCfcUfaAfa

1370 1370-1388 1926 1927 fuUfdTsdT UfgdTsdT

auUfuAfgGfgGfuGfaCfuCfcU GfAfaGfgAfgUfcAfcCfcCfuAfa

1371 1371-1389 1928 1929 fuCfdTsdT AfudTsdT

uuUfaGfgGfgUfgAfcUfcCfu UfGfaAfgGfaGfuCfaCfcCfcUfa

1372 1372-1390 1930 1931

UfcAfdTsdT AfadTsdT

uuAfgGfgGfuGfaCfuCfcUfuC GfUfgAfaGfgAfgUfcAfcCfcCfu

1373 1373-1391 1932 1933 faCfdTsdT AfadTsdT

uaGfgGfgUfgAfcUfcCfuUfcA UfGfuGfaAfgGfaGfuCfaCfcCfc

1374 1374-1392 1934 1935 fcAfdTsdT UfadTsdT

ucUfgGfaUfcCfaCfaGfgAfaC CfAfgUfuCfcUfgUfgGfaUfcCfa

1404 1404-1422 1936 1937 fuGfdTsdT GfadTsdT

gaUfcCfaCfaGfgAfaCfuGfgA UfAfuCfcAfgUfuCfcUfgUfgGf

1408 1408-1426 1938 1939 fuAfdTsdT aUfcdTsdT

auCfcAfcAfgGfaAfcUfgGfaU AfUfaUfcCfaGfuUfcCfuGfuGfg

1409 1409-1427 1940 1941 faUfdTsdT AfudTsdT

ccAfcAfgGfaAfcUfgGfaUfaU GfAfaUfaUfcCfaGfuUfcCfuGfu

1411 1411-1429 1942 1943 fuCfdTsdT GfgdTsdT

caCfaGfgAfaCfuGfgAfuAfuU AfGfaAfuAfuCfcAfgUfuCfcUf

1412 1412-1430 1944 1945 fcUfdTsdT gUfgdTsdT

acUfgGfaUfaUfuCfuGfaAfaA GfGfuUfuUfcAfgAfaUfaUfcCfa

1419 1419-1437 1946 1947 fcCfdTsdT GfudTsdT

auUfcUfgAfaAfaCfcGfuAfaA CfCfuUfuAfcGfgUfuUfuCfaGfa

1426 1426-1444 1948 1949 fgGfdTsdT AfudTsdT

uuCfuGfaAfaAfcCfgUfaAfaG UfCfcUfuUfaCfgGfuUfuUfcAf

1427 1427-1445 1950 1951 fgAfdTsdT gAfadTsdT

ugAfaAfaCfcGfuAfaAfgGfaA AfUfuUfcCfuUfuAfcGfgUfuUf

1430 1430-1448 1952 1953 faUfdTsdT uCfadTsdT

gaAfaAfcCfgUfaAfaGfgAfaA GfAfuUfuC

1431 1431-1449 fcUfuUfaCfgGfuUf

1954 1955 fuCfdTsdT uUfcdTsdT

siRNA Sequence with Chemical Modification Info

lower case (n) = 2'-0-Me; Nf = 2'-F; dT = deoxy-T residue;

s = phosphorothioate backbone modification; iB = inverted abasic

Table 7. AR Target Sequences

GGGUGUCACUAUGGAGCUC 1959

29 2822-2840 2

XD-01829K1 UCAC h

UACUACAACUUUCCACUGGC 1960

21 2207-2225 1

XD-01821K1 UCU h

AAGCUUCUGGGUGUCACUAU 1961

25 2814-2832 2

XD-01825K1 GGA h,m

CUUCUGGGUGUCACUAUGGA 1962

26 2817-2835 2

XD-01826K1 GCU h

Table 8. β-catenin Target Sequences

R- Mycl364 AGGAAGAAAUCGAU ACAACAUCGAUUUCUU

1364 1997 1998

1163 U GUUGUdTsdT CCUdTsdT

R- Mycl711 AGCUUUUUUGCCCU CACGCAGGGCAAAAAA

1711 1999 2000

1164 U GCGUGdTsdT GCUdTsdT

R- Mycl769 AGGUAGUUAUCCUU UUUUUAAGGAUAACUA

1769 2001 2002

1165 U AAAAAdTsdT CCUdTsdT

siRNA Sequence with Chemical Modification Info

lower case (n) = 2'-0-Me; Nf = 2'-F; dT = deoxy-T residue;

s = phosphorothioate backbone modification; iB = inverted abasic

Table 10. PIK3CA* and PIK3CB* Target Sequences

Species is Homo sapiens.

Table 11. IK3CA and PIK3CB siRNA Sequences

2522 GACAUGA UUUCAUA

PIK3CA UAAUUUUGAAAUGAA 2019 ACUAGUUCAUUUCAA 2020

PIK3CA 5290 3555 CUAGUUU AAUUAUA

PIK3CA UUUUAUUUCUGUUCU 2021 CAGCAAGAACAGAAA 2022

PIK3CA 5290 3484 UGCUGUA UAAAAUA

PIK3CB 8 UCAUACAUUUUCUUG 2023 AAGAUCAAGAAAAUG 2024

PIK3CB 5291 62 AUCUUGC UAUGAUA

PIK3CB 1 UUGGGUAAUUGUGAA 2025 GCAAGUUCACAAUUA 2026

PIK3CB 5291 83 CUUGCUU CCCAAUA

PIK3CB 1 UUCAAUAAUCUUAUC 2027 CCUUCGAUAAGAUUA 2028

PIK3CB 5291 520 GAAGGGA UUGAAUA

PIK3CB 2 UCGUGUUUCAUCUUC 2029 AGCUUGAAGAUGAAA 2030

PIK3CB 5291 72 AAGCUCC CACGAUA

PIK3CB 9 UAAUUCGUGUUUUCU 2031 ACCAAAGAAAACACG 2032

PIK3CB 5291 48 UUGGUGG AAUUAUA

Table 12. Additional polynucleic acid molecule sequences

Example 2. General Experimental Protocol

[0504] Stem-loop qPCR assay for quantification of siRNA [0505] Plasma samples were directly diluted in TE buffer. 50 mg tissue pieces were homogenized in 1 mL of Trizol using a FastPrep-24 tissue homogenizer (MP Biomedicals) and then diluted in TE buffer. Standard curves were generated by spiking siRNA into plasma or homogenized tissue from untreated animals and then serially diluting with TE buffer. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit (Applied Biosystems) with 25 nM of a sequence - specific stem-loop RT primer. The cDNA from the RT step was utilized for real-time PCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) with 1.5 μΜ of forward primer, 0.75 μΜ of reverse primer, and 0.2 μΜ of probe. The sequences of KRAS and EGFR siRNA antisense strands and all primers and probes used to measure them are shown in Table 13. Quantitative PCR reactions were performed using standard cycling conditions in a ViiA 7 Real-Time PCR System (Life Technologies). The Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 13. Sequences for all siRNA antisense strands, primers, and probes used in the stem-loop qPCR assay.

[0506] Comparative qPCR assay for determination of mRNA knockdown

[0507] Tissue samples were homogenized in Trizol as described above. Total RNA was isolated using RNeasy RNA isolation 96-well plates (Qiagen), then 500 ng RNA was reverse transcribed with a High Capacity RNA to cDNA kit (ThermoFisher). KRAS, EGFR, CTNNB 1 and PPIB mRNA was quantified by TaqMan qPCR analysis performed with a ViiA 7 Real-Time PCR System. The TaqMan primers and probes for KRAS were designed and validated by Avidity and are shown in Table 14. The TaqMan primers and probes for EGFR and CTNNB 1 were purchased from Applied Biosystems as pre-validated gene expression assays. PPIB (housekeeping gene) was used as an internal RNA loading control, with all TaqMan primers and probes for PPIB purchased from Applied Biosystems as pre-validated gene expression assays. Results are calculated by the comparative Ct method, where the difference between the target gene (KRAS, CTNNB l, or EGFR) Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt).

Table 14. Sequences of primers and probes for KRAS mRNA detection using comparative qPCR assay.

[0508] Animals

[0509] All animal studies were conducted following protocols in accordance with the Institutional Animal Care and Use Committee (IACUC) at Explora BioLabs, which adhere to the regulations outlined in the USDA Animal Welfare Act as well as the "Guide for the Care and Use of Laboratory Animals" (National Research Council publication, 8th Ed., revised in 2011). All mice were obtained from either Charles River Laboratories or Harlan Laboratories.

[0510] H358, HCC827, and Hep-3B2 1-7 subcutaneous flank tumor model

[0511] For the H358 subcutaneous flank tumor model, tumor cells were inoculated and tumors were established according to the following methods. Female NCr nu/nu mice were identified by ear -tag the day before cell injection. Mice were weighed prior to inoculation. H358 cells were cultured with 10%

FBS/RPMI medium and harvested with 0.05% Trypsin and Cell Stripper (MediaTech). 5 million H358 cells in 0.05 ml Hank's Balanced Salt Solution (HBSS) with Matrigel (1 : 1) were injected subcutaneously

(SC) into the upper right flank of each mouse. Tumor growth was monitored by tumor volume

measurement using a digital caliper starting on day 7 after inoculation, and followed 2 times per week until average tumor volume reaches > 100 & < 300 mm ³ . Once tumors were staged to the desired volume (average from 100 to 300 mm ³ ), animals were randomized and mice with very large or small tumors were culled. Mice were divided into the required groups and randomized by tumor volume. Mice were then treated as described in the individual experiments.

[0512] For the Hep3B orthotopic liver tumor model, tumor cells were inoculated and tumors were established according to the following methods. Female NCr nu/nu mice were identified by ear -tag the day before, mice will be anesthetized with isoflurane. The mice were then placed in a supine position on a water circulating heating pad to maintain body temperature. A small transverse incision below the sternum will be made to expose the liver. Cancer cells were slowly injected into the upper left lobe of the liver using a 28- gauge needle. The cells were injected at a 30-degree angle into the liver, so that a transparent bleb of cells can be seen through the liver capsule. Hep 3B2.1 7 cells were prepared by suspending in cold PBS (0.1 - 5x10 ⁶ cells) and mixing with diluted matrigel (3 Ox in PBS). 30-50 ul of the cell/matrigel was inoculated. After injection, a small piece of sterile gauze was placed on the injection site, and light pressure was applied for 1 min to prevent bleeding. The abdomen was then closed with a 6-0 silk suture. After tumor cell implantation, animals were kept in a warm cage, observed for 1-2 h, and subsequently returned to the animal room after full recovery from the anesthesia. 7-10 days after tumor implantation animals were randomized, divided into the required groups and then treated as described in the individual experiments.

[0513] LNCap subcutaneous flank tumor model

[0514] LNCaP cells (ATCC ^® Ci¾L 740") were grown in RPMI + 10% FBS supplemented with nonessential amino acids and sodium pyruvate to a confluency of about 80%. Cells were mixed 1 : 1 with matrigel and 5-7* 106 cells injected subcutaneously into male SCID mice (6-8 weeks). Tumors usually developed within 3-5 weeks to a size of 100-350 mm ³ . Animals bearing tumors within this range were randomized and treated with ASCs by injections into the tail vein. For PD studies animals were sacrificed 96 hours after injection and organ fragments harvested, weighted, and frozen in liquid nitrogen. For R A isolation, organ samples were homogenized in Trizol and RNA prepared using a Qiagen RNeasy 96 Plus kit following the instructions by the manufacturer. RNA concentrations were determined spectroscopically. RNAs were converted into cDNAs by reverse transcription and expression of specific targets quantified by qPCR using the AACT method and validated Taqman assays (Thermofisher). Samples were standardize to the expression levels of PPIB.

[0515] Cholesterol siRNA conjugate synthesis

[0516] All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. Structure of cholesterol conjugated to the passenger strand is illustrated in Fig. 2. Table 15 shows KRAS, EGFR, and CTNNB 1 siRNA sequences.

Table 15.

[0517] The siRNA chemical modifications include:

• upper case (N) = 2'-OH (ribo);

• lower case (n) = 2'-0-Me (methyl); • dN = 2'-H (deoxy);

• Nf = 2'-F (fluoro);

• s = phosphorothioate backbone modification;

• iB = inverted abasic

[0518] Peptide synthesis

[0519] Peptides were synthesized on solid phase using standard Fmoc chemistry. Both peptides have cysteine at the N-terminus and the cleaved peptides were purified by HPLC and confirmed by mass spectroscopy. INF7 peptide is as illustrated in Fig. 3 (SEQ ID NO: 2055). Melittin peptide is as illustrated in Fig. 4 (SEQ ID NO: 2060).

[0520] Anti-EGFR Antibody

[0521] Anti-EGFR antibody is a fully human IgGltc monoclonal antibody directed against the human epidermal growth factor receptor (EGFR). It is produced in the Chinese Hamster Ovary cell line DJT33, which has been derived from the CHO cell line CHO-K1SV by transfection with a GS vector carrying the antibody genes derived from a human anti-EGFR antibody producing hybridoma cell line (2F8). Standard mammalian cell culture and purification technologies are employed in the manufacturing of anti-EGFR antibody.

[0522] The theoretical molecular weight (MW) of anti-EGFR antibody without glycans is 146.6 kDa. The experimental MW of the major glycosylated isoform of the antibody is 149 kDa as determined by mass spectrometry. Using SDS-PAGE under reducing conditions the MW of the light chain was found to be approximately 25 kDa and the MW of the heavy chain to be approximately 50 kDa. The heavy chains are connected to each other by two inter-chain disulfide bonds, and one light chain is attached to each heavy chain by a single inter-chain disulfide bond. The light chain has two intra-chain disulfide bonds and the heavy chain has four intra-chain disulfide bonds. The antibody is N-linked glycosylated at Asn305 of the heavy chain with glycans composed of N-acetyl-glucosamine, mannose, fucose and galactose. The predominant glycans present are fucosylated bi-antennary structures containing zero or one terminal galactose residue.

[0523] The charged isoform pattern of the IgGltc antibody has been investigated using imaged capillary IEF, agarose IEF and analytical cation exchange HPLC. Multiple charged isoforms are found, with the main isoform having an isoelectric point of approximately 8.7.

[0524] The major mechanism of action of anti-EGFR antibody is a concentration dependent inhibition of EGF -induced EGFR phosphorylation in A431 cancer cells. Additionally, induction of antibody-dependent cell-mediated cytotoxicity (ADCC) at low antibody concentrations has been observed in pre -clinical cellular in vitro studies. Example 3: Synthesis, purification and analysis of antibody-PEG-EGFR and antibody-EGFR conjugates

Conjugation scheme-1

[0525] Step 1: Antibody conjugation with maleimide-PEG-NHS followed by SH-EGFR

[0526] Anti-EGFR antibody (EGFR-Ab) was exchanged with IX Phosphate buffer (pH 7.4) and made up to 5mg/ml concentration. To this solution, 2 equivalents of SMCC linker or maleimide-PEGxkDa-NHS (x = 1, 5, 10, 20) was added and rotated for 4 hours at room temperature. Unreacted maleimide-PEG was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS pH 7.4. The antibody-PEG- Mal conjugate was collected and transferred into a reaction vessel. SH-C6-EGFR (2 equivalents) was added at RT to the antibody-PEG-maleimide in PBS and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugate along with unreacted antibody and siRNA was seen.

[0527] Step 2: Purification

[0528] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing the antibody-PEG-EGFR conjugate were pooled, concentrated and buffer exchanged with PBS, pH 7.4. Antibody siRNA conjugates with SMCC linker, PEGlkDa, PEG5kDa and PEGlOkDa were separated based on the siRNA loading. Conjugates with PEG20kDa gave poor separation.

[0529] Step-3: Analysis of the purified conjugate

[0530] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3. Examples of all the conjugates made using these methods are described in Table 16. Table 16. List of AXCYB conjugates

[0531] Anion exchange chromatography method-1

Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID X 15 cm, 13 um Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow Rate: 6.0 ml/min

Gradient:

a. %A %B Column Volume

b. 100 0 1.00

c. 60 40 18.00

d. 40 60 2.00

e. 40 60 5.00

f. 0 100 2.00

8. 100 0 2.00

[0532] Anion exchange chromatography method-2

1. Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4 X 250 mm

2. Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 1.0 ml/min

3. Gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 1 1.00 40 60

e. 13.00 40 60

f. 15.00 90 10

g. 20.00 90 10

[0533] Anion exchange chromatography method-3

1. Column: Thermo Scientific, ProPacTM SAX-10, Bio LCTM, 4 X 250 mm

2. Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl

3. Flow Rate: 0.75 ml/min

4. Gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 1 1.00 40 60

e. 23.00 40 60

f. 25.00 90 10

g. 30.00 90 10 [0534] The analytical data for EGFR antibody-PEG20kDa-EGFR are illustrated in Fig. 5 and Fig. 6. Fig. 5 shows the analytical HPLC of EGFR antibody-PEG20kDa-EGFR. Fig. 6 shows a SDS-PAGE analysis of EGFR antibody-PEG20kDa-EGFR conjugate. The analytical chromatogram of EGFR antibody-PEGlOkDa- EGFR is illustrated in Fig. 7. The analytical data for EGFR antibody-PEG5kDa-EGFR are illustrated in Fig. 8 and Fig. 9. Fig. 8 shows the analytical chromatogram of EGFR antibody-PEG5kDa-EGFR. Fig. 9 shows SDS PAGE analysis of EGFR antibody-PEGlOkDa-EGFR and EGFR antibody-PEG5kDa-EGFR conjugates. The analytical data for EGFR antibody-PEGlkDa-EGFR conjugates with different siRNA loading is illustrated in Fig. 10.

Example 4: S nthesis, purification and analysis of antibody-siRNA-PEG conjugates

Conjugation Scheme-2

[0535] Step 1: Antibody conjugation with SMCC linker followed by SH-KRAS-PEG5kDa

[0536] Anti-EGFR antibody was exchanged with IX Phosphate buffer (pH 7.4) and made up to 5mg/ml concentration. To this solution, 2 equivalents of SMCC linker (succinimidyl 4-(N- maleimidomethyl)cyclohexane-l-carboxylate) was added and rotated for 4 hours at room temperature. Unreacted SMCC linker was removed by spin filtration using 50 kDa MWCO Ami con spin filters and PBS buffer pH 7.4. The retentate was collected and 2 equivalents of SH-C6-KRAS-PEG5kDa was added at RT and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and the conjugate along with unreacted antibody and siRNA was observed.

[0537] Step 2: Purification

[0538] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing the antibody-KRAS-PEG conjugate were pooled, concentrated and buffer exchanged with PBS, pH 7.4.

[0539] Step-3: Analysis of the purified conjugate

[0540] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-3 (described in example 1). Examples of the conjugates made using the methods described in Examples 4 and 5 are illustrated in Table 17.

Table 17. List of A-X-B-Y-C conjugates

[0541] The HPLC chromatogram of EGFR Antibody-KRAS-PEG5kDa is illustrated in Fig. 11. The HPLC chromatogram of Panitumumab-KRAS-PEG5kDa is as shown in Fig. 12.

Conjugation scheme-3

[0542] Step 1: Antibody conjugation with SPDP linker followed by SH-siRNA-PEG5kDa

[0543] Anti-EGFR antibody was exchanged with IX Phosphate buffer (pH 7.4) and made up to 5mg/ml concentration. To this solution, 2 equivalents of SPDP linker (succinimidyl 3 -(2-pyridyldithio)propionate) was added and rotated for 4 hours at room temperature. Unreacted SPDP linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and pH 7.4 PBS buffer. The retentate was collected and 2 equivalents of SH-C6-siRNA-PEG5kDa was added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugate along with unreacted antibody and siRNA was seen. [0544] Step 2: Purification

[0545] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing the antibody-PEG-siRNA conjugate were pooled, concentrated and buffer exchanged with PBS, pH 7.4.

[0546] Step-3: Analysis of the purified conjugate

[0547] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2. The HPLC chromatogram of EGFR Antibody-S-S-siRNA-PEG5kDa (DAR = 1) is as shown in Fig. 13.

Example 6: Synthesis, purification and analysis of antibody-SMCC-Endosomal escape peptide con ugates

Conjugation Scheme-4

[0548] Step 1: Antibody conjugation with SMCC linker or maleimide-PEG-NHS followed by SH- Cvs-Peptide-CONH,

[0549] Anti-EGFR antibody was exchanged with IX Phosphate buffer (pH 7.4) and made up to lOmg/ml concentration. To this solution, 3 equivalents of SMCC linker (succinimidyl 4-(N- maleimidomethyl)cyclohexane-l-carboxylate) or maleimide-PEGlkDa-NHS was added and rotated for 1.5 hours at room temperature. Unreacted SMCC linker or PEG linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS buffer pH 7.4 (25mM MES pH=6.1 for Melittin conjugates). The retentate was collected and 3 equivalents of SH-Cys-Peptide-CONH ₂ was added at RT and rotated overnight. The reaction mixture was then purified by either HIC chromatography or cation exchange chromatography to isolate the anti-EGFR antibody-Peptide or anti-EGFR antibody-PEGlk-Peptide.

[0550] Step 2: Purification

[0551] The crude reaction mixture was purified by AKTA explorer FPLC using either hydrophobic interaction chromatography (HIC) method- 1 or cation exchange chromatography method- 1. Fractions containing the antibody-peptide conjugates were pooled, concentrated and buffer exchanged with PBS, pH 7.4 (10 mM Acetate pH=6.0 for Melittin conjugates).

[0552] Step-3: Analysis of the purified conjugate

[0553] The isolated conjugate was characterized by either mass spec or SDS-PAGE. Purity and peptide loading was assessed by analytical HPLC using either HIC method-2 or cation exchange chromatography method-2. Examples of all the conjugates made using the method of Example 6 are described in Tables 18 and 19.

Table 18. List of AXYD conjugates

Table 19. List of AXYD conjugates

[0554] Cation exchange chromatography method-1

1. Column: GE Healthcare HiPrep SP HP 16/ 10

2. Solvent A: 50 mM MES pH=6.0; Solvent B: 50 mM MES + 0.5M NaCl pH=6.0; Flow Rate: 2.0 ml/min

3. Gradient:

a. %A %B Column Volume

b. 100 0 0.1

c. 100 0 Flush loop 12ml

d. 100 0 2.5

e. 0 100 15

f. 0 100 5

g- 100 0 0.5

h. 100 0 5

[0555] Cation exchange chromatography method -2

1. Column: Thermo Scientific, MAbPac™ SCX-10, Bio LC™, 4 X 250 mm (product # 074625)

2. Solvent A: 20 mM MES pH=5.5; Solvent B: 20 mM MES + 0.3 M NaCl pH=5.5; Flow Rate: 0.5 ml/min

3. Gradient:

a. Time %A %B b. 0.0 100 0

c. 5 100 0

d. 50 0 100

e. 80 0 100

f. 85 100 0

8. 90 100 0

[0556] Hydrophobic interaction chromatography method-1 (HIC method-1)

1. Column: GE Healthcare Butyl Sepharose High Performance (17-5432-02) 200ml

2. Solvent A: 50 mM Sodium Phosphate + 0.8M ammonium sulfate (pH=7.0); Solvent B: 80% 50 mM Sodium Phosphate (pH=7.0), 20% IPA; Flow Rate: 3.0 ml/min

3. Gradient:

a. %A %B Column Volume

b. 100 0 0.1

c. 0 100 3

d. 0 100 1.35

e. 100 0 0.1

f. 100 0 0.5

[0557] Hydrophobic interaction chromatography method-2 (HIC method-2)

1. Column: Tosoh Bioscience TSKgel Butyl -NPR 4.6mm ID x 10cm 2.5 μιη

2. Solvent A: 100 mM Sodium phosphate + 1.8 M ammonium sulfate (pH=7.0); Solvent B: 80% 100 mM sodium phosphate (pH=7.0), 20% IPA; Flow Rate: 0.5 ml/min

3. Gradient:

a. Time %A %B

b. 0 100 0

c. 3 50 50

d. 21 0 100

e. 23 0 100

f. 25 100 0

[0558] Fig. 14 illustrates the HPLC chromatogram of EGFR antibody-PEG24-Melittin (loading =~1). Fig. 15 illustrates the HPLC chromatogram of EGFR antibody-Melittin (n=~l). Fig. 16 shows the mass spectrum of EGFR antibody-Melittin (n=l). Fig. 17 shows the HIC chromatogram of EGFR antibody- PEGlkDa-INF7 (Peptide loading = ~1). Fig. 18 shows the HPLC chromatogram of EGFR antibody-INF7 (Peptide Loading = ~1).

Examp s

EGFR-Ab-siRNA-PEG5kDa

Conjugation Scheme-5

[0559] Step 1: Conjugation of PEG24 linker followed by SH-Cvs-Peptide-CONH, to EGFR-Ab- siRNA-PEG

[0560] EGFR-Ab-siR A-PEG conjugate with a siRNA loading of 1 was conjugated with 4 equivalents of PEGlk linker (succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate) in PBS, pH 7.4 buffer and rotated for 1.5 hours at room temperature. Unreacted PEGlk linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS buffer pH 7.4. The retentate was collected and 4 equivalents of SH-Cys-Peptide-CONH ₂ was added at RT and rotated overnight.

[0561] Step 2: Purification

[0562] The reaction mixture was then purified by repeated spin filtration using PBS buffer pH7.4 and 50 kDa Amicon spin filters until the unreacted peptide was removed as monitored by HPLC. The product contains a mixture of conjugates with 0, 1, 2, 3 or more peptides conjugated to the antibody backbone.

[0563] Step-3: Analysis of the purified conjugate

[0564] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity and the peptide loading of the conjugate was assessed by analytical HPLC using either HIC method-2 or cation exchange chromatography method-2. Examples of the conjugates made using the method described in Example 7 are shown in Table 20. Table 20. List of (A-X-B-Y-Cn)-L-D conjugates

[0565] Fig. 19 shows INF7-PEGlkDa-(EGFR antibody-KRAS-PEG5kDa). Fig. 20 shows Melittin- PEG 1 kDa-(EGFR antibody-KRAS -PEG5kDa) .

Example 8: In vivo Pharmacokinetics Study of a EGFR antibody-siRNA-PEG Conjugate (PK-055)

[0566] Groups (n=3) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=4) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups that received EGFR antibody-siRNA-PEG conjugates were dosed at 0.5 mg/kg (based on the weight of siRNA) and groups that received cholesterol-siRNA conjugates were dosed at 15 mg/kg. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Non -terminal blood samples were collected at 2, 15, or 60 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 h post-dose. Table 21 describes the study design in more detail and provides a cross-reference to the conjugate synthesis and characterization. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap -frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2-7.

Table 21. Study design for a EGFR antibody-siRNA-PEG Conjugate (PK-055) with a cross-reference to the synthesis and characterization of the conjugates tested.

[0567] PEG linkers of various molecular weights and a small molecule linker were used to attach EGFR siRNA to an EGFR antibody (EGFR-Ab) and the PK was assessed to determine the effect of the linker molecular weight on the behavior of the mAb-siRNA conjugate in plasma. As illustrated in Fig 21, the molecular weight of the PEG linker does not have a large impact on the plasma PK, except for the 10 kDa PEG leads to a faster siRNA clearance (i.e. lower plasma concentrations at later times). The orientation of the siRNA and PEG relative to the EGFR-Ab was also explored. As illustrated in Fig 22, having the siRNA in between the EGFR-Ab and the PEG5k (EGFR antibody-KRAS-PEG5k) results in significantly higher plasma concentrations than the alternative conjugate where PEG5k is in between the EGFR-Ab and the siRNA (EGFR antibody-PEG5k-EGFR). In some instances, the use of two different siRNAs on these conjugates does not impact the plasma kinetics.

[0568] The drug loading on the EGFR-Ab was also investigated, with n=l and n=2 siRNAs per EGFR- Ab. As illustrated in Fig 23, having only one siRNA per EGFR-Ab resulted in much higher plasma concentrations, whereas the higher loading of n=2 siRNA per EGFR-Ab resulted in faster clearance from plasma. The impact of adding an endosomal escape peptide (melittin) was assessed. EGFR antibody- KRAS-PEG5k and EGFR antibody-melittin were mixed together in solution and co-injected. As illustrated in Fig 24, the presence of EGFR antibody-melittin increases the clearance from plasma of EGFR antibody- KRAS-PEG5k at later times.

[0569] The plasma PK of cholesterol-siRNA conjugates was next compared to the mAb-siRNA conjugates after intravenous administration via tail vein injection. As illustrated in Fig 25, the chol-siRNA conjugates are cleared much faster from plasma than the mAb-siRNA conjugates. As illustrated from the PK profile, having either EGFR or KRAS siRNA on the conjugate did not affect the plasma kinetics.

[0570] In addition to the plasma PK analysis, siRNA concentrations were determined in tissues at various times post-dose to determine the tissue PK. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL. In Fig 26, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As illustrated in Fig 26A, a single i.v. dose of 0.5 mg/kg of EGFR antibody-siRNA resulted in approximately 100 nM concentrations of siRNA in tumor at 24 h post- dose for virtually all of the conjugates. In the case of these EGFR antibody-linker-siRNA conjugates, the molecular weight of the linker between the EGFR-Ab and the EGFR siRNA does not seem to alter the PK of these conjugates in the s.c. flank H358 tumors. As illustrated in Fig 26B, the concentration of siRNA in liver following a single i.v. dose of 0.5 mg/kg of EGFR antibody-siRNA is approximately 100 nM at 24 h post-dose, similar to that seen in tumor. Only the small molecule linker at 24 h post-dose produces a siRNA concentration in liver approximately half of what is seen with longer PEG linkers. siRNA concentrations decrease over time in both tumor and liver tissue with these EGFR antibody-linker-siRNA conjugates.

[0571] The orientation of the siRNA and PEG relative to the EGFR-Ab was also explored relative to the tissue PK profiles. As illustrated in Fig 27, both the EGFR antibody-KRAS-PEG5k and the EGFR antibody-PEG5k-EGFR conjugates deliver approximately 100 nM siRNA into both tumor and liver following a single i.v. dose of 0.5 mg/kg. However, while the EGFR antibody-KRAS-PEG5k maintains the siRNA concentration in tumor at approximately 100 nM until 168 h post -dose, the other 3 curves decline in concentration over time. Next, the tissue PK as a function of drug loading was assessed. As illustrated from Fig 28, n=l siRNA per EGFR-Ab delivered higher amounts of siRNA into tumor compared to liver.

However, increasing the siRNA loading to n=2 siRNA per EGFR-Ab increased the amount of siRNA delivered to liver and decreased the amount of siRNA delivered to tumor. Additionally, EGFR antibody- melittin was mixed with some formulations in order to introduce endosomal escape functionality. As illustrated from Fig 29, mixing and co-administering EGFR antibody-melittin with EGFR antibody-siRNA did not have a large impact on the tissue PK. The addition of melittin decreased uptake of siRNA in tumor and increased the uptake of siRNA in liver.

[0572] The tissue PK profiles of cholesterol-siRNA conjugates (using both EGFR and KRAS siRNA) in liver and in s.c. flank H358 tumors was also assessed. As illustrated from Fig 30, both chol-siRNA conjugates delivered approximately 5 μΜ concentrations of siRNA into liver 24 h following a single i.v. dose of 15 mg/kg. In liver, the chol-KRAS appears to clear slightly faster than the chol-EGFR on the 1 - week time scale. The two different chol-siRNA conjugates further show different PK profiles in tumor. Both cholesterol conjugates deliver less siRNA into tumor compared to liver, but the chol-EGFR delivers more siRNA into tumor when compared to the chol-KRAS conjugate. Both chol-siRNA conjugates are cleared from tumor over time and with a similar slope.

[0573] A PD analysis followed the PK analysis. As illustrated in Fig 31A, the chol-KRAS conjugate produced only marginal (-25%) mRNA knockdown of the KRAS target gene in tumor following a single i.v. dose of 15 mg/kg. However, as illustrated in Fig 3 IB, the same 15 mg/kg dose of chol-KRAS was able to produce >50% mRNA knockdown in the mouse liver. The chol-EGFR conjugate was able to produce >50% mRNA knockdown in tumor, as illustrated in Fig 32. In some instances, the higher knockdown with chol-EGFR in tumor compared to chol-KRAS is due to the higher siRNA concentrations observed in tumor with chol-EGFR compared to chol-KRAS (Fig 30). Finally, as illustrated in Figs 33 and 34, most of the EGFR antibody-siRNA conjugates resulted in approximately 25 -50% EGFR or KRAS mRNA knockdown in tumors after a single IV dose, but at a much lower dose (0.5 mg/kg) compared to the chol -siRNA conjugates.

Example 9: Synthesis, purification and analysis of additional antibody-siRNA conjugates

Scheme-6: Antibody-lys-siRNA-PEG conjugates via antibody lysine conjugation of SMCC linker

[0574] Step 1 : Antibody conjugation with SMCC linker followed by SH-siRNA

[0575] Antibody was buffer exchanged with IX Phosphate buffer (pH 7.4) and made up to 10 mg/ml concentration. To this solution, 2 equivalents of SMCC linker dissolved in DMSO was added and rotated for 4 hours at room temperature. Unreacted SMCC linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and PBS pH 7.4. The antibody-maleimide conjugate was collected into a reaction vessel and SH-C6-siRNA or SH-C6-siRNA-C6-NHCO-PEG-XkDa (2 equivalents) (X= 0.5 kDa to 10 kDa) was added at RT in pH 7.4 PBS with 5mM EDTA and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography method-2 showed antibody siRNA conjugate along with unreacted antibody and siRNA. [0576] Step 2: Purification

[0577] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DARl and DAR>2 antibody-siRNA-PEG conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.

[0578] Step-3: Analysis of the purified conjugate

[0579] The isolated conjugates were characterized by SAX chromatography SEC chromatography and SDS-PAGE analysis. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2. All DARl conjugate generally eluted at 9.0 ±0.4 minutes while the DAR2 and DAR3 conjugates generally eluted at 9.7 ±0.2 minutes. Typical DARl conjugate is greater than 90% pure after purification while typical DAR>2 lysine conjugates contains 70-80% DAR2 and 20-30% DAR3.

Scheme-7: Antibody-Cys-siRNA-PEG conjugates via antibody cysteine conjugation

[0580] Step 1: Antibody interchain disulfide reduction with TCEP

[0581] Antibody was buffer exchanged with borax buffer (pH 8) and made up to 10 mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of SMCC-C6-siRNA or SMCC-C6-siRNA-C6-NHCO-PEG-XkDa (2 equivalents) (X= 0.5 kDa to 10 kDa) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.

[0582] Step 2: Purification

[0583] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DARl and DAR>2 antibody-PEG-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.

[0584] Step-3: Analysis of the purified conjugate

[0585] The isolated conjugates were characterized by SEC, SAX chromatography and SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3. Isolated DARl conjugates are typically eluted at 9.0 + 0.3 min on analytical SAX method-2 and are greater than 90% pure. The typical DAR>2 cysteine conjugate contains more than 85% DAR2 and less than 15% DAR3.

CBTF-si A

Scheme-8: Antibody siRNA conjugates via antibody inter-chain cysteine conjugation

[0586] Step 1 : Antibody interchain disulfide reduction with TCEP

[0587] Antibody was buffer exchanged with borax buffer (pH 8) and made up to 10 mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was buffer exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of CBTF-C6-siRNA-C6-NHCO-PEG-5kDa (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.

[0588] Step 2: Purification

[0589] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 cysteine conjugate contains greater than 85% DAR2 and less than 15% DAR3 or higher.

[0590] Step-3: Analysis of the purified conjugate

[0591] The isolated conjugates were characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3.

MSS*siRNi ȣG

Scheme-9: Antibody siRNA conjugates via antibody inter-chain cysteine conjugation [0592] Step 1 : Antibody reduction with TCEP

[0593] Antibody was buffer exchanged with borax buffer (pH 8) and made up to 5mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of MBS - C6-siRNA-C6-NHCO-PEG-5kDa (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA. [0594] Step 2: Purification

[0595] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 cysteine conjugate contains greater than 85% DAR2 and less than 15% DAR3 or higher.

[0596] Step-3: Analysis of the purified conjugate

[0597] The isolated conjugates were characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3.

Scheme-10: Antibody siRNA conjugates via antibody inter-chain cysteine conjugation

[0598] Step 1 : Antibody reduction with TCEP

[0599] Antibody was buffer exchanged with borax buffer (pH 8) and made up to 5mg/ml concentration. To this solution, 2 equivalents of TCEP in water was added and rotated for 2 hours at RT. The resultant reaction mixture was exchanged with pH 7.4 PBS containing 5 mM EDTA and added to a solution of MBS - C6-siRNA-C6-NHCO-PEG-5kDa (2 equivalents) in pH 7.4 PBS containing 5 mM EDTA at RT and rotated overnight. Analysis of the reaction mixture by analytical SAX column chromatography showed antibody siRNA conjugate along with unreacted antibody and siRNA.

[0600] Step 2: Purification

[0601] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 cysteine conjugate contains greater than 85% DAR2 and less than 15% DAR3 or higher.

[0602] Step-3: Analysis of the purified conjugate

[0603] The isolated conjugates were characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using either anion exchange chromatography method-2 or anion exchange chromatography method-3.

K and R ^* - H or &te

Scheme-11 : Synthesis of antibody-lysine-S-S-siRNA-PEG conjugates

[0604] Step 1 : Antibody conjugation with SPDP linker followed by SH-siRNA-PEG5kDa

[0605] Antibody was buffer exchanged with pH 7.4 IX PBS and made up to 10 mg/ml concentration. To this solution, 2 equivalents of SPDP linker [succinimidyl 3-(2-pyridyldithio)propionate] or its methylated version was added and rotated for 4 hours at room temperature. Unreacted SPDP linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and pH 7.4 PBS buffer. The retentate was collected and 2 equivalents of SH-C6-siRNA-PEG5kDa in pH 7.4 PBS was added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and the conjugate along with unreacted antibody and siRNA was seen.

[0606] Step 2: Purification

[0607] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 lysine conjugate contains 70 to 80% DAR2 and 20 to 30% DAR3 or higher.

[0608] Step-3: Analysis of the purified conjugate

[0609] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2.

Scheme-12: Synthesis of antibody-cysteine-S-S-siRNA-PEG conjugates

[0610] Step 1 : Antibody reduction and conjugation with pyridyldithio-siRNA-PEG5kDa

[0611] Antibody was buffer exchanged with pH 8.0 borax buffer and made up to 10 mg/ml concentration. To this solution, 1.5 equivalents of TCEP was added and the reaction mixture was rotated for 1 hour at room temperature. Unreacted TCEP was removed by spin filtration using 50 kDa MWCO Amicon spin filters and buffer exchanged with pH 7.4 PBS buffer. The retentate was collected and 2 equivalents of pyridyldithio- C6-siR A-PEG5kDa in pH 7.4 PBS was added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugate along with unreacted antibody and siR A was seen.

[0612] Step 2: Purification

[0613] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.

[0614] Step-3: Analysis of the purified conjugate

[0615] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2. Typical DAR>2 cysteine conjugate contains 90% DAR2 and 10% DAR3 or higher.

Scheme-13: Synthesis of antibody-cysteine-ECL-siRNA-PEG conjugates

[0616] Step 1 : Antibody reduction and conjugation with maleimide-ECL-siRNA-PEG5kDa

[0617] Antibody was buffer exchanged with pH 8.0 borax buffer and made up to 10 mg/ml concentration. To this solution, 1.5 equivalents of TCEP (Tris(2-carboxyethyl)phosphine hydrochloride) reagent was added and rotated for 1 hour at room temperature. Unreacted TCEP was removed by spin filtration using 50 kDa MWCO Amicon spin filters and pH 7.4 PBS buffer with 5mM EDTA. The retentate was collected and 1.5 equivalents of maleimide-ECL-C6-siR A-PEG5kDa in pH 7.4 PBS was added at room temperature and rotated overnight. The reaction mixture was analyzed by analytical SAX column chromatography and conjugate along with unreacted antibody and siR A was seen.

[0618] Step 2: Purification

[0619] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.

[0620] Step-3: Analysis of the purified conjugate

[0621] The isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2. Typical DAR>2 lysine conjugate contains 70 to 80% DAR2 and 20 to 30% DAR3 or higher.

Scheme-14: Antibody Lysine conjugation with TCO/Tetrazine linker

[0622] Step 1 : Antibody conjugation with NHS-PEG4-TCO followed by methyltetrazine-PEG4- siRNA-PEG5kDa

[0623] Antibody was buffer exchanged with pH 7.4 PBS and made up to 5mg/ml concentration. To this solution, 2 equivalents of NHS-PEG4-TCO linker was added and rotated for 4 hours at room temperature. Unreacted linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and pH 7.4 PBS. The retentate was collected and 2 equivalents of methyltetrazine-PEG4-siRNA-PEG5kDa in pH 7.4 PBS was added at room temperature. The reaction mixture was analyzed by analytical SAX column

chromatography and the antibody-siRNA conjugate was seen along with the unreacted antibody and siRNA.

[0624] Step 2: Purification

[0625] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3 or higher.

[0626] Step-3: Analysis of the purified conjugate

[0627] The characterization and purity of the isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2.

Scheme-15: Site specific conjugation at antibody glycans

[0628] Step 1: Antibody glvcan modification and Gal-N^addition

[0629] Antibody was buffer exchanged with pH 6.0, 50 mM sodium phosphate buffer and treated with EndoS2 at 37 °C for 16 hrs. The reaction mixture was buffer exchanged into TBS buffer (20 mM Tris, 0.9% NaCl, pH 7.4) and UDP-GalNAz was added followed by MnCl ₂ , and Gal-T(Y289L) in 50 mM Tris, 5mM EDTA (pH 8). The final solution contained concentrations of 0.4 mg/mL antibody, 10 mM MnCl ₂ , 1 mM UDP-GalNAz, and 0.2 mg/mL Gal-T(Y289L) and was incubated overnight at 30 °C. [0630] Step 2: DIBO-PEG-TCO conjugation to azide modified antibody

[0631] The reaction mixture from step-1 was buffer exchanged with PBS and 2 equivalents of DIBO- PEG4-TCO linker was added and rotated for 6 hours at room temperature. Unreacted linker was removed by spin filtration using 50 kDa MWCO Amicon spin filters and pH 7.4 PBS. The retentate was collected and used as is in step-3.

[0632] Step 3: Methyl tetrazine-siRNA conjugation to TCP labeled antibody

[0633] 2 equivalents of methyltetrazine-PEG4-siR A-PEG5kDa in pH 7.4 PBS was added to the retentate from step-2 and rotated at room temperature for 1 hour. The reaction mixture was analyzed by analytical SAX column chromatography and the antibody-siR A conjugate was seen along with the unreacted antibody and siRNA.

[0634] Step 4: Purification

[0635] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method- 1. Fractions containing DAR1 and DAR>2 antibody-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS. Typical DAR>2 lysine conjugate contains 70-80% DAR2 and 20-30% DAR3 or higher.

[0636] Step-5: Analysis of the purified conjugate

[0637] The characterization and purity of the isolated conjugate was characterized by either mass spec or SDS-PAGE. The purity of the conjugate was assessed by analytical HPLC using anion exchange chromatography method-2.

Scheme-16: Fab-siRNA conjugate generation [0638] Step 1 : Antibody digestion with pepsin

[0639] Antibody was buffer exchanged with pH 4.0, 20 mM sodium acetate/acetic acid buffer and made up to 5mg/ml concentration. Immobilized pepsin (Thermo Scientific, Prod#20343) was added and incubated for 3 hours at 37 °C. The reaction mixture was filtered using 30 kDa MWCO Amicon spin filters and pH 7.4 PBS. The retentate was collected and purified using size exclusion chromatography to isolate F(ab')2. The collected F(ab')2 was then reduced by 10 equivalents of TCEP and conjugated with SMCC-C6-siRNA- PEG5 at room temperature in pH 7.4 PBS. Analysis of reaction mixture on SAX chromatography showed Fab-siRNA conjugate along with unreacted Fab and siRNA-PEG.

[0640] Step 2: Purification

[0641] The crude reaction mixture was purified by AKTA explorer FPLC using anion exchange chromatography method-1. Fractions containing DARl and DAR2 Fab-siRNA conjugates were separated, concentrated and buffer exchanged with pH 7.4 PBS.

[0642] Step-3: Analysis of the purified conjugate

[0643] The characterization and purity of the isolated conjugate was assessed by SDS-PAGE and analytical HPLC using anion exchange chromatography method-2.

[0644] Purification and analytical Methods

[0645] Anion exchange chromatography method-1.

[0646] Column: Tosoh Bioscience, TSKGel SuperQ-5PW, 21.5 mm ID X 15 cm, 13 um

[0647] Solvent A: 20 mM TRIS buffer, pH 8.0; Solvent B: 20 mM TRIS, 1.5 M NaCl, pH 8.0; Flow

Rate: 6.0 ml/min

[0648] Gradient:

a. %A %B Column Volume

b. 100 0 1.00

c. 60 40 18.00

d. 40 60 2.00

e. 40 60 5.00

f. 0 100 2.00

g. 100 0 2.00

[0649] Anion exchange chromatography method-2

[0650] Column: Thermo Scientific, ProPac™ SAX-10, Bio LC™, 4 X 250 mm

[0651] Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl; Flow Rate: 1.0 ml/min

[0652] Gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 1 1.00 40 60

e. 13.00 40 60

f. 15.00 90 10

g. 20.00 90 10 [0653] Anion exchange chromatography method-3

[0654] Column: Thermo Scientific, ProPacTM SAX-10, Bio LCTM, 4 X 250 mm

[0655] Solvent A: 80% 10 mM TRIS pH 8, 20% ethanol; Solvent B: 80% 10 mM TRIS pH 8, 20% ethanol, 1.5 M NaCl

[0656] Flow Rate: 0.75 ml/min

[0657] Gradient:

a. Time %A %B

b. 0.0 90 10

c. 3.00 90 10

d. 11.00 40 60

e. 23.00 40 60

f. 25.00 90 10

g. 30.00 90 10

[0658] Size exclusion chromatography method-1

[0659] Column: TOSOH Biosciences, TSKgelG3000SW XL, 7.8 X 300 mm, 5 μΜ

[0660] Mobile phase: 150 mM phosphate buffer

[0661] Flow Rate: 1.0 ml/min for 20 mins

[0662] siRNA synthesis

[0663] All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.

[0664] Each siRNA passenger strand contains two conjugation handles, C6-NH ₂ and C6-SH, one at each end of the strand. The passenger strand with C6-NH ₂ handle at 5' end contains C6-SH at its 3' end and the strand that contains C6-NH ₂ handle at 3' end contains C6-SH at its 5' end. Both conjugation handles are connected to siRNA passenger strand via inverted abasic phosphodiester or phosphorothioate.

[0665] A representative structure of siRNA with C6-NH ₂ conjugation handle at the 5' end and C6-SH at 3 '

[0666] ASC Architectures described in Examples 10-41

[0667] ASC Architecture-1: Antibody-Lys-SMCC-S-3' -Passenger strand. This conjugate was generated by antibody lysine-SMCC conjugation to thiol at the 3' end of passenger strand.

[0668] ASC Architecture-2: Antibody-Cys-SMCC-3 '-Passenger strand. This conjugate was generated by antibody inter-chain cysteine conjugation to SMCC at the 3' end of passenger strand.

[0669] ASC Architecture-3: Antibody-Lys-SMCC-S-5 '-passenger strand. This conjugate was generated by antibody lysine-SMCC conjugation to C6-thiol at the 5' end of passenger strand.

[0670] ASC Architecture-4: Antibody-Cys-SMCC-5' -passenger strand. This conjugate was generated b antibody inter-chain cysteine conjugation to SMCC at the 5' end of passenger strand.

[0671] ASC Architecture-5: Antibody-Lys-PEG-5 '-passenger strand. This conjugate was generated by antibody PEG-TCO conjugation to tetrazine at the 5' end of passenger strand.

[0672] ASC Architecture-6: Antibody-Lys-PEG-5' -passenger strand. This conjugate was generated by antibody PEG-TCO conjugation to tetrazine at the 5' end of passenger strand.

[0673] ASC Architecture-7: Antibody-Cys-PEG-5' -passenger strand without inverted abasic at 5' end. This conjugate was generated using procedure similar to architecture -2. The antibody was conjugated di

[0674] Zalutumumab (EGFR-Ab)

[0675] Zalutumumab is a fully human IgGltc monoclonal antibody directed against the human epidermal growth factor receptor (EGFR). It is produced in the Chinese Hamster Ovary cell line DJT33, which has been derived from the CHO cell line CHO-KISV by transfection with a GS vector carrying the antibody genes derived from a human anti-EGFR antibody producing hybridoma cell line (2F8). Standard mammalian cell culture and purification technologies are employed in the manufacturing of zalutumumab.

[0676] The theoretical molecular weight (MW) of zalutumumab without glycans is 146.6 kDa. The experimental MW of the major glycosylated isoform of the antibody is 149 kDa as determined by mass spectrometry. Using SDS-PAGE under reducing conditions the MW of the light chain was found to be approximately 25 kDa and the MW of the heavy chain to be approximately 50 kDa. The heavy chains are connected to each other by two inter-chain disulfide bonds, and one light chain is attached to each heavy chain by a single inter-chain disulfide bond. The light chain has two intra-chain disulfide bonds and the heavy chain has four intra-chain disulfide bonds. The antibody is N-linked glycosylated at Asn305 of the heavy chain with glycans composed of N-acetyl-glucosamine, mannose, fucose and galactose. The predominant glycans present are fucosylated bi-antennary structures containing zero or one terminal galactose residue. The charged isoform pattern of the IgGltc antibody has been investigated using imaged capillary IEF, agarose IEF and analytical cation exchange HPLC. Multiple charged isoforms are found, with the main isoform having an isoelectric point of approximately 8.7.

[0677] The major mechanism of action of zalutumumab is a concentration dependent inhibition of EGF - induced EGFR phosphorylation in A431 cancer cells. Additionally, induction of antibody-dependent cell- mediated cytotoxicity (ADCC) at low antibody concentrations has been observed in pre -clinical cellular in vitro studies.

[0678] Panitumumab (EGFR2-Ab)

[0679] Panitumumab is a clinically approved, fully human IgG2 subclass monoclonal antibody specific to the epidermal growth factor receptor (EGFR). Panitumumab has two gamma heavy chains and two kappa light chains. Glycosylated panitumumab has a total molecular weight of approximately 147 kDa.

Panitumumab is expressed as a glycoprotein with a single consensus N-linked glycosylation site located on the heavy chain. Panitumumab is produced from Chinese Hamster Ovary (CHO) cells and purified by a series of chromatography steps, viral inactivation step, viral filtration step and ultrafiltration/diafiltration steps.

[0680] Panitumumab acts as a competitive antagonist at the ligand binding site of EGFR to inhibit binding and signaling mediated by EGF and transforming growth factor a, the natural ligands for this receptor. The affinity of binding panitumumab to the EGFR was determined be 3.5 and 5.7 x 10 ^"12 M in recombinant EGFR using BIAcore methods. Inhibition of binding of EGF was shown in A431 cells, a human epidermal carcinoma cell line that expresses EGFR. Intracellular acidification, phosphorylation and internalization of the EGFR were blocked in a dose-dependent manner by panitumumab in A431 cells. Panitumumab was also shown to inhibit cell growth in vitro and in vivo in the same cell line.

[0681] Herceptin (EGFR3-Ab)

[0682] Herceptin is a clinically approved, humanized IgGl subclass monoclonal antibody specific to the epidermal growth factor receptor2 (EGFR2) also known as Her2. Herceptin has human Fc γΐ isotype along with kappa light chains.

[0683] PSMA-Ab

[0684] PSMA-Ab is a humanized IgGl subclass monoclonal antibody specific to prostate specific membrane antigen (PSMA).

[0685] ASGRl-Ab

[0686] ASGR mAb-Sinol03 is a rabbit IgG monoclonal antibody that binds mouse asialoglycoprotein receptorl (ASGPR1). It is supplied by Sino Biologicals Inc. (Cat # 50083-R103). [0687] ASGR2-Ab

[0688] ASGR mAb-R&D is a rat IgG ₂ A subclass monoclonal antibody that binds mouse

asialoglycoprotein receptorl (ASGPRl). It is purified by protein A or G from hybridoma culture supernatant and supplied by R&D Systems (Cat # MAB2755)

[0689] siRNA-TriGalNAc Conjugate

[0690] The siRNA triGalNAc conjugate was synthesized using Lys-Lys dipeptide. Protected triGalNAc was coupled with dipeptide PEG linker and purified. After the removal of carboxylic acid protection group

Example 10: 2016-PK-163-LNCap

[0691] siRNA design and synthesis

[0692] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to obtain the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0693] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0694] ASC synthesis and characterization

[0695] The AXBYC conjugate used in groups 3-4 were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. The AXB and AXCYB conjugates were made as described in Example 9.

[0696] In vivo study design

[0697] Groups (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups 1-6 were dosed at 1.0 or 0.5 mg/kg (based on the weight of siRNA) as per the study design below. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 22 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 22

8 PBS Control 5 IV 5.0 1 96

SCID SHO mice with LNCaP

Total # of Animals: 40

tumors

[0698] The orientation of the siRNA and PEG relative to the PSMA-Ab was explored in an in vivo mouse tumor model. As illustrated in Fig. 50A, having the siRNA in between the PSMA-Ab and the PEG5k (PSMA-Ab(Cys)-EGFR-PEG5k or the AXBYC format) resulted in higher levels of EGFR mRNA knockdown in the tumor relative to the alternative conjugate where PEG5k is in between the PSMA-Ab and the siRNA (PSMA-Ab(Cys)-PEG5k-EGFR or AXCYB format). This approach (AXBYC) also resulted in higher levels of EGFR mRNA knockdown in the tumor relative to the conjugate without PEG5K (PSMA- Ab(Cys)-EGFR or AXB format).

[0699] The orientation of the siRNA and PEG relative to the PSMA-Ab was also explored relative to the tissue PK profiles. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL (a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue). As illustrated in Fig. 50B, having the siRNA in between the PSMA-Ab and the PEG5k (AXBYC) resulted in higher levels of siRNA delivery to the tumor relative to the alternative conjugate where PEG5k is in between the PSMA-Ab and the siRNA (AXCYB). This approach (AXBYC) resulted in higher levels of EGFR siRNA delivery to the tumor relative to the conjugate without PEG5K (AXB).

[0700] In a mouse LNCaP subcutaneous xenograph model, it was demonstrated that the AXBYC format for the antibody siRNA conjugate resulted in higher levels of siRNA accumulation in the tumor tissue and a greater magnitude of EGFR mRNA knockdown, relative to the AXCYB and AXB formats. The LNCap tumor expresses human PSMA, resulting in tumor tissue specific accumulation of the PSMA targeted siRNA conjugates after i.v. administration, receptor mediate uptake and siRNA facilitated knockdown of the target gene.

Example 11: 2016-PK-202-LNCap

[0701] siRNA design and synthesis

[0702] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure. [0703] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0704] ASC synthesis and characterization

[0705] The AXBYC conjugate used in groups 3-5 and 7 was made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. The AXB (groups 1 -2) and AXCYB (group 6) conjugates were made as described in Example 9.

[0706] In vivo study design

[0707] Groups (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups 1-6 were dosed at 1.0 or 0.5 mg/kg (based on the weight of siRNA) as per the study design below. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 23 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 23

3 PSMA-Ab(Cys)-EGFR-PEG5k (n=l) 5 1 IV 5.0 1 96

4 PSMA-Ab(Cys)-EGFR-PEG5k (n=l) 5 0.5 IV 5.0 1 96

5 PSMA-Ab(Cys)-EGFR-PEG5k (n=l) 5 0.25 IV 5.0 1 96

6 PSMA-Ab(Cys)-PEG5k-EGFR (n=l) 5 0.5 IV 5.0 1 96

7 PSMA-Ab(Cys)-scramble-PEG5k (n=l) 5 1 IV 5.0 1 96

8 PBS Control 5 - IV 5.0 1 96

„ , .„ , . . . SCID SHO mice with

Total # ot Animals: 40 _{T XT} , _n .

LNCaP tumors

[0708] The orientation of the siRNA and PEG relative to the PSMA-Ab was also explored in an in vivo mouse tumor model. As illustrated in Fig. 51A, having the siRNA in between the PSMA-Ab and the PEG5k (PSMA-Ab(Cys)-EGFR-PEG5k or AXBYC format)) resulted in higher levels of EGFR mRNA knockdown in the tumor relative to the alternative conjugate where PEG5k is in between the PSMA-Ab and the siRNA (P SMA- Ab (Cys)-PEG5 k-EGFR or AXCYB format). This approach (AXBYC) also resulted in higher levels of EGFR mRNA knockdown in the tumor relative to the conjugate without PEG5K (PSMA-Ab(Cys)-EGFR or AXB format).

[0709] The orientation of the siRNA and PEG relative to the PSMA-Ab was also explored relative to the tissue PK profiles. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL (a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue). As illustrated in Fig. 5 IB, having the siRNA in between the PSMA-Ab and the PEG5k (PSMA- Ab(Cys)-EGFR-PEG5k or AXBYC) resulted in higher levels of siRNA delivery to the tumor relative to the alternative conjugate where PEG5k is in between the PSMA-Ab and the siRNA (PSMA-Ab(Cys)-PEG5k- EGFR or AXCYB). This approach (AXBYC) also resulted in higher levels of EGFR siRNA delivery to the tumor relative to the conjugate without PEG5K (PSMA-Ab(Cys)-EGFR or AXB).

[0710] In a mouse LNCaP subcutaneous xenograph model, it was demonstrated that the AXBYC format for the antibody siRNA conjugate results in higher levels of siRNA accumulation in the tumor tissue and a greater magnitude of EGFR mRNA knockdown, relative to the AXCYB and AXB formats. The LNCap tumor expresses human PSMA, resulting in tumor tissue specific accumulation of the PSMA targeted siRNA conjugates after i.v. administration, receptor mediate uptake and siRNA facilitated knockdown of the target gene.

Example 12: 2016-PK-219-WT

[0711] siRNA design and synthesis

[0712] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082)). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siR A. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0713] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0714] ASC synthesis and characterization

[0715] The AXBYC conjugate used in groups 4-6 was made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. The AXB (groups 1-3) and AXCYB (groups 7-9) and BYC (groups 10-12) conjugates were made as described in Example 9.

[0716] In vivo study design

[0717] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 24 illustrates the study design in more detail. Non-terminal blood samples were collected at 5, 30, and 180 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 24

5 PEG5k (n=l) 4 0.5 IV 1 t=0 30 96

6 4 0.5 IV 1 t=0 180 168

7 4 0.5 IV 1 t=0 5 24

EGFR-Ab(Cys)-PEG5k-

8 4 0.5 IV 1 t=0 30 96

EGFR (n-l)

9 4 0.5 IV 1 t=0 180 168

10 4 0.5 IV 1 t=0 5 24

EGFR Alone (aka

1 1 4 0.5 IV 1 t=0 30 96

EGFR-PEG5k)

12 4 0.5 IV 1 t=0 180 168

Total # of Animals: j 48 WT mice CD-I

[0718] In this in vivo PK experiment the orientation of the siRNA and PEG relative to the EGFR-Ab was explored to determine the behavior of the mAb-siRNA conjugate in plasma. As illustrated in Fig. 52, all the mAb-siRNA conjugates (AXB, AXBYC and AXCYB formats) had comparable plasma PK with approximately 10 % of the siRNA remaining in the systemic circulation after 168 hours (7days), compared to the siRNA-PEG5K (BYC format) which was rapidly cleared from the plasma.

[0719] The AXBYC format for the antibody siRNA conjugate has improved PK properties relative the siRNA-PEG conjugate (BYC) which was rapidly cleared from the plasma.

Example 13: 2016-PK-199-HCC827

[0720] siRNA design and synthesis

[0721] EFGR: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082)). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.

[0722] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). The same base, sugar and phosphate modifications that were used for the active EGFR siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.

[0723] ASC synthesis and characterization

[0724] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9. [0725] In vivo study design

[0726] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups 1-3 and 4-6 were dosed at 1.0, 0.5 or 0.25 mg/kg (based on the weight of siRNA) as per the study design below. As described in Example 9, groups 1-3 contained the same targeting antibody, but groups 4-6 had a different EGFR targeting antibody, while the rest of the conjugate components (linker, siRNA and PEG) were identical. Group 7 received an antibody conjugate with a negative control siRNA sequence (scramble) as a control for groups 1. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 25 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem -loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 25

[0727] siRNA concentrations were determined 96 hours in the tumor and liver after a single i.v. injection at 1.0, 0.5 and 0.25 mg/kg. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL. In Fig. 53A, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As illustrated in Fig. 53A, both antibody conjugates were capable of delivering higher levels of siRNA to the tumor relative to the liver, and a dose response was observed. The EGFR antibody conjugate was capable of delivering more siRNA to the tumor tissue, at all the doses tested, relative to the EGFR2 antibody. See Fig. 53B. Both conjugates were capable of EGFR gene specific mRNA knockdown at 96 hours post-administration. The control conjugate that contained the scrambled siRNA and the PBS vehicle control did not produce significant EGFR gene specific mRNA knockdown.

[0728] As highlighted in Fig. 54, biological activity was demonstrated with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated that tumor specific accumulation of 2 conjugates targeted with two different EGFR antibodies conjugated to an siRNA designed to down regulate EGFR mRNA. The HCC827 tumor expresses high levels of human EGFR and both conjugates have a human specific EGFR antibody to target the siRNA, resulting in tumor tissue specific accumulation of the conjugates. Receptor mediate uptake resulted in siRNA mediated knockdown of the target gene.

Example 14: 2016-PK-236-HCC827

[0729] siRNA design and synthesis

[0730] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0731] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure. [0732] ASC synthesis and characterization

[0733] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0734] In vivo study design

[0735] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group 6 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups 1-3 were dosed at 1.0, 0.5 or 0.25 mg/kg (based on the weight of siRNA), groups 4 and 5 at 1.0 mg/kg, as per the study design below. As described in Example 9, groups 1-3 contained the same targeting antibody, but groups 4 had a different EGFR targeting antibody, while the rest of the conjugate components (linker, siRNA and PEG) were identical. Group 6 received an antibody conjugate with a negative control siRNA sequence (scramble) as a control for groups 5. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 26 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt).

Table 26

[0736] In this in vivo PD experiment, it was demonstrated that dose dependent EGFR gene specific mRNA knockdown (Fig. 55) at 96 hour's post-administration with a third example of an EGFR antibody targeting agent (EGFR3). The control conjugate that contained the scrambled siRNA and the PBS vehicle control did not produce significant EGFR gene specific mRNA knockdown.

[0737] As highlighted in Fig. 54, it was demonstrated that biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated that tumor specific down regulation of EGFR mRNA using a third EGFR antibody targeting ligand. The HCC827 tumor expresses human EGFR and both conjugates have a human specific EGFR antibody (EGFR and EGFR3) to target the siRNA, resulting in tumor tissue specific accumulation of the conjugates. Receptor mediate uptake resulted in siRNA mediated knockdown of the target gene.

Example 15: 2016-PK-234-HCC827

[0738] siRNA design and synthesis

[0739] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence (5' to 3') of the guide/antisense strand was

TCUCGUGCCUUGGCAAACUUU (SEQ ID NO: 2117) and it was design to be complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR. Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0740] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0741] ASC synthesis and characterization

[0742] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0743] In vivo study design

[0744] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group 10 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups 1-3, 4-6 and 7-9 were dosed at 1.0, 0.5 or 0.25 mg/kg (based on the weight of siRNA), as per the study design below. As described in Example 9, groups 1 -3 contained the same targeting antibody (EGFR3) but groups 4-9 had a different EGFR targeting antibody, while the rest of the conjugate components (linker, siRNA and PEG) were identical. Group 7-9 received an antibody conjugate with a negative control siRNA sequence (scramble) as a control for groups 1 -6. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 27 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB

(housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 27

[0745] siRNA concentrations were determined 96 hours in the tumor and liver after a single i.v. injection at 1.0, 0.5 and 0.25 mg/kg. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL. In Fig. 56A, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As illustrated in Fig. 56A, both antibody conjugates were capable of delivering higher levels of siRNA to the tumor relative to the liver, and a dose response was observed. Both conjugates were capable of EGFR gene specific mRNA knockdown at 96 hours post -administration relative to the scramble and vehicle control. See Fig. 56B.

[0746] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated tumor specific accumulation of 2 conjugates targeted with two different EGFR antibodies conjugated to an siRNA designed to down regulate EGFR mRNA. The HCC827 tumor expresses high levels of human EGFR and both conjugates have a human specific EGFR antibody to target the siRNA, resulting in tumor tissue specific accumulation of the conjugates. Receptor mediate uptake resulted in siRNA mediated knockdown of the target gene

Example 16: 2016-PK-237-HCC827

[0747] siRNA design and synthesis

[0748] KRAS: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human KRAS. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mRNA transcript for KRAS

(UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-SH at the 3' end, which was connected to siRNA passenger strand via via phosphodiester-inverted abasic-phosphorothioate linker. The C6-SH was connected through the phosphodiester, see Example 9 for the chemical structure. In addition, the 5' end of the passenger strand had the inverted abasic removed and the antibody was conjugated directly to the amine on passenger strand 5' end sugar on a T base using a procedure similar to architecture 2, see Example 9.

[0749] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0750] ASC synthesis and characterization

[0751] Conjugates in groups 1-3 were made and purified as a DAR1 (n=l) using ASC architecture -7, as described in Example 9.

[0752] Conjugates in groups 4-6 were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9.

[0753] In vivo study design

[0754] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group 7 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups 1-3, 4-6 were dosed at 1.0, 0.5 or 0.25 mg/kg (based on the weight of siRNA), as per the study design below. As described in Example 9, groups 1-6 contained the same targeting antibody (EGFR) but groups 1 - 3 had an siRNA designed to downregulate KRAS and groups 4-6 had an siRNA designed to downregulate EGFR. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 28 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in the methods section. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem -loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Plasma concentrations of the antibody component of the conjugate were determined using an ELISA assay.

Table 28

Animals: 1 5 tumors

[0755] siRNA concentrations were determined 96 hours in the tumor and liver after a single i.v. injection at 1.0, 0.5 and 0.25 mg/kg. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL. In Fig. 57A and Fig. 57B, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As illustrated in Fig. 57A and Fig. 57B, both antibody conjugates were capable of delivering higher levels of siRNA to the tumor relative to the liver. The conjugate that contained the siRNA designed to downregulate KRAS was capable of KRAS gene specific mRNA knockdown (Fig. 57C) at 96 hours post-administration relative to the conjugate that contained the siRNA designed to down regulate EGFR or the PBS vehicle control. Both antibody conjugate constructs had similar PK properties (see Fig. 58A and Fig. 58B) indicating the alternative conjugation strategy used on the 5' guide strand for the antibody had no impact on this biological parameter.

[0756] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated tumor specific accumulation and siRNA mediated mRNA knockdown of a EGFR antibody conjugated to an siRNA designed to down regulate KRAS mRNA. The HCC827 tumor expresses high levels of human EGFR and the conjugate has a human specific EGFR antibody to target the siRNA, resulting in tumor tissue specific accumulation of the conjugates. Receptor mediate uptake resulted in siRNA mediated knockdown of the KRAS gene.

Example 17: 2016-PK-187-Hep3B

[0757] siRNA design and synthesis

[0758] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0759] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0760] ASC synthesis and characterization

[0761] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0762] In vivo study design

[0763] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank Hep-3B2 1-7 tumors 100-300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group 5 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control.

Treatment groups 1-3 were dosed at 1.0, 0.5 or 0.25 mg/kg (based on the weight of siRNA), group 4 (scramble control) was dosed at 1.0 mg/kg, as per the study design below. Group 4 received an antibody conjugate with a negative control siRNA sequence (scramble) as a control for group 1. All groups

(treatments and controls) were administered a dose volume of 5 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. Table 29 describes the study design in more detail. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Table 29

[0764] siRNA concentrations were determined 96 hours in the tumor and liver after a single i.v. injection at 1.0, 0.5 and 0.25 mg/kg. Tissue concentrations were measured pmol/g and then converted to pmol/mL by assuming the density of tissue equals 1 g/mL. In Fig. 59A, a concentration of 1 nM = 1 nmol/L = 1 pmol/mL = 1 pmol/g tissue. As illustrated in Fig. 59A, the antibody conjugate was capable of delivering siRNA to the tumor. The conjugate was capable of EGFR gene specific mRNA knockdown (Fig. 59B) at 96 hours post-administration relative to the conjugate that contained the negative control siRNA sequence or the PBS vehicle control.

[0765] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated tumor specific accumulation and siRNA mediated mRNA knockdown of an EGFR antibody conjugated to an siRNA designed to down regulate EGFR mRNA. The Hep-3B2 1-7 tumor cells express human EGFR and the conjugate has a human specific EGFR antibody to target the siRNA, resulting in tumor tissue specific accumulation of the conjugates. Receptor mediate uptake resulted in siRNA mediated knockdown of the EGFR gene.

Example 18: 2016-PK-257-WT

[0766] siRNA design and synthesis

[0767] R1442: N5-CTNNB 1-3 S

[0768] CTNNB 1 : A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human CTNNB 1. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 1248 for the human mRNA transcript for CTNNB 1

(UAAUGAGGACCUAUACUUAUU; SEQ ID NO: 2095). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to the siRNA passenger strand via phosphodiester-inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0769] ASC synthesis and characterization

[0770] The antibody conjugate was made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9. The tri-GalNAc-CTN B 1 conjugate was made as described in Example 9.

[0771] In vivo study design

[0772] Groups 1-3 (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, the GalNAc targeted control was doses by subcutaneous injection.

Treatment groups 1-3 received doses of 2.0 1.0 and 0.5 mg/kg (based on the weight of siRNA) and the GalNAc targeted control conjugate was doses at 2 mg/kg. All groups were administered a dose volume of 5.0 mL/kg. Table 30 illustrates the study design in more detail. 50 mg pieces of liver were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt).

Table 30

[0773] CTNNB 1 gene knockdown was determined 96 hours post administration. As illustrated in Fig. 60, the GalNac-conjugated siRNA was capable of gene specific knockdown after a single s.c injection, as has been well described by others in the field. The same siRNA conjugated to an ASGR antibody was also capable of CTNNB 1 gene specific downregulation and in a dose dependent manner.

[0774] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated liver delivery with an ASGR antibody conjugated to an siRNA designed to down regulate CTN B 1 mRNA. Mouse Liver cells express the asialoglycoprotein receptor (ASGR) and the conjugate has a mouse specific ASGR antibody to target the siRNA, resulting in siRNA mediated knockdown of the CTNNB 1 in the liver.

Example 19: 2016-PK-253-WT

[0775] siRNA design and synthesis

[0776] KRAS: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human KRAS. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mRNA transcript for KRAS

(UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphorothioate linker. The C6- NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0777] ASC synthesis and characterization

[0778] The antibody conjugate was made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9. The tri-GalNAc-CTNNB 1 conjugate was made as described in Example 9.

[0779] In vivo study design

[0780] Groups 1-3 (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, the GalNAc targeted control was doses by subcutaneous injection.

Treatment groups 1-3 received doses of 2.0 1.0 and 0.5 mg/kg (based on the weight of siRNA) and the GalNAc targeted control conjugate was doses at 2 mg/kg. All groups were administered a dose volume of 5.0 mL/kg. Table 31 illustrates the study design in more detail. 50 mg pieces of liver were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt).

Table 31

(n=l)

ASGR2-Ab(Lys)-KRAS-PEG5k

2 4 1 IV 5.0 1 96

(n=l)

ASGR2-Ab(Lys)-KRAS-PEG5k

3 4 0.5 IV 5.0 1 96

(n=l)

4 3GalNAc-KRAS Control 5 2 s.c. 5.0 1 96

5 PBS Control 5 - IV 5.0 1 96

Total # of Animals: ! 22 WT mice (CD-I)

[0781] KRAS gene knockdown was determined 96 hours post administration. As illustrated in Fig. 61, the GalNac-conjugated siRNA was capable of gene specific knockdown after a single s.c injection, as has been well described by others in the field. The same siRNA conjugated to an ASGR antibody was also capable of KRAS gene specific downregulation and in a dose dependent manner.

[0782] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated liver delivery with an ASGR antibody conjugated to an siRNA designed to down regulate KRAS mRNA. Mouse Liver cells express the asialoglycoprotein receptor (ASGR) and the conjugate has a mouse specific ASGR antibody to target the siRNA, resulting in siRNA mediated knockdown of the KRAS in the liver

Example 20: 2016-PK-129-WT-plasma

[0783] siRNA design and synthesis

[0784] KRAS: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human KRAS. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mRNA transcript for KRAS

(UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0785] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siR A passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0786] ASC synthesis and characterization

[0787] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9.

[0788] In vivo study design

[0789] Groups (n=3) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 32 illustrates the study design in more detail. Non-terminal blood samples were collected at 5, 30, and 180 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Plasma concentrations of antibody were determined using an ELISA assay.

Table 32

Dose Survival Terminal siRNA Dose # of

Group Test Article N ROA Volume Bleed Bleed

(mg/kg) Doses

(mL/kg) (min) (h)

1 3 0.5 IV 5.0 1 5 24

EGFR2-Ab(Lys)-

2 3 0.5 IV 5.0 1 30 96 KRAS-PEG5k (N=l)

3 3 0.5 IV 5.0 1 180 168

4 3 0.5 IV 5.0 1 5 24

PSMA-Ab(Lys)-EGFR-

5 3 0.5 IV 5.0 1 30 96

PEG5k (N=l)

6 3 0.5 IV 5.0 1 180 168

Total # of Animals: 18 WT mice CD-I

[0790] In this in vivo PK experiment the plasma clearance of two different conjugates was explored. As illustrated in Fig. 62, both the mAb-siRNA conjugates had comparable plasma PK when comparing the plasma levels of the siRNA (KRAS vs EGFR) or the antibody (EGFR2 vs PSMA).

[0791] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated that two different conjugates with different antibody targeting ligands and different siRNA cargos have comparable plasma PK properties. Example 21: 2016-PK-123-LNCaP

[0792] siRNA design and synthesis

[0793] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0794] ASC synthesis and characterization

[0795] All conjugates were made and purified as a DAR1 (n=l) or DAR2 (n=2) using ASC architecture- 1, as described in Example 9.

[0796] In vivo study design

[0797] Groups (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups were dosed as per the study design in Table 33. All groups (treatments and controls) were administered a dose volume of 5.71 mL/kg. Mice were sacrificed by C0 ₂ asphyxiation at 72 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Table 33

[0798] siRNA concentrations were determined 72 hours in the tumor and liver after a single i.v. injection, see Fig. 63A. As illustrated in Fig. 63A, the antibody conjugate with a drug to antibody ratio of 1 (n=l) was capable of delivering siRNA to the tumor in a dose dependent manner, at levels greater than measured in the liver and produced EGFR gene specific mRNA knockdown relative to the scrambled and PBS controls. This is in contrast to the antibody conjugate with a drug to antibody ratio of 2 (n=2), which achieved lower concentrations of siRNA in the tumor at an equivalent dose, liver and tumor concentrations which were of the same magnitude and a lower levels of EGFR knockdown. The unconjugated siRNA had poor tumor and liver accumulation and no measurable EGFR mRNA knockdown. Fig. 63B illustrates relative percentage of EGFR mRNA in LNCaP Tumor.

[0799] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated that the DARl conjugate is able to achieve greater siRNA tumor concentrations, relative to the DAR 2 and unconjugated siRNA. In addition, the DARl conjugate is able to achieve greater levels of siRNA mediate knockdown of EGFR, relative to the DAR 2 and unconjugated siRNA.

Example 22: 2016-PK-258-WT

[0800] siRNA design and synthesis

[0801] HPRT: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human HPRT. The sequence of the guide/antisense strand was

AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2102) and design to be complementary to the gene sequence starting a base position 425 for the human mRNA transcript for HPRT. Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester -inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0802] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). The same base, sugar and phosphate modifications that were used for the active EGFR siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0803] ASC synthesis and characterization

[0804] Conjugates in groups 1-3 and 7-9 were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. Conjugates in groups 4-6 were made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9.

[0805] In vivo study design

[0806] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, while the control group (n=4) of the same mice received one i.v. injection of PBS as a vehicle control. Table 34 illustrates the study design in more detail. 50 mg pieces of tissue, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem -loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 34 siRNA

Dose # of Harvest Dose

Group Test Article N ROA Volume Dose Time

(mg/kg

(mL/kg) s (h) )

Anti-B cell Ab(Cys)-HPRT-PEG5k 4

1 3 IV 5.0 1 96

(n=l)

Anti-B cell Ab(Cys)-HPRT-PEG5k 4

2 1 IV 5.0

(n=l) 1 96

Anti-B cell Ab(Cys)-HPRT-PEG5k 4

3 0.3 IV 5.0

(n=l) 1 96

Anti-B cell Ab(Lys)-HPRT-PEG5k 4

4 3 IV 5.0

(n=l) 1 96

Anti-B cell Ab(Lys)-HPRT-PEG5k 4

5 1 IV 5.0

(n=l) 1 96

Anti-B cell Ab(Lys)-HPRT-PEG5k 4

6 0.3 IV 5.0

(n=l) i 96

Anti-B cell Ab(Cys)-scramble-PEG5k 4

7 3 IV 5.0

(n=l) 1 96

Anti-B cell Ab(Cys)-scramble-PEG5k 4

8 1 IV 5.0 1 96

(n=l)

Anti-B cell Ab(Cys)-scramble-PEG5k 4

9 0.3 IV 5.0 1 96

(n=l)

10 PBS Control 4 - IV 5.0 1 96

WT

Total # of Animals: 77 mice

(CD-I)

[0807] As illustrated on Fig. 64A-Fig. 64C, after a single i.v. administration of an ASC dose dependent knockdown of HPRT in heart muscle, gastroc skeletal muscle and liver were measured. There was no measurable knockdown of HPRT in the lung tissue (Fig. 64D). In addition, dose dependent accumulation of the siRNA in all four tissue compartments was observed (Fig. 64E). There was no significant difference in the biological activity (KD and tissue concentration) between the lysine and cysteine conjugates.

[0808] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated that an anti-B cell antibody can be used to target an siRNA to heart muscle, gastroc skeletal muscle and liver and achieve gene specific

downregulation of the reporter gene HPRT. There was no measurable difference in the biological activity of the ASC constructs when a lysine or cysteine conjugation strategy was use to attach to the antibody.

Example 23: 2016-PK-254-WT

[0809] siRNA design and synthesis

[0810] HPRT: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human HPRT. The sequence of the guide/antisense strand was

AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2102) and design to be complementary to the gene sequence starting a base position 425 for the human mRNA transcript for HPRT. Base, sugar and phosphate modifications that are well described in the field of R Ai were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6- SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester - inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the

phosphodiester, see Example 9 for the chemical structure.

[0811] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). The same base, sugar and phosphate modifications that were used for the active EGFR siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0812] ASC synthesis and characterization

[0813] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0814] In vivo study design

[0815] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, while the control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 35 illustrates the study design in more detail. 50 mg pieces of tissue, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Table 35

[0816] As illustrated on Fig. 65A-Fig. 65C, after a single i.v. administration of an ASC containing an anti-B cell Fab targeting ligand, dose dependent knockdown of HPRT in heart muscle, gastroc skeletal muscle and liver were measured. There was no measurable knockdown of HPRT in the lung tissue (Fig. 65D). In addition, dose dependent accumulation of the siRNA in all four tissue compartments was observed (Fig. 65E).

[0817] As highlighted in Fig. 54, biological activity was demonstrated with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example it was demonstrated that an anti-B cell Fab is used to target an siRNA to heart muscle, gastroc skeletal muscle and liver and achieve gene specific downregulation of the reporter gene HPRT.

Example 24: 2016-PK-245-WT

[0818] siRNA design and synthesis

[0819] CTNNB 1 : A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human CTNNB 1. The sequence of the guide/antisense strand was

TUUCGAAUCAAUCCAACAGUU (SEQ ID NO: 2096), design to target the gene sequence starting a base position 1797 for the human mRNA transcript for CTNNB 1. Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphorothioate linker. The C6- NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0820] ASC synthesis and characterization

[0821] Conjugates in groups 3-4 were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9. Conjugates in groups 1 -2 were made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9.

[0822] In vivo study design

[0823] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, while the control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 36 illustrates the study design in more detail. 50 mg pieces of tissue, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem -loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 36

[0824] As illustrated on Fig. 66A and Fig. 66B, after a single i.v. administration of an ASC containing an anti-B cell antibody targeting ligand (anti-B cell-Ab), HPRT knockdown and dose dependent tissue siRNA accumulation in heart muscle were elicited. As illustrated on Fig. 66C and Fig. 66D, after a single i.v. administration of an ASC containing an anti-B cell antibody targeting ligand, HPRT knockdown and dose dependent tissue siRNA accumulation in gastroc skeletal muscle were elicited. There was no significant difference in the biological activity (KD and tissue concentration) between the lysine and cysteine conjugates.

[0825] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated that an anti-B cell antibody is used to target an siRNA to heart muscle and gastroc skeletal muscle and achieve gene specific downregulation of CTNNB 1 mRNA.

Example 25: 2016-PK-160-LNCaP

[0826] siRNA design and synthesis

[0827] AR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human AR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 2822 for the human mRNA transcript for AR (Guide strand sequence: GAGAGCUCCAUAGUGACACUU; SEQ ID NO: 2108). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0828] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0829] ASC synthesis and characterization

[0830] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9.

[0831] In vivo study design

[0832] Groups (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. The table below describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mR A knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 37

[0833] As illustrated in Fig. 67A, after a single i.v. administration of an ASC containing a PSMA antibody targeting ligand and siRNA designed to downregulate AR, AR knockdown in the LNCaP tumor tissue at all the doses tested relative to the scrambled control was elicited. As illustrated Fig. 67B, there was measurable accumulation of siRNA in the tumor tissue and at levels higher than those measured in the liver tissue.

[0834] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated delivery to an LNCaP prostate tumor with a PSMA antibody conjugated to an siRNA designed to down regulate AR mRNA. LNCaP cells express human PSMA on cell surface, the conjugate has a human specific PSMA antibody that binds to the antigen and allows internalization of the siRNA, resulting in siRNA mediated knockdown of AR in the tumor tissue. Example 26: In vitro uptake and knockdown in B cells

[0835] siRNA design and synthesis

[0836] HPRT: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human HPRT. The sequence of the guide/antisense strand was

AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2102) and design to be complementary to the gene sequence starting a base position 425 for the human mRNA transcript for HPRT. Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester -inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0837] ASC synthesis and characterization

[0838] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0839] In vitro study design

[0840] Mouse spleens were harvested and kept in PBS with 100 u/ml penicillin and streptomycin on ice. Spleens were smashed with clean glass slides, cut into small pieces, homogenized with 18G needles, and filtered (70 um nylon membrane). Dead cells were removed with the dead cell removal kit from Milteny biotec (Catalog# 130-090101) according to manufacturer instruction. To isolate mouse B cells, B cell isolation kit Milteny biotec (Catalog# 130-090-862) was used following manufacturer instruction. Briefly, live spleen cells were resuspended with 200μ1 of MACS buffer per mouse spleen. Non-B cells were depleted with biotin-conjugated monoclonal antibodies against CD43 (Ly48), CD4, and Ter-1 19, coupled with anti- biotin magnetic microbeads. From one mouse spleen, 30 million live B cells can be obtained. To activate isolated mouse B cells (2xl0 ⁶ /ml in 10%FBS RPMI-1640 with 100 u/ml penicillin and streptomycin), a cocktail of ΙΟμ^πύ LPS, 5μg/ml anti-IgM, ^g/ml anti-CD40, 0.05 μg/ml IL-4, and 0.05 μg/ml INFy was added. After four hours of activation, ASCs (1 pM to 10 nM) were added to 10 ⁶ cells per well in 24 (0.5 ml media) or 12 (1 ml media) well plates. After 48 hours of ASC treatments, cells were harvested and isolated RNAs were analyzed for mRNA knockdown.

Table 38

[0841] In this in vitro experiment in activated primary mouse B cells, the ability of an anti-B cell antibody and Fab ASCs to deliver an siRNA design to downregulate Hypoxanthine-guanine

phosphoribosyltransferase (HPRT) was measured. As illustrated in Fig. 68A, the Fab conjugate was able to downregulate HPRT relative to the vehicle or scramble controls. As illustrated in Fig. 68B, the antibody conjugate was able to downregulate HPRT relative to the antibody, vehicle, and scramble controls.

[0842] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated delivery to an activated mouse B cell with a mouse anti-B cell antibody or anti-B cell Fab conjugated to an siRNA designed to down regulate HPRT mRNA. Activated mouse B cells recognize and internalize the antibody-siRNA conjugate via surface receptors that recognize the anti-B cell antibody, resulting in siRNA mediated knockdown of HPRT.

Example 27: 2016-PK-249-WT

[0843] siRNA design and synthesis

[0844] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0845] KRAS: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mRNA transcript for KRAS

(UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0846] ASC synthesis and characterization

[0847] The conjugate for groups 1-2 were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9. The conjugate for groups 3-4 were made and purified as a DAR2 (n=2) using ASC architecture-4, as described in Example 9. The conjugate for groups 5-6 were made and purified as a DAR1 (n=l) using ASC architecture -5, as described in Example 9. The conjugate for groups 7-8 were made and purified as a DAR2 (n=2) using ASC architecture-5, as described in Example 9. The conjugate for groups 9-10 were made and purified as a DAR1 (n=l) using ASC architecture -6, as described in Example 9. The conjugate for groups 11-12 were made and purified as a DAR2 (n=2) using ASC architecture-6, as described in Example 9.

[0848] In vivo study design

[0849] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates (groups 1-12) or antibody alone (groups 13-14). Table 39 illustrates the study design. Non-terminal blood samples were collected at 0.25, and 3 hours post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24 and 72 hours post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Plasma concentrations of antibody were determined using an ELISA assay.

Table 39

¹⁴ EGFR-Ab 4 0.5 5.0 1 1 3 72

Total # of Animals: 56 WT mice CD-I

[0850] In this in vivo PK study it was demonstrated the utility of site specific conjugation. As illustrated in Fig. 69A, the DAR1 (n=l) test article (group 9) had a comparable siRNA plasma clearance profile to the two controls (groups 1 and 5), with approximately 10% of the siRNA remaining in the plasma after 168 hours. All the DAR2 (n=2) conjugates had much faster clearance of the siRNA from the plasma relative to the DAR1 conjugates. As illustrated in Fig. 69B, the DAR1 (n=l) test article (group 9) had a comparable EGFR-Ab plasma clearance profile to the two controls (groups 1 and 5). All the DAR2 (n=2) conjugates had much faster clearance of the antibody from the plasma relative to the DAR1 conjugates.

[0851] In the above Examples, it was demonstrated the use of lysine and cysteine conjugation strategies to attach the siRNA to the antibody. In this example, it was demonstrated the utility of a site specific conjugation strategy and demonstrate the conjugate has comparable PK properties to non-specific conjugation strategies.

Example 28: 2016-PK-180-HCC827

[0852] siRNA design and synthesis

[0853] EFGR: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0854] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure. [0855] ASC synthesis and characterization

[0856] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0857] In vivo study design

[0858] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 40 describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the

appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of plasma and tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma and tissue concentrations using the linear equations derived from the standard curves.

Table 40

¹⁶ PBS Control 5 1 iv 5.0 1 96 1

Total # of Animals: 80 nu/nu mice with HCC827 tumors

[0859] In this in vivo PK study, replacing the SMCC linker between the antibody and siRNA with an enzymatically cleavable linker and the introduction of a cleavable disulfide linker between the siRNA and PEG, or the combination of both were tested. As illustrated in Fig. 70A, all the linker combination were capable of EGFR mRNA knockdown in the HCC827 tumor cells relative to the scrambled control. As illustrated in Fig. 70B, all the linker combinations produced comparable siRNA tissue accumulation in the tumor and liver. As illustrated in Fig. 70C, all the conjugates were capable of maintaining high levels of siRNA in the plasma, with approximately 10 % remaining in the plasma after 168 hours.

[0860] In this AXBYC example, it was demonstrated that different linker combinations ("X" and/or 'Ύ") can be used to conjugate the siRNA to the antibody and PEG.

Example 29: 2016-PK-162-LNCaP

[0861] EFGR: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0862] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0863] ASC synthesis and characterization

[0864] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9. [0865] In vivo study design

[0866] Groups 1-7 (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siR A conjugate, while control group 8 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. The table below describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 41

[0867] In this in vivo PK study, a disulfide (SS), enzymatically cleavable (ECL) or SMCC linker was used between the antibody and siRNA. As illustrated in graph 1 on slide 42, the tumor tissue accumulation of the siRNA was reduced when the cleavable disulfide leaker was used instead of the ECL or SMCC linkers. As illustrated on graph 2 on slide 42, the ECL linker strategy produced EGFR mRNA knockdown in the LNCaP tumor cells relative to the scrambled control. However, the SS linker failed to produce EGFR mR A knockdown in the LNCaP tumor cells relative to the scrambled control. In addition to these linker experiments, the feasibility of -80 °C storage of the ASC was examined. The Formulation was snap-frozen in liquid nitrogen at 5 mg/ml antibody concentration, thawed at room temperature after 30 days storage at - 80 °C and diluted to the required dosing concentration prior to administration. As illustrated on graph 3 on slide 42, the construct stored at -80 °C , thawed prior to administration, retained its ability to produce EGFR mRNA knockdown in the LNCaP tumor cells relative to the scrambled control.

[0868] In this AXBYC example, it was demonstrated that an ECL linker ("X") can be used to conjugate the antibody to the siRNA and that an ASC can be stored at -80 °C for 1 month and thawed prior to administration.

Example 30: 2016-PK-181-HCC827

[0869] siRNA design and synthesis

[0870] EFGR: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard

phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6- SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate- inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0871] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0872] ASC synthesis and characterization

[0873] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0874] In vivo study design

[0875] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 42 describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mR A knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in the methods section. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into tissue concentrations using the linear equations derived from the standard curves.

Table 42

[0876] In this in vivo PK study, a disulfide or SMCC linker was used between the antibody and siRNA. As illustrated in Fig. 72A, the tumor tissue accumulation of the siRNA was reduced when the cleavable disulfide leaker was used instead of the more stable SMCC linker. As illustrated in Fig. 72B, both linker strategies were capable of producing EGFR mRNA knockdown in the HCC827 tumor cells relative to the scrambled control.

[0877] In this AXBYC example, it was demonstrated the use of a cleavable disulfide linker ("X") between the antibody and siRNA.

Example 31: 2016-PK-220-WT

[0878] siRNA design and synthesis

[0879] KRAS: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human KRAS. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mR A transcript for KRAS (Guide strand sequence: UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0880] ASC synthesis and characterization

[0881] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0882] In vivo study design

[0883] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 43 illustrates the study design in more detail. Non-terminal blood samples were collected at 5, 30, and 180 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 hours post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Plasma concentrations of antibody were determined using an ELISA assay.

Table 43

[0884] In this in vivo PK study, different disulfide linkers were explored, with varying degrees of steric hindrance, to understand how the rate of disulfide cleavage impacts ASC plasma PK. As illustrated in Fig. 73A, the clearance of the siRNA from the plasma was modulated by varying the degree of steric hindrance of the disulfide linker. Fig. 73B illustrates the clearance of the antibody zalutumumab from the plasma.

[0885] In this example, it was demonstrated biological activity with a range of different AXBYC conjugates in which a range of different disulfide linkers ("X") can be used to conjugate the siRNA to the antibody.

Example 32: 2016-PK-256-WT

[0886] siRNA design and synthesis

[0887] KRAS: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human KRAS. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mRNA transcript for KRAS (Guide strand sequence: UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0888] ASC synthesis and characterization

[0889] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0890] In vivo study design

[0891] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 44 illustrates the study design in more detail. Non-terminal blood samples were collected at 0.25, 3, and 24 hours post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 72, 96, or 168 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves. Plasma concentrations of antibody were determined using an ELISA assay.

Table 44

[0892] In this in vivo PK study a range of different linkers between the antibody and siRNA were tested to determine the effect on plasma clearance. As illustrated on the graph on slide 45, all the conjugates were capable of maintaining high levels of siRNA in the plasma, with greater than 10 % remaining in the plasma after 168 hours.

[0893] In this example, it was demonstrated biological activity with a range of different AXBYC conjugates in which a range of different linkers ("Y") can be used to conjugate the siRNA to the antibody while maintaining the improved plasma kinetics over those historically observed for unconjugated siRNA.

Example 33: 2016-PK-237-HCC827

[0894] siRNA design and synthesis

[0895] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR (Guide strad sequence: ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.

[0896] Two different passenger strands were made containing two conjugation handles (C6-NH ₂ and C6- SH) in two different orientations (S5'-EGFR-3'N and N5'-EGFR-3'S). In the N5'-EGFR-3'S passenger strand both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure. In the S5'-EGFR-3'N passenger strand both conjugation handles were connected to siRNA passenger strand via phosphodiester -inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0897] ASC synthesis and characterization

[0898] The conjugate for groups 1-3 was made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. The conjugate for groups 4-6 was made and purified as a DAR1 (n=l) using ASC architecture-2, as described in Example 9.

[0899] In vivo study design

[0900] Groups (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100- 300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 45 describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 72, 96, and 168 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue and plasma siRNA concentrations were determined using a stem -loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 45

[0901] In this in vivo PK study the biological outcome of changes in the orientation of the conjugation site of the antibody and PEG (5' or 3') onto the siRNA were evaluated. In addition, the biological outcome of using a lysine or cysteine to attach the linker to the antibody was evaluated As illustrated Fig. 75A, both orientations of siRNA produced comparable EGFR tumor knockdown. As illustrated Fig. 75B and Fig. 75C, both orientations produced comparable siRNA tissue accumulation in the tumor and liver. As illustrated in Fig. 75D, both orientations produce a comparable plasma clearance kinetics.

[0902] As highlighted in Fig. 54, it was demonstrated biological activity with the A-X-B-Y-C conjugate with a range of different antibodies and siRNA cargos that are capable of in vivo biological activity in a range of different tissue targets. In this example, it was demonstrated that the antibody can be conjugated onto the 5 ' and 3 ' ends of the passenger strand of the siRNA and while maintaining the biological activity of the EGFR siRNA and tissue distribution.

Example 34: 2016-PK-259-WT

[0903] siRNA design and synthesis

[0904] HPRT: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human HPRT. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 425 for the human mRNA transcript for HPRT (guide strand sequence: UUAAAAUCUACAGUCAUAGUU; SEQ ID NO: 2104). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. Two different passenger strands were made containing two conjugation handles (C6-NH ₂ and C6-SH) in two different orientations (S5'-HPRT-3'N and N5'-HPRT-3'S). Both conjugation handles were connected to siRNA passenger strand via phosphodiester- inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the

phosphodiester, see Example 9 for the chemical structure.

[0905] ASC synthesis and characterization

[0906] The conjugate for groups 1-3 was made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. The conjugate for groups 4-6 was made and purified as a DAR1 (n=l) using ASC architecture-2, as described in Example 9. The conjugate for groups 7-9 was made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9. The conjugate for groups 10-12 was made and purified as a DAR1 (n=l) using ASC architecture -3, as described in Example 9.

[0907] In vivo study design

[0908] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, while the control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 46 illustrates the study design in more detail. 50 mg pieces of tissue, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem -loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem-loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 46

[0909] In the in vivo PK study the biological outcome of changes in the orientation of the conjugation site of the antibody and PEG (5' or 3') onto the siRNA were evaluated. In addition, the biological outcome of using a lysine or cysteine to attach the linker to the antibody was evaluated. As illustrated in Fig. 76A-Fig. 76D, all the combinations of making the antibody conjugates produced comparable HPRT knockdown in the four tissue compartments measured. As illustrated in Fig. 77A-Fig. 77D, all the combinations of making the antibody conjugates produced comparable siRNA tissue accumulation in the different compartments measured.

[0910] In this example, it was demonstrated that a variety of different conjugation strategies to the siRNA and antibody can be used in the A-X-B-Y-C format while maintaining the biological activity of the HPRT siRNA and tissue distribution.

Example 35: 2016-PK-267-WT

[0911] siRNA design and synthesis

[0912] CTNNB 1 : A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human CTNNB 1. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 1797 for the human mRNA transcript for CTNNB 1 (guide strand sequence: UUUCGAAUCAAUCCAACAGUU; SEQ ID NO: 2098). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA.

[0913] Two different passenger strands were made containing two conjugation handles (C6-NH ₂ and C6- SH) in two different orientations (S5'-CTNNB 1-3'N and N5'-CTNNB1-3'S). Both conjugation handles were connected to siRNA passenger strand via phosphodiester-inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0914] ASC synthesis and characterization

[0915] The conjugate for groups 1-3 was made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. The conjugate for groups 4-6 was made and purified as a DAR1 (n=l) using ASC architecture-3, as described in Example 9. The conjugate for groups 7-9 was made and purified as a DAR1 (n=l) using ASC architecture-2, as described in Example 9. The conjugate for groups 10-12 was made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9.

[0916] In vivo study design

[0917] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates, while the control group (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 47 illustrates the study design in more detail. 50 mg pieces of tissue, were collected and snap-frozen in liquid nitrogen. mR A knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt).

Table 47

[0918] In this in vivo PK study, the biological outcome of changes in the orientation of the conjugation site of the antibody and PEG (5' or 3') onto the siRNA and the biological outcome of using a lysine or cysteine to attach the linker to the antibody were evaluated. As illustrated in Fig. 78A-Fig. 78D, all the combinations of making the antibody conjugates produced comparable CTNNB l knockdown in the four tissue compartments measured. [0919] In this example, it was demonstrated that a variety of different conjugation strategies to the siRNA and antibody can be used in the A-X-B-Y-C format while maintaining the biological activity of the

CTN B 1 siRNA.

Example 36: 2016-PK-188-PK

[0920] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0921] ASC synthesis and characterization

[0922] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9.

[0923] In vivo study design

[0924] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 48 illustrates the study design in more detail. Non-terminal blood samples were collected at 5, 30, and 180 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 48

4 4 IV 5.0 1 5 24

5 EGFR-Ab(Cys)-ECL-EGFR-PEG5k (n=l) 4 IV 5.0 1 30 96

6 4 IV 5.0 1 180 168

7 4 IV 5.0 1 5 24

8 EGFR-Ab(Cys)-EGFR-SS-PEG5k (n=l) 4 IV 5.0 1 30 96

9 4 IV 5.0 1 180 168

10 4 IV 5.0 1 5 24

EGFR-Ab(Cys)-ECL-EGFR-SS-PEG5k

1 1 4 IV 5.0 1 30 96

(n=l)

12 4 IV 5.0 1 180 168

Total # of Animals: j 48 WT mice CD-I

[0925] As illustrated in Fig. 79, all the ASC with the different cleavable linker configurations achieved equivalent plasma PK profiles, with approximately 10% of the siRNA remaining 168 hours after administration.

[0926] In this example, it was demonstrated biological activity with a range of A-X-B-Y-C conjugates in which a variety of different linker strategies (component X and Y) were used to conjugate the PEG and antibody to the siRNA passenger strand.

Example 37: 2016-PK-201-LNCaP

[0927] siRNA design and synthesis

[0928] EFGR: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0929] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure. [0930] ASC synthesis and characterization

[0931] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0932] In vivo study design

[0933] Groups 1-7 (n=5) of female SCID SHO mice bearing subcutaneous flank LNCaP tumors 100-350 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group 8 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Table 49 describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem -loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 49

[0934] As illustrated in Fig. 80A, a variety of different linkers were used between the siRNA and PEG, after i.v administration of a single dose of siRNA measurable tumor tissue EGFR downregulation was achieved relative to the negative control siRNA sequence or PBS controls. In addition, as illustrated in Fig. 80B, the different linker configurations resulted in tumor siRNA accumulation at higher levels than the other tissue samples measured (liver, spleen, lung and kidney).

[0935] In this example, it was demonstrated biological activity with a range of A-X-B-Y-C conjugates in which a variety of different linkers strategies (component Y) were used to conjugate the PEG to the siRNA passenger strand.

Example 38: 2016-PK-198-HCC827

[0936] siRNA design and synthesis

[0937] EFGR: A 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0938] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3 ' dinucleotide overhangs was used. The sequence (5 ' to 3 ') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 21 16). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5 ' end and a C6-SH at the 3 ' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0939] ASC synthesis and characterization

[0940] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9.

[0941] In vivo study design

[0942] Groups 1-15 (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conj ugate, while control group 16 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control.

Table 50 describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap-frozen in liquid nitrogen. mR A knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total R A was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 50

PEG5k (n=l)

16 PBS Control 5 - IV 5.0 1 96

Total # of Animals: 80 nu/nu mice with HCC827 tumors

[0943] As illustrated in Fig. 81A, all the ASC with the different configurations of linear PEG length achieved dose dependent EGFR mR A knockdown in the HCC827 tumor cells, relative to the negative control siRNA sequence (scramble) and PBS controls. As illustrated in Fig. 8 IB, all the ASC with the different configurations in linear PEG length achieved equivalent dose dependent siRNA tumor tissue accumulation. In addition to low liver, lung, kidney and spleen accumulation relative to tumor.

[0944] In this example, it was demonstrated biological activity with a range of A-X-B-Y-C conjugates in which a variety of different PEG (component C) lengths were used.

Example 39: 2016-PK-194-WT

[0945] siRNA design and synthesis

[0946] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate-inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0947] ASC synthesis and characterization

[0948] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0949] In vivo study design

[0950] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 51 illustrates the study design in more detail. Non-terminal blood samples were collected at 5, 30, and 180 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence -specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 51

Dose Survival Terminal siRNA Dose # of

Group Test Article N ROA Volume Bleed Bleed

(mg/kg) Doses

(mL/kg) (min) (h)

1 4 0.5 IV 5.0 1 5 24

EGFR-Ab(Cys)-EGFR-

2 4 0.5 IV 5.0 1 30 96

PEG2k (n=l)

3 4 0.5 IV 5.0 1 180 168

4 4 0.5 IV 5.0 1 5 24

EGFR-Ab(Cys)-EGFR -

5 4 0.5 IV 5.0 1 30 96 dPEG ₄₈ (n=l)

6 4 0.5 IV 5.0 1 180 168

7 4 0.5 IV 5.0 1 5 24

EGFR-Ab(Cys)-EGFR -

8 4 0.5 IV 5.0 1 30 96 dPEG ₂₄ (n=l)

9 4 0.5 IV 5.0 1 180 168

10 4 0.5 IV 5.0 1 5 24

EGFR-Ab(Cys)-EGFR -

11 4 0.5 IV 5.0 1 30 96 dPEG ₁₂ (n=l)

12 4 0.5 IV 5.0 1 180 168

Total # of Animals: 48 WT mice CD-I

[0951] As illustrated on slide 54, all the ASC with the different linear PEG lengths achieved equivalent plasma PK profiles, with approximately 10% of the siRNA remaining 168 hours after administration.

[0952] In this example, it was demonstrated equivalent plasma PK properties with a range of A-X-B-Y-C conjugates in which a variety of different PEG (component C) lengths were used.

Example 40: 2016-PK-195-WT

[0953] siRNA design and synthesis

[0954] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure. [0955] ASC synthesis and characterization

[0956] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0957] In vivo study design

[0958] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siR A conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 52 illustrates the study design in more detail. Non-terminal blood samples were collected at 5, 30, and 180 minutes post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 96, or 168 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. Quantitation of plasma siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 52

[0959] As illustrated in Fig. 83, all the ASC with the different PEG configurations (length and branching) achieved equivalent plasma PK profiles, with approximately 10% of the siRNA remaining 168 hours after administration.

[0960] In this example, it was demonstrated equivalent plasma PK properties with a range of A-X-B-Y-C conjugates in which a variety of different PEG (component C) lengths and branching were used. Example 41: 2016-PK-236-HCC827

[0961] siRNA design and synthesis

[0962] EFGR: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human EGFR. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 333 for the human mRNA transcript for EGFR

(ACUCGUGCCUUGGCAAACUUU; SEQ ID NO: 2082). Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphorothioate -inverted abasic-phosphorothioate linker, see Example 9 for the chemical structure.

[0963] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). Base, sugar and phosphate modifications were used to reduce immunogenicity and were comparable to those used in the active siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0964] ASC synthesis and characterization

[0965] All conjugates were made and purified as a DAR1 (n=l) using ASC architecture -4, as described in Example 9.

[0966] In vivo study design

[0967] Groups 1-12 (n=5) of female NCr nu/nu mice bearing subcutaneously (SC) flank HCC827 tumors 100-300 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control group 13 (n=5) of the same mice received one i.v. injection of PBS as a vehicle control.

Table 53 describes the study design. Mice were sacrificed by C0 ₂ asphyxiation at 96 hours post-dose. 50 mg pieces of tumor and liver, were collected and snap -frozen in liquid nitrogen. mRNA knockdown in target tissue was determined using a comparative qPCR assay as described in Example 2. Total RNA was extracted from the tissue, reverse transcribed and mRNA levels were quantified using TaqMan qPCR, using the appropriately designed primers and probes. PPIB (housekeeping gene) was used as an internal RNA loading control, results were calculated by the comparative Ct method, where the difference between the target gene Ct value and the PPIB Ct value (ACt) is calculated and then further normalized relative to the PBS control group by taking a second difference (AACt). Quantitation of tissue siRNA concentrations were determined using a stem-loop qPCR assay as described in Example 2. The antisense strand of the siRNA was reverse transcribed using a TaqMan MicroRNA reverse transcription kit using a sequence-specific stem- loop RT primer. The cDNA from the RT step was then utilized for real-time PCR and Ct values were transformed into plasma or tissue concentrations using the linear equations derived from the standard curves.

Table 53

[0968] As illustrated in Fig. 84, all the ASC with the different configurations of PEG (length and branching) achieved equivalent EGFR mRNA knockdown in the HCC827 tumor cells to the construct with the linear PEG5K at the 1 mg/kg dose. Those constructs tested in a dose response format, showed dose dependent knockdown of EGFR mRNA. As illustrated in Fig. 85, all the ASC with the different variations in linear PEG length and PEG branching achieved equivalent siRNA tumor tissue accumulation to the construct with the linear PEG5K at the 1 mg/kg dose. In addition to low liver accumulation relative to tumor, those constructs tested in a dose response format, showed dose dependent tumor tissue accumulation of siRNA.

[0969] In this example, it was demonstrated biological activity with a range of A-X-B-Y-C conjugates in which a variety of different PEG (component C) lengths and branching were used.

Example 42: In vitro knockdown with ASCs with PEG polymers

[0970] siRNA design and synthesis

[0971] HPRT: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human HPRT. The sequence of the guide/antisense strand was

AUAAAAUCUACAGUCAUAGUU (SEQ ID NO: 2082) and design to be complementary to the gene sequence starting a base position 425 for the human mRNA transcript for HPRT. Base, sugar and phosphate modifications were used to optimize the potency of the duplex and reduce immunogenicity. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via phosphodiester -inverted abasic-phosphorothioate linker. The C6-NH ₂ and C6-SH were connected through the phosphodiester, see Example 9 for the chemical structure.

[0972] Negative control siRNA sequence (scramble): A published (Burke et al. (2014) Pharm. Res., 31(12):3445-60) 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was used. The sequence (5 ' to 3') of the guide/antisense strand was UAUCGACGUGUCCAGCUAGUU (SEQ ID NO: 2116). The same base, sugar and phosphate modifications that were used for the active EGFR siRNA duplex were used in the negative control siRNA. All siRNA single strands were fully assembled on solid phase using standard phospharamidite chemistry and purified over HPLC. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6- NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0973] ASC synthesis and characterization

[0974] Conjugates in groups 1-3 made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9. Conjugates in groups 4-6 were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9.

[0975] In vitro study design

[0976] Mouse spleens were harvested and kept in PBS with 100 u/ml penicillin and streptomycin on ice. Spleens were smashed with clean glass slides, cut into small pieces, homogenized with 18G needles, and filtered (70 um nylon membrane). Dead cells were removed with the dead cell removal kit from Milteny biotec (Catalog# 130-090101) according to manufacturer instruction. To isolate mouse B cells, B cell isolation kit Milteny biotec (Catalog# 130-090-862) was used following manufacturer instruction. Briefly, live spleen cells were resuspended with 200μ1 of MACS buffer per mouse spleen. Non-B cells were depleted with biotin-conjugated monoclonal antibodies against CD43 (Ly48), CD4, and Ter-119, coupled with anti- biotin magnetic microbeads. From one mouse spleen, 30 million live B cells can be obtained. To activate isolated mouse B cells (2xl0 ⁶ /ml in 10%FBS RPMI-1640 with 100 u/ml penicillin and streptomycin), a cocktail of ^g/ml LPS, 5μg/ml anti-IgM, ^g/ml anti-CD40, 0.05 μg/ml IL-4, and 0.05 μg/ml INFy was added. After four hours of activation, ASCs (1 pM to 10 nM) were added to 10 ⁶ cells per well in 24 (0.5 ml media) or 12 (1 ml media) well plates. After 48 hours of ASC treatments, cells were harvested and isolated RNAs were analyzed for mRNA knockdown. See Table 54 for the study design.

Table 54 2 Anti-B cell Ab(Lys)-S3'-HPRT-5'N -pHPMA5K

3 Anti-B cell Ab(Lys)-S3'-HPRT-5'N -pHPMAlOK

4 Anti-B cell Ab(Cys)-N5'-HPRT-3'S-pMAA10K

5 Anti-B cell Ab(Cys)-N5'-HPRT-3'S -PEG5K

6 Anti-B cell Ab(Cys)-N5'-scramble-3'S -PEG5K

[0977] In this in vitro experiment in activated primary mouse B cells, the ability of an anti-B cell antibody ASCs to deliver an siRNA design to downregulate Hypoxanthine-guanine

phosphoribosyltransferase (HPRT) with a range of alternative PEG polymers were measured. As illustrated in Fig. 86, the range of ASC with alternative PEGs were able to downregulate HPRT relative to the scramble control.

[0978] In this example, the biological activity was demonstrated with a range of A-X-B-Y-C conjugates in which a variety of polymer alternatives to PEG (component C) were used.

Example 43: PK-236-WT

[0979] siRNA design and synthesis

[0980] KRAS: A 21mer duplex with 19 bases of complementarity and 3' dinucleotide overhangs was designed against human KRAS. The sequence of the guide/antisense strand was complementary to the gene sequence starting a base position 237 for the human mRNA transcript for KRAS (Guide strand sequence: UGAAUUAGCUGUAUCGUCAUU; SEQ ID NO: 2088). Base, sugar and phosphate modifications that are well described in the field of RNAi were used to optimize the potency of the duplex and reduce

immunogenicity. All siRNA single strands were fully assembled on solid phase using standard

phospharamidite chemistry and purified over HPLC. The base at position 11 on the passenger strand had a Cy5 fluorescent label attached, as described in Example 9. Purified single strands were duplexed to get the double stranded siRNA. The passenger strand contained two conjugation handles, a C6-NH ₂ at the 5' end and a C6-SH at the 3' end. Both conjugation handles were connected to siRNA passenger strand via a phosphodiester -inverted abasic-phosphodiester linker, see Example 9 for the chemical structure.

[0981] ASC synthesis and characterization

[0982] Conjugates in groups 1-3 were made and purified as a DAR1 (n=l) using ASC architecture-4, as described in Example 9. Conjugates in groups 4-6 were made and purified as a DAR1 (n=l) using ASC architecture-4, but there was no PEG on the 3' end of the passenger strand. Prior to conjugateion, the 3 'thiol was end-capped using N-ethylmaleimide. Conjugates in groups 7-9 were made and purified as a DAR1 (n=l) using ASC architecture- 1, as described in Example 9. Conjugates in groups 10-12 made and purified as a DAR1 (n=l) using ASC architecture- 1, but there was no PEG on the 5' end of the passenger strand.

[0983] In vivo study design

[0984] Groups (n=4) of wild-type female CD-I mice were treated with one intravenous (i.v.) tail vein injections of siRNA conjugates. Treatment groups received 0.5 mg/kg (based on the weight of siRNA) and all groups were administered a dose volume of 5.0 mL/kg. Table 55 illustrates the study design in more detail. Non-terminal blood samples were collected at 0.25, 1, and 4 hours post-dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 24, 48, or 72 h post-dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis.

[0985] Plasma samples (K2 EDTA) were processed within 4 hours after harvesting. Plasma samples were diluted with matching mouse plasma (Bioreclamation) (2-400 fold) and the concentration of CY5-siRNA in these plasma samples quantified spectroscopically using a TECAN Infinite M200 Pro (Excitation 635 nm; Emission 675 nm). To release macromolecular interactions that might quench the CY5 fluorescence, all samples were diluted 2-fold into water containing 0.01% Tween 20 and 100 ug/ml heparin prior to quantification. To determine the amount of intact ASCs in these plasma samples, plasma samples were diluted with mouse plasma to 2-50 nM CY5-siRNA and incubated with Protein G Dynabeads

(Thermofisher) loaded with 150 nM of a purified EGFR-Fc protein (Sino Biological). These binding reactions were incubated at RT for 1 hour. Beads were washed twice with PBS containing 0.01% Tween 20 and 0.05% BSA before ASCs bound to EGFR were eluted by incubation in 0.1 M citric acid (pH 2.7). The amount of CY5-siRNA contained in the input, unbound fraction, washes and bead eluate was quantified by fluorescence as stated above.

Table 55

[0986] In this in vivo PK study, the in vivo plasma stability of two AXBYC conjugates (cysteine and lysine conjugation to the EGFR-Ab) relative to two AXB conjugates were compared. As illustrated in Fig. 87, the concentration of the siRNA was determined using two methods. The fluorescence of the plasma was measured directly and the siRNA concentration determined using a standard curve. Or a magnetic bead decorated with EGFR was used to bind the antibody conjugates and then the fluorescence of the sample was measured and the siRNA concentration determined using a standard curve. All data were plotted as a percentage of the injected dose. In both examples of the AXBYC conjugates (cysteine and lysine conjugation to the EGFR-Ab) improved plasma PK were observed relative to the corresponding AXB conjugate.

[0987] In this example, in vivo plasma PK for the Cys and Lys AXBYC conjugates compared to the matching control AXB conjugates was demonstrate.

Example 44: In vivo Pharmacodynamics Study of a Cholesterol-KRAS Conjugate (PD-058)

[0988] Groups (n=5) of female NCr nu/nu mice bearing intrahepatic Hep 3B tumors one week after inoculation were treated with three intravenous (i.v.) tail vein injections (separated by 48 h) of cholesterol - siRNA conjugate, while control groups (n=5) of the same mice received three i .v. injections of PBS as a vehicle control on the same dosing schedule. Treatment groups that received chol-KRAS were dosed at 10, 4, or 2 mg/kg. All groups (treatments and controls) were administered a dose volume of 6.25 mL/kg. Table 56 describes the study design in more detail and gives a cross-reference to the conjugate synthesis and characterization. Mice were sacrificed by C0 ₂ asphyxiation at 72 h post-final dose. 50 mg pieces of tumor- bearing liver were collected and snap-frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2-7.

Table 56. Study design for a Cholesterol-KRAS Conjugate (PD-058) with a cross-reference to the synthesis and characterization of the conjugates tested.

[0989] The chol-KRAS conjugate was assessed for mRNA knockdown in a 3 -dose study with a dose response. As illustrated in Fig 35, within the mouse liver tissue there was a clear dose-response for mouse KRAS mRNA knockdown. The lowest dose of 2 mg/kg resulted in 45% knockdown of mouse KRAS, while the highest dose of 10 mg/kg resulted in 65% knockdown of mouse KRAS in this 3 -dose format. However, there were not enough human tumor cells in the mouse liver at the time of harvest to detect a signal from human KRAS (potentially due to model development issues, it appeared that not enough human cells were inoculated to produce fast-growing tumors). As such, it was not possible to measure the knockdown in tumor.

Example 45: In vivo Pharmacokinetics Study of a Cholesterol-siRNA Conjugate (PK-063)

[0990] Groups (n=3) of wild-type female CD-I mice were treated with either one or two intravenous (i.v.) tail vein injections of chol-siR A conjugate. Treatment groups received chol-KRAS at 10 mg/kg (based on the weight of siRNA) and the 2-dose groups received the second dose 48 h after the first dose. All groups were administered a dose volume of 6.25 mL/kg. Table 57 illustrates the study design in more detail and gives a cross-reference to the conjugate synthesis and characterization. Non-terminal blood samples were collected at 2, 15, 60 or 120 minutes post-final dose via puncture of the retro-orbital plexus and centrifuged to generate plasma for PK analysis. Mice were sacrificed by C0 ₂ asphyxiation at 4, 24, 96, or 144 h post-final dose. Terminal blood samples were collected via cardiac puncture and processed to generate plasma for PK analysis. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap- firozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2-7.

Table 57. Study design for a Cholesterol-siRNA Conjugate (PK-063) with a cross-reference to the synthesis and characterization of the conjugates tested.

[0991] The pharmacokinetic behavior of chol-siRNA was assessed in a single-dose format compared to a 2-dose format. As illustrated from Fig 36, the plasma PK profiles for the first dose and a second dose following 48 h later are nearly identical. The mechanism for clearance from plasma has not saturated from the first dose and the second dose behaves similarly. The tissue PK for 3 major tissues (the liver, kidneys, and lungs) was similarly assessed. As illustrated from Fig 37, chol-KRAS was delivered to liver in the highest concentrations, with kidneys and lungs having approximately 10-fold lower siRNA concentrations compared to liver. For all three tissues, the siRNA concentrations following the second doses were higher than the siRNA concentrations following the first dose, demonstrating that there is accumulation of siRNA in tissues when doses of chol-siRNA are spaced by 48 h. [0992] In vivo study a Cholesterol-siRNA Conjugate (PK-067). Groups (n=3) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=4) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups that received cholesterol -siRNA conjugates were dosed at 5 mg/kg (based on the weight of siRNA). Some treatment groups also received cholesterol-peptide conjugates at specified molar peptide: siRNA ratios, where all chol -siRNA and chol-peptide conjugates were mixed together in solution and co-injected. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Table 58 shows the study design in more detail and gives a cross-reference to the conjugate synthesis and characterization. Mice were sacrificed by C0 ₂ asphyxiation at 24, 72, or 144 h post-dose. 50 mg pieces of tumor, liver, kidneys, and lungs were collected and snap-frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2- 7.

Table 58. Study design for a Cholesterol-siRNA Conjugate (PK-067) with a cross-reference to the conjugate synthesis and characterization

[0993] Endosomolytic moieties (EEPs) such as INF7 and melittin were conjugated to cholesterol, mixed with chol-siR A, and then co-injected into mice to demonstrate an increase in siRNA potency due to the improved endosomal escape. First, the effect of adding the EEPs on the siRNA concentration in various tissues was assessed. As illustrated in Fig 38A, the addition of chol-INF7 at any of the molar ratios of EEP:siRNA did not affect the siRNA tumor PK. However, as illustrated in Fig 38B, the addition of chol- melittin at a 1 : 1 ratio did not affect the tumor PK but the addition of chol-melittin at a 3: 1 EEP: siRNA ratio decreased the amount of siRNA in tumor. As illustrated in Fig 39, neither chol-INF7 nor chol-melittin had much of an impact on the liver PK. Similarly, as illustrated in Fig 40 and 41, the chol-INF7 and chol- melittin also did not have much of an impact on the PK profile in kidneys and lungs. Finally, the effect of the chol-EEP conjugates on mRNA KD was assessed and, as shown in Fig 42, the baseline level of knockdown for chol-KRAS alone was approximately 50%. The addition of 1 : 1 chol-melittin or 3: 1 chol- INF7 improves the knockdown at each time point, due to improved endosomal escape.

[0994] In vivo study a Cholesterol-siRNA Conjugate (PK-076). Groups (n=5) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with three intravenous (i.v.) tail vein injections of siRNA conjugate separated by 48 h, while control groups (n=5) of the same mice received three i.v. injections of PBS as a vehicle control on the same dosing schedule. Treatment groups that received cholesterol-siRNA conjugates were dosed at 5 mg/kg (based on the weight of siRNA). Some treatment groups also received cholesterol-peptide conjugates at specified molar peptide:siRNA ratios, where all chol-siRNA and chol -peptide conjugates were mixed together in solution and co-injected. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Table 59 describes the study design in more detail and gives a cross-reference to the conjugate synthesis and characterization. Mice were sacrificed by C0 ₂ asphyxiation at 24 or 96 h post-dose. 50 mg pieces of tumor, liver, kidneys, and lungs were collected and snap-frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2-7.

Table 59. Study design for a Cholesterol-siRNA Conjugate (PK-076) with a cross-reference to the synthesis and characterization of the conjugates tested.

[0995] The activity seen in the single-dose study with chol-siRNA and chol-EEP was followed up with a three dose study. The 3: 1 ratio of EEP:siRNA was selected for INF7, and the 1 : 1 ratio was selected for melittin. As illustrated in Fig. 43 and Fig. 44, the addition of either chol-EEP to the chol-siRNA does not seem to greatly affect the tissue PK following three doses. As for the knockdown, Fig 45 shows that addition of chol-melittin clearly improves tumor knockdown 24 h post-dose. It also shows that chol-melittin improves tumor knockdown at 96 h post-dose.

[0996] In vivo study a Cholesterol-siRNA Conjugate (PK-079). Groups (n=5) of female NCr nu/nu mice bearing subcutaneous flank H358 tumors 100-150 mm ³ in volume were treated with one intravenous (i.v.) tail vein injection of siRNA conjugate, while control groups (n=5) of the same mice received one i.v. injection of PBS as a vehicle control. Treatment groups that received EGFR antibody-siRNA-PEG conjugates were dosed at 0.5 mg/kg (based on the weight of siRNA) and groups that also received EGFR antibody-melittin had the dose of EGFR-Ab matched between EGFR antibody-siRNA and EGFR antibody- melittin. All groups (treatments and controls) were administered a dose volume of 5 mL/kg. Table 60 describes the study design in more detail and gives a cross-reference to the conjugate synthesis and characterization. Mice were sacrificed by C0 ₂ asphyxiation at 96 h post-dose. 50 mg pieces of tumor, liver, kidney, and lung were collected and snap-frozen in liquid nitrogen. mRNA knockdown analysis and siRNA quantitation were performed as described in Examples 2-7.

Table 60. Study design for a Cholesterol-siRNA Conjugate (PK-079) with a cross-reference to the synthesis and characterization of the conjugates tested.

[0997] The PK/PD relationship for EGFR antibody-siRNA conjugates to deliver siRNA to tumor and produce mRNA knockdown in tumor was evaluated for reproducibility. As illustrated in Fig 46, once again a single i.v. dose of 0.5 mg/kg of EGFR antibody-siRNA conjugate was able to deliver approximate 100 nM concentrations of siRNA into tumor with both configurations of the conjugate. The addition of EGFR antibody-melittin did not appear to impact the tissue PK. Out of the four tissues analyzed, tumor had the highest concentration and liver the second highest, with kidneys and lungs showing low uptake of siRNA. As illustrated in Fig 47, the strong siRNA delivery to tumor once again translated into approximately 50% knockdown of EGFR or KRAS in the tumors. Free EGFR-Ab, run as a control group, showed no mRNA knockdown as did the PBS control.

[0998] In vivo study a Cholesterol-siRNA Conjugate (PD-077). Groups (n=l 1) of female NCr nu/nu mice bearing intrahepatic Hep3B tumors one week after inoculation were treated with nine intravenous (i.v.) or subcutaneous (s.c.) injections (ΤΓ\¥) of cholesterol -siRNA conjugate, while control groups (n=l 1) of the same mice received nine i.v. tail vein injections of PBS as a vehicle control (also dosed ΤΓ\¥). Treatment groups that received chol-CTNNB l were dosed at 5 mg/kg. All groups (treatments and controls) were administered a dose volume of 6.25 mL/kg. Table 61 describes the study design in more detail and gives a cross-reference to the conjugate synthesis and characterization. Non -terminal blood samples were collected once per week via puncture of the retro-orbital plexus and processed to generate serum for alpha-Fetoprotein (AFP) measurement. Mice were sacrificed by C0 ₂ asphyxiation at 24 h post-final dose. 50 mg pieces of tumor-bearing liver were collected and snap-frozen in liquid nitrogen. mRNA knockdown analysis was performed as described above. AFP was quantified using the Human alpha-Fetoprotein DuoSet ELISA kit (R&D Systems) according to the manufacturer's instructions.

Table 61. Study design for a Cholesterol-siRNA Conjugate (PK-077) with a cross-reference to the synthesis and characterization of the conjugates tested.

[0999] Since earlier studies demonstrated that it was possible for a single dose of chol -siRNA to generate knockdown in normal liver, it was hypothesized that knockdown could be achieved in orthotopic liver tumors as well. Mice were inoculated with intrahepatic Hep3B tumors that were allowed to grow for one week post-inoculation, and then these mice were administered 5 mg/kg doses of chol-CTNNB l (either i.v. or s.c.) three times a week for three weeks (9 total doses). As illustrated in Fig 48, the chol-CTNNB 1 dosed s.c. was able to produce >50% mRNA knockdown at the harvest time point of 24 h post-final dose. In contrast, the chol-CTNNB l siRNA that was dosed i.v. does not seem to show any mRNA knockdown at this time point (although some mice did not have any measurable human CTNNB 1 signal, it was hard to determine if the loss of signal was related to knockdown or low tumor burden). The human Hep3B cells are also known to secrete human alpha-Fetoprotein (AFP), and it is known that the amount of secreted AFP correlates with the number of Hep3B cells. Thus, the concentration of AFP in serum is taken as a marker of tumor load in the mouse, and the increase in AFP over time correlates with tumor growth. As illustrated in Fig 49, the chol-CTN B l dosed s.c. markedly reduced the AFP levels in those mice, which provides evidence that the CTN B 1 mR A knockdown led to the inhibition of tumor growth.

Example 46. Liver PK/PD Study

[1000] Female wild-type CD-I mice will be dosed with chol-siR A-EEP conjugates at 5 mg/kg (based on the weight of siR A). In these studies the siR A used will be against the mouse Factor VII (FVII) such that FVII knockdown can be determined by measuring the FVII protein levels in plasma. Multiple EEPs (endosomolytic moieties) will be used to determine the peptide sequence that demonstrates optimal endosomal escape, resulting in the best knockdown of the FVII target gene relative to the control.

Example 47. Tumor PK/PD Study

[1001] Female NCr nu/nu mice bearing subcutaneous flank H358 tumors will be dosed with EGFR antibody-siRNA-EEP conjugates at 0.5 mg/kg (based on siRNA). Multiple EEPs (endosomolytic moieties) will be used to determine the peptide sequence that demonstrates optimal endosomal escape, resulting in the best knockdown of the target gene relative to the control.

Example 48. Formulation of an ABC conjugate with Nanoparticles

[1002] An exemplary ABC conjugate is packaged into self-assembled nanoparticles using cyclodextrin polymers (10 kDa) and an excess of non-conjugated siRNAs (ED 40-60 nm, PDI 0.1-0.2). In these particles, the exemplary ABC conjugate maintains its ability to interact with the antibody target. The stability and target binding competency of the particles in circulation in vivo is regulated through modifications of the packaging siRNAs.

[1003] Nanoparticle Formation

[1004] Nanoparticles are prepared at a final siRNA concentration of 1.6 mg/mL. siRNA containing CY5 - siRNA at a ratio of 1 :20 is first diluted to 2x final concentration in water. Cyclodextrin polymer (CDP) is diluted to 2x final concentration necessary to achieve a nitrogen to phosphorus ratio (N:P) of 3: 1 in 10 mM phosphate buffer at neutral pH. CDP is added quickly to siRNA and is further mixed by pipetting. Particles are incubated for at least 15 minutes before dosing or analysis.

[1005] In vitro EGFR binding

[1006] Nanoparticles containing various amount of the exemplary ABC conjugate are diluted into Fetal calf serum to a final concentration of 10 nM and are incubated for lh at RT with Protein G Dynabeads (Thermofisher) loaded with 150 nM of a purified EGFR-Fc protein (Sino Biological). Beads are washed twice with PBS containing 0.01% Tween 20 and 0.05% BSA before bead -bound nanoparticles are disrupted with water containing 0.01% Tween 20 and 100 ug/ml heparin. The amount of CY5-siR A contained in the input, unbound fraction, washes and bead eluate is quantified by fluorescence using a TECAN Infinite M200 Pro (Excitation 635 nm; Emission 675 nm).

[1007] CY5-ASC Plasma Quantification

[1008] Quantification of nanoparticles in mouse plasma is performed as illustrated in Example 43. The CY5-siRNAs bound to EGFR beads are released by using heparin to compete the electrostatic interactions between CDP and siR As.

[1009] While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the disclosure. It should be understood that various alternatives to the embodiments of the disclosure described herein may be employed in practicing the disclosure. It is intended that the following claims define the scope of the disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.