OLIGONUCLEOTIDE PROBES AND USES THEREOF

CROSS REFERENCE

This application claims the benefit of U.S. Provisional Patent Application Nos. 62/640,503, filed March 8, 2018; 62/665,361, filed May 1, 2018; 62/700,696, filed July 19, 2018; and 62/755,921, filed November 5, 2018; and this application is related to International Patent Application No. PCT/US2017/034567, which application claims the benefit of U.S. Provisional Patent Application Nos. 62/341,617, filed May 25,

2016; 62/413,361, filed October 26, 2016; 62/420,497, filed November 10, 2016; 62/432,561, filed December 9, 2016; 62/441,527, filed January 2, 2017; 62/457,691, filed February 10, 2017; 62/472,953, filed March 17, 2017; and 62/508,353, filed May 18, 2017; and this application is related to International Patent Application No. PCT/US2017/023108, filed March 18, 2017, which application claims the benefit of U.S. Provisional Patent Application Nos. 62/310,665, filed March, 18, 2016; 62/413,361, filed October 26, 2016; 62/420,497, filed November 10, 2016; 62/432,561, filed December 9, 2016; 62/457,691, filed February 10, 2017; and 62/472,953, filed March 17, 2017; all of which applications are incorporated herein by reference in their entirety.

SEQUENCE LISTING SUBMITTED VIA EFS-WEB

[0001] The entire content of the following electronic submission of the sequence listing via the USPTO EFS-WEB server, as authorized and set forth in MPEP §1730 II.B.2(a), is incorporated herein by reference in its entirety for all purposes. The sequence listing is within the electronically filed text file that is identified as follows:

[0002] File Name: 839601_SEQUENCES.txt

[0003] Date of Creation: March 6, 2019

[0004] Size (bytes): 19,954,110 bytes

BACKGROUND

[0005] The invention relates generally to oligonucleotide probes, which are useful for diagnostics of cancer and/or other diseases or disorders and as therapeutics to treat such medical conditions. The invention further relates to materials and methods for the administration of oligonucleotide probes capable of binding to cells of interest.

[0006] Oligonucleotide probes, or aptamers, are oligomeric nucleic acid molecules having specific binding affinity to molecules, which may be through interactions other than classic Watson-Crick base pairing. Unless otherwise specified, an“aptamer” as the term is used herein can refer to nucleic acid molecules that can associate with targets, regardless of manner of target recognition. Unless other specified, the terms“aptamer,”“oligonucleotide,”“polynucleotide,� ��“oligonucleotide probe,” or the like may be used interchangeably herein.

[0007] Oligonucleotide probes, like peptides generated by phage display or monoclonal antibodies (“mAbs”), are capable of specifically binding to selected targets and modulating the target's activity, e.g., bound aptamers may block their target’s ability to function. Created by an in vitro selection process from pools of random sequence oligonucleotides, aptamers have been generated for numerous proteins including growth factors, transcription factors, enzymes, immunoglobulins, and receptors. A typical aptamer comprises a region 10-15 kDa in size (30-45 nucleotides) which imparts its binding specificity, binds its target with sub-nanomolar affinity, and discriminates against closely related targets (e.g., aptamers can be designed to not bind other proteins from the same gene family). A series of structural studies have shown that aptamers are capable of using the same types of binding interactions (e.g., hydrogen bonding, electrostatic complementarity, hydrophobic contacts, steric exclusion) that drive affinity and specificity in antibody -antigen complexes.

[0008] The region of an aptamer sequence which imparts binding specificity may be referred to as a “variable region” or the like herein. The variable region is often flanked by additional nucleotide sequences that impart desired functionality. For example, the flanking sequences typically provide primer sites for amplification of the library. Additional non-limiting uses of flanking sequences include enhanced stability (e.g., using polyethylene glycol (PEG)), or capture or attachment to various substrates or chemical moieties, including without limitation arrays, beads, particles, wells, plates, membranes, liposomes, nanoparticles, labels (e.g., gold, dye, magnetic label, fluorescent label, light emitting particle, radioactive label, enzymatic label), crosslinking agents, toxins, or therapeutic agents. As desired, such attachment may be direct, e.g., via base pairing of the flanking sequences, or indirect, e.g., an aptamer may be biotinylated to provide attachment via streptavidin or the like.

[0009] We have developed an aptamer (oligonucleotide probe) profiling technique that enables development of tests capable of assessing the molecular networks that underlie response to various therapies, including without limitation anti-cancer therapy. See Int’l Patent Publications

WO/2016/145128, published 9/15/2016 (based on Int’l Patent Appl. PCT/US 16/21632, filed 3/9/2016) and WO/2017/161357, published 9/21/2017 (based on Int’l Patent Appl. PCT/US 17/23108, filed 3/18/2017); which references are incorporated by reference herein in their entirety. Here we developed an aptamer library using pre-treatment tumor specimens from a clinical trial. Using known patient outcomes from the trial, the library was trained to classify samples as responders or non-responders to treatment. Aptamer target proteins were also identified.

INCORPORATION BY REFERENCE

[0010] All publications, patents and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference.

SUMMARY

[0011] Compositions and methods described herein provide oligonucleotide probes that recognize tissues having phenotypes of interest. In various embodiments, oligonucleotide probes described herein are used in diagnostic, prognostic or theranostic processes. In some embodiments, oligonucleotide probes, or aptamers, described herein are chemically modified or composed in a composition for medical imaging or therapeutic applications. [0012] Thus, provided herein are oligonucleotides comprising a sequence comprising a region according to any one of: a) SEQ ID NOs. 2922-102938; or b) a row in any one of Table 9, Table 17, or Table 19.

[0013] In some embodiments, the oligonucleotides comprise a sequence comprising a variable region according to to any one of: a) SEQ ID NOs. 2922-102938; or b) a row in any one of Table 9, Table 17, or Table 19, and further having a 5’ region with sequence 5’-CTAGCATGACTGCAGTACGT (SEQ ID NO. 3) and a 3’ region with sequence 5’-CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 4).

[0014] In some embodiments, the oligonucleotides comprise a sequence according to a row in Table 9. In some embodiments, the oligonucleotides comprise a sequence according to a row in Table 17. In some embodiments, the oligonucleotides comprise a sequence according to a row in Table 19.

[0015] In some embodiments, the oligonucleotides comprise a sequence according to any one of SEQ ID NOs. 2922-102938.

[0016] In some embodiments, the oligonucleotides are flanked by fixed sequences, wherein optionally the fixed sequences comprise hybridization sites for PCR primers, promoter sequences for RNA polymerases, restriction sites, homopolymeric sequences, catalytic cores, sites for selective binding to affinity substrates, or other sequences to facilitate cloning, sequencing, capture or attachment of the oligonucleotide.

[0017] In some embodiments, the oligonucleotides is capable of binding to pancreatic tissue.

[0018] In some embodiments, the oligonucleotides comprise a nucleic acid sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence as described herein.

[0019] Also provided herein is a plurality of oligonucleotides comprising different members with oligonucleotide sequences having a region according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 rows in Table 9.

[0020] Further, provided herein is a plurality of oligonucleotides comprising different members with oligonucleotide sequences having a region according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 rows in Table 19.

[0021] Additional provided herein is a plurality of oligonucleotides comprising different members with oligonucleotide sequences according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,

19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000 or all of SEQ ID NOs. 2922-102938.

[0022] In some embodiments, the plurality of oligonucleotides comprises member nucleic acid sequences or a portion thereof that are at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 percent homologous to the plurality of oligonucleotide sequences as described herein. In some embodiments, the plurality of oligonucleotides comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130,

140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000 or at least 100000 different oligonucleotide sequences as described herein.

[0023] In some embodiments, the oligonucleotide or plurality of oligonucleotides comprise a DNA,

RNA, 2’ -O-methyl or phosphorothioate backbone, or any combination thereof.

[0024] In some embodiments, the oligonucleotide or plurality of oligonucleotides comprise at least one of DNA, RNA, PNA, LNA, UNA, and any combination thereof.

[0025] In some embodiments, the oligonucleotide or plurality of oligonucleotides comprise at least one functional modification selected from the group consisting of biotinylation, a non-naturally occurring nucleotide, a deletion, an insertion, an addition, and a chemical modification. In some embodiments, the chemical modification comprises at least one of C18, polyethylene glycol (PEG), PEG4, PEG6, PEG8, and PEG12.

[0026] In some embodiments, the oligonucleotide or plurality of oligonucleotides is labeled.

[0027] In some embodiments, the oligonucleotide or plurality of oligonucleotides is attached to a nanoparticle, liposome, gold, magnetic label, fluorescent label, light emitting particle, light reactive moiety, radioactive label or enzymatic label.

[0028] Further, provided herein are isolated oligonucleotides or pluralities of oligonucleotides as described herein.

[0029] Additionally, provided herein are methods comprising contacting at least one sample from a subject (e.g., a subject with cancer, e.g., pancreatic cancer) with at least one oligonucleotide or plurality of oligonucleotides as described herein, and optionally further comprising detecting a presence or level of the at least one oligonucleotide or members of the plurality of oligonucleotides that associated with the at least one sample.

[0030] Further, provided herein are methods of predicting response to gemcitabine in a subject. The methods comprise providing at least one sample from the subject; contacting the at least one sample with at least one oligonucleotide or plurality of oligonucleotides as described herein; detecting a presence or level of the at least one oligonucleotide or members of the plurality of oligonucleotides that associated with the at least one sample; and predicting response to the gemcitabine based on the presence or level detected.

[0031] Also provided herein are methods of predicting response to gemcitabine, comprising providing at least one sample from a subject; detecting a presence or level of at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24 in the at least one sample; and predicting response to the gemcitabine based on the presence or level detected.

[0032] Adiitionally, provided herein are methods of predicting response to gemcitabine, comprising providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide aptamer that specifically binds to at least one protein in at least one of Tables 12-13, 15- 16, 18, and 20-24; detecting a presence or level of members of the at least one oligonucleotide aptamer that associated with the at least one target; and predicting response to the gemcitabine based on the presence or level detected. [0033] Also provided herein are methods of predicting response to gemcitabine and evofosfamide, comprising providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide or plurality of oligonucleotides as described herein; detecting a presence or level of the at least one oligonucleotide or members of the plurality of oligonucleotides that associated with the at least one sample; and predicting response to the gemcitabine and evofosfamide based on the presence or level detected.

[0034] Additionally, provided herein are methods of predicting response to gemcitabine and evofosfamide, comprising providing at least one sample from a subject; detecting a presence or level of at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24 in the at least one sample; and predicting response to the gemcitabine and evofosfamide based on the presence or level detected.

[0035] Further, provided herein are methods of predicting response to gemcitabine and evofosfamide, comprising providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide aptamer that specifically binds to at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24; detecting a presence or level of members of the at least one oligonucleotide aptamer that associated with the at least one target; and predicting response to the gemcitabine and evofosfamide based on the presence or level detected.

[0036] In some embodiments, the at least one oligonucleotide aptamer comprises at least one oligonucleotide or plurality of oligonucleotides as described herein.

[0037] In some embodiments, the detecting comprises sequencing, amplification, hybridization, gel electrophoresis, or chromatography.

[0038] In some embodiments, the detecting comprises an immunoassay, immunohistochemistry, or poly ligand histochemistry.

[0039] In some embodiments, the predicting comprises comparing the presence or level to a reference. In some embodiments, the reference comprises the presence or level determined in a sample from an individual without a disease or disorder, or from an individual with a different state of a disease or disorder.

[0040] In some embodiments, a positive detection predicts non-beneficial response to the gemcitabine or gemcitabine and evofosfamide, and/or negative detection predicts beneficial response to the gemcitabine or gemcitabine and evofosfamide.

[0041] In some embodiments, the at least one sample comprises a bodily fluid, tissue sample or cell culture.

[0042] In some embodiments, the tissue sample comprises fixed tissue. In some embodiments, the fixed tissue comprises formalin fixed paraffin embedded (FFPE) tissue. In some embodiments, the FFPE tissue comprises at least one of a fixed tissue, unstained slide, bone marrow core or clot, biopsy sample, surgical sample, core needle biopsy, malignant fluid, and fine needle aspirate (FNA). In some embodiments, the FFPE tissue is fixed on a substrate. In some embodiments, the substrate comprises a glass slide or membrane. [0043] In some embodiments, the bodily fluid comprises peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper’s fluid or pre- ejaculatory fluid, female ejaculate, sweat, fecal matter, hair oil, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood.

[0044] In some embodiments, the response to the gemcitabine and/or evofosfamide is determined when the gemcitabine and/or evofosfamide is given in combination with at least one other therapy. In some embodiments, the at least one other therapy comprises at least one chemotherapeutic agent,

chemoradiotherapy, radiotherapy, surgery, or any combination thereof. In some embodiments, the at least one chemotherapeutic agent comprises evofosfamide, 5-fluorouracil (5-FU), folinic acid (leucovorin), irinotecan, oxaliplatin, erlotinib, FOLFIRINOX (i.e., 5-FU, folinic acid, irinotecan, and oxaliplatin), paclitaxel, nab-paclitaxel, or any combination thereof. In some embodiments, the at least one chemotherapeutic agent comprises evofosfamide.

[0045] In some embodiments, the subject: i) has a disease or disorder; ii) is suspected of having or being predisposed to a disease or disorder; iii) is in need of treatment with gemcitabine and/or evofosfamide; or iv) is being considered for treatment with gemcitabine and/or evofosfamide.

[0046] In some embodiments, the disease or disorder comprises a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain.

[0047] In some embodiments, the cancer comprises pancreatic cancer; an acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma; AIDS-related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma); breast cancer; bronchial tumors; Burkitt lymphoma; cancer of unknown primary site; carcinoid tumor; carcinoma of unknown primary site; central nervous system atypical teratoid/rhabdoid tumor; central nervous system embryonal tumors; cervical cancer; childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer;

craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer; ependymoblastoma; ependymoma; esophageal cancer; esthesioneuroblastoma; Ewing sarcoma; extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer; liver cancer; lung cancer; malignant fibrous histiocytoma bone cancer; medulloblastoma;

medulloepithelioma; melanoma; Merkel cell carcinoma; Merkel cell skin carcinoma; mesothelioma; metastatic squamous neck cancer with occult primary; mouth cancer; multiple endocrine neoplasia syndromes; multiple myeloma; multiple myeloma/plasma cell neoplasm; mycosis fungoides;

myelodysplastic syndromes; myeloproliferative neoplasms; nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer; oropharyngeal cancer; osteosarcoma; other brain and spinal cord tumors; ovarian cancer; ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile cancer; pharyngeal cancer; pineal parenchymal tumors of intermediate differentiation; pineoblastoma; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system (CNS) lymphoma; primary hepatocellular liver cancer; prostate cancer; rectal cancer; renal cancer; renal cell (kidney) cancer; renal cell cancer; respiratory tract cancer; retinoblastoma; rhabdomyosarcoma; salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma;

squamous cell carcinoma; squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer; thymic carcinoma; thymoma; thyroid cancer; transitional cell cancer; transitional cell cancer of the renal pelvis and ureter; trophoblastic tumor; ureter cancer; urethral cancer; uterine cancer; uterine sarcoma; vaginal cancer; vulvar cancer; Waldenstrom macroglobulinemia; or Wilm’s tumor.

[0048] In some embodiments, the cancer comprises at least one of pancreatic cancer, breast cancer, ovarian cancer, non-small cell lung cancer, and bladder cancer. In some embodiments, the cancer comprises pancreatic cancer.

[0049] In some embodiments, the methods include administering the gemcitabine and/or evofosfamide with or without other combination therapy to the subject.

[0050] In some embodiments, the gemcitabine is administered to the subject when predicting beneficial response to the gemcitabine.

[0051] In some embodiments, the gemcitabine and evofosfamide is administered to the subject when predicting beneficial response to the gemcitabine and evofosfamide.

[0052] Also provided herein are kits comprising a reagent (e.g., as described herein) for carrying out a method as described herein, as well as the use of a reagent (e.g., as describd herein) for carrying out a method as described herein. In some embodiments, the reagent comprises at least one oligonucleotide or plurality of oligonucleotides as described herein.

[0053] Further, provided herein are methods of imaging at least one cell or tissue, comprising contacting the at least one cell or tissue with at least one oligonucleotide or plurality of oligonucleotides as described herein, and detecting the at least one oligonucleotide or the plurality of oligonucleotides in contact with at least one cell or tissue. [0054] In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides comprises nucleic acids having a sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000 or all of SEQ ID NOs. 2922-102921 or 102932-102938.

[0055] In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in any one of Tables 12-13, 15-16, 18, and 20-24.

[0056] In some embodiments, the at least one cell or tissue comprises pancreatic cells.

[0057] In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is as described herein.

[0058] In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is administered to a subject prior to the detecting.

[0059] In some embodiments, the at least one cell or tissue comprises neoplastic, malignant, tumor, hyperplastic, or dysplastic cells.

[0060] In some embodiments, the at least one cell or tissue comprises at least one of lymphoma, leukemia, renal carcinoma, sarcoma, hemangiopericytoma, melanoma, abdominal cancer, gastric cancer, colon cancer, cervical cancer, prostate cancer, pancreatic cancer, breast cancer, or non-small cell lung cancer cells.

[0061] In some embodiments, the at least one cell or tissue comprises a medical condition, disease or disorder.

[0062] Additionally, provided herein are pharmaceutical compositions comprising a therapeutically effective amount of a construct comprising the at least one oligonucleotide or the plurality of

oligonucleotides as described herein, or a salt thereof, and a pharmaceutically acceptable carrier, diluent, or both.

[0063] In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in any one of Tables 12-13, 15-16, 18, and 20-24.

[0064] In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides comprises nucleic acids having a sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000 or all of SEQ ID NOs. 2922-102921 or 102932-102938.

[0065] In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is attached to a toxin or therapeutic agent.

[0066] In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is comprised within a multipartite construct. [0067] In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is attached to a liposome or nanoparticle. In some embodiments, the liposome or nanoparticle comprises a toxin or therapeutic agent.

[0068] Further provided herein are methods of treating or ameliorating a medical condition, disease or disorder in a subject in need thereof, comprising administering a pharmaceutical composition as described herein to the subject.

[0069] In some embodiments, the medical condition, disease or disorder comprises a proliferative disorder, neoplasia, or cancer.

[0070] In some embodiments, the cancer comprises at least one of breast cancer, ovarian cancer, non small cell lung cancer, pancreatic cancer, and bladder cancer.

[0071] In some embodiments, the cancer is refractory to gemcitabine, or the cancer is refractory to gemcitabine with evofosfamide.

[0072] In some embodiments, the disease or disorder comprises a pancreatic cancer and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in Table 20.

[0073] In some embodiments, the disease or disorder displays gemcitabine resistance and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in Table 21.

[0074] In some embodiments, the disease or disorder comprises a tumor hypoxia and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in Table 22.

[0075] In some embodiments, the disease or disorder comprises a pancreatic cancer displaying gemcitabine resistance and tumor hypoxia and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein selected from the group consisting of CAPN1, CDC42, FN1, G6PD, LTF, PDIA3, RAB11A, S100P, TABLN2, and TNC.

[0076] In some embodiments, the disease or disorder comprises a pancreatic cancer displaying gemcitabine resistance and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein selected from the group consisting of AKR1C1, DDX17, HIST1H3A, HSPB1, RAB14, and RECQL.

[0077] In some embodiments, the disease or disorder comprises a pancreatic cancer displaying tumor hypoxia and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein selected from the group consisting of ACTN4, ALDOA, CALM1, CBR1, COL4A2, COL6A1, COMP, DES, GPI, LASPI, MUC5AC, PCBP1, PEBP1, PFN1, RAN, RPS6, S100A6, SND1, TALDOl, TKT, VCL, and VIM.

[0078] In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides associate with one or more protein not known to be associated with pancreatic cancer, gemcitabine resistance, hypoxia, or any combination thereof.

[0079] Also provided herein are methods of inducing cytotoxicity in a subject in need thereof, comprising administering a pharmaceutical composition as described herein to a subject. In some embodiments, the administering comprises at least one of intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, topical administration, or any combination thereof.

[0080] Also provided herein are binding agents that bind to a protein in any one of Tables 12-13, 15-16, 18, and 20-24. In some embodiments, the binding agent comprises one or more of a nucleic acid, DNA molecule, RNA molecule, antibody, antibody fragment, aptamer, peptoid, zDNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), lectin, peptide, dendrimer, protein labeling agent, drug, small molecule, chemical compound, or any combination thereof. In some embodiments, the binding agent comprises at least one of a toxin, small molecule, therapeutic agent, immunotherapy agent. In some embodiments, the binding agent comprises a detectable label. Also provided are the binding agents for use in a method as described herein, e.g., a method of treatment, prognosis/theranosis, or diagnosis as described herein. Also provided here are pharmaceutical compositions comprising a therapeutically effective amount of the binding agents, or a salt thereof, and a pharmaceutically acceptable carrier, diluent, or both. In some embodiments, the binding agent is attached directly or indirectly to at least one of a toxin, therapeutic agent, liposome or nanoparticle. Additionally provided are methods of treating or ameliorating a medical condition, disease or disorder in a subject in need thereof, comprising administering the pharmaceutical compositions to the subject. In some embodiments, the medical condition, disease or disorder comprises a proliferative disorder, neoplasia, or cancer. In some embodiments, the cancer comprises at least one of breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, and bladder cancer. In some embodiments, the cancer is refractory to gemcitabine, or the cancer is refractory to gemcitabine with evofosfamide. In some embodiments, the disease or disorder comprises a pancreatic cancer and the binding agent associates with one or more proteins listed in Table 20. In some embodiments, the disease or disorder displays gemcitabine resistance and the binding agent associates with one or more protein listed in Table 21. In some embodiments, the disease or disorder comprises a tumor hypoxia and the binding agent associates with one or more protein listed in Table 22. In some embodiments, the disease or disorder comprises a pancreatic cancer displaying gemcitabine resistance and tumor hypoxia and the binding agent associates with one or more protein selected from the group consisting of CAPN1, CDC42, FN1, G6PD, LTF, PDIA3, RAB11A, S100P, TABLN2, and TNC. In some embodiments, the disease or disorder comprises a pancreatic cancer displaying gemcitabine resistance and binding agent associates with one or more protein selected from the group consisting of AKR1C1, DDX17, HIST1H3A, HSPB1, RAB14, and RECQL. In some

embodiments, the disease or disorder comprises a pancreatic cancer displaying tumor hypoxia and the binding agent associates with one or more protein selected from the group consisting of ACTN4,

ALDOA, CALM1, CBR1, COL4A2, COL6A1, COMP, DES, GPI, LASPI, MUC5AC, PCBP1, PEBP1, PFN1, RAN, RPS6, S100A6, SND1, TALDOl, TKT, VCL, and VIM. In some embodiments, the binding agent associates with one or more protein not known to be associated with pancreatic cancer, gemcitabine resistance, hypoxia, or any combination thereof. In some embodiments, the one or more protein is listed in Table 23. Also provided are methods of inducing cytotoxicity in a subject in need thereof, comprising administering a pharmaceutical composition comprising a binding agent as described herein. In some embodiments, the administering comprises at least one of intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, topical administration, or any combination thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

[0081] FIGs. 1A-B illustrates a non-limiting example of an aptamer nucleotide sequence and its secondary structure. FIG. 1A illustrates a secondary structure of a 32-mer oligonucleotide, Aptamer 4, with sequence 5’-CCCCCCGAATCACATGACTTGGGCGGGGGTCG (SEQ ID NO. 1). In the figure, the sequence is shown with 6 thymine nucleotides added to the end, which can act as a spacer to attach a biotin molecule. This particular oligo has a high binding affinity to the target, epithelial cell adhesion molecule (EpCAM). Additional candidate EpCAM binders are identified by modeling the entire database of sequenced oligos to the secondary structure of this oligo. FIG. IB illustrates another 32-mer oligo with sequence 5’-ACCGGATAGCGGTTGGAGGCGTGCTCCACTCG (SEQ ID NO. 2) that has a different secondary structure than the aptamer in FIG. 1A. This aptamer is also shown with a 6-thymine tail.

[0082] FIG. 2 comprises a schematic for identifying a target of a selected aptamer, such as an aptamer selected by the process described herein. The figure shows an aptamer 202 tethered to a substrate 201.

The aptamer 202 can be covalently attached to substrate 201. The aptamer 202 may also be non- covalently attached. For example, aptamer 202 can comprise a label which can be attracted to the substrate, such as a biotin group which can form a complex with an avidin/streptavidin molecule that is covalently attached to the substrate. The aptamer 202 binds to a surface antigen 203 of target entity 204 (e.g., a cell or vesicle). In the step signified by arrow (i), the target entity is disrupted while leaving the complex between the aptamer 202 and surface antigen 203 intact. Disrupted target entity 205 is removed, e.g., via washing or buffer exchange, in the step signified by arrow (ii). In the step signified by arrow (iii), the surface antigen 203 is released from the aptamer 202. The surface antigen 203 can be analyzed to determine its identity.

[0083] FIGs. 3A-3G illustrate using an oligonucleotide probe library to differentiate cancer and non cancer samples.

[0084] FIG. 4 shows protein targets of oligonucleotide probes run on a silver stained SDS-PAGE gel.

[0085] FIGs. 5A-B illustrate a model generated using a training (FIG. 5A) and test (FIG. 5B) set from a round of cross validation. The AUC for the test set was 0.803. Another exemplary round of cross- validation is shown in FIGs. 5C-D with training (FIG. 5C) and test (FIG. 5D) sets. The AUC for the test set was 0.678.

[0086] FIG. 6 illustrates multipart oligonucleotide constructs.

[0087] FIGs. 7A-C illustrate SUPRA (SsDNA by Unequal length PRimer Asymmetric PCR), a protocol for single stranded DNA (ssDNA) oligonucleotide library preparation.

[0088] FIGs. 8A-C illustrate use of aptamers in methods of characterizing a phenotype. FIG. 8A is a schematic 800 showing an assay configuration that can be used to detect and/or quantify a target of interest. In the figure, capture aptamer 802 is attached to substrate 801. Target of interest 803 is bound by capture aptamer 802. Detection aptamer 804 is also bound to target of interest 803. Detection aptamer 804 carries label 805 which can be detected to identify target captured to substrate 801 via capture aptamer 802 FIG. 8B is a schematic 810 showing use of an aptamer pool to characterize a phenotype. A pool of aptamers to a target of interest is provided 811. The pool is contacted with a test sample to be characterized 812. The mixture is washed to remove unbound aptamers. The remaining aptamers are disassociated and collected 813. The collected aptamers are identified 814 and the identity of the retained aptamers is used to characterize the phenotype 815. FIG. 8C provides an outline 820 of such method. An aptamer pool is provided that has been enriched against a tissue of interest 821. The pool is contacted with a tissue sample 822. The tissue sample can be in a format such as described herein. As a non-limiting example, the tissue sample can be a fixed tumor sample. The sample may be a FFPE sample fixed to a glass slide or membrane. The sample is washed to remove unbound members of the aptamer pool and the remaining aptamers are visualized 823. Any appropriate method to visualize the aptamers can be used. In an example, the aptamer pool is biotinylated and the bound aptamer are visualized using streptavidin- horse radish peroxidase (SA-HRP). As described herein, other useful visualization methods are known in the art, including alternate labeling. The visualized sample is scored to determine the amount of staining 824. For example a pathologist can score the slide as in IHC. The score can be used to characterize the sample 825 as described herein. For example, a score of +1 or higher may indicate that the sample is a cancer sample, or is a cancer sample expressing a given biomarker or having certain characteristics, including without limitation drug susceptibility or resistance.

[0089] FIGs. 9A-D illustrate development and use of an oligonucleotide probe library to distinguish biological sample types.

[0090] FIGs. 10A-C illustrate enriching a naive oligonucleotide library with balanced design for oligonucleotides that differentiate between breast cancer and non-cancer microvesicles derived from plasma samples.

[0091] FIG. 11 illustrates study design for retrospective analysis of the phase III MAESTRO study by poly -ligand profding. The MAESTRO trial data comprised de-identified patient characteristics, clinical outcomes and sample availability for all 693 enrolled patients 1101. 323 cases had available unstained FFPE specimens for additional studies. Hematoxylin and eosin (H&E) stained tissue sections from each case were evaluated by a board-certified pathologist; 192 cases qualified for our study based on physical condition of the preserved tissue, sufficient tumor cellularity, and identifiable adjacent tissue for confirmation of metastatic lesions 1102. Twenty cases were initially un-blinded for enrichment of ssODN libraries 1103. The leading ssODN library was screened on 12 cases and staining and OS cut-offs were identified and locked on these samples 1104. Samples from the blinded test set (n=172) were screened 1105 and test performance was evaluated using previously locked cut-offs 1106. Assay performance metrics were calculated for the full blinded set as well as for the subsets of the blinded test set where tissue was collected from primary and metastatic tumor sites 1107. The sensitivity and specificity for each treatment arm (GE or G) observed in each test set cohort were then used in 1,000 simulated trials to model the impact of the PLP test on a projected population for a new trial 1108. [0092] FIG. 12 shows Kaplan-Meier (KM) curves for various cohorts of the blinded test set (n=172). A. All patients, regardless of PLP status. Median overall survival (OS) of 8.4 months for patients treated with GE (blue, n = 71, event = 50) and 7.8 months for patients treated with G (red, n = 101, event = 80). HR = 0.91 (95% Cl: 0.63-1.30); log-rank p = 0.595. B. PLP positive patients. Median OS of 8.1 months for patients treated with GE (blue, n = 38, event = 28) and 6.9 months for patients treated with G (red, n = 50, event = 43). HR = 0.82 (95% Cl: 0.51-1.32); log-rank p = 0.405. C. GE patients by PLP status. Median OS of 8.1 months for PLP positive patients (green, n = 38, event = 28) and 8.9 months for PLP negative patients (yellow, n = 33, event = 22). HR = 1.15 (95% Cl: 0.65-2.01); log-rank p = 0.631. D. G patients by PLP status. Median OS of 6.9 months for PLP positive patients (green, n = 50, event = 43) and 9.1 months for PLP negative patients (yellow, n = 51, event = 37). HR = 1.49 (95% Cl: 0.96-2.33); log-rank p =

0.077.

[0093] FIG. 13 illustrates results of modeling PLP-based performance of the blinded test set (n=172) on the entire MAESTRO study population. Upper panel shows the distributions of the hazard ratio (HR) (A), and median OS (B) of 1,000 simulations. The vertical lines in A and B represent the observed HR (0.84) and difference in median OS from GE to G (1.3 months) in MAESTRO. Of the 1,000 simulations, 96.9% show log-rank p < 0.05. C. KM curves of the patients from the MAESTRO trial stratified by treatment. Median OS is 8.9 months for patients treated with GE (blue, n = 344, event = 245) and 7.6 months for patients treated with G (red, n = 349, event = 268). HR = 0.84 (95% Cl: 0.71-1.00); log-rank p = 0.053. D. Representative KM curves from the simulated trials using diagnostic metrics from the blinded PLP -tested cohort. Median OS is 8.9 months for patients treated with GE (blue, n = 181, event = 133) and 6.4 months for patients treated with G (red, n = 174, event = 139). HR = 0.72 (95% Cl: 0.57-0.91); log-rank p =

0.006. Shaded regions in C-D represent the 95% confidence interval.

[0094] FIG. 14 illustrates results of the 1,000 simulated trials using PLP assay diagnostic metrics from subsets of the blinded test set where the tissue was collected from the primary tumor site (n=122, upper panel) or a metastatic site (n=49, lower panel). Histograms show the HRs (A, D) and median OS difference (B, E) in 1,000 simulated trials. Vertical red lines in A and D represent the observed HR in MAESTRO (0.84). Vertical red lines in B and E show the difference in median OS from GE and G (1.3 months) in MAESTRO. Of the 1,000 simulated trials, 100% show log-rank p < 0.05 when diagnostic metrics from the primary subset were used, and 0% show log-rank p < 0.05 when diagnostic metrics from the metastatic subset were used. C, F. Representative KM curves from the simulated trials using the primary and metastatic subsets. C. Median OS is 9.2 months for patients treated with GE (blue, n = 198, event = 137) and 6.1 months for patients treated with G (red, n = 180, event = 149). HR = 0.63 (95% Cl: 0.50-0.80); log-rank p < 0.001. F. Median OS is 6.5 months for patients treated with GE (blue, n = 134, event = 104) and 7.0 months for patients treated with G (red, n = 162, event = 131). HR = 0.97 (95% Cl: 0.75-1.25); log-rank test p = 0.810. Shaded regions in C and F represent the 95% confidence interval.

[0095] FIG. 15 illustrates an example enrichment scheme of the leading library, EL-EvNR2. Rounds Rl- R3 (R1 = round 1; R2 = round 2; etc) were positive-selections on samples from the same non-benefiter patient (PI). Rounds R4-R6 included two counter selection steps where the unbound fractions were collected from samples from 2 different benefiter patients (Nl, N2) and applied back to the NB sample from patient PI used for R1-R3. Rounds R1-R6 were performed identically for each of the nine initial libraries using different NB and B cases. Library EL-Ev-NR2 was subjected to two additional rounds of positive selection (R7, R8) on two different non-benefiter cases (P2, P3) to further increase representation of selectively -binding species.

[0096] FIG. 16 shows NGS read count distribution. (A) Library EL-EvNR2-Rd6 matured most effectively after R6 and was further trained for two additional positive selection rounds (R7, R8). In each group, the bars are ordered from left to right as EvNRl, EnNR2, EvNR3, EvNR4, EvNR5, EvRl, EvR2, EvR4 and EvR5. (B) Library EL-EvNR2 read count comparisons between R6, R7 and R8 confirmed further maturation. In each group, the bars are ordered from left to right as Round 6, 7, 8.

[0097] FIG. 17 shows staining of the tissue of the 12 cases with enriched library EvNR2_21. Slides are annotated with the patient’s overall survival (OS) in days. Ten cases were naive to enrichment and two were used in round R7 (OS: 48, upper panel, middle) and round R8 (OS: 33, upper panel, second from left). Histological scores for each nuclear and cytoplasmic component are shown in Table 10 herein. Four out of five non-benefiter cases (OS < 240) have at least 30% of cells with nucleus staining. Five out of seven benefiter cases (OS > 240) have more that 70% of cells without nucleus staining. Slides shown at 20x magnification, 40 pm scale bar.

[0098] FIG. 18 shows Kaplan-Meier (KM) curves for various cohorts of the blinded test set (n=172). (A) All patients, regardless of PLP status. Median time of benefit is 8.4 months for patients treated with GE (blue, n = 71, event = 50) and 7.8 months for patients treated with G (red, n = 101, event = 80). HR = 0.91 (95% CL 0.63-1.30); log-rank p = 0.595. (B) PLP positive patients. Median time of benefit is 8.1 months for patients treated with GE (blue, n = 38, event = 28) and 6.9 months for patients treated with G (red, n = 50, event = 43). HR = 0.82 (95% CL 0.51-1.32); log-rank p = 0.405. (C) GE patients by PLP status. Median time of benefit is 8.1 months for PLP positive patients (green, n = 38, event = 28) and 8.9 months for PLP negative patients (yellow, n = 33, event = 22). HR = 1.15 (95% CL 0.65-2.01); log-rank p =

0.631. (D) G patients by PLP status. Median time of benefit is 6.9 months for PLP positive patients (green, n = 50, event = 43) and 9.1 months PLP negative patients (yellow, n = 51, event = 37). HR = 1.49 (95% CL 0.96-2.33); log-rank p = 0.077.

[0099] FIG. 19 show histograms of the median OS for each trial arm (left panels A, C, E, red is G and blue is GE) and relative median OS increase (right panel) of 1,000 simulated trials using PLP assay diagnostic metrics from full blinded set (n=172, A-B), and the subsets of the blinded test set where the tissue was collected from the primary tumor site (n=122, C-D) or a metastatic site (n=49, E-F). The vertical red and blue lines in the left panel represent the median OS for G (7.6 months) and GE (8.9 months) in MAESTRO. The vertical red lines in the right panel represent the median relative OS increase (17.4%) in MAESTRO.

[00100] FIG. 20 shows additional KM curves from simulated trials including PLP-positive patients using OS. Trials with the smallest (left panel) and largest (right panel) hazard ratio out of the 1,000 using performance metrics from the blinded test set (A-B), primary subset (C-D), and metastatic subset (E-F) are shown. (A) Median time of benefit is 8.5 months for patients treated with GE (blue, n = 181, event = 122) and 6.0 months for patients treated with G (red, n = 174, event = 143). HR = 0.62 (95% Cl: 0.48- 0.79); log-rank p < 0.001. (B) Median time of benefit is 8.5 months for patients treated with GE (blue, n = 181, event = 137) and 6.6 months for patients treated with G (red, n = 174, event = 137). HR = 0.83 (95% Cl: 0.65-1.05); log-rank p = 0.121. (C) Median time of benefit is 10.1 months for patients treated with GE (blue, n = 198, event = 132) and 5.9 months for patients treated with G (red, n = 180, event = 149). HR = 0.55 (95% Cl: 0.43-0.69); log-rank p < 0.001. (D) Median time of benefit is 9.1 months for patients treated with GE (blue, n = 198, event = 146) and 6.4 months for patients treated with G (red, n = 180, event = 142). HR = 0.73 (95% Cl: 0.58-0.92); log-rank p = 0.008. (E) Median time of benefit is 6.4 months for patients treated with GE (blue, n = 134, event = 97) and 6.0 months for patients treated with G (red, n = 162, event = 135). HR = 0.80 (95% Cl: 0.62-1.05); log-rank p = 0.102. (F) Median time of benefit is 6.3 months for patients treated with G+E (blue, n = 134, event = 107) and 7.0 months for patients treated with G (red, n = 162, event = 121). HR = 1.17 (95% Cl: 0.90-1.51); log-rank p = 0.247.

[00101] FIG. 21 shows results of the modeling PLP -based performance of the blinded test set (n=172) on the entire MAESTRO trial using PFS as the endpoint. Each panel corresponds to the same letter in FIG. 13, which shows OS as the endpoint. The upper panels show the distributions of the HR (A), and median OS (B) of 1,000 simulations. The vertical red lines in (A) and (B) represent the observed HR (0.75) and difference in median OS from GE to G (1.8 months) in MAESTRO. Of the 1,000 simulations, 97.9% show log-rank p < 0.05. (C) KM curves of the patients from the MAESTRO trial stratified by treatment. Median time of benefit is 5.5 months for patients treated with GE (blue, n = 344, event = 228) and 3.7 months for patients treated with G (red, n = 349, event = 262). HR = 0.75 (95% Cl: 0.63-0.90); log-rank p = 0.001. (D) Representative KM curves from the simulated trials using diagnostic metrics from the blinded PLP -tested cohort. Median time of benefit is 5.5 months for patients treated with GE (blue, n = 181, event = 122) and 3.6 months for patients treated with G (red, n = 174, event = 128). HR = 0.65 (95% Cl: 0.51-0.84); log-rank p < 0.001.

[00102] FIG. 22 shows histograms of the median PFS for each trial arm (left panels A, C, E, red is G and blue is GE) and relative median OS increase (right panel) of 1,000 simulated trials using PLP assay diagnostic metrics from full blinded set (n=172, A, B), and the subsets of the blinded test set where the tissue was collected from the primary tumor site (n=122, C, D) or a metastatic site (n=49, E, F). The vertical red and blue lines in the left panel represent the median PFS for G (3.7 months) and GE (5.5 months) in MAESTRO. The vertical red lines in the right panel represent the median relative PFS increase (49.1%) in MAESTRO. Compare to overall survival (OS) in FIG. 19.

[00103] FIG. 23 shows additional KM curves from simulated trials including PLP-positive patients using PFS as the primary endpoint. Trials with the smallest (left panel) and largest (right panel) hazard ratio out of the 1,000 using performance metrics from the blinded test set (A-B), primary subset (C-D), and metastatic subset (E-F) are shown. A) Median time of benefit is 5.5 months for patients treated with GE (blue, n = 181, event = 117) and 3.4 months for patients treated with G (red, n = 174, event = 131). HR = 0.61 (95% Cl: 0.47-0.79); log-rank p < 0.001. B) Median time of benefit is 5.5 months for patients treated with GE (blue, n = 181, event = 120) and 3.4 months for patients treated with G (red, n = 174, event = 130). HR = 0.64 (95% Cl: 0.50-0.82); log-rank p < 0.001. C) Median time of benefit is 5.5 months for patients treated with GE (blue, n = 198, event = 135) and 3.6 months for patients treated with G (red, n = 180, event = 130). HR = 0.52 (95% Cl: 0.431-0.67); log-rank p < 0.001. D) Median time of benefit is 9.1 months for patients treated with GE (blue, n = 198, event = 146) and 6.4 months for patients treated with G (red, n = 180, event = 142). HR = 0.73 (95% Cl: 0.58-0.93); log-rank p = 0.015. E) Median time of benefit is 5.3 months for patients treated with GE (blue, n = 134, event = 87) and 3.4 months for patients treated with G (red, n = 162, event = 128). HR = 0.64 (95% Cl: 0.49-0.84); log-rank p = 0.001. F) Median time of benefit is 3.8 months for patients treated with G+E (blue, n = 134, event = 92) and 3.7 months for patients treated with G (red, n = 162, event = 118). HR = 1.09 (95% Cl: 0.83-1.43); log-rank p = 0.545. Compare to overall survival (OS) in FIG. 20.

[00104] FIG. 24 shows results of the 1,000 simulated trials using PLP assay diagnostic metrics from subsets of the blinded test set where the tissue was collected from the primary tumor site (n=122, upper panel A-C) or a metastatic site (n=49, lower panel D-F). Each panel corresponds to the same letter in FIG. 13, which shows OS as the endpoint. Histograms show the distribution of the HRs (A, D) and median OS difference (B, E) in 1,000 simulated trials. Vertical red lines in (A) and (D) represent the observed HR in MAESTRO (0.75). Vertical red lines in (B) and (E) show the difference in median OS from GE to G (1.8 months) in MAESTRO. Of the 1,000 simulated trials, 100% show log-rank p < 0.05 when diagnostic metrics from the primary subset were used, and 21.2% show log-rank p < 0.05 when diagnostic metrics from the metastatic subset were used. C, F show representative KM curves from the simulated trials using the primary and metastatic subsets. (C) Median time of benefit is 5.5 months for patients treated with GE (blue, n = 198, event = 128) and 3.5 months for patients treated with G (red, n = 180, event = 136). HR = 0.60 (95% Cl: 0.47-0.77); log-rank p < 0.001. (F) Median time of benefit is 3.7 months for patients treated with GE (blue, n = 134, event = 89) and 3.7 months for patients treated with G (red, n = 162, event = 112). HR = 0.98 (95% Cl: 0.74-1.30); log-rank test p = 0.897.

[00105] FIGs. 25A-P show immunohistochemistry verification of the presence of protein targets PKM1, PKM2, HSPB1, COL6A3, RPS14, GAPDH, ANX1, TUBA1B, EPO, ANX2, ACTB, TGM2, identified by mass-spectrometry in samples, affinity purified with library EvNR2 from pancreatic FFPE tissue. The corresponding antibodies are specified above the images. Rb - host is rabbit, Ms - host is mouse. Tissue samples from four patients with pancreatic cancer were used: Case #658 (A, E, I, M); Case #641 (B, F, J, N); Case #034 (C, G, K, O); Case #617 (D, H, L, P). Magnification 20x, 40 pm scale bar shown in (A) is applicable to all images.

[00106] FIG. 26 shows target identification scheme and selected cases. Part 1: Staining: FFPE slides comprising pancreatic cancer tissue 2601 are contacted with enriched ssODN library 2602 comprising biotinylated oligonucleotides. The slides comprising aptamer bound tissue 2604 are stained 2603 to visualize areas of cancer tissue. Cancer tissue with bound oligos 2606 is microdissected 2607. Part 2: Protein Lysis: Microdissected cancer tissue with bound oligonucleotides 2606 is lysed 2607, washed 2608, and centrifuged 2609 to pellet cellular debris and the supernatant comprising the previously bound aptamers is recovered 2610. Part 3: Pull-down: The supernatant comprising the previously bound aptamers 2610 is contacted with magnetic streptavidin beads 2611. The biotinylated oligos are bound to the streptavidin beads 2612, washed 2613, eluted from the beads 2614 and separated on a silver stained PAGE gel 2615 where individual bands are excised from the gel 2616. Part 4: MS: Enriched proteins are excised 2616 from silver stained PAGE gel 2615. Recovered gel slice 2617 is subjected in-gel digestion 2618, peptide extraction 2619, and enrichment 2620 using standard techniques. The processed peptides are subjected to high-resolution mass-spectrometry (MS) 2621.

[00107] FIG. 27 shows five cases from MAESTRO trial, all of which are non-benefiters for gemcitabine or gemcitabine + evofosfamide with the highest staining intensity from library EvNR2. Magnification 20x. These cases were selected for target identification according to FIG. 26. Each case had two binding replicates, 2 slides per replicate. MS data analysis: 99% protein threshold, min 2 peptides/protein detection, 95% peptide threshold.

[00108] FIGs. 28A-B show target ID with Library EvNR2 and pools of selected sequences thereof.

DETAILED DESCRIPTION

[00109] The details of one or more embodiments described herein are set forth in the accompanying description below. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. Other features, objects, and advantages described herein will be apparent from the description. In the specification, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the case of conflict, the present Specification will control.

[00110] Disclosed herein are compositions and methods that can be used to characterize a phenotype, or assess, a biological sample. The compositions and methods described herein comprise the use of oligonucleotide probes (aptamers) that bind biological entities of interest, including without limitation tissues, cell, microvesicles, or fragments of any thereof. The antigens recognized by the oligonucleotide aptamers may comprise proteins or polypeptides or any other useful biological components such as nucleic acids, lipids and/or carbohydrates. In general, the oligonucleotides disclosed are synthetic nucleic acid molecules, including DNA and RNA, and variations thereof. Unless otherwise specified, the oligonucleotide probes can be synthesized in DNA or RNA format or as hybrid molecules as desired. The methods disclosed herein comprise diagnostic, prognostic and theranostic processes and techniques using one or more aptamer described herein. Alternatively, an oligonucleotide probe described herein can also be used as a binding agent to capture, isolate, or enrich, a cell, cell fragment, microvesicle or any other fragment or complex that comprises the antigen or functional fragments thereof.

[00111] The compositions and methods described herein also comprise individual oligonucleotides that can be used to assess biological samples. The invention further discloses compositions and methods of oligonucleotide pools that can be used to detect a biosignature in a sample. [00112] Oligonucleotide probes and sequences disclosed in the compositions and methods described herein may be identified herein in the form of DNA or RNA. Unless otherwise specified, one of skill in the art will appreciate that an oligonucleotide may generally be synthesized as either form of nucleic acid and carry various chemical modifications and remain within the scope described herein. The term aptamer may be used in the art to refer to a single oligonucleotide that binds specifically to a target of interest through mechanisms other than Watson crick base pairing, similar to binding of a monoclonal antibody to a particular antigen. Within the scope of this disclosure and unless stated explicitly or otherwise implicit in context, the terms aptamer, oligonucleotide and oligonucleotide probe, and variations thereof, may be used interchangeably to refer to an oligonucleotide capable of distinguishing biological entities of interest (e.g, tissues, cells, microvesicles, biomarkers) whether or not the specific entity has been identified or whether the precise mode of binding has been determined.

[00113] An oligonucleotide probe or plurality of such probes described herein can also be used to provide in vitro or in vivo detection or imaging and to provide diagnostic readouts, including for diagnostic, prognostic or theranostic purposes.

[00114] Separately, an oligonucleotide probe described herein can also be used for treatment or as a therapeutic to specifically target a cell, tissue, organ or the like. As the invention provides methods to identify oligonucleotide probes that bind to specific tissues, cells, microvesicles or other biological entities of interest, the oligonucleotide probes described herein target such entities and are inherently drug candidates, agents that can be used for targeted drug delivery, or both.

Phenotypes

[00115] Disclosed herein are products and processes for characterizing a phenotype using the methods and compositions described herein. The term“phenotype” as used herein can mean any trait or characteristic that can be identified using in part or in whole the compositions and/or methods described herein. For example, a phenotype can be a diagnostic, prognostic or theranostic determination based on a characterized biomarker profile for a sample obtained from a subject. A phenotype can be any observable characteristic or trait of, such as a disease or condition, a stage of a disease or condition, susceptibility to a disease or condition, prognosis of a disease stage or condition, a physiological state, or response / potential response to therapeutics. A phenotype can result from a subject’s genetic makeup as well as the influence of environmental factors and the interactions between the two, as well as from epigenetic modifications to nucleic acid sequences.

[00116] A phenotype in a subject can be characterized by obtaining a biological sample from a subject and analyzing the sample using the compositions and/or methods described herein. For example, characterizing a phenotype for a subject or individual can include detecting a disease or condition (including pre-symptomatic early stage detecting), determining a prognosis, diagnosis, or theranosis of a disease or condition, or determining the stage or progression of a disease or condition. Characterizing a phenotype can include identifying appropriate treatments or treatment efficacy for specific diseases, conditions, disease stages and condition stages, predictions and likelihood analysis of disease progression, particularly disease recurrence, metastatic spread or disease relapse. A phenotype can also be a clinically distinct type or subtype of a condition or disease, such as a cancer or tumor. Phenotype determination can also be a determination of a physiological condition, or an assessment of organ distress or organ rejection, such as post-transplantation. The compositions and methods described herein allow assessment of a subject on an individual basis, which can provide benefits of more efficient and economical decisions in treatment.

[00117] In an aspect, the invention relates to the analysis of tissues, cells, microvesicles, and/or other circulating biomarkers to provide a diagnosis, prognosis, and/or theranosis of a disease or condition. Theranostics includes diagnostic testing that provides the ability to affect therapy or treatment of a disease or disease state. Theranostics testing provides a theranosis in a similar manner that diagnostics or prognostic testing provides a diagnosis or prognosis, respectively. As used herein, theranostics encompasses any desired form of therapy related testing, including predictive medicine, personalized medicine, precision medicine, integrated medicine, pharmacodiagnostics and Dx/Rx partnering. Therapy related tests can be used to predict and assess drug response in individual subjects, i.e., to provide personalized medicine. Predicting a drug response can be determining whether a subject is a likely responder or a likely non-responder to a candidate therapeutic agent, e.g., before the subject has been exposed or otherwise treated with the treatment. Assessing a drug response can be monitoring a response to a drug, e.g., monitoring the subject’s improvement or lack thereof over a time course after initiating the treatment. Therapy related tests are useful to select a subject for treatment who is particularly likely to benefit from the treatment or to provide an early and objective indication of treatment efficacy in an individual subject. Thus, analysis using the compositions and methods described herein may indicate that treatment should be altered to select a more promising treatment, thereby avoiding the great expense of delaying beneficial treatment and avoiding the financial and morbidity costs of administering an ineffective drug(s).

[00118] In assessing a phenotype, a biosignature can be analyzed in the subject and compared against that of previous subjects that were known to respond or not to a treatment. The biosignature may comprise certain biomarkers or may comprise certain detection agents, such as the oligonucleotide probes as provided herein. If the biosignature in the subject more closely aligns with that of previous subjects that were known to respond to the treatment, the subject can be characterized, or predicted, as a responder to the treatment. Similarly, if the biomarker profile in the subject more closely aligns with that of previous subjects that did not respond to the treatment, the subject can be characterized, or predicted as a non responder to the treatment. The treatment can be for any appropriate disease, disorder or other condition, including without limitation those disclosed herein.

[00119] In some embodiments, the phenotype comprises a medical condition including without limitation a disease or disorder listed in Table 1. For example, the phenotype can comprise detecting the presence of or likelihood of developing a tumor, neoplasm, or cancer, or characterizing the tumor, neoplasm, or cancer (e.g., stage, grade, aggressiveness, likelihood of metastatis or recurrence, etc).

[00120] A cancer characterized by the compositions and methods described herein can comprise, without limitation, a carcinoma, a sarcoma, a lymphoma or leukemia, a germ cell tumor, a blastoma, or other cancers. Carcinomas include without limitation epithelial neoplasms, squamous cell neoplasms squamous cell carcinoma, basal cell neoplasms basal cell carcinoma, transitional cell papillomas and carcinomas, adenomas and adenocarcinomas (glands), adenoma, adenocarcinoma, linitis plastica insulinoma, glucagonoma, gastrinoma, vipoma, cholangiocarcinoma, hepatocellular carcinoma, adenoid cystic carcinoma, carcinoid tumor of appendix, prolactinoma, oncocytoma, hurthle cell adenoma, renal cell carcinoma, grawitz tumor, multiple endocrine adenomas, endometrioid adenoma, adnexal and skin appendage neoplasms, mucoepidermoid neoplasms, cystic, mucinous and serous neoplasms, cystadenoma, pseudomyxoma peritonei, ductal, lobular and medullary neoplasms, acinar cell neoplasms, complex epithelial neoplasms, warthin's tumor, thymoma, specialized gonadal neoplasms, sex cord stromal tumor, thecoma, granulosa cell tumor, arrhenoblastoma, sertoli leydig cell tumor, glomus tumors, paraganglioma, pheochromocytoma, glomus tumor, nevi and melanomas, melanocytic nevus, malignant melanoma, melanoma, nodular melanoma, dysplastic nevus, lentigo maligna melanoma, superficial spreading melanoma, and malignant acral lentiginous melanoma. Sarcoma includes without limitation Askin's tumor, botryodies, chondrosarcoma, Ewing's sarcoma, malignant hemangio endothelioma, malignant schwannoma, osteosarcoma, soft tissue sarcomas including: alveolar soft part sarcoma, angiosarcoma, cystosarcoma phyllodes, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, epithelioid sarcoma, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, kaposi's sarcoma, leiomyosarcoma, liposarcoma,

lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma,

rhabdomyosarcoma, and synovialsarcoma. Lymphoma and leukemia include without limitation chronic lymphocytic leukemia/small lymphocytic lymphoma, B-cell prolymphocytic leukemia,

lymphoplasmacytic lymphoma (such as Waldenstrom macroglobulinemia), splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, monoclonal immunoglobulin deposition diseases, heavy chain diseases, extranodal marginal zone B cell lymphoma, also called malt lymphoma, nodal marginal zone B cell lymphoma (nmzl), follicular lymphoma, mantle cell lymphoma, diffuse large B cell lymphoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, burkitt lymphoma/leukemia, T cell prolymphocytic leukemia, T cell large granular lymphocytic leukemia, aggressive NK cell leukemia, adult T cell leukemia/lymphoma, extranodal NK/T cell lymphoma, nasal type, enteropathy -type T cell lymphoma, hepatosplenic T cell lymphoma, blastic NK cell lymphoma, mycosis fungoides / sezary syndrome, primary cutaneous CD30-positive T cell lymphoproliferative disorders, primary cutaneous anaplastic large cell lymphoma, lymphomatoid papulosis, angioimmunoblastic T cell lymphoma, peripheral T cell lymphoma, unspecified, anaplastic large cell lymphoma, classical hodgkin lymphomas (nodular sclerosis, mixed cellularity, lymphocyte-rich, lymphocyte depleted or not depleted), and nodular lymphocyte -predominant hodgkin lymphoma. Germ cell tumors include without limitation germinoma, dysgerminoma, seminoma, nongerminomatous germ cell tumor, embryonal carcinoma, endodermal sinus turmor, choriocarcinoma, teratoma, polyembryoma, and gonadoblastoma. Blastoma includes without limitation nephroblastoma, medulloblastoma, and retinoblastoma. Other cancers include without limitation labial carcinoma, larynx carcinoma, hypopharynx carcinoma, tongue carcinoma, salivary gland carcinoma, gastric carcinoma,

adenocarcinoma, thyroid cancer (medullary and papillary thyroid carcinoma), renal carcinoma, kidney parenchyma carcinoma, cervix carcinoma, uterine corpus carcinoma, endometrium carcinoma, chorion carcinoma, testis carcinoma, urinary carcinoma, melanoma, brain tumors such as glioblastoma, astrocytoma, meningioma, medulloblastoma and peripheral neuroectodermal tumors, gall bladder carcinoma, bronchial carcinoma, multiple myeloma, basalioma, teratoma, retinoblastoma, choroidea melanoma, seminoma, rhabdomyosarcoma, craniopharyngeoma, osteosarcoma, chondrosarcoma, myosarcoma, liposarcoma, fibrosarcoma, Ewing sarcoma, and plasmocytoma.

[00121] The compositions and methods described herein can be used to characterize these and other diseases and disorders. Thus, characterizing a phenotype can be providing a diagnosis, prognosis or theranosis of a medical condition, disease or disorder, including without limitation one of the diseases and disorders disclosed herein.

Subject

[00122] One or more phenotypes of a subject can be determined by analyzing a biological sample obtained from the subject. A subject or patient can include, but is not limited to, mammals such as bovine, avian, canine, equine, feline, ovine, porcine, or primate animals (including humans and non-human primates). A subject can also include a mammal of importance due to being endangered, such as a Siberian tiger; or economic importance, such as an animal raised on a farm for consumption by humans, or an animal of social importance to humans, such as an animal kept as a pet or in a zoo. Examples of such animals include, but are not limited to, carnivores such as cats and dogs; swine including pigs, hogs and wild boars; ruminants or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, camels or horses. Also included are birds that are endangered or kept in zoos, as well as fowl and more particularly domesticated fowl, e.g., poultry, such as turkeys and chickens, ducks, geese, guinea fowl. Also included are domesticated swine and horses (including race horses). In addition, any animal species connected to commercial activities are also included such as those animals connected to agriculture and aquaculture and other activities in which disease monitoring, diagnosis, and therapy selection are routine practice in husbandry for economic productivity and/or safety of the food chain.

[00123] The subject can have a pre-existing disease or condition, including without limitation cancer. Alternatively, the subject may not have any known pre-existing condition. The subject may also be non- responsive to an existing or past treatment, such as a treatment for cancer.

Samples

[00124] A sample used and/or assessed via the compositions and methods described herein includes any relevant biological sample that can be used to characterize a phenotype of interest, including without limitation sections of tissues such as biopsy or tissue removed during surgical or other procedures, bodily fluids, autopsy samples, frozen sections taken for histological purposes, and cell cultures. Such samples include blood and blood fractions or products (e.g., serum, bufiy coat, plasma, platelets, red blood cells, and the like), sputum, malignant effusion, cheek cells tissue, cultured cells (e.g., primary cultures, explants, and transformed cells), stool, urine, other biological or bodily fluids (e.g., prostatic fluid, gastric fluid, intestinal fluid, renal fluid, lung fluid, cerebrospinal fluid, and the like), etc. The sample can comprise biological material that is a fresh frozen & formalin fixed paraffin embedded (FFPE) block, formalin -fixed paraffin embedded, or is within an RNA preservative + formalin fixative. More than one sample of more than one type can be used for each patient.

[00125] The sample used in the methods described herein can be a formalin fixed paraffin embedded (FFPE) sample. The FFPE sample can be one or more of fixed tissue, unstained slides, bone marrow core or clot, core needle biopsy, malignant fluids and fine needle aspirate (FNA). In an embodiment, the fixed tissue comprises a tumor containing formalin fixed paraffin embedded (FFPE) block from a surgery or biopsy. In another embodiment, the unstained slides comprise unstained, charged, unbaked slides from a paraffin block. In another embodiment, bone marrow core or clot comprises a decalcified core. A formalin fixed core and/or clot can be paraffin-embedded. In still another embodiment, the core needle biopsy comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, e.g., 3-6, paraffin embedded biopsy samples. An 18 gauge needle biopsy can be used. The malignant fluid can comprise a sufficient volume of fresh pleural/ascitic fluid to produce a 5x5x2mm cell pellet. The fluid can be formalin fixed in a paraffin block. In an embodiment, the core needle biopsy comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more, e.g., 4-6, paraffin embedded aspirates.

[00126] A sample may be processed according to techniques understood by those in the art. A sample can be without limitation fresh, frozen or fixed cells or tissue. In some embodiments, a sample comprises formalin-fixed paraffin-embedded (FFPE) tissue, fresh tissue or fresh frozen (FF) tissue. A sample can comprise cultured cells, including primary or immortalized cell lines derived from a subject sample. A sample can also refer to an extract from a sample from a subject. For example, a sample can comprise DNA, RNA or protein extracted from a tissue or a bodily fluid. Many techniques and commercial kits are available for such purposes. The fresh sample from the individual can be treated with an agent to preserve RNA prior to further processing, e.g., cell lysis and extraction. Samples can include frozen samples collected for other purposes. Samples can be associated with relevant information such as age, gender, and clinical symptoms present in the subject; source of the sample; and methods of collection and storage of the sample. A sample is typically obtained from a subject, e.g., a human subject.

[00127] A biopsy comprises the process of removing a tissue sample for diagnostic or prognostic evaluation, and to the tissue specimen itself. Any biopsy technique known in the art can be applied to the molecular profiling methods of the present invention. The biopsy technique applied can depend on the tissue type to be evaluated (e.g., colon, prostate, kidney, bladder, lymph node, liver, bone marrow, blood cell, lung, breast, etc.), the size and type of the tumor (e.g., solid or suspended, blood or ascites), among other factors. Representative biopsy techniques include, but are not limited to, excisional biopsy, incisional biopsy, needle biopsy, surgical biopsy, and bone marrow biopsy. An“excisional biopsy” refers to the removal of an entire tumor mass with a small margin of normal tissue surrounding it. An“incisional biopsy” refers to the removal of a wedge of tissue that includes a cross-sectional diameter of the tumor. The invention can make use a“core-needle biopsy” of the tumor mass, or a "fine-needle aspiration biopsy" which generally obtains a suspension of cells from within the tumor mass. Biopsy techniques are discussed, for example, in Harrison’s Principles of Internal Medicine, Kasper, et al., eds., 16th ed., 2005, Chapter 70, and throughout Part V.

[00128] Standard molecular biology techniques known in the art and not specifically described are generally followed as in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (1989), and as in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989) and as in Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988), and as in Watson et al., Recombinant DNA, Scientific American Books, New York and in Birren et al (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4 Cold Spring Harbor Laboratory Press, New York (1998) and methodology as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057 and incorporated herein by reference.

Polymerase chain reaction (PCR) can be carried out generally as in PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, Calif. (1990).

[00129] The biological sample assessed using the compositions and methods described herein can be any useful bodily or biological fluid, including but not limited to peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen (including prostatic fluid), Cowper’s fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates or other lavage fluids, cells, cell culture, or a cell culture supernatant. A biological sample may also include the blastocyl cavity, umbilical cord blood, or maternal circulation which may be of fetal or maternal origin. The biological sample may also be a cell culture, tissue sample or biopsy from which microvesicles, circulating tumor cells (CTCs), and other circulating biomarkers may be obtained. In various embodiments, biomarkers or more particularly biosignatures disclosed herein can be assessed directly from such biological samples (e.g., identification of presence or levels of nucleic acid or polypeptide biomarkers or functional fragments thereof) using various methods, such as extraction of nucleic acid molecules from blood, plasma, serum or any of the foregoing biological samples, use of protein or antibody arrays to identify polypeptide (or functional fragment) biomarker(s), as well as other array, sequencing, PCR and proteomic techniques known in the art for identification and assessment of nucleic acid and polypeptide molecules. In addition, one or more components present in such samples can be first isolated or enriched and further processed to assess the presence or levels of selected biomarkers, to assess a given biosignature (e.g., isolated portions of a tissue slide prior to profiling for protein and/or nucleic acid biomarkers).

[00130] Table 1 presents a non-limiting listing of diseases, conditions, or biological states and corresponding biological samples that may be used for analysis according to the methods described herein. Table 1: Examples of Biological Samples for Various Diseases,

Conditions, or Biological States

[00131] The compositions and methods described herein can be used to characterize a phenotype using a blood sample or blood derivative. Blood derivatives include fractions such as plasma and serum. Blood plasma is the liquid component of whole blood, and makes up approximately 55% of the total blood volume. It is composed primarily of water with small amounts of minerals, salts, ions, nutrients, and proteins in solution. In whole blood, red blood cells, leukocytes, and platelets are suspended within the plasma. Blood serum refers to blood plasma without fibrinogen or other clotting factors (i.e., whole blood minus both the cells and the clotting factors). The blood sample may comprise circulating tumor cells (CTCs) which can be assessed by the compositions and methods described herein.

[00132] The biological sample may be obtained through a third party, such as a party not performing the analysis of the sample. For example, the sample may be obtained through a clinician, physician, or other health care manager of a subject from which the sample is derived. Alternatively, the biological sample may obtained by the same party analyzing the sample. In addition, biological samples be assayed, are archived (e.g., frozen) or ortherwise stored in under preservative conditions.

Diagnostic Methods

[00133] The aptamers described herein can be used in various methods to assess presence or level of biomarkers in a biological sample, e.g., biological entities of interest such as cells, proteins, and/or nucleic acids. The biological entities can be part of larger entities, such as complexes, cells or tissue, or can be circulating in bodily fluids. The aptamers may be used to assess presence or level of the target molecule/s. Therefore, in various embodiments described herein directed to diagnostics, prognostics or theranostics, one or more aptamers described herein are configured in a ligand-target based assay, where one or more aptamer described herein is contacted with a selected biological sample, where the or more aptamer associates with or binds to its target molecules. Aptamers described herein are used to identify biosignatures based on the biological samples assessed and biomarkers detected. In some embodiments, aptamer or oligonucleotide probes, or libraries thereof, may themselves provide a biosignature for a particular condition or disease. A biosignature refers to a profile of a biological sample comprising a presence, level or other characteristic that can be assessed (including without limitation a sequence, mutation, rearrangement, translocation, deletion, epigenetic modification, methylation, post-translational modification, allele, activity, complex partners, stability, half life, and the like) of one or more biomarker of interest. Biosignatures can be used to evaluate diagnostic and/or prognostic criteria such as presence of disease, disease staging, disease monitoring, disease stratification, or surveillance for detection, metastasis or recurrence or progression of disease. As another example, methods described herein using aptamers against tissue are useful for correlating a biosignature comprising tissue antigens to a selected condition or disease. A biosignature can also be used clinically in making decisions concerning treatment modalities including therapeutic intervention. A biosignature can further be used clinically to make treatment decisions, including whether to perform surgery or what treatment standards should be used along with surgery (e.g., either pre-surgery or post-surgery). As an illustrative example, a biosignature of circulating biomarkers or biomarkers displayed on fixed tissue may indicate an aggressive form of cancer and may call for a more aggressive surgical procedure and/or more aggressive therapeutic regimen to treat the patient.

[00134] Characterizing a phenotype, such as providing a diagnosis, prognosis or theranosis, may comprise comparing a biosignature to a reference. For example, the level of a biomarker in a diseased state may be elevated or reduced as compared to a reference control without the disease, or with a different state of the disease. An oligonucleotide probe library disclosed herein may be engineered to detect a certain phenotype and not another phenotype. As a non-limiting example, the oligonucleotide probe library may stain a cancer tissue using an immunoassay but not a non-cancer reference tissue. Alternately, the oligonucleotide probe library may stain a cancer tissue using an immunoassay at a detectable higher level than a non-cancer reference tissue. One of skill will appreciate that one may engineer an oligonucleotide probe library to stain a non-cancer tissue using an immunoassay at a detectable higher level than cancer tissue as well.

[00135] A biosignature can be used in any methods disclosed herein, e.g., to assess whether a subject is afflicted with disease, is at risk for developing disease or to assess the stage or progression of the disease. For example, a biosignature can be used to assess whether a subject has prostate cancer, colon cancer, or other cancer as described herein. See, e.g., section labeled“Phenotypes.” Furthermore, a biosignature can be used to determine a stage of a disease or condition, such as cancer.

[00136] A biosignature for characterizing a phenotype may comprise any number of useful criteria. The term“phenotype” as used herein can mean any trait or characteristic that is attributed to a biosignature / biomarker profde. A phenotype can be detected or identified in part or in whole using the compositions and/or methods described herein. In some embodiments, at least one criterion is used for each biomarker. In some embodiments, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or at least 100 criteria are used. For example, for the characterizing of a cancer, a number of different criteria can be used when the subject is diagnosed with a cancer: 1) if the amount of a biomarker in a sample from a subject is higher than a reference value; 2) if the amount of a biomarker within specific cell types is higher than a reference value; or 3) if the amount of a biomarker within a cell, tissue or microvesicle with one or more cancer specific biomarkers is higher than a reference value. Similar rules can apply if the amount of the biomarkers is less than or the same as the reference. The method can further include a quality control measure, such that the results are provided for the subject if the samples meet the quality control measure. In some embodiments, if the criteria are met but the quality control is questionable, the subject is reassessed.

[00137] A biosignature can be used in therapy related diagnostics to provide tests useful to diagnose a disease or choose the correct treatment regimen, such as provide a theranosis. Theranostics includes diagnostic testing that provides the ability to affect therapy or treatment of a diseased state. Theranostics testing provides a theranosis in a similar manner that diagnostics or prognostic testing provides a diagnosis or prognosis, respectively. As used herein, theranostics encompasses any desired form of therapy related testing, including predictive medicine, personalized medicine, integrated medicine, pharmacodiagnostics and Dx/Rx partnering. Therapy related tests can be used to predict and assess drug response in individual subjects, i.e., to provide personalized medicine. Predicting a drug response can be determining whether a subject is a likely responder or a likely non-responder to a candidate therapeutic agent, e.g., before the subject has been exposed or otherwise treated with the treatment. Assessing a drug response can be monitoring a response to a drug, e.g., monitoring the subject’s improvement or lack thereof over a time course after initiating the treatment. Therapy related tests are useful to select a subject for treatment who is particularly likely to benefit from the treatment or to provide an early and objective indication of treatment efficacy in an individual subject. Thus, a biosignature as disclosed herein may indicate that treatment should be altered to select a more promising treatment, thereby avoiding the great expense of delaying beneficial treatment and avoiding the financial and morbidity costs of administering an ineffective drug(s).

[00138] The compositions and methods described herein can be used to identify or detect a biosignature associated with a variety of diseases and disorders, which include, but are not limited to cardiovascular disease, cancer, infectious diseases, sepsis, neurological diseases, central nervous system related diseases, endovascular related diseases, and autoimmune related diseases. Therapy related diagnostics also aid in the prediction of drug toxicity, drug resistance or drug response. Therapy related tests may be developed in any suitable diagnostic testing format, which include, but are not limited to, e.g., immunohistochemical tests, clinical chemistry, immunoassay, cell-based technologies, nucleic acid tests or body imaging methods. Therapy related tests can further include but are not limited to, testing that aids in the determination of therapy, testing that monitors for therapeutic toxicity, or response to therapy testing. Thus, a biosignature can be used to predict or monitor a subject’s response to a treatment. A biosignature can be determined at different time points for a subject after initiating, removing, or altering a particular treatment.

[00139] In some embodiments, the compositions and methods described herein provide for a

determination or prediction as to whether a subject is responding to a treatment is made based on a change in the amount of one or more components of a biosignature (e.g., biomarkers of interest), an amount of one or more components of a particular biosignature, or the biosignature detected for the components. In another embodiment, a subject’s condition is monitored by determining a biosignature at different time points. The progression, regression, or recurrence of a condition is determined. Response to therapy can also be measured over a time course. Thus, a method is provided herein of monitoring a status of a disease or other medical condition in a subject, comprising isolating or detecting a biosignature from a biological sample from the subject, detecting the overall amount of the components of a particular biosignature, or detecting the biosignature of one or more components (such as the presence, absence, or expression level of a biomarker). The biosignatures are used to monitor the status of the disease or condition.

[00140] One or more biosignatures can also be identified by the compositions and methods described herein. For example, one or more aptamer pools can be identified that preferentially bind a sample from a subject that responds to a drug treatment or treatment regimen and compared to a reference, such as another subject that does not respond to the drug treatment or treatment regimen. Differences between the biosignatures can be determined and used to identify other subjects as responders or non-responders to a particular drug or treatment regimen.

[00141] In some embodiments, a biosignature is used to determine whether a particular disease or condition is resistant to a drug, in which case a physician need not waste valuable time with such drug treatment. To obtain early validation of a drug choice or treatment regimen, a biosignature is determined for a sample obtained from a subject. The biosignature is used to assess whether the particular subject’s disease has the biomarker associated with drug resistance. Such a determination enables doctors to devote critical time as well as the patient’s financial resources to effective treatments.

[00142] Biosignatures can be used in the theranosis of diseases such as cancer, e.g., identifying whether a subject suffering from a disease is a likely responder or non-responder to a particular treatment. The subject methods can be used to theranose cancers including without limitation those listed herein, e.g., in the“Phenotypes” section herein. These include without limitation lung cancer, non-small cell lung cancer small cell lung cancer (including small cell carcinoma (oat cell cancer), mixed small cell/large cell carcinoma, and combined small cell carcinoma), colon cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, brain cancer, kidney cancer, ovarian cancer, stomach cancer, melanoma, bone cancer, gastric cancer, breast cancer, glioma, glioblastoma, hepatocellular carcinoma, papillary renal carcinoma, head and neck squamous cell carcinoma, leukemia, lymphoma, myeloma, or other solid tumors.

[00143] A biosignature of circulating biomarkers, including markers associated with a component present in a biological sample (e.g., cell, CTC, cell-fragment, cell-derived microvesicle), in a sample from a subject suffering from a cancer can be used select a candidate treatment for the subject. The biosignature can be determined according to the compositions and methods described herein presented herein. In some embodiments, the candidate treatment comprises a standard of care for the cancer. The treatment can be a cancer treatment such as radiation, surgery, chemotherapy or a combination thereof. The cancer treatment can be a therapeutic such as anti-cancer agents and chemotherapeutic regimens. Further drug associations and rules that are used in embodiments described herein are found in PCT/US2007/69286, filed May 18, 2007; PCT/US2009/60630, filed October 14, 2009; PCT/ 2010/000407, filed February 11, 2010;

PCT/US 12/41393, fded June 7, 2012; PCT/US2013/073184, filed December 4, 2013;

PCT/US2010/54366, fded October 27, 2010; PCT/US 11/67527, fded December 28, 2011; PCT/US15/13618, filed January 29, 2015; and PCT/US 16/20657, filed March 3, 2016; each of which applications is incorporated herein by reference in its entirety.

Biomarkers

[00144] The aptamers and aptamer pools provided herein can be used in assays to detect the presence or level of one or more biomarker of interest. The biomarker can be any useful biomarker including those disclosed herein or in the literature, or to be discovered. In an embodiment, the biomarker comprises a protein or polypeptide. As used herein,“protein,”“polypeptide” and“peptide” are used interchangeably unless stated otherwise. The biomarker can be a nucleic acid, including DNA, RNA, and various subspecies of any thereof as disclosed herein or known in the art. The biomarker can comprise a lipid. The biomarker can comprise a carbohydrate. The biomarker can also be a complex, e.g., a complex comprising protein, nucleic acids, lipids and/or carbohydrates. In some embodiments, the biomarker comprises a microvesicle. In an embodiment, a method is provided wherein a pool of aptamers is used to assess a sample without necessarily knowing the precise antigen targeted by each member of the pool. See, e.g., FIGs. 8B-C. In other cases, known biomarkers can be specifically assessed according to the methods described herein. See, e.g., FIG. 8A. The oligonucleotide pools described herein can be used to assess cells and tissue whether or not the target biomarkers of the individual oligonucleotide aptamers are known. The targets of such oligonucleotide aptamer pools and members thereof can also be determined. See, e.g., Examples 1, 9-11, and 14-17 herein.

[00145] A biosignature may comprise one type of biomarker or multiple types of biomarkers. As a non- limiting example, a biosignature can comprise multiple proteins, multiple nucleic acids, multiple lipids, multiple carbohydrates, multiple biomarker complexes, multiple microvesicles, or a combination of any thereof. For example, the biosignature may comprise one or more protein and one or more nucleic acid.

As another example, the biosignature may be an oligonucleotide pool signature, and the members of the oligonucleotide pool can associate with various biomarker or multiple types of biomarkers.

[00146] Gene and protein aliases and descriptions used herein can be found using a variety of online databases, including GeneCards® (genecards.org), HUGO Gene Nomenclature (genenames.org), Entrez Gene (ncbi.nlm.nih.gov/entrez/query cgi?db=gene), UniProtKB/Swiss-Prot (uniprot.org),

UniProtKB/TrEMBL (imiprot.org), OMIM (ncbi.nlm.nih.gov/entrez/query fcgi?db=OMIM), GeneLoc (genecards.weizmann.ac.il/geneloc/), and Ensembl (ensembl.org). Generally, gene symbols and names below correspond to those approved by HUGO, and protein names are those recommended by

UniProtKB/Swiss-Prot. Common alternatives are provided as well. Where a protein name indicates a precursor, the mature protein is also implied. Throughout the application, gene and protein symbols may be used interchangeably and the meaning can be derived from context as necessary.

Biomarker Detection

[00147] The compositions and methods described herein can be used to assess any useful biomarkers in a biological sample for charactering a phenotype associated with the sample. Such biomarkers include all sorts of biological entities such as proteins, nucleic acids, lipids, carbohydrates, complexes of any thereof, and microvesicles. [00148] The aptamers described herein can be used to provide a biosignature in tissue or bodily fluids, e.g., by assessing various biomarkers therein. See, e.g., FIGs. 8B-C. The aptamers described herein can also be used to assess levels or presence of their specific target molecule. See, e.g., FIG. 8A. In addition, aptamers described herein are used to capture or isolated a component present in a biological sample that has the aptamer’s target molecule present. For example, if a given surface antigen is present on a cell, cell fragment or cell-derived extracellular vesicle, a binding agent to the biomarker, including without limitation an aptamer provided herein, may be used to capture or isolate the cell, cell fragment or cell- derived extracellular vesicles. See, e.g., FIG. 8A. Such captured or isolated entities may be further characterized to assess additional surface antigens or internal“payload” molecules, e.g., nucleic acid molecules, lipids, sugars, polypeptides or functional fragments thereof, or anything else present in the cellular milieu that may be used as a biomarker. Therefore, aptamers described herein are used not only to assess one or more surface antigen of interest but are also used to separate a component present in a biological sample, where the components themselves can be comprised within the biosignature.

[00149] The methods described herein can comprise multiplex analysis of at least 2, 3, 4, 5, 6, 7, 8, 9, 10,

11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000,

10000, or more different biomarkers. For example, an oligonucleotide pool may contain any number of individual aptamers that can target different biomarkers. As another example, an assay can be performed with a plurality of particles that are differentially labeled. There can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,

12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 50, 75 or 100 differentially labeled particles. The particles may be externally labeled, such as with a tag, or they may be intrinsically labeled. Each differentially labeled particle can be coupled to a capture agent, such as a antibody or aptamer, and can be used to capture its target. One or more captured biomarkers can be detected by a plurality of binding agents. The binding agent can be directly labeled to facilitate detection. Alternatively, the binding agent is labeled by a secondary agent. For example, the binding agent may be an antibody or aptamer for a biomarker, wherein the binding agent is linked to biotin. A secondary agent comprises streptavidin linked to a reporter and can be added to detect the biomarker. In some embodiments, multiple detectors, i.e., detection of multiple biomarkers of a tissue of interest increase the signal obtained, permitted increased sensitivity, specificity, or both, and potentially the use of smaller amounts of samples.

[00150] An immunoassay based method (e.g., sandwich assay) can be used to detect a biomarker of interest. An example includes ELISA. A binding agent can be bound to a well. For example, a binding agent such as an aptamer or antibody to biomarker of interest can be attached to a well. A captured biomarker can be detected based on the methods described herein. FIG. 8A shows an illustrative schematic for a sandwich-type of immunoassay. The capture agent can be against a cellular antigen of interest. In the figure, the captured entities are detected, e.g., using fluorescently labeled binding agent (detection agent) against antigens of interest. Multiple capture binding agents can be used, e.g., in distinguishable addresses on an array or different wells of an immunoassay plate. The detection binding agents can be against the same antigen as the capture binding agent, or can be directed against other markers. The capture binding agent can be any useful binding agent, e.g., tethered aptamers, antibodies or lectins, and/or the detector antibodies can be similarly substituted, e.g., with detectable (e.g., labeled) aptamers, antibodies, lectins or other binding proteins or entities.

[00151] Further biomarkers and detection techniques are disclosed in International Patent Application Nos. PCT/U S2009/62880, fded October 30, 2009; PCT/US2009/006095, fded November 12, 2009; PCT/US2011/26750, fded March 1, 2011; PCT/US2011/031479, fded April 6, 2011; PCT/US 11/48327, fded August 18, 2011; PCT/US2008/71235, fded July 25, 2008; PCT/US 10/58461, filed November 30, 2010; PCT/US2011/21160, filed January 13, 2011; PCT/US2013/030302, fded March 11, 2013;

PCT/US 12/25741, fded February 17, 2012; PCT/2008/76109, fded September 12, 2008;

PCT/US 12/42519, fded June 14, 2012; PCT/US 12/50030, fded August 8, 2012; PCT/US 12/49615, filed August 3, 2012; PCT/US12/41387, filed June 7, 2012; PCT/US2013/072019, fded November 26, 2013; PCT/U S2014/039858, fded May 28, 2013; PCT/IB2013/003092, filed October 23, 2013;

PCT/US 13/76611, fded December 19, 2013; PCT/US 14/53306, fded August 28, 2014; PCT/US 15/62184, fded November 23, 2015; PCT/US 16/40157, fded June 29, 2016; PCT/US 16/44595, fded July 28, 2016; and PCT/US16/21632, fded March 9, 2016; each of which applications is incorporated herein by reference in its entirety.

[00152] Techniques of detecting biomarkers or capturing sample components using an aptamer described herein include the use of a planar substrate such as an array (e.g., biochip or microarray), with molecules immobilized to the substrate as capture agents that facilitate the detection of a particular biosignature. The array can be provided as part of a kit for assaying one or more biomarkers. Aptamers described herein can be included in an array for detection and diagnosis of diseases including pre symptomatic diseases. In some embodiments, an array comprises a custom array comprising biomolecules selected to specifically identify biomarkers of interest. Customized arrays can be modified to detect biomarkers that increase statistical performance, e.g., additional biomolecules that identifies a biosignature which lead to improved cross-validated error rates in multivariate prediction models (e.g., logistic regression, discriminant analysis, or regression tree models). In some embodiments, customized array(s) are constructed to study the biology of a disease, condition or syndrome and profile biosignatures in defined physiological states. Markers for inclusion on the customized array be chosen based upon statistical criteria, e.g., having a desired level of statistical significance in differentiating between phenotypes or physiological states. In some embodiments, standard significance of p-value = 0.05 is chosen to exclude or include biomolecules on the microarray. The p-values can be corrected for multiple comparisons. As an illustrative example, nucleic acids extracted from samples from a subject with or without a disease can be hybridized to a high density microarray that binds to thousands of gene sequences. Nucleic acids whose levels are significantly different between the samples with or without the disease can be selected as biomarkers to distinguish samples as having the disease or not. A customized array can be constructed to detect the selected biomarkers. In some embodiments, customized arrays comprise low density microarrays, which refer to arrays with lower number of addressable binding agents, e.g., tens or hundreds instead of thousands. Low density arrays can be formed on a substrate. In some embodiments, customizable low density arrays use PCR amplification in plate wells, e.g., TaqMan® Gene Expression Assays (Applied Biosystems by Life Technologies Corporation, Carlsbad, CA).

[00153] An aptamer described herein or other useful binding agent may be linked directly or indirectly to a solid surface or substrate. A solid surface or substrate can be any physically separable solid to which a binding agent can be directly or indirectly attached including, but not limited to, surfaces provided by microarrays and wells, particles such as beads, columns, optical fibers, wipes, glass and modified or functionalized glass, quartz, mica, diazotized membranes (paper or nylon), polyformaldehyde, cellulose, cellulose acetate, paper, ceramics, metals, metalloids, semiconductive materials, quantum dots, coated beads or particles, other chromatographic materials, magnetic particles; plastics (including acrylics, polystyrene, copolymers of styrene or other materials, polypropylene, polyethylene, polybutylene, polyurethanes, Teflon material, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, ceramics, conducting polymers (including polymers such as polypyrole and polyindole); micro or nanostructured surfaces such as nucleic acid tiling arrays, nanotube, nanowire, or nanoparticulate decorated surfaces; or porous surfaces or gels such as methacrylates, acrylamides, sugar polymers, cellulose, silicates, or other fibrous or stranded polymers. In addition, as is known the art, the substrate may be coated using passive or chemically -derivatized coatings with any number of materials, including polymers, such as dextrans, acrylamides, gelatins or agarose. Such coatings can facilitate the use of the array with a biological sample.

[00154] An aptamer or other useful binding agent can be conjugated to a detectable entity or label.

Appropriate labels include without limitation a magnetic label, a fluorescent moiety, an enzyme, a chemiluminescent probe, a metal particle, a non-metal colloidal particle, a polymeric dye particle, a pigment molecule, a pigment particle, an electrochemically active species, semiconductor nanocrystal or other nanoparticles including quantum dots or gold particles, fluorophores, quantum dots, or radioactive labels. Protein labels include green fluorescent protein (GFP) and variants thereof (e.g., cyan fluorescent protein and yellow fluorescent protein); and luminescent proteins such as luciferase, as described below. Radioactive labels include without limitation radioisotopes (radionuclides), such as ³ H, ⁿ C, ¹⁴ C, ¹⁸ F, ³² P, ³⁵ S, ⁶⁴ Cu, ⁶⁸ Ga, ⁸⁶ Y, "Tc, ^m In, ¹²³ I, ¹²⁴ I, ¹²⁵ I, ¹³¹ I, ¹³³ Xe, ¹⁷⁷ Lu, ²¹¹ At, or ²¹³ Bi. Fluorescent labels include without limitation a rare earth chelate (e.g., europium chelate), rhodamine; fluorescein types including without limitation FITC, 5-carboxyfluorescein, 6-carboxy fluorescein; a rhodamine type including without limitation TAMRA; dansyl; Lissamine; cyanines; phycoerythrins; Texas Red; Cy3, Cy5, dapoxyl, NBD, Cascade Yellow, dansyl, PyMPO, pyrene, 7-diethylaminocoumarin-3-carboxylic acid and other coumarin derivatives, Marina Blue™, Pacific Blue™, Cascade Blue™, 2-anthracenesulfonyl, PyMPO, 3,4,9, 10- perylene-tetracarboxylic acid, 2,7-difluorofluorescein (Oregon Green™ 488-X), 5-carboxyfluorescein, Texas Red™-X, Alexa Fluor 430, 5-carboxytetramethylrhodamine (5-TAMRA), 6- carboxytetramethylrhodamine (6-TAMRA), BODIPY FL, bimane, and Alexa Fluor 350, 405, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 647, 660, 680, 700, and 750, and derivatives thereof, among many others. See, e.g.,“The Handbook— A Guide to Fluorescent Probes and Labeling Technologies,” Tenth Edition, available on the internet at probes (dot) invitrogen (dot) com/handbook. The fluorescent label can be one or more of FAM, dRHO, 5-FAM, 6FAM, dR6G, JOE, HEX, VIC, TET, dTAMRA, TAMRA, NED, dROX, PET, BHQ, Gold540 and LIZ.

[00155] Using conventional techniques, an aptamer can be directly or indirectly labeled. In a non-limiting example, the label is attached to the aptamer through biotin-streptavidin/avidin chemistry. For example, synthesize a biotinylated aptamer, which is then capable of binding a streptavidin molecule that is itself conjugated to a detectable label; non-limiting example is streptavidin, phycoerythrin conjugated (SAPE)). Methods for chemical coupling using multiple step procedures include biotinylation, coupling of trinitrophenol (TNP) or digoxigenin using for example succinimide esters of these compounds.

Biotinylation can be accomplished by, for example, the use of D-biotinyl-N-hydroxysuccinimide.

Succinimide groups react effectively with amino groups at pH values above 7, and preferentially between about pH 8.0 and about pH 8.5. The labeling may comprise a secondary labeling system. As a non- limiting example, the aptamer can be conjugated to biotin or digoxigenin. Target bound aptamer can be detected using streptavidin/avidin or anti-digoxigenin antibodies, respectively.

[00156] Various enzyme-substrate labels may also be used in conjunction with a composition or method described herein. Such enzyme-substrate labels are available commercially (e.g., U.S. Pat. No. 4,275,149). The enzyme generally catalyzes a chemical alteration of a chromogenic substrate that can be measured using various techniques. For example, the enzyme may catalyze a color change in a substrate, which can be measured spectrophotometrically. Alternatively, the enzyme may alter the fluorescence or

chemiluminescence of the substrate. Examples of enzymatic labels include luciferases (e.g., firefly luciferase and bacterial luciferase; U.S. Pat. No. 4,737,456), luciferin, 2,3-dihydrophthalazinediones, malate dehydrogenase, urease, peroxidase such as horseradish peroxidase (HRP), alkaline phosphatase (AP), b-galactosidase, glucoamylase, lysozyme, saccharide oxidases (e.g., glucose oxidase, galactose oxidase, and glucose-6-phosphate dehydrogenase), heterocyclic oxidases (such as uricase and xanthine oxidase), lactoperoxidase, microperoxidase, and the like. Examples of enzyme-substrate combinations include, but are not limited to, horseradish peroxidase (HRP) with hydrogen peroxidase as a substrate, wherein the hydrogen peroxidase oxidizes a dye precursor (e.g., orthophenylene diamine (OPD) or 3,3',5,5'-tetramethylbenzidine hydrochloride (TMB)); alkaline phosphatase (AP) with para-nitrophenyl phosphate as chromogenic substrate; and b-D-galactosidase (b-D-Gal) with a chromogenic substrate (e.g., p-nitrophenyl- b-D-galactosidase) or fluorogenic substrate 4-methylumbelliferyl^-D-galactosidase.

[00157] Aptamer(s) can be linked to a substrate such as a planar substrate. A planar array generally contains addressable locations (e.g., pads, addresses, or micro-locations) of biomolecules in an array format. The size of the array will depend on the composition and end use of the array. Arrays can be made containing from 2 different molecules to many thousands. Generally, the array comprises from two to as many as 100,000 or more molecules, depending on the end use of the array and the method of manufacture. A microarray for use with the compositions and methods described herein comprises at least one biomolecule that identifies or captures a biomarker present in a biosignature of interest, e.g., a cell, microRNA or other biomolecule or vesicle that makes up the biosignature. In some arrays, multiple substrates are used, either of different or identical compositions. Accordingly, planar arrays may comprise a plurality of smaller substrates.

[00158] The compositions and methods described herein can make use of many types of arrays for detecting a biomarker, e.g., a biomarker associated with a biosignature of interest. Useful arrays or microarrays include without limitation DNA microarrays, such as cDNA microarrays, oligonucleotide microarrays and SNP microarrays, microRNA arrays, protein microarrays, antibody microarrays, tissue microarrays, cellular microarrays (also called transfection microarrays), chemical compound microarrays, and carbohydrate arrays (gly coarrays). These arrays are described in more detail above. In some embodiments, microarrays comprise biochips that provide high-density immobilized arrays of recognition molecules (e.g., aptamers or antibodies), where biomarker binding is monitored indirectly (e.g., via fluorescence).

[00159] An array or microarray that can be used to detect a biosignature comprising one or more aptamers described herein can be made according to the methods described in U.S. Pat. Nos. 6,329,209; 6,365,418; 6,406,921; 6,475,808; and 6,475,809, and U.S. Patent Application Ser. No. 10/884,269, each of which is herein incorporated by reference in its entirety. Custom arrays to detect specific can be made using the methods described in these patents. Commercially available microarrays can also be used to carry out the methods described herein, including without limitation those from Asymetrix (Santa Clara, CA), Illumina (San Diego, CA), Agilent (Santa Clara, CA), Exiqon (Denmark), or Invitrogen (Carlsbad, CA). Custom and/or commercial arrays include arrays for detection proteins, nucleic acids, and other biological molecules and entities (e.g., cells, vesicles, virii) as described herein.

[00160] In some embodiments, multiple capture molecules are disposed on an array, e.g., proteins, peptides or additional nucleic acid molecules. In certain embodiments, the proteins are immobilized using methods and materials that minimize the denaturing of the proteins, that minimize alterations in the activity of the proteins, or that minimize interactions between the protein and the surface on which they are immobilized. The capture molecules can comprise one or more aptamer described herein. In some embodiments, an array is constructed for the hybridization of a pool of aptamers. The array can then be used to identify pool members that bind a sample, thereby facilitating characterization of a phenotype. See FIGs. 8B-8C and related disclosure for further details.

[00161] Array surfaces useful may be of any desired shape, form, or size. Non-limiting examples of surfaces include chips, continuous surfaces, curved surfaces, flexible surfaces, fdms, plates, sheets, or tubes. Surfaces can have areas ranging from approximately a square micron to approximately 500 cm ² .

The area, length, and width of surfaces may be varied according to the requirements of the assay to be performed. Considerations may include, for example, ease of handling, limitations of the material(s) of which the surface is formed, requirements of detection systems, requirements of deposition systems (e.g., arrayers), or the like.

[00162] In certain embodiments, it is desirable to employ a physical means for separating groups or arrays of binding islands or immobilized biomolecules: such physical separation facilitates exposure of different groups or arrays to different solutions of interest. Therefore, in certain embodiments, arrays are situated within microwell plates having any number of wells. In such embodiments, the bottoms of the wells may serve as surfaces for the formation of arrays, or arrays may be formed on other surfaces and then placed into wells. In certain embodiments, such as where a surface without wells is used, binding islands may be formed or molecules may be immobilized on a surface and a gasket having holes spatially arranged so that they correspond to the islands or biomolecules may be placed on the surface. Such a gasket is preferably liquid tight. A gasket may be placed on a surface at any time during the process of making the array and may be removed if separation of groups or arrays is no longer desired.

[00163] In some embodiments, the immobilized molecules can bind to one or more biomarkers present in a biological sample contacting the immobilized molecules. Contacting the sample typically comprises overlaying the sample upon the array.

[00164] Modifications or binding of molecules in solution or immobilized on an array can be detected using detection techniques known in the art. Examples of such techniques include immunological techniques such as competitive binding assays and sandwich assays; fluorescence detection using instruments such as confocal scanners, confocal microscopes, or CCD-based systems and techniques such as fluorescence, fluorescence polarization (FP), fluorescence resonant energy transfer (FRET), total internal reflection fluorescence (TIRF), fluorescence correlation spectroscopy (FCS);

colorimetric/spectrometric techniques; surface plasmon resonance, by which changes in mass of materials adsorbed at surfaces are measured; techniques using radioisotopes, including conventional radioisotope binding and scintillation proximity assays (SPA); mass spectroscopy, such as matrix-assisted laser desorption/ionization mass spectroscopy (MAEDI) and MALDI-time of flight (TOF) mass spectroscopy; ellipsometry, which is an optical method of measuring thickness of protein films; quartz crystal microbalance (QCM), a very sensitive method for measuring mass of materials adsorbing to surfaces; scanning probe microscopies, such as atomic force microscopy (AFM), scanning force microscopy (SFM) or scanning electron microscopy (SEM); and techniques such as electrochemical, impedance, acoustic, microwave, and IR/Raman detection. See, e.g., Mere L, et al., "Miniaturized FRET assays and microfluidics: key components for ultra-high-throughput screening, "Drug Discovery Today 4(8):363-369 (1999), and references cited therein; LakowiczJ R, Principles of Fluorescence Spectroscopy, 2nd Edition, Plenum Press (1999), or Jain KK: Integrative Omics, Pharmacoproteomics, and Human Body Fluids. In: Thongboonkerd V, ed., ed. Proteomics of Human Body Fluids: Principles, Methods and Applications. Volume 1: Totowa, N.J. : Humana Press, 2007, each of which is herein incorporated by reference in its entirety.

[00165] Microarray technology can be combined with mass spectroscopy (MS) analysis and other tools. Electrospray interface to a mass spectrometer can be integrated with a capillary in a microfluidics device. For example, one commercially available system contains eTag reporters that are fluorescent labels with unique and well-defined electrophoretic mobilities; each label is coupled to biological or chemical probes via cleavable linkages. The distinct mobility address of each eTag reporter allows mixtures of these tags to be rapidly deconvoluted and quantitated by capillary electrophoresis. This system allows concurrent gene expression, protein expression, and protein function analyses from the same sample Jain KK: Integrative Omics, Pharmacoproteomics, and Human Body Fluids. In : Thongboonkerd V, ed., ed.

Proteomics of Human Body Fluids: Principles, Methods and Applications. Volume 1 : Totowa, N.J. : Humana Press, 2007, which is herein incorporated by reference in its entirety.

[00166] A biochip can include components for a microfluidic or nanofluidic assay. A microfluidic device can be used for isolating or analyzing biomarkers, such as determining a biosignature. Microfluidic systems allow for the miniaturization and compartmentalization of one or more processes for detecting a biosignature, and other processes. The microfluidic devices can use one or more detection reagents in at least one aspect of the system, and such a detection reagent can be used to detect one or more biomarkers. Various probes, antibodies, proteins, or other binding agents can be used to detect a biomarker within the microfluidic system. The detection agents, e.g., oligonucleotide probes described herein, may be immobilized in different compartments of the microfluidic device or be entered into a hybridization or detection reaction through various channels of the device.

[00167] Nanofabrication techniques are opening up the possibilities for biosensing applications that rely on fabrication of high-density, precision arrays, e.g., nucleotide-based chips and protein arrays otherwise known as heterogeneous nanoarrays. Nanofluidics allows a further reduction in the quantity of fluid analyte in a microchip to nanoliter levels, and the chips used here are referred to as nanochips. See, e.g., Unger Met al, Biotechniques 1999; 27(5): 1008-14, Kartalov EP et al, Biotechniques 2006; 40(l):85-90, each of which are herein incorporated by reference in their entireties. Commercially available nanochips currently provide simple one step assays such as total cholesterol, total protein or glucose assays that can be run by combining sample and reagents, mixing and monitoring of the reaction. Gel-free analytical approaches based on liquid chromatography (LC) and nanoLC separations ( Cutillas et al. Proteomics, 2005;5:101-112 and Cutillas et al., Mol Cell Proteomics 2005;4:1038-1051, each of which is herein incorporated by reference in its entirety) can be used in combination with the nanochips.

[00168] An array suitable for identifying a disease, condition, syndrome or physiological status can be included in a kit. A kit can include, an aptamer described herein, including as non-limiting examples, one or more reagents useful for preparing molecules for immobilization onto binding islands or areas of an array, reagents useful for detecting binding of biomarkers to immobilized molecules, e.g., aptamers, and instructions for use.

[00169] Further provided herein is a rapid detection device that facilitates the detection of a particular biosignature in a biological sample. The device can integrate biological sample preparation with polymerase chain reaction (PCR) on a chip. The device can facilitate the detection of a particular biosignature of a vesicle in a biological sample, and an example is provided as described in Pipper et al., Angewandte Chemie, 47(21), p. 3900-3904 (2008), which is herein incorporated by reference in its entirety. A biosignature can be incorporated using micro-/nano-electrochemical system (MEMS/NEMS) sensors and oral fluid for diagnostic applications as described in Li et al., Adv Dent Res 18(1): 3-5 (2005), which is herein incorporated by reference in its entirety.

[00170] As an alternative to planar arrays, assays using particles, such as bead based assays are also capable of use with an aptamer described herein. Aptamers are easily conjugated with commercially available beads. See, e.g., Srinivas et al. Anal. Chem. 2011 Oct. 21, Aptamer functionalized Microgel Particles for Protein Detection ; See also, review article on aptamers as therapeutic and diagnostic agents, Brody and Gold, Rev. Mol. Biotech. 2000, 74:5-13.

[00171] Multiparametric assays or other high throughput detection assays using bead coatings with cognate ligands and reporter molecules with specific activities consistent with high sensitivity automation can be used. In a bead based assay system, a binding agent such as an antibody or aptamer can be immobilized on an addressable microsphere. Each binding agent for each individual binding assay can be coupled to a distinct type of microsphere (i.e., microbead) and the assay reaction takes place on the surface of the microsphere, such as depicted in FIG. IB. In a non-limiting example, a binding agent for a cell or microvesicle can be a capture antibody or aptamer coupled to a bead. Dyed microspheres with discrete fluorescence intensities are loaded separately with their appropriate binding agent or capture probes. The different bead sets carrying different binding agents can be pooled as desired to generate custom bead arrays. Bead arrays are then incubated with the sample in a single reaction vessel to perform the assay.

[00172] Bead-based assays can be used with one or more aptamers described herein. A bead substrate can provide a platform for attaching one or more binding agents, including aptamer(s). For multiplexing, multiple different bead sets (e.g., Illumina, Luminex) can have different binding agents (specific to different target molecules). For example, a bead can be conjugated to an aptamer described herein and used to detect the presence (quantitatively or qualitatively) of an antigen of interest, or it can also be used to isolate a component present in a selected biological sample (e.g., cell, cell-fragment or vesicle comprising the target molecule to which the aptamer is configured to bind or associate). Any molecule of organic origin can be successfully conjugated to a polystyrene bead through use of commercially available kits.

[00173] One or more aptamers described herein can be used with any bead based substrate, including but not limited to magnetic capture method, fluorescence activated cell sorting (FACS) or laser cytometry. Magnetic capture methods can include, but are not limited to, the use of magnetically activated cell sorter (MACS) microbeads or magnetic columns. Examples of bead or particle based methods that can be modified to use an aptamer described herein include methods and bead systems described in U.S. Patent Nos. 4,551,435, 4,795,698, 4,925,788, 5,108,933, 5,186,827, 5,200,084 or 5,158,871; 7,399,632;

8,124,015; 8,008,019; 7,955,802; 7,445,844; 7,274,316; 6,773,812; 6,623,526; 6,599,331; 6,057,107; 5,736,330; International Patent Publication Nos. WO/2012/ 174282; WO/1993/022684.

[00174] Isolation or detection of circulating biomarkers, e.g., protein antigens, from a biological sample, or of the biomarker-comprising cells, cell fragments or vesicles may also be achieved using an aptamer described herein in a cytometry process. As a non-limiting example, aptamers described herein can be used in an assay comprising using a particle such as a bead or microsphere. The aptamers described herein provide binding agents which may be conjugated to the particle. Flow cytometry can be used for sorting microscopic particles suspended in a stream of fluid. As particles pass through they can be selectively charged and on their exit can be deflected into separate paths of flow. It is therefore possible to separate populations from an original mix, such as a biological sample, with a high degree of accuracy and speed. Flow cytometry allows simultaneous multiparametric analysis of the physical and/or chemical characteristics of single cells flowing through an optical/electronic detection apparatus. A beam of light, usually laser light, of a single frequency (color) is directed onto a hydrodynamically focused stream of fluid. A number of detectors are aimed at the point where the stream passes through the light beam; one in line with the light beam (Forward Scatter or FSC) and several perpendicular to it (Side Scatter or SSC) and one or more fluorescent detectors.

[00175] Each suspended particle passing through the beam scatters the light in some way, and fluorescent chemicals in the particle may be excited into emitting light at a lower frequency than the light source. This combination of scattered and fluorescent light is picked up by the detectors, and by analyzing fluctuations in brightness at each detector (one for each fluorescent emission peak), it is possible to deduce various facts about the physical and chemical structure of each individual particle. FSC correlates with the cell size and SSC depends on the inner complexity of the particle, such as shape of the nucleus, the amount and type of cytoplasmic granules or the membrane roughness. Some flow cytometers have eliminated the need for fluorescence and use only light scatter for measurement.

[00176] Flow cytometers can analyze several thousand particles every second in "real time" and can actively separate out and isolate particles having specified properties. They offer high-throughput automated quantification, and separation, of the set parameters for a high number of single cells during each analysis session. Flow cytometers can have multiple lasers and fluorescence detectors, allowing multiple labels to be used to more precisely specify a target population by their phenotype. Thus, a flow cytometer, such as a multicolor flow cytometer, can be used to detect targets of interest using multiple fluorescent labels or colors. In some embodiments, the flow cytometer can also sort or isolate different targets of interest, such as by size or by different markers.

[00177] The flow cytometer may have one or more lasers, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more lasers. In some embodiments, the flow cytometer can detect more than one color or fluorescent label, such as at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 different colors or fluorescent labels. For example, the flow cytometer can have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16,

17, 18, 19, or 20 fluorescence detectors.

[00178] Examples of commercially available flow cytometers include, but are not limited to .the MoFlo™ XDP Cell Sorter (Beckman Coulter, Brea, CA), MoFlo™ Legacy Cell Sorter (Beckman Coulter, Brea, CA), BD FACSAria™ Cell Sorter (BD Biosciences, San Jose, CA), BD™ LSRII (BD Biosciences, San Jose, CA), and BD FACSCalibur™ (BD Biosciences, San Jose, CA). Use of multicolor or multi-fluor cytometers can be used in multiplex analysis. In some embodiments, the flow cytometer can sort, and thereby collect or sort more than one population of cells, microvesicles, or particles, based one or more characteristics. For example, two populations differ in size, such that the populations have a similar size range can be differentially detected or sorted. In another embodiment, two different populations are differentially labeled. [00179] The data resulting from flow-cytometers can be plotted in 1 dimension to produce histograms or seen in 2 dimensions as dot plots or in 3 dimensions with newer software. The regions on these plots can be sequentially separated by a series of subset extractions which are termed gates. Specific gating protocols exist for diagnostic and clinical purposes especially in relation to hematology. The plots are often made on logarithmic scales. Because different fluorescent dye's emission spectra overlap, signals at the detectors have to be compensated electronically as well as computationally. Fluorophores for labeling biomarkers may include those described in Ormerod, Flow Cytometry 2nd ed, Springer-Verlag, New York (1999), and in Nida et al., Gynecologic Oncology 2005 ;4 889-894 which is incorporated herein by reference. In a multiplexed assay, including but not limited to a flow cytometry assay, one or more different target molecules can be assessed using an aptamer described herein.

[00180] One or more aptamer described herein can be disposed on any useful planar or bead substrate. In one aspect, one or more aptamer described herein is disposed on a microfluidic device, thereby facilitating assessing, characterizing or isolating a component of a biological sample comprising a polypeptide antigen of interest or a functional fragment thereof. For example, the circulating antigen or a cell, cell fragment or cell-derived microvesicles comprising the antigen can be assessed using one or more aptamers described herein (alternatively along with additional binding agents). Microfluidic devices, which may also be referred to as "lab-on-a-chip" systems, biomedical micro-electro-mechanical systems (bioMEMs), or multicomponent integrated systems, can be used for isolating and analyzing such entities. Such systems miniaturize and compartmentalize processes that allow for detection of biosignatures and other processes.

[00181] A microfluidic device can also be used for isolation of a cell, cell fragment or cell-derived microvesicles through size differential or affinity selection. For example, a microfluidic device can use one more channels for isolating entities from a biological sample based on size or by using one or more binding agents. A biological sample can be introduced into one or more microfluidic channels, which selectively allows the passage of the entity. The selection can be based on a property such as the size, shape, deformability, or biosignature.

[00182] In some embodiments, a heterogeneous population of cells, cell fragments, microvesicles or other biomarkers (e.g., protein complexes) is introduced into a microfluidic device, and one or more different homogeneous populations of such entities can be obtained. For example, different channels can have different size selections or binding agents to select for different populations of such entities. Thus, a microfluidic device can isolate a plurality of entities wherein at least a subset of the plurality comprises a different biosignature from another subset of the plurality. For example, the microfluidic device can isolate at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 different subsets, wherein each subset comprises a different biosignature.

[00183] In some embodiments, the microfluidic device can comprise one or more channels that permit further enrichment or selection of targets of interest. A population that has been enriched after passage through a first channel can be introduced into a second channel, which allows the passage of the desired population to be further enriched, such as through one or more binding agents present in the second channel.

[00184] Array -based assays and bead-based assays can be used with a microfluidic device. For example, the binding agent, such as an oligonucleotide probe, can be coupled to beads and the binding reaction between the beads and targets of the binding agent can be performed in a microfluidic device.

Multiplexing can also be performed using a microfluidic device. Different compartments can comprise different binding agents for different target populations. In some embodiments, each population has a different biosignature. The hybridization reaction between the microsphere and target can be performed in a microfluidic device and the reaction mixture can be delivered to a detection device. The detection device, such as a dual or multiple laser detection system can be part of the microfluidic system and can use a laser to identify each bead or microsphere by its color-coding, and another laser can detect the hybridization signal associated with each bead.

[00185] Any appropriate microfluidic device can be used in the methods described herein. Examples of microfluidic devices that may be used include but are not limited to those described in U.S. Pat. Nos. 7,591,936, 7,581,429, 7,579,136, 7,575,722, 7,568,399, 7,552,741, 7,544,506, 7,541,578, 7,518,726, 7,488,596, 7,485,214, 7,467,928, 7,452,713, 7,452,509, 7,449,096, 7,431,887, 7,422,725, 7,422,669, 7,419,822, 7,419,639, 7,413,709, 7,411,184, 7,402,229, 7,390,463, 7,381,471, 7,357,864, 7,351,592, 7,351,380, 7,338,637, 7,329,391, 7,323,140, 7,261,824, 7,258,837, 7,253,003, 7,238,324, 7,238,255, 7,233,865, 7,229,538, 7,201,881, 7,195,986, 7,189,581, 7,189,580, 7,189,368, 7,141,978, 7, 138,062, 7,135,147, 7,125,711, 7,118,910, 7,118,661, 7,640,947, 7,666,361, 7,704,735; and International Patent Publication WO 2010/072410; each of which patents or applications are incorporated herein by reference in their entirety. Another example for use with methods disclosed herein is described in Chen et al., “Microfluidic isolation and transcriptome analysis of serum vesicles,” Lab on a Chip, Dec. 8, 2009 DOI: 10.1039/b916199f

[00186] Other microfluidic devices for use with the compositions and method described herein include devices comprising elastomeric layers, valves and pumps, including without limitation those disclosed in U.S. Patent Nos. 5,376,252, 6,408,878, 6,645,432, 6,719,868, 6,793,753, 6,899,137, 6,929,030, 7,040,338, 7,118,910, 7,144,616, 7,216,671, 7,250,128, 7,494,555, 7,501,245, 7,601,270, 7,691,333, 7,754,010, 7,837,946; U.S. Patent Application Nos. 2003/0061687, 2005/0084421, 2005/0112882, 2005/0129581, 2005/0145496, 2005/0201901, 2005/0214173, 2005/0252773, 2006/0006067; and EP Patent Nos.

0527905 and 1065378; each of which application is herein incorporated by reference..

[00187] The microfluidic device can have one or more binding agents attached to a surface in a channel, or present in a channel. For example, the microchannel can have one or more capture agents, such as an oligonucleotide probe described herein. The surface of the channel can also be contacted with a blocking aptamer if desired. In some embodiments, a microchannel surface is treated with avidin/streptavidin and a capture agent, such as an antibody or aptamer, that is biotinylated can be injected into the channel to bind the avidin. In other embodiments, the capture agents are present in chambers or other components of a microfluidic device. The capture agents can also be attached to beads that can be manipulated to move through the microfluidic channels. In some embodiments, the capture agents are attached to magnetic beads. The beads can be manipulated using magnets.

[00188] A biological sample can be flowed into the microfluidic device, or a microchannel, at rates such as at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 mΐ per minute, such as between about 1-50, 5-40, 5-30, 3-20 or 5-15 mΐ per minute. One or more targets of interest can be captured and directly detected in the microfluidic device. Alternatively, the captured target may be released and exit the microfluidic device prior to analysis. In another embodiment, one or more captured cells or microvesicles are lysed in the microchannel and the lysate can be analyzed. Lysis buffer can be flowed through the channel. The lysate can be collected and analyzed, such as performing RT- PCR, PCR, mass spectrometry, Western blotting, or other assays, to detect one or more biomarkers of the captured cells or microvesicles.

[00189] Samples may be processed to isolate (in whole or in part) biomarkers of interest when performing analysis using the oligonucleotide probes described herein. Isolation can be performed using various techniques as useful and desirable, including without limitation size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, affinity capture, immunoassay, immunoprecipitation, microfluidic separation, flow cytometry, polymeric isolation (e.g., using polyethylene glycol (PEG)) or combinations thereof. Methods and techniques for isolation and analysis are disclosed in International Patent

Application Nos. PCT/US2009/62880, filed October 30, 2009; PCT/US2009/006095, filed November 12, 2009; PCT/US2011/26750, filed March 1, 2011; PCT/US2011/031479, filed April 6, 2011;

PCT/US 11/48327, filed August 18, 2011; PCT/US2008/71235, filed July 25, 2008; PCT/US10/58461, filed November 30, 2010; PCT/US2011/21160, filed January 13, 2011; PCT/US2013/030302, filed March 11, 2013; PCT/US 12/25741, filed February 17, 2012; PCT/2008/76109, filed September 12, 2008;

PCT/US 12/42519, filed June 14, 2012; PCT/US 12/50030, filed August 8, 2012; PCT/US 12/49615, filed August 3, 2012; PCT/US12/41387, filed June 7, 2012; PCT/US2013/072019, filed November 26, 2013; PCT/US2014/039858, filed May 28, 2013; PCT/IB2013/003092, filed October 23, 2013;

PCT/US 13/76611, filed December 19, 2013; PCT/US 14/53306, filed August 28, 2014; and

PCT/US 15/62184, filed November 23, 2015; PCT/US 16/40157, filed June 29, 2016; PCT/US16/44595, filed July 28, 2016; and PCT/US16/21632, filed March 9, 2016; each of which applications is incorporated herein by reference in its entirety.

[00190] The compositions and methods described herein can be used in and with various immune assay formats. Immunoaffinity assays can be based on antibodies and aptamers selectively immunoreactive with proteins or other biomarkers of interest. These techniques include without limitation immunoprecipitation, Western blot analysis, molecular binding assays, enzyme-linked immunosorbent assay (ELISA), enzyme- linked immunofiltration assay (ELIFA), fluorescence activated cell sorting (FACS),

immunohistochemistry (IHC) and the like. For example, an optional method of detecting the expression of a biomarker in a sample comprises contacting the sample with an antibody or aptamer against the biomarker, or an immunoreactive fragment thereof, or a recombinant protein containing an antigen binding region against the biomarker; and then detecting the binding of the biomarker in the sample. Various methods for producing antibodies and aptamers are known in the art. Such binding agents can be used to immunoprecipitate specific proteins from solution samples or to immunoblot proteins separated by, e.g., polyacrylamide gels. Immunocytochemical methods can also be used in detecting specific protein polymorphisms in tissues or cells. Other well-known immunoassay techniques can also be used including, e.g., ELISA, radioimmunoassay (RIA), immunoradiometric assays (IRMA) and immunoenzymatic assays (IEMA), including sandwich assays. See, e.g., U.S. Pat. Nos. 4,376,110 and 4,486,530, both of which are incorporated herein by reference.

[00191] In alternative methods, a sample may be contacted with an antibody or aptamer specific for a biomarker under conditions sufficient for a complex to form, and then detecting such complex. The presence of the biomarker may be detected in a number of ways, such as by Western blotting and ELISA procedures for assaying a wide variety of tissues and samples, including bodily fluids such as plasma or serum. A wide range of immunoassay techniques using such an assay format are available, see, e.g., U.S. Pat. Nos. 4,016,043, 4,424,279 and 4,018,653. These include both single-site and two-site or“sandwich” assays of the non-competitive types, as well as in the traditional competitive binding assays. These assays also include direct binding of a labelled antibody or aptamer to a target biomarker.

[00192] There are a number of variations of the sandwich assay technique which can be encompassed within the compositions and method described herein. In a typical forward assay, an unlabeled binding agent, e.g., an antibody or aptamer, is immobilized on a solid substrate, and the sample to be tested brought into contact with the bound molecule. After a suitable period of of time sufficient to allow formation of an complex, a second binding agent specific to the antigen, labelled with a reporter molecule capable of producing a detectable signal is then added and incubated, allowing time sufficient for the formation of another complex comprising the labelled binding agent. Any unreacted material is washed away, and the presence of the antigen is determined by observation of a signal produced by the reporter molecule. The results may either be qualitative, by simple observation of the visible signal, or may be quantitated by comparing with a control sample containing known amounts of biomarker.

[00193] Variations on the above assay include a simultaneous assay, in which both sample and labelled binding agent are added simultaneously to the tethered binding agent. In a typical forward sandwich assay, a first binding agent, e.g., an antibody or aptamer, having specificity for a tissue/cell/biomarker or such target of interest is either covalently or passively bound to a solid surface. The solid surface is typically glass or a polymer, the most commonly used polymers being cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene. The solid supports may be in the form of tubes, beads, discs of microplates, or any other surface suitable for conducting an immunoassay. The binding processes generally consist of cross-linking, covalently binding or physically adsorbing, the polymer-antibody complex to the support, which is then washed in preparation for the test sample. An aliquot of the sample to be tested is then added to the solid phase complex and incubated for a period of time sufficient (e.g., 2- 40 minutes or overnight) and under suitable conditions (e.g. ,from room temperature to 40°C such as between 25 °C and 32°C inclusive) to allow binding of the target to the support. Following the incubation period, the support is washed and incubated with a second binding agent specific for a portion of the biomarker. The second binding agent is linked to a reporter molecule which is used to indicate the binding of the second binding agent to the molecular marker.

[00194] An alternative method involves immobilizing the target biomarkers in the sample and then exposing the immobilized target to specific binding agents, e.g., antibodies or aptamers, which may or may not be labelled with a reporter molecule. Depending on the amount of target and the strength of the reporter molecule signal, a bound target may be detectable by direct labelling with the binding agent. Alternatively, a second labelled binding agent, specific to the first binding agent, is exposed to the first target complex to form a tertiary complex. The complex is detected by the signal emitted by the reporter molecule. A“reporter molecule” includes molecule which, by its chemical nature, provides an analytically identifiable signal which allows the detection of antigen-bound complexes. Some commonly used reporter molecules in this type of assay include enzymes, fluorophores or radionuclide containing molecules (i.e. radioisotopes) and chemiluminescent molecules. Examples of such detectable labels are disclosed herein.

[00195] In the case of an enzyme immunoassay, an enzyme is conjugated to the secondary binding agent. Commonly used enzymes include horseradish peroxidase, glucose oxidase, b-galactosidase and alkaline phosphatase, amongst others. The substrates to be used with the specific enzymes are generally chosen for the production, upon hydrolysis by the corresponding enzyme, of a detectable color change. Examples of suitable enzymes include alkaline phosphatase and peroxidase. It is also possible to employ fluorogenic substrates, which yield a fluorescent product rather than the chromogenic substrates noted above. In all cases, the enzyme-labelled binding agent is added to the first bound molecular marker complex, allowed to bind, and then the excess reagent is washed away. A solution containing the appropriate substrate is then added to the tertiary complex comprising primary binding agent, antigen, and secondary binding agent. The substrate will react with the enzyme linked to the secondary binding agent, giving a qualitative visual signal, which may be further quantitated, usually spectrophotometrically, to give an indication of the amount of antigen which was present in the sample. Alternately, fluorescent compounds, such as fluorescein and rhodamine, may be chemically coupled to secondary binding agent without altering their binding capacity. When activated by illumination with light of a particular wavelength, the fluorochrome- labelled secondary binding agent adsorbs the light energy, inducing a state to excitability in the molecule, followed by emission of the light at a characteristic color visually detectable with a light microscope. As in the EIA, the fluorescent labelled secondary binding agent is allowed to bind to antigen complex. After washing off the unbound reagent, the remaining tertiary complex is then exposed to the light of the appropriate wavelength. The fluorescence observed indicates the presence of the molecular marker of interest. Immunofluorescence and EIA techniques are both very well established in the art. However, other reporter molecules, such as radioisotope, chemiluminescent or bioluminescent molecules, may also be employed.

[00196] Immunohistorchemistry (IHC) is a process of localizing antigens (e.g., proteins) in cells of a tissue using binding agents (e.g., antibodies or aptamers) specifically to antigens in the tissues. The antigen-binding binding agent can be conjugated or fused to a tag that allows its detection, e.g., via visualization. In some embodiments, the tag is an enzyme that can catalyze a color-producing reaction, such as alkaline phosphatase or horseradish peroxidase. The enzyme can be fused to the binding agent or non-covalently bound, e.g., using a biotin-avadin/streptavidin system. Alternatively, the binding agent can be tagged with a fluorophore, such as fluorescein, rhodamine, Dy Light Fluor or Alexa Fluor. The binding agent can be directly tagged or it can itself be recognized by a secondary detection binding agent (antibody or antigen) that carries the tag. Using IHC, one or more proteins may be detected. The expression of a gene product can be related to its staining intensity compared to control levels. In some embodiments, the gene product is considered differentially expressed if its staining varies at least 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.2, 2.5, 2.7, 3.0, 4, 5, 6, 7, 8, 9 or 10-fold in the sample versus the control.

[00197] IHC comprises the application of such immunoassay formats to histochemical techniques. In an illustrative example, a tissue section is mounted on a slide and is incubated with a binding agent. The binding agents are typically polyclonal or monoclonal antibodies, and can be aptamers such as oligonucleotide probes described herein, specific to the antigen. The primary reaction comprises contacting the tissue section with this primary binding agent, forming primary complexes. The antigen- antibody signal is then amplified using a second binding agent conjugated to a complex of that can provide a visible signal, such as enzymes including without limitation peroxidase antiperoxidase (PAP), avidin-biotin-peroxidase (ABC) or avidin-biotin alkaline phosphatase. In the presence of substrate and chromogen, the enzyme forms a colored deposit at the sites of primary complexes. Immunofluorescence is an alternate approach to visualize antigens. In this technique, the primary signal is amplified using a second binding agent conjugated to a fluorochrome. On UV light absorption, the fluorochrome emits its own light at a longer wavelength (fluorescence), thus allowing localization of the primary complexes.

[00198] The methods described herein may comprise performing an IHC assay using an oligonucleotide probe library. This may be referred to as a polyligand histochemistry assay (PHC) or poly-ligand profiling (PLP). As an example of this approach, a tissue section is contacted with an enriched oligonucleotide probe library. Members of the library can be labeled, e.g., with a biotin molecule, digoxigenin, or other label as appropriate. The bound library members are visualized using a secondary labeling system, e.g., streptavidin-horse radish peroxidase (SA-HRP) or anti-digoxigenin horse radish peroxidase. The resulting slides can be read and scored as in typical antibody based IHC methods. See Examples 14-16 herein.

Oligonucleotide Probes / Aptamers

[00199] Aptamers have a number of desirable characteristics for use as therapeutics and diagnostics including high specificity and affinity, biological efficacy, and excellent pharmacokinetic properties. In addition, they offer certain advantages over antibodies and other protein biologies. For example, aptamers are produced by an entirely in vitro process, allowing for the rapid synthesis. In vitro selection allows the specificity and affinity of the aptamer to be tightly controlled. In addition, aptamers as a class have demonstrated little or no toxicity or immunogenicity. Whereas the efficacy of many monoclonal antibodies can be severely limited by immune response to antibodies themselves, it is difficult to elicit antibodies to aptamers most likely because aptamers cannot be presented by T-cells via the MHC and the immune response is generally trained not to recognize nucleic acid fragments. Whereas most currently approved antibody therapeutics are administered by intravenous infusion (typically over 2-4 hours), aptamers can be administered by subcutaneous injection. This difference is primarily due to the comparatively low solubility and thus large volumes necessary for most therapeutic mAbs. With good solubility (>150 mg/mL) and comparatively low molecular weight (aptamer: 10-50 kDa; antibody: 150 kDa), a weekly dose of aptamer may be delivered by injection in a volume of less than 0.5 mL. In addition, the small size of aptamers allows them to penetrate into areas of conformational constrictions that do not allow for antibodies or antibody fragments to penetrate, presenting yet another advantage of aptamer-based therapeutics or prophylaxis.

[00200] Aptamers are chemically synthesized and are readily scaled as needed to meet production demand for diagnostic or therapeutic applications. In addition, aptamers are chemically robust. They can be adapted to regain activity following exposure to factors such as heat and denaturants and can be stored for extended periods (>1 yr) at room temperature as lyophilized powders.

[00201] SELEX

[00202] The classical method for generating an aptamer is with the process entitled“Systematic Evolution of Ligands by Exponential Enrichment” (“SELEX”) generally described in, e.g., U.S. patent application Ser. No. 07/536,428, fded Jun. 11, 1990, now abandoned, U.S. Pat. No. 5,475,096 entitled“Nucleic Acid Ligands”, and U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled“Nucleic Acid Ligands.” Each SELEX -identified nucleic acid ligand, i.e., each aptamer (or oligonucleotide probe), is a specific ligand of a given target compound or molecule. The SELEX process is based on the insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with any variety of chemical compounds, whether monomeric or polymeric. Molecules of any size or composition can serve as targets.

[00203] SELEX relies as a starting point upon a large library or pool of single stranded oligonucleotides comprising randomized sequences. The oligonucleotides can be modified or unmodified DNA, RNA, or DNA/RNA hybrids. In some examples, the pool comprises 100% random or partially random oligonucleotides. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed and/or conserved sequence incorporated within randomized sequence. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed and/or conserved sequence at its 5' and/or 3' end which may comprise a sequence shared by all the molecules of the oligonucleotide pool. Fixed sequences are sequences such as hybridization sites for PCR primers, promoter sequences for RNA polymerases (e.g., T3, T4, T7, and SP6), restriction sites, or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, and other sequences to facilitate cloning and/or sequencing of an oligonucleotide of interest. Conserved sequences are sequences, other than the previously described fixed sequences, shared by a number of aptamers that bind to the same target.

[00204] The oligonucleotides of the pool preferably include a randomized sequence portion as well as fixed sequences necessary for efficient amplification. Typically the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences which flank an internal region of 30-50 random nucleotides.

The randomized nucleotides can be produced in a number of ways including chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in test nucleic acids can also be introduced or increased by mutagenesis before or during the selection/amplification iterations.

[00205] The random sequence portion of the oligonucleotide can be of any appropriate length and can comprise ribonucleotides and/or deoxyribonucleotides and can include modified or non-natural nucleotides or nucleotide analogs. See, e.g. U.S. Pat. No. 5,958,691; U.S. Pat. No. 5,660,985; U.S. Pat.

No. 5,958,691; U.S. Pat. No. 5,698,687; U.S. Pat. No. 5,817,635; U.S. Pat. No. 5,672,695, and PCT Publication WO 92/07065. Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques well known in the art. See, e.g., Froehler et al., Nucl. Acid Res. 14:5399-5467 (1986) and Froehler et al., Tet. Lett. 27:5575-5578 (1986). Random oligonucleotides can also be synthesized using solution phase methods such as triester synthesis methods. See, e.g., Sood et al., Nucl. Acid Res. 4:2557 (1977) and Hirose et al., Tet. Lett., 28:2449 (1978). Typical syntheses carried out on automated DNA synthesis equipment yield 10 ¹⁴ -10 ¹⁶ individual molecules, a number sufficient for most SELEX experiments. Sufficiently large regions of random sequence in the sequence design increases the likelihood that each synthesized molecule is likely to represent a unique sequence.

[00206] The starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesizer. To synthesize randomized sequences, mixtures of all four nucleotides are added at each nucleotide addition step during the synthesis process, allowing for random incorporation of nucleotides.

As stated above, in some embodiments, random oligonucleotides comprise entirely random sequences; however, in other embodiments, random oligonucleotides can comprise stretches of nonrandom or partially random sequences. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step.

[00207] The starting library of oligonucleotides may be for example, RNA, DNA, or RNA/DNA hybrid. A starting RNA library can be generated by transcribing a DNA library in vitro using T7 RNA polymerase or modified T7 RNA polymerases and purified. The library is then mixed with the target under conditions favorable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. More specifically, starting with a mixture containing the starting pool of nucleic acids, the SELEX method includes steps of: (a) contacting the mixture with the target under conditions favorable for binding; (b) partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule. In those instances where RNA aptamers are being selected, the SELEX method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process.

[00208] Within a nucleic acid mixture containing a large number of possible sequences and structures, there is a wide range of binding affinities for a given target. A nucleic acid mixture comprising, for example, a 20 nucleotide randomized segment can have 4 ²⁰ candidate possibilities. Those which have the higher affinity constants for the target are most likely to bind to the target. After partitioning, dissociation and amplification, a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favor better ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested for binding affinity as pure ligands or aptamers.

[00209] Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle. The method is typically used to sample approximately 10 ¹⁴ different nucleic acid species but may be used to sample as many as about 10 ¹⁸ different nucleic acid species. Generally, nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure. In some

embodiments, heterogeneity is introduced only in the initial selection stages and does not occur throughout the replicating process.

[00210] In some embodiments of SELEX, the selection process is so efficient at isolating those nucleic acid ligands that bind most strongly to the selected target, that only one cycle of selection and amplification is required. Such an efficient selection may occur, for example, in a chromatographic-type process wherein the ability of nucleic acids to associate with targets bound on a column operates in such a manner that the column is sufficiently able to allow separation and isolation of the highest affinity nucleic acid ligands.

[00211] In many cases, it is not necessarily desirable to perform the iterative steps of SELEX until a single nucleic acid ligand is identified. The target-specific nucleic acid ligand solution may include a family of nucleic acid structures or motifs that have a number of conserved sequences and a number of sequences which can be substituted or added without significantly affecting the affinity of the nucleic acid ligands to the target. By terminating the SELEX process prior to completion, it is possible to determine the sequence of a number of members of the nucleic acid ligand solution family. The compositions and method described herein provide for the identification of aptamer pools and uses thereof that jointly can be used to characterize a test sample. For example, the aptamer pools can be identified through rounds of positive and negative selection to identify cells, tissue or microvesicles indicative of a disease or condition or a state thereof. The compositions and method described herein further provide use of such aptamer pools to stain, detect and/or quantify such cells, tissue or microvesicles in a sample, thereby allowing a diagnosis, prognosis or theranosis to be provided.

[00212] A variety of nucleic acid primary, secondary and tertiary structures are known to exist. The structures or motifs that have been shown most commonly to be involved in non-Watson-Crick type interactions are referred to as hairpin loops, symmetric and asymmetric bulges, pseudoknots and myriad combinations of the same. Such motifs can typically be formed in a nucleic acid sequence of no more than 30 nucleotides. For this reason, it is often preferred that SELEX procedures with contiguous randomized segments be initiated with nucleic acid sequences containing a randomized segment of between about 20 to about 50 nucleotides and in some embodiments, about 30 to about 40 nucleotides. In one example, the 5'-fixed:random:3'-fixed sequence comprises a random sequence of about 30 to about 50 nucleotides. The random region may be referred to as the variable region herein.

[00213] The core SELEX method has been modified to achieve a number of specific objectives. For example, U.S. Pat. No. 5,707,796 describes the use of SELEX in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. Pat. No. 5,763,177 describes SELEX based methods for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S.

Pat. No. 5,567,588 and U.S. Pat. No. 5,861,254 describe SELEX based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S.

Pat. No. 5,496,938 describes methods for obtaining improved nucleic acid ligands after the SELEX process has been performed. U.S. Pat. No. 5,705,337 describes methods for covalently linking a ligand to its target.

[00214] SELEX can also be used to obtain nucleic acid ligands that bind to more than one site on the target molecule, and to obtain nucleic acid ligands that include non-nucleic acid species that bind to specific sites on the target. SELEX provides means for isolating and identifying nucleic acid ligands which bind to any envisionable target, including large and small biomolecules such as nucleic acid binding proteins and proteins not known to bind nucleic acids as part of their biological function as well as lipids, cofactors and other small molecules. For example, U.S. Pat. No. 5,580,737 discloses nucleic acid sequences identified through SELEX which are capable of binding with high affinity to caffeine and the closely related analog, theophylline.

[00215] Counter-SELEX is a method for improving the specificity of nucleic acid ligands to a target molecule by eliminating nucleic acid ligand sequences with cross-reactivity to one or more non-target molecules. Counter-SELEX is comprised of the steps of: (a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture; (d) dissociating the increased affinity nucleic acids from the target; e) contacting the increased affinity nucleic acids with one or more non-target molecules such that nucleic acid ligands with specific affinity for the non-target molecule(s) are removed; and (f) amplifying the nucleic acids with specific affinity only to the target molecule to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity and specificity for binding to the target molecule. As described above for SELEX, cycles of selection and amplification are repeated until a desired goal is achieved.

[00216] A potential problem encountered in the use of nucleic acids as therapeutics and vaccines is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. The SELEX method thus encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the ribose and/or phosphate and/or base positions. SELEX identified nucleic acid ligands containing modified nucleotides are described, e.g., in U.S. Pat. No. 5,660,985, which describes oligonucleotides containing nucleotide derivatives chemically modified at the 2' position of ribose, 5' position of pyrimidines, and 8' position of purines, U.S. Pat. No. 5,756,703 which describes oligonucleotides containing various 2'- modified pyrimidines, and U.S. Pat. No. 5,580,737 which describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2'-amino ( — NH ₂ ), 2'-fluoro (2'-F), and/or 2'-0-methyl (2'-OMe) substituents.

[00217] Modifications of the nucleic acid ligands contemplated herein include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole. Modifications to generate oligonucleotide populations which are resistant to nucleases can also include one or more substitute intemucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include, but are not limited to, 2'- position sugar modifications, 5 -position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil; backbone modifications, phosphorothioate or allyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanosine. Modifications can also include 3' and 5' modifications such as capping.

[00218] In some embodiments, oligonucleotides are provided in which the P(0)0 group is replaced by P(0)S (“thioate”), P(S)S (“dithioate”), P(0)NR ₂ (“amidate”), P(0)R, P(0)OR', CO or CH ₂ (“formacetal”) or 3'-amine (— NH— CH ₂ — CH ₂ — ), wherein each R or R' is independently H or substituted or unsubstituted alkyl. Linkage groups can be attached to adjacent nucleotides through an -0-,— N— , or— S— linkage. Not all linkages in the oligonucleotide are required to be identical. As used herein, the term phosphorothioate encompasses one or more non-bridging oxygen atoms in a phosphodiester bond replaced by one or more sulfur atoms.

[00219] In further embodiments, the oligonucleotides comprise modified sugar groups, for example, one or more of the hydroxyl groups is replaced with halogen, aliphatic groups, or functionalized as ethers or amines. In some embodiments, the 2'-position of the furanose residue is substituted by any of an O- methyl, O-alkyl, O-allyl, S-alkyl, S-allyl, or halo group. Methods of synthesis of 2'-modified sugars are described, e.g., in Sproat, et al., Nucl. Acid Res. 19:733-738 (1991); Cotten, et al., Nucl. Acid Res.

19:2629-2635 (1991); and Hobbs, et al., Biochemistry 12:5138-5145 (1973). Other modifications are known to one of ordinary skill in the art. Such modifications may be pre-SELEX process modifications or post-SELEX process modifications (modification of previously identified unmodified ligands) or may be made by incorporation into the SELEX process. [00220] Pre-SELEX process modifications or those made by incorporation into the SELEX process yield nucleic acid ligands with both specificity for their SELEX target and improved stability, e.g., in vivo stability. Post-SELEX process modifications made to nucleic acid ligands may result in improved stability, e.g., in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand.

[00221] The SELEX method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S. Pat. No. 5,637,459 and U.S. Pat. No. 5,683,867. The SELEX method further encompasses combining selected nucleic acid ligands with lipophilic or non-immunogenic high molecular weight compounds in a diagnostic or therapeutic complex, as described, e.g., in U.S. Pat. No. 6,011,020, U.S. Pat. No. 6,051,698, and PCT Publication No. WO 98/18480. These patents and applications teach the combination of a broad array of shapes and other properties, with the efficient amplification and replication properties of oligonucleotides, and with the desirable properties of other molecules.

[00222] The identification of nucleic acid ligands to small, flexible peptides via the SELEX method has also been explored. U.S. Pat. No. 5,648,214 identified high affinity RNA nucleic acid ligands to an 11 amino acid.

[00223] Aptamers / oligonucleotide probes with desired specificity and binding affinity to the target(s) of interest herein can be selected by the SELEX N process as described herein. As part of the SELEX process, the sequences selected to bind to the target are then optionally minimized to determine the minimal sequence having the desired binding affinity. The selected sequences and/or the minimized sequences are optionally optimized by performing random or directed mutagenesis of the sequence to increase binding affinity or alternatively to determine which positions in the sequence are essential for binding activity. Additionally, selections can be performed with sequences incorporating modified nucleotides to stabilize the aptamer molecules against degradation in vivo.

[00224] For an aptamer to be suitable for use as a therapeutic, it is preferably inexpensive to synthesize, and safe and stable in vivo. Wild-type RNA and DNA aptamers are typically not stable is vivo because of their susceptibility to degradation by nucleases. Resistance to nuclease degradation can be greatly increased by the incorporation of modifying groups at the 2'-position.

[00225] Fluoro and amino groups have been successfully incorporated into oligonucleotide pools from which aptamers have been subsequently selected. However, these modifications greatly increase the cost of synthesis of the resultant aptamer, and may introduce safety concerns in some cases because of the possibility that the modified nucleotides could be recycled into host DNA by degradation of the modified oligonucleotides and subsequent use of the nucleotides as substrates for DNA synthesis.

[00226] Aptamers that contain 2'-0-methyl (“2'-OMe”) nucleotides, as provided herein, may overcome one or more potential drawbacks. Oligonucleotides containing 2'-OMe nucleotides are nuclease-resistant and inexpensive to synthesize. Although 2'-OMe nucleotides are ubiquitous in biological systems, natural polymerases do not accept 2'-OMe NTPs as substrates under physiological conditions, thus there are no safety concerns over the recycling of 2'-OMe nucleotides into host DNA. The SELEX method used to generate 2'-modified aptamers is described, e.g., in U.S. Provisional Patent Application Ser. No. 60/430,761, filed Dec. 3, 2002, U.S. Provisional Patent Application Ser. No. 60/487,474, filed Jul. 15,

2003, U.S. Provisional Patent Application Ser. No. 60/517,039, filed Nov. 4, 2003, U.S. patent application Ser. No. 10/729,581, filed Dec. 3, 2003, and U.S. patent application Ser. No. 10/873,856, filed Jun. 21,

2004, entitled“Method for in vitro Selection of 2'-0-methyl substituted Nucleic Acids,” each of which is herein incorporated by reference in its entirety.

Therapeutics

[00227] As used herein“therapeutically effective amount” refers to an amount of a composition that relieves (to some extent, as judged by a skilled medical practitioner) one or more symptoms of a medical condition such as a disease or disorder in a subject. Additionally, by“therapeutically effective amount” of a composition is meant an amount that returns to normal, either partially or completely, physiological or biochemical parameters associated with or causative of a disease or condition. A clinician skilled in the art can determine the therapeutically effective amount of a composition in order to beat or prevent a particular disease condition, or disorder when it is administered, such as intravenously, subcutaneously, intraperitoneally, orally, or through inhalation. The precise amount of the composition required to be therapeutically effective will depend upon numerous factors, e.g., such as the specific activity of the active agent, the delivery device employed, physical characteristics of the agent, purpose for the administration, in addition to many patient specific considerations. But a determination of a

therapeutically effective amount is within the skill of an ordinarily skilled clinician upon the appreciation of the disclosure set forth herein.

[00228] The terms“beating,”“beatment,”“therapy,” and“therapeutic beatment” as used herein refer to curative therapy, prophylactic therapy, or preventative therapy. An example of“preventative therapy” is the prevention or lessening the chance of a targeted disease (e.g., cancer or other proliferative disease) or related condition thereto. Those in need of beatment include those already with the disease or condition as well as those prone to have the disease or condition to be prevented. The terms“beating,”“beatment,” “therapy,” and“therapeutic beatment” as used herein also describe the management and care of a mammal for the purpose of combating a disease, or related condition, and includes the adminisbation of a composition to alleviate the symptoms, side effects, or other complications of the disease, condition. Therapeutic beatment for cancer includes, but is not limited to, surgery, chemotherapy, radiation therapy, gene therapy, and immunotherapy.

[00229] As used herein, the term“agent” or“drug” or“therapeutic agent” refers to a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an exbact made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues that are suspected of having therapeutic properties. The agent or drug can be purified, substantially purified or partially purified. An“agent” as used herein also includes a radiation therapy agent or a

“chemotherapuetic agent.”

[00230] As used herein, the term“diagnostic agent” refers to any chemical used in the imaging of diseased tissue, such as, e.g., a tumor. [00231] As used herein, the term“chemotherapuetic agent” refers to an agent with activity against cancer, neoplastic, and/or proliferative diseases, or that has ability to kill cancerous cells directly.

[00232] As used herein,“pharmaceutical formulations” include formulations for human and veterinary use with no significant adverse toxicological effect.“Pharmaceutically acceptable formulation” as used herein refers to a composition or formulation that allows for the effective distribution of the nucleic acid molecules described herein in the physical location most suitable for their desired activity.

[00233] As used herein the term“pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated.

[00234] Aptamer Conjugates as a Cancer Therapeutics

[00235] Previous work has developed the concept of antibody -toxin conjugates (“immunoconjugates”) as potential therapies for a range of indications, mostly directed at the treatment of cancer with a primary focus on hematological tumors. A variety of different payloads for targeted delivery have been tested in pre-clinical and clinical studies, including protein toxins, high potency small molecule cytotoxics, radioisotopes, and liposome-encapsulated drugs. While these efforts have successfully yielded several FDA-approved therapies for hematological tumors, immunoconjugates as a class (especially for solid tumors) face challenges that have been attributable to multiple different properties of antibodies, including tendencies to develop neutralizing antibody responses to non-humanized antibodies, limited penetration in solid tumors, loss of target binding affinity as a result of toxin conjugation, and imbalances between antibody half-life and toxin conjugate half-life that limit the overall therapeutic index (reviewed by Reff and Heard, Critical Reviews in Oncology /Hematology, 40 (2001):25-35).

[00236] Aptamers are functionally similar to antibodies in target recognition, although their absorption, distribution, metabolism, and excretion (“ADME”) properties are intrinsically different and they generally lack many of the immune effector functions generally associated with antibodies (e.g., antibody- dependent cellular cytotoxicity, complement-dependent cytotoxicity). In comparing many of the properties of aptamers and antibodies previously described, several factors suggest that toxin-delivery via aptamers offers several concrete advantages over delivery with antibodies, ultimately affording them better potential as therapeutics. Several examples of the advantages of toxin-delivery via aptamers over antibodies are as follows:

[00237] 1) Aptamer-toxin conjugates are entirely chemically synthesized. Chemical synthesis provides more control over the nature of the conjugate. For example, the stoichiometry (ratio of toxins per aptamer) and site of attachment can be precisely defined. Different linker chemistries can be readily tested. The reversibility of aptamer folding means that loss of activity during conjugation is unlikely and provides more flexibility in adjusting conjugation conditions to maximize yields.

[00238] 2) Smaller size allows better tumor penetration. Poor penetration of antibodies into solid tumors is often cited as a factor limiting the efficacy of conjugate approaches. See Colcher, D., Goel, A., Pavlinkova, G., Beresford, G., Booth, B., Batra, S. K. (1999)“Effects of genetic engineering on the pharmacokinetics of antibodies,” Q. J. Nucl. Med., 43: 132-139. Studies comparing the properties of unPEGylated anti-tenascin C aptamers with corresponding antibodies demonstrate efficient uptake into tumors (as defined by the tumorblood ratio) and evidence that aptamer localized to the tumor is unexpectedly long-lived (ti _/2 >12 hours) (Hicke, B. J., Stephens, A. W., "Escort aptamers: a delivery service for diagnosis and therapy", J. Clin. Invest., 106:923-928 (2000)).

[00239] 3) Tunable PK. Aptamer half-life/metabolism can be more easily tuned to match properties of payload, optimizing the ability to deliver toxin to the tumor while minimizing systemic exposure.

Appropriate modifications to the aptamer backbone and addition of high molecular weight PEGs should make it possible to match the half-life of the aptamer to the intrinsic half-life of the conjugated toxin/linker, minimizing systemic exposure to non-functional toxin-bearing metabolites (expected if ti _/ 2(aptamer)«ti _/ 2(toxin)) and reducing the likelihood that persisting unconjugated aptamer will functionally block uptake of conjugated aptamer (expected if ti _/ 2(aptamer)»ti/2 (toxin)).

[00240] 4) Relatively low material requirements. It is likely that dosing levels will be limited by toxicity intrinsic to the cytotoxic payload. As such, a single course of treatment will likely entail relatively small (<100 mg) quantities of aptamer, reducing the likelihood that the cost of oligonucleotide synthesis will be a barrier for aptamer-based therapies.

[00241] 5) Parenteral administration is preferred for this indication. There will be no special need to develop alternative formulations to drive patient/physician acceptance.

[00242] The invention provides a pharmaceutical composition comprising a therapeutically effective amount of an aptamer described herein or a salt thereof, and a pharmaceutically acceptable carrier or diluent. The invention also provides a pharmaceutical composition comprising a therapeutically effective amount of the aptamer or a salt thereof, and a pharmaceutically acceptable carrier or diluent. Relatedly, the invention provides a method of treating or ameliorating a disease or disorder, comprising

administering the pharmaceutical composition to a subject in need thereof. As non-limiting examples, administering a therapeutically effective amount of the composition to the subject may result in: (a) an enhancement of the delivery of the active agent to a disease site relative to delivery of the active agent alone; (b) an enhancement of target clearance resulting in a decrease of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in a blood level of target targeted by the aptamer; (c) a decrease in size of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of a tumor targeted by the aptamer; or (d) an decrease in biological activity of targets of the aptamer of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%. In an embodiment, the biological activity of microvesicles comprises immune suppression or transfer of genetic information. The disease or disorder can include without limitation those disclosed herein. For example, the disease or disorder may comprise a neoplastic, proliferative, or inflammatory, metabolic, cardiovascular, or neurological disease or disorder. See, e.g., section “Phenotypes.”

[00243] In some embodiments, an aptamer described herein is modified to comprise at least one chemical modification. The modification may include without limitation a chemical substitution at a sugar position; a chemical substitution at a phosphate position; and a chemical substitution at a base position of the nucleic acid. In some embodiments, the modification is selected from the group consisting of:

biotinylation, incorporation of a fluorescent label, incorporation of a modified nucleotide, a 2'-modified pyrimidine, 3' capping, conjugation to an amine linker, conjugation to a high molecular weight, non- immunogenic compound, conjugation to a lipophilic compound, conjugation to a drug, conjugation to a cytotoxic moiety, and labeling with a radioisotope, or other modification as disclosed herein. The position of the modification can be varied as desired. For example, the biotinylation, fluorescent label, or cytotoxic moiety can be conjugated to the 5' end of the aptamer. The biotinylation, fluorescent label, or cytotoxic moiety can also be conjugated to the 3' end of the aptamer.

[00244] In some embodiments, the cytotoxic moiety is encapsulated in a nanoparticle. The nanoparticle can be selected from the group consisting of: liposomes, dendrimers, and comb polymers. In other embodiments, the cytotoxic moiety comprises a small molecule cytotoxic moiety. The small molecule cytotoxic moiety can include without limtation vinblastine hydrazide, calicheamicin, vinca alkaloid, a cryptophycin, a tubulysin, dolastatin-10, dolastatin-15, auristatin E, rhizoxin, epothilone B, epithilone D, taxoids, maytansinoids and any variants and derivatives thereof. In still other embodiments, the cytotoxic moiety comprises a protein toxin. For example, the protein toxin can be selected from the group consisting of diphtheria toxin, ricin, abrin, gelonin, and Pseudomonas exotoxin A. Non-immunogenic, high molecular weight compounds for use with the compositions described herein include polyalkylene glycols, e.g., polyethylene glycol. Appropriate radioisotopes include yttrium-90, indium-111, iodine-131, lutetium-177, copper-67, rhenium-186, rhenium-188, bismuth-212, bismuth-213, astatine-211, and actinium-225. The aptamer may be labeled with a gamma-emitting radioisotope.

[00245] In some embodiments described herein, an active agent is conjugated to the aptamer. For example, the active agent may be a therapeutic agent or a diagnostic agent. The therapeutic agent may be selected from the group consisting of tyrosine kinase inhibitors, kinase inhibitors, biologically active agents, biological molecules, radionuclides, adriamycin, ansamycin antibiotics, asparaginase, bleomycin, busulphan, cisplatin, carboplatin, carmustine, capecotabine, chlorambucil, cytarabine, cyclophosphamide, camptothecin, dacarbazine, dactinomycin, daunorubicin, dexrazoxane, docetaxel, doxorubicin, etoposide, epothilones, floxuridine, fludarabine, fluorouracil, gemcitabine, hydroxyurea, idarubicin, ifosfamide, irinotecan, lomustine, mechlorethamine, mercaptopurine, melphalan, methotrexate, rapamycin (sirolimus), mitomycin, mitotane, mitoxantrone, nitrosurea, paclitaxel, pamidronate, pentostatin, plicamycin, procarbazine, rituximab, streptozocin, teniposide, thioguanine, thiotepa, taxanes, vinblastine, vincristine, vinorelbine, taxol, combretastatins, discodermolides, transplatinum, anti-vascular endothelial growth factor compounds (“anti-VEGFs”), anti-epidermal growth factor receptor compounds (“anti-EGFRs”), 5- fluorouracil and derivatives, radionuclides, polypeptide toxins, apoptosis inducers, therapy sensitizers, enzyme or active fragment thereof, and combinations thereof.

Anti-target and Multivalent Oligonucleotides

[00246] As described herein, the target of oligonucleotide probes can be identified. For example, when the target comprises a protein or protein complex (e.g., a nucleoprotein or lipoprotein), identifying the target may comprise use of mass spectrometry (MS), peptide mass fingerprinting (PMF; protein fingerprinting), sequencing, N-terminal amino acid analysis, C-terminal amino acid analysis, Edman degradation, chromatography, electrophoresis, two-dimensional gel electrophoresis (2D gel), antibody array, or immunoassay. Such approaches can be applied to identify a number of targets recognized by an oligonucleotide probe library. For example, an oligonucleotide probe library can be incubated with a sample of interest, bound members of the library captured, and the targets bound to the captured members identified. See Examples 1, 9-11, and 14-15 herein for an examples of such target identification using mass spectrometry.

[00247] The oligonucleotide aptamers to the various targets can be used for multiple purposes. In some embodiments, the aptamers are used as therapeutic agents. Immunotherapeutic approaches using antibodies that recognize foreign/misfolded antigens (e,g., anti-CD20, anti-CD30, anti-CD33, anti-CD52, anti-EGFR, anti-nucleolin, anti-nucleophosmin, etc.) can selectively kill target cells via linked therapeutic agents or by stimulating the immune system through activation of cell-mediated cytotoxicity. Aptamers or oligonucleotides are an attractive immunotherapeutic alternative for various reasons such as low cost, small size, ease and speed of synthesis, stability and low immunogenicity. In an embodiment, immunotherapeutic agents are conjugated to disease specific target oligonucleotide or antibody (Ab) for targeted cell killing via recruitment of complement proteins and the downstream membrane attack complex. See, e.g., Zhou and Rossi, Cell-type-specific, Aptamer-functionalized Agents for Targeted Disease Therapy, Mol Ther Nucleic Acids. 2014 Jun 17;3:el69. doi: 10.1038/mtna.2014.21; Pei et al., Clinical applications of nucleic acid aptamers in cancer, Mol Clin Oncol. 2014 May;2(3):341-348. Epub 2014 Feb 10. This approach can be applied to target diseased host cells such as cancer cells, gram negative bacteria, viral and/or parasitic infections, and the like.

[00248] In some embodiments, the compositions described herein include a multipartite construct comprising a binding agent specific to a biological target with another binding agent specific to immunomodulatory entity. Examples of such constructs are shown in FIG. 6. In Design 1 in the figure, the horizontal line indicates an oligonucleotide construct, which construct comprises a 5’ primer 601 (Primer 1), a variable region 602 that can be an aptamer to a target of interest, a 3’ primer 603 (Primer 2), and an immunomodulatory domain region (“IMD”) 604. The complete Design 1 construct can be used to bring a target of interest in proximity with an immunomodulatory agent. The primers can be designed for any desired purpose, e.g., amplification, capture, modification, direct or indirect labeling, and the like. In some embodiments, the target of the variable region is a disease marker and thus the construct is targeted to a diseased tissue, cell or microvesicle. The immunomodulatory domain region can act as an immune stimulator or suppressor. Any appropriate immune stimulator or suppressor can be used, e.g., a small molecule, antibody or an aptamer. Thus, the construct can modulate the immune response at a target of interest, e.g., at a cell or microvesicle carrying the target. The basic construct can be modified as desired. For example, Design 2 in FIG. 6 shows the construct carrying a linker 605 between Primer 2 603 and the IMD 604. Such linkers are explained further below and can be inserted between any components of the construct as desired. Linkers can provide a desired space between the regions of the construct and can be manipulated to influence other properties such as stability. Design 3 in FIG. 6 shows another example wherein the IMD 604 is an oligonucleotide and the variable region 602 and IMD 604 lie between the primers 601 and 603. One of skill will appreciate that one or more linker, such as 605 of Design 2, can also be inserted into Design 3, e.g., between the variable region 602 and IMD 604. One of skill will further appreciate that the ordering of the oligonucleotide segments from 5’ to 3’ can be modified, e.g., reversed.

[00249] As noted, the multipartite constructs may be synthesized and/or modified as desired. In some embodiments, the multipartite oligonucleotide construct is synthesized directly with or without a linker in between the oligonucleotide segments. See, e.g., FIG. 6 Design 3, which can be generated directly via amplification by Primer 1 601 and Primer 2 603. One or more linker can act as a spacer to create a desired spacing between the target of the variable region segment 602 and the target of the IMD segment 604. The spacing can be determined via computer modeling or via experimentation due to steric hindrance or other considerations.

[00250] The multipartite constructs can be generated against any appropriate target. The targets can include without limitation tumors or diseased tissues, cells, cancer cells, circulating tumor cells (CTCs), immune cells (e.g., B-cells, T-cells, macrophages, dendritic cells), microvesicles, bacteria, viruses or other parasites. The target can be large biological complexes, e.g., protein complexes, ribonucleoprotein complexes, lipid complexes, or a combination thereof. It will be understood that the specific target of the multipartite constructs can be a certain member of the foregoing macromolecular targets. For example, consider that the desired target of the multipartite construct is a particular cell. In such case, the multipartite construct can be directed to a specific biomarker, e.g., a surface antigen, of the cell. As a non- limiting example, the target of interest can be B-cells and the specifc target of the variable region of the multipartite construct can be CD20. CD20 is a cellular marker of B-cells targeted by the monoclonal antibodies (mAh) rituximab, obinutuzumab, ofatumumab, ibritumomab tiuxetan, and tositumomab, which are used as agents in the treatment of B-cell lymphomas and leukemias. As another non-limiting example, the target of interest can be cancer cells and the specifc target of the variable region of the multipartite construct can be c-MET. MET is a membrane receptor that is essential for embryonic development and wound healing. Abnormal MET activation in cancer correlates with poor prognosis, where aberrantly active MET triggers tumor growth, formation of new blood vessels (angiogenesis), and cancer spread to other organs (metastasis). MET has been observed to be deregulated in many types of human malignancies, including cancers of kidney, liver, stomach, breast, and brain. Other biomarkers can be used as the specifc target as desired. For example, the biomarker can be selected from any of the aptamer targets in the Examples herein, or Table 4 of International Patent Application PCT/US2016/040157, filed June 29, 2016.

[00251] As noted above, the IDM domain can be constructed to illicit a complement mediated immune response that can induce apoptosis. Such IDM can include but are not limited to Clq, Clr, Cls, Cl, C3a, C3b, C3d, C5a, C2, C4, and cytokines. The IDM region may comprise an oligonucleotide sequence including without limitation Toll-Like Receptor (TLR) agonists like CpG sequences which are immunostimulatory and/or polyG sequences which can be anti-proliferative or pro-apoptotic. The moiety can be vaccine like moiety or antigen that stimulates an immune response. In an embodiment, the immune stimulating moiety comprises a superantigen. In some embodiments, the superantigen can be selected from the group consisting of staphylococcal enterotoxins (SEs), a Streptococcus pyogenes exotoxin (SPE), a Staphylococcus aureus toxic shock-syndrome toxin (TSST-1), a streptococcal mitogenic exotoxin (SME), a streptococcal superantigen (SSA), a hepatitis surface antigen, or a combination thereof. Other bacterial antigens that can be used with the compositions and method described herein comprise bacterial antigens such as Freund’s complete adjuvant, Freund’s incomplete adjuvant, monophosphoryl- lipid A/trehalose dicorynomycolate (Ribi’s adjuvant), BCG (Calmette -Guerin Bacillus; Mycobacterium bovis), and Corynebacterium parvum. The immune stimulating moiety can also be a non-specific immunostimulant, such as an adjuvant or other non-specific immunostimulator. Useful adjuvants comprise without limitation aluminium salts, alum, aluminium phosphate, aluminium hydroxide, squalene, oils, MF59, and AS03 (“Adjuvant System 03”). The adjuvant can be selected from the group consisting of Cationic liposome-DNA complex JVRS-100, aluminum hydroxide vaccine adjuvant, aluminum phosphate vaccine adjuvant, aluminum potassium sulfate adjuvant, Alhydrogel, ISCOM(s)™, Freund’s Complete Adjuvant, Freund’s Incomplete Adjuvant, CpG DNA Vaccine Adjuvant, Cholera toxin, Cholera toxin B subunit, Fiposomes, Saponin Vaccine Adjuvant, DDA Adjuvant, Squalene-based Adjuvants, Etx B subunit Adjuvant, IF- 12 Vaccine Adjuvant, FTK63 Vaccine Mutant Adjuvant,

TiterMax Gold Adjuvant, Ribi Vaccine Adjuvant, Montanide ISA 720 Adjuvant, Corynebacterium- derived P40 Vaccine Adjuvant, MPF™ Adjuvant, AS04, AS02, Fipopoly saccharide Vaccine Adjuvant, Muramyl Dipeptide Adjuvant, CRT 1005, Killed Corynebacterium parvum Vaccine Adjuvant, Montanide ISA 51, Bordetella pertussis component Vaccine Adjuvant, Cationic Fiposomal Vaccine Adjuvant, Adamantylamide Dipeptide Vaccine Adjuvant, Arlacel A, VSA-3 Adjuvant, Aluminum vaccine adjuvant, Poly gen Vaccine Adjuvant, Adjumer™, Algal Glucan, Bay R1005, Theramide®, Stearyl Tyrosine,

Specol, Algammulin, Avridine®, Calcium Phosphate Gel, CTA1-DD gene fusion protein, DOC/ Alum Complex, Gamma Inulin, Gerbu Adjuvant, GM-CSF, GMDP, Recombinant hIFN-gamma/Interferon-g, Interleukin- 1b, Interleukin-2, Interleukin- 7, Sclavo peptide, Rehydragel TV, Rehydragel HP A,

Foxoribine, MF59, MTP-PE Fiposomes, Murametide, Murapalmitine, D-Murapalmitine, NAGO, Non- Ionic Surfactant Vesicles, PMMA, Protein Cochleates, QS-21, SPT (Antigen Formulation), nanoemulsion vaccine adjuvant, AS03, Quil-A vaccine adjuvant, RC529 vaccine adjuvant, FTR192G Vaccine Adjuvant, E. coli heat-labile toxin, FT, amorphous aluminum hydroxyphosphate sulfate adjuvant, Calcium phosphate vaccine adjuvant, Montanide Incomplete Seppic Adjuvant, Imiquimod, Resiquimod, AF03, Flagellin, Poly(TC), ISCOMATRIX®, Abisco-100 vaccine adjuvant, Albumin-heparin microparticles vaccine adjuvant, AS-2 vaccine adjuvant, B7-2 vaccine adjuvant, DHEA vaccine adjuvant,

Immunoliposomes Containing Antibodies to Costimulatory Molecules, SAF-1, Sendai Proteoliposomes, Sendai-containing Fipid Matrices, Threonyl muramyl dipeptide (TMDP), Ty Particles vaccine adjuvant, Bupivacaine vaccine adjuvant, DF-PGF (Polyester poly (DF-lactide-co-glycolide)) vaccine adjuvant, IF- 15 vaccine adjuvant, FTK72 vaccine adjuvant, MPF-SE vaccine adjuvant, non-toxic mutant E112K of Cholera Toxin mCT-E112K, and Matrix-S. Additional adjuvants that can be used with the multipartite constructs described herein can be identified using the Vaxjo database. See Sayers S, Ulysse G, Xiang Z, and He Y. Vaxjo: a web-based vaccine adjuvant database and its application for analysis of vaccine adjuvants and their uses in vaccine development. Journal of Biomedicine and Biotechnology.

2012;2012:831486. Epub 2012 Mar 13. PMID: 22505817; violinet.org/vaxjo/. Other useful non-specific immunostimulators comprise histamine, interferon, transfer factor, tuftsin, interleukin- 1, female sex hormones, prolactin, growth hormone vitamin D, deoxycholic acid (DCA), tetrachlorodecaoxide (TCDO), and imiquimod or resiquimod, which are drugs that activate immune cells through the toll-like receptor 7. A multipartite construct can be created that comprises more than one immunomodulating moiety, e.g., using segments that span CpG sequences which are immunostimulatory with complement directed segments that can stimulate apoptosis.

Modifications

[00252] Modifications to the one or more oligonucleotide described herein can be made to alter desired characteristics, including without limitation in vivo stability, specificity, affinity, avidity or nuclease susceptibility. Alterations to the half life may improve stability in vivo or may reduce stability to limit in vivo toxicity. Such alterations can include mutations, truncations or extensions. The 5’ and/or 3’ ends of the multipartite oligonucleotide constructs can be protected or deprotected to modulate stability as well. Modifications to improve in vivo stability, specificity, affinity, avidity or nuclease susceptibility or alter the half life to influence in vivo toxicity may be at the 5’ or 3’ end and include but are not limited to the following: locked nucleic acid (LNA) incorporation, unlocked nucleic acid (UNA) incorporation, phosphorothioate backbone instead of phosphodiester backbone, amino modifiers (i.e. C6-dT), dye conjugates (Cy dues, Fluorophores, etc), Biotinylation, PEG linkers, Click chemistry linkers, dideoxynucleotide end blockers, inverted end bases, cholesterol TEG or other lipid based labels.

[00253] Linkage options for segments of the oligonucleotide described herein can be on the 5’ or 3’ end of an oligonucleotide or to a primary amine, sulfhydryl or carboxyl group of an antibody and include but are not limited to the following: Biotin-target oligonucleotide /Ab, streptavidin-complement oligonucleotide or vice versa, amino modified-target Ab/ oligonucleotide, thiol/carboxy -complement oligonucleotide or vice versa, Click chemistry -target Ab/ oligonucleotide, corresponding Click chemistry partner- complement oligonucleotide or vice versa. The linkages may be covalent or non-covalent and may include but are not limited to monovalent, multivalent (i.e. bi, tri or tetra-valent) assembly, to a DNA scaffold (i.e. DNA origami structure), drug/chemotherapeutic agent, nanoparticle, microparticle or a micelle or liposome.

[00254] A linker region can comprise a spacer with homo- or multifunctional reactive groups that can vary in length and type. These include but are not limited to the following: spacer Cl 8, PEG4, PEG6, PEG8, and PEG12.

[00255] The multipartite oligonucleotide described herein can further comprise additional elements to add desired biological effects. For example, the oligonucleotide described herein may comprise a membrane disruptive moiety. The oligonucleotide described herein may also be conjugated to one or more chemical moiety that provides such effects. For example, the oligonucleotide described herein may be conjugated to a detergent-like moiety to disrupt the membrane of a target cell or microvesicle. Useful ionic detergents include sodium dodecyl sulfate (SDS, sodium lauryl sulfate (SLS)), sodium laureth sulfate (SLS, sodium lauryl ether sulfate (SLES)), ammonium lauryl sulfate (ALS), cetrimonium bromide, cetrimonium chloride, cetrimonium stearate, and the like. Useful non-ionic (zwitterionic) detergents include polyoxyethylene glycols, polysorbate 20 (also known as Tween 20), other polysorbates (e.g., 40, 60, 65, 80, etc), Triton-X (e.g., X100, XI 14), 3-[(3-cholamidopropyl)dimethylammonio]-l-propanesulfonate (CHAPS), CHAPSO, deoxycholic acid, sodium deoxycholate, NP-40, glycosides, octyl-thio-glucosides, maltosides, and the like. One of skill will appreciate that functional fragments, such as membrance disruptive moieties, can be covalently or non-covalently attached to the oligonucleotide described herein.

[00256] Oligonucleotide segments, including those of a multipartite construct, can include any desireable base modification known in the art. In certain embodiments, oligonucleotide segments are 10 to 50 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies

oligonucleotides of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range derivable there within.

[00257] In certain embodiments, a multipartite construct comprises a chimeric oligonucleotide that contains two or more chemically distinct regions, each made up of at least one nucleotide. Such chimeras can be referred to using terms such as multipartite, multivalent, or the like. The oligonucleotides portions may contain at least one region of modified nucleotides that confers one or more beneficial properties, e.g., increased nuclease resistance, bioavailability, increased binding affinity for the target. Chimeric nucleic acids described herein may be formed as composite structures of two or more oligonucleotides, two or more types of oligonucleotides (e.g., both DNA and RNA segments), modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics. Such compounds have also been referred to in the art as hybrids. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US patent nos: 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference in its entirety.

[00258] In certain embodiments, an oligonucleotide described herein comprises at least one nucleotide modified at the 2’ position of the sugar, including without limitation a 2’ -0-alkyl, 2’ -0-alky 1-0-alkyl or 2’- fluoro-modified nucleotide. In other embodiments, RNA modifications include 2’- fluoro, 2’-amino and 2’ O-methyl modifications on the ribose of pyrimidines, a basic residue or an inverted base at the 3’ end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these

oligonucleotides have been shown to have higher target binding affinity in some cases than 2’- deoxyoligonucleotides against a given target.

[00259] A number of nucleotide and nucleoside modifications have been shown to make an

oligonucleotide more resistant to nuclease digestion, thereby prolonging in vivo half- life. Specific examples of modified oligonucleotides include those comprising backbones comprising, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. The constructs described herein can comprise oligonucleotides with phosphorothioate backbones and/or heteroatom backbones, e.g., CH2 -NH-0-CH2, CH ,~N(CH3)~0~CH2 (known as a methylene (methylimino) or MMI backbone], CH2 -O-N (CH3)-CH2, CH2 -N (CH3)-N (CH3)-CH2 and O-N (CH3)- CH2 -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P— O- CH,); amide backbones (De Mesmaeker et ah,

1995); morpholino backbone structures (Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (Nielsen, et al., 1991), each of which is herein incorporated by reference in its entirety. Phosphorus- containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3’alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3‘-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3‘-5’ linkages, 2’-5’ linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3*-5* to 5*-3* or 2*-5* to 5*-2*; see U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321, 131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference in its entirety. Morpholino-based oligomeric compounds are known in the art described in Braasch & Corey, Biochemistry vol. 41, no. 14, 2002, pages 4503 - 4510; Genesis vol. 30, 2001, page 3; Heasman, J. Dev. Biol. vol. 243, 2002, pages 209 - 214; Nasevicius et al. Nat. Genet vol. 26, 2000, pages 216 - 220; Lacerra et al. Proc. Natl. Acad. Sci. vol. 97, 2000, pages 9591 - 9596 and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991, each of which is herein incorporated by reference in its entirety. Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al., J. Am. Chem. Soc. Vol. 122, 2000, pages 8595 - 8602, the contents of which is incorporated herein in its entirety. An oligonucleotide described herein can comprise at least such modification as desired.

[00260] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that can be formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones;

sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216, 141;

5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference in its entirety. An oligonucleotide described herein can comprise at least such modification as desired.

[00261] In certain embodiments, an oligonucleotide described herein comprises one or more substituted sugar moieties, e.g., one of the following at the 2’ position: OH, SH, SCH ₃ , F, OCN, OCH ₃ OCH ₃ , OCH ₃ 0(CH ₂ )n CH ₃ , 0(CH ₂ )n NH ₂ or 0(CH ₂ )n CH ₃ where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF ₃ ; OCF ₃ ; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH ₃ ; S0 ₂ CH ₃ ; ON0 ₂ ; N 0 ₂ ; N ₃ ; NH ₂ ; heterocycloalkyl; heterocycloalkaryl;

aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacokinetic/pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2’ -methoxy ethoxy [2’-0- CH2CH20CH3, also known as 2’-0-(2-methoxyethyl)]. Other preferred modifications include 2*-methoxy (2*-0-CH3), 2*-propoxy (2*-OCH2 CH2CH3) and 2*-fiuoro (2*-F). Similar modifications may also be made at other positions on the oligonucleotide, e.g., the 3’ position of the sugar on the 3’ terminal nucleotide and the 5’ position of 5’ terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.

[00262] In certain embodiments, an oligonucleotide described herein comprises one or more base modifications and/or substitutions. As used herein,“unmodified” or“natural” bases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified bases include, without limitation, bases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5 -Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2’ deoxy cytosine and often referred to in the art as 5-Me-C), 5- hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic bases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2- (imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2- thiouracil, 2- thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6- aminohexyl)adenine and 2,6-diaminopurine (Kornberg, 1980; Gebeyehu, et ah, 1987). A“universal” base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions can also be included. These have been shown to increase nucleic acid duplex stability by 0.6- 1.20C. See, e.g., Sanghvi et al., ‘Antisense Research & Applications’, 1993, CRC PRESS pages 276 - 278. Further suitable modified bases are described in U.S. Patent Nos. 3,687,808, as well as 4,845,205; 5,130,302; 5,134,066; 5,175, 273; 5, 367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.

[00263] It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.

[00264] In certain embodiments, both a sugar and an intemucleoside linkage, i.e., the backbone, of one or more nucleotide units within an oligonucleotide described herein are replaced with novel groups. The base can be maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to retain hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an

oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative patents that teach the preparation of PNA compounds comprise, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al. Science vol. 254, 1991, page 1497, which is herein incorporated by reference.

[00265] In certain embodiments, the oligonucleotide described herein is linked (covalently or non- covalently) to one or more moieties or conjugates that enhance activity, cellular distribution, or localization. Such moieties include, without limitation, lipid moieties such as a cholesterol moiety (Letsinger et al. Proc. Natl. Acad. Sci. Usa. vol. 86, 1989, pages 6553 - 6556), cholic acid (Manoharan et al. Bioorg. Med. Chem. Let. vol. 4, 1994, pages 1053 - 1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al. Ann. N. Y. Acad. Sci. Vol. 660, 1992, pages 306 - 309; Manoharan et al. Bioorg. Med. Chem. Let. vol. 3, 1993, pages 2765 - 2770), a thiochole sterol (Oberhauser et al. Nucl. Acids Res. vol. 20, 1992, pages 533 - 538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al. Febs Lett. vol. 259, 1990, pages 327 - 330; Svinarchuk et al. Biochimie. vol. 75, 1993, pages 49 - 54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac- glycero-3- H-phosphonate (Manoharan et al. Tetrahedron Lett. vol. 36, 1995, pages 3651 - 3654; Shea et al. Nucl. Acids Res. vol. 18, 1990, pages 3777 - 3783), a polyamine or a polyethylene glycol chain (Mancharan et al. Nucleosides & Nucleotides vol. 14, 1995, pages 969 - 973), or adamantane acetic acid (Manoharan et al. Tetrahedron Lett. vol. 36, 1995, pages 3651 - 3654), a palmityl moiety (Mishra et al. Biochim.

Biophys. Acta vol. 1264, 1995, pages 229 - 237), or an octadecylamine or hexylamino- carbonyl-t oxycholesterol moiety (Crooke et al. J. Pharmacol. Exp. Ther. vol. 277, 1996, pages 923 - 937), each of which is herein incorporated by reference in its entirety. See also U.S. Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241,5,391,723; 5,416,203,5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference in its entirety.

[00266] The oligonucleotide described herein can be modified to incorporate a wide variety of modified nucleotides as desired. For example, the construct may be synthesized entirely of modified nucleotides or with a subset of modified nucleotides. The modifications can be the same or different. Some or all nucleotides may be modified, and those that are modified may contain the same modification. For example, all nucleotides containing the same base may have one type of modification, while nucleotides containing other bases may have different types of modification. All purine nucleotides may have one type of modification (or are unmodified), while all pyrimidine nucleotides have another, different type of modification (or are unmodified). Thus, the construct may comprise any combination of desired modifications, including for example, ribonucleotides (2’-OH), deoxyribonucleotides (2’-deoxy), 2’- amino nucleotides (2’-NH2), 2’- fluoro nucleotides (2’-F) and 2’-0-methyl (2’-OMe) nucleotides.

[00267] In some embodiments, the oligonucleotide described herein is synthesized using a transcription mixture containing modified nucleotides in order to generate a modified construct. For example, a transcription mixture may contain only 2’-OMe A, G, C and U and/or T triphosphates (2’-OMe ATP, 2’- OMe UTP and/or 2*-OMe TTP, 2*-OMe CTP and 2*-OMe GTP), referred to as an MNA or mRmY mixture. Oligonucleotides generated therefrom are referred to as MNA oligonucleotides or mRmY oligonucleotides and contain only 2’-0-methyl nucleotides. A transcription mixture containing all 2’-OH nucleotides is referred to as an“rN” mixture, and oligonucleotides generated therefrom are referred to as “rN”,“rRrY” or RNA oligonucleotides. A transcription mixture containing all deoxy nucleotides is referred to as a“dN” mixture, and oligonucleotides generated therefrom are referred to as“dN”,“dRdY” or DNA oligonucleotides. Atematively, a subset of nucleotides (e.g., C, U and /or T) may comprise a first modified nucleotides (e.g, 2’-OMe) nucleotides and the remainder (e.g., A and G) comprise a second modified nucleotide (e.g., 2’ -OH or 2’-F). For example, a transcription mixture containing 2’-F U and 2’- OMe A, G and C is referred to as a“fUmV” mixture, and oligonucleotides generated therefrom are referred to as“fUmV” oligonucleotides. A transcription mixture containing 2’-F A and G, and 2’-OMe C and U and/or T is referred to as an“fRmY” mixture, and oligonucleotides generated therefrom are referred to as“fRmY” oligonucleotides. A transcription mixture containing 2’-F A and 2’-OMe C, G and U and/or T is referred to as“fAmB” mixture, and oligonucleotides generated therefrom are referred to as “fAmB” oligonucleotides.

[00268] One of skill in the art can improve pre-identified aptamer segments (e.g., variable regions or immunomodulatory regions that comprise an aptamer to a biomarker target or other entity) using various process modifications. Examples of such process modifications include, but are not limited to, truncation, deletion, substitution, or modification of a sugar or base or intemucleotide linkage, capping, and PEGylation. In addition, the sequence requirements of an aptamer may be explored through doped reselections or aptamer medicinal chemistry. Doped reselections are carried out using a synthetic, degenerate pool that has been designed based on the aptamer of interest. The level of degeneracy usually varies from about 70-85% from the aptamer of interest. In general, sequences with neutral mutations are identified through the doped reselection process. Aptamer medicinal chemistry is an aptamer improvement technique in which sets of variant aptamers are chemically synthesized. These variants are then compared to each other and to the parent aptamer. Aptamer medicinal chemistry is used to explore the local, rather than global, introduction of substituents. For example, the following modifications may be introduced: modifications at a sugar, base, and/or intemucleotide linkage, such as 2’-deoxy, 2’-ribo, or 2’ -0-methyl purines or pyrimidines, phosphorothioate linkages may be introduced between nucleotides, a cap may be introduced at the 5’ or 3’ end of the aptamer (such as 3’ inverted dT cap) to block degradation by exonucleases, or a polyethylene glycol (PEG) element may be added to the aptamer to increase the half-life of the aptamer in the subject.

[00269] Additional compositions comprising an oligonucleotide described herein and uses thereof are further described below. As oligonucleotide probes described herein bind to specific tissues, cells, microvesicles or other biological entities of interest, such oligonucleotide probes target such entities and are inherently drug candidates, agents that can be used for targeted drug delivery, or both.

Pharmaceutical Compositions

[00270] In an aspect, the pharmaceutical compositions described herein comprise one or more oligonucleotide described herein, e.g., as a standalone drug, as a drug delivery agent, as a multipartite construct as described above, or any combination thereof. The invention further provides methods of administering such compositions. Also provided are compositions comprising gemcitabine and/or evofosphamide for use in a method described herein, e.g., in a subject identified as likely to respond to such treatment using a method described herein.

[00271] The term“condition,” as used herein means an interruption, cessation, or disorder of a bodily function, system, or organ. Representative conditions include, but are not limited to, diseases such as cancer, inflammation, diabetes, and organ failure.

[00272] The phrase“treating,”“treatment of,” and the like include the amelioration or cessation of a specified condition.

[00273] The phrase“preventing,”“prevention of,” and the like include the avoidance of the onset of a condition.

[00274] The term“salt,” as used herein, means two compounds that are not covalently bound but are chemically bound by ionic interactions.

[00275] The term“pharmaceutically acceptable,” as used herein, when referring to a component of a pharmaceutical composition means that the component, when administered to an animal, does not have undue adverse effects such as excessive toxicity, irritation, or allergic response commensurate with a reasonable benefit/risk ratio. Accordingly, the term“pharmaceutically acceptable organic solvent,” as used herein, means an organic solvent that when administered to an animal does not have undue adverse effects such as excessive toxicity, irritation, or allergic response commensurate with a reasonable benefit/risk ratio. Preferably, the pharmaceutically acceptable organic solvent is a solvent that is generally recognized as safe (“GRAS”) by the United States Food and Drug Administration (“FDA”). Similarly, the term“pharmaceutically acceptable organic base,” as used herein, means an organic base that when administered to an animal does not have undue adverse effects such as excessive toxicity, irritation, or allergic response commensurate with a reasonable benefit/risk ratio.

[00276] The phrase“injectable” or“injectable composition,” as used herein, means a composition that can be drawn into a syringe and injected subcutaneously, intraperitoneally, or intramuscularly into an animal without causing adverse effects due to the presence of solid material in the composition. Solid materials include, but are not limited to, crystals, gummy masses, and gels. Typically, a formulation or composition is considered to be injectable when no more than about 15%, preferably no more than about 10%, more preferably no more than about 5%, even more preferably no more than about 2%, and most preferably no more than about 1% of the formulation is retained on a 0.22 pm filter when the formulation is filtered through the filter at 98° F. There are, however, some compositions described herein, which are gels, that can be easily dispensed from a syringe but will be retained on a 0.22 pm filter. In some embodiments, the term“injectable,” as used herein, includes these gel compositions. In some embodiments, the term “injectable,” as used herein, further includes compositions that when warmed to a temperature of up to about 40° C. and then filtered through a 0.22 pm filter, no more than about 15%, preferably no more than about 10%, more preferably no more than about 5%, even more preferably no more than about 2%, and most preferably no more than about 1% of the formulation is retained on the filter. In some embodiments, an example of an injectable pharmaceutical composition is a solution of a pharmaceutically active compound (for example, one or more oligonucleotide described herein, e.g. , a multipartite construct, an anti-ClQ oligonucleotide, a 10.36 oligonucleotide, as described above, or any combination thereof) in a pharmaceutically acceptable solvent. One of skill will appreciate that injectable solutions have inherent properties, e.g., sterility, pharmaceutically acceptable excipients and free of harmful measures of pyrogens or similar contaminants.

[00277] The term“solution,” as used herein, means a uniformly dispersed mixture at the molecular or ionic level of one or more substances (solute), in one or more other substances (solvent), typically a liquid.

[00278] The term“suspension,” as used herein, means solid particles that are evenly dispersed in a solvent, which can be aqueous or non-aqueous.

[00279] The term“animal,” as used herein, includes, but is not limited to, humans, canines, felines, equines, bovines, ovines, porcines, amphibians, reptiles, and avians. Representative animals include, but are not limited to a cow, a horse, a sheep, a pig, an ungulate, a chimpanzee, a monkey, a baboon, a chicken, a turkey, a mouse, a rabbit, a rat, a guinea pig, a dog, a cat, and a human. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human. In some embodiments, the animal is a non-human. In some embodiments, the animal is a canine, a feline, an equine, a bovine, an ovine, or a porcine.

[00280] The phrase“drug depot,” as used herein means a precipitate, which includes one or more oligonucleotide described herein, e.g. , a multipartite construct, an anti-ClQ oligonucleotide, a 10.36 oligonucleotide, as described above, or any combination thereof, formed within the body of a treated animal that releases the oligonucleotide over time to provide a pharmaceutically effective amount of the oligonucleotide.

[00281] The phrase“substantially free of,” as used herein, means less than about 2 percent by weight. For example, the phrase“a pharmaceutical composition substantially free of water” means that the amount of water in the pharmaceutical composition is less than about 2 percent by weight of the pharmaceutical composition.

[00282] The term“effective amount,” as used herein, means an amount sufficient to treat or prevent a condition in an animal. [00283] The nucleotides that make up the oligonucleotide described herein can be modified to, for example, improve their stability, i.e., improve their in vivo half-life, and/or to reduce their rate of excretion when administered to an animal. The term“modified” encompasses nucleotides with a covalently modified base and/or sugar. For example, modified nucleotides include nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Modified nucleotides may also include 2' substituted sugars such as 2'-0-methyl-; 2'-0-alkyl; 2'-0-allyl; 2'-S-alkyl; 2'-S-allyl; 2'-fluoro-; 2'-halo or 2'-azido-ribose; carbocyclic sugar analogues; a-anomeric sugars; and epimeric sugars such as arabinose, xyloses or lyxoses, pyranose sugars, furanose sugars, and sedoheptulose.

[00284] Modified nucleotides are known in the art and include, but are not limited to, alkylated purines and/or pyrimidines; acylated purines and/or pyrimidines; or other heterocycles. These classes of pyrimidines and purines are known in the art and include, pseudoisocytosine; N4,N4-ethanocytosine; 8- hydroxy-N6-methyladenine; 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil; 5-fluorouracil; 5- bromouracil; 5-carboxymethylaminomethyl-2-thiouracil; 5-carboxymethylaminomethyl uracil;

dihydrouracil; inosine; N6-isopentyl-adenine; 1-methyladenine; 1-methylpseudouracil; 1-methylguanine; 2,2-dimethylguanine; 2-methyladenine; 2-methylguanine; 3-methylcytosine; 5-methylcytosine; N6- methyladenine; 7-methylguanine; 5 -methylaminomethyl uracil; 5-methoxy amino methyl-2 -thiouracil; b- D-mannosylqueosine; 5-methoxycarbonylmethyluracil; 5-methoxyuracil; 2 methylthio-N6- isopentenyladenine; uracil-5 -oxy acetic acid methyl ester; psueouracil; 2-thiocytosine; 5-methyl-2 thiouracil, 2-thiouracil; 4-thiouracil; 5-methyluracil; N-uracil-5-oxyacetic acid methylester; uracil 5- oxyacetic acid; queosine; 2-thiocytosine; 5-propyluracil; 5-propylcytosine; 5-ethyluracil; 5-ethylcytosine; 5-butyluracil; 5-pentyluracil; 5-pentylcytosine; and 2,6,-diaminopurine; methylpsuedouracil; 1- methylguanine; and 1-methylcytosine.

[00285] An oligonucleotide described herein can also be modified by replacing one or more

phosphodiester linkages with alternative linking groups. Alternative linking groups include, but are not limited to embodiments wherein P(0)0 is replaced by P(0)S, P(S)S, P(0)NR2, P(0)R, P(0)OR', CO, or CH2, wherein each R or R' is independently H or a substituted or unsubstituted C1-C20 alkyl. A preferred set of R substitutions for the P(0)NR2 group are hydrogen and methoxy ethyl. Linking groups are typically attached to each adjacent nucleotide through an— O— bond, but may be modified to include— N— or— S— bonds. Not all linkages in an oligomer need to be identical.

[00286] The oligonucleotide described herein can also be modified by conjugation to a polymer, for example, to reduce the rate of excretion when administered to an animal. For example, the oligonucleotide can be“PEGylated,” i.e., conjugated to polyethylene glycol (“PEG”). In some embodiments, the PEG has an average molecular weight ranging from about 20 kD to 80 kD. Methods to conjugate an

oligonucleotide with a polymer, such PEG, are known to those skilled in the art (See, e.g., Greg T.

Hermanson, Bioconjugate Techniques, Academic Press, 1966). [00287] The oligonucleotide described herein, e.g., a multipartite construct, an anti-ClQ oligonucleotide, a 10.36 oligonucleotide, as described above, or any combination thereof, can be used in the

pharmaceutical compositions disclosed herein or known in the art.

[00288] In some embodiments, the pharmaceutical composition further comprises a solvent.

[00289] In some embodiments, the solvent comprises water.

[00290] In some embodiments, the solvent comprises a pharmaceutically acceptable organic solvent. Any useful and pharmaceutically acceptable organic solvents can be used in the compositions described herein.

[00291] In some embodiments, the pharmaceutical composition is a solution of the salt in the

pharmaceutically acceptable organic solvent.

[00292] In some embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable organic solvent and further comprises a phospholipid, a sphingomyelin, or phosphatidyl choline. Without wishing to be bound by theory, it is believed that the phospholipid, sphingomyelin, or phosphatidyl choline facilitates formation of a precipitate when the pharmaceutical composition is injected into water and can also facilitate controlled release of the oligonucleotide from the resulting precipitate. Typically, the phospholipid, sphingomyelin, or phosphatidyl choline is present in an amount ranging from greater than 0 to 10 percent by weight of the pharmaceutical composition. In some embodiments, the phospholipid, sphingomyelin, or phosphatidyl choline is present in an amount ranging from about 0.1 to 10 percent by weight of the pharmaceutical composition. In some embodiments, the phospholipid, sphingomyelin, or phosphatidyl choline is present in an amount ranging from about 1 to 7.5 percent by weight of the pharmaceutical composition. In some embodiments, the phospholipid, sphingomyelin, or phosphatidyl choline is present in an amount ranging from about 1.5 to 5 percent by weight of the pharmaceutical composition. In some embodiments, the phospholipid, sphingomyelin, or phosphatidyl choline is present in an amount ranging from about 2 to 4 percent by weight of the pharmaceutical composition.

[00293] The pharmaceutical compositions can optionally comprise one or more additional excipients or additives to provide a dosage form suitable for administration to an animal. When administered to an animal, the oligonucleotide containing pharmaceutical compositions are typically administered as a component of a composition that comprises a pharmaceutically acceptable carrier or excipient so as to provide the form for proper administration to the animal. Suitable pharmaceutical excipients are described in Remington’s Pharmaceutical Sciences 1447-1676 (Alfonso R. Gennaro ed., 19th ed. 1995), incorporated herein by reference. The pharmaceutical compositions can take the form of solutions, suspensions, emulsion, tablets, pills, pellets, capsules, capsules containing liquids, powders, suppositories, emulsions, aerosols, sprays, suspensions, or any other form suitable for use.

[00294] In some embodiments, the pharmaceutical compositions are formulated for intravenous or parenteral administration. Typically, compositions for intravenous or parenteral administration comprise a suitable sterile solvent, which may be an isotonic aqueous buffer or pharmaceutically acceptable organic solvent. Where necessary, the compositions can also include a solubilizing agent. Compositions for intravenous administration can optionally include a local anesthetic such as lidocaine to lessen pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where oligonucleotide- containing pharmaceutical compositions are to be administered by infusion, they can be dispensed, for example, with an infusion bottle containing, for example, sterile pharmaceutical grade water or saline. Where the pharmaceutical compositions are administered by injection, an ampoule of sterile water for injection, saline, or other solvent such as a pharmaceutically acceptable organic solvent can be provided so that the ingredients can be mixed prior to administration.

[00295] In another embodiment, the pharmaceutical compositions are formulated in accordance with routine procedures as a composition adapted for oral administration. Compositions for oral delivery can be in the form of tablets, lozenges, aqueous or oily suspensions, granules, powders, emulsions, capsules, syrups, or elixirs, for example. Oral compositions can include standard excipients such as mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, and magnesium carbonate. Typically, the excipients are of pharmaceutical grade. Orally administered compositions can also contain one or more agents, for example, sweetening agents such as fructose, aspartame or saccharin; flavoring agents such as peppermint, oil of wintergreen, or cherry; coloring agents; and preserving agents, to provide a pharmaceutically palatable preparation. Moreover, when in tablet or pill form, the compositions can be coated to delay disintegration and absorption in the gastrointestinal tract thereby providing a sustained action over an extended period of time. Selectively permeable membranes surrounding an osmotically active driving compound are also suitable for orally administered compositions. A time-delay material such as glycerol monostearate or glycerol stearate can also be used.

[00296] The pharmaceutical compositions further comprising a solvent can optionally comprise a suitable amount of a pharmaceutically acceptable preservative, if desired, so as to provide additional protection against microbial growth. Examples of preservatives useful in the pharmaceutical compositions described herein include, but are not limited to, potassium sorbate, methylparaben, propylparaben, benzoic acid and its salts, other esters of parahydroxy benzoic acid such as butylparaben, alcohols such as ethyl or benzyl alcohol, phenolic compounds such as phenol, or quaternary compounds such as benzalkonium chlorides (e.g., benzethonium chloride).

[00297] In some embodiments, the pharmaceutical compositions described herein optionally contain a suitable amount of a pharmaceutically acceptable polymer. The polymer can increase the viscosity of the pharmaceutical composition. Suitable polymers for use in the compositions and methods described herein include, but are not limited to, hydroxypropylcellulose, hydoxypropylmethylcellulose (HPMC), chitosan, poly aery lie acid, and polymethacrylic acid.

[00298] Typically, the polymer is present in an amount ranging from greater than 0 to 10 percent by weight of the pharmaceutical composition. In some embodiments, the polymer is present in an amount ranging from about 0.1 to 10 percent by weight of the pharmaceutical composition. In some embodiments, the polymer is present in an amount ranging from about 1 to 7.5 percent by weight of the pharmaceutical composition. In some embodiments, the polymer is present in an amount ranging from about 1.5 to 5 percent by weight of the pharmaceutical composition. In some embodiments, the polymer is present in an amount ranging from about 2 to 4 percent by weight of the pharmaceutical composition. In some embodiments, the pharmaceutical compositions described herein are substantially free of polymers.

[00299] In some embodiments, any additional components added to the pharmaceutical compositions described herein are designated as GRAS by the FDA for use or consumption by animals. In some embodiments, any additional components added to the pharmaceutical compositions described herein are designated as GRAS by the FDA for use or consumption by humans.

[00300] The components of the pharmaceutical composition (the solvents and any other optional components) are preferably biocompatible and non-toxic and, over time, are simply absorbed and/or metabolized by the body.

[00301] As described above, the pharmaceutical compositions described herein can further comprise a solvent.

[00302] In some embodiments, the solvent comprises water.

[00303] In some embodiments, the solvent comprises a pharmaceutically acceptable organic solvent.

[00304] In an embodiment, the oligonucleotide described herein, e.g. , a multipartite construct, an anti- C1Q oligonucleotide, a 10.36 oligonucleotide, as described above, or any combination thereof, are available as the salt of a metal cation, for example, as the potassium or sodium salt. These salts, however, may have low solubility in aqueous solvents and/or organic solvents, typically, less than about 25 mg/mL. The pharmaceutical compositions described herein comprising (i) an amino acid ester or amino acid amide and (ii) a protonated oligonucleotide, however, may be significantly more soluble in aqueous solvents and/or organic solvents. Without wishing to be bound by theory, it is believed that the amino acid ester or amino acid amide and the protonated oligonucleotide form a salt, such as illustrated above, and the salt is soluble in aqueous and/or organic solvents.

[00305] Similarly, without wishing to be bound by theory, it is believed that the pharmaceutical compositions comprising (i) an oligonucleotide described herein; (ii) a divalent metal cation; and (iii) optionally a carboxylate, a phospholipid, a phosphatidyl choline, or a sphingomyelin form a salt, such as illustrated above, and the salt is soluble in aqueous and/or organic solvents.

[00306] In some embodiments, the concentration of the oligonucleotide described herein in the solvent is greater than about 2 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide described herein in the solvent is greater than about 5 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is greater than about 7.5 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is greater than about 10 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is greater than about 12 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is greater than about 15 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is ranges from about 2 percent to 5 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is ranges from about 2 percent to 7.5 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent ranges from about 2 percent to 10 percent by weight of the

pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is ranges from about 2 percent to 12 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is ranges from about 2 percent to 15 percent by weight of the pharmaceutical composition. In some embodiments, the concentration of the oligonucleotide in the solvent is ranges from about 2 percent to 20 percent by weight of the pharmaceutical composition.

[00307] Any pharmaceutically acceptable organic solvent can be used in the pharmaceutical compositions described herein. Representative, pharmaceutically acceptable organic solvents include, but are not limited to, pyrrolidone, N-methyl-2-pyrrolidone, polyethylene glycol, propylene glycol (i.e., 1,3- propylene glycol), glycerol formal, isosorbid dimethyl ether, ethanol, dimethyl sulfoxide, tetraglycol, tetrahydrofurfuryl alcohol, triacetin, propylene carbonate, dimethyl acetamide, dimethyl formamide, dimethyl sulfoxide, and combinations thereof.

[00308] In some embodiments, the pharmaceutically acceptable organic solvent is a water soluble solvent. A representative pharmaceutically acceptable water soluble organic solvents is triacetin.

[00309] In some embodiments, the pharmaceutically acceptable organic solvent is a water miscible solvent. Representative pharmaceutically acceptable water miscible organic solvents include, but are not limited to, glycerol formal, polyethylene glycol, and propylene glycol.

[00310] In some embodiments, the pharmaceutically acceptable organic solvent comprises pyrrolidone. In some embodiments, the pharmaceutically acceptable organic solvent is pyrrolidone substantially free of another organic solvent.

[00311] In some embodiments, the pharmaceutically acceptable organic solvent comprises N-methyl-2- pyrrolidone. In some embodiments, the pharmaceutically acceptable organic solvent is N-methyl-2- pyrrolidone substantially free of another organic solvent.

[00312] In some embodiments, the pharmaceutically acceptable organic solvent comprises polyethylene glycol. In some embodiments, the pharmaceutically acceptable organic solvent is polyethylene glycol substantially free of another organic solvent.

[00313] In some embodiments, the pharmaceutically acceptable organic solvent comprises propylene glycol. In some embodiments, the pharmaceutically acceptable organic solvent is propylene glycol substantially free of another organic solvent.

[00314] In some embodiments, the pharmaceutically acceptable organic solvent comprises glycerol formal. In some embodiments, the pharmaceutically acceptable organic solvent is glycerol formal substantially free of another organic solvent.

[00315] In some embodiments, the pharmaceutically acceptable organic solvent comprises isosorbid dimethyl ether. In some embodiments, the pharmaceutically acceptable organic solvent is isosorbid dimethyl ether substantially free of another organic solvent. [00316] In some embodiments, the pharmaceutically acceptable organic solvent comprises ethanol. In some embodiments, the pharmaceutically acceptable organic solvent is ethanol substantially free of another organic solvent.

[00317] In some embodiments, the pharmaceutically acceptable organic solvent comprises dimethyl sulfoxide. In some embodiments, the pharmaceutically acceptable organic solvent is dimethyl sulfoxide substantially free of another organic solvent.

[00318] In some embodiments, the pharmaceutically acceptable organic solvent comprises tetraglycol. In some embodiments, the pharmaceutically acceptable organic solvent is tetraglycol substantially free of another organic solvent.

[00319] In some embodiments, the pharmaceutically acceptable organic solvent comprises

tetrahydrofurfuryl alcohol. In some embodiments, the pharmaceutically acceptable organic solvent is tetrahydrofurfuryl alcohol substantially free of another organic solvent.

[00320] In some embodiments, the pharmaceutically acceptable organic solvent comprises triacetin. In some embodiments, the pharmaceutically acceptable organic solvent is triacetin substantially free of another organic solvent.

[00321] In some embodiments, the pharmaceutically acceptable organic solvent comprises propylene carbonate. In some embodiments, the pharmaceutically acceptable organic solvent is propylene carbonate substantially free of another organic solvent.

[00322] In some embodiments, the pharmaceutically acceptable organic solvent comprises dimethyl acetamide. In some embodiments, the pharmaceutically acceptable organic solvent is dimethyl acetamide substantially free of another organic solvent.

[00323] In some embodiments, the pharmaceutically acceptable organic solvent comprises dimethyl formamide. In some embodiments, the pharmaceutically acceptable organic solvent is dimethyl formamide substantially free of another organic solvent.

[00324] In some embodiments, the pharmaceutically acceptable organic solvent comprises at least two pharmaceutically acceptable organic solvents.

[00325] In some embodiments, the pharmaceutically acceptable organic solvent comprises N-methyl-2- pyrrolidone and glycerol formal. In some embodiments, the pharmaceutically acceptable organic solvent is N-methyl-2-pyrrolidone and glycerol formal. In some embodiments, the ratio of N-methyl-2- pyrrolidone to glycerol formal ranges from about 90: 10 to 10:90.

[00326] In some embodiments, the pharmaceutically acceptable organic solvent comprises propylene glycol and glycerol formal. In some embodiments, the pharmaceutically acceptable organic solvent is propylene glycol and glycerol formal. In some embodiments, the ratio of propylene glycol to glycerol formal ranges from about 90: 10 to 10:90.

[00327] In some embodiments, the pharmaceutically acceptable organic solvent is a solvent that is recognized as GRAS by the FDA for administration or consumption by animals. In some embodiments, the pharmaceutically acceptable organic solvent is a solvent that is recognized as GRAS by the FDA for administration or consumption by humans. [00328] In some embodiments, the pharmaceutically acceptable organic solvent is substantially free of water. In some embodiments, the pharmaceutically acceptable organic solvent contains less than about 1 percent by weight of water. In some embodiments, the pharmaceutically acceptable organic solvent contains less about 0.5 percent by weight of water. In some embodiments, the pharmaceutically acceptable organic solvent contains less about 0.2 percent by weight of water. Pharmaceutically acceptable organic solvents that are substantially free of water are advantageous since they are not conducive to bacterial growth. Accordingly, it is typically not necessary to include a preservative in pharmaceutical compositions that are substantially free of water. Another advantage of pharmaceutical compositions that use a pharmaceutically acceptable organic solvent, preferably substantially free of water, as the solvent is that hydrolysis of the oligonucleotide is minimized. Typically, the more water present in the solvent the more readily the oligonucleotide can be hydrolyzed. Accordingly,

oligonucleotide containing pharmaceutical compositions that use a pharmaceutically acceptable organic solvent as the solvent can be more stable than oligonucleotide containing pharmaceutical compositions that use water as the solvent.

[00329] In some embodiments, comprising a pharmaceutically acceptable organic solvent, the pharmaceutical composition is injectable.

[00330] In some embodiments, the injectable pharmaceutical compositions are of sufficiently low viscosity that they can be easily drawn into a 20 gauge and needle and then easily expelled from the 20 gauge needle. Typically, the viscosity of the injectable pharmaceutical compositions are less than about 1,200 cps. In some embodiments, the viscosity of the injectable pharmaceutical compositions are less than about 1,000 cps. In some embodiments, the viscosity of the injectable pharmaceutical compositions are less than about 800 cps. In some embodiments, the viscosity of the injectable pharmaceutical compositions are less than about 500 cps. Injectable pharmaceutical compositions having a viscosity greater than about 1,200 cps and even greater than about 2,000 cps (for example gels) are also within the scope described herein provided that the compositions can be expelled through an 18 to 24 gauge needle.

[00331] In some embodiments, comprising a pharmaceutically acceptable organic solvent, the pharmaceutical composition is injectable and does not form a precipitate when injected into water.

[00332] In some embodiments, comprising a pharmaceutically acceptable organic solvent, the pharmaceutical composition is injectable and forms a precipitate when injected into water. Without wishing to be bound by theory, it is believed, for pharmaceutical compositions that comprise a protonated oligonucleotide and an amino acid ester or amide, that the a-amino group of the amino acid ester or amino acid amide is protonated by the oligonucleotide to form a salt, such as illustrated above, which is soluble in the pharmaceutically acceptable organic solvent but insoluble in water. Similarly, when the pharmaceutical composition comprises (i) an oligonucleotide; (ii) a divalent metal cation; and (iii) optionally a carboxylate, a phospholipid, a phosphatidyl choline, or a sphingomyelin, it is believed that the components of the composition form a salt, such as illustrated above, which is soluble in the pharmaceutically acceptable organic solvent but insoluble in water. Accordingly, when the

pharmaceutical compositions are injected into an animal, at least a portion of the pharmaceutical composition precipitates at the injection site to provide a drug depot. Without wishing to be bound by theory, it is believed that when the pharmaceutically compositions are injected into an animal, the pharmaceutically acceptable organic solvent diffuses away from the injection site and aqueous bodily fluids diffuse towards the injection site, resulting in an increase in concentration of water at the injection site, that causes at least a portion of the composition to precipitate and form a drug depot. The precipitate can take the form of a solid, a crystal, a gummy mass, or a gel. The precipitate, however, provides a depot of the oligonucleotide at the injection site that releases the oligonucleotide over time. The components of the pharmaceutical composition, i.e., the amino acid ester or amino acid amide, the pharmaceutically acceptable organic solvent, and any other components are biocompatible and non-toxic and, over time, are simply absorbed and/or metabolized by the body.

[00333] In some embodiments, comprising a pharmaceutically acceptable organic solvent, the pharmaceutical composition is injectable and forms liposomal or micellar structures when injected into water (typically about 500 pL are injected into about 4 mL of water). The formation of liposomal or micellar structures are most often formed when the pharmaceutical composition includes a phospholipid. Without wishing to be bound by theory, it is believed that the oligonucleotide in the form of a salt, which can be a salt formed with an amino acid ester or amide or can be a salt with a divalent metal cation and optionally a carboxylate, a phospholipid, a phosphatidyl choline, or a sphingomyelin, that is trapped within the liposomal or micellar structure. Without wishing to be bound by theory, it is believed that when these pharmaceutically compositions are injected into an animal, the liposomal or micellar structures release the oligonucleotide over time.

[00334] In some embodiments, the pharmaceutical composition further comprising a pharmaceutically acceptable organic solvent is a suspension of solid particles in the pharmaceutically acceptable organic solvent. Without wishing to be bound by theory, it is believed that the solid particles comprise a salt formed between the amino acid ester or amino acid amide and the protonated oligonucleotide wherein the acidic phosphate groups of the oligonucleotide protonates the amino group of the amino acid ester or amino acid amide, such as illustrated above, or comprises a salt formed between the oligonucleotide; divalent metal cation; and optional carboxylate, phospholipid, phosphatidyl choline, or sphingomyelin, as illustrated above. Pharmaceutical compositions that are suspensions can also form drug depots when injected into an animal.

[00335] By varying the lipophilicity and/or molecular weight of the amino acid ester or amino acid amide it is possible to vary the properties of pharmaceutical compositions that include these components and further comprise an organic solvent. The lipophilicity and/or molecular weight of the amino acid ester or amino acid amide can be varied by varying the amino acid and/or the alcohol (or amine) used to form the amino acid ester (or amino acid amide). For example, the lipophilicity and/or molecular weight of the amino acid ester can be varied by varying the R1 hydrocarbon group of the amino acid ester. Typically, increasing the molecular weight of Rl increase the lipophilicity of the amino acid ester. Similarly, the lipophilicity and/or molecular weight of the amino acid amide can be varied by varying the R3 or R4 groups of the amino acid amide. [00336] For example, by varying the lipophilicity and/or molecular weight of the amino acid ester or amino acid amide it is possible to vary the solubility of the oligonucleotide described herein in water, to vary the solubility of the oligonucleotide in the organic solvent, vary the viscosity of the pharmaceutical composition comprising a solvent, and vary the ease at which the pharmaceutical composition can be drawn into a 20 gauge needle and then expelled from the 20 gauge needle.

[00337] Furthermore, by varying the lipophilicity and/or molecular weight of the amino acid ester or amino acid amide (i.e., by varying R1 of the amino acid ester or R3 and R4 of the amino acid amide) it is possible to control whether the pharmaceutical composition that further comprises an organic solvent will form a precipitate when injected into water. Although different oligonucleotides exhibit different solubility and behavior, generally the higher the molecular weight of the amino acid ester or amino acid amide, the more likely it is that the salt of the protonated oligonucleotide and the amino acid ester of the amide will form a precipitate when injected into water. Typically, when R1 of the amino acid ester is a hydrocarbon of about C16 or higher the pharmaceutical composition will form a precipitate when injected into water and when R1 of the amino acid ester is a hydrocarbon of about C12 or less the pharmaceutical composition will not form a precipitate when injected into water. Indeed, with amino acid esters wherein R1 is a hydrocarbon of about C12 or less, the salt of the protonated oligonucleotide and the amino acid ester is, in many cases, soluble in water. Similarly, with amino acid amides, if the combined number of carbons in R3 and R4 is 16 or more the pharmaceutical composition will typically form a precipitate when injected into water and if the combined number of carbons in R3 and R4 is 12 or less the pharmaceutical composition will not form a precipitate when injected into water. Whether or not a pharmaceutical composition that further comprises a pharmaceutically acceptable organic solvent will form a precipitate when injected into water can readily be determined by injecting about 0.05 mL of the pharmaceutical composition into about 4 mL of water at about 98° F. and determining how much material is retained on a 0.22 pm fdter after the composition is mixed with water and fdtered. Typically, a formulation or composition is considered to be injectable when no more than 10% of the formulation is retained on the filter. In some embodiments, no more than 5% of the formulation is retained on the filter. In some embodiments, no more than 2% of the formulation is retained on the filter. In some embodiments, no more than 1% of the formulation is retained on the filter.

[00338] Similarly, in pharmaceutical compositions that comprise a protonated oligonucleotide and a diester or diamide of aspartic or glutamic acid, it is possible to vary the properties of pharmaceutical compositions by varying the amount and/or lipophilicity and/or molecular weight of the diester or diamide of aspartic or glutamic acid. Similarly, in pharmaceutical compositions that comprise an oligonucleotide; a divalent metal cation; and a carboxylate, a phospholipid, a phosphatidyl choline, or a sphingomyelin, it is possible to vary the properties of pharmaceutical compositions by varying the amount and/or lipophilicity and/or molecular weight of the carboxylate, phospholipid, phosphatidyl choline, or sphingomyelin.

[00339] Further, when the pharmaceutical compositions that further comprises an organic solvent form a depot when administered to an animal, it is also possible to vary the rate at which the oligonucleotide is released from the drug depot by varying the lipophilicity and/or molecular weight of the amino acid ester or amino acid amide. Generally, the more lipophilic the amino acid ester or amino acid amide, the more slowly the oligonucleotide is released from the depot. Similarly, when the pharmaceutical compositions that further comprises an organic solvent and also further comprise a carboxylate, phospholipid, phosphatidyl choline, sphingomyelin, or a diester or diamide of aspartic or glutamic acid and form a depot when administered to an animal, it is possible to vary the rate at which the oligonucleotide is released from the drug depot by varying the amount and/or lipophilicity and/or molecular weight of the carboxylate, phospholipid, phosphatidyl choline, sphingomyelin, or the diester or diamide of aspartic or glutamic acid.

[00340] Release rates from a precipitate can be measured injecting about 50 pL of the pharmaceutical composition into about 4 mL of deionized water in a centrifuge tube. The time that the pharmaceutical composition is injected into the water is recorded as T=0. After a specified amount of time, T, the sample is cooled to about -9° C. and spun on a centrifuge at about 13,000 rpm for about 20 min. The resulting supernatant is then analyzed by HPLC to determine the amount of oligonucleotide present in the aqueous solution. The amount of oligonucleotide in the pellet resulting from the centrifugation can also be determined by collecting the pellet, dissolving the pellet in about 10 pL of methanol, and analyzing the methanol solution by HPLC to determine the amount of oligonucleotide in the precipitate. The amount of oligonucleotide in the aqueous solution and the amount of oligonucleotide in the precipitate are determined by comparing the peak area for the HPLC peak corresponding to the oligonucleotide against a standard curve of oligonucleotide peak area against concentration of oligonucleotide. Suitable HPLC conditions can be readily determined by one of ordinary skill in the art.

[00341] Methods of Treatment

[00342] The pharmaceutical compositions described herein are useful in human medicine and veterinary medicine. Accordingly, the invention further relates to a method of treating or preventing a condition in an animal comprising administering to the animal an effective amount of the pharmaceutical composition described herein. In some embodiments, the subject is identified, e.g., identified as likely to benefit from the treatment using a method described herein.

[00343] In some embodiments, the invention relates to methods of beating a condition in an animal comprising administering to an animal in need thereof an effective amount of a pharmaceutical composition described herein.

[00344] In some embodiments, the invention relates to methods of preventing a condihon in an animal comprising administering to an animal in need thereof an effective amount of a pharmaceutical composition described herein.

[00345] Methods of adminisbation include, but are not limited to, inbadermal, inbamuscular, inbaperitoneal, inbavenous, subcutaneous, inbanasal, epidural, oral, sublingual, inbacerebral, inbavaginal, bansdermal, rectal, by inhalation, or topical. The mode of adminisbation is left to the discretion of the practitioner. In some embodiments, adminisbation will result in the release of the oligonucleotide described herein, e.g., an aptamer, an drug targeting aptamer, a multipartite construct, or any combination thereof, into the bloodstream.

[00346] In some embodiments, the method of treating or preventing a condition in an animal comprises administering to the animal in need thereof an effective amount of an oligonucleotide by parenterally administering the pharmaceutical composition described herein. In some embodiments, the

pharmaceutical compositions are administered by infusion or bolus injection. In some embodiments, the pharmaceutical composition is administered subcutaneously.

[00347] In some embodiments, the method of treating or preventing a condition in an animal comprises administering to the animal in need thereof an effective amount of an oligonucleotide by orally administering the pharmaceutical composition described herein. In some embodiments, the composition is in the form of a capsule or tablet.

[00348] The pharmaceutical compositions can also be administered by any other convenient route, for example, topically, by absorption through epithelial or mucocutaneous linings (e.g., oral, rectal, and intestinal mucosa, etc.).

[00349] The pharmaceutical compositions can be administered systemically or locally.

[00350] The pharmaceutical compositions can be administered together with another biologically active agent.

[00351] In some embodiments, the animal is a mammal.

[00352] In some embodiments, the animal is a human.

[00353] In some embodiments, the animal is a non-human animal.

[00354] In some embodiments, the animal is a canine, a feline, an equine, a bovine, an ovine, or a porcine.

[00355] The effective amount administered to the animal depends on a variety of factors including, but not limited to the type of animal being treated, the condition being treated, the severity of the condition, and the specific multipartite construct being administered. A treating physician can determine an effective amount of the pharmaceutical composition to treat a condition in an animal.

[00356] In some embodiments, the multipartite construct can inhibit angiogenesis. In some embodiments, the multipartite construct can inhibit angiogenesis and the disease being treated is cancer. In some embodiments, the aptamer can inhibit angiogenesis and the disease being treated is a solid tumor.

[00357] The multipartite construct can be a multipartite construct that inhibits a neoplastic growth or a cancer. In embodiments, the cancer comprises an acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma; AIDS-related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma); breast cancer; bronchial tumors; Burkitt lymphoma; cancer of unknown primary site; carcinoid tumor; carcinoma of unknown primary site; central nervous system atypical teratoid/rhabdoid tumor; central nervous system embryonal tumors; cervical cancer; childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer;

ependymoblastoma; ependymoma; esophageal cancer; esthesioneuroblastoma; Ewing sarcoma;

extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer; liver cancer; malignant fibrous histiocytoma bone cancer; medulloblastoma; medulloepithelioma;

melanoma; Merkel cell carcinoma; Merkel cell skin carcinoma; mesothelioma; metastatic squamous neck cancer with occult primary; mouth cancer; multiple endocrine neoplasia syndromes; multiple myeloma; multiple myeloma/plasma cell neoplasm; mycosis fungoides; myelodysplastic syndromes;

myeloproliferative neoplasms; nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer;

oropharyngeal cancer; osteosarcoma; other brain and spinal cord tumors; ovarian cancer; ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; pancreatic cancer; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile cancer; pharyngeal cancer; pineal parenchymal tumors of intermediate differentiation; pineoblastoma; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system (CNS) lymphoma; primary hepatocellular liver cancer; prostate cancer; rectal cancer; renal cancer; renal cell (kidney) cancer; renal cell cancer; respiratory tract cancer; retinoblastoma; rhabdomyosarcoma; salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma;

squamous cell carcinoma; squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer; thymic carcinoma; thymoma; thyroid cancer; transitional cell cancer; transitional cell cancer of the renal pelvis and ureter; trophoblastic tumor; ureter cancer; urethral cancer; uterine cancer; uterine sarcoma; vaginal cancer; vulvar cancer; Waldenstrom macroglobulinemia; or Wilm’s tumor. The compositions and methods described herein can be used to treat these and other cancers.

Oligonucleotide Probe Methods

[00358] Nucleic acid sequences fold into secondary and tertiary motifs particular to their nucleotide sequence. These motifs position the positive and negative charges on the nucleic acid sequences in locations that enable the sequences to bind to specific locations on target molecules, including without limitation proteins and other amino acid sequences. These binding sequences are known in the field as aptamers. Due to the trillions of possible unique nucleotide sequences in even a relatively short stretch of nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

33, 34, 35, 36, 37, 38, 39 or 40 nucleotides), a large variety of motifs can be generated, resulting in aptamers for almost any desired protein or other target. [00359] As described above, aptamers can be created by randomly generating oligonucleotides of a specific length, typically 20-80 base pairs long, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79 or 80 base pairs. These random oligonucleotides are then incubated with the target of interest (e.g., tissue, cell, protein, etc). After several wash steps, the oligonucleotides that bind to the target are collected and amplified. The amplified aptamers are iteratively added to the target and the process is repeated, often 15-20 times. A common version of this process known to those of skill in the art as the SELEX method.

[00360] The end result comprises one or more oligonucleotide probes / aptamers with high affinity to the target. The invention provides further processing of such resulting aptamers that can be use to provide desirable characteristics: 1) competitive binding assays to identify aptamers to a desired epitope; 2) motif analysis to identify high affinity binding aptamers in silico: and 3) aptamer selection assays to identify aptamers that can be used to detect a particular disease. The methods are described in more detail below and further in the Examples.

[00361] The invention further contemplates aptamer sequences that are highly homologous to the sequences that are discovered by the methods described herein.“High homology” typically refers to a homology of 40% or higher, preferably 60% or higher, 70% or higher, more preferably 80% or higher, even more preferably 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher between a polynucleotide sequence sequence and a reference sequence. In an embodiment, the reference sequence comprises the sequence of one or more aptamer provided herein. Percent homologies (also referred to as percent identity) are typically carried out between two optimally aligned sequences. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences and comparison can be conducted, e.g., using the algorithm in“Wilbur and Lipman, Proc Natl Acad Sci USA 80: 726-30 (1983)”. Homology calculations can also be performed using BLAST, which can be found on the NCBI server at: ncbi.nlm.nih.gov/BLAST/ (Altschul S F, et al, Nucleic Acids Res. 1997; 25(17):3389-402; Altschul S F, et al, J Mol. Biol. 1990; 215(3):403-10). In the case of an isolated polynucleotide which is longer than or equivalent in length to the reference sequence, e.g., a sequence identified by the methods herein, the comparison is made with the full length of the reference sequence. Where the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than a sequence identified by the methods herein, the comparison is made to a segment of the reference sequence of the same length (excluding any loop required by the homology calculation).

[00362] The invention further contemplates aptamer sequences that are functional fragments of the sequences that are discovered by the methods described herein. In the context of an aptamer sequence, a “functional fragment” of the aptamer sequence may comprise a subsequence that binds to the same target as the full length sequence. In some instances, a candidate aptamer sequence is from a member of a library that contains a 5’ leader sequences and/or a 3’ tail sequence. Such leader sequences or tail sequences may serve to facilitate primer binding for amplification or capture, etc. In these embodiments, the functional fragment of the full length sequence may comprise the subsequence of the candidate aptamer sequence absent the leader and/or tail sequences.

[00363] Competitive Antibody Addition

[00364] Known aptamer production methods may involve eluting all bound aptamers from the target sequence. In some cases, this may not easily identify the desired aptamer sequence. For example, when trying to replace an antibody in an assay, it may be desirable to only collect aptamers that bind to the specific epitope of the antibody being replaced. The invention provides a method comprising addition of an antibody that is to be replaced to the aptamer/target reaction in order to allow for the selective collection of aptamers which bind to the antibody epitope. In an embodiment, the method comprises incubating a reaction mixture comprising randomly generated oligonucleotides with a target of interest, removing unbound aptamers from the reaction mixture that do not bind the target, adding an antibody to the reaction mixture that binds to that epitope of interest, and collecting the aptamers that are displaced by the antibody. The target can be a biological entity such as disclosed herein, e.g., a protein.

[00365] Motif Analysis

[00366] In aptamer experiments, multiple aptamer sequences can be identified that bind to a given target. These aptamers will have various binding affinities. It can be time consuming and laborious to generate quantities of these many aptamers sufficient to assess the affinities of each. To identify large numbers of aptamers with the highest affinities without physically screening large subsets, the invention provides a method comprising the analysis of the two dimensional structure of one or more high affinity aptamers to the target of interest. In an embodiment, the method comprises screening the database for aptamers that have similar two-dimensional structures, or motifs, but not necessarily similar primary sequences. In an embodiment, the method comprises identifying a high affinity aptamer using traditional methods such as disclosed herein or known in the art (e.g. surface plasmon resonance binding assay), approximating the two-dimensional structure of the high affinity aptamer, and identifying aptamers from a pool of sequences that are predicted to have a similar two-dimensional structure to the high affinity aptamer. The method thereby provides a pool of candidates that also bind the target of interest. The two-dimensional structure of an oligo can be predicting using methods known in the art, e.g., via free energy (AG) calculations performed using a commercially available software program such as Vienna or mFold, for example as described in Mathews, D., Sabina, J., Zucker, M. & Turner, H. Expanded sequence dependence of thermodynamic parameters provides robust prediction of RNA secondary structure. J. Mol. Biol. 288, 911-940 (1999); Hofacker et al., Monatshefte f. Chemie 125: 167-188 (1994); and Hofacker, I. L. Vienna RNA secondary structure server. Nucleic Acids Res. 31, 3429-3431 (2003), the contents of which are incorporated herein by reference in their entirety. See FIGs. IA-lB.The pool of sequences can be sequenced from a pool of randomly generated aptamer candidates using a high-throughput sequencing platform, such as the Ion Torrent platform from Thermo Fisher Scientific (Waltham, MA) or

HiSeq/NextSeq/MiSeq platform from Illumina, Inc (San Diego, CA). Identifying aptamers from a pool of sequences that are predicted to have a similar two-dimensional structure to the high affinity aptamer may comprise loading the resulting sequences into the software program of choice to identify members of the pool of sequences with similar two-dimensional structures as the high affinity aptamer. The affinities of the pool of sequences can then be determined in situ, e.g., surface plasmon resonance binding assay or the like.

[00367] Aptamer Subtraction Methods

[00368] In order to develop an assay to detect a disease, for example, cancer, one typically screens a large population of known biomarkers from normal and diseased patients in order to identify markers that correlate with disease. This process works where discriminating markers are already described. In order to address this problem, the invention provides a method comprising subtracting out non-discriminating aptamers from a large pool of aptamers by incubating them initially with non-target tissue, microvesicles, cells, or other targets of interest. The non-target entities can be from a normal / healthy / non-diseased sample. The aptamers that did not bind to the normal non-target entities are then incubated with diseased entities. The aptamers that bind to the diseased entities but that did not bind the normal entities are then possible candidates for an assay to detect the disease. This process is independent of knowing the existence of a particular marker in the diseased sample.

[00369] Subtraction methods can be used to identify aptamers that preferentially recognize a desired population of targets. In an embodiment, the subtraction method is used to identify aptamers that preferentially recognize target from a diseased target population over a control (e.g., normal or non- diseased) population. The diseased target population may be a tissue or a population of cells or microvesicles from a diseased individual or individuals, whereas the control population comprises corresponding tissue, cells or microvesicles from a non-diseased individual or individuals. The disease can be a cancer or other disease disclosed herein or known in the art. Accordingly, the method provides aptamers that preferentially identify disease targets versus control targets.

[00370] Circulating microvesicles can be isolated from control samples, e.g., plasma from“normal” individuals that are absent a disease of interest, such as an absence of cancer. Vesicles in the sample are isolated using a method disclosed herein or as known in the art. For example, vesicles can be isolated from the plasma by one of the following methods: filtration, ultrafiltration, nanomembrane ultrafiltration, the ExoQuick reagent (System Biosciences, Inc., Mountain View, CA), centrifugation, ultracentrifugation, using a molecular crowding reagent (e.g., TEXIS from Life Technologies), polymer precipitation (e.g., polyethylene glycol (PEG)), affinity isolation, affinity selection, immunoprecipitation, chromatography, size exclusion, or a combination of any of these methods. The microvesicles isolated in each case will be a mixture of vesicle types and will be various sizes although ultracentrifugation methods may have more tendencies to produce exosomal-sized vesicles. Randomly generated oligonucleotide libraries (e.g., produced as described in the Examples herein) are incubated with the isolated normal vesicles. The aptamers that do not bind to these vesicles are isolated, e.g., by precipitating the vesicles (e.g, with PEG) and collecting the supernatant containing the non-binding aptamers. These non-binding aptamers are then contacted with vesicles isolated from diseased patients (e.g., using the same methods as described above) to allow the aptamers to recognize the disease vesicles. Next, aptamers that are bound to the diseased vesicles are collected. In an embodiment, the vesicles are isolated then lysed using a chaotropic agent (e.g., SDS or a similar detergent), and the aptamers are then captured by running the lysis mixture over an affinity column. The affinity column may comprise streptavidin beads in the case of biotin conjugated aptamer pools. The isolated aptamers are the amplified. The process can then then repeated, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more times to achieve aptamers having a desired selectivity for the target.

[00371] In one aspect described herein, an aptamer profile is identified that can be used to characterize a biological sample of interest. In an embodiment, a pool of randomly generated oligonucleotides, e.g., at least 10, 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ⁿ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , 10 ¹⁸ , 10 ¹⁹ or at least 10 ²⁰ oligonucleotides, is contacted with a biological component or target of interest from a control population. The oligonucleotides that do not bind the biological component or target of interest from the control population are isolated and then contacted with a biological component or target of interest from a test population. The oligonucleotides that bind the biological component or target of interest from the test population are retained. The retained oligonucleotides can be used to repeat the process by contacting the retained oligonucleotides with the biological component or target of interest from the control population, isolating the retained oligonucleotides that do not bind the biological component or target of interest from the control population, and again contacting these isolated oligonucleotides with the biological component or target of interest from the test population and isolating the binding oligonucleotides. The“component” or“target” can be anything that is present in sample to which the oligonucleotides are capable of binding (e.g., tissue, cells, microvesicles, polypeptides, peptide, nucleic acid molecules, carbodyhrates, lipids, etc.). The process can be repeated any number of desired iterations, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 or more times. The resulting oligonucleotides comprise aptamers that can differentially detect the test population versus the control. These aptamers provide an aptamer profile, which comprises a biosignature that is determined using one or more aptamer, e.g., a biosignature comprising a presense or level of the component or target which is detected using the one or more aptamer.

[00372] In an embodiment, the invention provides an isolated polynucleotide that encodes a polypeptide, or a fragment thereof, identified by the methods above. The invention further provides an isolated polynucleotide having a nucleotide sequence that is at least 60% identical to the nucleotide sequence identified by the methods above. More preferably, the isolated nucleic acid molecule is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, identical to the nucleotide sequence identified by the methods above. In the case of an isolated polynucleotide which is longer than or equivalent in length to the reference sequence, e.g., a sequence identified by the methods above, the comparison is made with the full length of the reference sequence. Where the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than a sequence identified by the methods above, the comparison is made to a segment of the reference sequence of the same length (excluding any loop required by the homology calculation).

[00373] In a related aspect, the invention provides a method of characterizing a biological phenotype using an aptamer profile. The aptamer profile can be determined using the method above. The aptamer profile can be determined for a test sample and compared to a control aptamer profile. The phenotype may be a disease or disorder such as a cancer. Characterizing the phenotype can include without limitation providing a diagnosis, prognosis, or theranosis. Thus, the aptamer profile can provide a diagnostic, prognostic and/or theranostic readout for the subject from whom the test sample is obtained.

[00374] In another embodiment, an aptamer profile is determined for a test sample by contacting a pool of aptamer molecules to the test sample, contacting the same pool of aptamers to a control sample, and identifying one or more aptamer molecules that differentially bind a component or target in the test sample but not in the control sample (or vice versa). A“component” or“target” as used in the context of the biological test sample or control sample can be anything that is present in sample to which the aptamers are capable of binding (e.g., tissue, cells, microvesicles, polypeptides, peptide, nucleic acid molecules, carbodyhrates, lipids, etc.). For example, if a sample is a plasma or serum sample, the aptamer molecules may bind a polypeptide biomarker that is solely expressed or differentially expressed (over- or underexpressed) in a disease state as compared to a non-diseased subject. Comparison of the aptamer profile in the test sample as compared to the control sample may be based on qualitative and quantitative measure of aptamer binding (e.g., binding versus no binding, or level of binding in test sample versus different level of binding in the reference control sample).

[00375] In an aspect, the invention provides a method of identifying a target-specific aptamer profile, comprising contacting a biological test sample with a pool of aptamer molecules, contacting the pool to a control biological sample, identifying one or more aptamers that bind to a component in said test sample but not to the control sample, thereby identifying an aptamer profile for said biological test sample. In an embodiment, a pool of aptamers is selected against a disease sample and compared to a reference sample, the aptamers in a subset that bind to a component(s) in the disease sample but not in the reference sample can be sequenced using conventional sequencing techniques to identify the subset that bind, thereby identifying an aptamer profile for the particular disease sample. In this way, the aptamer profile provides an individualized platform for detecting disease in other samples that are screened. Furthermore, by selecting an appropriate reference or control sample, the aptamer profile can provide a diagnostic, prognostic and/or theranostic readout for the subject from whom the test sample is obtained.

[00376] In a related aspect, the invention provides a method of selecting a pool of aptamers, comprising: (a) contacting a biological control sample with a pool of oligonucleotides; (b) isolating a first subset of the pool of oligonucleotides that do not bind the biological control sample; (c) contacting the biological test sample with the first subset of the pool of oligonucleotides; and (d) isolating a second subset of the pool of oligonucleotides that bind the biological test sample, thereby selecting the pool of aptamers. The pool of oligonucleotides may comprise any number of desired sequences, e.g., at least 10, 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ ,

10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ⁿ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , 10 ¹⁸ , 10 ¹⁹ or at least 10 ²⁰ oligonucleotides may be present in the starting pool. Steps (a)-(d) may be repeated to further hone the pool of aptamers. In an embodiment, these steps are repeated at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,

19 or at least 20 times. [00377] As described herein, the biological test sample and biological control sample may comprise tissues, cells, microvesicles, or biomarkers of interest. In an embodiment, the biological test sample and optionally biological control sample comprise a bodily fluid. The bodily fluid may comprise without limitation peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, Cowper’s fluid, pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural fluid, peritoneal fluid, malignant fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates or other lavage fluids. Tthe biological test sample and optionally biological control may also comprise a tumor sample, e.g., cells from a tumor or tumor tissue. In other embodiments, the biological test sample and optionally biological control sample comprise a cell culture medium. In embodiments, the biological test sample comprises a diseased sample and the biological control sample comprises a non-diseased sample.

Accordingly, the pool of aptamers may be used to provide a diagnostic, prognostic and/or theranostic readout for the disease.

[00378] The invention further provides kits comprising one or more reagent to carry out the methods above. In an embodiment, the one or more reagent comprises a library of potential binding agents that comprises one or more of an aptamer, antibody, and other useful binding agents described herein or known in the art.

[00379] Negative and Positive Aptamer Selection

[00380] Aptamers can be used in various biological assays, including numerous types of assays which rely on a binding agent. For example, aptamers can be used instead of or along side antibodies in various immunoassay formats, such as sandwich assays, flow cytometry and IHC. The invention provides an aptamer screening method that identifies aptamers that do not bind to any surfaces (substrates, tubes, filters, beads, other antigens, etc.) throughout the assay steps and bind specifically to an antigen of interest. The assay relies on negative selection to remove aptamers that bind non-target antigen components of the final assay. The negative selection is followed by positive selection to identify aptamers that bind the desired antigen.

[00381] In an aspect, the invention provides a method of identifying an aptamer specific to a target of interest, comprising (a) contacting a pool of candidate aptamers with one or more assay components, wherein the assay components do not comprise the target of interest; (b) recovering the members of the pool of candidate aptamers that do not bind to the one or more assay components in (a); (c) contacting the members of the pool of candidate aptamers recovered in (b) with the target of interest in the presence of one or more confounding target; and (d) recovering a candidate aptamer that binds to the target of interest in step (c), thereby identifying the aptamer specific to the target of interest. In the method, steps (a) and (b) provide negative selection to remove aptamers that bind non-target entities. Conversely, steps (c) and (d) provide positive selection by identifying aptamers that bind the target of interest but not other confounding targets, e.g., other antigens that may be present in a biological sample which comprises the target of interest. The pool of candidate aptamers may comprise at least 10, 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ ,

10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ⁿ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , 10 ¹⁸ , 10 ¹⁹ or at least 10 ²⁰ nucleic acid sequences.

[00382] In some embodiments, steps (a)-(b) are optional. In other embodiments, steps (a)-(b) are repeated at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or at least 20 times before positive selection in step (c) is performed. The positive selection can also be performed in multiple rounds. Steps (c)-(d) can be repeated at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or at least 20 times before identifying the aptamer specific to the target of interest. Multiple rounds may provide improved stringency of selection.

[00383] In some embodiments, the one or more assay components contacted with the aptamer pool during negative selection comprise one or more of a substrate, a bead, a planar array, a column, a tube, a well, or a filter. One of skill will appreciate that the assay components can include any substance that may be part of a desired biological assay.

[00384] The target of interest can be any appropriate entity that can be detected when recognized by an aptamer. In an embodiment, the target of interest comprises a protein or polypeptide. As used herein, “protein,”“polypeptide” and“peptide” are used interchangeably unless stated otherwise. The target of interest can be a nucleic acid, including DNA, RNA, and various subspecies of any thereof as disclosed herein or known in the art. The target of interest can comprise a lipid. The target of interest can comprise a carbohydrate. The target of interest can also be a complex, e.g., a complex comprising protein, nucleic acids, lipids and/or carbohydrates. In some embodiments, the target of interest comprises a tissue, cell, or microvesicle. In such cases, the aptamer may be a binding agent to a surface antigen or disease antigen.

[00385] The surface antigen can be a biomarker of a disease or disorder. In such cases, the aptamer may be used to provide a diagnosis, prognosis or theranosis of the disease or disorder. As a non-limiting example, the one or more protein may comprise one or more of PSMA, PCSA, B7H3, EpCam, ADAM- 10, BCNP, EGFR, IL1B, KLK2, MMP7, p53, PBP, SERPINB3, SPDEF, SSX2, and SSX4. These markers can be used detect a prostate cancer.

[00386] The one or more confounding target can be an antigen other than the target of interest. For example, a confounding target can be another entity that may be present in a sample to be assayed. As a non-limiting example, consider that the sample to be assessed is a tissue or blood sample from an individual. The target of interest may be a protein, e.g., a surface antigen, which is present in the sample.

In this case, a confounding target could be selected from any other antigen that is likely to be present in the sample. Accordingly, the positive selection should provide candidate aptamers that recognize the target of interest but have minimal, if any, interactions with the confounding targets. In some embodiments, the target of interest and the one or more confounding target comprise the same type of biological entity, e.g., all protein, all nucleic acid, all carbohydrate, or all lipids. As a non-limiting example, the target of interest can be a protein selected from the group consisting of SSX4, SSX2, PBP, KFK2, SPDEF, and EpCAM, and the one or more confounding target comprises the other members of this group. In other embodiments, the target of interest and the one or more confounding target comprise different types of biological entities, e.g., any combination of protein, nucleic acid, carbohydrate, and lipids. The one or more confounding targets may also comprise different types of biological entities, e.g., any combination of protein, nucleic acid, carbohydrate, and lipids.

[00387] In an embodiment, the invention provides an isolated polynucleotide, or a fragment thereof, identified by the methods above. The invention further provides an isolated polynucleotide having a nucleotide sequence that is at least 60% identical to the nucleotide sequence identified by the methods above. The isolated polynucleotide is also referred to as an aptamer or oligonucleotide probe. More preferably, the isolated nucleic acid molecule is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, identical to the nucleotide sequence identified by the methods above. In the case of an isolated polynucleotide which is longer than or equivalent in length to the reference sequence, e.g., a sequence identified by the methods above, the comparison is made with the full length of the reference sequence. Where the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than a sequence identified by the methods above, the comparison is made to a segment of the reference sequence of the same length (excluding any loop required by the homology calculation).

[00388] In a related aspect, the invention provides a method of selecting a group of aptamers, comprising: (a) contacting a pool of aptamers to a tissue from a first sample; (b) enriching a subpool of aptamers that show affinity to the tissue from the first sample; (c) contacting the subpool to a second tissue from a second sample; and (d) depleting a second subpool of aptamers that show affinity to the second tissue from the second sample, thereby selecting the group of aptamers that have preferential affinity for the tissue from the first sample as compared to the second sample. The first sample and/or second sample may comprise a fixed tissue such as disclosed herein. For example, the fixed tissue may include FFPE tissue. The first sample and/or second sample may comprise a tumor sample.

[00389] In an embodiment, the first sample comprises a cancer sample and the second sample comprises a control sample, such as a non-cancer sample. The first sample and/or and the second sample may each comprise a pooled sample. For example, the first sample and/or second sample can comprise bodily fluid from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 individuals. In such cases, the members of a pool may be chosen to represent a desired phenotype. In a non-limiting example, the members of the first sample pool may be from patients with a cancer and the members of the second sample pool may be from non-cancer controls. With tissue samples, the first sample may comprise tissues from different individuals, e.g., from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 individuals. As a nonlimiting example, the first sample may comprise a fixed tissue from each individual.

[00390] Steps (a)-(d) can be repeated a desired number of times in order to further enrich the pool in aptamers that have preferential affinity for the target from the first sample. For example, steps (a)-(d) can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 times. The output from step (d) can be used as the input to repeated step (a). In embodiment, the first sample and/or second sample are replaced with a different sample before repeating steps (a)-(d). In a non-limiting example, members of a first sample pool may be from patients with a cancer and members of a second sample pool may be from non-cancer controls. During subsequent repetitions of steps (a)-(d), the first sample pool may comprise samples from different cancer patients than in the prior round/s. Similarly, the second sample pool may comprise samples from different controls than in the prior round/s.

[00391] In still another related aspect, the invention provides a method of enriching a plurality of oligonucleotides, comprising: (a) contacting a first sample with the plurality of oligonucleotides; (b) fractionating the first sample contacted in step (a) and recovering members of the plurality of oligonucleotides that fractionated with the first sample; (c) contacting the recovering members of the plurality of oligonucleotides from step (b) with a second sample; (d) fractionating the second sample contacted in step (c) and recovering members of the plurality of oligonucleotides that did not fractionate with the second sample; (e) contacting the recovering members of the plurality of oligonucleotides from step (d) with a third sample; and (f) fractionating the third sample contacted in step (a) and recovering members of the plurality of oligonucleotides that fractionated with the third sample; thereby enriching the plurality of oligonucleotides. The samples can be of any appropriate form as described herein, e.g., tissue, cells, microvesicles, etc. The first and third samples may have a first phenotype while the second sample has a second phenotype. Thus, positive selection occurs for the samples associated with the first phenotype and negative selection occurs for the samples associated with the second phenotype. In one non-limiting example of such selection schemes, the first phenotype comprises biopsy -positive breast cancer and the second phenotype comprises non-breast cancer (biopsy -negative or healthy).

[00392] In some embodiments, the first phenotype comprises a medical condition, disease or disorder and the second phenotype comprises a healthy state or a different state of the medical condition, disease or disorder. The first phenotype can be a healthy state and the second phenotype comprises a medical condition, disease or disorder. The medical condition, disease or disorder can be any detectable medical condition, disease or disorder, including without limitation a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain. Various types of such conditions are disclosed herein. See, e.g., Section“Phenotypes” herein.

[00393] When the sample comprises an FFPE tissue sample, the sample can be subjected to epitope retrival, also known as antigen retrival, prior ro the enrichment process. Although tissue fixation is useful for the preservation of tissue morphology, this process can also have a negative impact on immuno detection methods. For example, fixation can alter protein biochemistry such that the epitope of interest is masked and can no longer bind to the primary antibody. Masking of the epitope can be caused by cross- linking of amino acids within the epitope, cross-linking unrelated peptides at or near an epitope, altering the conformation of an epitope, or altering the electrostatic charge of the antigen. Epitope retrieval refers to any technique in which the masking of an epitope is reversed and epitope-recognition is restored. Techniques for epitope retrieval are known in the art. For example, enzymes including Proteinase K, Trypsin, and Pepsin have been used successfully to restore epitope binding. Without being bound by theory, the mechanism of action may be the cleavage of peptides that may be masking the epitope. Heating the sample may also reverse some cross-links and allows for restoration of secondary or tertiary structure of the epitope. Change in pH or cation concentration may also influence epitope availability.

[00394] The contacting can be performed in the presence of a competitor, which may reduce non-specific binding events. Any useful competitor can be used. In an embodiment, the competitor comprises at least one of salmon sperm DNA, tRNA, dextran sulfate and carboxymethyl dextran. As desired, different competitors or competitor concentrations can be used at different contacting steps.

[00395] The method can be repeated to achieve a desired enrichment. In an embodiment, steps (a)-(f) are repeated at least once. These steps can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,

18, 19, 20, or more than 20 times as desired. At the same time, each of the contacting steps can be repeated as desired. In some embodiments, the method further comprises: (i) repeating steps (a)-(b) at least once prior to step (c), wherein the recovered members of the plurality of oligonucleotides that fractionated with the first sample in step (b) are used as the input plurality of oligonucleotides for the repetition of step (a); (ii) repeating steps (c)-(d) at least once prior to step (e), wherein the recovered members of the plurality of oligonucleotides that did not fractionate with the second sample in step (d) are used as the input plurality of oligonucleotides for the repetition of step (c); and/or (iii) repeating steps (e)- (f) at least once, wherein the recovered members of the plurality of oligonucleotides that fractionated with the third sample in step (f) are used as the input plurality of oligonucleotides for the repetition of step (e). Repetitions (i)-(iii) can be repeated any desired number of times, e.g., (i)-(iii) can be repeated 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more than 20 times. In an embodiment, (i)-(iii) each comprise three repetitions.

[00396] The method may further comprise identifying the members of the selected group of aptamers or oligonucleotides, e.g., by DNA sequencing. The sequencing may be performed by Next Generation sequencing as desired and after or before any desired step in the method.

[00397] The method may also comprise identifying the targets of the selected group of

aptamers/oligonucleotides. Useful methods to identify such targets are disclosed herein. In a non-limiting example, an enriched oligonucleotide library is contacted with an appropriate sample (e.g., the first or third sample), the library is cross-linked to the sample, and the library is recovered. Proteins cross-linked with the recovered library are identified, e.g., by mass spectrometry.

[00398] Oligonucleotide Probe Target Identification

[00399] The methods and kits above can be used to identify binding agents that differentiate between two target populations. The invention further provides methods of identifying the targets of such binding agents. For example, the methods may further comprise identifying a surface marker of a cell or microvesicle that is recognized by the binding agent.

[00400] In an embodiment, the invention provides a method of identifying a target of a binding agent comprising: (a) contacting the binding agent with the target to bind the target with the binding agent, wherein the target comprises a surface antigen of a cell or microvesicle; (b) disrupting the cell or microvesicle under conditions which do not disrupt the binding of the target with the binding agent; (c) isolating the complex between the target and the binding agent; and (d) identifying the target bound by the binding agent. The binding agent can be a binding agent identified by the methods above, e.g., an oligonucleotide probe, ligand, antibody, or other useful binding agent that can differentiate between two target populations, e.g., by differentiating between biomarkers thereof.

[00401] An illustrative schematic for carrying on the method is shown in FIG. 2. The figure shows a binding agent 202, here an oligonucleotide probe aptamer for purposes of illustration, tethered to a substrate 201. The binding agent 202 can be covalently attached to substrate 201. The binding agent 202 may also be non-covalently attached. For example, binding agent 202 can comprise a label which can be attracted to the substrate, such as a biotin group which can form a complex with an avidin/streptavidin molecule that is covalently attached to the substrate. This can allow a complex to be formed between the aptamer and the target while in solution, followed by capture of the aptamer using the biotin label. The binding agent 202 binds to a surface antigen 203 of target cell 204. In the step signified by arrow (i), the cell 205 is disrupted while leaving the complex between the binding agent 202 and surface antigen 203 intact. Disrupted cell 205 is removed, e.g., via washing or buffer exchange, in the step signified by arrow (ii). In the step signified by arrow (iii), the surface antigen 203 is released from the binding agent 202. The surface antigen 203 can be analyzed to determine its identity using methods disclosed herein and/or known in the art. The target of the method can be any useful biological entity associated with a cell or tissue of interest. For example, the target may comprise a protein, nucleic acid, lipid or carbohydrate, or other biological entity disclosed herein or known in the art.

[00402] In some embodiments of the method, the target is cross-linked to the binding agent prior disrupting the cell. Without being bound by theory, this step may assist in maintaining the complex between the binding agent and the target during the disruption process. Any useful method of crosslinking disclosed herein or known in the art can be used. In embodiments, the cross-linking comprises photocrosslinking, an imidoester crosslinker, dimethyl suberimidate, an N-Hydroxysuccinimide-ester crosslinker, bissulfosuccinimidyl suberate (BS3), an aldehyde, acrolein, crotonaldehyde, formaldehyde, a carbodiimide crosslinker, N,N'-dicyclohexylcarbodiimide (DDC), N,N'-diisopropylcarbodiimide (DIC), 1- Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC or ED AC), Succinimidyl-4-(N- maleimidomethyl)cyclohexane-l-carboxylate (SMCC), a Sulfosuccinimidyl-4-(N- maleimidomethyl)cyclohexane-l-carboxylate (Sulfo-SMCC), a Sulfo-N-hydroxysuccinimidyl-2-(6- [biotinamido]-2-(p-azido benzamido)-hexanoamido) ethyl-1, 3'-dithioproprionate (Sulfo-SBED), 2-[N2-(4- Azido-2,3,5,6-tetrafluorobenzoyl)-N6-(6-biotin-amidocaproyl) -L-lysinyl]ethyl methanethiosulfonate (Mts-Atf-Biotin; available from Thermo Fisher Scientific Inc, Rockford IL.), 2-{N2-[N6-(4-Azido- 2,3,5,6-tetrafluorobenzoyl-6-amino-caproyl)-N6-(6-biotinamid ocaproyl)-L-lysinylamido]}ethyl methanethiosultonate (Mts-Atf-LC -Biotin; available from Thermo Fisher Scientific Inc), a photoreactive amino acid (e.g., L-Photo-Leucine and L-Photo-Methionine, see, e.g., Suchanek, M., et al. (2005). Photo leucine and photo-methionine allow identification of protein-protein interactions. Nat. Methods 2:261- 267), an N-Hydroxysuccinimide (NHS) crosslinker, an NHS-Azide reagent (e.g., NHS-Azide, NHS- PEG4- Azide, NHS-PEG12-Azide; each available from Thermo Fisher Scientific, Inc.), an NHS- Phosphine reagent (e.g., NHS-Phosphine, Sulfo-NHS-Phosphine; each available from Thermo Fisher Scientific, Inc.), or any combination or modification thereof.

[00403] A variety of methods can be used to disrupt the cell. For example, the cellular membrane can be disrupted using mechanical forces, chemical agents, or a combination thereof. In embodiments, disrupting the cell comprises use of one or more of a detergent, a surfactant, a solvent, an enzyme, or any useful combination thereof. The enzyme may comprise one or more of lysozyme, lysostaphin, zymolase, cellulase, mutanolysin, a glycanase, a protease, and mannase. The detergent or surfactant may comprise one or more of a octylthioglucoside (OTG), octyl beta-glucoside (OG), a nonionic detergent, Triton X, Tween 20, a fatty alcohol, a cetyl alcohol, a stearyl alcohol, cetostearyl alcohol, an oleyl alcohol, a polyoxyethylene glycol alkyl ether (Brij), octaethylene glycol monododecyl ether, pentaethylene glycol monododecyl ether, a polyoxypropylene glycol alkyl ether, a glucoside alkyl ether, decyl glucoside, lauryl glucoside, octyl glucoside, a polyoxyethylene glycol octylphenol ethers, a polyoxyethylene glycol alkylphenol ether, nonoxynol-9, a glycerol alkyl ester, glyceryl laurate, a polyoxyethylene glycol sorbitan alkyl esters, polysorbate, a sorbitan alkyl ester, cocamide MEA, cocamide DEA, dodecyldimethylamine oxide, a block copolymers of polyethylene glycol and polypropylene glycol, poloxamers, polyethoxylated tallow amine (POEA), a zwitterionic detergent, 3-[(3-cholamidopropyl)dimethylammonio]-l- propanesulfonate (CHAPS), a linear alkylbenzene sulfonate (LAS), a alkyl phenol ethoxylate (APE), cocamidopropyl hydroxy sultaine, a betaine, cocamidopropyl betaine, lecithin, an ionic detergent, sodium dodecyl sulfate (SDS), cetrimonium bromide (CTAB), cetyl trimethylammonium chloride (CTAC), octenidine dihydrochloride, cetylpyridinium chloride (CPC), benzalkonium chloride (BAC),

benzethonium chloride (BZT), 5-Bromo-5-nitro-l,3-dioxane, dimethyldioctadecylammonium chloride, dioctadecyldimethylammonium bromide (DODAB), sodium deoxycholate, nonyl

phenoxypolyethoxylethanol (Tergitol-type NP-40; NP-40), ammonium lauryl sulfate, sodium laureth sulfate (sodium lauryl ether sulfate (SLES)), sodium myreth sulfate, an alkyl carboxylate, sodium stearate, sodium lauroyl sarcosinate, a carboxy late-based fluorosurfactant, perfluorononanoate, perfluorooctanoate (PFOA or PFO), and a biosurfactant. Mechanical methods of disruption that can be used comprise without limitation mechanical shear, bead milling, homogenation, microfluidization, sonication, French Press, impingement, a colloid mill, decompression, osmotic shock, thermolysis, freeze-thaw, desiccation, or any combination thereof.

[00404] As shown in FIG. 2, the binding agent may be tethered to a substrate. The binding agent can be tethered before or after the complex between the binding agent and target is formed. The substrate can be any useful substrate such as disclosed herein or known in the art. In an embodiment, the substrate comprises a microsphere. In another embodiment, the substrate comprises a planar substrate. In another embodiment, the substrate comprises column material. The binding agent can also be labeled. Isolating the complex between the target and the binding agent may comprise capturing the binding agent via the label. As a non-limiting example, the label can be a biotin label. In such cases, the binding agent can be attached to the substrate via a biotin-avidin/streptavidin binding event. [00405] Methods of identifying the target after release from the binding agent will depend on the type of target of interest. For example, when the target comprises a protein, identifying the target may comprise use of mass spectrometry (MS), peptide mass fingerprinting (PMF; protein fingerprinting), sequencing, N- terminal amino acid analysis, C-terminal amino acid analysis, Edman degradation, chromatography, electrophoresis, two-dimensional gel electrophoresis (2D gel), antibody array, and immunoassay. Nucleic acids can be identified by amplification, hybridization or sequencing.

[00406] One of skill will appreciate that the method can be used to identify any appropriate target, including those not associated with a membrane. For example, with respect to the FIG. 2, all steps except for the step signified by arrow (i) (i.e., disrupting the cell 205), could be performed for a tissue lysate or a circulating target such as a protein, nucleic acid, lipid, carbohydrate, or combination thereof. The target can be any useful target, including without limitation a tissue, a cell, an organelle, a protein complex, a lipoprotein, a carbohydrate, a microvesicle, a virus, a membrane fragment, a small molecule, a heavy metal, a toxin, a drug, a nucleic acid, mRNA, microRNA, a protein-nucleic acid complex, and various combinations, fragments and/or complexes of any of these.

[00407] In an aspect, the invention provides a method of identifying at least one protein associated with at least one cell in a biological sample, comprising: a) contacting the at least one cell with an oligonucleotide probe library, b) isolating at least one protein bound by at least one member of the oligonucleotide probe library in step a); and c) identifying the at least one protein isolated in step b). The isolating can be performed using any useful method such as disclosed herein, e.g., by immunopreciption or capture to a substrate. Similarly, the identifying can be performed using any useful method such as disclosed herein, including without limitation use of mass spectrometry, 2-D gel electrophoresis or an antibody array. Examples of such methodology are presented herein in Examples 1, 9-11, and 14-15.

[00408] The targets identified by the methods described herein can be detected, e.g., using the oligonucleotide probes described herein, for various purposes as desired. For example, an identified surface antigen can be used to detect a cell displaying such antigen. In an aspect, the invention provides a method of detecting at least one cell in a biological sample comprising contacting the biological sample with at least one binding agent to at least one surface antigen and detecting the at least one cell recognized by the binding agent to the at least one protein. In an embodiment, the at least one surface antigen is selected from the Examples herein, e.g., within any one of Tables 12-13, 15-16, 18, and 20-24. The at least one surface antigen can be selected those disclosed in International Patent Application Nos.

PCT/US2009/62880, filed October 30, 2009; PCT/US2009/006095, filed November 12, 2009;

PCT/US2011/26750, filed March 1, 2011; PCT/US2011/031479, filed April 6, 2011; PCT/US 11/48327, filed August 18, 2011; PCT/US2008/71235, filed July 25, 2008; PCT/US 10/58461, filed November 30, 2010; PCT/US2011/21160, filed January 13, 2011; PCT/US2013/030302, filed March 11, 2013;

PCT/US 12/25741, filed February 17, 2012; PCT/2008/76109, filed September 12, 2008;

PCT/US 12/42519, filed June 14, 2012; PCT/US 12/50030, filed August 8, 2012; PCT/US 12/49615, filed August 3, 2012; PCT/US12/41387, filed June 7, 2012; PCT/US2013/072019, filed November 26, 2013; PCT/US2014/039858, filed May 28, 2013; PCT/IB2013/003092, filed October 23, 2013; PCT/US 13/76611, filed December 19, 2013; PCT/US 14/53306, filed August 28, 2014; and

PCT/U S 15/62184, filed November 23, 2015; PCT/US 16/40157, filed June 29, 2016; PCT/US16/44595, filed July 28, 2016; and PCT/US16/21632, filed March 9, 2016; each of which applications is incorporated herein by reference in its entirety. The at least one surface antigen can be an aptamer target identified in the Examples herein. See, e.g., Examples 1, 9-11, and 14-15. The at least one binding agent may comprise any useful binding agent, including without limitation a nucleic acid, DNA molecule, RNA molecule, antibody, antibody fragment, aptamer, peptoid, zDNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), lectin, peptide, dendrimer, membrane protein labeling agent, chemical compound, or a combination thereof. In some embodiments, the at least one binding agent comprises at least one oligonucleotide, such as an oligonucleotide probe as provided herein. The cell can be part of a tissue.

[00409] The at least one binding agent can be used to capture and/or detect the at least one cell or microvesicle, which can be a circulating cell or microvesicle, including without limitation a microvesicle shed into bodily fluids. Methods of detecting soluble biomarkers and circulating cells or microvesicles using binding agents are provided herein. In some embodiments, the at least one binding agent used to capture the at least one cell or microvesicle is bound to a substrate. Any useful substrate can be used, including without limitation a planar array, a column matrix, or a microbead. In some embodiments, the at least one binding agent used to detect the at least one cell or microvesicle is labeled. Various useful labels are provided herein or known in the art, including without limitation a magnetic label, a fluorescent moiety, an enzyme, a chemiluminescent probe, a metal particle, a non-metal colloidal particle, a polymeric dye particle, a pigment molecule, a pigment particle, an electrochemically active species, a semiconductor nanocrystal, a nanoparticle, a quantum dot, a gold particle, a fluorophore, or a radioactive label.

[00410] In an embodiment, the detecting is used to characterize a phenotype. The phenotype can be any appropriate phenotype of interest. In some embodiments, the phenotype is a disease or disorder. The characterizing may comprise providing diagnostic, prognostic and/or theranostic information for the disease or disorder. The characterizing may be performed by comparing a presence or level of the aptamer target (or targets) to a reference. The reference can be selected per the characterizing to be performed. For example, when the phenotype comprises a disease or disorder, the reference may comprise a presence or level of the target in a sample from an individual or group of individuals without the disease or disorder. The comparing can be determining whether the presence or level of the target differs from that of the reference. In some embodiments, the detected targets are found at higher levels in a healthy sample as compared to a diseased sample. In another embodiment, the targets are found at higher levels in a diseased sample as compared to a healthy sample. When multiplex assays are performed, e.g., using a plurality of binding agents to different biomarkers, e.g, using an aptamer pool such as provided herein, some antigens may be observed at a higher level in the biological samples as compared to the reference whereas other antigens may be observed at a lower level in the biological samples as compared to the reference.

[00411] The method can be used to detect the target in any appropriate biological sample. For example, the biological sample may comprise a bodily fluid, tissue sample or cell culture. The bodily fluid or tissue sample can be from a subject having or suspected of having a medical condition, a disease or a disorder. Thus, the method can be used to provide a diagnostic, prognostic, or theranostic read out for the subject. Any appropriate bodily fluid can be used, including without limitation peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper’s fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair oil, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood.

[00412] The method described herein can be used to detect or characterize any appropriate disease or disorder of interest, including without limitation Breast Cancer, Alzheimer’s disease, bronchial asthma, Transitional cell carcinoma of the bladder, Giant cellular osteoblastoclastoma, Brain Tumor, Colorectal adenocarcinoma, Chronic obstructive pulmonary disease (COPD), Squamous cell carcinoma of the cervix, acute myocardial infarction (AMI) / acute heart failure, Chron’s Disease, diabetes mellitus type II, Esophageal carcinoma, Squamous cell carcinoma of the larynx, Acute and chronic leukemia of the bone marrow, Lung carcinoma, Malignant lymphoma, Multiple Sclerosis, Ovarian carcinoma, Parkinson disease, Prostate adenocarcinoma, psoriasis, Rheumatoid Arthritis, Renal cell carcinoma, Squamous cell carcinoma of skin, Adenocarcinoma of the stomach, carcinoma of the thyroid gland, Testicular cancer, ulcerative colitis, or Uterine adenocarcinoma.

[00413] In some embodiments, the disease or disorder comprises a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain. The cancer can include without limitation one of acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma; AIDS-related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma,

medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma); breast cancer; bronchial tumors; Burkitt lymphoma; cancer of unknown primary site; carcinoid tumor; carcinoma of unknown primary site; central nervous system atypical teratoid/rhabdoid tumor; central nervous system embryonal tumors; cervical cancer; childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer;

ependymoblastoma; ependymoma; esophageal cancer; esthesioneuroblastoma; Ewing sarcoma;

extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer; liver cancer; lung cancer; malignant fibrous histiocytoma bone cancer; medulloblastoma;

medulloepithelioma; melanoma; Merkel cell carcinoma; Merkel cell skin carcinoma; mesothelioma; metastatic squamous neck cancer with occult primary; mouth cancer; multiple endocrine neoplasia syndromes; multiple myeloma; multiple myeloma/plasma cell neoplasm; mycosis fungoides;

myelodysplastic syndromes; myeloproliferative neoplasms; nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer; oropharyngeal cancer; osteosarcoma; other brain and spinal cord tumors; ovarian cancer; ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; pancreatic cancer; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile cancer; pharyngeal cancer; pineal parenchymal tumors of intermediate differentiation; pineoblastoma; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system (CNS) lymphoma; primary hepatocellular liver cancer; prostate cancer; rectal cancer; renal cancer; renal cell (kidney) cancer; renal cell cancer; respiratory tract cancer; retinoblastoma;

rhabdomyosarcoma; salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma; squamous cell carcinoma; squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer; thymic carcinoma; thymoma; thyroid cancer; transitional cell cancer; transitional cell cancer of the renal pelvis and ureter; trophoblastic tumor; ureter cancer; urethral cancer; uterine cancer; uterine sarcoma; vaginal cancer; vulvar cancer; Waldenstrom macroglobulinemia; or Wilm’s tumor. The premalignant condition can include without limitation Barrett’s Esophagus. The autoimmune disease can include without limitation one of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), pelvic inflammation, vasculitis, psoriasis, diabetes, autoimmune hepatitis, multiple sclerosis, myasthenia gravis, Type I diabetes, rheumatoid arthritis, psoriasis, systemic lupus erythematosis (SLE), Hashimoto's Thyroiditis, Grave's disease, Ankylosing Spondylitis Sjogrens Disease, CREST syndrome, Scleroderma, Rheumatic Disease, organ rejection, Primary Sclerosing Cholangitis, or sepsis. The cardiovascular disease can include without limitation one of atherosclerosis, congestive heart failure, vulnerable plaque, stroke, ischemia, high blood pressure, stenosis, vessel occlusion or a thrombotic event. The neurological disease can include without limitation one of Multiple Sclerosis (MS), Parkinson’s Disease (PD), Alzheimer’s Disease (AD), schizophrenia, bipolar disorder, depression, autism, Prion Disease, Pick's disease, dementia, Huntington disease (HD), Down’s syndrome, cerebrovascular disease, Rasmussen's encephalitis, viral meningitis, neurospsychiatric systemic lupus erythematosus (NPSLE), amyotrophic lateral sclerosis, Creutzfeldt- Jacob disease, Gerstmann-Straussler-Scheinker disease, transmissible spongiform encephalopathy, ischemic reperfusion damage (e.g. stroke), brain trauma, microbial infection, or chronic fatigue syndrome. The pain can include without limitation one of fibromyalgia, chronic neuropathic pain, or peripheral neuropathic pain. The infectious disease can include without limitation one of a bacterial infection, viral infection, yeast infection, Whipple’s Disease, Prion Disease, cirrhosis, methicillin-resistant staphylococcus aureus, HIV, HCV, hepatitis, syphilis, meningitis, malaria, tuberculosis, or influenza. One of skill will appreciate that oligonucleotide probes or plurality of oligonucleotides or methods described herein can be used to assess any number of these or other related diseases and disorders.

[00414] In a related aspect, the invention provides a kit comprising a reagent for carrying out the methods herein. In still another related aspect, the invention provides for use of a reagent for carrying out the methods. The reagent may comprise at least one binding agent to the at least one protein. The binding agent may be an oligonucleotide probe as provided herein.

[00415] Sample Characterization

[00416] The oligonucleotide probe / aptamers described herein can be used to characterize a biological sample. For example, an oligonucleotide probe or oligonucleotide probe library can be used to provide a biosignature for the sample. The biosignature can indicate a characteristic of the sample, such as a diagnosis, prognosis or theranosis of a disease or disorder associated with the sample. In some embodiments, the biosignature comprises a presence or level of one or more biomarker present in the sample. In some embodiments, biosignature comprises a presence or level of the oligonucleotide probe or members of the oligonucleotide probe library that associated with the sample (e.g., by forming a complex with the sample).

[00417] In an aspect, the invention provides an aptamer comprising a nucleic acid sequence that is at least about 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to any one of SEQ ID NOs. 1-102938; or a functional variation or fragment of any preceding sequence. A functional variation or fragment includes a sequence comprising modifications that is still capable of binding a target molecule, wherein the modifications comprise without limitation at least one of a deletion, insertion, point mutation, truncation or chemical modification. In a related aspect, the invention provides a method of characterizing a disease or disorder, comprising: (a) contacting a biological test sample with one or more aptamer described herein, e.g., any of those in this paragraph or modifications thereof; (b) detecting a presence or level of a complex between the one or more aptamer and the target bound by the one or more aptamer in the biological test sample formed in step (a); (c) contacting a biological control sample with the one or more aptamer; (d) detecting a presence or level of a complex between the one or more aptamer and the target bound by the one or more aptamer in the biological control sample formed in step (c); and (e) comparing the presence or level detected in steps (b) and (d), thereby characterizing the disease or disorder.

[00418] The biological test sample and biological control sample can each comprise a tissue sample, a cell culture, or a biological fluid. In some embodiments, the biological test sample and biological control sample comprise the same sample type, e.g., both the test and control samples are tissue samples or both are fluid samples. In other embodiments, different sample types may be used for the test and control samples. For example, the control sample may comprise an engineered or otherwise artificial sample. In some embodiments, the tissue samples comprise fixed samples. [00419] The biological fluid may comprise a bodily fluid. The bodily fluid may include without limitation one or more of peripheral blood, sera, plasma, ascites, mine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper’s fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood. In some embodiments, the bodily fluid comprises blood, serum or plasma.

[00420] The biological fluid may comprise microvesicles. For example, the biological fluid can be a tissue, cell culture, or bodily fluid which comprises microvesicles released from cells in the sample. The microvesicles can be circulating microvesicles. The biological fluid may comprise cells. For example, the biological fluid can be a tissue, cell culture, or bodily fluid which comprises cells circulating in the sample.

[00421] The one or more aptamer can bind a target biomarker, e.g., a biomarker useful in characterizing the sample. The biomarker may comprise a polypeptide or fragment thereof, or other useful biomarker described herein or known in the art (lipid, carbohydrate, complex, nucleic acid, etc). In embodiments, the polypeptide or fragment thereof is soluble or membrane bound. Membrane bound polypeptides may comprise a cellular surface antigen or a microvesicle surface antigen. The biomarker can be a biomarker selected from the Examples herein. The biomarker can be selected from one of International Patent Application Nos. PCT/US2009/62880, fded October 30, 2009; PCT/US2009/006095, filed November 12, 2009; PCT/US2011/26750, filed March 1, 2011; PCT/US2011/031479, fded April 6, 2011;

PCT/US 11/48327, fded August 18, 2011; PCT/US2008/71235, filed July 25, 2008; PCT/US10/58461, fded November 30, 2010; PCT/US2011/21160, filed January 13, 2011; PCT/US2013/030302, filed March 11, 2013; PCT/US 12/25741, fded February 17, 2012; PCT/2008/76109, fded September 12, 2008;

PCT/US 12/42519, fded June 14, 2012; PCT/US 12/50030, fded August 8, 2012; PCT/US 12/49615, filed August 3, 2012; PCT/US12/41387, filed June 7, 2012; PCT/US2013/072019, fded November 26, 2013; PCT/US2014/039858, fded May 28, 2013; PCT/IB2013/003092, filed October 23, 2013;

PCT/US 13/76611, fded December 19, 2013; PCT/US 14/53306, fded August 28, 2014; and

PCT/U S 15/62184, fded November 23, 2015; PCT/US 16/40157, fded June 29, 2016; PCT/US16/44595, fded July 28, 2016; and PCT/US16/21632, filed March 9, 2016; each of which applications is incorporated herein by reference in its entirety.

[00422] The characterizing can comprises a diagnosis, prognosis or theranosis of the disease or disorder. Various diseases and disorders can be characterized using the compositions and methods described herein, including without limitation a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, a neurological disease or disorder, an infectious disease, and/or pain. See, e.g., section herein“Phenotypes” for further details. In embodiments, the disease or disorder comprises a proliferative or neoplastic disease or disorder. For example, the disease or disorder can be a cancer. In some embodiments, the cancer comprises a breast cancer, ovarian cancer, prostate cancer, lung cancer, colorectal cancer, melanoma, pancreatic cancer, kidney cancer, or brain cancer.

[00423] FIG. 8A is a schematic 800 showing an assay configuration that can be used to detect and/or quantify a target of interest using one or more oligonucleotide probe described herein. Capture aptamer 802 is attached to substrate 801. The substrate can be a planar substrate, well, microbead, or other useful substrate as disclosed herein or known in the art. Target of interest 803 is bound by capture aptamer 802. The target of interest can be any appropriate entity that can be detected when recognized by an aptamer or other binding agent. The target of interest may comprise a protein or polypeptide, a nucleic acid, including DNA, RNA, and various subspecies thereof, a lipid, a carbohydrate, a complex, e.g., a complex comprising protein, nucleic acids, lipids and/or carbohydrates. In some embodiments, the target of interest comprises a tissue, cell or microvesicle. The target of interest can be a cellular surface antigen or microvesicle surface antigen. The target of interest may be a biomarker, e.g., as disclosed herein. The target of interest can be isolated from a sample using various techniques as described herein, e.g., chromatography, filtration, centrifugation, flow cytometry, affinity capture (e.g., to a planar surface, column or bead), and/or using microfluidics. Detection aptamer 804 is also bound to target of interest 803. Detection aptamer 804 carries label 805 which can be detected to identify target captured to substrate 801 via capture aptamer 802. The label can be a fluorescent, radiolabel, enzyme, or other detectable label as disclosed herein. Either capture aptamer 802 or detection aptamer 804 can be substituted with another binding agent, e.g., an antibody. For example, the target may be captured with an antibody and detected with an aptamer, or vice versa. When the target of interest comprises a complex, the capture and detection agents (aptamer, antibody, etc) can recognize the same or different targets. For example, when the target is a cell or microvesicle, the capture agent may recognize one surface antigen while the detection agent recognizes microvesicle surface antigen. Alternately, the capture and detection agents can recognize the same surface antigen.

[00424] The aptamers described herein may be identified and/or used for various purposes in the form of DNA or RNA. Unless otherwise specified, one of skill in the art will appreciate that an aptamer may generally be synthesized in various forms of nucleic acid. The aptamers may also carry various chemical modifications and remain within the scope described herein.

[00425] Oligonucleotide Pools to Characterize a Sample

[00426] The complexity and heterogeneity present in biology challenges the understanding of biological systems and disease. Diversity exists at various levels, e.g., within and between cells, tissues, individuals and disease states. See, e.g., FIG. 9A. FIG. 9B overviews various biological entities that can be assessed to characterize such samples. As shown in FIG. 9B, as one moves from assessing DNA, to RNA, to protein, and finally to protein complexes, the amount of diversity and complexity increases dramatically. The oligonucleotide probe library method described herein can be used characterize complex biological sources, e.g., tissue samples, cells, circulating tumor cells, microvesicles, and complexes such as protein and proteolipid complexes. [00427] Current methods to characterize biological samples may not adequately address such complexity and diversity. As shown in FIG. 9C, such current methods often have a trade off between measuring diversity and complexity. As an example, consider high throughput sequencing technology. Next generation approaches may query many 1000s of molecular targets in a single assay. However, such approaches only probe individual DNA and/or RNA molecules, and thus miss out on the great diversity of proteins and biological complexes. On the other hand, flow cytometry can probe biological complexes, but are limited to a small number of pre-defined ligands. For example, a single assay can probe a handful of differentially labeled antibodies to pre-defined targets.

[00428] The oligonucleotide probe libraries described herein address the above challenges. The size of the starting library can be adjusted to measure as many different entities as there are library members. For example, the initial untrained oligonucleotide library has the potential to measure 10 ¹² or more biological features. A larger and/or different library can be constructed as desired. The technology is adapted to find differences between samples without assumptions about what“should be different.” For example, the probe library may distinguish based on individual proteins, protein modifications, protein complexes, lipids, nucleic acids, different folds or conformations, or whatever is there that distinguishes a sample of interest. Thus, the method provides an unbiased approach to identify differences in biological samples that can be used to identify different populations of interest.

[00429] In the context herein, the use of the oligonucleotide library probe to assess a sample may be referred to as Adaptive Dynamic Artificial Poly-ligand Targeting, or ADAPT™. Although as noted the terms aptamer and oligonucleotides are typically used interchangeable herein, some differences between “classic” individual aptamers and ADAPT probes are as follows. Individual aptamers may comprise individual oligonucleotides selected to bind to a known specific target in an antibody -like“key -in-lock” binding mode. They may be evaluated individually based on specificity and binding affinity to the intended target. However, ADAPT probes may comprise a library of oligonucleotides intended to produce multi-probe signatures. The ADAPT probes comprise numerous potential binding modalities

(electrostatic, hydrophobic, Watson-Crick, multi-oligo complexes, etc.). The ADAPT probe signatures have the potential to identify heterogeneous patient subpopulations. For example, a single ADAPT library can be assembled to differentiate multiple biological states. Unlike classic single aptamers, the binding targets may or may not be isolated or identified. It will be understood that screening methods that identify individual aptamers, e.g., SELEX, can also be used to enrich a naive library of oligonucleotides to identify a ADAPT probe library.

[00430] The general method described herein is outlined in FIG. 9D. One input to the method comprises a randomized oligonucleotide library with the potential to measure 10 ¹² or more biological features. As outlined in the figure, the method identifies a desired number (e.g., ~10 ⁵ -10 ⁶ ) that are different between two input sample types. The randomized oligonucleotide library is contacted with a first and a second sample type, and oligonucleotides that bind to each sample are identified. The bound oligonucleotide populations are compared and oligonucleotides that specifically bind to one or the other biological input sample are retained for the oligonucleotide probe library, whereas oligonucleotides that bind both biological input samples are discarded. This trained oligonucleotide probe library can then be contacted with a new test sample and the identities of oligonucleotides that bind the test sample are determined. The test sample is characterized based on the profde of oligonucleotides that bound.

[00431] Extracellular vesicles provide one vehicle to profde the biological complexity and diversity driven by many inter-related sources. There can be a great deal of heterogeneity between patient-to-patient microvesicle populations, or even in microvesicle populations from a single patient under different conditions (e.g., stress, diet, exercise, rest, disease, etc). Diversity of molecular phenotypes within microvesicle populations in various disease states, even after microvesicle isolation and sorting by vesicle biomarkers, can present challenges identifying surface binding ligands. This situation is further complicated by vesicle surface-membrane protein complexes. The oligonucleotide probe library can be used to address such challenges and allow for characterization of biological phenotypes. The approach combines the power of diverse oligonucleotide libraries and high throuput (next-generation) sequencing technologies to probe the complexity of extracellular microvesicles.

[00432] ADAPT™ profding may provide quantitative measurements of dynamic events in addition to detection of presence/absence of various biomarkers in a sample. For example, the binding probes may detect protein complexes or other post-translation modifications, allowing for differentiation of samples with the same proteins but in different biological configurations. The approaches outlined herein, e.g. in FIG. 9, can be adapted to any desired sample type, e.g., tissues, cells, microvesicles, circulating biomarkers, and constituents of any of these.

[00433] In an aspect, the invention provides a method of characterizing a sample by contacting the sample with a pool of different oligonucleotides (which can be referred to as an aptamer pool or oligonucleotide probe library), and determining the frequency at which various oligonucleotides in the pool bind the sample. For example, a pool of oligonucleotides is identified that preferentially bind to tissues, cells or microvesicles from cancer patients as compared to non-cancer patients. A test sample, e.g., from a patient suspected of having the cancer, is collected and contacted with the pool of oligonucleotides.

Oligonucleotides that bind the test sample are eluted from the test sample, collected and identified, and the composition of the bound oligonucleotides is compared to those known to bind cancer samples. Various sequencing, amplification and hybridization techinques can be used to identify the eluted

oligonucleotides. For example, when a large pool of oligonucleotides is used, oligonucleotide identification can be performed by high throughput methods such as next generation sequencing or via hybridization. If the test sample is bound by the oligonucleotide pool in a similar manner (e.g., as determined by bioinformatics classification methods) to the sample from cancer patients, then the test sample is indicative of cancer as well. Using this method, a pool of oligonucleotides that bind one or more antigen can be used to characterize the sample without necessarily knowing the precise target of each member of the pool of oligonucleotides. Thus, the pool of oligonucleotides can provide a biosignature. Examples 14-15 herein illustrate such embodiments described herein.

[00434] In an aspect, the invention provides a method for characterizing a condition for a test sample comprising: contacting a sample with a plurality of oligonucleotide capable of binding one or more target(s) present in the sample, identifying a set of oligonucleotides that form a complex with the sample wherein the set is predetermined to characterize a condition for the sample, thereby characterizing a condition for a sample. The sample can be any useful sample such as disclosed herein, e.g., a tissue, cell, microvesicle, or biomarker sample, or any useful combination thereof.

[00435] In an related aspect, the invention provides a method for identifying a set of oligonucleotides associated with a test sample, comprising: (a) contacting a sample with a plurality of oligonucleotides, isolating a set of oligonucleotides that form a complex with the sample, (b) determining sequence and/or copy number for each of the oligonucleotides, thereby identifying a set of oligonucleotides associated with the test sample. The sample can be any useful sample such as disclosed herein, e.g., a tissue, cell, microvesicle, or biomarker sample, or any useful combination thereof.

[00436] In still another related aspect, the invention provides a method of diagnosing a sample as cancerous or predisposed to be cancerous, comprising contacting the sample with a plurality of oligonucleotides that are predetermined to preferentially form a complex with a cancer sample as compared to a non-cancer sample. The sample can be any useful sample such as disclosed herein, e.g., a tissue, cell, microvesicle, or biomarker sample, or any useful combination thereof.

[00437] The oligonucleotides can be identified by sequencing, e.g., by dye termination (Sanger) sequencing or high throughput methods. High throughput methods can comprise techiques to rapidly sequence a large number of nucleic acids, including next generation techniques such as Massively parallel signature sequencing (MPSS; Polony sequencing; 454 pyrosequencing; Illumina (Solexa;

MiSeq/HiSeq/NextSeq/etc) sequencing; SOLiD sequencing; Ion Torrent semiconductor sequencing; DNA nanoball sequencing; Heliscope single molecule sequencing; Single molecule real time (SMRT) sequencing, or other methods such as Nanopore DNA sequencing; Tunnelling currents DNA sequencing; Sequencing by hybridization; Sequencing with mass spectrometry; Microfluidic Sanger sequencing; Microscopy -based techniques; RNAP sequencing; In vitro virus high-throughput sequencing. The oligonucleotides may also be identified by hybridization techniques. For example, a microarray having addressable locals to hybridize and thereby detect the various members of the pool can be used.

Alternately, detection can be based on one or more differentially labelled oligonucleotides that hybridize with various members of the oligonucleotide pool. The detectable signal of the label can be associated with a nucleic acid molecule that hybridizes with a stretch of nucleic acids present in various oligonucleotides. The stretch can be the same or different as to one or more oligonucleotides in a library. The detectable signal can comprise fluorescence agents, including color-coded barcodes which are known, such as in U.S. Patent Application Pub. No. 20140371088, 2013017837, and 20120258870. Other detectable labels (metals, radioisotopes, etc) can be used as desired.

[00438] The plurality or pool of oligonucleotides can comprise any desired number of oligonucleotides to allow characterization of the sample. In various embodiments, the pool comprises at least 2, 3, 4, 5, 6, 7,

8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or at least 10000 different oligonucleotide members. [00439] The plurality of oligonucleotides can be pre-selected through one or more steps of positive or negative selection, wherein positive selection comprises selection of oligonucleotides against a sample having substantially similar characteristics compared to the test sample, and wherein negative selection comprises selection of oligonucleotides against a sample having substantially different characteristics compared to the test sample. Substantially similar characteristics mean that the samples used for positive selection are representative of the test sample in one or more characteristic of interest. For example, the samples used for positive selection can be from cancer patients or cell lines and the test sample can be a sample from a patient having or suspected to have a cancer. Substantially different characteristics mean that the samples used for negative selection differ from the test sample in one or more

phenotype/characteristic of interest. For example, the samples used for negative selection can be from individuals or cell lines that do not have cancer (e.g.,“normal,”“healthy” or otherwise“control” samples) and the test sample can be a sample from a patient having or suspected to have a cancer. The cancer can be a breast cancer, ovarian cancer, prostate cancer, lung cancer, colorectal cancer, melanoma, brain cancer, pancreatic cancer, kidney cancer, or other cancer such as disclosed herein.

[00440] By selecting samples representative of the desired phenotypes to detect and/or distinguish, the characterizing can comprise a diagnosis, prognosis or theranosis for any number of diseases or disorders. Various diseases and disorders can be characterized using the compositions and methods described herein, including without limitation a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, a neurological disease or disorder, an infectious disease, and/or pain. See, e.g., section herein“Phenotypes” for further details. In embodiments, the disease or disorder comprises a proliferative or neoplastic disease or disorder. For example, the disease or disorder can be a cancer.

[00441] FIG. 8B is a schematic 810 showing use of an oligonucleotide pool to characterize a phenotype of a sample, such as those listed above. A pool of oligonucleotides to a target of interst is provided 811. For example, the pool of oligonucleotides can be enriched to target a tissue, cell, microvesicle biomarker, or any combination thereof. The members of the pool may bind different targets (e.g., different proteins) or different epitopes of the same target (e.g., different epitopes of a single protein). The pool is contacted with a test sample to be characterized 812. For example, the test sample may be a biological sample from an individual having or suspected of having a given disease or disorder. The mixture is washed to remove unbound oligonucleotides. The remaining oligonucleotides are eluted or otherwise disassociated from the sample and collected 813. The collected oligonucleotides are identified, e.g., by sequencing or hybridization 814. The presence and/or copy number of the identified is used to characterize the phenotype 815. FIG. 8C is a schematic 820 showing an implementation of the method in FIG. 8B to tissue. In some embodiments, the pool is used to stain the sample in a manner similar to IHC. Such method may be referred to herein as PHC (polyligand histochemistry) or PLP (poly ligand profiing). See also Examples 14-15 herein. [00442] In a related aspect, the invention provides a composition of matter comprising a plurality of oligonucleotides that can be used to carry out the methods comprising use of an oligonucleotide pool to characterize a phenotype. The plurality of oligonucleotides can comprise any of those described herein.

[00443] In an aspect, the invention provides a method for identifying oligonucleotides specific for a test sample. The method comprises: (a) enriching a plurality of oligonucleotides for a sample to provide a set of oligonucleotides predetermined to form a complex with a target sample; (b) contacting the plurality in (a) with a test sample to allow formation of complexes of oligonucleotides with test sample; (c) recovering oligonucleotides that formed complexes in (b) to provide a recovered subset of

oligonucleotides; and (d) profiling the recovered subset of oligonucleotides by high-throughput sequencing, amplification or hybridization, thereby identifying oligonucleotides specific for a test sample. The test sample may comprise tissue, cells, microvesicles, biomarkers, or other biological entities of interest. The oligonucleotides may comprise RNA, DNA or both. In some embodiment, the method further comprises performing informatics analysis to identify a subset of oligonucleotides comprising sequence identity of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% to the oligonucleotides predetermined to form a complex with the target sample.

[00444] One of skill will appreciate that the method can be used to identify any appropriate target. The target can be any useful target, including without limitation a cell, an organelle, a protein complex, a lipoprotein, a carbohydrate, a microvesicle, a virus, a membrane fragment, a small molecule, a heavy metal, a toxin, a drug, a nucleic acid (including without limitation microRNA (miR) and messenger RNA (mRNA)), a protein-nucleic acid complex, and various combinations, fragments and/or complexes of any of these. The target can, e.g., comprise a mixture of such biological entities.

[00445] In an aspect, the invention also provides a method comprising contacting an oligonucleotide or plurality of oligonucleotides with a sample and detecting the presence or level of binding of the oligonucleotide or plurality of oligonucleotides to a target in the sample, wherein the oligonucleotide or plurality of oligonucleotides can be those provided by the invention above. The sample may comprise a biological sample, an organic sample, an inorganic sample, a tissue, a cell culture, a bodily fluid, blood, serum, a cell, a microvesicle, a protein complex, a lipid complex, a carbohydrate, or any combination, fraction or variation thereof. The target may comprise a cell, an organelle, a protein complex, a lipoprotein, a carbohydrate, a microvesicle, a membrane fragment, a small molecule, a heavy metal, a toxin, or a drug.

[00446] In another aspect, the invention provides a method comprising: a) contacting a sample with an oligonucleotide probe library comprising at least 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ⁿ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , or at least 10 ¹⁸ different oligonucleotide sequences oligonucleotides to form a mixture in solution, wherein the oligonucleotides are capable of binding a plurality of entities in the sample to form complexes, wherein optionally the oligonucleotide probe library comprises an oligonucleotide or plurality of oligonucleotides as provided by the invention above; b) partitioning the complexes formed in step (a) from the mixture; and c) recovering oligonucleotides present in the complexes partitioned in step (b) to identify an oligonucleotide profile for the sample.

[00447] In still another aspect, the invention provides a method for generating an enriched oligonucleotide probe library comprising: a) contacting a first oligonucleotide library with a biological test sample and a biological control sample, wherein complexes are formed between biological entities present in the biological samples and a plurality of oligonucleotides present in the first oligonucleotide library; b) partitioning the complexes formed in step (a) and isolating the oligonucleotides in the complexes to produce a subset of oligonucleotides for each of the biological test sample and biological control sample; c) contacting the subsets of oligonucleotides in (b) with the biological test sample and biological control sample wherein complexes are formed between biological entities present in the biological samples and a second plurality of oligonucleotides present in the subsets of oligonucleotides to generate a second subset group of oligonucleotides; and d) optionally repeating steps b)-c), one, two, three or more times to produce a respective third, fourth, fifth or more subset group of oligonucleotides, thereby producing the enriched oligonucleotide probe library. In a related aspect, the invention provides a plurality of oligonucleotides comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, or 500000 different oligonucleotide sequences, wherein the plurality results from the method in this paragraph, wherein the library is capable of distinguishing a first phenotype from a second phenotype. In some embodiments, the first phenotype comprises a disease or disorder and the second phenotype comprises a healthy state; or wherein the first phenotype comprises a disease or disorder and the second phenotype comprises a different disease or disorder; or wherein the first phenotype comprises a stage or progression of a disease or disorder and the second phenotype comprises a different stage or progression of the same disease or disorder; or wherein the first phenotype comprises a positive response to a therapy and the second phenotype comprises a negative response to the same therapy.

[00448] In yet another aspect, the invention provides a method of characterizing a disease or disorder, comprising: a) contacting a biological test sample with the oligonucleotide or plurality of oligonucleotides provided by the invention; b) detecting a presence or level of complexes formed in step (a) between the oligonucleotide or plurality of oligonucleotides provided by the invention and a target in the biological test sample; and c) comparing the presence or level detected in step (b) to a reference level from a biological control sample, thereby characterizing the disease or disorder. The step of detecting may comprise performing sequencing of all or some of the oligonucleotides in the complexes, amplification of all or some of the oligonucleotides in the complexes, and/or hybridization of all or some of the oligonucleotides in the complexes to an array. The sequencing may be high-throughput or next generation sequencing. In some embodiments, the step of detecting comprises visualizing the oligonucleotide or plurality of oligonucleotides in association with the biological test sample. For example, polyligand histochemistry (PHC) as provided by the invention may be used. [00449] In the methods described herein, the biological test sample and biological control sample may each comprise a tissue sample, a cell culture, or a biological fluid. In some embodiments, the biological fluid comprises a bodily fluid. Useful bodily fluids within the method described herein comprise peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper’s fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood. In some preferred embodiments, the bodily fluid comprises blood, serum or plasma. The biological fluid may comprise microvesicles. In such case, the complexes may be formed between the oligonucleotide or plurality of oligonucleotides and at least one of the microvesicles.

[00450] The biological test sample and biological control sample may further comprise isolated microvesicles, wherein optionally the microvesicles are isolated using at least one of chromatography, filtration, ultrafiltration, centrifugation, ultracentrifugation, flow cytometry, affinity capture (e.g., to a planar surface, column or bead), polymer precipitation, and using microfluidics. The vesicles can also be isolated after contact with the oligonucleotide or plurality of oligonucleotides.

[00451] The biological test sample and biological control sample may comprise tissue. The tissue can be formalin fixed paraffin embedded (FFPE) tissue. In some embodiments, the FFPE tissue comprises at least one of a fixed tissue, unstained slide, bone marrow core or clot, biopsy sample, surgical sample, core needle biopsy, malignant fluid, and fine needle aspirate (FNA). The FFPE tissue can be fixed on a substrate, e.g., a glass slide or membrane.

[00452] In various embodiments of the methods described herein, the oligonucleotide or plurality of oligonucleotides binds a polypeptide or fragment thereof. The polypeptide or fragment thereof can be soluble or membrane bound, wherein optionally the membrane comprises a cellular or microvesicle membrane. The membrane could also be from a fragment of a cell, organelle or microvesicle. In some embodiments, the polypeptide or fragment thereof comprises a biomarker target of an aptamer identified in the Examples herein. The oligonucleotide or plurality of oligonucleotides may bind a microvesicle surface antigen in the biological sample. For example, the oligonucleotide or plurality of oligonucleotides can be enriched from a naive library against microvesicles.

[00453] As noted above, the microvesicles may be isolated in whole or in part using polymer precipitation. In an embodiment, the polymer comprises polyethylene glycol (PEG). Any appropriate form of PEG may be used. For example, the PEG may be PEG 8000. The PEG may be used at any appropriate concentration. For example, the PEG can be used at a concentration of 1%, 2%, 3%, 4%, 5%, 6%, 7%,

8%, 9%, 10%, 11%, 12%, 13%, 14% or 15% to isolate the microvesicles. In some embodiments, the PEG is used at a concentration of 6%.

[00454] The disease or disorder detected by the oligonucleotide, plurality of oligonucleotides, or methods provided here may comprise any appropriate disease or disorder of interest, including without limitation Breast Cancer, Alzheimer’s disease, bronchial asthma, Transitional cell carcinoma of the bladder, Giant cellular osteoblastoclastoma, Brain Tumor, Colorectal adenocarcinoma, Chronic obstructive pulmonary disease (COPD), Squamous cell carcinoma of the cervix, acute myocardial infarction (AMI) / acute heart failure, Chron’s Disease, diabetes mellitus type II, Esophageal carcinoma, Squamous cell carcinoma of the larynx, Acute and chronic leukemia of the bone marrow, Lung carcinoma, Malignant lymphoma, Multiple Sclerosis, Ovarian carcinoma, Parkinson disease, Prostate adenocarcinoma, psoriasis,

Rheumatoid Arthritis, Renal cell carcinoma, Squamous cell carcinoma of skin, Adenocarcinoma of the stomach, carcinoma of the thyroid gland, Testicular cancer, ulcerative colitis, or Uterine adenocarcinoma.

[00455] In some embodiments, the disease or disorder comprises a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain. The cancer can include without limitation one of acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma; AIDS-related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma,

medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma); breast cancer; bronchial tumors; Burkitt lymphoma; cancer of unknown primary site; carcinoid tumor; carcinoma of unknown primary site; central nervous system atypical teratoid/rhabdoid tumor; central nervous system embryonal tumors; cervical cancer; childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer;

ependymoblastoma; ependymoma; esophageal cancer; esthesioneuroblastoma; Ewing sarcoma;

extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer; liver cancer; lung cancer; malignant fibrous histiocytoma bone cancer; medulloblastoma;

medulloepithelioma; melanoma; Merkel cell carcinoma; Merkel cell skin carcinoma; mesothelioma; metastatic squamous neck cancer with occult primary; mouth cancer; multiple endocrine neoplasia syndromes; multiple myeloma; multiple myeloma/plasma cell neoplasm; mycosis fungoides;

myelodysplastic syndromes; myeloproliferative neoplasms; nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer; oropharyngeal cancer; osteosarcoma; other brain and spinal cord tumors; ovarian cancer; ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; pancreatic cancer; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile cancer; pharyngeal cancer; pineal parenchymal tumors of intermediate differentiation; pineoblastoma; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system (CNS) lymphoma; primary hepatocellular liver cancer; prostate cancer; rectal cancer; renal cancer; renal cell (kidney) cancer; renal cell cancer; respiratory tract cancer; retinoblastoma;

rhabdomyosarcoma; salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma; squamous cell carcinoma; squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer; thymic carcinoma; thymoma; thyroid cancer; transitional cell cancer; transitional cell cancer of the renal pelvis and ureter; trophoblastic tumor; ureter cancer; urethral cancer; uterine cancer; uterine sarcoma; vaginal cancer; vulvar cancer; Waldenstrom macroglobulinemia; or Wilm’s tumor. The premalignant condition can include without limitation Barrett’s Esophagus. The autoimmune disease can include without limitation one of inflammatory bowel disease (IBD), Crohn's disease (CD), ulcerative colitis (UC), pelvic inflammation, vasculitis, psoriasis, diabetes, autoimmune hepatitis, multiple sclerosis, myasthenia gravis, Type I diabetes, rheumatoid arthritis, psoriasis, systemic lupus erythematosis (SLE), Hashimoto's Thyroiditis, Grave's disease, Ankylosing Spondylitis Sjogrens Disease, CREST syndrome, Scleroderma, Rheumatic Disease, organ rejection, Primary Sclerosing Cholangitis, or sepsis. The cardiovascular disease can include without limitation one of atherosclerosis, congestive heart failure, vulnerable plaque, stroke, ischemia, high blood pressure, stenosis, vessel occlusion or a thrombotic event. The neurological disease can include without limitation one of Multiple Sclerosis (MS), Parkinson’s Disease (PD), Alzheimer’s Disease (AD), schizophrenia, bipolar disorder, depression, autism, Prion Disease, Pick's disease, dementia, Huntington disease (HD), Down’s syndrome, cerebrovascular disease, Rasmussen's encephalitis, viral meningitis, neurospsychiatric systemic lupus erythematosus (NPSLE), amyotrophic lateral sclerosis, Creutzfeldt- Jacob disease, Gerstmann-Straussler-Scheinker disease, transmissible spongiform encephalopathy, ischemic reperfusion damage (e.g. stroke), brain trauma, microbial infection, or chronic fatigue syndrome. The pain can include without limitation one of fibromyalgia, chronic neuropathic pain, or peripheral neuropathic pain. The infectious disease can include without limitation one of a bacterial infection, viral infection, yeast infection, Whipple’s Disease, Prion Disease, cirrhosis, methicillin-resistant staphylococcus aureus, HIV, HCV, hepatitis, syphilis, meningitis, malaria, tuberculosis, or influenza. One of skill will appreciate that the oligonucleotide or plurality of oligonucleotides or methods described herein can be used to assess any number of these or other related diseases and disorders.

[00456] In some embodiments described herein, the oligonucleotide or plurality of oligonucleotides and methods of use thereof are useful for characterizing certain diseases or disease states. As desired, a pool of oligonucleotides useful for characterizing various diseases is assembled to create a master pool that can be used to probe useful for characterizing the various diseases. One of skill will also appreciate that pools of oligonucleotides useful for characterizing specific diseases or disorders can be created as well. The sequences provided herein can also be modified as desired so long as the functional aspects are still maintained (e.g., binding to various targets or ability to characterize a phenotype). For example, the oligonucleotides may comprise DNA or RNA, incorporate various non-natural nucleotides, incorporate other chemical modifications, or comprise various deletions or insertions. Such modifications may facilitate synthesis, stability, delivery, labeling, etc, or may have little to no effect in practice. In some cases, some nucleotides in an oligonucleotide may be substituted while maintaining functional aspects of the oligonucleotide. Similarly, 5’ and 3’ flanking regions may be substituted. In still other cases, only a portion of an oligonucleotide may be determined to direct its functionality such that other portions can be deleted or substituted. Numerous techniques to synthesize and modify nucleotides and polynucleotides are disclosed herein or are known in the art.

[00457] In an aspect, the invention provides a kit comprising a reagent for carrying out the methods described herein provided herein. In a similar aspect, the invention contemplates use of a reagent for carrying out the methods described herein provided herein. In embodiments, the reagent comprises an oligonucleotide or plurality of oligonucleotides. The oligonucleotide or plurality of oligonucleotides can be those provided herein. The reagent may comprise various other useful components including without limitation microRNA (miR) and messenger RNA (mRNA)), a protein-nucleic acid complex, and various combinations, fragments and/or complexes of any of these. The one or more reagent can be one or more of: a) a reagent configured to isolate a microvesicle, optionally wherein the at least one reagent configured to isolate a microvesicle comprises a binding agent to a microvesicle antigen, a column, a substrate, a filtration unit, a polymer, polyethylene glycol, PEG4000, PEG8000, a particle or a bead; b) at least one oligonucleotide configured to act as a primer or probe in order to amplify, sequence, hybridize or detect the oligonucleotide or plurality of oligonucleotides; c) a reagent configured to remove one or more abundant protein from a sample, wherein optionally the one or more abundant protein comprises at least one of albumin, immunoglobulin, fibrinogen and fibrin; d) a reagent for epitope retrieval; and e) a reagent for PHC visualization.

[00458] Tissue ADAPT

[00459] As noted herein, the invention provides oligonucleotide libraries enriched against various biological samples, including tissue samples. Tissue samples may be fixed. Fixation may be used in the preparation of histological sections by which biological tissues are preserved from decay, thereby preventing autolysis or putrefaction. The principal macromolecules inside a cell are proteins and nucleic acids. Fixation terminates any ongoing biochemical reactions, and may also increase the mechanical strength or stability of the treated tissues. Thus, tissue fixation can be used to preserve cells and tissue components and to do this in such a way as to allow for the preparation of thin, stained sections. Such samples are available for many biological specimens, e.g., tumor samples. Thus, fixed tissues provide a desirable sample source for various applications of the oligonucleotide probe libraries described herein. This process may be referred to as“tissue ADAPT.”

[00460] Tissue ADAPT according to the invention has been used to provide various oligonucleotide probes. In an aspect, the invention provides an oligonucleotide comprising a region corresponding to: a) a variable sequence as described in any one of Examples 14-16; b) a variable sequence as described in any one of Table 9, Table 17, or Table 19; or c) a sequence listed in any one of SEQ ID NO. 2922-102921 or 102932-102938. In some embodiments, the oligonucleotide further comprises a 5’ region with sequence 5’-CTAGCATGACTGCAGTACGT (SEQ ID NO. 4), a 3’ region with sequence 5’- CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5), or both. The invention further provides an oligonucleotide comprising a nucleic acid sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to such oligonucleotide sequences. In a related aspect, the invention provides a plurality of oligonucleotides comprising at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, or at least 100000 different oligonucleotide sequences as described above.

[00461] As described herein, many useful modifications can be made to nucleic acid molecules. In an embodiment, the oligonucleotide or the plurality of oligonucleotides described herein comprise a DNA, RNA, 2’ -O-methyl or phosphorothioate backbone, or any combination thereof. In some embodiments, the oligonucleotide or the plurality of oligonucleotides comprises at least one of DNA, RNA, PNA, LNA, UNA, and any combination thereof. The oligonucleotide or at least one member of the plurality of oligonucleotides can have at least one functional modification selected from the group consisting of DNA, RNA, biotinylation, a non-naturally occurring nucleotide, a deletion, an insertion, an addition, and a chemical modification. In some embodiments, the chemical modification comprises at least one of Cl 8, polyethylene glycol (PEG), PEG4, PEG6, PEG8, PEG12 and digoxygenin.

[00462] The oligonucleotide or plurality of oligonucleotides described herein can be labeled using any useful label such as described herein. For example, the oligonucleotide or plurality of oligonucleotides can be attached to a nanoparticle, liposome, gold, magnetic label, fluorescent label, light emitting particle, biotin moiety, or radioactive label.

[00463] Tissue ADAPT provides for the enrichment of oligonucleotide libraries against samples of interest. In an aspect, the invention provides a method of enriching an oligonucleotide library using multiple rounds of positive and negative selection. The method of enriching a plurality of oligonucleotides may comprise: a) performing at least one round of positive selection, wherein the positive selection comprises: i) contacting at least one sample with the plurality of oligonucleotides, wherein the at least one sample comprises tissue; and ii) recovering members of the plurality of oligonucleotides that associated with the at least one sample; b) optionally performing at least one round of negative selection, wherein the negative selection comprises: i) contacting at least one additional sample with the plurality of oligonucleotides, wherein at least one additonal sample comprises tissue; ii) recovering members of the plurality of oligonucleotides that did not associate with the at least one additonal sample; and c) amplifying the members of the plurality of oligonucleotides recovered in at least one or step (a)(ii) and step (b)(ii), thereby enriching the oligonucleotide library. Various alternatives of these processes are useful and described herein, such as varying the rounds of enrichment, and varying performance or positive and negative selection steps. In an embodiments, the recovered members of the plurality of oligonucleotides in step (a)(ii) are used as the input for the next iteration of step (a)(i). In an embodiment, the recovered members of the plurality of oligonucleotides in step (b)(ii) are used as the input for the next iteration of step (a)(i). The unenriched oligonucleotide library may possess great diversity. For example, the unenriched oligonucleotide library may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,

16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000, 200000, 300000, 400000, 500000, 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ⁿ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , or at least 10 ¹⁸ different oligonucleotide sequences. In an embodiment, the unenriched oligonucleotide library comprises the naive F-Trin library as described herein.

[00464] In embodiments of the enrichment methods described herein, the at least one sample and/or at least one additional sample comprise tissue. As desired, such tissue may be fixed using methods described herein or known in the art. The fixed tissue may be archived. The fixed tissue may comprise formalin fixed paraffin embedded (FFPE) tissue. In embodiment, the FFPE tissue comprises at least one of a fixed tissue, unstained slide, bone marrow core or clot, biopsy sample, surgical sample, core needle biopsy, malignant fluid, and fine needle aspirate (FNA). The FFPE tissue can be fixed on a substrate. For example, the substrate can be a glass slide, membrane, or any other useful material.

[00465] In some embodiment, the at least one sample and/or the at least one additional sample are fixed on different substrates. As a non-limiting example, the at least one sample is fixed on one glass slide whereas the at least one additional sample is fixed on a different glass slide. As desired, such slides may be from different patients, different tumors, a same tumor at different time points, multiple slices of the same tumor, etc. Alternately, the at least one sample and/or the at least one additional sample is fixed on a single substrate. As a non-limiting example, the at least one sample and at least one additional sample are fixed on a same glass slide, such as a tumor sample and normal adjacent tissue to the tumor. In some embodiments, the at least one sample and/or the at least one additional sample are lysed, scraped from a substrate, or subjected to microdissection. Lysed samples can be arrayed on a substrate. The invention contemplates any useful substrate. In some embodiments, the substrate comprises a membrane. For example, the membrane can be a nitrocellulose membrane.

[00466] In various embodiments of the enrichment methods described herein, the at least one sample and the at least one additional sample differ in a phenotype of interest. The at least one sample and the at least one additional sample can be from different sections of a same substrate. As a non-limiting example, the samples may comprise cancer tissue and normal adjacent tissue from a fixed tissue sample. In such cases, the at least one sample and the at least one additional sample may be scraped or microdissected from the same substrate to facilitate enrichment.

[00467] The oligonucleotide library can be enriched for analysis of any desired phenotype. In embodiments, the phenotype comprises a tissue, anatomical origin, medical condition, disease, disorder, or any combination thereof. For example, the tissue can be muscle, epithelial, connective and nervous tissue, or any combination thereof. For example, the anatomical origin can be the stomach, liver, small intestine, large intestine, rectum, anus, lungs, nose, bronchi, kidneys, urinary bladder, urethra, pituitary gland, pineal gland, adrenal gland, thyroid, pancreas, parathyroid, prostate, heart, blood vessels, lymph node, bone marrow, thymus, spleen, skin, tongue, nose, eyes, ears, teeth, uterus, vagina, testis, penis, ovaries, breast, mammary glands, brain, spinal cord, nerve, bone, ligament, tendon, or any combination thereof. As described further below, the phenotype can be related to at least one of diagnosis, prognosis, theranosis, medical condition, disease or disorder.

[00468] In various embodiments of the enrichment methods described herein, the method further comprises determining a target of the enriched members of the oligonucleotide library. Techniques for such determining are provided herein. See, e.g., Examples 9-10, 17 and 19.

[00469] Tissue ADAPT further comprises analysis of biological samples. In an aspect, the invention provides a method of characterizing a phenotype in a sample comprising: a) contacting the sample with at least one oligonucleotide or plurality of oligonucleotides; and b) identifying a presence or level of a complex formed between the at least one oligonucleotide or plurality of oligonucleotides and the sample, wherein the presence or level is used to characterize the phenotype. In a related aspect, the invention provides a method of visualizing a sample comprising: a) contacting the sample with at least one oligonucleotide or plurality of oligonucleotides; b) removing the at least one oligonucleotide or members of the plurality of oligonucleotides that do not bind the sample; and c) visualizing the at least one oligonucleotide or plurality of oligonucleotides that bound to the sample. The visualization can be used to characterize a phenotype.

[00470] The sample to be characterized can be any useful sample, including without limitation a tissue sample, bodily fluid, cell, cell culture, microvesicle, or any combination thereof. In some embodiments, the tissue sample comprises fixed tissue. The tissue may be fixed using any useful technique for fixation known in the art. Examples of fixation methods include heat fixation, immersion, perfusion, chemical fixation, cross-linked (for example, with an aldehyde such as formaldehyde or glutaraldehyde), precipitation (e.g., using an alcohol such as methanol, ethanol and acetone, and acetic acid), oxidation (e.g., using osmium tetroxide, potassium dichromate, chromic acid, and potassium permanganate), mercurials, picrates, Bouin solution, hepes-glutamic acid buffer-mediated organic solvent protection effect (HOPE), and freezing. In preferred embodiments, the fixed tissue is formalin fixed paraffin embedded (FFPE) tissue. In various embodiments, the FFPE sample comprises at least one of a fixed tissue, unstained slide, bone marrow core or clot, biopsy sample, surgical sample, core needle biopsy, malignant fluid, and fine needle aspirate (FNA).

[00471] Any useful technique for identifying a presence or level can be used for applications of tissue ADAPT, including without limitation nucleic acid sequencing, amplification, hybridization, gel electrophoresis, chromatography, or visualization. In some embodiments, the hybridization comprises contacting the sample with at least one labeled probe that is configured to hybridize with at least one oligonucleotide or plurality of oligonucleotides. The at least one labeled probe can be directly or indirectly attached to a label. The label can be, e.g., a fluorescent, radioactive or magnetic label. An indirect label can be, e.g., biotin or digoxigenin. In some embodiments, the sequencing comprises next generation sequencing, dye termination sequencing, and/or pyrosequencing of the at least one oligonucleotide or plurality of oligonucleotides. The visualization may be that of a signal linked directly or indirectly to the at least one oligonucleotide or plurality of oligonucleotides. The signal can be any useful signal, e.g., a fluorescent signal or an enzymatic signal. In some embodiments, the enzymatic signal is produced by at least one of a luciferase, firefly luciferase, bacterial luciferase, luciferin, malate dehydrogenase, inease, peroxidase, horseradish peroxidase (HRP), alkaline phosphatase (AP), b-galactosidase, glucoamylase, lysozyme, a saccharide oxidase, glucose oxidase, galactose oxidase, glucose-6-phosphate dehydrogenase, a heterocyclic oxidase, uricase, xanthine oxidase, lactoperoxidase, and microperoxidase. Visualization may comprise use of light microscopy or fluorescent microscopy. Various examples of visualization using polyligand histochemistry (PHC) are provided herein. See Examples 14-16.

[00472] In the methods described herein directed to characterizing or visualizing a sample, the target of at least one of the at least one oligonucleotide or plurality of oligonucleotides may be known. For example, an oligonucleotide may bind a known protein target. In some embodiments, the target of at least one the at least one oligonucleotide or plurality of oligonucleotides is unknown. For example, the at least one oligonucleotide or plurality of oligonucleotides may themselves provide a biosignature or other useful result that does not necessarily require knowledge of the antigens bound by some or all of the oligonucleotides. In some embodiments, the targets of a portion of the oligonucleotides are known whereas the targets of another portion of the oligonucleotides have not been identified.

[00473] In the methods of characterizing or visualizing a sample, the at least one oligonucleotide or plurality of oligonucleotides can be as provided herein. The at least one oligonucleotide or plurality of oligonucleotides may have been determined using the enrichment methods described herein provided herein, e.g., enrichment via tissue ADAPT. For example, the at least one oligonucleotide or plurality of oligonucleotides may comprise nucleic acids may have a sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least one of SEQ ID NOs. 1-102938.

[00474] In the methods described herein, including enriching an oligonucleotide library, characterizing a sample or visualizing a sample, the phenotype can be a biomarker status. In some embodiments, the biomarker is selected from the Examples herein. See, e.g., Tables 12-13, 15-16, 18, and 20-24.

[00475] In the methods described herein, including enriching an oligonucleotide library, characterizing a sample or visualizing a sample, the phenotype can be a phenotype comprises a disease or disorder. The methods can be employed to assist in providing a diagnosis, prognosis and/or theranosis for the disease or disorder. For example, the enriching may be performed using sample such that the enriched library can be used to assist in providing a diagnosis, prognosis and/or theranosis for the disease or disorder. Similarly, the characterizing may comprise assisting in providing a diagnosis, prognosis and/or theranosis for the disease or disorder. The visualization may also comprise assisting in providing a diagnosis, prognosis and/or theranosis for the disease or disorder. In some embodiments, the theranosis comprises predicting a treatment efficacy or lack thereof, classifying a patient as a responder or non-responder to treatment, or monitoring a treatment efficacy. The theranosis can be directed to any appropriate treatment, e.g., the treatment may comprise at least one of chemotherapy, immunotherapy, and targeted cancer therapy. In some embodiments, the treatment comprises at least one of afatinib, afatinib + cetuximab, alectinib, aspirin, atezolizumab, bicalutamide, cabozantinib, capecitabine, carboplatin, ceritinib, cetuximab, cisplatin, crizotinib, dabrafenib, dacarbazine, doxorubicin, enzalutamide, epirubicin, erlotinib, everolimus, exemestane + everolimus, fluorouracil, fulvestrant, gefitinib, gemcitabine, hormone therapies, irinotecan, lapatinib, liposomal-doxorubicin, matinib, mitomycin-c, nab-paclitaxel, nivolumab, olaparib, osimertinib, oxaliplatin, palbociclib combination therapy, paclitaxel, palbociclib, panitumumab, pembrolizumab, pemetrexed, pertuzumab, simitinib, T-DM1, temozolomide docetaxel, temsirolimus, topotecan, trametinib, trastuzumab, vandetanib, and vemurafenib. The hormone therapy can be one or more of tamoxifen, toremifene, fulvestrant, letrozole, anastrozole, exemestane, megestrol acetate, leuprolide, goserelin, bicalutamide, flutamide, abiraterone, enzalutamide, triptorelin, abarelix, and degarelix.

[00476] The theranosis can be for a therapy listed in any one of PCT/US2007/69286, filed May 18, 2007; PCT/US2009/60630, fded October 14, 2009; PCT/ 2010/000407, filed February 11, 2010;

PCT/US 12/41393, fded June 7, 2012; PCT/US2013/073184, filed December 4, 2013;

PCT/U S2010/54366, fded October 27, 2010; PCT/US 11/67527, filed December 28, 2011;

PCT/US15/13618, fded January 29, 2015; and PCT/US 16/20657, fded March 3, 2016; each of which applications is incorporated herein by reference in its entirety. The likelihood of benefd or lack of benefd of these therapies for treating various cancers can be related to a biomarker status. For example, anti- HER2 treatments may be of most benefd for patients whose tumors express HER2, and vice versa. Using appropriate samples for enrichment (e.g., known responders or non-responders), tissue ADAPT may be used to provide improved theranosis as compared to conventional companion diagnostics. For example, an oligonucleotide probe library described herein may be used to characterize a pancreatic tumor as a responder or not to antimetabolite treatment. The antimetabolite treatment may comprise a nucleoside analog, e.g., a pyrimidine nucleoside antagonist such as 5 -fluorouracil, foxuridine, cytarabine, capecitabine, or gemcitabine. Such analog may be gemcitabine, which may be administered with or without evofosphamide.

[00477] In the methods described herein directed to characterizing a sample, the characterizing may comprise comparing the presence or level to a reference. In some embodiments, the reference comprises a presence or level determined in a sample from an individual without a disease or disorder, or from an individual with a different state of a disease or disorder. The presence or level can be that of a visual level, such as an IHC score, determined by the visualizing. As a non-limiting example, the comparison to the reference of at least one oligonucleotide or plurality of oligonucleotides provided by the invention indicates that the sample comprises a cancer sample or a non-cancer/normal sample.

[00478] In some embodiments of the methods described herein, one or more sample comprises a bodily fluid. The bodily fluid can be any useful bodily fluid, including without limitation peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper’s fluid or pre-ejaculatory fluid, female ejaculate, sweat, fecal matter, hair oil, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus,

-Il l- sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood.

[00479] In the methods described herein, including characterizing a sample or visualizing a sample, the sample can be from a subject suspected of having or being predisposed to a medical condition, disease, or disorder.

[00480] In the methods described herein, including enriching an oligonucleotide library, characterizing a sample or visualizing a sample, the medical condition, the disease or disorder may be a cancer, a premalignant condition, an inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain.

Numerous non-limiting examples of medical conditions, diseases and disorders, are provided herein or known to those of skill in the art. See, e.g., Section“Phenotypes” herein.

[00481] In an aspect, the invention provides a kit comprising at least one reagent for carrying out the methods provided by the invention, including enriching an oligonucleotide library, characterizing a sample or visualizing a sample. In a related aspect, the invention provides use of at least one reagent for carrying out the methods provided by the invention, including enriching an oligonucleotide library, characterizing a sample or visualizing a sample. In some embodiments, the at least one reagent comprises an oligonucleotide or a plurality of oligonucleotides provided herein. Additional useful reagents are also provided herein. See, e.g., the protocols provided in the Examples.

[00482] The at least one oligonucleotide or plurality of oligonucleotides provided by tissue ADAPT can be used for various purposes. As described above, such oligonucleotides can be used to characterize and/or visualize a sample. As the oligonucleotides are selected to associate with tissues of interest, such associations can also be used for other purposes. In an aspect, the invention provides a method of imaging at least one cell or tissue, comprising contacting the at least one cell or tissue with at least one oligonucleotide or plurality of oligonucleotides provided herein, and detecting the at least one oligonucleotide or the plurality of oligonucleotides in contact with at least one cell or tissue. In a non- limiting example, such method can be used for medical imaging of a tumor or tissue in a patient.

[00483] For example, the at least one oligonucleotide or plurality of oligonucleotides may comprise nucleic acids may have a sequence or a portion thereof that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, or all of SEQ ID NOs. 2922-102921 or 102932-102938. In such cases, the imaging may be, e.g., directed to pancreatic tissue. See Examples 14-17.

[00484] In the imaging methods provided by the invention, the at least one oligonucleotide or the plurality of oligonucleotides can carry various useful chemical structures or modifications such as described herein. Such modifications can be made to enhance binding, stability, allow detection, or for other useful purposes. [00485] In the imaging methods provided by the invention, the at least one oligonucleotide or the plurality of oligonucleotides can be administered to a subject prior to the detecting. Such method may allow imaging of at least one cell or tissue in the subject. In some embodiments, the at least one cell or tissue comprises neoplastic, malignant, tumor, hyperplastic, or dysplastic cells. In some embodiments, the at least one cell or tissue comprises at least one of lymphoma, leukemia, renal carcinoma, sarcoma, hemangiopericytoma, melanoma, abdominal cancer, gastric cancer, colon cancer, cervical cancer, prostate cancer, pancreatic cancer, breast cancer, or non-small cell lung cancer cells. The at least one cell or tissue can be from any desired tissue or related to any desired medicial condition, disease or disorder such as described herein. See, e.g., Section“Phenotypes” herein.

[00486] As the oligonucleotides provided by tissue ADAPT are selected to associate with tissues of interest, such associations can also be used in therapeutic applications such as targeted drug delivery. The oligonucleotides may provide therapeutic benefit alone or by providing targeted delivery of

immunomodulators, drugs and the like. In an aspect, the invention provides a pharmaceutical composition comprising a therapeutically effective amount of a construct comprising the at least one oligonucleotide or the plurality of oligonucleotides as provided herein, or a salt thereof, and a pharmaceutically acceptable carrier, diluent, or both. In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in any one of Tables 12-13, 15-16, 18, and 20- 24.

[00487] For example, the at least one oligonucleotide or plurality of oligonucleotides may comprise nucleic acids having a sequence or a portion thereof, e.g., a variable region, that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95,

96, 97, 98, 99 or all of in any one of Table 9, Table 17, or Table 19. Such pharmaceutical composition may be useful for therapy related to a cancer, wherein optionally the cancer comprises pancreatic cancer. See, e.g., Examples 14-17.

[00488] The at least one oligonucleotide or the plurality of oligonucleotides within the pharmaceutical composition can have any useful desired chemical modification. In an embodiment, the at least one oligonucleotide or the plurality of oligonucleotides is attached to a toxin or chemotherapeutic agent. The at least one oligonucleotide or the plurality of oligonucleotides may be comprised within a multipartite construct. The at least one oligonucleotide or the plurality of oligonucleotides can be attached to a liposome or nanoparticle. In some embodiments, the liposome or nanoparticle comprises a toxin or chemotherapeutic agent. In such cases, the at least one oligonucleotide or the plurality of oligonucleotides can be used to target a therapeutic agent to a desired cell, tissue, organ or the like.

[00489] In a related aspect, the invention provides a method of beating or ameliorating a disease or disorder in a subject in need thereof, comprising administering the pharmaceutical composition described herein to the subject. In another related aspect, the invention provides a method of inducing cytotoxicity in a subject, comprising administering the pharmaceutical composition described herein to the subject. Any useful means of administering can be used, including without limitation at least one of inbadermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, topical administration, or any combination thereof.

[00490] The oligonucleotide or plurality of oligonucleotides provided by tissue ADAPT can be used for imaging or therapeutic applications of any desired medical condition, disease or disorder, such as those described herein (see above). As a non-limiting example, the oligonucleotide or plurality of

oligonucleotides can be used for imaging of tumors from various anatomical locals, or for treatment of cancers derived from various tissues.

[00491] Therapy-related Aptamers and Targets

[00492] Gemcitabine is an anti-cancer (“anti-neoplastic” or“cytotoxic”) chemotherapy drug and is classified as an antimetabolite. Antimetabolites are cell-cycle specific and inhibit cellular division.

Gemcitabine is a synthetic pyrimidine nucleoside prodrug— a nucleoside analog in which the hydrogen atoms on the 2' carbon of deoxycytidine are replaced by fluorine atoms. After entering a cell and being phosphorylated, gemcitabine masquerades as cytidine and can be into incorporated into new DNA strands as the cell replicates. Incorporation of gemcitabine into the DNA creates an irreparable error that leads to inhibition of further DNA synthesis, and cell death. Other pyrimidine antagonists include 5-fluorouracil, foxuridine, cytarabine, and capecitabine.

[00493] Gemcitabine is used for the treatment of various cancers, most commonly pancreatic cancer, non small cell lung cancer, bladder cancer, soft-tissue sarcoma, metastatic breast cancer and ovarian cancer. Common side effects include flu-like symptoms (e.g., muscle pain, fever, headache, chills, fatigue), fever, fatigue, nausea, vomiting, loss of appetite, rashes, low blood count, increased liver enzymes, and blood or protein in the urine. Less common side effects include diarrhea, weakness, hair loss, mouth sores, difficulty sleeping and shortness of breath. Severe reactions including bleeding, which may be in the urine or stool, and bruising require medical attention. Tests that would predict sensitivity or not to gemcitabine would help avoid such side effects and the time and expense of unnecessary treatment.

[00494] Gemcitabine activity is reduced in hypoxic environments, and may be less effective in patients with hypoxic tumors. On the other hand, evofosfamide was designed as a pro-drug that is activated under hypoxic conditions. Thus, reduced efficacy of gemcitabine in hypoxic tumors may be partially or fully recovered with the addition of evofosfamide.

[00495] We used the tissue ADAPT methodology described herein as described above to develop an oligonucleotide probe test to predict benefit from gemcitabine, or from gemcitabine in combination with evofosfamide. We also used aptamer pulldown experiments with mass spectrometry to identify protein targets of the oligonucleotide probe aptamers. See Examples 14-17 herein.

[00496] In an aspect, the invention provides an oligonucleotide comprising a sequence according to any one of: a) SEQ ID NOs. 2922-102938; or b) a row in any one of Table 9, Table 17, or Table 19. In some embodiments, the oligonucleotide comprises a sequence according to a row in Table 9. In other embodiments, the oligonucleotide comprises a sequence according to a row in Table 17. In still other embodiments, the oligonucleotide comprises a sequence according to a row in Table 19. The sequence may be according to any one of SEQ ID NOs. 2922-102938. The sequence may be a variable region sequence of an aptamer. As described herein, such variable region may be flanked by additional nucleic acid sequences to impart desired functionality. For example, the variable region may have at least one of a 5’ region with sequence 5’-CTAGCATGACTGCAGTACGT (SEQ ID NO. 3) and a 3’ region with sequence 5’-CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 4). Among other uses, these sequences can serve as primer sites. Examples of uses of the flanking sequences include without limitation hybridization sites for PCR primers, promoter sequences for RNA polymerases, restriction sites, homopolymeric sequences, catalytic cores, sites for selective binding to affinity substrates, or other sequences to facilitate cloning, sequencing, capture or attachment of the oligonucleotide.

[00497] The oligonucleotide aptamer described herein may be capable of binding to a tissue sample, e.g., pancreatic tissue. See, e.g., Example 14. It will be appreciated that various substitutions, additions or deletions may be made to an oligonucleotide described herein without significantly altering its functionality. Thus, the invention provides an oligonucleotide that is at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 percent identical or homologous to an oligonucleotide sequence described above. In some cases, such alterations may improve various characteristics if so desired, such as enhanced stability and/or binding, or more or less specific binding.

[00498] In a related aspect, the invention provides pools of oligonucleotide probes or aptamers. Example 14 herein describes the development of such a pool useful for predicting patient benefit or lack of benefit from gemcitabine or gemcitabine plus evofosfamide. The aptamer pool can include any useful and desired number of the oligonucleotide provided herein, including those described in the paragraphs above. In some embodiments, the invention provides a plurality of oligonucleotides (aptamer pool) comprising different members with oligonucleotide sequences according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,

13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130,

140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000,

6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000 or all of SEQ ID NOs. 2922-102938. If desired, subpools can be chosen based on certain criteria, such as prevalence. In another example, the invention provides a plurality of oligonucleotides comprising different members with oligonucleotide sequences having a region according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13,

14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 rows in Table 9. In still another related example, the invention provides a plurality of oligonucleotides comprising different members with oligonucleotide sequences having a region according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 rows in Table 19. See Examples 14 and 16 herein for description and uses of such pools.

[00499] As noted above, certain alterations can be made to the nucleotide sequences without parting from the invention. Accordingly, the invention provides a plurality of oligonucleotides comprising member nucleic acid sequences or a portion thereof that are at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89,

90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 percent identical or homologous to any of the above. The plurality of oligonucleotides can include at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000 or at least 100000 different oligonucleotide sequences provided by the invention. As a non-limiting example, an oligonucleotide probe library of high diversity with over 100000 sequences can be used to stain a tissue sample. See Example 14. However, a subpool thereof may also be used to stain the tissue sample if so desired. See, e g., Example 16.

[00500] As described herein, many useful modifications can be made to nucleic acid molecules. In an embodiment, the oligonucleotide or the plurality of oligonucleotides described herein comprise a DNA, RNA, 2’ -O-methyl or phosphorothioate backbone, or any combination thereof. Such modifications can be chosen for ease of synthesis, or to improve or detract stability. In some embodiments, the oligonucleotide or the plurality of oligonucleotides comprises at least one of DNA, RNA, PNA, LNA, UNA, and any useful combination thereof. The oligonucleotide or at least one member of the plurality of

oligonucleotides can have at least one functional modification selected from the group consisting of DNA, RNA, biotinylation, a non-naturally occurring nucleotide, a deletion, an insertion, an addition, and a chemical modification. In some embodiments, the chemical modification comprises at least one of Cl 8, polyethylene glycol (PEG), PEG4, PEG6, PEG8, PEG12 and digoxygenin. The oligonucleotide or plurality of oligonucleotides described herein can be labeled using any useful label, including without limitation those described herein. For example, the oligonucleotide or plurality of oligonucleotides can be attached to a nanoparticle, liposome, gold, magnetic label, fluorescent label, light emitting particle, biotin moiety, or radioactive label. A biotin moiety is particularly useful as it can be used for various purposes through its interaction with streptavidin or similar binding partner. For example, a biotinylated aptamer can be captured or immobilized to a surface comprising streptavidin, or such biotinylated aptamer can be detected using a label such as streptavidin horse radish peroxidase (SA-HRP).

[00501] In a related aspect, the invention provides an isolated oligonucleotide or plurality of

oligonucleotides as described above.

[00502] As noted, the oligonucleotide or plurality of oligonucleotides described herein can be used to predict a response to various treatments. Unless otherwise noted, the terms“response” or“non-response,” as used herein, refer to any appropriate indication that a treatment provides a benefit to a patient (a “responder” or“benefiter”) or has a lack of benefit to the patient (a“non-responder” or“non-benefiter”). Such an indication may be determined using accepted clinical response criteria such as the standard Response Evaluation Criteria in Solid Tumors (RECIST) criteria, or any other useful patient response criteria such as progression free survival (PFS), time to progression (TTP), disease free survival (DFS), time-to-next treatment (TNT, TTNT), tumor shrinkage or disappearance, or the like. RECIST is a set of rules published by an international consortium that define when tumors improve (“respond”), stay the same (“stabilize”), or worsen (“progress”) during treatment of a cancer patient. As used herein and unless otherwise noted, a patient“benefit” from a treatment may refer to any appropriate measure of improvement, including without limitation a RECIST response or longer PFS/TTP/DFS/TNT/TTNT, whereas“lack of benefit” from a treatment may refer to any appropriate measure of worsening disease during treatment. Generally disease stabilization is considered a benefit, although in certain

circumstances, if so noted herein, stabilization may be considered a lack of benefit. A predicted or indicated benefit may be described as“indeterminate” if there is not an acceptable level of prediction of benefit or lack of benefit. In some cases, benefit is considered indeterminate if it cannot be calculated, e.g., due to lack of necessary data.

[00503] The treatment may comprise gemcitabine. See, e.g., Examples 14-17. In an aspect, the invention provides a method of predicting response to gemcitabine comprising: providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide or plurality of

oligonucleotides provided herein; detecting a presence or level of the at least one oligonucleotide or members of the plurality of oligonucleotides that associated with the at least one sample; and predicting response to the gemcitabine based on the detected presence or level. In a related aspect, the invention provides a method of predicting response to gemcitabine comprising: providing at least one sample from a subject; detecting a presence or level of at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24 in the at least one sample; and predicting response to the gemcitabine based on the detected presence or level. In another related aspect, the invention provides a method of predicting response to gemcitabine comprising: providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide aptamer that specifically binds to at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24; detecting a presence or level of members of the at least one oligonucleotide aptamer that associated with the at least one protein; and predicting response to the gemcitabine based on the detected presence or level. The at least one oligonucleotide aptamer can be at least one oligonucleotide or plurality of oligonucleotides provided herein.

[00504] The treatment may comprise combination therapy with gemcitabine and evofosfamide. See, e.g., Examples 14-17. In an aspect, the invention provides a method of predicting response to gemcitabine and evofosfamide comprising: providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide or plurality of oligonucleotides provided herein; detecting a presence or level of the at least one oligonucleotide or members of the plurality of oligonucleotides that associated with the at least one sample; and predicting response to the gemcitabine and evofosfamide based on the detected presence or level. In a related aspect, the invention provides a method of predicting response to gemcitabine and evofosfamide comprising: providing at least one sample from a subject; detecting a presence or level of at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24 in the at least one sample; and predicting response to the gemcitabine and evofosfamide based on the detected presence or level. In another related aspect, the invention provides a method of predicting response to gemcitabine and evofosfamide comprising: providing at least one sample from a subject; contacting the at least one sample with at least one oligonucleotide aptamer that specifically binds to at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24; detecting a presence or level of members of the at least one oligonucleotide aptamer that associated with the at least one target; and predicting response to the gemcitabine and evofosfamide based on the detected presence or level. The at least one oligonucleotide aptamer can be at least one oligonucleotide or plurality of oligonucleotides provided herein.

[00505] In the methods of predicting response to gemcitabine and/or evofosfamide provided by the invention, any useful means of detecting may be selected as desired. As non-limiting examples, nucleic acids may be detected using sequencing, amplification, hybridization, gel electrophoresis,

chromatography, or any combination thereof. The sequencing may be high throughput or next generation sequencing ( GS). In further non-limiting examples, proteins may be detecting using various immunoassays, immunohistochemistry, poly -ligand histochemistry (referred to herein as PHC or PLP), flow cytometry, or the like. The detecting may be qualitative (e.g., present/absent) or quantitative (e.g., concentration, copy number, staining intensity, etc) as desired. Additional non-limiting examples of technology that can be used to detect nucleic acids and proteins are described in section“Biomarker Detection” herein.

[00506] In some embodiments of the methods of predicting response to gemcitabine and/or evofosfamide provided by the invention, the predicting comprises comparing the detected presence or level to a reference. The reference may be a set value, e.g., not detected, zero, or a set value or the like. For example, when staining a tissue slide using PLP, the reference may be lack of staining, or 0. See, e.g., Example 14. The reference can be a detected presence or level determined in a relevant control, including without limitation a sample from an individual without a disease or disorder, or a sample from an individual with a different state of a disease or disorder. As an example, consider that the presence or level is used to identify a responder to gemcitabine. The reference may be the presence or level in a non responder to gemcitabine. Similarly, when the presence or level is used to identify a non-responder to gemcitabine, the reference may be the presence or level in a responder to gemcitabine. Positive detection may predict non-beneficial response to the gemcitabine or gemcitabine and evofosfamide, whereas negative detection may predict beneficial response to the gemcitabine or gemcitabine and evofosfamide.

In this context, positive detection indicates that a positive presence is detected (e.g., aptamers are bound to a tissue as evidenced by staining using poly-ligand histochemistry) or that the level detected is above a threshold, such as a control level. Similarly, negative detection indicates that a presence is not detected (e.g., no aptamers are bound to a tissue as evidenced by lack of staining using poly -ligand histochemistry) or that the level detected is below a threshold, such as a control level. The threshold may be set such that a level detected at or close to the threshold is considered positive or negative, as desired. In some embodiments, a level detected at or close to the threshold is considered indeterminate.

[00507] In various embodiments of the methods of predicting response to gemcitabine and/or evofosfamide provided by the invention, the at least one sample can be a bodily fluid, tissue sample or cell culture. Various sample types are disclosed herein. For example, the tissue sample may comprise fixed tissue, including without limitation formalin fixed paraffin embedded (FFPE) tissue. FFPE tissue may be at least one of a fixed tissue, an unstained slide, bone marrow core or clot, biopsy sample, surgical sample, core needle biopsy, malignant fluid, and fine needle aspirate (FNA). The FFPE tissue may be fixed on a substrate, including without limitation a glass slide or membrane. A bodily fluid sample include peripheral blood, sera, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper’s fluid or pre -ejaculatory fluid, female ejaculate, sweat, fecal matter, hair oil, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, or umbilical cord blood.

[00508] Gemcitabine may be used in combination with other therapies in order to treat various cancers. While such combinations may be effective, they may also incur additional toxicities. See, e.g., Jin SF, et al., Gemcitabine-based combination therapy compared with gemcitabine alone for advanced pancreatic cancer: a meta-analysis of nine randomized controlled trials. Hepatobiliary Pancreat Dis Int. 2017 Jun; 16(3): 236-244, which reference is incorporated by reference herein in its entirety. Thus, it is advantageous to identify patients more likely to benefit from such treatments. Accordingly, in some embodiments of the methods of predicting response to gemcitabine and/or evofosfamide provided by the invention, the response to the gemcitabine and/or evofosfamide is determined when the gemcitabine and/or evofosfamide is given in combination with at least one other therapy. The at least one other therapy can be any useful therapy, including without limitation at least one chemotherapeutic agent,

chemoradiotherapy, radiotherapy, surgery, or any combination thereof. In some embodiments, the at least one chemotherapeutic agent comprises carboplatin, evofosfamide, 5-fluorouracil (5-FU), folinic acid (leucovorin), irinotecan, oxaliplatin, erlotinib, FOLFIRINOX (i.e., 5-FU, folinic acid, irinotecan, and oxaliplatin), paclitaxel, nab-paclitaxel, or any combination thereof. The at least one chemotherapeutic agent may include evofosfamide.

[00509] The methods of predicting response to gemcitabine and/or evofosfamide provided by the invention may be useful in various settings, including without limitation when the subject: i) has a disease or disorder; ii) is suspected of having or being predisposed to a disease or disorder; iii) is in need of treatment with gemcitabine and/or evofosfamide; or iv) is being considered for treatment with gemcitabine and/or evofosfamide. The disease or disorder can be any that may benefit from such treatment, including without limitation one or more of a cancer, a premalignant condition, an

inflammatory disease, an immune disease, an autoimmune disease or disorder, a cardiovascular disease or disorder, neurological disease or disorder, infectious disease or pain. In various embodiments, the cancer comprises an acute lymphoblastic leukemia; acute myeloid leukemia; adrenocortical carcinoma; AIDS- related cancers; AIDS-related lymphoma; anal cancer; appendix cancer; astrocytomas; atypical teratoid/rhabdoid tumor; basal cell carcinoma; bladder cancer; brain stem glioma; brain tumor (including brain stem glioma, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, astrocytomas, craniopharyngioma, ependymoblastoma, ependymoma,

medulloblastoma, medulloepithelioma, pineal parenchymal tumors of intermediate differentiation, supratentorial primitive neuroectodermal tumors and pineoblastoma); breast cancer; bronchial tumors; Burkitt lymphoma; cancer of unknown primary site; carcinoid tumor; carcinoma of unknown primary site; central nervous system atypical teratoid/rhabdoid tumor; central nervous system embryonal tumors; cervical cancer; childhood cancers; chordoma; chronic lymphocytic leukemia; chronic myelogenous leukemia; chronic myeloproliferative disorders; colon cancer; colorectal cancer; craniopharyngioma; cutaneous T-cell lymphoma; endocrine pancreas islet cell tumors; endometrial cancer;

ependymoblastoma; ependymoma; esophageal cancer; esthesioneuroblastoma; Ewing sarcoma;

extracranial germ cell tumor; extragonadal germ cell tumor; extrahepatic bile duct cancer; gallbladder cancer; gastric (stomach) cancer; gastrointestinal carcinoid tumor; gastrointestinal stromal cell tumor; gastrointestinal stromal tumor (GIST); gestational trophoblastic tumor; glioma; hairy cell leukemia; head and neck cancer; heart cancer; Hodgkin lymphoma; hypopharyngeal cancer; intraocular melanoma; islet cell tumors; Kaposi sarcoma; kidney cancer; Langerhans cell histiocytosis; laryngeal cancer; lip cancer; liver cancer; lung cancer; malignant fibrous histiocytoma bone cancer; medulloblastoma;

medulloepithelioma; melanoma; Merkel cell carcinoma; Merkel cell skin carcinoma; mesothelioma; metastatic squamous neck cancer with occult primary; mouth cancer; multiple endocrine neoplasia syndromes; multiple myeloma; multiple myeloma/plasma cell neoplasm; mycosis fungoides;

myelodysplastic syndromes; myeloproliferative neoplasms; nasal cavity cancer; nasopharyngeal cancer; neuroblastoma; Non-Hodgkin lymphoma; nonmelanoma skin cancer; non-small cell lung cancer; oral cancer; oral cavity cancer; oropharyngeal cancer; osteosarcoma; other brain and spinal cord tumors; ovarian cancer; ovarian epithelial cancer; ovarian germ cell tumor; ovarian low malignant potential tumor; pancreatic cancer; papillomatosis; paranasal sinus cancer; parathyroid cancer; pelvic cancer; penile cancer; pharyngeal cancer; pineal parenchymal tumors of intermediate differentiation; pineoblastoma; pituitary tumor; plasma cell neoplasm/multiple myeloma; pleuropulmonary blastoma; primary central nervous system (CNS) lymphoma; primary hepatocellular liver cancer; prostate cancer; rectal cancer; renal cancer; renal cell (kidney) cancer; renal cell cancer; respiratory tract cancer; retinoblastoma;

rhabdomyosarcoma; salivary gland cancer; Sezary syndrome; small cell lung cancer; small intestine cancer; soft tissue sarcoma; squamous cell carcinoma; squamous neck cancer; stomach (gastric) cancer; supratentorial primitive neuroectodermal tumors; T-cell lymphoma; testicular cancer; throat cancer; thymic carcinoma; thymoma; thyroid cancer; transitional cell cancer; transitional cell cancer of the renal pelvis and ureter; trophoblastic tumor; ureter cancer; urethral cancer; uterine cancer; uterine sarcoma; vaginal cancer; vulvar cancer; Waldenstrom macroglobulinemia; or Wilm’s tumor. In preferred embodiments, the cancer comprises at least one of breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, and bladder cancer. The cancer can be pancreatic cancer. See Example 14 herein. Other exemplary types of diseases and disorders that may benefit from the methods described herein, including various cancers, are disclosed herein. See, e.g., section“Phenotypes.”

[00510] Treatment regimen for the subject may be directed by the response to gemcitabine and/or evofosfamide predicted by the methods described herein. Thus, the methods described herein may further comprise administering gemcitabine and/or evofosfamide, with or without other combination therapy, to the subject. A treating physician, e.g., an oncologist, will make the decision based upon the prediction of the methods and potentially other clinical factors such as prior treatments, patient age, and known propensity to side effects. In some embodiments, the gemcitabine is administered to the subject when the methods described herein predict beneficial response to the gemcitabine. In some embodiments, the gemcitabine and evofosfamide is administered to the subject when the methods described herein predict beneficial response to the gemcitabine and evofosfamide. Likewise, predicted lack of benefit may direct the treating physician to forego gemcitabine with or without evofosfamide and prescribe another treatment regimen with potentially greater patient benefit.

[00511] In a related aspect, the invention provides a reagent for carrying out methods of predicting response to gemcitabine and/or evofosfamide provided by the invention. Similarly, the invention provides for the use of a reagent for carrying out these methods. The reagent may be any useful reagent, including without limitation one or more of at least oligonucleotide or plurality of oligonucleotides provided herein, or another binding agent at least one protein in at least one of Tables 12-13, 15-16, 18, and 20-24.

[00512] The oligonucleotide or plurality of oligonucleotides provided by the invention were enriched and selected for their ability to bind tissue samples. See Example 14 for details. Thus, the oligonucleotide or plurality of oligonucleotides bind constituents of the tissue samples, including cells and cellular proteins. See, e.g., Tables 12-13, 15-16, 18, and 20-24 and accompanying text. In an aspect, the invention provides a method of imaging at least one cell or tissue, comprising contacting the at least one cell or tissue with at least one oligonucleotide or plurality of oligonucleotides provided by the invention herein, and detecting the at least one oligonucleotide or the plurality of oligonucleotides in contact with at least one cell or tissue. In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides comprises nucleic acids having a sequence or a portion thereof (e.g., a variable region) that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000 or all of SEQ ID NOs. 2922-102921 or 102932-102938. The at least one oligonucleotide or plurality of oligonucleotides may associate with one or more protein listed in any one of Tables 12-13, 15-16, 18, and 20-24. In certain embodiments, the at least one cell or tissue comprises pancreatic tissue or cells. See Example 14.

[00513] To facilitate the imaging, the at least one oligonucleotide or the plurality of oligonucleotides may carry, directly or indirectly, a detectable label. For example, the label may comprise nanoparticle, liposome, gold, magnetic label, fluorescent label, light emitting particle, light reactive moiety, radioactive label or enzymatic label. Various useful labels are described in the section“Biomarker Detection” herein. In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is administered to a subject prior to the detecting. For example, such administering may allow localization of a target of the at least one oligonucleotide or the plurality of oligonucleotides. Although each oligonucleotide aptamer may target a particular epitope on a protein or the like, the target of the imaging may be a larger entity such as a cell, organ or tissue. In some embodiments, the cell, organ or tissue comprises neoplastic, malignant, tumor, hyperplastic, and/or dysplastic cells. Such targets may comprise at least one of lymphoma, leukemia, renal carcinoma, sarcoma, hemangiopericytoma, melanoma, abdominal cancer, gastric cancer, colon cancer, cervical cancer, prostate cancer, pancreatic cancer, breast cancer, or non- small cell lung cancer cells. A cancer being imaged may comprise at least one of breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, bladder cancer and sarcoma. Non-limiting examples of medical conditions, diseases or disorders, including additional useful cancers, that may be imaged via the methods described herein are found in section“Phenotypes” herein.

[00514] The oligonucleotide or plurality of oligonucleotides provided by the invention were enriched and selected for their ability to bind tissue samples. See Example 14 for details. Thus, the oligonucleotide or plurality of oligonucleotides bind constituents of the tissue samples, including cells and cellular proteins. See, e.g., Tables 12-13, 15-16, 18, and 20-24 and accompanying text. In an aspect, the invention provides a pharmaceutical composition comprising a therapeutically effective amount of a construct comprising at least one oligonucleotide or plurality of oligonucleotides as provided by the invention, or a salt thereof, and a pharmaceutically acceptable carrier, diluent, or both. For example, the at least one oligonucleotide or plurality of oligonucleotides may comprise nucleic acids having a sequence or a portion thereof, e.g., an aptamer variable region, that is at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent homologous to an oligonucleotide sequence according to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000,

4000, 5000, 6000, 7000, 8000, 9000, 10000, 20000, 30000, 40000, 50000, 60000, 70000, 80000, 90000, 100000 or all of SEQ ID NOs. 2922-102921 or 102932-102938. In some embodiments, the at least one oligonucleotide or plurality of oligonucleotides associates with, e.g., specifically binds, one or more protein listed in any one of Tables 12-13, 15-16, 18, and 20-24.

[00515] To facilitate or enhance therapeutic effect as desired, the at least one oligonucleotide or the plurality of oligonucleotides may be modified as described herein. For example, the at least one oligonucleotide or the plurality of oligonucleotides can be attached to a toxin or therapeutic agent. Thus, the aptamer/s may serve to deliver such toxin or therapeutic agent to a desired location, such as a cell, tissue or organ. In some embodiments, the at least one oligonucleotide or the plurality of oligonucleotides is comprised within a multipartite construct. See, e.g., section“Anti-target and multivalent

oligonucleotides” herein. The at least one oligonucleotide or the plurality of oligonucleotides can be attached to a liposome or nanoparticle, e.g., to effect delivery thereof. The liposome or nanoparticle may deliver various entities, e.g., a toxin or therapeutic agent. Such entities can be payload or on the surface of the particles as desired. Various useful aptamer modifications, constructs, conjugates and compositions thereof are further described herein, including without limitation in sections“Therapeutics,”“Anti-target and Multivalent Oligonucleotides,”“Modifications,”“Pharmaceutical Compositions,” and sub-sections thereof.

[00516] The invention further provides method of using the pharmaceutical compositions described herein for treating or ameliorating medical conditions, diseases and/or disorders. In an aspect, the invention provides a method of treating or ameliorating such medical conditions, diseases and/or disorders in a subject in need thereof, comprising administering the pharmaceutical composition described herein to the subject. Such administration may include cytotoxic effect, i.e., cell killing. In some embodiments, the medical condition, disease or disorder comprises a proliferative disorder, neoplasia, or cancer. For example, the cancer may be at least one of breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, bladder cancer, or sarcoma. Such cancers are most commonly treated with gemcitabine. The cancer may be refractory (e.g., resistant or non-responsive) to gemcitabine. The cancer may be refractory to gemcitabine in combination with evofosfamide. Additional medical conditions, diseases or disorders that may be treated using the pharmaceutical compositions described herein, including additional cancers, are listed herein in section“Phenotypes.” Any useful means of administering the pharmaceutical composition described herein may be used, including without limitation at least one of intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, topical administration, or any combination thereof.

[00517] The oligonucleotide or the plurality of oligonucleotides within the pharmaceutical composition described herein may be chosen to preferentially bind certain targets of interest. In some embodiments, the disease or disorder being treated comprises a pancreatic cancer and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in Table 20. In another embodiment, the disease or disorder displays gemcitabine resistance and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in Table 21. In still another embodiment, the disease or disorder comprises tumor hypoxia and the at least one oligonucleotide or plurality of oligonucleotides associates with one or more protein listed in Table 22. Such embodiments are not mutually exclusive. For example, the disease or disorder can be a pancreatic cancer displaying both gemcitabine resistance and tumor hypoxia and the at least one oligonucleotide or plurality of oligonucleotides may associate with one or more protein selected from the group consisting of CAPN1, CDC42, FN1, G6PD, LTF, PDIA3, RAB11A, S100P, TABLN2, and TNC. The disease or disorder can be a pancreatic cancer displaying gemcitabine resistance and the at least one oligonucleotide or plurality of oligonucleotides may associate with one or more protein selected from the group consisting of AKR1C1, DDX17, HIST1H3A, HSPB1, RAB14, and RECQL. The disease or disorder can be a pancreatic cancer displaying tumor hypoxia and the at least one oligonucleotide or plurality of oligonucleotides may associate with one or more protein selected from the group consisting of ACTN4, ALDOA, CALM1, CBR1, COL4A2, COL6A1, COMP, DES, GPI, LASPI, MUC5AC, PCBP1, PEBP1, PFN1, RAN, RPS6, S100A6, SND1, TALDOl, TKT, VCL, and VIM.

[00518] As noted, the oligonucleotide or plurality of oligonucleotides described herein were enriched and selected for their ability to bind tissue samples. See Example 14 for details. Thus, the protein targets of such oligonucleotides are present in such tissue samples. Accordingly, the protein targets of the oligonucleotides described herein are useful for targeting certain cells, tissues or organs. In an aspect, the invention provides a binding agent to a protein target of the oligonucleotide or plurality of

oligonucleotides described herein, including without limitation a protein listed in any one of Tables 12- 13, 15-16, 18, and 20-24. The binding agent can be any useful agent that can bind the protein target with a desired level of specificity. In some embodiments, the binding agent comprises one or more of a nucleic acid, DNA molecule, RNA molecule, antibody, antibody fragment, aptamer, peptoid, zDNA, peptide nucleic acid (PNA), locked nucleic acid (LNA), lectin, peptide, dendrimer, protein labeling agent, drug, small molecule, chemical compound, or any combination thereof. The binding agent may be conjugated or otherwise attached to chemical moieties or other entities to impart desired properties. In some embodiments, the binding agent is attached to a toxin, small molecule, therapeutic agent or

immunotherapeutic agent. As a non-limiting example, the binding agent is used to deliver such agents to the protein target. In some embodiments, the binding agent is attached to a detectable label, such as a label described herein. For example, the label may comprise nanoparticle, liposome, gold, magnetic label, fluorescent label, light emitting particle, light reactive moiety, radioactive label or enzymatic label.

Various useful labels are described in the section“Biomarker Detection” herein. Such constructs may be used for medical imaging purposes as described herein.

[00519] In a related aspect, the invention provides a pharmaceutical composition comprising a therapeutically effective amount of the binding agent described herein, or a salt thereof, and a pharmaceutically acceptable carrier, diluent, or both. As noted, the binding agent may be attached directly or indirectly to at least one of a toxin, therapeutic agent, liposome or nanoparticle.

[00520] In still another related aspect, the invention provides a method of treating or ameliorating a medical condition, disease or disorder in a subject in need thereof, comprising administering the pharmaceutical composition provided herein to the subject. Such administration may induce cytotoxicity to certain cells. In some embodiments, the medical condition, disease or disorder comprises a proliferative disease or disorder, neoplasia, or cancer. The cancer may be breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, bladder cancer or sarcoma. Additional medical conditions, diseases or disorders that may be treated using such pharmaceutical composition, including additional cancers, are listed herein in section“Phenotypes.” Any useful means of administering the pharmaceutical composition described herein may be used, including without limitation at least one of intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, oral, sublingual, intracerebral, intravaginal, transdermal, rectal, by inhalation, topical administration, or any combination thereof. In some embodiments, the cancer is refractory to gemcitabine, or the cancer is refractory to gemcitabine with evofosfamide. In some embodiments, the disease or disorder being treated comprises a pancreatic cancer and the binding agent associates with one or more protein listed in Table 20. In another embodiment, the disease or disorder displays gemcitabine resistance and the binding agent associates with one or more protein listed in Table 21. In still another embodiment, the disease or disorder comprises tumor hypoxia and the binding agent associates with one or more protein listed in Table 22. Such embodiments are not mutually exclusive. For example, the disease or disorder can be a pancreatic cancer displaying both gemcitabine resistance and tumor hypoxia and the binding agent may associate with one or more protein selected from the group consisting of CAPN1, CDC42, FN1, G6PD, LTF, PDIA3, RAB11A, S100P, TABLN2, and TNC. The disease or disorder can be a pancreatic cancer displaying gemcitabine resistance and the binding agent may associate with one or more protein selected from the group consisting of AKR1C1, DDX17, HIST1H3A, HSPB1, RAB14, and RECQL. The disease or disorder can be a pancreatic cancer displaying tumor hypoxia and the binding agent may associate with one or more protein selected from the group consisting of ACTN4, ALDOA, CALM1, CBR1, COL4A2, COL6A1, COMP, DES, GPI, LASPI, MUC5AC, PCBP1, PEBP1, PFN1, RAN, RPS6, S100A6, SND1, TALDOl, TKT, VCL, and VIM. In some embodiments, the binding agent associates with one or more protein not known to be associated with pancreatic cancer, gemcitabine resistance, hypoxia, or any combination thereof. Non-limiting examples of such one or more protein are listed in Table 23. Various combinations of binding agents may be administered to achieve desired efficacy. The administering may be performed after predicting a response of the subject to gemcitabine and/or evofosfamide as described herein. As a non-limiting example, the pharmaceutical composition may be administered if the methods described herein indicate non-benefit or indeterminate benefit from the gemcitabine and/or evofosfamide.

Kits

[00521] The invention also provides a kit comprising one or more reagent to carry out the methods described herein. For example, the one or more reagent can be the one or more aptamer, a buffer, blocker, enzyme, or combination thereof. The one or more reagent may comprise any useful reagents for carrying out the subject methods, including without limitation aptamer libraries, substrates such as microbeads or planar arrays or wells, reagents for biomarker and/or microvesicle isolation (e.g., via chromatography, filtration, ultrafiltration, centrifugation, ultracentrifugation, flow cytometry, affinity capture (e.g., to a planar surface, column or bead), polymer precipitation, and/or using microfluidics), aptamers directed to specific targets, aptamer pools that facilitate detection of a tissue/cell/microvesicle/biomarker population, reagents such as primers for nucleic acid sequencing or amplification, arrays for nucleic acid

hybridization, detectable labels, solvents or buffers and the like, various linkers, various assay components, blockers, and the like. The one or more reagent may also comprise various compositions provided by the invention. In an embodiment, the one or more reagent comprises one or more aptamer described herein. The one or more reagent can comprise a substrate, such as a planar substate, column or bead. The kit can contain instructions to carry out various assays using the one or more reagent. The one or more reagent may comprise a reagent for performing a PHC/PLP assay, including components of enzymatic detection systems and substrates thereof useful for staining a tissue sample. See, e.g., Example 14 herein.

[00522] In an embodiment, the kit comprises an oligonucleotide probe or composition provided herein.

The kit can be configured to carry out the methods provided herein. For example, the kit can include an aptamer described herein, a substrate, or both an aptamer described herein and a substrate.

[00523] In an embodiment, the kit is configured to carry out an assay. For example, the kit can contain one or more reagent and instructions for detecting the presence or level of a biological entity in a biological sample. In such cases, the kit can include one or more binding agent to a biological entity of interest. The one or more binding agent can be bound to a substrate. The one or more binding agent can be modified to allow capture, detection or visualization. For example, the one or more binding agent can be biotinylated or conjugated to digoxigenin.

[00524] In an embodiment, the kit comprises a set of oligonucleotides that provide a particular oligonucleotide profile for a biological sample. An oligonucleotide profile can include, without limitation, a profde that can be used to characterize a particular disease or disorder. For example, the disease or disorder can be a proliferative disease or disorder, including without limitation a cancer. In some embodiments, the cancer comprises a breast cancer, ovarian cancer, non-small cell lung cancer, pancreatic cancer, bladder cancer, or sarcoma.

EXAMPLES

Example 1: Aptamer Target Identification

[00525] In this Example, aptamers conjugated to microspheres are used to assist in determining the target of two aptamers identified by library screening methods as described herein. The approach is used to verify the targets of CAR003, an aptamer identified by library screening to recognize EpCAM. CAR003 is an aptamer candidate identified using the above methodology. As an RNA aptamer, CAR003 with alternate tail sequence has the following RNA sequence (SEQ ID NO. 3):

[00526] 5 ' -auccagagug acgcagcagu cuuuucugau ggacacgugg uggucuagua ucacuaagcc accgugucca-3'

[00527] In this approach, the sequence of CAR003 is randomly rearranged before linkage to the microspheres. The microspheres are used as controls to bind to targets that are similar but not identical to the intended target molecule.

[00528] The protocol used is as follows:

[00529] 1) The candidate aptamers (here, CAR003) and negative control aptamers (here, randomly arranged CAR003) are synthesized with modifications to allow capture (here, the aptamers are biotinylated) and crosslinking (here, using the Sulfo-SBED Biotin Label Transfer Reagent and Kit, Catalog Number 33073 from Thermo Fisher Scientific Inc., Rockford, IL, to allow photocrosslinking).

[00530] 2) Each of the aptamers is individually mixed with microvesicles having the target of interest (here, BrCa cell line microvesicles).

[00531] 3) After incubation to allow the aptamers to bind target, ultraviolet light is applied to the mixtures to trigger crosslinking of the aptamers with the microvesicle targets.

[00532] 4) The microvesicles are lysed, thereby releasing the crosslinked aptamer-target complex into solution.

[00533] 5) The crosslinked aptamer-target complexes are captured from solution using a streptavidin coated substrate.

[00534] 6) The crosslinked aptamer-target complexes for each aptamer are run individually on SDS- PAGE gel electrophoresis. The captured protein targets are visualized with Coomasie Blue staining.

[00535] 7) The crosslinking and binding steps may be promiscuous so that multiple bands including the intended target but also random proteins will appear on each of the gels. The intended target will be found in a band that appears on the gel with the candidate aptamer (here, CAR003) but not the related negative control aptamers (here, randomly arranged CAR003). The bands corresponding to the target are excised from the gel.

[00536] 8) Mass spectrometry (MS) is used to identify the aptamer target from the excised bands. Example 2: Disease Diagnosis

[00537] This example illustrates the use of oligonucleotide probes described herein to diagnose a proliferative disease.

[00538] A suitable quantity of an oligonucleotide or pool of oligonucleotides that bind pancreatic tissue, such as identified in Examples 14-17 below, is synthesized via chemical means known in the art. The oligonucleotides are conjugated to a diagnostic agent suitable for detection, such as a fluorescent moiety, using a conjugation method known in the art.

[00539] The composition is applied to tissue slides isolated from tumors taken from a test cohort of patients suffering from a proliferative disease associated with pancreatic tissue, e.g., pancreatic cancer. The composition is likewise applied to tissue slides isolated from tumors taken from a negative control cohort, e.g., not suffering from such proliferative disease.

[00540] The use of appropriate detection techniques (e.g., PHC/PLP as described here) on the test cohort samples indicates the presence of disease, while the same techniques applied to the control cohort samples indicate the absence of disease.

[00541] The results show that the oligonucleotides of the present invention are useful in diagnosing proliferative diseases.

Example 3: Theranostics

[00542] This example illustrates the use of oligonucleotide probes of the present invention to provide a theranosis for a drug for treating a proliferative disease.

[00543] A suitable quantity of an oligonucleotide or pool of oligonucleotides that bind pancreatic tissue, such as identified in Examples 14-17 below, is synthesized via chemical means known in the art. The probes are conjugated to an agent suitable for detection, such as a biotin moiety, which can then be detected using streptavidin constructs such as streptavidin-horse radish peroxidase using

immunohistochemistry (IHC) techniques. The oligonucleotide probe or panel of oligonucleotide probes are within a suitable composition, such as a buffered solution.

[00544] Treatment selection. The probes are applied to tumor tissue samples taken from a test cohort of patients suffering from a proliferative disease, e.g. pancreatic cancer, that responded to a certain treatment, e.g., gemcitabine. The probes are likewise applied to tumor tissue taken from a control cohort consisting of patients suffering from the same proliferative disease that did not respond to the treatment. The use of appropriate detection techniques (e.g., IHC/PHC/PLP) on the test cohort samples indicates that probes which bind the samples are useful for identifying patients that will respond to the treatment, while the same techniques applied to the control cohort samples identifies probes useful for identifying patients that will not respond to the treatment.

[00545] Treatment monitoring. In another setting, the probes are applied to tumor tissue samples from a test cohort of patients suffering from a proliferative disease, e.g. pancreatic cancer, prior to or dining a course of treatment, such as surgery, radiotherapy and/or chemotherapy. The probes are then applied to tumor tissue samples from the patients over a time course. The use of appropriate detection techniques (e.g., IHC/PHC/PLP) on the test cohort samples indicates whether the detected population of disease- related cells increases, decreases, or remains steady in concentration over time during the course of treatment. An increase in the population of disease-related cells post-treatment may indicate that the treatment is less effective whereas a decrease in the population of disease-related cells post-treatment may indicate that the treatment has a beneficial effect.

[00546] The results show that the oligonucleotide probes of the present invention are useful in theranosing proliferative diseases.

Example 4: Therapeutic Oligonucleotide Probes

[00547] This example illustrates the use of oligonucleotide probes of the present invention to treat a proliferative disease.

[00548] A suitable quantity of an oligonucleotide or pool of oligonucleotides that bind pancreatic cancer tumor tissue, such as identified in Examples 14-17 below, is synthesized via chemical means known in the art. The oligonucleotides are conjugated to a chemotherapeutic agent, such as Doxil, using a conjugation method known in the art. The conjugate is formulated in an aqueous composition.

[00549] The composition is administered intravenously, in one or more doses, to a test cohort of subjects suffering from pancreatic cancer. A control cohort suffering from pancreatic cancer is administered a placebo intravenously, according to a corresponding dosage regimen.

[00550] Pathological analysis of tumor samples and/or survival indicates that mortality and/or morbidity are improved in the test cohort over the control cohort.

[00551] The results show that the oligonucleotides of the present invention are useful in treating proliferative diseases.

Example 5: Oligonucleotide - Sequencing Detection Method

[00552] This Example illustrates the use of an oligonucleotide pool to detect microvesicles that are indicative of a phenotype of interest. The method makes use of a pool of oligonucleotides that have been enriched against a target of interest that is indicative of a phenotype of interest. The method in this Example allows efficient use of a library of oligonucleotides to preferentially recognize a target entity.

[00553] For purposes of illustration, the method is described in the Example with a microvesicle target from a bodily fluid sample. One of skill will appreciate that the method can be extended to other types of target entity (e.g., cells, proteins, various other biological complexes), sample (e.g., tissue, cell culture, biopsy, other bodily fluids) and other phenotypes (other cancers, other diseases, etc) by enriching an aptamer library against the desired input samples.

[00554] General workflow.

[00555] 1) Obtain sample (plasma, serum, urine or any other biological sample) of patients with unknown medical etymology and pre-treating them accordingly to ensure availability of the target of interest (see below). Where the target of interest is a microvesicle population, the microvesicles can be isolated and optionally tethered to a solid support such as a microbead.

[00556] 2) Expose pre-treated sample to an oligonucleotide pool carrying certain specificity against target of interest. As described herein, an oligonucleotide pool carrying certain specificity against the target of interest can be enriched using various selection schemes, e.g., using non-cancer microvesicles for negative selection and cancer microvesicles for positive selection as described above. DNA or RNA

oligonucleotides can be used as desired.

[00557] 3) Contact oligonucleotide library with the sample.

[00558] 4) Elute any oligonucleotides bound to the target.

[00559] 5) Sequence the eluted oligonucleotides. Next generation sequencing methods can be used.

[00560] 6) Analyze oligonucleotide profde from the sequencing. A profile of oligonucleotides known to bind the target of interest indicates the presence of the target within the input sample. The profde can be used to characterize the sample, e.g., as cancer or non-cancer.

[00561] Protocol variations.

[00562] Various configurations of the assay can be performed. Four exemplary protocols are presented for the purposes of the oligonucleotide-sequencing assay. Samples can be any appropriate biological sample. The protocols can be modified as desired. For example, the microvesicles can be isolated using alternate techniques instead or or in addition to ultracentrifugation. Such techniques can be disclosed herein, e.g., polymer precipitation (e.g., PEG), column chromatography, and/or affinity isolation.

[00563] Protocol 1 :

[00564] Ultracentrifugation of 1-5 ml bodily fluid samples (e.g., plasma/serum/urine) (120K x g, no sucrose) with two washes of the precipitate to isolate microvesicles.

[00565] Measure total protein concentration of recovered sample containing the isolated microvesicles.

[00566] Conjugate the isolated microvesicles to magnetic beads (for example MagPlex beads (Euminex Corp. Austin TX)).

[00567] Incubate conjugated microvesicles with oligonucleotide pool of interest.

[00568] Wash unbound oligonucleotides by retaining beads using magnet.

[00569] Elute oligonucleotides bound to the microvesicles.

[00570] Amplify and purify the eluted oligonucleotides.

[00571] Oligonucleotide sequencing (for example, Next generation methods; Ion Torrent: fusion PCR, emulsion PCR, sequencing).

[00572] Assess oligonucleotide profile.

[00573] Protocol 2:

[00574] This alternate protocol does not include a microvesicle isolation step, microvesicles conjugation to the beads, or separate partitioning step. This may present non-specific binding of the oligonucleotides against the input sample.

[00575] Remove cells/debris from bodily fluid sample and dilute sample with PBS containing MgCT (2mM).

[00576] Pre-mix sample prepared above with oligonucleotide library.

[00577] Ultracentrifugation of oligonucleotide/sample mixture (120K x g, no sucrose). Wash precipitated microvesicles.

[00578] Recover precipitate and elute oligonucleotides bound to microvesicles.

[00579] Amplify and purify the eluted oligonucleotides. [00580] Oligonucleotide sequencing (for example, Next generation methods; Ion Torrent: fusion PCR, emulsion PCR, sequencing).

[00581] Assess oligonucleotide profde.

[00582] Protocol 3:

[00583] This protocol uses filtration instead of ultracentrifugation and should require less time and sample volume.

[00584] Remove cells/debris from bodily fluid sample and dilute it with PBS containing MgC’L (2mM).

[00585] Pre-mix sample prepared above with oligonucleotide library.

[00586] Load sample into filter (i.e., 150K or 300K MWCO filter or any other that can eliminate unbound or unwanted oligonucleotides). Centrifuge sample to concentrate. Concentrated sample should contain microvesicles.

[00587] Wash concentrate. Variant 1 : Dilute concentrate with buffer specified above to the original volume and repeat centrifugation. Variant 2: Dilute concentrate with buffer specified above to the original volume and transfer concentrate to new filter unit and centrifuge. Repeat twice.

[00588] Recover concentrate and elute oligonucleotides bound to microvesicles.

[00589] Amplify and purify the eluted oligonucleotides.

[00590] Oligonucleotide sequencing (for example, Next generation methods; Ion Torrent: fusion PCR, emulsion PCR, sequencing).

[00591] Assess oligonucleotide profile.

[00592] Protocol 4\

[00593] Ultracentrifugation of 1-5 ml bodily fluid sample (120K x g, no sucrose) with 2 washes of the precipitate to isolate microvesicles.

[00594] Pre-mix microvesicles with oligonucleotide pool.

[00595] Load sample into 300K MWCO filter unite and centrifuge (2000xg). Concentration rate is ~3x.

[00596] Wash concentrate. Variant 1 : Dilute concentrate with buffer specified above to the original volume and centrifuge. Repeat twice. Variant 2: Dilute concentrate with buffer specified above to the original volume and transfer concentrate to new filter unit and centrifuge. Repeat twice

[00597] Recover concentrate and elute oligonucleotides bound to microvesicles.

[00598] Amplify and purify the eluted oligonucleotides.

[00599] Oligonucleotide sequencing (for example, Next generation methods; Ion Torrent: fusion PCR, emulsion PCR, sequencing).

[00600] Assess oligonucleotide profile.

[00601] In alterations of the above protocols, polymer precipitation is used to isolate microvesicles from the patient samples. For example, the oligonucleotides are added to the sample and then PEG4000 or PEG8000 at 4% or 8% concentration is used to precipitate and thereby isolate microvesicles. Elution, recovery and sequence analysis continues as above. Example 6: Plasma/Serum probing with an Oligonucleotide Probe Library

[00602] The following protocol is used to probe a plasma or serum sample using an oligonucleotide probe library.

[00603] In pul oligonucleotide library.

[00604] Use 2 ng input of oligonucleotide library per sample.

[00605] Input oligonucleotide library is a mixture of two libraries, cancer and non-cancer enriched, concentration is 16.3 ng/ul.

[00606] Dilute to 0.2ng/ul working stock using Aptamer Buffer (3mM MgCl ₂ in IX PBS)

[00607] Add lOul from working stock (equal to 2 ng library) to each optiseal tube

[00608] Materials.

[00609] PBS, Hyclone SH30256.01, LN: AYG165629, bottle# 8237, exp. 7/2015

[00610] Round Bottom Centrifuge Tubes, Beckman 326820, LN:P91207

[00611] OptiSeal Centrifuge tubes and plugs, polyallomer Konical, Beckman 361621, lot# Z10804SCA [00612] Ultracentrifuge rotor: 50.4 TI

[00613] Ultracentrifuge rotor: 50.4 TI, Beckman Caris ID# 0478

[00614] Protocol·.

[00615] 1 Pre-chill tabletop centrifuge, ultracentrifuge, buckets, and rotor at 4°C.

[00616] 2 Thaw plasma or serum samples

[00617] 3 Dilute 1ml of samples with 1 :2 with Aptamer Buffer (3mM MgCl ₂ in IX PBS)

[00618] 4 Spin at 2000xg, 30 min, 4°C to remove debris (tabletop centrifuge)

[00619] 5 Transfer supernatants for all samples to a round bottom conical

[00620] 6 Spin at 12,000xg, 45 min, 4°C in ultracentrifuge to remove additional debris.

[00621] 7 Transfer supernatant about 1.8ml for all samples into new OptiSeal bell top tubes (uniquely marked).

[00622] 8 Add 2ng (in 10 ul) of DNA Probing library to each optiseal tube

[00623] 9 QS to 4.5 ml with Aptamer Buffer

[00624] 10 Fix caps onto the OptiSeal bell top tubes

[00625] 11 Apply Parafdm around caps to prevent leakage

[00626] 12 Incubate plasma and oligonucleotide probe library for 1 hour at room temperature with rotation [00627] 13 Remove parafilm (but not caps)

[00628] 14 Place correct spacer on top of each plugged tube

[00629] 15 Mark pellet area on the tubes, insure this marking is facing outwards from center.

[00630] 16 Spin tubes at 120,000 x g, 2hr, 4°C (inner row, 33,400 rpm) to pellet microvesicles.

[00631] 17 Check marking is still pointed away from center.

[00632] 18 Completely remove supernatant from pellet, by collecting liquid from opposite side of pellet marker and using a 10 ml syringe barrel and 21G2 needle

[00633] 19 Discard supernatant in appropriate biohazard waste container

[00634] 20 Add 1 ml of 3 mM MgC12 diluted with IX PBS [00635] 21 Gentle vortex, 1600rpm for 5 sec and incubate 5 min at RT.

[00636] 22 QS to ~4.5 mL with 3 mM Mg C12 diluted with IX PBS

[00637] 23 Fix caps onto the OptiSeal bell top tubes.

[00638] 24 Place correct spacer on top of each plugged tube.

[00639] 25 Mark pellet area on the tubes, insure this marking is facing outwards from center.

[00640] 26 Spin tubes at 120,000 x g, 70 min, 4°C (inner row 33,400 rpm) to pellet microvesicles

[00641] 27 Check marking in still pointed away from center.

[00642] 28 Completely remove supernatant from pellet, by collecting liquid from opposite side of pellet marker and using a 10 ml syringe barrel and 21G2 needle

[00643] 29 Discard supernatant in appropriate biohazard waste container

[00644] 30 Add 1 ml of 3 mM MgC12 diluted with IX PBS

[00645] 31 Gentle vortex, 1600rpm for 5 sec and incubate 5 min at RT.

[00646] 32 QS to ~4.5 mL with 3 mM Mg C12 diluted with IX PBS

[00647] 33 Fix caps onto the OptiSeal bell top tubes.

[00648] 34 Place correct spacer on top of each plugged tube.

[00649] 35 Mark pellet area on the tubes, insure this marking is facing outwards from center.

[00650] 36 Spin tubes at 120,000 x g, 70 min, 4°C (inner row 33,400 rpm) to pellet microvesicles

[00651] 37 Check marking is still pointed away from center.

[00652] 38 Save an aliquot of the supernatant (lOOul into a 1.5ml tube)

[00653] 39 Completely remove supernatant from pellet, by collecting liquid from opposite side of pellet marker and using a 10 ml syringe barrel and 21G2 needle

[00654] 40 Add 50 ul of Rnase-free water to the side of the pellet

[00655] 41 Leave for 15min incubation on bench top

[00656] 42 Cut top off tubes using clean scissors.

[00657] 43 Resuspend pellet, pipette up and down on the pellet side

[00658] 44 Measure the volume, make a note on the volume in order to normalize all samples

[00659] 45 Transfer the measured resuspended eluted microvesicles with bound oligonucleotides to a Rnase free 1.5ml Eppendorf tube

[00660] 46 Normalize all samples to lOOul to keep it even across samples and between experiments.

[00661] Next Generation Sequencing Sample Preparation :

[00662] I) Use 50 ul of sample from above, resuspended in 100 ul H20 and containing microvesicle/oligo complexes, as template in Transposon PCR, 14 cycles.

[00663] II) AMPure transposon PCR product, use entire recovery for indexing PCR, 10 cycles.

[00664] III) Check indexing PCR product on gel, proceed with AMPure if band is visible. Add 3 cylces if band is invisible, check on gel. After purification quantify product with QuBit and proceed with denaturing and dilting for loading on HiSeq flow cell (Illumina Inc., San Diego, CA).

[00665] IV) 5 samples will be multiplexed per one flow cell. 10 samples per HiSeq. Example 7: Oligonucleotide probe library

[00666] This Example presents development of an oligonucleotide probe library to detect biological entities. In this Example, steps were taken to reduce the presence of double stranded oligonucleotides (dsDNA) when probing the patient samples. The data were also generated comparing the effects of 8% and 6% PEG used to precipitate microvesicles (and potentially other biological entities) from the patient samples.

[00667 ] Protocol:

[00668] 1) Pre-chill tabletop centrifuge at 4°C.

[00669] 2) Protease inhibition: dissolve 2 tablets of“cOmplete ULTRA MINI EDTA-free EASYpack” protease inhibitor in 1100 ul of H ₂ 0 (20x stock of protease inhibitor).

[00670] 3) Add 50 ul of protease inhibitor to the sample (on top of frozen plasma) and start thawing: 1 ml total ea.

[00671] 4) To remove cells/debris, spin samples at 10,000 x g, 20 min, 4°C. Collect 1 ml supernatant (SN).

[00672] 5) Mix 1 ml supernatant from step 4 with 1ml of 2xPBS 6 mM gCL. collect 400 ul into 3 tubes (replicates A, B, C) and use it in step 6.

[00673] 6) Add competitor per Table 2: make dilutions in lxPBS, 3mM MgCL, mix well, pour into trough, pipet using multichannel.

Table 2: Competitors

[00674] 7) Incubate for 10 min, RT, end-over-end rotation

[00675] Pool of 6-3 S and 8-3 S oligonucleotide probing libraries is ready: 2.76 ng/ul (—185 ng). Save pool stock and dilutions. New pool can be made by mixing 171.2ul (500ng) of library 6-3S (2.92 ng/ul) with 190.8ul (500ng) of library 8-3S (2.62 ng/ul). Aliquot pooled library into 30 ul and store at -80C.

[00676] Add ssDNA oligonucleotide probing library to the final concentration 2.5 pg/ul for binding. Make dilutions in lxPBS, 3mM gCL.

Table 3: Probe library calculations

[00677] 8) Binding: Incubate for lh at RT with rotation.

[00678] 9) Prepare polymer solution: 20% PEG8000 in lx PBS 3mM MgC12 (dilute 40% PEG8000 with 2xPBS with 6mM MgC12). Add 20% PEG8000 to sample to the final concentration 6%. Invert few times to mix, incubate for 15 min at 4C

Table 4: PEG calculations

[00679] 10) Spin at 10,000 x g for 5 min, RT.

[00680] 11) Remove SN, add 1ml lxPBS, 3 mM MgC12 and wash pellet by gentle invertion with 1ml aptamer buffer.

[00681] 12) Remove buffer, Re-suspend pellets in 100 ul H20: incubate at RT for 10 min on mixmate 900rpm to re-suspend.

[00682] 13) Make sure each sample is re-suspended by pipeting after step 13. Make notes on hardly re- suspendable samples.

[00683] 14) 50 ul of re-suspended sample to indexing PCR -> next generation sequencing (NGS).

[00684] 15) Keep leftover at 4C

[00685] Technical Validation.

[00686] The current protocol was tested versus a protocol using 8% PEG8000 to precipitate microvesicles. The current protocol further comprises steps to reduce dsDNA in the oligonucleotide probing libraries.

[00687] FIG. 3A shows the within sample variance (black) between binding replicates and the between sample variance (grey). Black is on top of grey, thus any observable grey oligo is informative about differences in the biology of two paitent samples. This evaluation of Sources of Variance shows that the technical variances is significantly smaller than the biological variance.

[00688] FIG. 3B shows the impact of using a higher proportion of single stranded DNA and PEG 6% isolation (white bars) compared to when there is a higher amount of double stranded DNA and 8% PEG (grey). This data indicates that the protocol in this Example improves biological separation between patients. [00689] The plots in FIG. 3C show the difference between an earlier protocol (PEG 8% with increased dsDNA) and a modified protocol of the Example (PEG 6% no dsDNA). The black is the scatter between replicates (independent binding events) and the grey is the difference between patients. This data shows that the signal to noise increased significantly using the newer protocol.

[00690] Patient testing:

[00691] The protocol above was used to test patient samples having the following characteristics:

Table 5: Patient characteristics

[00692] Microvesicles (and potentially other biological entities) were precipitated in blood (plasma) samples from the above patients using polymer precipitation with PEG as indicated above. The protocol was used to probe the samples with the oligonucleotide probe libraries. Sequences that bound the PEG precipitated samples were identified using next generation sequencing (NGS).

[00693] FIG. 3D shows scatter plots of a selection of results from testing the 40 patients listed previously. The spread in the data indicates that large numbers of oligos were detected that differed between samples. The number of significant oligos found is much greater than would be expected randomly as shown in Table 6. The table shows the number of oligonucleotides sorted by copy number detected and p-value. The d-# indicates the number copies of a sequence observed for the data in the rows.

Table 6: Expected versus observed sequences

[00694] As a control, the cancer and non-cancer samples were randomly divided into two groups. Such randomization of the samples significantly reduced the number of oligos found that differentiate between sample groups. Indeed, there was a 50-fold increase in informative oligos between the cancer/non-cancer grouping versus random grouping. FIG. 3E shows data as in Table 6 and indicates the number of observed informative oligos between the indicated sample groups.

[00695] FIG. 3F shows distinct groups of oligos that differentiate between cancer and non-cancer samples. The figure shows a heatmap of the 40 samples tested with oligos selected that had more than 500 copies and p-value less than 0.005. There are clear subpopulations emerging with a distinct non-cancer cohort at the top. The non-cancer samples have boxes around them on the left axis. FIG. 3G is similar and shows results with an additional 20 cancer and 20 non-cancer samples. As shown, analysis with the 80 samples provides the emergence of more distinct and larger clusters.

[00696] The data for the additional 80 samples was also used to compare the consistency of informative oligos identified in different screening experiments. Of the 315 informative oligos identified using the first set of 40 patients, 86% of them showed fold-change in a consistent manner when tested on the independent set of 40 patients.

Example 8: Enrichment of Oligonucleotide probes using a balanced library design

[00697] In this Example, a naive ADAPT oligonucleotide library was screened to enrich oligonucleotides that identify microvesicles circulating in the blood of breast cancer patients and microvesicles circulating in the blood of healthy, control individuals (i.e., without breast cancer). The input library was the naive F- TRin-35n-B 8-3s library, which comprises a 5’ region (5 ' CTAGCATGACTGCAGTACGT (SEQ ID NO. 4)) followed by the random naive aptamer sequences of 35 nucleotides and a 3’ region (5 '

CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5)). The“balanced” design is described in Example 23 of Int’l Patent Publication WO/2015/031694 (Appl. No. PCT/US2014/053306, fded August 28, 2014), which is incorporated by reference herein in its entirety. The working library comprised approximately 2 x 10 ¹³ synthetic oligonucleotide sequences. The naive library may be referred to as the “L0 Library” herein.

[00698] The L0 Library was enriched against fractionated plasma samples from breast cancer patients and from healthy (non-breast cancer) controls using the protocol shown in FIG. 10A. In Step 1, an aliquot of approximately 10 ⁿ sequences of PCR-amplified L0 was incubated with pooled blood-plasma from 59 breast cancer patients with positive biopsy (represented by“Source A” in FIG. 10A). In parallel, another aliquot of 10 ⁿ sequences was incubated with pooled blood-plasma from 30 patients with suspected breast cancer who proved negative on biopsy and 30 self declared healthy women (represented by“Source B” in FIG. 10A). In Step 2, microvesicles (extracellular vesicles,“EV”) were precipitated using

ultracentrifugation (UC) from both LO-samples. The EV-associated oligodeoxynucleotides (ODNs) were recovered from the respective pellets. In Step 3, a counter-selection step (Step 3) was carried out by incubation of each enriched library with plasma from the different cohorts to drive the selection pressure towards enrichment of ODNs specifically associated with each sample cohort. In this step, sequences contained in the EV pellets were discarded. In Step 4, a second positive selection was performed. In this step, the sequences contained in the respective supernatants (sn) from Step 3 were mixed with plasma from another aliquot of each positive control sample-population, and EVs were again isolated. EV- associated ODNs were recovered, representing two single-round libraries called library LI for positive enrichment of cancer (positive biopsy) patients, and library L2 for the positive enrichment against control patients. In a final step, LI and L2 were amplified by PCR, reverted to single stranded DNA (ssDNA), and mixed to yield library L3.

[00699] This enrichment scheme was iterated two times more using L3 as the input to further reduce the complexity of the profiling library to approximately 10 ⁶ different sequences. In Step 2, UC was used for partitioning of microvesicles, which may increase the specificity for the EV fraction. In Steps 3 and 4, partitioning was performed using PEG-precipitation. This procedure enriches for ODNs specific for each biological source. Library L3 contains those ODNs that are associated with targets characteristic for EV- populations from both sources, i.e. ODNs acting as aptamers that bind to molecules preferentially expressed in each source. A total of biopsy -positive (n = 59), biopsy -negative (n = 30), and self-declared normal (n = 30) were used in the first round of L3 enrichment, while only the cancer and non-cancer samples were used in the subsequent rounds.

[00700] The enriched libraries were characterized using next-generation-sequencing (NGS) to measure copy numbers of sequences contained in each profiling library. NGS of L0 shows that the vast majority of sequences existed in low copy numbers, whereas libraries LI and L2 showed significantly higher average counts per sequence (FIG. 10B) and a reduced amount of different sequences, with unaltered total valid reads, (FIG. 10C) consistent with an enrichment process.

Example 9: Analysis of ADAPT-identified biomarkers

[00701] As described herein, e.g., in the section entitled“Aptamer Target Identification,” an unknown target recognized by an aptamer can be identified. In this Example, an oligonucleotide probe library (also referred to as Adaptive Dynamic Artificial Poly-ligand Targeting (ADAPT) libraries) was developed as described here and targets of the screened oligonucleotides were determined. This Example used a ADAPT library generated by enriching microvesicles collected from the blood of breast cancer patients and normal controls (i.e., non-cancer individuals). The enrichment protocols are described herein in

Example 8.

[00702] Materials & Methods

[00703] SBED library conjugation

[00704] A naive F-TRin-35n-B 8-3s library was enriched against microvesicles from normal female plasma. The naive unenriched library comprised a 5’ region (5 ' CTAGCATGACTGCAGTACGT (SEQ ID NO. 4)) followed by the random naive aptamer sequences of 35 nucleotides and a 3’ region (5 '

CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5)). The naive library may be referred to as the“L0 Library” herein and the enriched library referred to as the“L2 library.” See Example 8. The screened library was PCR amplified with a C6-amine sense primer (C6 Amine-5'

CTAGCATGACTGCAGTACGT 3' (SEQ ID NO. 4)) and a 5’ phosphorylated anti-sense primer (5' Phos TCGTCGGCAGCGTCA (SEQ ID NO. 6)), the purified product was strand separated and conjugated with sulfo-SBED (Thermo Scientific) according to Vinkenborg et al. (Angew Chem Int Ed Engl. 2012, 51:9176-80) with the following modifications: The reaction was scaled down to 5pg C6-amine DNA library (8.6 mM) in 25mM HEPES-KOH, 0.1M NaCl, pH 8.3 and incubated with either 100-fold molar excess of sulfo-SBED or DMSO in a 21pL volume for 30 min at room temp in the dark. The SBED- conjugated library was immediately separated from the unconjugated library and free sulfo-SBED by injection onto a Waters X-BridgeTM OST C-18 column (4.6 mm x 50 mm) and fractionated by HPLC (Agilent 1260 Infinity) with a linear gradient Buffer A: 100 mM TEAA, pH7.0, 0% ACN to 100 mM TEAA, pH7.0, 25% ACN at 0.2ml/min, 65 °C. There SBED-conjugated fractions were desalted into water with Glen Gel-PakTM Cartridges and concentrated by speed-vac. SBED conjugation was confirmed by LC-MS and/or a dot blot with streptavidin-HRP detection.

[00705] Binding reaction and cross-linking

[00706] SBED library functionalization was tested by performing the ADAPT assay with SBED vs DMSO mock conjugated control C6-amine library and sequenced on a HiSeq 2500TM (Illumina Corp.). The aptamer precipitation was performed with forty -eight ADAPT reactions incubated for lhr with end- over-end rotation at room temp with a 5ng input of SBED conjugated library per 200 pL of plasma (prespun to remove cellular debris at 10,000 xg for 20min, 4 °C) in IX PBS, 3mM MgCl ₂ , O.OlmM dextran sulfate, 40 ng/mΐ salmon sperm DNA and 40 ng/mΐ yeast transfer RNA, and cOmplete ULTRA Mini EDTA-free TM protease inhibitors (Roche) equivalent to ~240ng library and 9.6 mis plasma. A duplicate set of 48 reactions was prepared with the DMSO control C6-amine library. Aptamer library -protein complexes were precipitated with incubation in 6% PEG8000 for 15 min at 4 °C then centrifuged at 10,000 xg for 5 min. Pellets were washed with 1ml lx PBS, 3mM MgC12 by gentle inversion to remove unbound aptamers. The washed pellets were resuspended in 100pL of water and subjected to photo-cross- linking at 365nm with a hand-held 3UV (254NM/302NM/365NM) lamp, 115 volts (Thermo Scientific) for 10 min on ice with 1-2 cm between the 96-well plate and lamp.

[00707] Oligonucleotide precipitation

[00708] Cross-linked reactions were subsequently pooled (~4.8ml) per library or 4.8 ml of IX PBS (AP bead only control) and incubated with 10 pL of Prepared Dynabeads® My One™ Streptavidin Cl (lOmg/ml) (Life Technologies) (pre-washed with IX PBS, 0.01% Triton X-100) shaking for 1 hr at room temp. Beads were transferred to an eppendorf tube and lysed for 20 min with lysis buffer (50 mM Tris- HC1, lOmM MgC12, 200mM NaCl, 0.5% Triton X-100, 5% glycerol, pH 7.5) on ice, washed 3 times with wash buffer 1 (lOmM Tris-HCl, ImM EDTA, 2M NaCl, 1% Triton X-100), followed by 2 times with wash buffer 2 (lOmM Tris-HCl, ImM EDTA, 2M NaCl, 0.01% Triton X-100) as described by

Vinkenborg et al. (Angew Chem Int Ed Engl. 2012, 51 :9176-80). Cross-linked proteins were eluted by boiling 15 min in IX LDS sample buffer with reducing agent added (Life Technologies) and loaded on a 4-12% SDS-PAGE gradient gel (Life Technology). Proteins and DNA were detected with double staining with Imperial Blue Protein Stain (Thermo Scientific) followed by Prot-SIL2 TM silver stain kit (Sigma) used according to manufacturer’s instructions in order to enhance sensitivity and reduce background.

[00709] Protein identification

[00710] Protein bands that appeared to differ between the cancer and normal were excised from the gradient gels and subjected to liquid chromatography -tandem mass spectrometry (LC-MS/MS).

[00711] Results

[00712] ADAPT protein targets were identified from bands cut from a silver stained SDS-PAGE gel (FIG. 4). Aptamer-SBED protein complexes (lane 3) or Aptamer-DMSO protein complexes (control-lane 4) were precipitated with 6% PEG8000, subjected to UV photo-cross-linking, and pulled-down with Streptavidin coated beads. Eluate was analyzed under reducing conditions by SDS-PAGE and silver staining. Aptamer library alone (5ng) (lane 1) was loaded as a control for migration of the library (second to botom arrows) and an equal volume of eluate from a bead only sample (lane 4) was loaded as a streptavidin control to control for potential leaching of the streptavidin monomer (botom arrow) under the harsh elution conditions. Upper arrows (“Targets”) indicate specific or more predominant bands identified with the SBED-conjugated library vs. the mock DMSO treated control C6-amine library. Indicated target protein bands were cut out and sent for LC-MS/MS protein identification or indicated DNA library bands were eluted, reamplified and sequenced. The identified proteins are those that appeared as upregulated in the normal samples.

Example 10: Identification of biomarkers through affinity enrichment with an enriched oligonucleotide library and mass spectrometry

[00713] This Example continues upon the Example above. Identification of protein-protein and nucleic acid-protein complexes by affinity purification mass spectrometry (AP-MS) can be hampered in samples comprising complex mixtures of biological components (e.g., bodily fluids including without limitation blood and derivatives thereof). For example, it may be desireable to detect low abundance protein and nucleic acid-protein complexes in a complex milieu comprising various components that may interact promiscuously with specific binding sites such as high abundance proteins that interact non-specifically with the affinity resin. AP-MS has been used previously to enrich for pre -identified targets of interest using individual DNA or RNA aptamers or specific nucleic acid binding domains. In this Example, an enriched oligonucleotide probing library was used as the affinity reagent. This approach combined with mass spectrometry enables the identification of differentially expressed biomarker from different disease states or cellular perturbations without relying on a priori knowledge of the targets of interest. Such biomarker may comprise proteins, nucleic acids, miRNA, mRNA, carbohydrates, lipid targets, combinations thereof, or other components in a biological system.

[00714] The method comprises identification of an enriched oligonucleotide probe library according to the methods described herein followed by target identification with affinity purification of the bound probing library and mass spectrometry. The members of the enriched oligonucleotide probing library comprise an affinity tag. A biological sample is probed with the oligonucleotide probe library, affinity purification of the oligonucleotide probe library via the affinity tag is performed which will accordingly purify biological entities in complex with various members of the probe library, and read-out of targets that purified with the members of the probe library is performed using liquid chromatography -tandem mass spectrometry (LC-MS/MS) for proteins or oligonucleotide targets (e.g., miRNA or mRNA) with next generation sequencing (NGS). Confirmation of protein targets is performed using quantitative mass spectrometry (MS), e.g., using MRM/SRM or SWATH based methods.

[00715] The method of the Example lends itself to various options. For example, any appropriate affinity tags can be used for affinity pull-down, including without limitation anti-sense oligonucleotides, biotin, polyhistidine, FLAG octapeptide (i.e., N-DYKDDDDK-C (SEQ ID NO. 7), where N stands for Amino- terminus and C stands for Carboxy terminus), 3X FLAG, Human influenza hemagglutinin (HA)-tag (i.e., N-YPYDVPDYA-C (SEQ ID NO. 8)), myc-tag (N-EQKLISEEDL-C (SEQ ID NO. 9)), other such as known in the art, and combinations thereof. Similarly, any appropriate enrichment support can be used in addition to the magnetic streptavidin beads exemplified herein, including without limitation other bead systems, agarose beads, planar arrays or column chromatography supports. It follows that the various supports can be coupled with the various affinity reagents appropriate for the oligonucleotide library, including without limitation streptavidin, avidin, anti-His tag antibodies, nickel, and the like. The different affinity tags and supports can be combined as desired. This Example used cross-linking but in certain cases such cross-linking is not necessary and may even be undesirable, e.g., to favor identification of high affinity complex formation. When cross-linking is desired, any appropriate cross-linkers can be used to carry out the invention, including BS2G, DSS, formaldehyde, and the like. Other appropriate cross-linkers and methods are described herein. See, e.g., Section“Aptamer Target Identification.” Lysis buffers and wash stringencies can be varied, e.g, depending on whether complexes are cross-linked or not. Less stringent lysis/wash conditions may produce a wider array of potential protein complexes of interest whereas more stringent lysis/wash conditions may favor higher affinity oligo-target complexes and/or targets comprising specific proteins (e.g., by disassociating larger complexes bound to the oligos). One of skill will further appreciate that qualitative and/or quantitative LC -MS/MS may be used for target detection and verification. Similarly, metabolic labeling and label-free approaches may be used for quantitative MS, including without limitation spectral counting, SILAC, dimethyl labeling, TMT labeling, Targeted MS with SRM/MRM or SWATH, and the like.

[00716] References.

[00717] Vickenborg et al.“Aptamer based affinity labeling of proteins”, Angew Chem Int. 51(36):9176- 80 (2012).

[00718] Tacheny, M, Amould, T., Renard, A.“Mass spectrometry -based identification of proteins interacting with nucleic acids”, Journal of Proteomics 94; 89-109 (2013).

[00719] Laoro C and Ataide SL.“Ribonomic approaches to study the RNA-binding proteome.”, LEBS Lett. 588(20):3649-64 (2014).

[00720] Budayeva HG, Cristea, IM,“A mass spectrometry view of stable and transient protein inteeractions.” Adv Exp Med Biol. 806:263-82 (2014).

Example 11: Protocol for Affinity capture using oligonucleotide probing library

[00721] This Example presents a detailed protocol for the method of affinity capture using an oligonucleotide probing library presented in the Example above.

[00722] Protocol·.

[00723] The oligonucleotide probe library comprises F-TRin-35n-B-8-3s described herein either desthiobiotin labeled or unlabeled library and binding to normal (i.e., non-cancer) female plasma. The oligonucleotide probe library is enriched against the plasma samples as described herein. The plasma samples are processed separately against the desthiobiotin labeled or unlabeled oligonucleotide libraries. General parameters included the following:

[00724] 48 normal plasma samples are pooled for enrichment of each oligonucleotide library

(Desthiobiotin or Unlabeled)

[00725] 200 mΐ input plasma per sample [00726] Ultracentrifugation (UC) is used to pre-clear the samples

[00727] 5 ng of each aptamer library is added to each sample

[00728] Binding competitors for all library samples include 0.0 IX SI (dextran sulfate), 340ng for tRNA and 340 ng Salmon sperm DNA as described elsewhere herein

[00729] 6% PEG 8000 is used for precipitation of microvesicles within the samples

[00730] Affinity purification is performed with Cl Streptavidin beads (My One Strptavidin Beads Cl-

65001, lot 2ml (10mg/ml))

[00731 \ Buffers:

[00732] Plasma dilution: 6 mM MgC12 in 2X PBS

[00733] Pellet Wash Buffer: IX PBS, 3mM MgC12

[00734] PEG Ppt Buffer: 20% Peg8000 in IX PBS, 3mM MgC12

[00735] Bead Prep Buffer: 1XPBS containing 0.01% Triton X-100

[00736] Lysis Buffer: prepare a 2X stock solution consisting of lOOmM Tris-HCl, 20mM MgC12, 400mM NaCl, 1% Triton X-100, 10% glycerol, pH 7.5. Diluted to IX with water 1: 1 prior to using.

[00737] AP Wash buffer 1 : lOmM Tris-HCl, ImM EDTA, 2M NaCl, 1% Triton X-100, pH 7.5

[00738] AP wash buffer 2: lOmM Tris-HCL, ImM EDTA, 2M NaCl, 0.01% Triton X-100, pH 7.5

[00739] Biotin Elution buffer 1: 5mM Biotin, 20mM Tris, 50mM NaCl, pH 7.5

[00740] IX LDS, IX Reducing buffer 2

[00741] Reagent/Instrument Prep:

[00742] Pre-chill Ultracentrifuge to 4 °C.

[00743] Protease inhibition: dissolve 2 tablets of“cOmplete ULTRA MINI EDTA-free EASYpack” protease inhibitor in 1100 mΐ of H20 (20x stock of protease inhibitor).

[00744] Plasma Preparation (for each of Desthiobiotin or Unlabeled oligonucleotide libraries) :

[00745] 1. Add 50 mΐ of protease inhibitor to each ml of sample (on top of frozen plasma) in a room temperature (RT) water bath. Will use 20 mis of pooled plasma, so 1100 mΐ inhibitor.

[00746] 2. To remove cell/debris, spin samples at 7500 xg 20min, 4 °C in the Ultracentrifuge.

[00747] 3. Collect the supernatant, pool and measure volume & record .

[00748] 4. Add an equal volume of 2X PBS, 6mM MgCE to the plasma.

[00749] 5. Label low-retention eppendorf tubes 1-96.

[00750] 6. Transfer 400m1 of each sample to eppendorf tubes based on appropriate tube map

[00751] 7. Using an electronic P200, add competitors: 8.6 mΐ of 40ng/pl Salmon sperm DNA; 8.6 mΐ of 40ng/pl tRNA; 8.6m1 of 0.5X SI.

[00752] 8. Incubate at RT with end over end rotation for 10 min.

[00753] 9. Add 10pL of appropriate oligo library, mix well. Save any leftover diluted library for gel control (see below).

[00754] 10. Incubate 1 hr at RT with end over end rotation. [00755] 11. Using an electronic repeat P100, add 187m1 of 20% PEG 8000 to sample for a final 6% concentration to the 435.5 mΐ of sample/oligo library. Invert a few times to mix and incubate for 15 min at 4 °C

[00756] 12. Spin each sample in table top centrifuge at 10,000 xg for 5 min.

[00757] 13. Remove supernatant and discard, add 1ml lx PBS, 3mM MgCE to pellet.

[00758] 14. Wash pellet by gentle inversion

[00759] 15. Remove buffer, re-suspend pellets in IOOmI IX PBS, 3mM MgCE: incubate at RT for 10 min on mixmate @ 900rpm to re-suspend. Make sure each sample is well re-suspended by pipetting.

[00760] 16. Pool all desthiobiotin library samples into one 50ml falcon tube, and the unlabeled library into another, total volume for each should be 4800m1.

[00761] 17. Take 10pL aliquot for the input into AP sample for gel (add 10 pL of 2x LDS buffer w/ 2X reducing agent.

[00762] Affinity Purification.

[00763] 18. Prepare 10pL of MyOne Strep-coated Magnetic beads per each condition into a 1.5 ml eppendorf tube and place on a magnetic bead rack. Have a Bead only control as well (n=3)

[00764] 19. Remove supernatant and wash IX 500m1 with Bead buffer.

[00765] 20. Discard supernatant

[00766] 21. Resuspend beads in an equal volume of IX PBS, 3mM MgC’f (equal vol to what was taken out originally = 10m1)

[00767] 22. Add the 10m1 of beads directly to the 4780pL from step 19. To Bead only control add

PBS.

[00768] 23. Incubate samples with streptavidin beads lhr RT on plate shaker (taped).

[00769] 24. Place on the large magnetic stand for 1 min and remove supernatant

[00770] 25. Add 1.5 mL of IX lysis buffer to the samples (do 3 X 500m1 with a good rinse of the 50mL falcon tube for each to collect all the beads) and transfer to a new set of eppendorf tubes.

[00771] 26. Incubate for 20 min on ice.

[00772] 27. Place tubes in magnetic bead rack, let equilibrate 1 min and remove the supernatant.

[00773] 28. Wash the beads with wash buffer #1 via vortexing. Resuspend well.

[00774] 29. Place tubes on magnetic bead rack, let equilibrate 1 min and remove the supernatant [00775] 30. Wash 2 additional times as with wash buffer # 1 steps 27-29 (total 3 washes with wash buffer #1)

[00776] 31. Repeat steps 27-29 (2) additional times with wash buffer #2

[00777] 32. Dining the last wash transfer beads to a new eppendorf tube (to reduce non-specific binding)

[00778] 33. Do one dry spin to make sure all residual wash buffer is removed.

[00779] 34. Add 10m1 of Biotin Elution buffer 1 to beads

[00780] 35. Incubate for 15 minutes at 37°C. [00781] 36. Place on magnetic stand for 1 min, collect sup and transfer to a new tube, add 10pL of 2X LDS, 2X Reducing agent to eluted sample. Save as Elution #1.

[00782] 37. Add 10m1 of IX LDS Sample Buffer, IX Reducing buffer to magnetic beads.

[00783] 38. Boil the samples for 15 min at 90 °C. The boiling time is 15 minutes to essure the streptavidin on the beads unfolds and releases the biotinylated aptapmer-protein complex.

[00784] 39. Place samples on magnetic stand on ice and collect the eluted sample. This is Elution #2. Discard the beads.

[00785] 40. Gel 1 layout:

[00786] Lane 1 : 5ng Desthiobiotin library

[00787] Lane 2: IX LDS

[00788] Lane 3: Marker

[00789] Lane 4: Desthiobiotin Elution #1

[00790] Lane 5: Unlabeled Elution #1

[00791] Lane 6: Bead only Elution #1

[00792] Lane 7: Desthiobiotin Elution #2

[00793] Lane 8: Unlabeled Elution #2

[00794] Lane 9: Bead only Elution #2

[00795] Lane 10: Input for AP (saved from step 17)

[00796] Running Reducing SDS gel:

[00797] Prepare IX MOPS SDS Running Buffer from 20X MOPS SDS Buffer

[00798] Use 10 or 12 well 4 -12 % Bis Tris gel

[00799] Peel off tape seal and place in the gel box. Insert spacer for second gel cassette if needed

[00800] Fill the inside/upper chamber with running buffer MOPS (IX) and 500ul Antioxidant

[00801] Remove the comb carefully, not disturbing the wells

[00802] Rinse the wells with the running buffer to remove the storage buffer which can interfere with sample running

[00803] Slowly load samples to each well carefully using L-20 tip

[00804] Fill the outer/lower chamber with approximately 600ml of running buffer MOPS (IX)

[00805] Place top portion of unit and secure correct electrodes

[00806] Run the gel to migrate proteins

[00807] 100 V constant for samples to move through stack (until all samples line up) for 15 min

[00808] Increase to 150 V constant for running (until visible sample buffer comes to bottom) for ~1 hr [00809] At the end of the run, stop the power supply and remove the gel cassettes from cell

[00810] Disassemble the gel cassette by with gel knife.

[00811] Remove one side of cassette case. Trim off the gel foot and wells (avoid drying gel).

[00812] Transfer gel into container fdled with Mill Q water and perform a quick wash.

[00813] Silver staining:

[00814] Materials : [00815] ProteoSilver TMSilver Stain Kit, Sigma Catalog No. PROT-SIL1, Lot No. SLBJ0252V

[00816] Ethanol, Fisher Scientific Catalog No. BP2818-4, Lot No. 142224

[00817] Acetic acid, Acros organics Catalog No. 14893-0025, Lot No. B0520036

[00818] Water, Sigma Catalog No. W4502, Lot No. RNBD1581

[00819] Preparation:

[00820] 1. Fixing solution. Add 50 ml of ethanol and 10 ml of acetic acid to 40 ml of ultrapure water.

[00821] 2. 30% Ethanol solution. Add 30 ml of ethanol to 70 ml of ultrapure water.

[00822] 3. Sensitizer solution. Add 1 ml of ProteoSilver Sensitizer to 99 ml of ultrapure water.The prepared solution should be used within 2 hours. A precipitate may form in the ProteoSilver Sensitizer. This precipitate will not affect the performance of the solution. Simply allow the precipitate to settle and remove 1 ml of the supernatant.

[00823] 4. Silver solution. Add 1 ml of ProteoSilver Silver Solution to 99 ml of ultrapure water. The prepared solution should be used within 2 hours.

[00824] 5. Developer solution. Add 5 ml ProteoSilver Developer 1 and 0.1 ml ProteoSilver Developer 2 to 95 ml of ultrapure water. The developer solution should be prepared immediately (<20 minutes) before use.

[00825] 6. All steps should be carried out in the hood and waste needs to be collected in toxic designated container.

[00826] Procedure

[00827] A. Direct Silver Staining

[00828]• All steps are carried out at room temperature on an orbital shaker at 60 to 70 rpm.

[00829] 1. Fixing - After electrophoresis of the proteins in the mini polyacrylamide gel, place the gel into a clean tray with 100 ml of the Fixing solution overnight in the hood. Cover tightly.

[00830] 2. Ethanol wash - Decant the Fixing solution and wash the gel for 10 minutes with 100 ml of the 30% Ethanol solution.

[00831] 3. Water wash - Decant the 30% Ethanol solution and wash the gel for 10 minutes with 200 ml of ultrapure water.

[00832] 4. Sensitization - Decant the water and incubate the gel for 10 minutes with 100 ml of the Sensitizer solution.

[00833] 5. Water wash - Decant the Sensitizer solution and wash the gel twice, each time for 10 minutes with 200 ml of ultrapure water.

[00834] 7. Silver equilibration - Decant the water and equilibrate the gel for 10 minutes with 100 ml of the Silver solution.

[00835] 8. Water wash - Decant the Silver solution and wash the gel for 1 to 1.5 minutes with 200 ml of ultrapure water.

[00836] 9. Gel development -Decant the water and develop the gel with 100 ml of the Developer solution. Development times of 3 to 7 minutes are sufficient to produce the desired staining intensity for most gels. Development times as long as 10 to 12 minutes may be required to detect bands or spots with very low protein concentrations (0.1 ng/mm2).

[00837] 10. Stop - Add 5 ml of the Proteo Silver Stop Solution to the developer solution to stop the developing reaction and incubate for 5 minutes. Bubbles of CO2 gas will form in the mixture.

[00838] 11. Storage - Decant the Developer/Stop solution and wash the gel for 15 minutes with 200 ml of ultrapure water. Store the gel in fresh, ultrapure water and take picture for documentation.

[00839] Protein identification

[00840] Protein bands of interest were excised from the gradient gels and subjected to liquid

chromatography -tandem mass spectrometry (LC -MS/MS) as above.

Example 12: Use of an oligonucleotide probe library to characterize Breast Cancer samples

[00841] An oligonucleotide probe library comprising approximately 2000 different probe sequences was constructed and used to probe approximately 500 individual breast cancer and non-cancer samples. The probe sequences were derived from different screening experiments and are listed herein in SEQ ID NOs 10-2921. The oligonucleotides listed in these tables were synthesized and pooled together. The samples were plasma samples from 212 breast cancer patients, 177 biospy confirmed non-cancer patients, and 117 normal control patients (self-reported as non-cancer). The plasma samples were contacted with the oligonucleotide probe library and microvesicles were isolated using PEG precipitation. Oligonucleotides that were recovered with the microvesicles were isolated. Next Generation Sequencing (Illumina HiSeq) was used to identify the isolated sequences for each sample.

[00842] Analysis of significance of difference identified 18 aptamers with p-values below 0.01 when compared Cancer/Normal, 15 aptamers with p-values below 0.001 when compared cancer/Non-Cancer,

28 aptamers with p-values below 0.001 when compared Non-Cancer/Normal.

[00843] Multi-oligonucleotide panels were next contracted using a cross-validation approach. Briefly, 50 samples were randomly withheld from the sample cohort. The performance of individual oligonucleotides to distinguish the remaining cancers and non-cancer/normals was determined using logistic regression methodology. Additional oligonucleotides were added iteratively and performance was assessed using logistic regression until further performance improvements were no longer obtained with additional oligonucleotides. The approach generally led to panels of approximately 20-100 different probe sequences. The contracted panels were then used to classify the 50 withheld samples and diagnostic performance was assessed using Receiver Operating Curve (ROC) analysis and estimation of the Area under the Curve (AUC).

[00844] In approximately 300 rounds of cross-validation, the average AUC was 0.6, thus showing that the average performance was statistically better than random (i.e., AUC of 0.5) and that the probe library could distinguish breast cancer and non-breast cancer/normal patient samples. AUC values as high as 0.8 were observed for particular cross validations. FIGs. 5A-B illustrate a model generated using a training (FIG. 5A) and test (FIG. 5B) set from a round of cross validation. The AUC was 0.803. Another exemplary round of cross-validation is shown in FIGs. 5C-D. The AUC was 0.678. [00845] The SEQ ID NOs. of the sequences used in the model in FIGs. 5A-B are listed in rank in Table 7. The oligonucleotides were synthesized with a 5’ region consisting of the sequence (5 ' - CTAGCATGACTGCAGTACGT (SEQ ID NO. 4)) and a 3’ region consisting of the sequence (5 ' - CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5)) flanking the variable regions.

Table 7: Oligonucleotide Probe Variable Regions

[00846] The data presented in this Example demonstrate that an oligonucleotide pool comprising members having the variable regions listed in SEQ ID NOs 10-2921, e.g., a pool of probes having the variable regions listed in Table 7, can be used to distinguish plasma from individuals having breast cancer versus plasma from non-breast cancer individuals.

Example 13: Single stranded DNA (ssDNA) oligonucleotide library preparation for library development

[00847] The preparation of high yield and high quality ssDNA libraries is a critical step in SELEX (Systematic Evolution of Ligands by Exponential enrichment) [1, 2] as well as in other biological applications, such as DNA chips and microarrays [3], and single-stranded conformation polymorphism technique (SSCP) [4] The standard approach for preparing ssDNA libraries includes PCR amplification to first generate a double stranded (dsDNA) library, followed by ssDNA separation and purification. Several strategies of ssDNA preparation have been developed to date, each with advantages and disadvantages:

[00848] Lambda exonuclease digestion [2, 5-7]

[00849] The dsDNA standard PCR product is followed by Lambda exonuclease to digest the

complementary strand and leave the target ssDNA. ssDNA purification is then performed to remove enzymes and unwanted buffer.

[00850] Advantages. Regular PCR amplification has high yield in generating dsDNA.

[00851] Disadvantages: The purity of final ssDNA is limited by enzyme digestion efficiency. Also dsDNA needs to be purified prior to digestion, together with post-digestion purification there will be two purifications, which results in substantial loss of input material. The digestion usually requires at least 2 hours. The digestion rate may not be consistent.

[00852] Asymmetric PCR [8, 9]

[00853] The procedure generates target ssDNA as the main product and less dsDNA products and non target ssDNA. The band corresponding to the target ssDNA is cut from a native gel.

[00854] Advantages. The final ssDNA product potentially has high purity. [00855] Disadvantages: Separation of strands is possible in the native gel, but the yield is typically low and the presence of non-target strand cannot be excluded. The yield cannot be increased on denaturing gel because the strands have the same length.

[00856] Biotin-streptavidin magnetic beads separation [10, 11]

[00857] The non-target PCR primer is biotinylated so final PCR products are Biotinylated-dsDNA, which can be captured by streptavidin magnetic beads and denatured to release the non-biotin labeled target ssDNA.

[00858] Advantages. The final ssDNA product has relatively high purity.

[00859 ] Disadvantages: In most cases, the input library needs to be biotinylated, but it may be difficult to replace or release the captured target strands from streptavidin beads. Post-denaturing purification is required to remove NaOH and/or acid used for neutralization.

[00860] Unequal primer length PCR [12]

[00861] The non-target PCR primer has a chemical modified spacer and a few extra nucleotides following. In the PCR reaction, the DNA polymerase will stop at the spacer, resulting in unequal length of PCR dsDNA product. Then target ssDNA can be cut from a denaturing PAGE gel.

[00862 ] Advantages: The final ssDNA product has high purity because the target ssDNA is not mixed with non-target strands.

[00863 ] Disadvantages: ssDNA cannot be seen on native gel. Requires time consuming denaturing PAGE gel. It may be difficult to denature some dsDNA library, which can limit the final yield.

[00864] Indirect purification method [13]

[00865] The indirect purification strategy combines Asymmetric PCR and Biotin-streptavidin magnetic beads separation. In short, regular PCR is used to generate sufficient template, then asymmetric PCR with excess of target primer and less biotinylated complementary primers, followed by biotin-streptavidin separation.

[00866 ] Advantages: May increase yield and purity of ssDNA product.

[00867 ] Disadvantages: It cannot produce biotinylated target ssDNA library. The process is relatively long and complicated and may be prone to generate mutants of the original sequence.

[00868] The invention provides methods of enriching oligonucleotide probe libraries against a target of interest. As the probes comprise ssDNA, the process may comprise PCR amplification then conversion back into ssDNA after each round of enrichment. In this Example, we developed a strategy for preparation of a ssDNA oligonucleotide library. The goals were to develop a process that is efficient and quick, while delivering high quality /purity ssDNA. We aimed to combine PCR and ssDNA prep in one step, remain efficient in the presence of selection buffer, target molecules, other sample components (e.g., highly abundant proteins for plasma samples) and other assay components (e.g., PEG precipitation solution that may be used to precipitate microvesicles). In addition, we desired the method to be able to generate ssDNA library with any modification, including without limitation Biotin.

[00869] We have used an optimized version of Lambda exonuclease digestion protocol for preparation of ssDNA oligonucleotide library. However, the digestion yield limits the overall recovery and is not consistent between different library preparations. In some cases, the ssDNA band is hardly visible on the gel following digestion. We have also observed incomplete digestion of dsDNA in the ssDNA product. In this Example, we developed an alternative protocol, termed“ssDNA by Unequal length PRimer

Asymmetric PCR,” or SUPRA. It lacks disadvantages from the known methods listed above, and provides high quality and yield up to lOx higher yield of ssDNA oligonucleotide library as compared to the previous methods. It is relatively fast and convenient technically, since target ssDNA can be distinguished from non-target DNA on a gel.

[00870] A schematic comparing standard PCR 700 and unequal length PCR 710 is shown in FIG. 7A. In regular PCR 700, a formard primer 701 and reverse primer 703 are hybridized with the reverse strand of an aptamer library 702. The PCR reaction is performed, thereby creating equal length forward 704 and reverse strands 702. The strands are denatured in equal length single strands 705. In unequal length PCR 701, a formard primer 711 having a lengthener segment and terminator segment and a reverse primer 713 are hybridized with the reverse strand of an aptamer library 712. The PCR reaction is performed, thereby creating unequal length forward 714 and reverse strands 712. The strands are denatured into unequal length single strands 714 and 712 that can be separated by size, e.g., on a denaturing gel.

[00871] The steps of SUPRA include: (i) Modification of regular non-target primer with two Isp9 (Internal Spacer 9; triethylene glycol spacer) as terminator and 32 extra nucleotides (e.g., poly-A) as lengthener. It is referred as Unequal-Forward-Double isp9 primer (UF-D9); (ii) Perform asymmetric PCR, by mixing DNA template, UF-D9 and regular target (reverse) primer at ratio that favors the reverse primer, e.g., 1:37.5. The PCR program has longer elongation step (e.g., 3 min instead of standard 1 min) and more cycles due to linear amplification mode (instead of exponential). The PCR product contains a majority of target ssDNA and small portion of dsDNA. (iii) Mix PCR reaction products 1 : 1 with denaturing buffer (e.g., 180 mM NaOH and 6 mM EDTA) and denature samples by heating (e.g., 70°C for 10 min) and cooling (e.g., incubation on ice for 3 min); (iv) Run denatured products in denaturing buffer on an agarose gel stained with SybrGold. The non-target strand, which is longer due to the lengthener, will appear as upper band (if visible) and the target strand (strong lower band) is cut and purified. The process can include optional steps, including without limitation: (v) Weigh the gel pieces and purify ssDNA from the gel pieces (e.g., using the ssDNA Nucleospin kit or the like); (vi) quantification of the yield and native gel can be used to check the purity and yield of final product (e.g., using the ssDNA Qubit kit or the like).

[00872] The first step (i) uses a specific design of the forward primer with efficient terminator and lengthener, which creates non-target strand of unequal length. The DNA polymerase used to build the target strand will stop polymerization once it reaches the terminator, and the lengthener facilitates differentiation between the target and non-target strands. In the second step (ii), the ratio between the two primers is shifted toward the reverse primer, to produce a majority of target ssDNA. The ratio, however, should not limit double strand templates production to keep reaction running. FIG. 7B is a gel showing titration of forward and reverse primers input in asymmetrical PCR. The optimal condition, at which target strand is clearly visible, is in the range 1 :20-l :50 F:R primers ratio. As shown in the figure, the ratio between two primers in asymmetric PCR can affect dsDNA and ssDNA amount in final products. The PCR thermocycler program is also adjusted to provide efficiency in the asymmetric PCR. In the third step (iii), a reliable denaturing method is used to separate target ssDNA to ensure the final yield and high purity.

[00873] As desired, the final step (vi) estimates the ratio of residual dsDNA, e.g., using ssDNA Qubit kit. In cases where the yield is not critical, the denaturing steps (iii and iv) can be skipped and the PCR products can be directly run on native gel. There will be a dsDNA band, but lower MW target ssDNA band can be distinguished and purified from gel. This is also a way to visualize the target band directly after PCR for a quality check or purification without denaturing. The purity of final product will be the same but yield will be lower.

[00874] A comparison of native versus denatured gel purification is shown in FIG. 79C. A post-probing oligonucleotide probe library was PCRed using unequal length primers mixed at a ratio of 1 :38

(Forward/Reverse). In the figure, the left lane on each gel is a 50 bp molecular weight ladder and the lower band is the reverse primer. The positions of the dsDNA and ss DNA are indicated. A native gel showed the presence of both dsDNA and ssDNA (target strand) (FIG. 7C, panel A). Here, part of the target reverse strand is migrating in dsDNA. Thus, using the native gel, one can purify target ssDNA with moderate recovery. When a higher yield is desired, the PCR products can be run on denaturing agarose gel as described above. This approach provides maximal recovery wherein only target strand is visible, and can be cut from gel and purified (FIG. 7C, panel B). In this case, the reverse strand ssDNA, which is part of the dsDNA on native gel (FIG. 7C, panel A), is denatured and migrates together with other free molecules of target ssDNA strand, while forward strand becomes invisible due to limited amplification.

[00875] Compared to standard asymmetric PCR, which has relatively low yield and does not allow to distinguish target and non-target strands on denaturing gel, SUPRA delivers different lengths of target and non-target that can be purified on both native gel and denaturing gels. Compared to unequal primer length PCR, which uses lengthy Urea-PAGE protocol and produces only dsDNA, SUPRA has less dsDNA and free target ssDNA can be cut even from native gel if yield is not critical.

[00876] SUPRA has been used in the oligonucleotide probe library enrichment methods provided by the invention. The method is robust. In the presence of enrichment buffer, target/non-target molecules, proteins, exosomes/microvesicles, PEG and other components, SUPRA provides high quality and quantity of the ssDNA oligonucleotide library.

[00877] References.

[00878] 1. Comparison of different methods for generation of single-stranded DNA for SELEX processes. Anal. Bioanal. Chem. 2012, 404, 835-842.

[00879] 2. Upgrading SELEX Technology by Using Lambda Exonuclease Diogestion for Single-Straded DNA Generation. Molecules 2010, 15, 1-11.

[00880] 3. Tang, K.; Fu, D.J.; Julien, D.; Braun, A.; Cantor, C.R.; Koster, H. Chip-based genotyping by mass spectrometry. Proc. Natl. Acad. Sci. USA 1999, 96, 10016-10020. [00881] 4. Kuypers, A.W.; Linssen, P.C.; Willems, P.M.; Mensink, E.J. On-line melting of double- stranded DNA for analysis of single-stranded DNA using capillary electrophoresis. J. Chromatogr. B Biomed. Appl. 1996, 675, 205-211.

[00882] 5. Higuchi, R.G.; Ochman, H. Production of single-stranded DNA templates by exonuclease digestion following the polymerase chain reaction. Nucleic Acids Res. 1989, 17, 5865.

[00883] 6. Jones, L.A.; Clancy, L.E.; Rawlinson, W.D.; White, P.A. High-affinity aptamers to subtype 3a hepatitis C virus polymerase display genotypic specificity. Antimicrob. Agents Chemother. 2006, 50, 3019-3027.

[00884] 7. S. S. Oh, K. Ahmads, M. Cho, Y. Xiao, H. T. Soh,“Rapid, Efficient Aptamer Generation: Kinetic -Challenge Microfluidic SELEX,” presented in the 12th Annual UC Systemwide Bioengineering Symposium, Jun. 13-15, 2011, Santa Barbara, U.S.A

[00885] 8. Gyllensten, U.B.; Erlich, H.A. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc. Natl. Acad. Sci. USA 1988, 85, 7652-7656.

[00886] 9. Wu, L.; Curran, J.F. An allosteric synthetic DNA. Nucleic Acids Res. 1999, 27, 1512-1516.

[00887] 10. Espelund, M.; Stacy, R.A.; Jakobsen, K.S. A simple method for generating single-stranded DNA probes labeled to high activities. Nucleic Acids Res. 1990, 18, 6157-6158.

[00888] 11. A. Paul, M. Avci-Adali, G. Ziemer, H.P. Wendel. Streptavidin-coated magnetic beads for DNA strand separation implicate a multitude of problems during cell-SELEX. Oligonucleotides 2009, 19, 243-254.

[00889] 12. Williams K., Bartel D. PCR product with strands of unequal length. Nucleic Acids Research, 1995, Vol. 23, No. 20.

[00890] 13. Indirect purification method provides high yield and quality ssDNA sublibrary for potential aptamer selection. Anal. Biochem. 2015, online available.

Example 14: Poly-ligand profiling identifies molecular signatures related to patient outcomes in the MAESTRO study

[00891] This Example presents development and validation of a poly-ligand profiling (PLP, also referred to as poly -ligand histochemistry or PHC herein) assay that identifies patients based on their response to treatments in the MAESTRO clinical trial (Clinical Trial NCT01746979;

clinicaltrials.gov/ct2/show/NCT01746979). Despite significant advances in companion diagnostics, new analytical platforms are needed to fully realize the promise of precision medicine, most notably in the ability to more reliably predict clinical outcomes and properly identify therapeutic regimens best suited for individual patients. The poly -ligand profiling (PLP) assay presented here identifies differences in pancreatic cancer patients based on their response to the investigational intervention tested in a phase 3 clinical trial, specifically the phase 3 MAESTRO study.

[00892] Poly -ligand profiling (PLP) enables development of tests capable of assessing the molecular networks that underlie response to various therapies, including without limitation anti-cancer therapy. See (7, 8); Int’l Patent Publications WO/2016/145128, published 9/15/2016 (based on Int’l Patent Appl. PCT/US 16/21632, filed 3/9/2016) and WO/2017/161357, published 9/21/2017 (based on Inf 1 Patent Appl. PCT/US 17/23108, filed 3/18/2017); all of which references are incorporated by reference herein in their entirety. In this Example, we developed a PLP library using pre-treatment pancreatic tumor specimens from the unsuccessful MAESTRO study and, based on results from a blinded test set, performed 1,000 simulated trials on only PLP -positive patients. Prospective PLP based enrollment predicts an average difference in median overall survival (OS) between arms of 2.4 months, a 70% improvement compared to the observed MAESTRO results. Using only data from primary tumor samples, simulations predict an average difference in median OS of 3.3 months, a 125% improvement compared to MAESTRO. High-resolution mass-spectrometry of proteins bound by the PLP-library identified 14 known pancreatic cancer markers implicated in tumor hypoxia or gemcitabine efficacy. Our data show that PLP can differentiate patient populations by capturing molecular features underlying the efficacy of anti-cancer therapies, in this case of gemcitabine or evofosfamide in pancreatic cancer.

[00893] Introduction

[00894] Molecular biomarkers that assess one or a few predictive targets have found success in various settings of anti-cancer drug treatment, but the vast majority of patients have cancers that do not express such singular or few markers which could inform treatment decisions or assignment into a trial arm. This poses a serious obstacle in the development of new anti-cancer drugs or therapeutic regimen. Predicting responses to any given therapeutic regimen for treating cancer and for designing clinical trials remains difficult due to multiple factors such as cancer type, tumor heterogeneity, disease stage and health status (1,2). These factors and others contribute to the high failure rate of clinical trials and poor outcomes for most cancer patients. Success rates for investigational cancer drugs rarely exceeded 40% in randomized controlled pivotal clinical trials between 2006 and 2015 (3-5). This success rate may be improved by surrogate companion diagnostic (CDx) tests that can assess the enormous level of molecular complexity and dynamic interactome in tumors that influence response to therapy (6). Use of such CDx prior to trial may not only guide more precise therapeutic decision-making but also the design of any anti-cancer drug trial. An ideal CDx may comprise a large number of potential detector molecules that together are able to identify differences in the complex system states of tumors in a given cohort of patients, a criterion that is addressed by a technology called Poly -Ligand Profiling (PLP) (7,8). PLP exploits the diversity of highly complex single-stranded (ss)DNA libraries and their ability to potentially interact with molecular features in the tumor sample including DNA, miRNA, other RNA targets, protein, and protein complexes (9-11). The poly-ligand nature of this approach enables the simultaneous detection of an unprecedented number of molecular features across a wide range of biological specimens including plasma exosomes (7, Inf 1 Patent Publications WO/2016/145128, published 9/15/2016 (based on Inf 1 Patent Appl.

PCT/US16/21632, filed 3/9/2016) and formalin-fixed paraffin-embedded (LPPE) tissues (8,

WO/2017/161357, published 9/21/2017 (based on Inf 1 Patent Appl. PCT/US 17/23108, filed 3/18/2017)).

[00895] As described further herein, the first step of PLP is to convert random unbiased libraries of synthetic, single stranded oligodeoxynucleotides (ssODN), e.g., comprised of > 4x10 ¹² individual species, into a more specific library capable of preferentially recognizing molecular phenotypes of interest. We typically refer to this conversion process as“enrichment,” during which these libraries are subjected to several rounds of positive binding and counter binding directly on clinical specimens representing the different phenotypes of interest (e.g. treatment benefit versus lack of benefit). Since only subsets of sequences will bind the molecular targets, every round of binding will reduce the number of unique sequences in the library at the same time increasing the number of counts for binding sequences. Such refining process yields“enriched” libraries of far lower complexities that preferentially bind to specimens representing the target phenotype.

[00896] In this Example, we investigated how PLP would have affected the outcome of an unsuccessful clinical trial if patients had been assigned into trial arms based of their PLP test status. A recent example for such a trial is the international randomized, double -blinded phase III trial in locally advanced or metastatic pancreatic cancer (MAESTRO; NCTO 1746979) that compared gemcitabine monotherapy (G) to gemcitabine plus evofosfamide (GE). Evofosfamide was designed as a prodrug that becomes selectively activated under hypoxic conditions commonly found within pancreatic and other tumors. Tumor hypoxia is the situation where tumor cells have been deprived of oxygen. As a tumor grows, it rapidly outgrows its blood supply, leaving portions of the tumor with regions where the oxygen concentration is significantly lower than in healthy tissues. Hypoxic microenvironements in solid tumors are a result of available oxygen being consumed within 70 to 150 pm of tumor vasculature by rapidly proliferating tumor cells thus limiting the amount of oxygen available to diffuse further into the tumor tissue. The pivotal MAESTRO study showed clear evidence of clinical activity but nonetheless failed to meet the primary endpoint of 33% increase in median overall survival (OS) (12). MAESTRO was conducted without molecular selection of biomarkers or measmements of tumor hypoxia, the assessment of which is far from routine (13). Given the complex mechanism of action of evofosfamide and the complex and heterogeneous nature of cancer (14,15), a CDx signatme may have been beneficial. We used PLP to identify distinguishing features in the tumor molecular interactomes and systems states associated with patient outcomes in MAESTRO (16).

[00897] In this Example, we report the development and performance of a PLP assay using FFPE tumor specimens from patients enrolled in the MAESTRO study and demonstrate the use of PLP to

prospectively stratify patients for treatment with either G or GE. We show that a prospective trial enrolling PLP -positive pancreatic cancer patients would have reached statistical significance with improvement in difference in median OS between treatment arms. PLP performance further improved when focused on patients whose tissue specimens originated from primary tumors. To understand the molecular underpinnings driving the performance of PLP, we performed target identification using high- resolution mass-spectrometry. Most of the proteins reliably identified in PLP -negative cases have been reported to be involved in hypoxia and overexpressed in pancreatic cancer tumor, compared to normal pancreatic tissue. Moreover, half of the identified proteins have been implicated in gemcitabine resistance. These findings demonstrate that PLP provides an approach to advance precision medicine for patient care and for increasing the success rates of clinical trials.

[00898] Results [00899] Experimental Design and Library Enrichment

[00900] The study design is outlined in FIG. 11. We analyzed data from the MAESTRO trial including de-identified patient characteristics, clinical outcomes and sample availability for all 693 enrolled patients 1101. Of these, 323 cases had available unstained FFPE specimens. Hematoxylin and eosin (H&E) stained tissue sections from each case were evaluated by a board-certified pathologist; 192 cases qualified for our study based on physical condition of the preserved tissue, sufficient tumor cellularity, and identifiable adjacent tissue for confirmation of metastatic lesions 1102. Outcome results for 20 samples from GE cases were un-blinded and used for enrichment of the ssODN libraries 1103. We initially set up enrichments for 9 libraries on individual GE cases (see Materials and Methods below, Table 8, FIG. 15), four of which were enriched, or trained, to bind to specimens from patients with more favorable outcomes (“benefiters”; B, OS > 13 months; also referred to as“responders” or“R”) and 5 were enriched to bind to specimens from patients who responded poorly (“non-benefiters”; NB, OS < 7 months; also referred to as“non-responders” or“NR”). After six rounds of enrichment (FIG. 15) libraries were evaluated by next-generation sequencing (NGS). Comparison of the copy numbers for unique sequences in every library showed that one library (EvNR2-Rd6) had individual ssODNs with copies exceeding 1000 counts (FIG. 16A). Thus, library EvNR2-Rd6, which had been enriched against NB cases, was selected as a lead library and subjected to two additional rounds of positive selection on 2 alternative NB cases (FIG. 15). NGS showed further maturation of this library (EvNR2-Rd8) evidenced by increased copy numbers of a subset of individual ssODNs and reduced complexity to approximately one million species (FIG. 16B).

Table 8: Case assignment for the enrichment of 9 ssODN libraries

[00901] As noted, EvNR2-Rd8 was reduced to to approximately one million ssODN species. The 100,000 sequences with the most counts are provided herein in SEQ ID NOs. 2922-102921. The sequences are ordered by count within the sequence listing. For example, the SEQ ID NOs., sequence and counts for the 100 most abundant sequences are listed in Table 9. The sequences in Table 9 are the variable region sequences of the aptamers as described in the Materials and Methods below. In some cases, the variable region sequences have random insertions or deletions that may have been introduced during amplification, or additions of 1-4 bases to enhance diversity. See Materials and Methods.

Table 9: Most abundant sequences library EvNR2-Rd8

[00902] Poly-Ligand Profiling

[00903] Library EvNR2-Rd8 was designed to preferentially bind to FFPE specimens from NB cases and was used for poly-ligand profding (Materials and Methods; reference 8) of 12 un-blinded cases. A board-certified pathologist, who was blinded to clinical outcomes and whether the specimen was stained with EvNR2-Rd8 or a“no library” control, evaluated these specimens and provided raw nuclear and cytoplasmic scores (percent positive tumor cells at each level of staining intensity from 0 to 3+; see Table 10, FIG. 17), as reported previously (8). The“no library” controls consistently resulted in negligible background staining. In contrast, EvNR2-Rd8 exhibited selective staining of specimens from NB cases (10-107 days OS) compared to B cases (240-369 days OS) (FIG. 17, Table 10). The most pronounced difference in staining between B and NB specimens was localized to tumor cell nuclei. Specifically, five of seven B cases showed approximately >70% of pancreatic cancer cells with“0” nuclear staining intensity (No), while four of five NB cases showed <30% of pancreatic cells with No. As described above, OS and PLP cut-points were locked prior to assessment of the remaining 172 blinded samples from patients treated with either GE or G (FIG. 11). Each case in the blinded test set was subjected to PLP and scored as described above.

Table 10: Staining scores for the 12 cases in the training set

[00904] Assay Performance and Statistical Modeling

[00905] After PLP and scoring of the blinded test set (n=172), the data were un-blinded to assess assay performance on specimens from both treatment arms (FIG. 12). In PLP -positive GE-treated cases the median overall survival 37 days compared to 18 days in the total population (FIGs. 12A-B). Although this small test set was insufficient to establish statistical significance, the positive trend indicated that a significant relationship between PLP score and outcome could be revealed when modeled onto the full intention-to-treat (ITT) population (n=693). Further analysis revealed that assay performance was primarily driven by the difference between PLP scores in the G treatment arm (FIGs. 12C and D).

Sensitivities and specificities were 52.8% and 47.0%, respectively, for the GE arm, and 40.0% and 41.2%, respectively, for the G arm. One case (OS=233) was removed from the sensitivity and specificity calculations as short censored. Similar analysis was performed for all cohorts using progression-free survival (PFS) as the end point (FIG. 18).

[00906] To assess the impact of PLP on a projected patient population in a modified study in which only PLP-positive patients would be enrolled, we modeled these performance metrics onto the full MAESTRO ITT dataset using 1,000 trials simulated from the known MAESTRO values (see Materials and

Methods). Hazard ratios (HR) in the simulated trials ranged from 0.62-0.83 (0.84 in MAESTRO, FIG. 13A) and 96.9% of the simulations yielded log-rank p < 0.05 (p=0.053 in MAESTRO). The mean HR of 0.72 (SD: 0.68-0.75) was a 14.9% reduction from MAESTRO. The simulations projected that the median OS for patients in the GE arm range from 1.6-3.5 months greater than that for those in the G arm (FIG. 13A), corresponding to increases of 23.2-58% (FIG. 19A), whereas in MAESTRO the difference in median OS was 1.3 months (17.4%). See Table 11; note that time is shown in days in the table. In the simulations, the average median OS in the GE arm was 8.8 months (SD: 8.5 -9.0 months) compared with 6.4 months (SD: 6.1-6.6 months) in the G arm (FIG. 19B). The average simulation yielded a median OS benefit of 2.4 months (SD: 2.0-2.7 months) for GE over G, a 70% increase over the benefit reported in MAESTRO (Table 11). KM plots from the original MAESTRO study (FIG. 13C) were compared to a representative KM plot from the simulations (FIG. 13D). For the latter, we selected a simulation with an HR of 0.72 since it was the mean HR of the 1,000 normally distributed simulated trials (FIG. 13B). Simulations with the minimum and maximum HR are shown in FIGs. 20A and B, respectively. For each simulation, we also recorded the PFS of the projected PLP-positive patients. We show corresponding figures for PFS data in FIGs. 21, 22A-B, and 23A-B.

Table 11: Summary of the median OS increase in blinded set and in 1,000 trials based on PLP library performance compared to MAESTRO

[00907] Since EvNR2-Rd8 included training for 6 rounds on FFPE specimens from primary tumors (Table 8), we separately evaluated primary (n=122) and metastatic specimens (n=49) from the blinded test set. One sample lacking information on its site of collection was excluded. We observed substantially greater performance for the primary tumor subset compared to the metastatic tumor subset (sensitivity and specificity of 61.5% and 46.2%, respectively, for the GE arm, and 38.5% and 36.7%, respectively, for the G arm). Trial simulations using these metrics projected HRs of 0.55-0.73 with 100% of the simulations reaching statistical significance (FIG. 14A). The average HR of 0.63 (SD: 0.60-0.66) corresponds to a decrease of 24.9% from MAESTRO, and the median OS for GE patients of 2.4-4.3 months (FIG. 14B), corresponds to 36.6-75.1% increase over that for G patients (FIGs. 19C-D). The average OS benefit of 3.3 months (SD: 3.0-3.6 months) represents an increase in 125% of the value reported in MAESTRO (Table 11). In contrast, within the metastatic subset, PLP had negligible impact. Sensitivity and specificity were 30.0% and 50.0%, respectively, for the GE arm, and 40.0% and 47.6%, respectively, for the G arm. The resulting trial simulations showed HRs from 0.81-1.2 (FIG. 14D) and none of the 1,000 simulated trials yielded log-rank p < 0.05. The median OS for GE patients ranged from a 1.4 month decrease to a 1.1 month increase (FIG. 14E) compared for G patients, or changes in median OS of -20- 18.5% (FIGs. 19E-F). HRs ranged from 0.81-1.2 (FIGs. 14D-E). FIG. 14C and F show representative KM plots for simulations using performance metrics from the primary and metastatic subsets respectively (compare to full test set in FIG. 13D). FIG. 20 shows KM curves for the simulations with the smallest and largest HR primary tumor subset (FIGs. 20C-D), and metastatic tumor subset (FIGs. 20E-F). Results of the simulations with PFS as the endpoint using the primary and metastatic blinded test sets are shown in FIGs. 24, 22C-F and 23C-F [00908 \Identiflcation of the molecular targets of enriched library EvNR2-Rd8

[00909] Because the enriched PLP library EvNR2-Rd8 consists of several hundred thousand of single- stranded (ss)DNA sequences and aptamers that can interact with molecular features in the tumor sample, including but not limited to proteins and protein complexes, we next sought to identify targets that interact with the EvNR2-Rd8 library. Five NB cases were selected for target identification with EvNR2-Rd8 based on their relatively high staining intensities (see Materials and Methods; FIG. 27). This sample selection criterion was used to increase the likelihood for reliable recovery and identification of the protein targets. Candidate proteins detected by mass spectrometry were accepted if identified at levels with <0.7% FDR, with a fold change at least 1.2 or greater for the enriched library over the negative controls, and with the requirement that the protein target was identified in at least two of the tested cases. In this analysis, 17 proteins passed these criteria, 14 of which we identified as having been reported as overexpressed in pancreatic cancer (Table 12).

Table 12: Molecular Targets of NB Enriched Library EvNR2-Rd8

[00910] Among these 14 pancreatic cancer markers in Table 12, 7 have been associated with resistance to gemcitabine: annexin A2 (ANXA2), tissue transglutaminase (TGM2), pyruvate kinase (PKM), heat shock protein beta- 1 (HSPB1), collagen alpha-3 (COL6A3), glyceraldehyde-3 -phosphate dehydrogenase (GAPDH), histone H3 (HIST1H3A). Most of the identified proteins were also associated with the hypoxia status of cancer tissues (Table 12). ANXA2 has been reported as a potential biomarker for gemcitabine resistance (17), based on the observation that ANXA2 increases NF-kB activity which is linked to chemoresistance of pancreatic carcinoma cell lines (18). Conversely, TGM2 knock-down by siRNA has been shown to decrease NF-kB activity and expression of its downstream target gene, and to increase gemcitabine sensitivity in drug-resistant pancreatic ductal adenocarcinoma (PD AC) cells (19).

[00911] Alternative splicing of PKM promotes gemcitabine resistance in pancreatic cancer cells (20), most likely by boosting glycolysis-fueled proliferation. Knock-down of HSPB1 restores sensitivity to gemcitabine, furthermore, increased expression of HSPB1 in triatic cancer specimens has been associated with decreased gemcitabine sensitivity (21). COL6A3 has been described as a potent promoter of chemo resistance (22) and can associate with collagen type I, which allows PD AC cells to override checkpoint arrest induced by gemcitabine (23). GAPDH has been reported to bind telomeric DNA directly in vitro and to protect telomeres against rapid degradation in response to gemcitabine (24). The potential role of histone H3 in gemcitabine resistance was reported in three pancreatic cancer cell lines that became sensitized to chemotherapy upon treatment with the histone deacetylase inhibitor CG200745, combined with gemcitabine and erlotinib. CG200745 induced the expression of apoptotic proteins (PARP and caspase-3) and increased the levels of acetylated histone H3, which indicates that de-acetylation of histone H3 may contribute to gemcitabine resistance (25).

[00912] In order to verily the expression of several of these candidate target proteins, we performed immunohistochemistry staining (IHC) (FIG. 25A-P). IHC was performed using antibodies directed at PKM1, PKM2, HSPB1, COL6A3, RPS14, GAPDH, ANX1, TUBA1B, EPO, ANX2, ACTB, TGM2 were used to verify the library hits in pancreatic 4 cancer cases. Most of the IHC results verified the expression and reported subcellular localization. Some antibodies were case specific (HSPB1, ANX1) or not informative (TUBA1B, EPO and TGM2). Without being bound by theory, these observations could be a characteristic of the particular antibody clone chosen in our experiments. Overall, the majority of the targets pulled down by EvNR2-Rd8 were confirmed by IHC.

[00913] Without being bound by theory, the ssODN library may associate with lower abundance proteins in quantities close to the detection limit of the mass spectrometer. To capture additional potentially interesting protein targets which might not be consistently detected in binding replicates, an alternative analysis was performed. With this alternate analysis, the same protein identification criteria of at least 2 unique peptides per protein and the low FDR was used as stated above. However identifications were accepted if the target was present in at least one of the biological replicates (Table 13). In Table 13, column“Accession” refers to the protein identifier (e.g., see uniprot.org), column“Gene” is a commonly used gene identifier as used in standard biological databases (e.g., see genenames.org), column“FC No lib” is the fold change compared to the level observed using a no aptamer library control, and column“FC R0” is the fold change compared to the unenriched library control. A fold-change of“n.d.” signifies that the protein was essentially undetected in the control. With this analysis, a total of 227 proteins were identified among all five NB cases, 29 of these were identified in at least 2 NB cases, and 2 proteins identified in at least 3 NB cases. Nine of the identified proteins matched with the list of proteins overexpressed in pancreatic cancer from the analysis above (including ACTB, COL6A3, HBB, HIST1H2AG, HIST1H2BK, HSPB1, PKM, and RPS14), three of which are with the reported association of gemcitabine resistance (COL6A3, HSPB1, and PKM). Additional targets described with roles in gemcitabine resistance were also identified.

Table 13: Molecular Targets of NB Enriched Library EvNR2-Rd8

[00914] Discussion

[00915] We used the MAESTRO study as an example of an unsuccessful clinical trial to investigate how the enrollment of patients into trial arms based on their PLP-status (i.e., PLP-positive or PLP -negative) would have affected the primary endpoint of the trial. MAESTRO enrolled patients with locally advanced or metastatic pancreatic cancer without any selection biomarkers. Like many randomized trials without biomarkers, MAESTRO missed its primary endpoint despite revealing evidence of clinical activity in the test (GE) arm (12). In this Example, we also performed a retrospective (hypothesis-generating) analysis to identify potential biomarkers for R and NR phenotypes.

[00916] We have demonstrated that PLP effectively classified classified patients according to their relative benefit from GE treatment (FIG. 12, FIG. 17, Table 10). We note that the difference in median OS between the GE arm and the G arm regardless of PLP status in our blinded test set was substantially lower than those observed in MAESTRO (7.6% and 17.4%, respectively; see Table 11). In other words, in the case of MAESTRO the test set was poorly representative of the full intent-to-treat cohort (FIG. 12 and FIG. 13C). Importantly, there was no selection bias in our test set which was conducted on all available samples that met standard pathology criteria. In addition, we were fully blinded to outcomes. Despite this fact, the PLP-positive cohort (n=88) showed a 100% increase in median OS (FIG. 12) compared to the full test set (PLP-positive and -negative, n=172) (FIG. 12). This performance was sufficient for further extrapolation to the ITT MAESTRO patients.

[00917] Simulated trials using locked assay performance metrics (staining score and OS cut-offs) and PLP-positive prevalence (51%) from the test set showed that if PLP-positive had been enrolled in MAESTRO (12), the study would likely have shown an average median increase in OS of 2.4 months (34.7% increase) for the GE arm versus the G monotherapy arm (FIG. 13B, FIG. 20A). The average projected HR was 0.72 (SD: 0.68-0.75, FIG. 13A) with 96.7% of simulations reaching statistical significance (log-rank p < 0.05). This represents a significant improvement (70%) over the MAESTRO trial results (median increase in OS 1.3 months, 17.4% increase in benefit; HR: 0.84; log-rank p = 0.053).

[00918] When sensitivities and specificities derived specifically from primary tumor specimens were used in the simulated trials, the average median OS for GE increased to by 3.3 months 46.9% over G (SD: 3.0- 3.6 months, 48.6-61.2%; FIG. 14B, FIG. 20C) with a mean HR of 0.63 (SD: 0.60-0.66, FIG. 14A), and a maximum projected log-rank p = 0.008. The underlying reasons for superior performance on primary tumor specimens (FIGs. 14D-F) are not currently understood and warrant further study. Within the primary tumor subset PLP -positivity was associated with both a favorable response to GE and an unfavorable response to G. The ability to identify non-benefiters to G remained intact in the full blinded test set, however our predictive power for GE benefit was compromised (8.7% decrease in sensitivity), which is likely noise observed from the metastatic samples (FIG. 20E).

[00919] Using cancer tissue derived from NB cases in immunoprecipitation experiments (also referred to as pulldown experiments herein) with the PLP library, 17 proteins were identified, 14 of which were previously reported to be associated with pancreatic cancer (Table 12). The fact that >80% of the proteins identified by LC/MS-MS have been implicated in pancreatic cancer is encouraging and indicates that the library selectively stains NB cases based on meaningful molecular interactions. The established relationship of most of these markers to pancreatic cancer resulted largely from studies in cell lines, whereas the PLP library was able to enrich them from relatively small amounts of patient-derived FFPE tissue. Even more reassuring is the finding that most of the identified proteins have been associated with hypoxia (26-40) and half have been associated with resistance to gemcitabine (19-25).

[00920] Without being bound by theory, the targets identified suggest a mechanism of action for how patients respond to gemcitabine and/or evofosfamide treatment. Gemcitabine activity is reduced in hypoxic environments (41), while evofosfamide was designed as a pro-drug that is activated under hypoxic conditions. Thus, gemcitabine may be less effective in patients with hypoxic pancreatic tumors. However, the decrease in survival may be partially or fully recovered with the addition of evofosfamide. Our blinded test set indicates that the PLP-negative status may predict greater benefit from gemcitabine, possibly due to a less hypoxic microenvironment. We propose a mechanism-based model that provides a plausible explanation of the MAESTRO findings. In this model, tumor hypoxia affects gemcitabine and evofosfamide in opposing directions: gemcitabine is less active under hypoxic conditions whereas evofosfamide activity would be optimal in a hypoxic tumor microenvironment.

[00921] Although MAESTRO failed to meet its designated endpoint, our results show that PLP revealed differences in outcomes that were otherwise undetectable in an unselected patient population. PLP enabled us to identify biomarkers from FFPE specimens that support a mechanism-based explanation of the MAESTRO results. This opens up new lines of inquiry, including but not limited to identification of new drug targets. PLP may be used in any variety of desired setting, e.g., resuscitating failed or failing drug candidates by offering a previously unavailable opportunity to increase the probability of success in clinical studies, which is currently unexpectably low. As another example, PLP may identify signals in phase I/II studies that can be prospectively verified and exploited in registrational Phase III studies by integrating joint PLP-CDx co-development. As yet another non-limiting example, PLP may provide valuable information to strengthen early Go/No-Go decision making during drug development programs, thus reducing the clinical, economic and ethical burdens associated with continued investment in futile therapies.

[00922] Previously we showed plasma-based PLP classification of breast cancer patients versus healthy controls (7; Int’l Patent Publications WO/2016/145128, published 9/15/2016 (based on Int’l Patent Appl. PCT/US16/21632, filed 3/9/2016)) and tissue-based PLP stratification of trastuzumab-treated breast cancer patients according to their outcomes (8; WO/2017/161357, published 9/21/2017 (based on Int’l Patent Appl. PCT/US17/23108, filed 3/18/2017)). This Example highlights the flexibility of PLP across multiple specimen types, tumor types and drug regimens.

[00923] Materials and Methods

[00924] MA liS'l RO trial data and samples

[00925] The original MAESTRO cohort consisted of 693 patients with pancreatic cancer that were treated with gemcitabine and evofosfamide (GE, n=344) or gemcitabine and placebo (G, n=349). See Table 11. Out of 693 patients enrolled in the trial, 323 had unstained FFPE tissue slides available for additional studies, which were provided by Threshold Pharmaceuticals. We received de-identified slides and trial data (ClinicalTrials.gov Identifier: NCT01746979) from Threshold Pharmaceuticals (currently Molecular Templates, Inc.) to comply with HIPAA regulations. H&E stained slides from each patient were evaluated by a Board-Certified Pathologist to triage unacceptable cases based on poor processing, insufficient number of cancer cells or non-identifiable surrounding tissue type (for metastatic lesions). In order to retain the maximum number of samples for the test set, only 20 random cases were unblinded for enrichment and training.

[00926] MAESTRO data were analyzed by“Treatment received” instead of by“Intention to treat” since our study is retrospective and does not impact drug approval. This allows assessment of the PLP test performance in relation to the actual treatment received.

[00927] In addition, by the time this study was initiated more post-trial outcome information was available, thus our analysis is based on the finalized up-to-date trial database. Therefore, trial performance metrics calculated here are slightly different from those reported at the official end of the trial (12).

[00928] Library design and reproduction

[00929] Details on library design were reported previously (7, 8). Briefly, a random ssDNA library (sense strand) was synthesized by Integrated DNA Technologies (IDT, USA) and consisted of a central variable region of 35-bases flanked by primer binding sites. Specifically, the ssDNA comprised a 5’ region (5' CTAGCATGACTGCAGTACGT (SEQ ID NO. 4)) followed by the random naive aptamer sequences of 35 nucleotides (referred to herein as the variable region) and a 3’ region (5'

CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5)). There was an equimolar mixture of four length variants (88-91 bases), designed with the intent of shifting the constant primer region out of alignment between the four variants, solely for the technical purpose of increasing sequence diversity during each cycle of NGS. The library was amplified via PCR using a biotinylated sense primer, allowing for SA-HRP binding during the staining process, and polyA(35n)/2xiSp9-modified antisense primer, allowing strand separation for ssDNA library preparation. See Example 13 for ssDNA library preparation. Sense strands were separated from longer antisense strands on 4% denaturing agarose gels and subsequently purified from gel using columns (Nucleospin, Macherey -Nagel).

[00930] Enrichment protocol

[00931] Enrichment consisted of eight rounds in total. The libraries in rounds 1-3 were exposed to a positive case (benefiters, B, OS > 13 months) FFPE tissue slide only, libraries in rounds 4-6 were exposed successively to two negative case (non-benefiters, NB, OS < 7 months) FFPE tissue slides followed by a positive case FFPE tissue slides, and rounds 7 and 8 were a modified version

(staining/decoverslip/dissect) of rounds 1-3 toward alternative positive cases.

[00932] Rounds 1-3: Inside a humidity chamber, 450 pL binding cocktail [3 mM gCT (#78641, Affymetrix), 15 nM ssDNA library, 0.65 ng/pL salmon sperm DNA (#15632-011, Life Technologies), 0.65 ng/pL yeast tRNA (#AM7119, Life Technologies), 1% v/v BlockAid (#B10710, Life Technologies)] was added to tissue sections representing positive cases and incubated for 60 min at RT. Following incubation, the binding cocktail was discarded, thereby leaving ssODNs of interest bound to the tissue. Slides were washed with buffer (lxPBS (#SH30256.01, V.W.R. International), 3 mM MgCL). Except for Round 1 the positive tissue slides were then stained with Nuclear Fast Red (NFR, American MasterTech, #STNFR5CB), supplemented with 3 mM MgCL. Then slides were rinsed with washing buffer, returned to the humidity chamber and mineral oil was applied to prevent drying during dissection. Pathology Assistants (PA) dissected the tumor tissue sections away from normal adjacent tissue and deposited each sample into individual wells containing molecular grade H ₂ 0 for PCR.

[00933] Rounds 4-6: Inside the humidity chamber, 450 pL binding cocktail was added to tissue sections from negative cases and incubated for 60 min at room temperature. Following incubation, the binding cocktail containing ssODN of interest (unbound), was pipetted into individual 1.5 mL microcentrifuge tubes (Round 4). Collected unbound fractions were applied to the tissues from a second negative case followed by incubation and recovery as described above. The recovered unbound fractions were applied to tissues of the corresponding positive cases from rounds 1-3 and incubation and recovery were performed the same way as in rounds 1-3.

[00934] Rounds 7-8: Round 6 libraries were used for staining as described below. Coverslips were removed with xylene and acetone. Bound libraries were recovered as described for rounds 1-3 and exposed to alternative positive cases.

[00935] Next-Generation sequencing

[00936] We utilized the modified version of the two-step library preparation protocol from Illumina for sequencing low diversity libraries (7).

[00937] Poly-Ligand Profiling of FFPET Specimens

[00938] A Ventana Discovery autostainer was used for this study. Slides were incubated for 90 min at 60°C. Deparaffmization was carried out at 69°C for 32 min, followed by epitope retrieval at 95°C for 24 min. The Ev-NR2 library was applied manually to tissue sections after deparaffmization and epitope retrieval. Two cocktail mixes were made“No Fibrary” &“10 nM EF-EvNR2” using Binding Buffer described above. The“No library” control has all the reagents of the binding solution except for the library and is meant to visualize the potential binding of the secondary detector Streptavidin-HRP. Bound ssODNs were visualized using streptavidin-poly HRP conjugate and colorimetric detection. Slides were counterstained with hematoxylin and coverslipped.

[00939] Histological scoring of the FFPE tissue staining intensities

[00940] Scoring was performed by a board certified pathologist as described previously (8).

[00941] Equipment and settings

[00942] Microscopy and scoring of PEP staining intensities was done on an Olympus BX51 using standard bright field settings. Microscopy and imaging of the PLP stained slide was done on an Olympus BX41 using standard bright field settings, with 4x, lOx and 20x objectives (UPlanFL N). Image acquisition camera: Olympus DP25. Image acquisition software: OLYMPUS DP2-TWAIN, which imports images, captured by DP25, via the TWAIN 64 Twacker (version 2.0 12/29/2008, TWAIN Working Group). [00943] Acquisition settings:

[00944] Exposure: automatic. Sensitivity: ISO 200. Exposure compensation: 1. Pseudo color: off. API version: 3.0.38. Firmware version: 1.0.14. Driver version: 2.1.32.

[00945] Image resolution data: Dimensions: 2560 x 1920 pixels. Bit depth: 24. Xyzt: not applicable.

[00946] Imaging was done at room temperature. No further manipulations or adjustments was done to the images.

[00947] Statistical analysis

[00948] PLP -assay thresholds were determined after staining the training cases (n=12) with the leading library. Specifically, staining intensity of >70% for the Nucleus 0 component is a positive test (or benefiter) and staining intensity of < 70% is a negative test (or non-benefiter), while OS > 240 days is a benefiter and < 240 days is a non-benefiter. After completion of staining of the blinded test set (n=172) patients, their outcomes were unblinded to calculate sensitivity and specificity for the

gemcitabine+evofosamide (GE) and gemcitabine+placebo (G) arms, using assay thresholds specified above. One GE sample was removed from the sensitivity and specificity calculations as it was short- censored (OS=233) to yield n=171 in the final blinded test set. These thresholds result in a sensitivity and specificity of 52.8% and 47.1%, respectively, for the GE cohort and 40.0% and 41.2%, respectively, for the G cohort.

[00949] As we did not perform staining on the full MAESTRO cohort of 693 patients, it was assumed that the calculated sensitivities and specificities from the 171 patients apply to the full MAESTRO dataset and performed trial simulations. The protocol for these trial simulations is as follows:

[00950] - Split the 693 MAESTRO patients into the GE and G cohorts.

[00951] - Further split each GE and G cohort into non-benefiters and benefiters based on pre-defined OS cutoff of 240 days. This yield four cohorts: GE/benefiters, GE/non-benefiters, G/benefiters, and G/non- benefiters.

[00952] - Assign a random integer (without replacement) to each patient in each of the four groups, ranging from 1 to the number of patients in that group. For example, there are 184 patients in the GE/benefiter cohort, so assign the numbers 1-184 to each.

[00953] - Using the random numbers for each cohort, take the proportion of patients that would be PLP- positive via the calculated sensitivities and specificities for that cohort.

[00954] For example, the GE sensitivity is 52.8%. For this cohort, 0.528*184=97.1, so the patients with a random number < 97 are the true positives for the GE group. Similarly, there are 160 patients in the GE/non-benefiter cohort and the specificity for this arm is 47.1%, so 160*(l-0.472)=84.7. Any patient in this cohort with a random number < 84 is a false positive for the GE group. In total, there are 181 positive tests for the GE arm and 174 positive tests for the G arm.

[00955] - Using the randomly selected PLP -positive, build a Kaplan-Meier plot using the“survival” package in B v3.4.1. Extract the median survival for each arm, the hazard ratio (HR), and the log-rank p- value.

[00956] - Repeat steps (3)-(6) 1,000 times. [00957] These 1,000 trial simulations essentially model the sensitivities and specificities obtained via the 171 patients on which Caris performed the high-quality staining method and build a distribution of trial results. Of these 1,000 simulations, 969 yield log-rank p < 0.05. The average median OS increase for GE to G was 37.5% (95% prediction interval: 27.0-51.6%) and the average HR was 0.716 (95% prediction interval: 0.646-0.789). We also calculated the sensitivities and specificities from the subsets of the blinded test set where the sample was excised from a primary or metastatic site and performed the same simulation procedure for those assay performance metrics.

[00958 ] Affinity Purification

[00959] To identify the molecular targets of library EvNR2-Rd8 enriched toward NB cases, 5 NB cases were selected from the MAESTRO trial, which had relatively high staining intensities in the test set profiling (FIG. 25A-P; FIG. 27). Considering tissue size, 2 slides per replicate were used from cases A,

B, C, E and 3 slides per replicate from case D (case B was excluded later due to technical failure of one replicate). Two biological replicates were used for each of the five NB cases, which included the initial PLP staining of the FFPE tissue for enriched library, a negative control consisting of the beads used for the pull-down coated in unenriched library, and a negative control with beads only (no library). Binding and visualization of the ssODNs to the 5 NB cases was performed as described above for Poly-Ligand Profiling of FFPE Specimens. Cancer tissue with bound ssODNs was dissected and placed in 1.5 mL microfuge tubes, subjected to detergent-based lysis, and pulled down using streptavidin coated magnetic beads. Eluted samples were run for 10 minutes on SDS-PAGE to remove any residual detergents, and the entire lane was extracted and subjected to in-gel digestion with trypsin (42).

[00960] Mass spectrometry analysis

[00961] Samples containing tryptic peptides were analyzed by nanoflow reverse phase liquid chromatography using a Dionex Ultimate 3000 RSLCnano System (Thermo Fisher Scientific, Waltham, MA USA) coupled in-line to a Q Exactive HF mass spectrometer (Thermo Fisher Scientific). The nano LC system included an Acclaim PepMap 100 C18 3pm 100A 75 mhi ^c 20mm trap column and an EASY- Spray C18 2pm 100A 75pmx250mm analytical column (Thermo Fisher Scientific). Peptide samples were loaded onto the bap column and held for 10 minutes at a constant flow rate of 9 pL/min using running solvent A, where A consisted of 0.1% formic acid in water. Peptides were then eluted using a linear gradient of 2% to 30% B in 27 minutes then 30% to 45% in 5 minutes, where B consisted of acetonitrile containing 0.1% formic acid. Blank samples consisting of 0.1% formic acid in water were injected between each sample and eluted with the same gradient profile as samples. The LC system was interfaced to the Q Exactive HF using an EASY-Spray electrospray ion source (Thermo Fisher Scientific) and the samples were analyzed using positive ion spray voltage set to 2.6 kV, S-lens RF level at 60, and heated capillary at 320 °C. The Q Exactive HF was operated in data-dependent acquisition mode selecting the top 15 most intense peaks for fragmentation. MSI survey scans (m/z 400-1400) were acquired in the Orbitrap analyzer with a resolution of 120,000 at m/z 200, an accumulation target of 3e6, and maximum fill time of 50 ms. MS2 scans of the 15 most intense precursor ions were collected using a resolution of 30,000 at m/z 200, an accumulation target of le5, and maximum fdl time of 100 ms, with an isolation window of 1.5 m/z, normalized collision energy of 28, and charged state recognition between 2 and 7. Dynamic exclusion was applied with exclusion duration of 20 seconds.

[00962] Mass spectrometry data processing and analysis

[00963] Raw data fdes from the Q Exactive HF were analyzed using Sequest HT in the Proteome Discoverer 2.1.1.21 suite and searched against the SwissProt Homo sapiens fasta database (V2015-11-11, with 42084 entries). Precursor selection was set to use MSI precursor ions with a signal to noise threshold of 1.5. The search parameters for Sequest HT included full tryptic specificity with a maximum of 2 missed cleavages, minimum peptide length of 6, precursor mass (MSI) tolerance of 10 ppm, and fragment mass (MS2) tolerance of 0.02 Da.

[00964] Dynamic modifications searched were carbamyl (43.0058 Da) for methionine; carbamidomethyl (57.0215 Da) for histidine, lysine, and peptide N-terminus; deamidated (0.9840 Da) for asparagine; formyl (27.9949 Da) for lysine; carboxymethyl (58.0055 Da) for lysine; dicarbamidomethyl (114.0429 Da) for peptide N-terminus; and dimethyl (28.0313 Da) for peptide N-terminus. Carbamidomethyl (57.0215 Da) for cysteine was set as a static modification.

[00965] Peptide spectrum matches from the resultant SequestHT processing were further validated within Scaffold Q+ suite, version 4.8.3 (Proteome Software, Inc., Portland, OR, US). X!Tandem processing was selected for additional PSM validation (43) using the same search modifications as for SequestHT along with Scaffold default modifications. Peptide and Protein identifications were accepted based on Bayesian probability thresholds specified by the Peptide Prophet Algorithm (44) and Protein Prophet Algorithm (45), respectively. A minimum of two unique peptides per protein was used for all protein identifications; and proteins that contained identical peptides and could not be differentiated based on spectral analysis alone were grouped to satisfy the principles of parsimony. Precursor intensity was selected for label-free quantitative analysis.

[00966] Strict acceptance criteria were first used to identify protein targets in the five NB cases (i.e., Cases A-E): (i) peptide and protein probabilities were set to give a false discovery rate (FDR) of < 0.7%; (ii) identified proteins need to be present in both biological replicates;(iii) proteins should have at least 1.2 fold change in the comparison between enriched library /unenriched R0 libraries (primary control) and between enriched library and“No library” control (secondary control); and (iv) proteins must be present in at least two of the NB cases.

[00967] References (indicated by number in parentheses in the body of the Example)

[00968] 1. Morgan, G., Ward, R. & Barton, M. The contribution of cytotoxic chemotherapy to 5- year survival in adult malignancies. Clin Oncol (R Coll Radiol) 16, 549-560 (2004).

[00969] 2. Miller, K. D. et al. Cancer treatment and survivorship statistics, 2016. CA Cancer J Clin 66, 271-289, doi: 10.3322/caac.21349 (2016).

[00970] 3. Hay, M., Thomas, D. W., Craighead, J. L., Economides, C. & Rosenthal, J. Clinical development success rates for investigational drugs. Nat Biotechnol 32, 40-51, doi: 10.1038/nbt.2786 (2014).

[00971] 4. Thomas, D. et al. Clinical Development Success Rates 2006-2015. 1-28 (2016). [00972] 5. Jardim, D. L., Groves, E. S., Breitfeld, P. P. & Kurzrock, R. Factors associated with failure of oncology drugs in late-stage clinical development: A systematic review. Cancer Treat Rev 52, 12-21, doi: 10.1016/j.ctrv.2016.10.009 (2017).

[00973] 6. Klement, G. L. et al. Future paradigms for precision oncology. Oncotarget 7, 46813- 46831, doi: 10.18632/oncotarget.9488 (2016).

[00974] 7. Domenyuk, V. et al. Plasma Exosome Profiling of Cancer Patients by a Next Generation Systems Biology Approach. Sci Rep 7, 42741, doi: 10.1038/srep42741 (2017).

[00975] 8. Domenyuk, V. et al. Poly-ligand profiling differentiates trastuzumab-treated breast cancer patients according to their outcomes. Nat. Commun. 9, 1219, doi: 10.1038/s41467-018-03631-z (2018).

[00976] 9. Famulok, M. & Mayer, G. Aptamer modules as sensors and detectors. Ace Chem Res 44, 1349-1358, doi: 10.1021/ar2000293 (2011).

[00977] 10. Zhou, J. & Rossi, J. Aptamers as targeted therapeutics: current potential and challenges. Nat Rev Drug Discov 16, 181-202, doi: 10.1038/nrd.2016.199 (2017).

[00978] 11. Nimjee, S. M., White, R. R., Becker, R. C. & Sullenger, B. A. Aptamers as Therapeutics. Annu Rev Pharmacol Toxicol 57, 61-79, doi: 10.1146/annurev-pharmtox-010716-104558 (2017).

[00979] 12. Van Curtsem, E. et al. MAESTRO: A randomized, double-blind phase III study of evofosfamide (Evo) in combination with gemcitabine (Gem) in previously untreated patients (pts) with metastatic or locally advanced unresectable pancreatic ductal adenocarcinoma (PD AC). J. Clin. Oncol. 34, 4007, doi: 10.1200/JC0.2016.34.15_suppl.4007 (2016).

[00980] 13. Walsh, J. C. et al. The clinical importance of assessing tumor hypoxia: relationship of tumor hypoxia to prognosis and therapeutic opportunities. Antioxid Redox Signal 21, 1516-1554, doi: 10.1089/ars.2013.5378 (2014).

[00981] 14. Vogelstein, B. et al. Cancer genome landscapes. Science 339, 1546-1558,

doi: 10.1126/science.1235122 (2013).

[00982] 15. Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: the next generation. Cell 144, 646- 674, doi: 10.1016/j.cell.2011.02.013 (2011).

[00983] 16. Dagogo-Jack, I. & Shaw, A. T. Tumour heterogeneity and resistance to cancer therapies. Nat Rev Clin Oncol 15, 81-94, doi: 10.1038/nrclinonc.2017.166 (2018).

[00984] 17. Jung, H. et al. Intracellular annexin A2 regulates NF-kappaB signaling by binding to the p50 subunit: implications for gemcitabine resistance in pancreatic cancer. Cell Death Dis 6, el 606, doi: 10.1038/cddis.2014.558 (2015).

[00985] 18. Arlt, A. et al. Role of NF-kappaB and Akt/PI3K in the resistance of pancreatic carcinoma cell lines against gemcitabine-induced cell death. Oncogene 22, 3243-3251, doi: 10.1038/sj. one.1206390 (2003).

[00986] 19. Verma, A. et al. Therapeutic significance of elevated tissue transglutaminase expression in pancreatic cancer. Clin Cancer Res 14, 2476-2483, doi: 10.1158/1078-0432.CCR-07-4529 (2008). [00987] 20. Calabretta, S. et al. Modulation of PKM alternative splicing by PTBP1 promotes gemcitabine resistance in pancreatic cancer cells. Oncogene 35, 2031-2039, doi: 10.1038/onc.2015.270 (2016).

[00988] 21. Mori-Iwamoto, S. et al. Proteomics finding heat shock protein 27 as a biomarker for resistance of pancreatic cancer cells to gemcitabine. Int J Oncol 31, 1345-1350 (2007).

[00989] 22. Chen, P., Cescon, M. & Bonaldo, P. Collagen VI in cancer and its biological mechanisms. Trends Mol Med 19, 410-417, doi: 10.1016/j.molmed.2013.04.001 (2013).

[00990] 23. Dangi-Garimella, S. et al. Three-Dimensional Collagen I Promotes Gemcitabine

Resistance in Pancreatic Cancer through MTl-MMP-Mediated Expression of HMGA2. Cancer Res. 71, 1019-1028, doi: 10.1158/0008-5472. Can-10-1855 (2011).

[00991] 24. Demarse, N. A. et al. Direct binding of glyceraldehyde 3-phosphate dehydrogenase to telomeric DNA protects telomeres against chemotherapy -induced rapid degradation. J Mol Biol 394, 789- 803, doi: 10.1016/j.jmb.2009.09.062 (2009).

[00992] 25. Lee, H. S. et al. A novel HD AC inhibitor, CG200745, inhibits pancreatic cancer cell growth and overcomes gemcitabine resistance. Sci Rep 7, 41615, doi: 10.1038/srep41615 (2017).

[00993] 26. Bizzarro, V. et al. Hypoxia regulates ANXA1 expression to support prostate cancer cell invasion and aggressiveness. Cell Adh Migr 11, 247-260, doi: 10.1080/19336918.2016.1259056 (2017).

[00994] 27. Chen, H. B., Yan, Y., Davidson, T. L., Shinkai, Y. & Costa, M. Hypoxic stress induces dimethylated histone H3 lysine 9 through histone methyltransferase G9a in mammalian cells. Cancer Research 66, 9009-9016, doi:10.1158/0008-5472.Can-06-0101 (2006).

[00995] 28. Higashimura, Y. et al. Up-regulation of glyceraldehyde-3 -phosphate dehydrogenase gene expression by HIF-1 activity depending on Spl in hypoxic breast cancer cells. Arch Biochem Biophys 509, 1-8, doi: 10.1016/j. abb.2011.02.011 (2011).

[00996] 29. Hu, C. J. et al. Differential regulation of the transcriptional activities of hypoxia-inducible factor 1 alpha (HIF-lalpha) and HIF-2alpha in stem cells. Mol Cell Biol 26, 3514-3526,

doi: 10.1128/MCB.26.9.3514-3526.2006 (2006).

[00997] 30. Luo, W. B. et al. Pyruvate Kinase M2 Is a PHD3-Stimulated Coactivator for Hypoxia- Inducible Factor 1. Cell 145, 732-744, doi: 10.1016/j.cell.2011.03.054 (2011).

[00998] 31. McCulloch, L. J. et al. COL6A3 Is Regulated by Leptin in Human Adipose Tissue and Reduced in Obesity. Endocrinology 156, 134-146, doi: 10.1210/en.2014-1042 (2015).

[00999] 32. Mimeault, M. & Batra, S. K. Hypoxia-inducing factors as master regulators of sternness properties and altered metabolism of cancer- and metastasis-initiating cells. J Cell Mol Med 17, 30-54, doi: 10. I l l 1/jcmm.12004 (2013).

[001000] 33. Musiani, D. et al. Heat-shock protein 27 (HSP27, HSPB1) is up-regulated by

MET kinase inhibitors and confers resistance to MET -targeted therapy. Faseb J 28, 4055-4067, doi: 10.1096/fj.13-247924 (2014). [001001] 34. Parker, A. L., Teo, W. S., McCarroll, J. A. & Kavallaris, M. An Emerging Role for Tubulin Isotypes in Modulating Cancer Biology and Chemotherapy Resistance. International Journal of Molecular Sciences 18, dokARTN 1434 10.3390/ijmsl8071434 (2017).

[001002] 35. Seliger, B. et al. Discrimination between Von Hippel-Lindau gene and hypoxia- regulated alterations in the metabolism and protein expression in renal cell carcinoma using ome-based strategies. Journal of Clinical Oncology 32, doi:DOI 10.1200/jco.2014.32.4_suppl.447 (2014).

[001003] 36. Welsch, T. et al. Prognostic Significance of Erythropoietin in Pancreatic

Adenocarcinoma. Plos One 6, dokARTN e23151 10.1371/joumal. pone.0023151 (2011).

[001004] 37. Zheng, Y. et al. Expression of beta-globin by cancer cells promotes cell survival during blood-borne dissemination. Nature Communications 8, dokARTN 14344

[001005] 10.1038/ncommsl4344 (2017).

[001006] 38. Zhou, X., Liao, W. J., Liao, J. M., Liao, P. & Lu, H. Ribosomal proteins:

functions beyond the ribosome. J Mol Cell Biol 7, 92-104, doi: 10.1093/jmcb/mjv014 (2015).

[001007] 39. Zieseniss, A. Hypoxia and the modulation of the actin cytoskeleton - emerging interrelations. Hypoxia (Auckl) 2, 11-21, doi: 10.2147/HP. S53575 (2014).

[001008] 40. Zonca, S. et al. Tissue transglutaminase (TG2) enables survival of human malignant pleural mesothelioma cells in hypoxia. Cell Death Dis 8, e2592, doi: 10.1038/cddis.2017.30 (2017).

[001009] 41. Yokoi, K. & Fidler, I. J. Hypoxia increases resistance of human pancreatic cancer cells to apoptosis induced by gemcitabine. Clin Cancer Res 10, 2299-2306 (2004).

[001010] 42. Shevchenko, A., Tomas, H., Havlis, J., Olsen, J. V. & Mann, M. In-gel digestion for mass spectrometric characterization of proteins and proteomes. Nat Protoc 1, 2856-2860, doi: 10.1038/nprot.2006.468 (2006).

[001011] 43. Searle, B. C., Turner, M. & Nesvizhskii, A. I. Improving sensitivity by probabilistically combining results from multiple MS/MS search methodologies. J Proteome Res 7, 245- 253, doi: 10.1021/pr070540w (2008).

[001012] 44. Keller, A., Nesvizhskii, A. L, Kolker, E. & Aebersold, R. Empirical statistical model to estimate the accuracy of peptide identifications made by MS/MS and database search. Anal Chem 74, 5383-5392, doi: 10.1021/ac025747h (2002).

[001013] 45. Nesvizhskii, A. L, Keller, A., Kolker, E. & Aebersold, R. A statistical model for identifying proteins by tandem mass spectrometry. Anal Chem 75, 4646-4658, doi: 10.1021/ac0341261 (2003).

Example 15: Poly-Ligand Profiling differentiates pancreatic cancer patients according to treatment benefit and identifies candidate targets

[001014] This Example follows Example 14 above and identifies candidate target proteins of the aptamer (aka oligonucleotide probe) libraries.

[001015] The accumulation of a multitude of subtle molecular aberrations during tumor progression limits the efficacy of anti-cancer drugs. A vast array of these variations can be assessed with Poly -Ligand Profiling (PLP), which is utilizing libraries of trillion unique ssDNA with aptamer binding properties. As described above, we developed a PLP library that differentiates pancreatic cancer patients who can benefit from gemcitabine+evofosfamide (GE) or gemcitabine+placebo (G). In this Example, we further identify molecular targets of the gemcitabine/evofofamide PLP library.

[001016] The patients in this study consisted of locally advanced or metastatic pancreatic cancer patients randomized to G vs GE in the phase III MAESTRO trial (Threshold Pharmaceuticals, Merck KgaA). FFPE tissues of patients with good (OS > 13 mos) or poor (OS < 7 mos) outcome from GE were used for PLP library development. For target ID, FFPE tissue of patients with poor outcome, stained with enriched library, was recovered, lysed, underwent affinity -based pull-downs, purified with PAGE gel and subjected to high resolution mass-spectrometry (MS). An overview of the experimental workflow is shown in FIG. 26 with additional details provided in FIG. 28A. This scheme was performed for five cases selected from enriched library EL-EvNR2 (see Example 14 for library description). The five cases were from the original blinded library screening and had relatively high staining intensity with the EvNR2 library. See FIG. 27; Table 14 for descriptions of the five selected cases (Cases A-E).

Table 14: Five cases selected for EvNR2 target ID

[001017] The experiments were that same as in Example 14 above (see, e.g., Tables 12-13 above and related text) but the MS data was analyzed using different parameters. Here, we assessed proteins detected in binding replicates which had >1.2 fold change EvNR2/R0 (“R0” refers to the enrichment round 0 control) and EvNR2/NoLib (“NoLib” refers to no library, used as a secondary control). Table 15 shows proteins detected in the pull down experiments that met the following criteria: Protein Threshold: 99%, min # Peptides: 2, Peptide Threshold: 95%; present in two replicates of EvNR2, FC > 1.2

(EvNR2/R0).“n/a” in the table indicates that the protein was not observed in the R0 or NoLib controls. The number following the Case identifier is the numbers of proteins detected that met the criteria.

Between the five cases, there were 136 total proteins detected.

Table 15: Identified target proteins by Case

[001018] Using the additional criteria that the proteins overlapped between at least two out of the five cases, the MS consistently detected 20 proteins as shown in Table 16. In the table, column “Pancreatic” reports whether the gene has been found linked to pancreatic cancer. Column“Gem.” reports whether the gene has been found linked to response to gemcitabine.

Table 16: 20 proteins overlapped among the 5 cases

[001019] As indicated in Table 16, 11 of the 20 proteins have reported associations with pancreatic cancer and six of those have been associated with resistance to gemcitabine. Vimentin is a mesenchymal marker whose expression increases during epithelial-to-mesenchymal transition (EMT) and tumor progression. EMT results in the suppression of human equilibrative/concentrative nucleoside transporter and protects tumor cells from gemcitabine [1] GRP78 overexpression confers resistance to gemcitabine and its knockdown sensitizes tumor cells to drug treatment [2] Alternative splicing of PKM promotes gemcitabine resistance in pancreatic cancer cells [3] most likely by boosting glycolysis-fueled proliferation [4] Heat shock proteins regulate multiple tumor survival and progression pathways and their inhibition attenuates resistance of cancer cells to gemcitabine [5] . Pancreatic tumors demonstrate increased histones acetylation, which was correlating with increased protection against gemcitabine [6] .

[001020] In a next set of experiments, 10 individual oligonucleotide probes from the EvNR2-21 library were synthesized and used in pulldown experiments. The sequences are shown in Table 17. All oligonucleotide used for pulldown experiments were synthesized with a 5’ region consisting of the sequence (5 ' -CTAGCATGACTGCAGTACGT (SEQ ID NO. 4)) and a 3’ region consisting of the sequence (5 ' -CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5)). Each sequence was also 5’ biotinylated. Sequences with Name ending in“_RC” are the reverse complements of the sequence above and serve as controls.

Table 17: 10 individual sequences from EvNR2 library and controls used for pulldowns

[001021] The sequences in Table 17 were pooled together according to their prevalence in the sequenced library. The percentage for each sequence is shown in the table. The staining of pancreatic tissue with the synthesized pool is shown in FIG. 28B. Staining followed the protocol shown in FIG. 28A. In the figure,“EvNR2-Lib” shows staining with the entire library, as described in the Examples above,“Nolib” is a negative control without library,“EvNR2-Pool+” is the pool of 10 synthesized sequences and“EvNR2-Pool-” is the pool of reverse complements. Strong staining is evident in the EvNR2-Pool+ slide. There was some background with the EvNR2-Pool-, but the staining was evidently lower than that observed with the EvNR2-Lib or EvNR2-Pool+ libraries.

[001022] We then performed pulldown experiments to identify targets of the EvNR2-Pool+ library. Pulldowns followed by MS was performed as above. See FIGs. 26, 28A. Table 18 shows proteins detected in the pull down experiments that met the following criteria: Protein Threshold: 99%; min # Peptides: 2; Peptide Threshold: 95%; Present in at least two replicates of Pool+, FC > 1.2 (EvNR2-Pool+/ EvNR2-Pool-). In Table 18, column“Pancreatic” reports whether the gene has been found linked to pancreatic cancer. Column“Gem.” reports whether the gene has been found linked to response to gemcitabine.

Table 18: Identified target proteins of EvNR2-Pool+ aptamer library

[001023] As noted in Table 18, several of the identified proteins have been implicated in pancreatic cancer and/or resistance to gemcitabine. For example, Ezrin is a member of ERM (ezrin- radixin-moesin) and plays roles in cell motility, invasion and tumor progression, and is crucial for metastasis. Decorin attenuates the cytostatic activity of chemotherapeutic drugs like gemcitabine.

Thrombospondin-l(TSP-l, TSP1) is a component of the extracellular matrix and is an endogenous inhibitor of angiogenesis. Low mRNA expression of TSP1 has been correlated to gemcitabine resistance.

[001024] PLP provides a platform for classifying pancreatic cancer patients according to their benefiting from G or GE treatment. MS of the PLP library pull-downs reveals targets associated with gemcitabine resistance as the samples were non-responders. The PLP platform can be applied to different therapeutic regimen for the development of companion diagnostic tests in cancer and other diseases.

[001025] References: (noted in brackets in the Example)

[001026] 1. Liang C., et al. Complex roles of the stroma in the intrinsic resistance to gemcitabine in pancreatic cancer: where we are and where we are going. Experimental & Molecular Medicine, 49 (2017): e406.

[001027] 2. Kosakowska-Cholody T., et al. HKH40A downregulates GRP78/BiP expression in cancer cells. Cell Death & Disease (2014), 5: el240.

[001028] 3. Calabretta S., et al. Modulation of PKM alternative splicing by PTBP1 promotes gemcitabine resistance in pancreatic cancer cells. Oncogene volume 35 (2016): 2031-2039.

[001029] 4. Dong G., et al. PKM2 and cancer: The function of PKM2 beyond glycolysis (Review).

Oncology Letters, 11.3 (2016): 1980-1986.

[001030] 5. Lu X., et al. Hsp90 Inhibitors and Drug Resistance in Cancer: The Potential Benefits of

Combination Therapies of Hsp90 Inhibitors and Other Anti-Cancer Drugs. Biochemical Pharmacology, 83(8) (2012): 995-1004.

[001031] 6. Dangi-Garimella S., et al. Three-Dimensional Collagen I Promotes Gemcitabine

Resistance In Vitro in Pancreatic Cancer Cells through HMGA2-Dependent Histone Acetyltransferase Expression. PLoS One, 8(5) (2013): e64566.

Example 16: Tissue Staining with Synthetic Oligonucleotide Pool Libraries

[001032] In a follow on set of experiments to the individual sequences shown in Table 18 in the Example above, 100 individual oligonucleotide probes from the EvNR2-21 library were synthesized. This subset of sequences can be used to create a library to stain pancreatic cancer tissue as described herein in order to predict benefit or not from gemcitabine or gemcitabine with evofosfamide. The sequences are shown in Table 19. These were the top 100 sequences after re-amplification of the library and sequencing with NGS. Any differences between the sequences in Table 9 versus Table 19 and likely due to the re amplification process. The sequences in Table 19 are ranked according to counts of species as indicated. All oligonucleotide probes were synthesized with a 5’ region consisting of the sequence (5’- CTAGCATGACTGCAGTACGT (SEQ ID NO. 4)) and a 3’ region consisting of the sequence (5’- CTGTCTCTTATACACATCTGACGCTGCCGACGA (SEQ ID NO. 5)). Each sequence was also 5’ biotinylated.

[001033] Two versions of the 100 sequence libraries were synthesized. In one library, the sequences were mixed in proportion to their percentage in the original EvNR2-21 library, which percentage is listed in Table 19. In another library, the sequences were mixed in equal percentages, i.e., 1% each. Each library was used to stain FFPE slides comprising pancreatic cancer tumor samples. The slides are scored as described herein and used to predict benefit or not from gemcitabine, or to predict benefit or not from gemcitabine and evofosfamide. See Example 14 for description of scoring and prediction.

Table 19: 100 individual sequences from EvNR2-21 library in synthetic pool

Example 17: Identification of Aptamer Library Targets in Stained Tissue

[001034] In Examples 14 and 15, we identified target proteins of the EvNR2-R8 aptamer library in pancreatic tissue slides. See, e.g., Tables 12-13, 15-16, and 18, and accompanying text. In those experiments, target proteins were identified in a selection of five non-responder samples with relatively high staining intensities. Thus, these proteins represent aptamer targets expressed in non-responder samples. In this Example, we repeated the pull down experiments using eight non-responder samples with strong staining using the EvNR2 library and eight non-responder samples with little to no observable staining (“non staining”) using the EvNR2 library. The protein targets for filtered for those that were unique to the strongly staining samples. Accordingly, the aptamer target proteins identified in the Example represent those that drive staining of the pancreatic tissue samples.

[001035] Materials and methods used in this Example are as in Example 14. Four of the strongly staining samples were from the experiments in Examples 14 and 15, and four additional strongly stained samples were chosen. Proteins detected by mass spectrometry were accepted if identified at levels with <0.7% FDR, with a fold change at least 1.2 or greater for the enriched library over the negative controls (i.e., R0 and no library controls as described in Examples 14 and 15), and with the additional requirement that the protein target was identified in at least two of the highly stained cases but in none of the no staining cases. In addition, the aptamer protein targets were filtered for those with known roles in pancreatic cancer (Table 20), gemcitabine resistance (Table 21), or hypoxia (Table 22). Aptamer protein targets that were not identified in any of these classes are listed in Table 23.

Table 20: Aptamer Library EvNR2 Protein Targets in Stained Pancreatic Tissue:

Role in Pancreatic Cancer

Table 21: Aptamer Library EvNR2 Protein Targets in Stained Pancreatic Tissue:

Role in Gemticabine Resistance

Table 22: Aptamer Library EvNR2 Protein Targets in Stained Pancreatic Tissue:

Role in Hypoxia

Table 23: Aptamer Library EvNR2 Protein Targets in Stained Pancreatic Tissue

[001036] As expected, many of the aptamer targets were found to play overlapping roles in pancreatic cancer, gemcitabine resistance and hypoxia. Overlap of the aptamer targets in Tables 20-22 is shown in Table 24. In the table, group abbreviations are“PC” = Pancreatic Cancer (Table 20),“Gem.” = Gemcitabine Resistance (Table 21), and“Hyp.” = Hypoxia (Table 22). No targets were detected that overlapped in gemcitabine resistance (Table 21) and hypoxia (Table 22) but not pancreatic cancer (Table 20).

Table 24: Aptamer Library EvNR2 Protein Targets in Stained Pancreatic Tissue: Multiple Roles

[001037] Further as expected, many of the targets overlapped with those identified in the pulldown experiments in the high staining slides only. Compare the proteins listed in Tables 20-24 with the proteins listed in Tables 12-13, 15-16 and 18.

[001038] References (numbers correspond to column Ref. in Tables 19-21):

[001039] 1. Liu X et al., Identification of PGAM1 as a putative therapeutic target for pancreatic ductal adenocarcinoma metastasis using quantitative proteomics. Onco Targets Ther. 2018.

[001040] 2. He XP et al., Effects of recombinant human canstatin protein in the treatment of pancreatic cancer. World J Gastroenterol. 2006 Nov 7;12(41):6652-7.

[001041] 3. Schiarea S et al., Secretome analysis of multiple pancreatic cancer cell lines reveals perturbations of key functional networks. J Proteome Res. 2010 Sep 3;9(9):4376-92.

[001042] 4. Balmana M et al., Analysis of sialyl-Lewis x on MUC5AC and MUC1 mucins in pancreatic cancer tissues. Int J Biol Macromol. 2018 Jun;l 12:33-45

[001043] 5. Shoji H et al., Measurement of copy number of ACTN4 to optimize the therapeutic strategy for locally advanced pancreatic cancer. Pancreatology. 2018 Sep; 18(6): 624-629.

[001044] 6. Nedjadi T et al., S100A6 binds to annexin 2 in pancreatic cancer cells and promotes pancreatic cancer cell motility. Br J Cancer. 2009 Oct 6; 101(7): 1145-54. [001045] 7. Zhao L, et al., LncRNA-PVTl promotes pancreatic cancer cells proliferation and migration through acting as a molecular sponge to regulate miR-448. J Cell Physiol. 2018

May;233(5):4044-4055.

[001046] 8. Pan S, et al., Proteomics portrait of archival lesions of chronic pancreatitis. PLoS

One. 2011;6(l l):e27574. Epub 2011 Nov 23.

[001047] 9. Lee HS et al. A novel HD AC inhibitor, CG200745, inhibits pancreatic cancer cell growth and overcomes gemcitabine resistance. Sci Rep. 2017 Jan 30;7:41615.

[001048] 10. Deng L et al. Ran GTPase protein promotes human pancreatic cancer proliferation by deregulating the expression of Survivin and cell cycle proteins. Biochem Biophys Res Commun. 2013 Oct 18;440(2):322-9.

[001049] 11. Kang CY et al., Clinical significance of serum COL6A3 in pancreatic ductal adenocarcinoma. J Gastrointest Surg. 2014 Jan;18(l):7-15.

[001050] 12. Maupin KA et al., Glycogene expression alterations associated with pancreatic cancer epithelial-mesenchymal transition in complementary model systems. PLoS One. 2010 Sep 27;5(9):el3002.

[001051] 13. Wang L et al., A FISH assay efficiently screens for BRAF gene rearrangements in pancreatic acinar-type neoplasms. Mod Pathol. 2018 Jan;31(1): 132-140.

[001052] 14. Ji S et al., ALDOA functions as an oncogene in the highly metastatic pancreatic cancer. Cancer Lett. 2016 Apr 28;374(1): 127-135.

[001053] 15. Yoshida T et al., Expression patterns of epiplakinl in pancreas, pancreatic cancer and regenerating pancreas. Genes Cells. 2008 Jul;13(7):667-78.

[001054] 16. Li Y et al., Pancreatic Stellate Cells Activation and Matrix Metallopeptidase 2

Expression Correlate With Lymph Node Metastasis in Pancreatic Carcinoma. Am J Med Sci. 2019 Jan;357(l): 16-22.

[001055] 17. Hu H et al., Diagnostic value of S100P for pancreatic cancer: a meta-analysis.

Tumour Biol. 2014 Oct;35(10):9479-85.

[001056] 18. Chalick M et al., MUC1-ARF-A Novel MUC1 Protein That Resides in the

Nucleus and Is Expressed by Alternate Reading Frame Translation of MUC1 mRNA. PLoS One. 2016 Oct 21 ; 11 (10):e0165031.

[001057] 19. Liu H et al., Fructose induces transketolase flux to promote pancreatic cancer growth. Cancer Res. 2010 Aug l;70(15):6368-76.

[001058] 20. Ge J et al., Rabl4 overexpression regulates gemcitabine sensitivity through regulation of Bcl-2 and mitochondrial function in pancreatic cancer. Virchows Arch. 2019 Jan;474(l):59- 69.

[001059] 21. Li D et al., Identification of IncRNAs and Their Functional Network Associated with Chemoresistance in SW1990/GZ Pancreatic Cancer Cells by RNA Sequencing. DNA Cell Biol. 2018 Oct;37(10):839-849.

[001060] 22. Guo C. et al., ACTB in cancer. Clin Chim Acta. 2013 Feb 18;417:39-44. [001061] 23. Plebuch M et al., Increased resistance of tumor cells to daunorubicin after transfection of cDNAs coding for anthracycline inactivating enzymes. Cancer Lett. 2007 Sep

18;255(l):49-56.

[001062] 24. Tokunaga M et al., Active Hexose-correlated Compound Down-regulates Heat

Shock Factor 1, a Transcription Factor for HSP27, in Gemcitabine -resistant Human Pancreatic Cancer Cells. Anticancer Res. 2015 Nov;35(l l):6063-7.

[001063] 25. Li D et al., RECQ1 A159C Polymorphism Is Associated With Overall Survival of

Patients With Resected Pancreatic Cancer: A Replication Study in NRG Oncology Radiation Therapy Oncology Group 9704. Int J Radiat Oncol Biol Phys. 2016 Mar l;94(3):554-60.

[001064] 26. Peng B et al., Annexin A5 as a potential marker in tumors. Clin Chim Acta. 2014

Jan l;427:42-8.

[001065] 27. Zhong Y et al., Mutant p53 Together with TGF[i Signaling Influence Organ-

Specific Hematogenous Colonization Patterns of Pancreatic Cancer. Clin Cancer Res. 2017 Mar

15;23(6): 1607-1620.

[001066] 28. Wang Y et al., Proteomic differential display identifies upregulated vinculin as a possible biomarker of pancreatic cancer. Oncol Rep. 2012 Nov;28(5): 1845-50.

[001067] 29. Gong XG et al., Gemcitabine resistance induced by interaction between alternatively spliced segment of tenascin-C and annexin A2 in pancreatic cancer cells. Biol Pharm Bull. 2010;33(8): 1261-7.

[001068] 30. Razidlo GL et al., Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42. J Biol Chem. 2018 Jul 13;293(28): 11143-11153.

[001069] 31. Felix K et al. Identification of Novel Serum Autoantibodies for Differential

Diagnosis of Autoimmune Pancreatitis and Pancreatic Ductal Adenocarcinoma. Pancreas. 2016

Oct;45(9): 1309-19.

[001070] 32. Burkhart RA et al., HuR is a post-transcriptional regulator of core metabolic enzymes in pancreatic cancer. RNA Biol. 2013 Aug; 10(8): 1312-23.

[001071] 33. Jhaveri DT et al., Using Quantitative Seroproteomics to Identify Antibody

Biomarkers in Pancreatic Cancer. Cancer Immunol Res. 2016 Mar;4(3):225-33.

[001072] 34. Liao Q et al., COMP is selectively up-regulated in degenerating acinar cells in chronic pancreatitis and in chronic-pancreatitis-like lesions in pancreatic cancer. Scand J Gastroenterol. 2003 Feb;38(2):207-15.

[001073] 35. Yao W et al., Profilin-1 suppresses tumorigenicity in pancreatic cancer through regulation of the SIRT3-HIFla axis. Mol Cancer. 2014 Aug 7;13: 187.

[001074] 36. Khalaileh A et al., Phosphorylation of ribosomal protein S6 attenuates DNA damage and tumor suppression during development of pancreatic cancer. Cancer Res. 2013 Mar 15;73(6): 1811-20.

[001075] 37. Yu L et al., Rabl la sustains GSK3 /Wnt/ -catenin signaling to enhance cancer progression in pancreatic cancer. Tumour Biol. 2016 Oct;37(10): 13821-13829. Epub 2016 Aug 1. [001076] 38. Li X et al., The presence of IGHG1 in human pancreatic carcinomas is associated with immune evasion mechanisms. Pancreas. 2011 Jul;40(5):753-61.

[001077] 39. Kim YR et al., Leukotriene B4 induces EMT and vimentin expression in PANC-1 pancreatic cancer cells: Involvement of BLT2 via ERK2 activation. Prostaglandins Leukot Essent Fatty Acids. 2016 Dec;l 15:67-76.

[001078] 40. Lister A et al., Nrf2 is overexpressed in pancreatic cancer: implications for cell proliferation and therapy. Mol Cancer. 2011 Apr 13 ; 10:37.

[001079] 41. Brandi J et al., The antioxidant uncoupling protein 2 stimulates hnRNPA2/Bl,

GLUT1 and PKM2 expression and sensitizes pancreas cancer cells to glycolysis inhibition. Free Radio Biol Med. 2016 Dec;101:305-316.

[001080] 42. Yu LM et al., High calpain-1 expression predicts a poor clinical outcome and contributes to tumor progression in pancreatic cancer patients. Clin Transl Oncol. 2018 Dec 18.

[001081] 43. Topalovski M et al., Matrix control of pancreatic cancer: New insights into fibronectin signaling. Cancer Lett. 2016 Oct 10;381(l):252-8.

[001082] 44. Qi ZH et al., RIPK4/PEBP1 axis promotes pancreatic cancer cell migration and invasion by activating RAF1/MEK/ERK signaling. Int J Oncol. 2018 Apr;52(4): 1105-1116.

[001083] 45. Song D et al., Antitumor activity and molecular effects of the novel heat shock protein 90 inhibitor, IPI-504, in pancreatic cancer. Mol Cancer Ther. 2008 Oct;7(10):3275-84.

[001084] 46. Takata T et al., Characterization of proteins secreted by pancreatic cancer cells with anticancer drug treatment in vitro. Oncol Rep. 2012 Dec;28(6): 1968-76.

[001085] 47. Zhao T et al., LASPI is a HIFla target gene critical for metastasis of pancreatic cancer. Cancer Res. 2015 Jan 1 ;75(1): 111-9.

[001086] 48. Desai SS et al., Pro-oncogenic Roles of HLXB9 Protein in Insulinoma Cells through Interaction with Nono Protein and Down-regulation of the c-Met Inhibitor Cblb (Casitas B- lineage Lymphoma b). J Biol Chem. 2015 Oct 16;290(42):25595-608.

[001087] 49. Lin H et al., Clinical significance of pituitary tumor transforming gene 1 and transgelin-2 in pancreatic cancer. Int J Immunopathol Pharmacol. 2013 Jan-Mar;26(l): 147-56.

[001088] 50. Chay D et al., ER-60 (PDIA3) is highly expressed in a newly established serous ovarian cancer cell line, YDOV-139. Int J Oncol. 2010 Aug;37(2):399-412.

[001089] 51. Dakhel S et al., S100P antibody -mediated therapy as a new promising strategy for the treatment of pancreatic cancer. Oncogenesis. 2014 Mar 17;3:e92.

[001090] 52. Yang CA et al., G6PD as a predictive marker for glioma risk, prognosis and chemosensitivity. J Neurooncol. 2018 Sep;139(3):661-670.

[001091] 53. Knecht KM et al., The structural basis for cancer drug interactions with the catalytic and allosteric sites of SAMHD1. Proc Natl Acad Sci U S A. 2018 Oct 23; 115(43):E10022- E10031. [001092] 54. Yang D et al., Intcgrinfl 1 modulates tumour resistance to gemcitabine and serves as an independent prognostic factor in pancreatic adenocarcinomas. Tumour Biol. 2016 Sep;37(9): 12315- 12327. Epub 2016 Jun 11.

[001093] 55. Wong FY et al., Combination therapy with gossypol reveals synergism against gemcitabine resistance in cancer cells with high BCL-2 expression. PLoS One. 2012;7(12):e50786.

[001094] 56. Miyamoto H et al., Tumor-stroma interaction of human pancreatic cancer:

acquired resistance to anticancer drugs and proliferation regulation is dependent on extracellular matrix proteins. Pancreas. 2004 Jan;28(l):38-44.

[001095] 57. Zhao F et al., MicroRNA-133b suppresses bladder cancer malignancy by targeting TAGFN2-mediated cell cycle. J Cell Physiol. 2019 Apr;234(4):4910-4923.

[001096] 58. Mu HN et al., Caffeic acid attenuates rat liver injury after transplantation involving PDI A3 -dependent regulation of NADPH oxidase. Free Radio Biol Med. 2018 Dec;129:202-214.

[001097] 59. Slattery MF et al., Oxidative balance and colon and rectal cancer: interaction of lifestyle factors and genes. Mutat Res. 2012 Jim l;734(l-2):30-40.

[001098] 60. Xu W et al., HIF-2a, acting via miR-191, is involved in angiogenesis and metastasis of arsenite-transformed HBE cells. Toxicol Res (Camb). 2015 Nov 6;5(l):66-78.

[001099] 61. Foftus SK et al., Hypoxia-induced HIFla targets in melanocytes reveal a molecular profile associated with poor melanoma prognosis. Pigment Cell Melanoma Res. 2017

May;30(3):339-352.

[001100] 62. Kanazawa H et al., Canstatin inhibits hypoxia-induced apoptosis through activation of inte grin/focal adhesion kinase/ Akt signaling pathway in H9c2 cardiomy oblasts. PFoS One. 2017 Feb 24;12(2):e0173051.

[001101] 63. Yoo JJ et al., Differential sensitivity of hepatocellular carcinoma cells to suppression of hepatocystin transcription under hypoxic conditions. J Bioenerg Biomembr. 2016

Dec;48(6):581-590.

[001102] 64. Nandal A et al., Activation of the HIF prolyl hydroxylase by the iron chaperones

PCBP1 and PCBP2. Cell Metab. 2011 Nov 2; 14(5): 647-57.

[001103] 65. Kim YJ et al., Hypoxia-mediated mechanism of MUC5AC production in human nasal epithelia and its implication in rhinosinusitis. PFoS One. 2014 May 19;9(5):e98136.

[001104] 66. Daniliuc S et al, Hypoxia inactivates inducible nitric oxide synthase in mouse macrophages by disrupting its interaction with alpha-actinin 4. J Immunol. 2003 Sep 15 ; 171 (6):3225-32.

[001105] 67. Mofid A et al., Cardiac Overexpression of SI 00 A6 Attenuates Cardiomy ocyte

Apoptosis and Reduces Infarct Size After Myocardial Ischemia-Reperfusion. J Am Heart Assoc. 2017 Feb 7;6(2).

[001106] 68. Ekman M et al., HIF-mediated metabolic switching in bladder outlet obstruction mitigates the relaxing effect of mitochondrial inhibition. Fab Invest. 2014 May;94(5):557-68. [001107] 69. Gomez-Roman N et al. Hypoxia-inducible factor 1 alpha is required for the tumourigenic and aggressive phenotype associated with Rab25 expression in ovarian cancer. Oncotarget. 2016 Apr 19;7(16):22650-64.

[001108] 70. Jiang X et al., Role of Ran-regulated nuclear-cytoplasmic trafficking of pVHL in the regulation of microtubular stability -mediated HIF-Ia in hypoxic cardiomyocytes. Sci Rep. 2015 Mar 17;5:9193.

[001109] 71. Romero-Garcia S et al., Transcriptional analysis of hnRNPAO, Al, A2, Bl, and

A3 in lung cancer cell lines in response to acidosis, hypoxia, and serum deprivation conditions. Exp Lung Res. 2014 Feb;40(l): 12-21.

[001110] 72. Heinrich EM et al., Regulation of miR-17-92a cluster processing by the microRNA binding protein SND1. FEBS Lett. 2013 Aug 2;587(15):2405-11.

[001111] 73. Chang YC et al., Feedback regulation of ALDOA activates the HIF-la/MMP9 axis to promote lung cancer progression. Cancer Lett. 2017 Sep 10;403:28-36.

[001112] 74. Bucher F et al., Hyperoxia causes reduced density of retinal astrocytes in the central avascular zone in the mouse model of oxygen-induced retinopathy. Mol Cell Neurosci. 2013 Sep;56:225-33.

[001113] 75. Seubwai W et al., Hypoxia enhances aggressiveness of cholangiocarcinoma cells.

Asian Pac J Cancer Prev. 2012;13 Suppl:53-8.

[001114] 76. Chettimada S et al., Hypoxia-induced glucose-6-phosphate dehydrogenase overexpression and -activation in pulmonary artery smooth muscle cells: implication in pulmonary hypertension. Am J Physiol Lung Cell Mol Physiol. 2015 Feb l;308(3):L287-300.

[001115] 77. Minchenko OH et al., Inhibition of IRE1 modifies hypoxic regulation of G6PD,

GPI, TKT, TALDOl, PGLS and RPIA genes expression in U87 glioma cells. Ukr Biochem J. 2017 Jan- Feb;89(l):38-49.

[001116] 78. Ma B et al., Zyxin-Siah2-Lats2 axis mediates cooperation between Hippo and

TGF-b signalling pathways. Nat Commun. 2016 Mar 31;7: 11123.

[001117] 79. Tak E et al., Human carbonyl reductase 1 upregulated by hypoxia renders resistance to apoptosis in hepatocellular carcinoma cells. J Hepatol. 2011 Feb;54(2):328-39.

[001118] 80. Appel S et al., CNN3 regulates trophoblast invasion and is upregulated by hypoxia in BeWo cells. PLoS One. 2014 Jul 22;9(7):el03216.

[001119] 81. Niu X et al., The von Hippel-Lindau tumor suppressor protein regulates gene expression and tumor growth through histone demethylase JARID1C. Oncogene. 2012 Feb 9;31(6):776- 86

[001120] 82. Misra A et al., Hypoxia activated EGFR signaling induces epithelial to mesenchymal transition (EMT). PLoS One. 2012;7(l l):e49766.

[001121] 83. Miroshnikova YA et al. , T issue mechanics promote IDH 1 -dependent HIF 1 a- tenascin C feedback to regulate glioblastoma aggression. Nat Cell Biol. 2016 Dec;18(12): 1336-1345. [001122] 84. Wang J et al., Proteomic analysis reveals that proteasome subunit beta 6 is involved in hypoxia-induced pulmonary vascular remodeling in rats. PLoS One. 2013 Jul 3;8(7):e67942.

[001123] 85. Applebaum MA et al., Integrative genomics reveals hypoxia inducible genes that are associated with a poor prognosis in neuroblastoma patients. Oncotarget. 2016 Nov 22;7(47):76816- 76826.

[001124] 86. Tatrai E et al., Cell type-dependent HIF1 a-mediated effects of hypoxia on proliferation, migration and metastatic potential of human tumor cells. Oncotarget. 2017 Jul

4;8(27):44498-44510.

[001125] 87. Wang F et al., Rab6A GTPase contributes to phenotypic modulation in pulmonary artery smooth muscle cells under hypoxia. J Cell Biochem. 2018 Nov 11.

[001126] 88. Fu Y et al., Glucose-6-Phosphate Isomerase (G6PI) Mediates Hypoxia-Induced

Angiogenesis in Rheumatoid Arthritis. Sci Rep. 2017 Jan 9;7:40274.

[001127] 89. Yu H et al., Hypoxia decrease expression of cartilage oligomeric matrix protein to promote phenotype switching of pulmonary arterial smooth muscle cells. Int J Biochem Cell Biol. 2017 Oct;91(Pt A):37-44.

[001128] 90. Fan Y et al., Profilin-1 phosphorylation directs angiocrine expression and glioblastoma progression through HIF-Ia accumulation. Nat Cell Biol. 2014 May;16(5):445-56.

[001129] 91. Przyklenk A et al., Effects of Endurance Exercise Bouts in Hypoxia, Hyperoxia, and Normoxia on mTOR-Related Protein Signaling in Human Skeletal Muscle. J Strength Cond Res.

2018 Jul 17.

[001130] 92. Kaitu'u-Eino TJ et al., Activating Transcription Factor 3 Is Reduced in

Preeclamptic Placentas and Negatively Regulates sFlt-1 (Soluble fms-Fike Tyrosine Kinase 1), Soluble Endoglin, and Proinflammatory Cytokines in Placenta. Hypertension. 2017 Nov;70(5): 1014-1024.

[001131] 93. Kidd ME et al., The role of vimentin intermediate filaments in the progression of lung cancer. Am J Respir Cell Mol Biol. 2014 Jan;50(l): l-6.

[001132] 94. Kim A., Intracellular oxygen determined by respiration regulates localization of

Ras and prenylated proteins. Cell Death Dis. 2015 Jul 16;6:el825.

[001133] 95. Pahima H et al., Hypoxic-induced truncation of voltage-dependent anion channel

1 is mediated by both asparagine endopeptidase and calpain 1 activities. Oncotarget. 2018 Jan

31 ;9(16): 12825- 12841.

[001134] 96. Olbryt M et al., Melanoma-associated genes, MXI1, FN1, and NME1, are hypoxia responsive in murine and human melanoma cells. Melanoma Res. 2011 Oct;21(5):417-25.

[001135] 97. Gluck AA et al., Identification of a MET-eIF4Gl translational regulation axis that controls HIF-Ia levels under hypoxia. Oncogene. 2018 Jul;37(30):4181-4196.

[001136] 98. Pierrat OA et al., The exon junction complex senses energetic stress and regulates contractility and cell architecture in cardiac myocytes. Biosci Rep. 2017 Jul 7;37(4).

[001137] 99. Burgula S et al., Downregulation of PEBP1 in rat brain cortex in hypoxia. J Mol

Neurosci. 2010 May;41(l):36-47. [001138] 100. Ren Y et al., Irradiation of Epithelial Carcinoma Cells Upregulates Calcium-

Binding Proteins That Promote Survival under Hypoxic Conditions. J Proteome Res. 2016 Dec

2;15(12):4258-4264. Epub 2016 Nov 10.

[001139] 101. Guo C et al., Intranasal Lactoferrin Enhances a-Secretase-Dependent Amyloid

Precursor Protein Processing via the ERK1/2-CREB and HIF-Ia Pathways in an Alzheimer's Disease Mouse Model. Neuropsychopharmacology. 2017 Dec;42(13):2504-2515.

[001140] 102. Zhao T et al., LASPI is a HIFla target gene critical for metastasis of pancreatic cancer. Cancer Res. 2015 Jan 1 ;75(1): 111-9.

[001141] 103. Kim IG et al., Hypoxia-inducible transgelin 2 selects epithelial-to-mesenchymal transition and g-radiation-resistant subtypes by focal adhesion kinase-associated insulin-like growth factor 1 receptor activation in non-small-cell lung cancer cells. Cancer Sci. 2018 Nov;109(l l):3519-3531.

[001142] Although preferred embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.