OLIGONUCLEOTIDE SEQUENCES FOR DETECTION OF LOW ABUNDANCE

TARGET SEQUENCES AND KITS THEREOF

CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. Provisional Applications No. 62/339,537, filed May 20, 2016, and 62/370,924, filed August 4, 2016, both of which are incorporated by reference herein in their entirety.

BACKGROUND OF THE DISCLOSURE

(1) Field of the invention

The present invention generally relates to compositions and methods for detecting specific nucleotide sequences in a sample. More specifically, provided are assay methods and oligonucleotide compositions for detecting a target nucleic acid sequence in a sample containing similar wild-type sequences.

(2) Description of the related art

Many diseases and especially cancers are associated with genetic mutations such as single point mutations, small base pair insertions/deletions and the like. Almost all current methods for detection of these alleles rely on polymerase chain reaction (PCR) employing select primer sequences. However, a major limitation of PCR-based methods is their low sensitivity and preferential amplification of normal (wild type) sequences due to the greater relative abundance of the wild type sequences over mutant sequences within a sample. Often, detection of a mutant allele is not possible until it represents greater than 1-10% of the total alleles present. Thus, the ability to detect genetic mutations in a background of wild type DNA sequence where the variant sequence is present at a low percentage relative to non- variant (target) sequence is beneficial and highly desired.

Modified PCR methods allowing selective amplification of mutant genes without requiring post-amplification sequencing assays have been described. Such methods include restriction endonuclease-mediated selective PCR (see, e.g., Ward et al., 1998, Am J Pathol 153:373-379), locked nucleic acids (see, e.g., Sun et al., 2002, Nat Biotechnol 20:186-189) COLD-PCR (Li, J., et al., 2008, Nat Med 14:579-584; US Patent Publication 2013/0149695; US Patent 8,623,603; US Patent 8,455,190; PCT Patent Publication WO2003072809). The COLD- PCR technique is relatively simple to perform, but has a low amplification factor (3-100x) and a low sensitivity towards minute temperature changes (Li, J., et al., 2008, Id.).

Quantitative threefold allele-specific PCR (QuanTAS-OCR), an assay for detection of minimal residual disease employing quantitative PCR has been recently described, but thus far only for the mutant allele JAK2 V617F associated with myeloproliferative neoplasms (Zapparoli et al. BMC Cancer 2013, 13:206; http://www.biomedcentral.com/1471-2407/13/206).

Nucleic acids in cancerous tissues, circulating cells, and cell-free (cf) nucleic acids present in bodily fluids can aid in identifying and selecting individuals with cancer or other diseases associated with such genetic alterations. Mutations in BRAF, KRAS and EGFR are examples of genetic alterations that confer a survival and growth advantage to cancer cells and can be used for selection of targeted cancer therapies. However, in a tumor or cell-free DNA, the alterations are frequently present with a large excess of non-altered, wild type sequences making detection difficult. See, e.g., Spindler et al., 2012, Clin. Cancer Res. 18:1177-1185; Benesova et al., 2013, Anal. Biochem. 433:227-234; Dawson et al., 2013, N. Eng. J. Med. 368:1199-1209; Forshew et al., 2012, Sci. Trans. Med. 4:1-12; Shaw et al., 2012, Genome Res. 22:220-231. Some data suggest that the amount of mutant DNA in blood correlates with tumor burden and can be used to identify the emergence of resistant mutations (Forshew et al., 2012, Id.; Murtaza et al., 2013, Nature 497:108-112; Dawson et al., 2013, Id.; Diaz et al., 2012, Nature 486:537-540; Misale et al., 2012, Nature 486:532-536; Diehl et al., 2008, Nat. Med. 14:985-990).

There is a need for additional molecular tools and methods whereby greater sensitivity and detection of low abundance target sequences can be achieved with efficiency and ease. The present invention addresses that need.

SUMMARY OF THE DISCLOSURE

The instant disclosure is based in part on the development of methods for amplification of short target sequences in cell-free nucleic acids in a biological sample, e.g., blood or urine, for example low-abundance nucleic acid sequences (e.g., a target sequence) such as altered, mutant, non-wild type nucleic acid sequences or other nucleic acids not normally present in biological samples having a background of native nucleic acid sequences. These cell-free nucleic acids are generally in the range of 40-400 bp, so assays that amplify a short nucleic acid sequence, for example, 200 base pairs (bp) or less, 110 bp or less (e.g., 51-110 bp, as described in US Patent Publication 2016/0002740), or 50 bp or less (e.g., 20-50 bp, as described in US Patent Publication 2010/0068711) can advantageously be utilized to achieve greater sensitivity than assays that amplify a longer sequence. However, the methods are also applicable for amplification of less fragmented sequences, such as, for example, more than 400 bp.

Thus, in some embodiments, an oligonucleotide comprising a sequence of any one of SEQ ID NOs:l-34 is provided.

Also provided is a composition comprising a set of two primers for detecting a sequence encoding a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13. In these embodiments, at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , or 32.

Also provided is a method of detecting a specific mutant nucleic acid sequence in a sample of a bodily fluid, where the sample comprises a nucleic acid comprising a specific wild- type nucleic acid sequence that differs from the specific mutant nucleic acid sequence by at least one nucleotide. The method comprises

preparing a reaction mixture comprising

nucleic acids from the sample, and

the above composition;

subjecting the reaction mixture to one or more cycles of an amplification reaction to create amplified sample nucleic acids; and

detecting the specific mutant nucleic acid in the amplified sample nucleic acids. In these methods, the specific mutant nucleic acid sequence encodes a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13.

Additionally provided is a method of detecting a secondary mutation in a cancer in a subject, where the cancer has a first mutation. The method comprises obtaining a sample of a bodily fluid from the subject; and testing for the presence of the second mutation in the cancer by the above method.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 illustrates aspects of various embodiments of invention methods.

FIG. 2 illustrates one embodiment of use of a composition provided in the present disclosure in a method for enrichment and detection of a low-abundance target sequence (EGFR Exon 19 deletion) within a high background of wild type sequence.

FIG. 3 illustrates one embodiment of use of a composition provided in the present disclosure in a method for enrichment and detection of a low-abundance target sequence (EGFR Exon 20 T790M) within a high background of wild type sequence.

FIG. 4 illustrates one embodiment of use of a composition provided in the present disclosure in a method of a low abundance target enrichment assay for KRAS Exon 2 mutations.

FIG. 5 is a graph showing quantitation of KRAS G12/13 mutant fragments in clinical samples and analytical DNA blend samples.

FIG. 6 is graphs of urinary mutant KRAS and sum of longest tumor diameters (SLD) for 8 cancer patients at various dates. PD = progressive disease; SD = stable disease; PR=partial response.

FIG. 7A and 7B are an illustration and graphs outlining aspects of the Enrichment PCR- NGS assays used in Example 6. FIG. 7A illustrates the assay design; FIG. 7B shows the mutant allele fold-enrichment estimates.

FIG. 8 is graphs showing T790M clinical sensitivity and DNA yield from urine of different volumes.

FIG. 9 is graphs showing concordance between determinations of T790M in tissue vs. two different volumes of urine.

FIG. 10 is an illustration of a clinical study design using a mutation enrichment PCR - next generation sequencing assay for detecting KRAS G12/13 mutants in the urine of colorectal cancer patients. FIG. 11 is a graph showing percentage change from baseline (before treatment) of KRAS G12/13 mutants in urine (left bars) and tumor size (right bars) of five patients with KRAS exon 2 mutation-positive colorectal cancer treated with FOLFOX.

FIG. 12 is a graph showing urinary KRAS G12/13 mutants at two- week intervals in four patients treated with FOLFOX.

FIG. 13 is a graph showing urinary KRAS G12/13 mutants in a patient superimposed with treatment data and results by imaging.

FIG. 14 is graphs showing quantification of EGFR mutant and Wild-Type DNA blends by mutation enrichment NGS. The analysis is of a dilution series of indicated mutant EGFR variants spiked into 60 ng (~ 18, 180 GEq) of WT DNA. An analysis algorithm was applied to transform the mutant EGFR sequencing reads into the absolute mutant copies detected. The box-and- whisker plots show the median (center line), 25th and 75th percentiles (box) with the connecting "whiskers" extending from the first quartile minus 1.5 of the interquartile range (IQR, the third quartile less the first quartile) and the third quartile plus 1.5 of the IQR.

FIG. 15 is a Venn diagram showing T790M-positive status of 60 cases with available matched tumor, plasma and urine specimens. Four cases not identified as T790M-positive by either tumor, plasma or urine are not depicted in the diagram.

FIG. 16A and 16B is graphs showing the dynamics of T790M cfDNA signal in urine of patients treated with rociletinib, a third generation anti-EGFR Tyrosine Kinase Inhibitor drug targeting T790M mutation positive tumors. FIG 16A shows T790M presence in patients with partial response or stable disease. FIG. 16B shows T790M presence in patients with progressive disease.

DETAILED DESCRIPTION OF THE INVENTION

Blood and urine have emerged as ideal diagnostic specimens to monitor tumor genomic changes and tumor dynamics through the detection of cell-free tumor DNA (e.g., circulating tumor DNA [ctDNA] or transrenal DNA). Those bodily fluids are also useful for monitoring transplant rejections and chronic infections such as HIV, HCV, herpes, tuberculosis or parasitic infections, and the efficacy of treatments therefor. Use of the compositions and methods of the present invention provide the ability to rapidly determine response to therapy in cancer patients, transplant patients and patients infected with a chronic infectious disease in a non-invasive manner and with a high level of sensitivity, specificity and ease. For example, in a biomarker study, circulating tumor DNA having EGFR activating and resistance mutations was detectable in ctDNA from patient urine months before progression on anti-EGFR TKI. (See, e.g., Kinetic Monitoring of EGFR and KRAS mutations in Urinary Circulating Tumor DNA Predicts Radiographic Progression and Response in Patients with Metastatic Lung Adenocarcinoma Collaborating Institution: University of California, San Diego School of Medicine, Hatim Husain, M.D. Poster Presentation September 27, 2015 European Cancer Congress 2015).

Provided are compositions and methods for detecting sequences, for example low abundance mutant sequences, in cell-free DNA using polymerase chain reaction (PCR) amplification of short (e.g., less than 50 nt) target sequences.

Also provided are nucleic acid sequence amplification protocols using the primers described herein to amplify short target sequences in nucleic acids in biological samples.

As used herein, the term "target sequence" refers to a nucleic acid that is in low- abundance or is less prevalent in a nucleic acid sample than a corresponding wild type sequence. In one embodiment, the target sequence will make up less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the total amount of wild-type sequence plus target sequence in a sample. The target sequence may be an abnormal or mutant allele. In those embodiments, the target sequence is a "specific mutant nucleic acid sequence".

In one embodiment, the target sequence must have, for example, at least 50% (but may be at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or greater) in homology to the corresponding wild-type sequence, but must differ by at least one nucleotide from the wild-type sequence. It is understood in the art that an oligonucleotide need not be 100% complementary to its target DNA sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when there is a sufficient degree of complementarity to avoid nonspecific binding of the oligonucleotide to non-target sequences under conditions wherein specific binding is desired. Target sequences are amplifiable via PCR with the same pair of primers as those used for the wild-type sequence, but need not be so restricted. Target sequences may also be amplifiable via PCR with primer pairs not used for the wild-type sequence so long as the primers are selected to amplify at the region of the sequence containing the target sequence.

As used herein, the term "wild-type sequence" refers to a nucleic acid that is more prevalent in a nucleic acid sample than a corresponding target sequence. In one embodiment, the wild-type sequence makes up over 50% of the total wild-type plus target sequences in a sample. Alternatively, the wild-type sequence is expressed at the DNA and/or RNA level at 10x, 15x, 20x, 25x, 30x, 35x, 40x, 45x, 50x, 60x, 70x, 80x, 90x 100x, 150x, 200x or more than the target sequence. As used herein, a "wild-type strand" refers to a single nucleic acid strand of a double- stranded wild-type sequence. Where the target sequence is a specific mutant nucleic acid sequence, the wild-type sequence is the wild type version of the mutant sequence. Where the target sequence is from another individual, e.g., when detecting an allogeneic transplant-specific sequence in the recipient, or when detecting a fetus-specific sequence in a maternal subject's urine or plasma, the "wild-type sequence" is the sequence from the subject/sample donor.

As used herein, the term "amplicon" refers to a nucleic acid that is the product of amplification. Thus an amplicon may be homologous to a wild-type sequence, a target sequence, or any sequence of nucleic acid that has been subjected to amplification. Generally, within a reaction sample, the concentration of an amplicon sequence will be significantly greater than the concentration of original template nucleic acid sequence.

As used herein, "homology" refers to the subunit sequence similarity between two polymeric molecules, e.g., two polynucleotides or two polypeptides. An example of an algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively.

As used herein, the term "wild type" refers to the most common or native polynucleotide sequence or allele for a certain gene in a population. Generally, the wild type allele is from normal cells.

As used herein, the term "mutant" refers to a nucleotide change (i.e., a single or multiple nucleotide substitution, deletion, or insertion) in a nucleic acid sequence from a wild type sequence. A nucleic acid that bears a mutation has a nucleic acid sequence (mutant allele) that is different in sequence from that of the corresponding wild type polynucleotide sequence.

The oligonucleotides of these embodiments that comprise any one of SEQ ID NOs 1-34 are useful as primers in various embodiments of the assay methods described herein.

A "primer sequence" includes nucleic acid sequences of about 9 - 30 bp, or about 10-25 bp, or about 11-22 bp or about 13-16 bp in length. A primer sequence is a synthetically engineered nucleic acid sequence that anneals to opposite strands of a target and wild-type sequence so as to form an amplification product during a PCR reaction. The target and the wild- type sequence can be about 25 bases or more, about 30 bases or more, about 35 bases or more, about 40 bases or more, or greater than about 45 bases, in order to facilitate primer attachment.

A primer sequence may include a common sequence tag ("CS-tag"), also called a "common sequence" ("CS"). Common sequences are part of adapters and facilitate massively parallel PCR amplification and sequencing of multiple target amplicons and samples. Adapters are platform-specific engineered nucleic acid sequences that facilitate downstream analysis and quantitation by next generation high-throughput sequencing (NGS). Adapters can also include "barcodes" or "indices" to identify individual samples, as is known in the art. Adapters may be about 6-80 nucleotides, 15-30 nt, about 20-25 nt, or about 18-23 nt in length. Non-limiting examples of such CS-tags include CSl ACACTGACGACATGGTTCTACA (SEQ ID NO: 1) and CS2 TACGGTAGCAGAGACTTGGTCT (SEQ ID NO: 2) (Fluidigm, South San Francisco, CA US), or any equivalent region from any adaptor compatible with an NGS platform, including any adapter provided in Illumina Adapter Sequences/Oligonucleotide sequences (© 2016 Mumina, Inc.), as used in the Examples with a MiSeq system (Illumina, Inc., San Diego, CA, US) with platform specific "P5" and "P7" sequences; any adapter useful for an Ion Torrent™ system (Thermo Fisher Scientific, Waltham, MA, US), e.g., Adapter PI, Adapter A, and/or Adapter A with a barcode, listed, e.g., at Application Note - Amplicon Sequencing, Ion Torrent, 2011, Life Technologies Corporation and BarcodeUpload.csv at https://ioncommunity.thermofisher.com/docs/DOC-2346.

As used herein, "primer pair" refers to two primer sequences designed so as to anneal to and extend from complementary nucleic acid strands and may be up to about 10 base pairs in length or more, about 15 base pairs in length or more, about 20 base pairs in length or more, about 35 base pairs in length or more, about 40 base pairs in length or more, about 45 base pairs in length or more, or between about 10 to about 60 base pairs in length. A primer can include a CS- tag that is non-homologous to the target sequence. Subsequent to initial rounds of amplification, the CS-tag ("synthetic tail") is incorporated into the resulting amplicon. The CS-tag aids as a bridge sequence. Subsequent to initial rounds of amplification, sequencing adapters may also be incorporated in additional amplification to aid in subsequent sequencing reactions. For example, CS-tag sequences may be, if desired, one or more common sequence allowing sequencing adapters to attach or bind. Such adapters may be standard reagents and have indexes ("labels") while having partial complementarity to the initial CS-tag. If desired, CS tags and adapters may be the same for each assay and may have fixed length, thereby allowing their use with a variety of target sequences.

In various embodiments, the primer comprises a modified nucleotide moiety, a non- nucleotide moiety and/or additional nucleotides to form a sequence with the oligonucleotide that does not occur in nature (e.g., an adapter sequence). In some of these embodiments, the primer comprises a fluorescent molecule, a modified nucleotide (e.g., an XNA), or a phosphoramidite spacer.

The skilled artisan can determine useful primers for PCR amplification of any mutant sequence for any of the methods described herein. In some embodiments, the PCR amplifies a sequence of less than about 50 nucleotides (nt), e.g., 20-50 nt as described in US Patent Publication US/2010/0068711, or 50-110 nt, as described in US Patent Publication 2016/0002740. In other embodiments, the PCR is performed using a blocking oligonucleotide that suppresses amplification of a wild type version of the gene, e.g., as described in US Patent 8,623,603 or PCT Patent Publication WO 2015/073163. In some embodiments, one or more primers contains an exogenous or heterologous sequence (such as an adapter or "tag" sequence), as is known in the art, such that the resulting amplified molecule has a sequence that is not naturally occurring.

A disclosed primer pair are two oligonucleotide primers wherein each contains a sequence at its 3'-end that is complementary to one strand of a duplex target sequence. Additionally, one or both of the oligonucleotide primers contain a heterologous sequence at its 5'-end that is not found in the target sequence. The heterologous sequence may be artificial, synthetic, manmade, or from a source that is exogenous to the target sequence. The use of such a primer results converts the target sequence into a chimeric molecule that is artificial and the result of performing the disclosed synthesis of nucleic acid molecules. A primer may be up to 45 bp or about 9 - 30, about 10-25, about 11-22 or about 13-16 bp in length. A primer may include an adapter sequence. An adapter sequence may be about 15 - 30 bp, about 20-25 bp or about 18-23bp in length.

The present invention is also directed to composition comprising a set of two primers for detecting a sequence encoding a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13. In these embodiments, at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32. In some embodiments, at least one of the two primers comprises a modified nucleotide moiety, or a non-nucleotide moiety.

In some of these embodiments, at least one of the two primers comprises a fluorescent molecule, a modified nucleotide, or a phosphoramidite spacer. Additionally, in some embodiments, at least one of the two primers comprises an XNA, and/or an adapter sequence.

In various embodiments, both primers comprise an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

In specific embodiments, the two primers comprise

(a) SEQ ID NO:3 and SEQ ID NO:4;

(b) SEQ ID NO:6 and SEQ ID NO:7;

(c) (SEQ ID NO:9 or SEQ ID NO: 10 or SEQ ID NO:l 1) and (SEQ ID NO: 12 or SEQ ID NO:13 or SEQ ID NO:14);

(d) SEQ ID NO: 15 and SEQ ID NO: 16;

(e) SEQ ID NO: 18 and SEQ ID NO: 19;

(f) (SEQ ID NO:21 or SEQ ID NO:22 or SEQ ID NO:23 or SEQ ID NO:24) and (SEQ ID NO:25 or SEQ ID NO:26 or SEQ ID NO:27 or SEQ ID NO:28); or (g) (SEQ ID NO:29 or SEQ ID NO:30) and (SEQ ID NO:31 or SEQ ID NO:32).

The low abundance target sequence, amplified using the primers described herein, can be identified and, optionally, quantitated by any means known in the art.

In some embodiments, the target sequence is detected after amplification using a nucleic acid probe, as is known in the art. See, e.g., Wetmur 1991, Crit Rev Biochem Mol Biol 26: 227- 259. The probe can be immobilized, for example on a microarray, a gel, or another solid substrate, where the probe binds to PCR amplicons comprising the target sequence but not amplicons comprising the wild-type sequence.

In various embodiments, the probe is in solution. In some of these embodiments, the probe binds to amplicons having the target sequence as well as to amplicons having the wild-type sequence. The amplicons having the target sequence can then be interrogated using next- generation sequencing (NGS). In other embodiments, the probes bind to amplicons having the target sequence but not the wild-type sequence, and the probe-target sequence complex is separated from the wild-type sequence, and the separated probe-target sequence is identified and optionally quantified. See, e.g., U.S. Patent 8,529,744.

These probes can be of any length useful to carry out the detection of the target sequence. In various embodiments, the probe is about the same length or longer than the amplicon having the target sequence, for example 90%, 100%, 200%, 500%, 1000%, 2000%, or any length in between or longer, than the amplicon.

Cell-free nucleic acids can also be amplified using the primers described herein with methods and reagents that enrich for amplicons having the target sequence over amplicons having the wild-type sequence. A non-limiting example of such a method is described in PCT Patent Publication WO 2015/073163 and summarized in FIGS. 1 and 7 A.

A blocker sequence, homologous to a wild-type sequence but not to a mutant sequence, preferentially binds to the wild-type sequence, sterically preventing the annealing or extension of primers in the wild-type sequence but not the mutant sequence. Thus, over several PCR cycles, the sample is enriched for the mutant sequence over the wild-type sequence. In that assay, the denaturation step of the PCR cycle is above the calculated Tm below which the blocker anneals to the wild-type sequence. As the temperature cools, the blocker binds to the wild-type strand before the primers, since the primer Tm is designed to be below the blocker-wild-type Tm. As the temperature continues to cool, primers anneal and immediately extend on both mutant strands. The blocker binding to the mutant strands (which occurs at a lower temperature) is further prevented by the annealed and extended primers. The blocker thus prevents extension of the wild- type sequence but not the mutant sequence.

Also provided are specific oligonucleotides, comprising a sequence of any one of SEQ ID NOs: 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32, useful as primers or blockers for practicing the above assays. The sequences are also listed in Example 3 below. They are useful in the above assays for detecting a sequence encoding a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13.

The oligonucleotides of these embodiments that comprise any one of SEQ ID NOs: 5, 8, 17, 20 or 33 are useful as wild-type blocking sequences in some embodiments of the assays described herein. Additional blockers can be determined without undue experimentation from an evaluation of the wild-type sequence corresponding to the mutant sequence. For example, a blocker for an assay for detecting an EGFR exon 20 mutation can be devised as an oligonucleotide comprising a sequence complementary to a portion of SEQ ID NO:34. Additionally, a blocker for an assay for detecting an EGFR exon 19 mutation can be devised as an oligonucleotide comprising a sequence complementary to a portion of SEQ ID NO:35.

As used herein, a "wild-type blocking sequence" (also referred to herein as "blocking sequence", "blocker", "wild-type blocking oligonucleotide", "blocking oligonucleotide", or "wild- type blocker") is an engineered single stranded or double stranded nucleic acid sequence that, in various assays described herein, is fully complementary to a section of a wild-type sequence (the "wild-type sequence") but not the corresponding mutant sequence (the "target sequence").

The wild-type blocking sequence is shorter than the amplicon sequence. Also, in most embodiments, the blocker does not exceed the length of a primer sequence. In various assays described herein, a wild-type blocking sequence is designed to allow a differential between the melting temperature of blocking sequence-wild-type sequence and melting temperature of blocking sequence-target mutant sequence, with the melting temperature of a primer in the reaction mixture being higher than the melting temperature of the blocking sequence-target mutant sequence. As would be apparent to one skilled in the art, the length of a wild-type blocking sequence has no maximum or upper limit as the kinetics of the method are based in part on a relationship between a primer-blocker binding temperature and a native-denatured conformation of a target nucleic acid. A blocker having a high melting temperature, and present in excess quantity in a reaction mixture, allows achievement of its preferential binding or annealing to a wild-type sequence. Both the high primer melting temperature and long primer length ensure efficient annealing and immediate extension on the target mutant template, prior to annealing of a blocker oligonucleotide to the target mutant template. Where a target:blocker melting temperature is lower or substantially lower due to nucleic acid sequence mismatch, a less favorable kinetics or binding rate ensues, allowing the forward or reverse primer to preferentially anneal to the target nucleic acid sequence relative to (or as compared to) the kinetics or rate of blocker binding/annealing to a target sequence. The kinetics of the enrichment assay are primer- and/or blocker-centric rather than based upon denaturation temperature of wild type sequence and mutant (target) sequences.

A "short blocker" or "short blocking sequence" is a wild-type blocking sequence having a shorter length than prior art blocking sequences. For example, a short blocking sequence, if desired, may have a length of about 30 bp or less, about 25 bp or less, about 20 bp or less, about 15 bp or less, about 14 bp or less, about 13 bp or less, about 12 bp or less, about 11 bp or less, about 10 bp or less, between about 10 bp and 80 bp in length, or any length in between. A short blocker sequence may include sequences having a melting temperature that is above the melting temperature of the wild-type sequence or a WT-WT duplex nucleotide strand. In certain examples, a short blocking sequence, when duplexed with a wild-type sequence, has a blocker:wild-type melting temperature that is greater than the melting temperature of at least one primer included in a reaction mixture. Short blocking sequences may be complementary to either the forward or reverse wild-type strand. Optionally, the short blockers have a melting temperature that is about at, or above, the melting temperature of its corresponding wild-type oligonucleotide sequence. Optionally, there may be some or partial overlap of the blocker sequence with the same-stranded primer sequence. Optionally, the short sequence blocking oligonucleotide may contain one or more non-natural amino acid (XNA) as desired and more fully described below.

The wild-type blocking oligonucleotide sequences may include a 3 '-end that is blocked to inhibit extension. Optionally, the 5' end of the same oligonucleotide may also be blocked. As a non-limiting example, the blocking oligonucleotide strand(s) may include a 5 '-end comprising a nucleotide that prevents 5' to 3' exonucleolysis by Taq DNA polymerases.

In yet additional embodiments, the wild-type blocking sequence may be (a) a single stranded nucleic acid wild-type blocking sequence; (b) a double-stranded nucleic acid wild-type blocking sequence which denatures to form single strand wild-type blocking sequences when the reaction mixture is heated to the first denaturing temperature; (c) a single stranded DNA, RNA, peptide nucleic acid (PNA), bridged nucleic acid (BNA), altritol nucleic acid (ANA), 1,5- anhydrohexitol nucleic acid (HNA), cyclohexane nucleic acid (CeNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), or locked nucleic acid (LNA), or any other xeno nucleic acid (XNA) now known or later discovered (see, e.g., Wang et al., 2013, Theranostics 3:395-408); or (d) a chimera between single stranded DNA, RNA, BNA, ANA, HNA, CeNA, TNA, GNA, PNA, LNA or another modified nucleotide or XNA.

The wild-type blocking sequence or short blocking sequence may be fully complementary with one strand of the wild-type sequence (between primer binding sites or partially overlapping the primer binding sites). The wild-type blocking sequence and short blocking sequence, in one embodiment, are shorter than the amplicon sequence.

A wild-type blocking sequence or short blocking sequence may also be designed so as to allow amplification of mutant fragments (amplicons) of any size length. Such blocking sequences are preferably designed so as to have a length sufficient to amplify short fragmented mutant nucleic acids such as those fragmented DNA sequences present in a cell-free DNA sample. A wild-type blocking sequence is preferably designed so as to allow a differential between the melting temperature of blocking sequence:wild-type sequence and melting temperature of blocking sequence:target mutant sequence and melting temperature of a primer in the reaction mixture. If desired, a phosphoramidite spacer may be included at one or both ends of a blocker sequence ("C3 Spacer" or "SpC3"). Such spacers allow creation of an "arm" to which another molecule may be attached, or may prevent blocker sequence from being extended by polymerase enzyme. Of course, as would be apparent to one skilled in the art, the length of a wild-type blocking sequence has no maximum or upper limit.

In various embodiments of the invention methods, the blocker has a length smaller than the amplified section of the target sequence. In some embodiments, the blocker overlaps with the portions of the wild-type sequence where the primers bind to the wild-type sequence. In some of these embodiments, the wild-type blocking sequence is only a few bases smaller than the amplified section of the wild-type sequence, so that the primers do not bind appreciably to the wild-type sequence due to blocking of the primer binding sites by the wild-type blocking sequence.

In various embodiments, a XNA (e.g., a BNA, an ANA, an HNA, a CeNA, a TNA, a GNA, a PNA, or an LNA) or another modified nucleotide is used in the blocking sequence at a position that flanks and/or includes the nucleotide in the wild-type sequence that differs from that in the target sequence. Such a construction will increase the difference in the melting temperature of the wild-type blocking sequence-wild-type sequence and the wild-type blocking sequence- target sequence heteroduplexes to further favor denaturation of wild-type blocking sequence- target sequence heteroduplexes at the denaturation temperature (T _sd ) and enrichment of the target sequence. Furthermore, XNA modifications may be added to other positions with the wild-type blocking sequence as to elevate and adjust the melting temperatures of the wild-type blocking sequence with the wild-type sequence and with the target-sequence.

If a modified nucleotide or XNA is present in the wild-type blocking sequence, the position of the modified nucleotide(s) or XNA may be selected to match at least one position where a mutation (i.e. a difference in sequence between the target and wild-type sequences) is suspected to be present. By selecting this position for incorporation of the modified nucleotide in the wild-type blocking sequence, the difference between the temperature needed to denature duplexes of the wild-type blocking sequence and the complementary wild-type strand and that required to denature heteroduplexes of the wild-type blocking sequence and the partially complementary target sequence is maximized. In various embodiments, more than one nucleotide is modified to further affect melting temperatures and enhance amplification reaction sensitivity. In some cases, the blocker contains DNA residues with one or more LNA nucleotides having a ribose sugar moiety that is "locked" in the 3'-endo conformation. The use of such an LNA blocking oligonucleotide may be used to increase the melting temperature of the oligonucleotide for both a wild-type sequence and target sequence of the disclosure.

In some aspects of a blocking sequence with an XNA, the position(s) of the XNA nucleotide on the chimeric blocking oligonucleotide is selected to match position(s) where mutations are suspected or known to be present, thereby increasing the difference between the temperature needed to denature heteroduplexes of the wild-type blocking sequence and target strands (wild-type:target) and the temperature needed to denature heteroduplexes of the wild-type blocking sequence and the complementary wild-type strand (wild-type: wild-type).

Also provided is a composition comprising one blocker oligonucleotide, and two primer oligonucleotides, each comprising one of the above sequences. In these embodiments, the three oligonucleotides are useful together in an assay for detecting a sequence encoding the mutation, e.g., as described herein.

Several combinations of three oligonucleotides work particularly well together in the assay methods described herein. Included are the three oligonucleotides in each of the following (a), (b), (c), (d), (e), (f), or (g) (forward primer, reverse primer and blocker, respectively):

(a) for KRAS G12 or G13 mutations: SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5;

(b) for EGFR T790M mutations: SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8;

(c) for EGFR exon 20 mutations (e.g., insertions): [SEQ ID NO:9 or SEQ ID NO: 10 or SEQ ID NO: 11], [SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14] and an oligonucleotide comprising a sequence complementary to a portion of SEQ ID NO:34;

(d) for EGFR L858R mutations: SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17;

(e) for EGFR exon 19 mutations (e.g., insertions and deletions): SEQ ID NO:18, SEQ ID NO:19 and SEQ ID NO:20;

(f) for EGFR exon 19 mutations: [SEQ ID NO:21 or SEQ ID NO:22 or SEQ ID NO:23 or SEQ ID NO:24], [SEQ ID NO:25 or SEQ ID NO:26 or SEQ ID NO:27 or SEQ ID NO:28] and an oligonucleotide comprising a sequence complementary to a portion of SEQ ID NO:35; (g) for BRAF V600 mutations: [SEQ ID NO:29 or SEQ ID NO:30], [SEQ ID NO:31 or SEQ ID NO:32] and SEQ ID NO:33.

Additionally provided is a kit for detection of a low-abundance mutant or target nucleotide sequence in a sample. The kit comprises any of the above primer compositions. The kit optionally also comprises a blocker, e.g., one of the blockers identified above. The kit can also include e.g., control reagents (e.g., positive and/or negative control target nucleic acid and positive and/or negative control wild-type nucleic acid at a standard concentration) and/or instructions for using the kit to detect and optionally quantitate one or more low-abundance target nucleic acid. The kit may also include various chemical reagents or appliances, as well as a unit for detection comprising a solution and/or a substance reactable with a dye, tag, fluorescent label or other such marker; the solution containing a dye which binds to a nucleic acid.

Further provided is a method of detecting a specific mutant nucleic acid sequence in a sample. In these embodiments, the sample comprises a nucleic acid comprising a specific wild- type nucleic acid sequence that differs from the specific mutant nucleic acid sequence by at least one nucleotide. The method comprises

preparing a reaction mixture with a target specific primer that is useful for amplifying the specific mutant nucleic acid, wherein the reaction mixture comprises

the mixture of nucleic acid sequences from the sample, and

one or more oligonucleotide having a sequence of any of SEQ ID NOs:3-33; and subjecting the reaction mixture to one or more cycle of an amplification reaction, wherein the specific mutant nucleic acid sequence encodes a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13.

In various embodiments of these methods, the oligonucleotide is the target specific primer. In other embodiments, the amplification reaction is polymerase chain reaction. In additional embodiments, the reaction mixture further comprises a second oligonucleotide having a sequence of any of SEQ ID NOs: 3-33.

As used herein, the term "sample" refers to any composition that may contain a target sequence. In some embodiments, the sample in a biological sample, such as a biological fluid or a biological tissue from a subject. Examples of biological fluids include urine, blood, plasma, serum, saliva, pancreatic juice, semen, stool, sputum, cerebrospinal fluid, tears, mucus, amniotic fluid or the like. Biological tissues are aggregates of cells, usually of a particular kind together with their intercellular substance that form one of the structural materials of a human, animal, plant, bacterial, fungal or viral structure, including connective, epithelium, muscle and nerve tissues. Examples of biological tissues also include organs, tumors, lymph nodes, arteries and individual cell(s). A "sample" also includes a sample of in vitro cell culture, natural isolates (such as drinking water, seawater, solid materials), microbial specimens or specimens that have been "spiked" with nucleic acid tracer molecules.

In some embodiments, the bodily fluid is urine and the specific mutant nucleic acid sequence is transrenal DNA.

As used herein, a "patient" or "subject" is a mammal. The mammal can be e.g., any mammal, e.g., a human, primate, bird, mouse, rat, fowl, dog, cat, cow, horse, goat, camel, sheep or a pig. In many cases, the mammal is a human being.

In additional embodiments, the disclosed methods are used with human subjects, such as those undergoing therapy or treatment for a disease or disorder associated with a gene alteration as described herein, or subjects surveyed for residual disease or recurrence. Subjects may be any individual of any age, sex or race.

Target nucleic acid sequences of the invention can be amplified from genomic DNA. Genomic DNA can be isolated from tissues or cells according to the following method or an alternative method. Such methods are well known in the art. Alternatively nucleic acids sequences of the invention can be isolated from blood, urine or another fluid by methods known in the art.

The inventors have also discovered that, when detecting a mutant gene in transrenal DNA in urine, utilizing nucleic acids from a sample volume of 90 ml or more provides greater sensitivity for detecting the mutant gene than sample volumes of less than 90 ml. See Examples 5 and 6. The sensitivity of assays described herein using a 90 ml urine sample is equivalent or better than the sensitivity of assays using tissue or plasma.

In these embodiments, the urine can be processed by any means known in the art. In some embodiments, the urine is unfractionated (e.g., not centrifuged to remove cells) during processing. In other embodiments, the transrenal DNA is isolated from the urine using an anion exchange medium, e.g., a quaternary ammonium anion exchange medium, for example as described in US Patent 8,222,370. In those embodiments, the transrenal DNA may be eluted from the anion exchange medium substantially free of larger DNA, using a salt having a molarity of less than 2.0M.

In additional embodiments of these methods, the PCR preferentially amplifies the specific mutant nucleic acid sequence over the specific wild-type nucleic acid sequence, for example by any of the methods described in WO 2015/073163, i.e., using a blocker and a PCR reaction cycle using a melting temperature above the calculated Tm of the blocker to the wild-type sequence.

The instant disclosure is also based in part on the discovery that for short amplicons, a significant differential in melting temperature can be obtained between wild-type blocker- wild- type sequence melting temperature ("T _m ") and wild-type blocker-target sequence T _m due to a mismatch at the position with variable sequence. Thus, the instant disclosure also provides a method for enriching and detecting low-abundance nucleic acid sequences (e.g., a target sequence) utilizing short blockers of about 80 bp or less, or about 60 bp or less, or about 40 bp or less, or between about 20-50 bp, or about 12 to about 20 bp in length. Further, the disclosure provides a quantitative method for substantially enriching and detecting low-abundance nucleic acid sequence(s) present in a sample having a greater abundance of non-target sequences such as a native, wild type sequence.

The instant disclosure also provides a method of detecting one or more target sequences (for example, multi-target) in a sample using oligonucleotide sequences designed with consideration of the binding kinetics of wild-type blocker and primer oligonucleotides. In one embodiment, a wild-type blocker may be a short oligonucleotide sequence, allowing for a amplification cycle(s), which reduces method reaction times while substantially enriching for and detecting low-abundance nucleic acid sequences (target sequences) contained in a high background of non-target nucleic acid sequences.

In some of these embodiments, the reaction mixture further comprises a blocking sequence that is fully complementary with a region of the wild-type sequence, the region of the wild-type sequence being within or overlapping the specific mutant nucleic acid sequence, wherein the blocking sequence is in excess relative to the wild-type sequence. In various embodiments, the reaction mixture is subjected to two or more cycles of:

(i) heating the temperature of the reaction mixture to a preselected denaturation temperature (Tsd) allowing but not requiring denaturation of the blocker sequence annealed to the wild-type sequence, wherein the Tsd is above a calculated melting temperature of the wild-type sequence-blocker sequence duplex, and

(ii) lowering the temperature of the reaction mixture to an elongation temperature allowing annealing of the primers and elongation of primers from their complementary mutant nucleic acid sequences to form an amplified mixture that is enriched in mutant nucleic acid sequence.

As used herein, the term "enriching a target sequence" refers to increasing the amount of a target sequence and increasing the ratio of a target sequence relative to the corresponding wild- type sequence in a sample.

A "selective denaturation temperature" or "Tsd" or "T _sd " is a temperature determined utilizing a preselected design including parameters and calculated Tm according to one aspect of an embodiment as disclosed herein. Generally, in the method provided herein, a selective denaturation temperature will be a preselected temperature that is above the melting temperature of a blocker:wild-type sequence.

The Tm can be estimated by a number of methods, for example by a nearest-neighbor calculation as per Wetmur, 1991, Crit Rev Biochem Mol Biol 26: 227-259, or by commercial programs including Oligo™ Primer Design. Alternatively, the Tm can be determined though actual experimentation. For example, double-stranded DNA binding or intercalating dyes, such as ethidium bromide or SYBR-green (MOLECULAR PROBES) can be used in a melting curve assay to determine the actual Tm of the nucleic acid. Additional methods for determining the Tm of a nucleic acid are well known in the art.

In some aspects, the compositions provided herein may be used in detection of target sequence as part of a method described, for example, in PCT Patent Publication WO2015/073163 and WO/2003/072809, U.S. Patents No. 8,623,603 and 8,455,190, and US Patent Publication 2014/0106362, describing enrichment methods for determining the amount of a target sequence in a sample containing a wild-type sequence. The method may comprise performance of a disclosed enrichment method followed by an additional analysis of the reaction mixture with enriched target sequence using one or more methods selected from MALDI-TOF, HR-melting, dideoxy-sequencing, single-molecule sequencing, pyrosequencing, NGS, SSCP, RFLP, dHPLC, CCM, digital PCR and quantitative- PCR. These analytical techniques may be used to detect specific target (mutant) sequences within synthesized nucleic acids as described herein. In some cases, the sample is urine, and the target sequence is cfDNA and/or ctDNA.

In one embodiment, the described method may also be performed as a quantitative assay allowing for quantification of the detected target (mutant) sequences. The quantification provides a means for determining a calculated input percentage of the target sequence prior to enrichment based upon the output signal (optionally as a percentage) from the assessment. This may be performed by reference to a fitted curve. The actual output from an assessment of a test sample is determined in combination with one or more control reactions containing a known quantity of target sequence DNA. The outputs from the test sample and the control(s) are compared to a fitted curve to interpolate or extrapolate a calculated input for the test sample. This permits a quantitative determination of the amount of a target sequence in a sample pre- enrichment based upon a post-enrichment detection.

The detection limits for the presence of a gene alteration (mutation) in cf nucleic acids may be determined by assessing data from one or more negative controls (e.g. from healthy control subjects or verified cell lines) and a plurality of patient samples. Optionally, the limits may be determined based in part on minimizing the percentage of false negatives as being more important than minimizing false positives. One set of non-limiting thresholds for BRAF V600E is defined as less than about 0.05% of the mutation in a sample of cf nucleic acids for a determination of no mutant present or wild-type only; the range of about 0.05% to about 0.107% as "borderline", and greater than about 0.107% as detected mutation. In other embodiments, a no- detection designation threshold for the mutation is set at less than about 0.001%, less than about 0.005%, less than about 0.01%, less than about 0.05%, less than about 0.1%, less than about 0.15%, less than about 0.2%, less than about 0.3%, less than about 0.4%, less than about 0.5%, less than about 0.6%, less than about 0.7%, less than about 0.8%, less than about 0.9%, or less than about 1% detection of the mutation relative to a corresponding wild type sequence.

As established in Examples 8 and 9, these methods are capable of detecting one copy of the target sequence in a urine, plasma or tissue sample.

In various embodiments of these methods, the sample is from a subject having a cancer associated with a mutant in BRAF, KRAS, EGFR, NRAS, PIK2CA or Alk. In some of these embodiments, the specific mutant nucleic acid sequence encodes a mutation at KRAS G12 or KRAS G13, and the subject has colorectal cancer or pancreatic cancer. In other embodiments, the specific mutant nucleic acid sequence encodes a mutation at EGFR L858, EGFR T790, EGFR19del, EGFR G719 or EGFR L861, and the subject has non-small cell lung cancer.

As discussed above, the inventors have also discovered that, when detecting a mutant gene in transrenal DNA in urine, utilizing nucleic acids from a sample volume of 90 ml or more provides greater sensitivity for detecting the mutant gene than sample volumes of less than 90 ml.

Thus, in additional embodiments, a method of detecting a specific mutant nucleic acid sequence in a human urine sample is provided. In these embodiments, the sample comprises a specific wild-type nucleic acid sequence that differs from the specific mutant nucleic acid sequence by at least one nucleotide. The method comprises

isolating cell-free nucleic acids from the sample;

subjecting a reaction mixture to one or more cycles of an amplification reaction, wherein the reaction mixture comprises the cell-free nucleic acids from the sample and primers that are suitable for amplifying the specific mutant nucleic acid sequence, to produce an amplification reaction product comprising an amplified specific mutant nucleic acid sequence if the specific mutant nucleic acid sequence was present in the sample; and

detecting the specific mutant nucleic acid sequence if present,

wherein the urine sample had a volume of 90 ml or greater, and

the method is capable of detecting one copy of the mutant sequence in the sample.

Analogous to the previously described methods, in some embodiments, the amplification reaction is a polymerase chain reaction (PCR) that preferentially amplifies the specific mutant nucleic acid sequence over the specific wild-type nucleic acid sequence. In several of those embodiments, the reaction mixture further comprises a blocking sequence that is fully complementary with a region of the wild-type sequence, the region of the wild-type sequence being within or overlapping the specific mutant nucleic acid sequence, wherein the blocking sequence is in excess relative to the wild-type sequence.

In some of those embodiments, the reaction mixture is subjected to two or more cycles of:

(i) heating the temperature of the reaction mixture to a preselected denaturation temperature (Tsd) allowing but not requiring denaturation of the blocker sequence annealed to the wild-type sequence, wherein the Tsd is above a calculated melting temperature of the wild-type sequence-blocker sequence duplex, and

(ii) lowering the temperature of the reaction mixture to an elongation temperature allowing annealing of the primers and elongation of primers from their complementary mutant nucleic acid sequences to form an amplified mixture that is enriched in mutant nucleic acid sequence.

In various of those embodiments, in step (ii), the blocker anneals to the wild-type sequence at a higher temperature than the primers anneal to the mutant sequence.

In additional embodiments, the sequence of at least one of the primers at least partially overlaps with the blocking sequence.

These methods are not limited to the detection of any particular target sequences. In some embodiments, the specific mutant nucleic acid sequence is associated with a cancer, and the specific wild-type nucleic acid sequence is a wild-type version of the specific mutant nucleic acid sequence.

These methods can provide information to accurately predict patient prognosis and response to therapy of a variety of cancer types, including but not limited to, adrenal cortical cancer, anal cancer, bile duct cancer, bladder cancer, bone cancer, brain or a nervous system cancer, breast cancer, cervical cancer, colon cancer, rectal cancer, colorectal cancer, endometrial cancer, esophageal cancer, Ewing family of tumor, eye cancer, gallbladder cancer, gastrointestinal carcinoid cancer, gastrointestinal stromal cancer, Hodgkin Disease, intestinal cancer, Kaposi Sarcoma, kidney cancer, large intestine cancer, laryngeal cancer, hypopharyngeal cancer, laryngeal and hypopharyngeal cancer, leukemia, acute lymphocytic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL), chronic myeloid leukemia (CML), chronic myelomonocytic leukemia (CMML), non-HCL lymphoid malignancy (hairy cell variant, splenic marginal zone lymphoma (SMZL), splenic diffuse red pulp small B-cell lymphoma (SDRPSBCL), chronic lymphocytic leukemia (CLL), prolymphocytic leukemia, low grade lymphoma, systemic mastocytosis, or splenic lymphoma/leukemia unclassifiable (SLLU)), liver cancer, lung cancer, non-small cell lung cancer, small cell lung cancer, lung carcinoid tumor, lymphoma, lymphoma of the skin, malignant mesothelioma, multiple myeloma, nasal cavity cancer, paranasal sinus cancer, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-Hodgkin lymphoma, oral cavity cancer, oropharyngeal cancer, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, penile cancer, pituitary tumor, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, adult soft tissue sarcoma, skin cancer, basal cell skin cancer, squamous cell skin cancer, basal and squamous cell skin cancer, melanoma, uveal melanoma, stomach cancer, small intestine cancer, testicular cancer, thymus cancer, thyroid cancer, uterine sarcoma, uterine cancer, vaginal cancer, vulvar cancer, Waldenstrom Macroglobulinemia, and Wilms Tumor.

Non-limiting examples of non-HCL lymphoid malignancy include, but are not limited to, hairy cell variant (HCL-v), splenic marginal zone lymphoma (SMZL), splenic diffuse red pulp small B-cell lymphoma (SDRPSBCL), splenic leukemia/lymphoma unclassifiable (SLLU), chronic lymphocytic leukemia (CLL), prolymphocytic leukemia, low grade lymphoma, systemic mastocytosis, and splenic lymphoma/leukemia unclassifiable (SLLU).

These methods can be used with any mutation associated with any of these cancers, for example, mutations in ABL1, BRAF, CHEK1, FANCC, GAT A3, JAK2, MITF, PDCD1LG2, RBMIO, STAT4, ABL2, BRCA1, CHEK2, FANCD2, GATA4, JAK3, MLH1, PDGFRA, RET, STK11, ACVR1B, BRCA2, CIC, FANCE, GATA6, JUN, MPL, PDGFRB, RICTOR, SUFU, AKT1, BRD4, CREBBP, FANCF, GID4(C17orf39), KAT6A (MYST3), MREl lA, PDK1, RNF43, SYK, AKT2, BRIPl, CRKL, FANCG, GLI1, KDM5A, MSH2, PIK3C2B, ROS1, TAF1, AKT3, BTG1, CRLF2, FANCL, GNA11, KDM5C, MSH6, PIK3CA, RPTOR, TBX3, ALK, BTK, CSF1R, FAS, GNA13, KDM6A, MTOR, PIK3CB, RUNXl, TERC, AMER1 (FAM123B), Cl lorGO (EMSY), CTCF, FATl, GNAQ, KDR, MUTYH, PIK3CG, RUNXITI, TERT promoter, APC, CARD11, CTNNA1, FBXW7, GNAS, KEAPl, MYC, PDGRl, SDHA, TET2, AR, CBFB, CTNNB1, FGF10, GPR124, KEL, MYCL (MYCL1), PDGR2, SDHB, TGFBR2, ARAF, CBL, CUL3, FGF14, GRIN2A, KIT, MYCN, PLCG2, SDHC, TNFAIP3, ARFRPl, CCND1, CYLD, FGF19, GRM,3 KLHL6, MYD88, PMS2, SDHD, TNFRSF14, ARID 1 A, CCND2, DAXX, FGF23, GSK3B, KMT2A (MLL), NF1, POLD1, SETD2, TOPI, ARID IB, CCND3, DDR2, FGF3, H3F3A, KMT2C (MLL3), NF2, POLE, SF3B1, TOP2A, ARID2, CCNE1, DICERl, FGF4, HGF, KMT2D (MLL2), NFE2L2, PPP2R1A, SLIT2, TP53, ASXL1, CD274, DNMT3A, FGF6, HNF1A, KRAS, NFKBIA, PRDMl, SMAD2, TSC1, ATM, CD79A, DOT1L, FGFR1, HRAS, LMOl, NKX2-1, PREX2, SMAD3, TSC2, ATR, CD79B, EGFR, FGFR2, HSD3B1, LRPIB, NOTCHl, PRKARIA, SMAD4, TSHR, ATRX, CDC73, EP300, FGFR3, HSP90AA1, LYN, NOTCH2, PRKCI, SMARCA4, U2AF1, AURKA, CDH1, EPHA3, FGFR4, IDH1, LZTR1, NOTCH3, PRKDC, SMARCB1, VEGFA, AURKB, CDK12, EPHA5, FH, IDH2, MAGI2, NPM1, PRSS8, SMO, VHL, AXIN1, CDK4, EPHA7, FLCN, IGF1R, MAP2K1, NRAS, PTCH1, SNCAIP, WISP3, AXL, CDK6, EPHB1, FLT1, IGF2, MAP2K2, NSDl, PTEN, SOCSl, WTl, BAPl, CDK8, ERBB2, FLT3, IKBKE, MAP2K4, NTRKl, PTPN11, SOX10, XPOl, BARD1, CDKNIA, ERBB3, FLT4, IKZF1, MAP3K1, NTRK2, QKI, SOX2, ZBTB2, BCL2, CDKNIB, ERBB4, FOXL2, IL7R, MCL1, NTRK3, RAC1, SOX9, ZNF217, BCL2L1, CDKN2A, ERG, FOXPl, INHBA, MDM2, NUP93, RAD50, SPEN, ZNF703, BCL2L2, CDKN2B, ERRFIl, FRS2, INPP4B, MDM4, PAK3, RAD51, SPOP, BCL6, CDKN2C, ESR1, FUBP1, IRF2, MED 12, PALB2, RAF1, SPTA1, BCOR, CEBPA, EZH2, GABRA6, IRF4, MEF2B, PARK2, RANBP2, SRC, BCORL1, CHD2, FAM46C, GATA1, IRS2, MEN1, PAX5, RARA, STAG2, BLM, CHD4, FANCA, GATA2, JAK1, MET, PBRM1, RBI, STAT3, MLL-PTD, or PHF6.

In some embodiments, the specific mutant nucleic acid sequence encodes a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13.

In specific embodiments, the mutant nucleic acid sequence is a KRAS mutation, e.g., a KRAS mutation is at a codon encoding amino acid position 12 or 13. In certain of these embodiments, the cancer is metastatic colorectal cancer or pancreatic cancer. In other specific embodiments, the mutant nucleic acid sequence is an EGFR mutation, e.g., a T790M, L858R, Exon 19 or Exon 20 mutation. In certain of these embodiments, the cancer is non-small cell lung cancer.

In some embodiments of these methods, the reaction mixture comprises at least one oligonucleotide comprising a sequence of any one of SEQ ID NOs: 3-33 and/or one or two oligonucleotide primers comprising any one of SEQ ID NOs: 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

In certain of these embodiments, the reaction mixture comprises three oligonucleotides from SEQ ID NO: 3-33, for example the three oligonucleotides in (a), (b), (c), (d), (e), (f), or (g): (a) for KRAS G12 or G13 mutations: SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5;

(b) for EGFR T790M mutations: SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8;

(c) for EGFR exon 20 mutations (e.g., insertions): [SEQ ID NO:9 or SEQ ID NO: 10 or SEQ ID NO: 11], [SEQ ID NO: 12 or SEQ ID NO: 13 or SEQ ID NO: 14] and an oligonucleotide comprising a sequence complementary to a portion of SEQ ID NO:34;

(d) for EGFR L858R mutations: SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 17;

(e) for EGFR exon 19 mutations (e.g., insertions and deletions): SEQ ID NO:18, SEQ ID NO:19 and SEQ ID NO:20;

(f) for EGFR exon 19 mutations: [SEQ ID NO:21 or SEQ ID NO:22 or SEQ ID NO:23 or SEQ ID NO:24], [SEQ ID NO:25 or SEQ ID NO:26 or SEQ ID NO:27 or SEQ ID NO:28] and an oligonucleotide comprising a sequence complementary to a portion of SEQ ID NO:35;

(g) for BRAF V600 mutations: [SEQ ID NO:29 or SEQ ID NO:30], [SEQ ID NO:31 or SEQ ID NO:32] and SEQ ID NO:33.

The quantity of a mutation before and after treatment has been correlated with response to treatment. See, e.g., Examples 5 and 9, in particular FIGS 6 and 16. With various mutations and cancers, if the quantity of the specific mutant nucleic acid in a post-treatment sample is less than 50%, 40%, 30%, 25%, 20%, 15% or 10%, depending on the disease and mutation, of the quantity of the specific mutant nucleic acid pre-treatment, then the patient has stable disease, partial response or complete response. Conversely, if the quantity of the specific mutant nucleic acid in the post-treatment sample is greater than 50%, 40%, 30%, 25%, 20%, 15% or 10% of the quantity of the specific mutant nucleic acid in the pre-treatment sample, then the patient has progressive disease.

The threshold for discriminating response from non-response for any cancer can be determined without undue experimentation, e.g., by the criteria of Eisenhauer et al., 2009, Eur. J. Cancer 45:228-247. Using the methods described herein, the quantity of the mutant will generally decrease at the initiation of treatment whether the subject's cancer is responding or not. The decrease is often preceded by a significant increase in the mutant. However, there is always a threshold of decrease that allows the discrimination of the responders from non- responders/progressive disease. See, e.g., PCT Patent Application PCT/US2016/020967.

Thus, a method is provided for determining, prior to imaging, whether a subject is responding to a cancer treatment. The method comprises

obtaining a first sample and a second sample of a bodily fluid from the subject, wherein the first sample is taken before the cancer treatment and the second sample is taken after the cancer treatment, and

detecting and quantifying a specific mutant nucleic acid associated with the cancer in the bodily fluid by any of the above methods. Here, if the quantity of the specific mutant nucleic acid in the second sample is less than 50%, 40%, 30%, 25%, 20%, 15% or 10% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has stable disease, partial response or complete response, and

if the quantity of the specific mutant nucleic acid in the second sample is greater than

50%, 40%, 30%, 25%, 20%, 15% or 10% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has progressive disease.

As shown in FIG. 16, with EGFR mutation T790M in non-small cell lung cancer, if the quantity of the specific mutant nucleic acid in the second sample is less than 25% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has stable disease, partial response or complete response, and if the quantity of the of the specific mutant nucleic acid in the second sample is greater than 25% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has progressive disease. In various embodiments, the method further comprises continuing the cancer treatment if the subject is responding to the treatment, or discontinuing the cancer treatment and starting a different treatment if the subject is not responding to the treatment.

Also provided is a method of determining, without imaging, whether a cancer in a subject is progressing. See, e.g., Example 7. The method comprises

obtaining a first sample and a second sample of a bodily fluid from the subject, wherein the first sample is taken before the second sample; and

detecting and quantifying a specific mutant nucleic acid associated with the cancer in the bodily fluid by any of the above methods. Here, if the quantity of the specific mutant nucleic acid in the second sample is less than 50%, 40%, 30%, 25%, 20%, 15% or 10%, depending on the disease and mutation, of the quantity of the specific mutant nucleic acid in the first sample, then the patient has stable disease, partial response or complete response, and if the quantity of the specific mutant nucleic acid in the second sample is greater than 50%, 40%, 30%, 25%, 20%, 15% or 10% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has progressive disease. In some embodiments, this method further comprises changing treatment if the cancer is progressing.

This method can also be used to detect secondary mutations that arise after treatment for a cancer associated with a first mutation. See Examples 6 and 9, where the secondary mutation, EGFR T790M, was detected in NSCLC patients after treatment for a cancer with a different primary EGFR mutation.

Thus, additionally provided is a method of detecting a secondary mutation in a cancer in a subject. In these embodiments, the cancer has a first mutation. The method comprises

obtaining a sample of a bodily fluid from the subject; and

testing for the presence of the second mutation in the cancer by any of the above methods. This method can be used with any cancer. In some embodiments, the cancer is non-small cell lung cancer. In certain of these embodiments, the first mutation is of EGFR, e.g., EGFR L858 or EGFR 19del, and the secondary mutation is EGFR T790M. In some of these embodiments, the subject is treated with a treatment specific for the secondary mutation. For example, where the mutation is EGFR T790M, the subject may be treated with osimertinib.

In further embodiments, a method of treating a cancer patient that has a cancer is provided. The method comprises detecting and quantifying the specific mutant nucleic acid associated with the cancer in a first sample of bodily fluid from the patient by any of the above methods, and treating the cancer as appropriate based on the results of the detecting method.

In some of these embodiments, the subject is undergoing a cancer treatment and the method further comprises

obtaining a second sample of the bodily fluid taken from the patient after the first sample is taken;

detecting and quantifying the specific mutant nucleic acid in the second sample by any of the above methods; and

continuing the treatment if the quantity of the specific mutant nucleic acid in the first sample is greater than in the second sample, or

changing the treatment if the quantity of the specific mutant nucleic acid in the first sample is less than in the second sample.

In some of these embodiments, the first sample is taken from the patient before the treatment and the second sample is taken from the patient after the treatment has started. Alternatively, both the first sample and the second sample are taken from the patient after the treatment has started.

In various embodiments, these methods further comprise

testing for the presence of the secondary mutation in the cancer using any of the above- described methods, and

changing treatment to a treatment for the secondary mutation.

In some of these embodiments, the cancer is non-small cell lung cancer and the secondary mutation is EGFR T790M.

Also provided herein is a method of detecting a specific mutant nucleic acid sequence in a sample of a bodily fluid. In this method, the sample comprises a nucleic acid comprising a specific wild-type nucleic acid sequence that differs from the specific mutant nucleic acid sequence by at least one nucleotide. The method comprises

preparing a reaction mixture comprising nucleic acids from the sample, and a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3-33;

subjecting the reaction mixture to one or more cycle of amplification reaction to create amplified sample nucleic acids; and

detecting the specific mutant nucleic acid in the amplified sample nucleic acids. In these embodiments, the specific mutant nucleic acid sequence encodes a mutation at BRAF V600; EGFR Exon 19, Exon 20, T790, or L858; or KRAS G12 or G13.

In some of these embodiments, the sample comprises cell-free DNA. In various aspects of those embodiments, the specific mutant nucleic acid sequence in the sample is cell-free DNA. In additional embodiments, the bodily fluid is blood, plasma, serum or urine. In further embodiments of these methods, the amplification reaction is polymerase chain reaction (PCR).

In various embodiments of this method, the specific mutant nucleic acid sequence in the sample is quantified.

In some aspects, the cancer is metastatic colorectal cancer, non-small cell lung cancer, or pancreatic cancer. In additional aspects, the mutant nucleic acid sequence is an EGFR mutation, e.g., a T790M, L858R, Exon 20 or Exon 19 mutation. In other aspects, the mutant nucleic acid sequence is a KRAS exon 2 mutation.

Also provided herewith is a method of determining, prior to imaging, whether a subject is responding to a cancer treatment. The method comprises

obtaining a first sample and a second sample of a bodily fluid from the subject, wherein the first sample is taken before the cancer treatment and the second sample is taken after the cancer treatment, and

detecting and quantifying a specific mutant nucleic acid associated with the cancer in the bodily fluid by the method described above that utilizes a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32. Here, if the quantity of the specific mutant nucleic acid in the second sample is less than 50%, 40%, 30%, 25%, 20%, 15% or 10%, depending on the disease and mutation, of the quantity of the specific mutant nucleic acid in the first sample, then the patient has stable disease, partial response or complete response, and if the quantity of the specific mutant nucleic acid in the second sample is greater than 50%, 40%, 30%, 25%, 20%, 15% or 10% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has progressive disease.

In some aspects this method further comprises continuing the cancer treatment if the subject is responding to the treatment, or discontinuing the cancer treatment and starting a different treatment if the subject is not responding to the treatment.

In various embodiments of this method, the first sample and the second sample are blood, plasma, serum or urine samples.

Additionally provided herein is a method of determining, without imaging, whether a cancer in a subject is progressing. The method comprises

obtaining a first sample and a second sample of a bodily fluid from the subject, wherein the first sample is taken before the second sample; and

detecting and quantifying a specific mutant nucleic acid associated with the cancer in the bodily fluid by the method described above that utilizes a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

In these embodiments, if the quantity of the specific mutant nucleic acid in the second sample is less than 50%, 40%, 30%, 25%, 20%, 15% or 10%, depending on the disease and mutation, of the quantity of the specific mutant nucleic acid in the first sample, then the patient has stable disease, partial response or complete response, and if the quantity of the specific mutant nucleic acid in the second sample is greater than 50%, 40%, 30%, 25%, 20%, 15% or 10% of the quantity of the specific mutant nucleic acid in the first sample, then the patient has progressive disease. In some aspects, this method further comprises changing treatment if the cancer is progressing.

Also provided is a method of detecting a secondary mutation in a cancer in a subject where the cancer has a first mutation. This method comprises obtaining a sample of a bodily fluid from the subject; and

testing for the presence of the second mutation in the cancer by the method described above that utilizes a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

In some of these embodiments, the bodily fluid is blood, plasma, serum or urine. In other embodiments, the cancer is non-small cell lung cancer. In various embodiments, the first mutation is of EGFR, and the secondary mutation is EGFR T790M. In some of those embodiments, the first mutation is EGFR L858 or EGFR 19del. In various embodiments where the secondary mutation is EGFR T790M, the method further comprises treating the patient with osimertinib if EGFR T790M is present.

Additionally provided is a method of treating a cancer patient that has a cancer. The method comprises detecting and quantifying a specific mutant nucleic acid associated with the cancer in a first sample of bodily fluid from the patient by the method described above that utilizes a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32. This method further comprises treating the cancer as appropriate based on the results of the detecting method. In some embodiments, the sample is blood, plasma, serum or urine.

In some embodiments of this method, the subject is undergoing a cancer treatment and the method further comprises

obtaining a second sample of the bodily fluid taken from the patient after the first sample is taken;

detecting and quantifying the specific mutant nucleic acid in the second sample by the method described above that utilizes a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32; and

continuing the treatment if the quantity of the specific mutant nucleic acid in the first sample is greater than in the second sample, or changing the treatment if the quantity of the specific mutant nucleic acid in the first sample is less than in the second sample.

In some embodiments, the first sample is taken from the patient before the treatment and the second sample is taken from the patient after the treatment has started. In other embodiments, both the first sample and the second sample are taken from the patient after the treatment has started.

In additional aspects, this method further comprises testing for the presence of the secondary mutation in the cancer bythe method described above that utilizes a set of two primers where at least one of the two primers comprises an oligonucleotide comprising any one of SEQ ID NOs 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 18, 19, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

In some aspects of this method, the cancer is non-small cell lung cancer. In additional aspects, the first mutation is of EGFR, e.g., EGFR L858 or EGFR 19del, and the secondary mutation is EGFR T790M. In some of those embodiments, the patient is treated with osimertinib if EGFR T790M is present.

These methods can also be utilized to determine the progression and effectiveness of treatment of transplant rejection or other diseases such as chronic viral (e.g., HIV, HCV, herpes), bacterial (e.g., tuberculosis) or other pathogen infections (e.g., parasitic infections such as by Enterobius vermicularis, Giardia lamblia, Ancylostoma duodenale, Necator americanus, and Entamoeba histolytica. The methods for these diseases are analogous to those described above for cancer. Samples of a bodily fluid such as urine or blood are taken periodically before, during and/or after treatment and cell-free nucleic acids associated with the disease (e.g., HIV, M. tuberculosis, or parasitic nucleic acids) or transplant (e.g., nucleic acids characteristic of the transplated tissue) are quantified, and the effectiveness of treatment is evaluated based on whether the nucleic acids are present and/or have changed in quantity.

It will be understood by one skilled in the art that any of the methods illustrated or provided herein can and should be optimized for individual protocols, conditions and practitioner objective. One skilled in the art may refer to general reference texts for detailed descriptions of known techniques discussed herein or equivalent techniques. These texts include Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (2005); Sambrook et al., Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2000); Coligan et al., Current Protocols in Immunology , John Wiley & Sons, N.Y.; Enna et al., Current Protocols in Pharmacology , John Wiley & Sons, N.Y.; Fingl et al., The Pharmacological Basis of Therapeutics (1975), Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA, 18th edition (1990). These texts can, of course, also be referred to in making or using an aspect of the disclosure.

Preferred embodiments of the present invention are described in the following examples.

Other embodiments within the scope of the claims herein will be apparent to one skilled in the art from consideration of the specification or practice of the invention as disclosed herein. Other features and advantages of the present disclosure are also apparent from the different examples. The provided examples illustrate different components and methodology useful in practicing the present disclosure. It is intended that the specification, together with the examples, be considered exemplary only, with the scope and spirit of the invention being indicated by the claims, which follow the examples.

EXAMPLES

Example 1. PCR enrichment assay for detection of EGFR Exon 19 deletions

An example of a two-step PCR enrichment assay (EGFR Exon 19 deletions) is provided in FIG. 2. In this assay, a selective denaturation step precedes the annealing step. As the reaction ramps to the annealing temperature of 62.4°C, any complementary wild type strands generated in the previous PCR cycle bind blocker before the primers anneal. In this exemplary assay, at the preselected annealing step (62.4 °C), blockentarget and wild-type (wt):target heteroduplex formation is likely to be extremely low (below detectable or calculable levels) because only a minor percentage will be complementary. The cycling conditions are provided in Table 1. Table 1.

Table 2 shows the fold enrichment of the mutation sequence when specific numbers of mutant copies are added with various amounts of background DNA. Under all conditions tested, the mutant sequence was enriched more than 1500 fold.

Table 2.

Table 3 shows the fold enrichment of the mutant sequence with greater amounts of mutant input than shown in Table 2.

Table 3.

Table 4 shows the fold enrichment of a pooled mutant sequences.

Table 4.

Example 2. PCR enrichment assay for detecting EGFR T790M mutations

A schematic example of an alternative enrichment assay is provided in FIG. 3. In this assay, a 98°C denaturation step ensures that all duplexes denature. During the second (optional) step (70°C) blocker-wild type duplexes form, but few blocker-mutant duplexes form (as 70°C is above the blocker-mutant Tm). At step 3, selective denaturation, many of the blocker-wild type will denature (along with any blocker-mutant duplexes that may exist). Just as in the two-step PCR (Example 1), as the reaction ramps back to the annealing temperature of 64.0°C, complementary wild type strands are bound by the excess blocker before the primers anneal. The primers then anneal to the complementary mutant strand and bar the possibility of blocker binding to that mutant strand. Short amplicon length allows extension without the need for an additional elongation step.

The level of enrichment for EGFR T790M is provided in Table 5.

Table 5.

Example 3. PCR enrichment assay for KRAS Exon 2 single base substitutions.

FIG. 4 provides an example of a low abundance target enrichment assay for KRAS Exon 2 single-base substitution. This assay proceeds in a similar fashion as Example 2 except that the selective denaturation step is chosen below the wild type-blocker T _m . The temperature differential between the blocker-wild type T _m , the primer-template T _m and the blocker-mutant T _m is much greater than in Example 2, leading to a more efficient enrichment.

Example 4. Oligonucleotide sequences

Oligonucleotide sequences useful for detection of low abundance target nucleotide sequences are provided in Table 6.

Table 6. SEQ ID NOs in this application and in US Provisional Application 62/370,924

Example 5. PCR mutation enrichment-next-generation sequencing method for absolute quantitation of circulating tumor DNA fragments in urine or plasma

Using the assay illustrated in FIG. 4 and further described in Example 3 of PCT patent publication WO 2015/073163, KRAS G12/13 mutants were detected and quantified in clinical urine samples of cancer patients undergoing treatment. The accuracy of the quantification procedure and the copy number determination of various clinical samples is shown in FIG. 5. The sensitivity and specificity of the assay was determined (Table 7). The sensitivity determinations were divided into two groups, where the volume of urine analyzed was 40-110 ml in one group, and 90-110 ml in the second group. As shown in Table 7, the sensitivity was much higher in the 90-110 ml group than in the 40-110 ml group, when multiple cancers were evaluated together, as well as when metastatic colorectal cancer (mCRC) patients were evaluated separately.

Table 7. Summary of clinical sensitivity of KRAS G12/13 detection in urine and plasma.

FIG. 6 shows results of evaluations of disease course for eight patients, where urinary KRAS mutants are quantified and compared to the sum of longest diameters (SLD) of tumors present.

Example 6. Assessment of EGFR mutations in matched urine, plasma and tumor tissue in non- small cell lung cancer (NSCLC) patients treated with rociletinib (CO- 1686)

Background

Approximately 60% of patients who receive an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor develop the acquired resistance mutation T790M (Yu et al. Clin Cancer Res. 2013, 19:2240-2247). Acquisition of suitable tumor tissue is a challenge for a considerable fraction of advanced non-small cell lung cancer (NSCLC) patients who require EGFR testing. We examined the detection of the EGFR T790M mutation in circulating tumor DNA (ctDNA) from urine, assessed urine sample requirements, and compared the results with contemporaneously matched tumor tissue and plasma in TIGER-X, a phase 1/2 clinical study of rociletinib in previously treated patients with advanced NSCLC and mutant EGFR.

Rociletinib (CO- 1686) is a novel, oral, selective covalent inhibitor of EGFR mutations in NSCLC. Rociletinib inhibits key activating mutations along with the T790M mutation (Walter et al. Cancer Discov. 2013;3:1404-1415; Sequist et al. N Engl J Med. 2015;372:1700-1709).

Methods Patients

Pretreatment urine or plasma was obtained from 68 patients with available tumor biopsy result in TIGER-X. Matched urine or plasma was available for 51 of these patients. Urine was available for 63 of these patients. Patients enrolled in TIGER-X were required to have documented evidence of an EGFR-activating mutation in their medical record.

T790M analysis

Tissue: Therascreen® EGFR RGQ polymerase chain reaction (PCR) test.

Urine and plasma: Trovagene quantitative PCR next-generation sequencing (NGS) EGFR T790M assay, using MiSeq NGS sequencing.

The assay used in this Example is outlined in FIG. 7 A, with validation results shown in

FIG. 7B. Gene-specific primers (GSP1, GSP2) with noncomplementary "common sequence tails"

(CSl, CS2) amplify target. Wild-type (WT) blocker (WTB) limits WT amplification. Allele- specific cycling conditions (ASCC) limit WT amplification. Add flow cell adapters (P5, P7) and sample barcode (BC).

Additional details of the assay are provided in Example 9.

Table 8 shows various characteristics of the EGFR assay with urine and plasma.

Table 8.

Results

Urine testing for T790M has high sensitivity with prespecified urine volume acceptance criteria and identifies some patients missed by tissue testing Recommended urine volumes for testing are 90-1 OOmL (approximately half of normal void). Nineteen of 63 patients provided the recommended volume of 90-100 mL; 14 of these patients had T790M-positive tissue.

Table 9 shows the sensitivity of this assay analyzing the EGFR mutations Exon 19 del (Exl9del), L858R, and T790M.

Table 9. Analytical sensitivity of EGFR PCR-NGS mutation enrichment assays. Verification of a single copy detection sensitivity using Poisson distribution statistics.

Clinical sensitivity and DNA yields increase with urine volume (FIG. 8). Clinical sensitivity of the assays by mutations using two different volumes of urine and plasma are provided in Table 10. Clinical sensitivity was increased in the group with a urine sample size of 90-100 ml over the 40-100 ml urine sample size group. Table 10. Summary of clinical sensitivity of EGFR detection in urine and plasma.

Table 11 shows the urine/plasma/tissue concordance for the three EGFR mutations evaluated.

Table 11. Urine/plasma/tissue concordance.

G Plasma vs. Tumor Tissue

FIG. 9 provides a graphical illustration of the concordance between urine and tissue for T790M where the urine volume is 90-100 ml or 10-100 ml. With 90-100 ml volumes, 13/14 urine samples identified a corresponding positive tissue sample (93% positive percent agreement (PPA)). The corresponding PPA for 10-100 ml urine volume was 72% (34/47). Further, when inadequate tissue specimens are factored in, urine testing identifies more T790M-positive patients than tissue testing, since four patients were identified as positive in urine but were negative (n=2) or inadequate (n=2) in formalin-fixed, paraffin-embedded (FFPE) tissue. These are not likely to be false positives since corresponding plasma samples from all four patients tested positive.

Table 12 shows T790M copies per sample and % T790M fragments in urine and plasma of patients with NSCLC. 100 ml of urine had more copies of T790M than 2 ml of plasma. Table 12.

Rates of T790M detection by M stage are similar in 90-100 ml urine samples as in plasma

As shown in Table 13, the sensitivity of the T790M assay is similar in urine as in plasma when 90-100 ml urine samples are utilized. Mutations have been shown to be more readily identified in the plasma of patients with distant metastases (Mlb) than in those with intrathoracic disease (M0/Mla) (Tseng JS et al. J Thoracic Oncol. In press; Karlovich C et al. Forthcoming 2016). Table 13.

The number of T790M fragments in urine was higher for Mlb patients than for M0/Mla patients. The M0/Mla median was 28 copies/10 ⁵ genome equivalents (geq) (range, 11 to 118 copies/ 10 ⁵ geq) (n=6, detectable patients only). The Mlb median was 75 copies/10 ⁵ geq (range, 9 to >1,375 copies/10 ⁵ geq) (n=36, detectable patients only). Example 7. Use of urinary circulating tumor mutant KRAS DNA for monitoring treatment response in patients with metastatic colorectal cancer

Background

Colorectal cancer (CRC) is the third leading cause of cancer mortality in the United States. Despite advances in early detection, each year more than 50,000 patients are diagnosed with metastatic disease. Combination chemotherapy, targeted drugs, and surgical interventions have revolutionized the treatment landscape and improved survival of these patients. Clonal evolution is considered a major cause of drug resistance and non-invasive strategies to detect new and evolving mutations can impact the delivery of personalized treatment. Moreover, non-invasive techniques have the potential to transform the standard of response assessment in metastatic colorectal cancer (mCRC) and reduce the need for imaging in the management of CRC.

Methods

Urinary circulating tumor DNA (ctDNA) was extracted using quaternary ammonium anion exchange with elution of DNA fragments primarily <400 bp using 1.8M NaCl, as described in US Patent 9,163,229. A quantitative mutation enrichment PCR-next generation sequencing assay using primers having SEQ ID NO:292 and 293, and a blocker oligonucleotide having SEQ ID NO:294 was utilized. This assay utilizes a 31 bp footprint. The primers have 5' barcode adapters for compatibility with NGS (MiSeq). The assay design is the same as in Example 6, using the above KRAS primers.

The clinical study design is illustrated in FIG. 10. The study was an interim analysis of 13 metastatic CRC patients with known KRAS tissue status. KRAS G 12/ 13 -positive, n=7; KRAS wild-type, n = 5. KRAS G 12/ 13 -positive patients were monitored for KRAS ctDNA during chemotherapy FOLFOX, n = 5; surgery, n = 2. Urine was collected every two weeks on treatment and with each radiologic scan (at 6-8 weeks).

Results

Table 14 summarizes the assay performance. Table 14.

The KRAS detection concordance between tissue and ctDNA was as follows:

Urine: Concordant KRAS G12/13 mutation was detected in 5 of 7 patients. In one additional patient (patient with lung metastases), a different KRAS mutation was detected in urine after surgical resection of the primary tumor.

Plasma: Concordant KRAS G12/13 mutation was detected in 6 of 7 patients. One of 7 tests failed.

The five patients treated with FOLFOX underwent CT scans and urine sampling at Cycle 4 Day 1. Partial response was observed in three of the patients and stable disease was observed in two patients (RECIST 1.1 criteria). The KRAS mutation burden in urine decreased by more than 90% in response to FOLFOX treatment (FIG. 11). The assay detected a decrease in urinary KRAS mutation burden at two weeks (the first time point sampled) after commencement of treatment (FIG. 12). Clinical response could be predicted three months in advance of imaging, as shown in FIG. 13. With that patient, the response by imaging was preceded by a rapid decrease of urinary KRAS mutants of more than 99%. A relapse to progressive disease was also preceded by a large increase in urinary KRAS mutants, six months prior to imaging. That increase led to the decision to administer additional treatment more than a month prior to imaging.

Discussion

This study establishes that • the dynamics of urinary ctDNA KRAS G12/13 mutational load correlates with clinical course in mCRC patients;

• a decrease in urine or plasma ctDNA KRAS G12/13 mutation levels after 2 weeks of chemotherapy detects molecular response in advance of radiographic response;

· in one patient (Patient 1), radiographic progression was detected 3 months after rising ctDNA KRAS mutation was observed in urine; and

• the ctDNA KRAS G12/13 assay can be used to guide treatment decisions in mCRC patients. Example 8. Detection of circulating tumor mutant KRAS DNA in pancreatic cancer

The KRAS G12/13 assay described in Example 7 was used in a clinical study to examine KRAS G12/13 detection rate in plasma of patients with unresectable, locally advanced or metastatic pancreatic cancer (PC). Also evaluated was the association between baseline KRAS levels in plasma and patient outcomes (overall survival), and the correlation between changes in KRAS levels in plasma and changes in tumor size by radiographic assessment following treatment with chemotherapy.

Data from 239 unresectable locally advanced or metastatic pancreatic cancer patients in the Danish BIOPAC (Biomarkers in Patients with Pancreatic Cancer) study was used. Blood was collected at baseline, before cycle 2 of chemotherapy, every 2-3 months at time of CT scans. KRAS plasma levels were monitored before and on treatment.

The patients were 84 females (48.1%) and 92 males (51.9%); median age 67 years (range 45-89 years). Fifty four (20.4%) patients had locally advanced PC, 172 (79.6%) patients had metastatic PC. The patients were on palliative treatment with gemcitabine or FOLFIRINOX.

Table 15 summarizes the results of this study.

Table 15.

The analytical performance of the KRAS G12/13 NGS assay is provided in Table 16. Table 16.

Discussion

This study establishes that ctDNA KRAS G12/13 assay has single copy analytical sensitivity and can accurately quantify mutation fragments in 5-125 copy region. Example 9. Additional study of EGFR mutants in NSCLC in tissue, plasma and urine samples ABSTRACT

The methods are set forth in Example 6. Samples from 63 patients were studied.

Results: Of 63 patients, 60 had evaluable tissue specimens. Using the tissue result as reference, the sensitivity of EGFR mutation detection in urine with specimens that met a recommended volume of 90-100 mL was 93% (13/14) for T790M, 8071% (45/57) for L858R, and 83% (10/12) for exon 19 deletions. A comparable sensitivity of EGFR mutation detection was observed in plasma: 93% (38/41) for T790M, 100% (17/17) for L858R, and 87% (34/39) for exon 19 deletions. Together, urine and plasma testing identified 12 additional T790M-positive cases that were either undetectable or inadequate by tissue test. In all patients monitored by urine while on treatment treated with rociletinib, a rapid decrease in urine T790M levels was observed by day 21.

Conclusions: DNA derived from NSCLC tumors can be detected with high sensitivity in urine, enabling diagnostic detection and monitoring of therapeutic response from these noninvasive "liquid biopsy" samples.

Abbreviations: ctDNA, circulating tumor DNA; NSCLC, non-small cell lung cancer;

EGFR, epidermal growth factor receptor; WT, wild-type; NGS, next-generation sequencing; CV%, coefficient of variation percent; GEq, genome equivalents; PCR, polymerase chain reaction; EBV, Epstein-Bar Virus; H&E, Hematoxylin and Eosin; FFPE, formalin-fixed paraffin- embedded; RECIST, response evaluation criteria in solid tumors; PR, partial response; SD, stable disease; PD, progressive disease.

INTRODUCTION

A major challenge for assessing EGFR mutation status in advanced non-small cell lung cancer (NSCLC) is the availability of suitable biopsy tissue for molecular testing. Clinical studies suggest 10-20% of all NSCLC biopsies are inadequate for molecular analysis because of a lack of either sufficient tumor cells or amplifiable DNA. ' Biopsies also pose an economic burden and health risk to patients, with biopsy-associated patient morbidity (e.g., pneumothorax) observed in 12 to 21% of image-guided transthoracic needle tissue biopsies.3 Moreover, despite guidelines recommending EGFR testing at diagnosis for guiding first-line treatment decisions ⁴ ' ⁵ , up to 25% of lung cancer patients receive treatment prior to EGFR mutation assessment. ⁶ Physicians cite tumor histology (i.e. squamous), insufficient tumor samples, poor health status of the patient, long turnaround times for tests and patient's desire to initiate therapy as reasons for failure to undergo timely molecular testing. ⁶

NSCLC patients receiving first-line tyrosine kinase inhibitors (TKIs) targeting EGFR mutation-positive tumors (i.e. erlotinib, gefitinib, afatinib) develop resistance to therapy through the emergence of a second mutation in EGFR, T790M, in approximately 60% of cases. Rebiopsy of these patients is still an emerging standard of care, and up to 25% of cases may be medically ineligible due to comorbidities or the lack of an accessible lesion. Those who do undergo rebiopsy may be at substantial risk of a false negative result due to the underlying intra- and inter-tumoral heterogeneity often associated with resistance mechanisms such as T790M. ⁹ ' ¹⁰ Detection and monitoring of cancer-specific genomic alterations in blood, specifically through the assessment of circulating tumor DNA (ctDNA), is a minimally-invasive alternative to a tissue biopsy that has shown promise in overcoming some of the challenges associated with sampling from tissue. ¹¹ However, ctDNA presents its own challenges for clinical diagnostics. It is highly fragmented, may be very rare (<0.01%) as a proportion of all circulating free nucleic acids in blood, and may be especially difficult to detect in certain cancers such as those localized in the central nervous system. Highly sensitive assays have been developed and continue to be improved upon to address these challenges.

CtDNA in the systemic circulation is eventually excreted into urine, where it is thought to undergo further degradation. ^19"21 Urine is a truly non-invasive alternative to tissue biopsy and could capture mutations missed in tissue because of tumor heterogeneity. To date, only a limited number of published studies have examined the feasibility of ctDNA detection from urine. While, to our knowledge, none of these describe ctDNA detection from the urine of NSCLC patients, patient-matched tissue, plasma and urine studies in colorectal cancer (KRAS) and histiocytic disorders (BRAF) indicate good concordance of DNA mutation status across all three biopsy specimens. ^21-24

Using the methods of Example 6, the clinical performance of this platform was evaluated in matched pretreatment urine and plasma was evaluated, and the feasibility of longitudinal monitoring of EGFR mutations from the urine of NSCLC patients was examined with data from TIGER-X, a phase 1/2 study of the third generation EGFR-TKI rociletinib (CO-1686).

PATIENTS AND METHODS

Patients. A blinded, retrospective study was conducted on matched urine and plasma specimens collected from 63 Stage IIIB-iV patients enrolled in the TIGER-X trial (NCT01526928). Patients in TIGER-X were required to have histologically or cytologically confirmed NSCLC and documented evidence of >1 EGFR mutations. All patients signed an EC/IRB-approved consent prior to any procedures. Further details regarding TIGER-X study

1 3

design have been previously published. , ^{' 25}

Sample Collection and Processing. Tissue biopsies were collected within 60 days of initiation of treatment with rociletinib. For all FFPE tissue specimens, tumor content was assessed by board-certified pathologists using Hematoxylin and Eosin (H&E) stained slides. Tumor specimens were considered evaluable if any tumor cells were identified present. For 7 cases, DNA was extracted from one 5 μιη section and central laboratory tissue testing was performed with the Cobas® EGFR Mutation Test (Roche Molecular Systems, CA). For 55 cases, DNA was extracted from two 5 μm sections and central laboratory tissue testing was performed with the Therascreen ^® EGFR RGQ Polymerase Chain Reaction (PCR) Kit (Qiagen, CA). A local EGFR test result was used for one case where tissue was not submitted to the central lab.

Blood and urine samples were obtained serially, prior to administration of the first dose and with every 21 -day cycle of treatment with rociletinib. Blood samples were collected in K2 EDTA BD Vacutainer tubes, processed into plasma within 30 minutes (1800 xg for 10 min at 18- 23 °C), and stored at or below -70°C. For plasma DNA analysis, 1.5-4 mL of plasma was extracted using the QIAamp DNA Circulating Nucleic Acid Kit (Manchester, U.K.) according to manufacturer's instructions. Urine samples between 10-100 mL were collected into 120-mL cups, supplemented with preservative, and stored at or below -70°C. For urinary DNA extraction, urine was concentrated to 4 mL using Vivacell 100 concentrators (Sartorius Corp, Bohemia, NY) and incubated with 700 μL of Q-sepharose Fast Flow quaternary ammonium resin (GE Healthcare, Pittsburg, PA). Tubes were spun to collect sepharose and bound DNA. The pellet was resuspended in a buffer containing guanidinium hydrochloride and isopropanol, and the eluted DNA was collected as a flow-through using polypropylene chromatography columns (BioRad Laboratories, Irvine, CA). The DNA was further purified using QiaQuick columns (Qiagen, Germany). Plasma and urine DNA was quantitated using a droplet digital PCR (ddPCR) assay that amplifies a single copy RNaseP reference gene (QX200 ddPCR system, Bio-Rad, CA) as described previously.

Urine and Plasma EGFR Mutation Analysis. Quantitative analysis of the T790M resistance mutation and EGFR activating mutations (L858R and 69 deletion variants in exon 19) was performed using a mutation enrichment PCR coupled with next-generation sequencing detection (MiSeq, Mumina Inc., San Diego, CA). Selective amplification of mutant fragments was accomplished via short amplicon (42-44bp) kinetically driven PCR that amplifies the mutant fragments while suppressing the amplification of the wild-type (WT) sequence using a blocker oligonucleotide. PCR primers contained a 3' gene-specific sequence and a 5' common sequence that was used in the subsequent sample-barcoding step. The PCR enrichment cycling conditions utilized the initial 98°C denaturation step followed by the assay specific 5-15 cycles of pre- amplification PCR and 17-32 cycles of mutation enrichment PCR.

Custom DNA sequencing libraries were constructed and indexed using the Access Array

System for Illumina Sequencing Systems (Fluidigm Corp, San Francisco, CA). The indexed libraries were pooled, diluted to equimolar amounts with buffer and the PhiX Control library, and sequenced to 200,000x coverage on an Illumina MiSeq platform using 150-V3 sequencing kits (Illumina, Inc.). Primary image analysis, secondary base calling and data quality assessment were performed on the MiSeq instrument using RTAvl.18.54 and MiSeq Reporter v2.6.2.3 software (Illumina, Inc.). The analysis output files (FASTQ) from the runs were processed using custom sequencing reads counting and variant calling algorithms to tally the sums of total target gene reads, wild-type or mutant EGFR reads, which passed predetermined sequence quality criteria (qscore > 20). A custom quantification algorithm was developed to accurately determine the absolute number of mutant DNA molecules in the source ctDNA sample. To that end, each single multiplexed MiSeq NGS run contained a set of standard curve samples in addition to clinical samples and controls. For each run the standard sample set was assayed in parallel with patient samples starting with PCR enrichment of mutant EGFR DNA followed by NGS. The number of mutant copies detected was determined by interpolation from a standard curve derived from the standard sample set, and standardized by normalizing the number of copies detected in the sample to a constant number of WT DNA genome equivalents (GEq)observed in an average urine sample (i.e., 330ng WT DNA = 100,000 GEq).

Determination of ctDNA EGFR Mutation Detection Cut-offs in Urine and Plasma. Clinical EGFR mutation detection cut-offs for urine and plasma were determined for each assay by assessing the level of non-specific signal present, if any, from urine and plasma DNA samples obtained from 54-64 unique healthy volunteers and metastatic patients with non-NSCLC cancers (approximately 1/1). Detection cut-offs were standardized to 100,000 WT GEq yielding adjusted clinical detection cut-offs of 5.5, 5.5 and 12.6 for exon 19 deletions, L858R and T790M, respectively.

Statistical Analysis. The correlation between input and output absolute EGFR mutant copies in the analytical spike-in experiments were examined using Spearman's correlation which is robust against non-linearity. Analysis of trends observed in urine ctDNA EGFR signal upon patient treatment with rociletinib was assessed using two-sided Wilcoxon's paired two-sample test. P-values less than 0.05 were considered statistically significant. All statistical analyses were carried out using R v3.2.3 computer software.

RESULTS

Development of EGFR Mutation Enrichment NGS EGFR Mutation Assays for ctDNA. A three-pronged approach was taken to overcome the inherent technical challenges of obtaining sensitive detection and robust quantification of ctDNA mutations in plasma and urine. First, ultra-short footprint PCR assays were developed to increase the likelihood of amplifying highly degraded ctDNA. Three ultra-short footprint assays were developed to detect the most common EGFR mutations: (a) a 42bp EGFR exon 19 deletion assay recognizing 69 annotated deletions, (b) a 46bp EGFR exon 21 L858R assay, and (c) a 44bp EGFR exon 20 T790M assay. Secondly, mutant ctDNA fragments were enriched by a PCR-based method to maximize sensitivity for detecting ctDNA mutations having rare prevalence (i.e., ~0.01%). Preferential PCR enrichment of mutant EGFR ctDNA was accomplished by using WT EGFR oligonucleotides that block the ability of PCR primers to anneal and amplify WT EGFR DNA thereby increasing the likelihood of amplifying mutant EGFR templates (Patients and Methods). Lastly, absolute ctDNA mutation copy numbers from a patient sample were quantitated by next generation sequencing (NGS) methodology. This was achieved with the aid of a standard sample set spiked with known copies of mutant EGFR molecules.

Enrichment performance of EGFR mutant DNA was assessed by spiking 5 to 500 copies of mutant DNA into 18,181 GEq of WT DNA (0.028% to 2.7%). Fold-enrichment of EGFR mutant fragments increased as the proportion of mutant versus WT fragments decreased from 2.7% to 0.028% (Table 15 and FIG. 7B). The resulting sequencing libraries were comprised of 24% to 99.9% mutant reads thus enabling sensitive mutation detection by NGS (Table 15). For the three assays, 857 to 3,214 fold enrichment of EGFR mutation signal was obtained for an input of 5 copies of mutant EGFR DNA within 60 ng (18,181 GEq) of WT DNA (FIG. 14). Mutant reads in a test sample were converted to mutant copy number in the original sample by interpolation to the standard curve (Patients and Methods).

Analytical Performance of ctDNA EGFR Mutation Assays. Enrichment performance of EGFR mutant DNA was assessed by spiking 5 to 500 copies of mutant DNA into 18,181 GEq of WT DNA (0.028% to 2.7%). Fold-enrichment of EGFR mutant fragments increased as the proportion of mutant versus WT fragments decreased from 2.7% to 0.028% (Table 15, FIG. 7B). The resulting sequencing libraries were comprised of 24% to 99.9% mutant reads thus enabling sensitive mutation detection by NGS (Table 17). For the three assays, 857 to 3,214 fold enrichment of EGFR mutation signal was obtained for an input of 5 copies of mutant EGFR DNA within 60 ng (18, 181 GEq) of WT DNA (FIG. 7B).

Determination of lower limit of detection. The lower limit of detection (LLoD) for the EGFR mutation assays was determined by using a statistical model based on the Poisson distribution of rare mutant DNA molecules within a series of highly diluted EGFR mutant DNA samples.

When quantifying rare DNA fragments, the frequency distribution of the number of DNA molecules that will be present for measurement in each PCR tube can be predicted by the Poisson distribution. If, for example, a PCR reaction is expected to contain a single molecule of target DNA, Poisson distribution predicts probabilities of 36.8, 36.8, 18.4, and 6.1% for 0, 1, 2, and 3 molecules, respectively, to be actually present in the PCR tube. Herein, the LLoD was defined as the lowest number of copies for which the frequency distribution of the copy number events upon repeated measurements fell within the 95% confidence interval of expected frequency distribution determined by Poisson statistics. For LLoD finding and verification, 80 repeated measurements were performed on a single multiplexed NGS run for each spike-in level of 1, 2 or 3 mutant EGFR copies within 18,181 genome equivalents (60 ng) of EGFR WT DNA, and the observed frequency distribution for mutant copy events was compared to the expected frequency. For sample preparation, stock DNA solutions of 100 mutant copies per μL were prepared using cell line DNA quantified using ddPCR (RainDance, Billerica, MA), and then diluted serially to a target copy level in 18,181 GEq of EGFR WT DNA. The number of mutant EGFR copies in each measured dilution sample was determined by interpolating the number of NGS reads to a standard curve, with reference standards at 5, 10, 50, 100 and 250 copy level prepared from a different stock solution. Lower Limit of Blank (LLoB) was calculated for each EGFR assay using samples containing EGFR WT DNA.

Observed frequency distribution of the number of copies detected within 80 replicates of samples with a mutant DNA spike-in level of one or two expected mutant DNA copies per replicate was within the 95% confidence intervals of expected frequency distribution within a Poisson model (Table 18). These results indicated a lower limit of detection of 1 copy in 18,181 WT GEq (0.006%) for EGFR exon 19 deletion and L858R assays and a LLoD of 2 copies in 18,181 GEq (0.01%) for the EGFR T790M assay. Table 18.

The analytical accuracy and reproducibility of the EGFR mutation assays were determined by a dilution series of six replicates of 0, 5, 10, 50, 100 and 250 copies in a background of 18,181 WT DNA copies, spanning the linear range of the assays. The entire workflow was replicated six times with three dilution series replicates prepared by two different operators on three different days for a total of 18 measurements at each copy level; NGS analysis was on two different Illumina MiSeq instruments. The Spearman correlation between spiked-in absolute copy numbers (quantified by ddPCR) versus detected copy numbers (quantified by mutation enrichment NGS) ranged from 0.967 to 0.981 for the EGFR mutation assays.

Table 19 shows the inter-run reproducibility of the EGFR exon 19 deletions, L858R and T790M mutation enrichment NGS assays for a 250 copies to 5 copies dilution series. CV% denotes Coefficient of Variation Percent (CV%).

The mean coefficient of variation percentage (CV%) was 34.5% across the reportable range of 5 to 250 for all three EGFR mutation assays yielding an adjusted quantifiable range of 27.5 to 1,375 copies per 100,000 GEq), with the highest CV% of 47.4-60.7% observed at the lowest input of 5 copies likely due to Poisson limitations (Table 19).

Table 19.

Assay fold-discrimination performance was examined by comparing the expected copy ratio between two consecutive dilutions to the observed copy ratio. Table 20 shows the quantification of 2-fold differences between subsequent mutant copy input levels. The expected fold ratio was calculated as the ratio of the two input mutant copy levels. The observed fold ratio was calculated as the ratio of two means for two measured mutant copy levels with a 95% confidence interval.

able 20.

Known 2-fold and 2.5-fold differences within the dilution series were maintained and detected for all three EGFR mutation assays (Table 20).

Clinical Performance of ctDNA EGFR Mutation Assays in Urine. Baseline tumor tissue biopsies and urine samples were obtained from 63 Stage IIIB/iV NSCLC patients enrolled in TIGER-X, a phase 1/2 trial of rociletinib in patients treated with at least one prior EGFR inhibitor and who have an EGFR activating mutation in their medical record. Tumor tissue was processed by a central laboratory for EGFR mutation testing. Of the 63 tumor tissue biopsies, 60 samples were adequate for analysis with 47 positive for T790M, 167 positive for L858R and 42 positive for exon 19 deletion mutations. (Thirteen of 60 e valuable cases were negative for T790M, and 2 of 60 cases were negative for either L858R or exon 19 deletion mutation by central lab testing.) Urine volumes ranged from 10-100 mL with 19 of 63 samples meeting the pre-specified criteria for the recommended urine volume of 90-100 mL.

Table 21 shows contingency tables for the analysis of EGFR T790M mutation in matched tumor, urine and plasma samples from patients enrolled in TIGER-X clinical trial. A, Urine versus tumor analysis of T790M in 63 matched tumor and urine specimens. B, Plasma versus tumor analysis of T790M in 60 matched tumor and plasma specimens. C, Urine versus plasma analysis of T790M in 60 matched urine and plasma specimens. Table 21.

A Urine vs Tissue

Plasma vs Tissue

c Urine vs Plasma

Using tumor tissue testing results as a reference standard, the sensitivity of the urine assays was 93% (13/14) for T790M, 80% (4/5) for L858R, and 83% (10/12) for exon 19 deletions for 90-100 mL sample volumes (Table 21). For all samples (volumes 10-100 mL), sensitivity of EGFR mutation detection was 72% (34/47) for T790M, 7% (1/1) for L858R, and 67% (28/42) for exon 19 deletion mutations (Table 21).

The specificity of the EGFR urine assays was determined using urine samples obtained from healthy donors and patients with non-NSCLC metastatic cancers (Patients and Methods) and was 96% for T790M, 100% for L858R, and 94% for the exon 19 deletion mutations (Table 21).

Clinical Performance of ctDNA EGFR Mutation Assays in Plasma. Plasma was available for 60 of the 63 patients. Using tumor tissue testing results as a reference standard, the detection sensitivity of the assays in plasma was 93% (38/41; 3 of 44 available plasma samples failed NGS) for T790M, 100% (17/17) for L858R, and 87% (34/39) for exon 19 deletions (Table 22). The specificity of the EGFR plasma tests was determined using plasma samples obtained from healthy donors and patients with non-NSCLC metastatic cancers and was 94% for the T790M, 100% for the L858R and 96% for the exon 19 deletion mutations (Table 21).

Table 22. Performance of Mutation Enrichment NGS Assays for Detection of EGFR Mutations in Urine and Plasma.

Urine and Plasma Identify Additional EGFR T790M Positive Cases Undetectable by Tissue Biopsy. FIG. 15 shows overlapping positive T790 cases determined by urine, tissue and plasma samples. For all urine sample volumes, there were 11 cases that were urine T790M- positive but tumor tissue T790M-negative or tissue sample inadequate (Table 19). Of these 11 cases, 10 were also T790M positive in plasma (1 sample was T790M negative in plasma). Similarly, of the 11 discordant cases that were plasma T790M positive but tissue T790M negative or tissue sample inadequate, 10 were also positive by urine T790M testing (1 sample was T790M negative in urine). Together, urine and plasma T790M testing identified a higher proportion of positive cases (89%, 56/63) than tissue (75%, 47/63).

When 60 cases with all three patient-matched specimen types were considered, urine identified seven T790M cases not detected or failed in plasma and eleven cases not detected by tissue or found to be tissue sample inadequate (FIG. 15). Urine and blood combined detected T790M in 93% of patients (56/60). Tissue alone detected T790M in 73% of patients (44/60). Four of 60 cases were negative by either tissue, plasma or urine.

Association of EGFR T790M Levels in Urine with Patient Response to Rociletinib. Recent studies have suggested that the extent to which plasma EGFR mutation levels drop after introduction of EGFR-TKI therapy may predict depth of response. ' To assess this relationship in urine, longitudinal urine samples were obtained from 15 patients treated with therapeutic doses of rociletinib (500, 625, 750 or 1000 mg BID HBr). Of these 15 patients, 5 patients had progressive disease (PD) as best overall confirmed response and 10 patients had either stable disease (SD) or partial response (PR) as best overall confirmed response. Among these, nine patients were identified with quantifiable levels of baseline T790M in urine (>27.5 copies per 100,000 GEq), with 7 experiencing PR or SD as best overall confirmed response and 2 with progressive PD as best overall confirmed response. For all 9 patients, there was a statistically significant large decrease in T790M levels in urine after cycle 1 relative to baseline irrespective of best overall confirmed response (range -51 to -100%; p=0.0091, two-sided Wilcoxon test; p<0.0001, two-sided t-test; FIG. 16 and Table 23). However, in the two patients with progressive disease, there was an observed attenuated decrease (-51 and -70%) in comparison to patients with PR and SD as best overall confirmed response (range -83 to -100%). Thus, patients responding to rociletinib had a decrease of EGFR T790M to below 25% of baseline (beginning of treatment) within three weeks (FIG. 16A), whereas patients that did not respond to treatment showed a more modest initial EGFR T790M decrease, to above 25% at 3 weeks. able 23.

DISCUSSION

Herein we describe a highly sensitive method for detection of actionable EGFR mutations in the urine and plasma of patients with advanced NSCLC. In our study cohort of relapsed patients, at the recommended urine volume of 90-100 mL, a sensitivity of 93% (13/14), 83% (10/12) and 71% (5/7) was observed for the T790M, EGFR exon 19 deletions and L858R mutations respectively. For all patients (all urine volumes) the sensitivity of EGFR mutation detection in urine with tumor as reference was 72% (34/47) for T790M, 67% (28/42) for exon 19 deletions, and 76% (13/17) for L858R mutations. The specificity of the urine EGFR assays in healthy volunteers or patients without NSCLC was 96% for T790M, 100% for L858R, and 94% for exon 19 deletion mutations. To our knowledge, this study represents the first successful demonstration of EGFR mutation detection in the urine of patients with metastatic NSCLC.

The transrenal clearance of systemically derived DNA was first demonstrated in 2000 by

Botezatu et al. who detected male-specific sequences in the urine of women transfused with male blood or pregnant with male fetuses. ¹⁹ In addition, this pioneering work demonstrated that circulating nucleic acid of tumor origin could be identified in the urine of cancer patients, specifically those with colorectal or pancreatic cancer. ¹⁹ Further studies suggested that the size of

21 the systemically derived DNA fragments in urine can range from approximately 35 to 250 bp. '

26 28

Subsequently, an anion exchange-based urinary DNA isolation technique coupled with ultrashort amplicon PCR detection was developed to maximize the detection of systemically derived DNA. ' ' The method described in the present study builds on this work, incorporating an anion exchange-based method to preferentially isolate low molecular weight DNA from urine, short amplicon PCR with wild-type DNA suppression for mutation enrichment, and ultra-deep sequencing to further enhance the identification of rare mutations. Using this approach, we show single copy detection with spiked sample material.

Our methodology may have also contributed to the high clinical sensitivity we observed for detecting EGFR mutations in plasma (range 87%- 100%), which compares favorably to the published performance of real-time and droplet digital PCR platforms. For example, T790M detection sensitivity in patients who relapsed on first-line EGFR TKIs was shown to range between 64% and 73% for the cobas® test, a test platform based on real-time PCR, and 73% to 81% for BEAMing, a technology based on digital PCR. ' In the same studies, the sensitivity for detection of activating EGFR mutations was 73-84% for the cobas® test and 82-84% for the

1 3 1 7

BEAMing assay. ' In four recent trials in previously untreated NSCLC patients (NCT01203917, FASTACT-2, TRIGGER and EUROTAC trials), the sensitivity for detection of EGFR exon 19 deletions and L858R mutations in plasma was 78% for a real-time peptide nucleic acid (PNA) clamp test, and ranged from 61.8% to 67.6% for the therascreen EGFR RGQ PCR test and 62.2% to 100% for the cobas® plasma test. ¹⁴ ' ¹⁵ ' ²⁹ ' ³⁰ The specificities of our plasma assays in healthy volunteers and patients without NSCLC were 94-100%, similar to that found in urine.

Assay sensitivity in the present study was calculated using tumor as the reference sample type. This method has limitations, particularly when applied to resistance mutations such as T790M which will have a significant false negative rate in biopsies due to tumor heterogeneity and low tumor cellularity. ⁹ ' ¹⁰ ' ¹³ In our study, the combination of urine and plasma testing identified 12 EGFR T790M positive cases that were undetectable by central lab testing of tumor tissue. While 10 of the 12 cases were positive by both ctDNA specimen types, one was unique to plasma and one was unique to urine. Urine may therefore provide unique and complementary information about a patient's mutational status that is not captured by plasma or tissue tests. These results indicate for the first time that either urine or plasma T790M testing may be considered as an alternative to tissue biopsy testing. Urine may be particularly attractive for patients with poor health status because it represents a truly non-invasive alternative that can be collected in a patient's own home.

Given the ease and flexibility of sample collection, urine holds promise for the serial monitoring of patients. Studies in plasma have already shown that early changes in ctDNA may predict response to targeted therapies and that emergence of resistance mutations can be identified before radiographic progression. ^12-14 ' ¹⁸ Reported here, T790M levels in urine rapidly fell to a fraction of their pretreatment levels in patients treated with rociletinib, regardless of RECIST response status. These data are consistent with previous findings in plasma and suggest that rociletinib reduces proliferation and consequently turnover of T790M-positive clones even in

9 1

patients with primary resistance. ' It is an intriguing observation that there was an attenuated decrease in T790M levels for the two patients with progressive disease as best overall response. Further urine analysis of a substantially larger cohort of patients from the TIGER-X study is ongoing and should further inform the utility of longitudinal monitoring in this patient population.

In conclusion, our data demonstrates that urine testing using mutation enrichment NGS method successfully identifies EGFR mutations in patients with metastatic NSCLC and has high concordance with tumor and plasma, suggesting that EGFR mutation detection from urine should be considered as a viable approach for assessing EGFR mutation status.

REFERENCES

1. Arcila ME, Oxnard GR, Nafa K, et al. Rebiopsy of lung cancer patients with acquired resistance to EGFR inhibitors and enhanced detection of the T790M mutation using a locked nucleic acid-based assay. Clin Cancer Res 2011; 17:1169-1180.

2. Douillard JY, Ostoros G, Cobo M, et al. Gefitinib treatment in EGFR mutated Caucasian NSCLC: circulating-free tumor DNA as a surrogate for determination of EGFR status. J Thorac Oncol 2014;9:1345-1353.

3. Accordino MK, Wright JD, Buono D, et al. Trends in use and safety of image-guided transthoracic needle biopsies in patients with cancer. J Oncol Pract 2015;11 :e351-359.

4. Levy BP, Chioda MD, Herndon D, et al. Molecular Testing for Treatment of Metastatic Non-Small Cell Lung Cancer: How to Implement Evidence-Based Recommendations. Oncologist 2015;20:1175-1181. 5. Lindeman NI, Cagle PT, Beasley MB, et al. Molecular testing guideline for selection of lung cancer patients for EGFR and ALK tyrosine kinase inhibitors: guideline from the College of American Pathologists, International Association for the Study of Lung Cancer, and Association for Molecular Pathology. J Thorac Oncol 2013;8:823-859.

6. Spicer J, Tischer B, Peters M. EGFR mutation testing and oncologist treatment choice in advanced NSCLC: Global trends and differences. European Lung Cancer Conference. Geneva, Switzerland: 2015;LBA2 PR.

7. Yu HA, Arcila ME, Rekhtman N, et al. Analysis of tumor specimens at the time of acquired resistance to EGFR-TKI therapy in 155 patients with EGFR-mutant lung cancers. Clin Cancer Res 2013;19:2240-2247.

8. Yoon HJ, Lee HY, Lee KS, et al. Repeat biopsy for mutational analysis of non-small cell lung cancers resistant to previous chemotherapy: adequacy and complications. Radiology 2012;265:939-948.

9. Piotrowska Z, Niederst MJ, Karlovich CA, et al. Heterogeneity Underlies the Emergence of EGFRT790 Wild-Type Clones Following Treatment of T790M-Positive Cancers with a Third- Generation EGFR Inhibitor. Cancer Discov 2015;5:713-722.

10. Suda K, Murakami I, Katayama T, et al. Reciprocal and complementary role of MET amplification and EGFR T790M mutation in acquired resistance to kinase inhibitors in lung cancer. Clin Cancer Res 2010;16:5489-5498.

11. Diaz LA, Jr., Bardelli A. Liquid biopsies: genotyping circulating tumor DNA. J Clin Oncol 2014;32:579-586.

12. Bettegowda C, Sausen M, Leary RJ, et al. Detection of circulating tumor DNA in early- and late-stage human malignancies. Sci Transl Med 2014;6:224ra224.

13. Karlovich C, Goldman JW, Sun JM, et al. Assessment of EGFR Mutation Status in Matched Plasma and Tumor Tissue of NSCLC Patients from a Phase I Study of Rociletinib (CO-

1686). Clin Cancer Res 2016.

14. Marchetti A, Palma JF, Felicioni L, et al. Early Prediction of Response to Tyrosine Kinase Inhibitors by Quantification of EGFR Mutations in Plasma of NSCLC Patients. J Thorac Oncol 2015;10:1437-1443. 15. Mok T, Wu YL, Lee JS, et al. Detection and Dynamic Changes of EGFR Mutations from Circulating Tumor DNA as a Predictor of Survival Outcomes in NSCLC Patients Treated with First-line Intercalated Erlotinib and Chemotherapy. Clin Cancer Res 2015;21:3196-3203.

16. Sausen M, Phallen J, Adleff V, et al. Clinical implications of genomic alterations in the tumour and circulation of pancreatic cancer patients. Nat Commun 2015;6:7686.

17. Thress KS, Brant R, Carr TH, et al. EGFR mutation detection in ctDNA from NSCLC patient plasma: A cross-platform comparison of leading technologies to support the clinical development of AZD9291. Lung Cancer 2015;90:509-515.

18. Siravegna G, Mussolin B, Buscarino M, et al. Clonal evolution and resistance to EGFR blockade in the blood of colorectal cancer patients. Nat Med 2015;21:795-801.

19. Botezatu I, Serdyuk O, Potapova G, et al. Genetic analysis of DNA excreted in urine: a new approach for detecting specific genomic DNA sequences from cells dying in an organism. Clin Chem 2000;46:1078-1084.

20. Lichtenstein AV, Melkonyan HS, Tomei LD, et al. Circulating nucleic acids and apoptosis. Ann N Y Acad Sci 2001;945:239-249.

21. Su ΥΉ, Wang M, Brenner DE, et al. Human urine contains small, 150 to 250 nucleotide- sized, soluble DNA derived from the circulation and may be useful in the detection of colorectal cancer. J Mol Diagn 2004;6:101-107.

22. Hyman DM, Diamond EL, Vibat CR, et al. Prospective blinded study of BRAFV600E mutation detection in cell-free DNA of patients with systemic histiocytic disorders. Cancer

Discov 2015;5:64-71.

23. Janku F, Vibat CR, Kosco K, et al. BRAF V600E mutations in urine and plasma cell-free DNA from patients with Erdheim-Chester disease. Oncotarget 2014;5:3607-3610.

24. Su Y-H, Song J, Wang Z, et al. Removal of High-Molecular-Weight DNA by Carboxylated Magnetic Beads Enhances the Detection of Mutated K-ras DNA in Urine. Annals of the New York Academy of Sciences 2008;1137:82-91.

25. Sequist LV, Soria JC, Goldman JW, et al. Rociletinib in EGFR-mutated non-small-cell lung cancer. N Engl J Med 2015;372:1700-1709. 26. Chan KC, Leung SF, Yeung SW, et al. Quantitative analysis of the transrenal excretion of circulating EBV DNA in nasopharyngeal carcinoma patients. Clin Cancer Res 2008; 14:4809- 4813.

27. Melkonyan HS, Feaver WJ, Meyer E, et al. Transrenal nucleic acids: from proof of principle to clinical tests. Ann N Y Acad Sci 2008;1137:73-81.

28. Tsui NB, Jiang P, Chow KC, et al. High resolution size analysis of fetal DNA in the urine of pregnant women by paired-end massively parallel sequencing. PLoS One 2012;7:e48319.

29. Douillard JY, Siena S, Peeters M, et al. Impact of early tumour shrinkage and resection on outcomes in patients with wild-type RAS metastatic colorectal cancer. Eur J Cancer 2015;51:1231-1242.

30. Karachaliou N, Mayo-de las Casas C, Queralt C, et al. Association of EGFR L858R Mutation in Circulating Free DNA With Survival in the EURTAC Trial. JAMA Oncol 2015;1:149-157. The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other documents.

The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including," "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in exemplary embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and biologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.