FIELD OF INVENTION

The present invention relates to oligonucleotides (oligomers) that are complementary to TOM1 , leading to modulation of the expression of TOM1 . Such oligonucleotides may be used for reducing TOM1 transcript in the cell, leading to modulation of the expression of TOM1 transcript in a cell. Modulation of TOM1 expression is beneficial for a range of medical disorders, such as cancers, Alzheimers disease or cystic fibrosis.

BACKGROUND

The "target of the Myb1 membrane trafficking protein" (TOM1 ) was identified as a target of the v-myb oncogene. TOM1 has been mapped to human chromosome 22q13.1 and is suggested to be a member of a family of genes implicated in the regulation of trafficking of growth-factor- receptor complexes that are destined for degradation in the lysosome (Seroussi et al 1999, Genomics 57:380-388).

TOM1 has been connected with cancer, see for example US2007/0264659 which discloses a connection between TOM1 over-expression levels and lung cancer. TOM1 has also been shown to be involved in proliferation and invasion of colon cancer (Li et al. 2013 Journal of Central South University Medical sciences Aug; 38(8):809-17).

TOM1 has been described in connection with neurodegenerative diseases like Alzheimer's Disease, where it has been shown that TOM1 plays important roles in protein-degradation systems in pathogenesis (Makioka et al. 2016 J Neurol Sci. 365: 101 -7). Furthermore TOM 1 has been described in connection with genetic disorders as in cystic fibrosis where it is involved in regulating innate immune responses in the lung (Oglesby et al, 2010 J Immunol,;

184(4): 1702-9).

Antisense oligonucleotides targeting repeated sites in the same RNA has been shown for some targets to have enhanced potency for down-regulation of the target mRNA in some cases in vitro transfection experiments. This has been the case for GCGR, STST3, MAPT, OGFR, and BOK RNA's (T, Vickers et al, PLOS one October 2014, volume 9, issue 10). Similar data are shown in WO2013/120003.

OBJECTIVE OF THE INVENTION TOM1 is involved in the progression of a number disease, such as cancer and

neurodegenerative diseases such as Alzheimer's and genetic disorders such as cystic fibrosis.

The present invention provides antisense oligonucleotides capable of modulating TOM1 mRNA and protein expression both in vivo and in vitro. Accordingly, the present invention can potentially be used in therapy of for example for Alzheimer's disease, cystic fibrosis or cancer. Particularly, in combination therapy together with the known therapies for cancers.

SUMMARY OF INVENTION

The present invention relates to oligonucleotides targeting a nucleic acid capable of modulating the expression of TOM1 and to treat or prevent diseases related to the functioning of the TOM1.

Accordingly, in a first aspect the invention provides oligonucleotides which comprise a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90%

complementarity to a target nucleic acid selected from the group consisting of SEQ ID NO:1 , SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and/or SEQ ID NO:10 . The oligonucleotide can be an antisense oligonucleotide, preferably with a gapmer design. Preferably, the oligonucleotide is capable of inhibiting the expression of TOM1 by cleavage of a target nucleic acid. The cleavage is preferably achieved via nuclease recruitment.

In a further aspect the invention provides an antisense oligonucleotide, wherein the sequence that is targeted by the oligonucleotide is an intron.

In a further aspect, the invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide is at least 90% complementary to SEQ ID NO: 12 or SEQ ID NO: 29.

In a further aspect, the antisense oligonucleotide targets at least two, such as at least three independent regions in the target nucleic acid.

In a further aspect the invention provides the antisense oligonucleotide according to any one of the previous aspects, wherein the contiguous nucleotide sequence is complementary to at least two independent region selected from the group consisting of position 43483-43502, 43608- 43627, 43726-43745, 43947-43966, 44249-44268, 44330-44349, 44437-44456; 43485-43502, 43610-43627, 43728-43745, 43949-43966, 44251-44268, 44332-44349, 44439-44456; 43485- 43500, 43610-43625, 43728-43743, 43949-43964, 44251-44266, 44332-44347, 44439-44454; 43485-43498, 43610-43623, 43728-43741 , 43949-43962, 44251-44264, 44332-44345, 44439- 44452; 43497-43516, 43622-43641 , 43740-43759, 43863-43882, 43961 -43980, 44158-44177, 44263-44282; 43497-43512, 43622-43637, 43740-43755, 43863-43878, 43961-43976, 44078- 44093, 44158-44173, 44263-44278, 44451 -44466; 43498-4351 1 , 43623-43636, 43741-43754, 43864-43877, 43962-43975, 44079-44092, 44159-44172, 44264-44277, 44452-44465; 43499- 43516, 43624-43641 , 43742-43759, 43865-43882, 43963-43980, 44160-44177, 44265-44282 of SEQ ID NO: 1.

In a further aspect the invention provides the antisense oligonucleotide according to any one of the previous aspects, wherein the oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NO: 21-28. In a further aspect, the invention provides pharmaceutical compositions comprising the oligonucleotides of the invention and pharmaceutically acceptable diluents, carriers, salts and/or adjuvants.

In a further aspect, the invention provides methods for in vivo or in vitro method for modulation of TOM1 expression in a target cell which is expressing TOM1 , by administering an

oligonucleotide or composition of the invention in an effective amount to said cell.

In a further aspect the invention provides methods for treating or preventing a disease, disorder or dysfunction associated with in vivo activity of TOM1 comprising administering a

therapeutically or prophylactically effective amount of the oligonucleotide of the invention to a subject suffering from or susceptible to the disease, disorder or dysfunction.

In a further aspect the oligonucleotide or the conjugate or the pharmaceutical or composition of the invention is used for the alleviation or prevention of Alzheimer's Disease, cystic fibrosis or cancer.

DEFINITIONS Oligonucleotide

The term "oligonucleotide" as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers.

Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides. Antisense oligonucleotides

The term "Antisense oligonucleotide" as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense

oligonucleotides of the present invention are single stranded.

Contiguous Nucleotide Sequence

The term "contiguous nucleotide sequence" refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term "contiguous nucleobase sequence" and the term "oligonucleotide motif sequence". In some embodiments all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.

Nucleotides

Nucleotides are the building blocks of oligonucleotides and polynucleotides, and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in

nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as "units" or "monomers".

Modified nucleoside

The term "modified nucleoside" or "nucleoside modification" as used herein refers to

nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. In a preferred embodiment the modified nucleoside comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term "nucleoside analogue" or modified "units" or modified "monomers". Nucleosides with an unmodified DNA or RNA sugar moiety are termed DNA or RNA nucleosides herein. Nucleosides with modifications in the base region of the DNA or RNA nucleoside are still generally termed DNA or RNA if they allow Watson Crick base pairing.

Modified internucleoside linkage

The term "modified internucleoside linkage" is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed "modified nucleotides". In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.

In an embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is for example more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages. In some embodiments at least 50% of the internucleoside linkages in the

oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages.

In some embodiments the modified internucleoside linkages may be selected from the group comprising phosphorothioate, diphosphorothioate and boranophosphate. In some

embodiments, the modified internucleoside linkages are compatible with the RNaseH recruitment of the oligonucleotide of the invention, for example phosphorothioate,

diphosphorothioate or boranophosphate.

In some embodiments the internucleoside linkage comprises sulphur (S), such as a

phosphorothioate internucleoside linkage, which is currently the preferred internucleoside linkage.

A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmakokinetics and ease of manufacture. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 75%, such as at least 80%, such as at least 90% or such as at least 95% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.

In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester,

methylphosphonate, MMI, amide-3, formacetal or thioformacetal.

Further internucleoside linkages are disclosed in WO2009/124238 (incorporated herein by reference). In an embodiment the internucleoside linkage is selected from linkers disclosed in WO2007/031091 (incorporated herein by reference). Particularly, the internucleoside linkage may be selected from -0-P(0) ₂ -0-, -0-P(0,S)-0-, -0-P(S) ₂ -0-, -S-P(0) ₂ -0-, -S-P(0,S)-0-, -S- P(S) ₂ -0-, -0-P(0) ₂ -S-, -0-P(0,S)-S-, -S-P(0) ₂ -S-, -0-PO(R ^H )-0-, 0-PO(OCH ₃ )-0-, -0-PO(NR ^H )- 0-, -0-PO(OCH ₂ CH ₂ S-R)-0-, -0-PO(BH ₃ )-0-, -0-PO(NHR ^H )-0-, -0-P(0) ₂ -NR ^H -, -NR ^H -P(0) ₂ -0- , -NR ^H -CO-0-, -NR ^H -CO-NR ^H -, and/or the internucleoside linker may be selected form the group consisting of: -0-CO-0-, -0-CO-NR ^H -, -NR ^H -CO-CH ₂ -, -0-CH ₂ -CO-NR ^H -, -0-CH ₂ -CH ₂ -NR ^H -, - CO-NR ^H -CH ₂ -, -CH ₂ -NR ^H CO-, -0-CH ₂ -CH ₂ -S-, -S-CH ₂ -CH ₂ -0-, -S-CH ₂ -CH ₂ -S-, -CH ₂ -S0 ₂ -CH ₂ -, -CH ₂ -CO-NR ^H -, -0-CH ₂ -CH ₂ -NR ^H -CO -, -CH ₂ -NCH ₃ -0-CH ₂ -, where R ^H is selected from hydrogen and C1 -4-alkyl.

Nuclease resistant linkages, such as phosphothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region of headmers and tailmers. Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and/or affinity enhancing regions such as regions F and F' for gapmers, or the modified nucleoside region of headmers and tailmers.

Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and/or bio-distribution of an oligonucleotide - see WO2008/1 13832, incorporated herein by reference.

In an embodiment all the internucleoside linkages in the oligonucleotide are phosphorothioate and/or boranophosphate linkages. Preferably, all the internucleoside linkages in the

oligonucleotide are phosphorothioate linkages. Nucleobase

The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring

nucleobases, but are functional during nucleic acid hybridization. In this context "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1 .4.1.

In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo- cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2- chloro-6-aminopurine.

The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used. Modified oligonucleotide

The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar- modified nucleosides and/or modified internucleoside linkages. The term chimeric"

oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides. Complementarity

The term "complementarity" describes the capacity for Watson-Crick base-pairing of

nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise

nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1 ).

The term "% complementary" as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to (i.e. form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences, dividing by the total number of nucleotides in the

oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch.

The term "fully complementary", refers to 100% complementarity.

The following is an example of the two oligonucleotide motifs of SEQ ID NO: 21 and SEQ ID NO: 27 (lower case letters) that are fully complementary to the target site sequence of SEQ ID NO: 29 (upper case letters). 5' ACACCACACACACATCTACACCCACCACACACAC 3' (SEQ ID NO : 29 ) .

3' tgtggtgtgtgtgtagatgt 5' (SEQ ID NO: 21)

3' gatgtgggtggtgt 5' (SEQ ID NO: 27)

Identity

The term "Identity" as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are identical to (i.e. in their ability to form Watson Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, including gaps

(mismatches), but excluding insertions and deletions, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent Identity = (Matches x 100)/Length of aligned region (with gaps).

Hybridization

The term "hybridizing" or "hybridizes" as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T _m ) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T _m is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔΘ° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔΘ° of the reaction between an

oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. ΔΘ° is the energy associated with a reaction where aqueous concentrations are 1 M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ΔΘ° is less than zero. ΔΘ° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem.

Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today. The skilled person will know that commercial equipment is available for AG° measurements. ΔΘ° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34: 1 121 1-1 1216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ΔΘ° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔΘ°. The oligonucleotides may hybridize to a target nucleic acid with estimated ΔΘ° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30

nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated ΔΘ° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or -16 to -27 kcal such as -18 to -25 kcal.

Target nucleic acid

According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian TOM1 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as a TOM1 target nucleic acid.

The oligonucleotide of the invention may, for example, target exon regions of a mammalian TOM1 , or may, for example, target intron region in the TOM1 , as predicted below in Table 1.

Table 1. Exon and intron regions in the human TOM1 pre-mRNA.

Suitably, the target nucleic acid encodes an TOM1 protein, in particular mammalian TOM1 , such as human TOM1 (See for example Tables 2 and 3) which provides the genomic sequence, the mature mRNA and pre-mRNA sequences for human, and pre-mRNA sequence for

Cynomolgus monkey TOM1.

In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 and 1 1 or naturally occurring variants thereof (e.g. sequences encoding a mammalian TOM1 protein. The target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA which encodes mammalian TOM1 protein, such as human TOM1 , e.g. the human pre-mRNA sequence, such as that disclosed as SEQ ID NO:1 , or human mature mRNA as disclosed in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10. In some embodiments the target sequence is a nucleic acid sequence which is conserved between human and monkey, in particular a sequence that is present in both SEQ ID NO: 1 and SEQ ID NO: 1 1 .

If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

For in vivo or in vitro application, the oligonucleotide of the invention is typically capable of inhibiting the expression of the TOM1 target nucleic acid in a cell which is expressing the TOM1 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the TOM1 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D' or D"). The target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA. In some embodiments the target nucleic acid is a RNA or DNA which encodes mammalian TOM1 protein, such as human TOM1 , e.g. the human TOM1 mRNA sequence, such as that disclosed as SEQ ID NO 1 . Further information on exemplary target nucleic acids is provided in table 2.

Table 2. Genome and assembly information for TOMI across species.

Fwd = forward strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). The NCBI reference provides the mRNA sequence (cDNA sequence) Table 3. Sequence details for TOM1 across species.

Target Sequence

The term "target sequence" as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention (i.e. a sub-sequence).

The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to the target nucleic acid, such as a target nucleic acid sequence described herein.

The target nucleic acid sequence to which the oligonucleotide is complementary to or hybridizes to generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous target nucleotide sequence is between 10 to 50 nucleotides, such as 12 to 30, such as 13 to 25, such as 14 to 20, such as 15 to 18 (contiguous nucleotides.

In one embodiment of the invention the target sequence is SEQ ID NO: 12.

In one embodiment of the invention the target sequence is SEQ ID NO: 29.

Target Cell

The term a "target cell" as used herein refers to a cell which is expressing the target nucleic acid. In some embodiments the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell.

In preferred embodiments the target cell expresses TOM1 mRNA, such as the TOM1 premRNA or TOM1 mature mRNA. The poly A tail of TOM1 mRNA is typically disregarded for antisense oligonucleotide targeting. Naturally occurring variant

The term "naturally occurring variant" refers to variants of TOM1 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.

In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian TOM1 target nucleic acid of SEQ ID NO: 1 , (or any other pre-mRNA or mRNAs disclosed in table 3). Table 4 lists specific natural occurring variants of TOM 1 .

Table 4: Numerous single nucleotide polymorphisms are known in the TOM1 gene, for example those disclosed in the following table (human pre-mRNA start/reference sequence is SEQ ID NO: 1 )

Variant Variant Alleles Minor allele Minor Position Name allele on SEQ frequency ID NO:l rs4821392 A/G G 0,473043 407 rs68156677 T/- - 0,473642 535 rs4821393 C/A A 0,473442 810 rs5755692 A/C C 0,453474 1632 rsl38719 AAAT/- - 0,465256 1664 rsll705224 G/A A 0,139577 2041 rsl38721 G/C C 0,438099 2125 rsl38722 T/C C 0,472045 2345 rsl38723 G/T T 0,454872 2538 rs5999786 T/G G 0,395168 3084 rs200766552 T/G G 0,0698882 3148 rs4509 G/A A 0,472244 3189 rsl38726 A/G G 0,472045 3224 rsl38727 C/A A 0,451877 3778 rs3215443 c/- - 0,451677 3837 rs4461 G/A A 0,466653 3858 rsl38728 G/A/C G 0,432508 3998 rsl38729 c/- - 0,473842 4186 rsl38730 A/G A 0,409545 4231 rsl38732 TATAT/- - 0,476637 4315 rs4462 A/G G 0,474042 4396 rsl38733 G/C G 0,446685 4492 rs4463 -/T T 0,474241 4498 rsl38735 T/G G 0,474042 4616 rsl38736 G/A A 0,454073 4988 rsl38737 G/- G 0,439696 5200 rsl38738 G/A A 0,474042 5221 rs377904 A/C/T C 0,474042 5252 rs79884643 T/G G 0,0752796 5350 rsl51275570 -/ACACACAC/ACACACACAC ACACACACAC 0,408946 5496 rs77155265 C/T T 0,0754792 5500 rs4510 A/G G 0,47524 5537 rs528560916 T/- - 0,16234 5956 rsl38740 C/T T 0,47524 6159 rsl38741 G/A A 0,47524 6190 rsl38742 G/A A 0,466254 6306 rsl38743 G/A A 0,47524 6342 rsl38744 C/T T 0,474042 6385 rsl38745 A/G G 0,47524 6455 rsl38746 G/A A 0,47524 6456 rsl38747 A/C/T T 0,470447 6632 rsl38748 G/T T 0,47504 6801 rs4464 A/G A 0,354832 6871 rsl38749 A/G G 0,47524 6907 rsl38750 G/A A 0,47524 7172 rsl38751 A/T T 0,47524 7475 rsl38752 G/A A 0,475439 7861 rsl38753 G/A A 0,466254 8014 rs9622171 A/G G 0,0878594 8055 rsl38755 A/G G 0,475439 8099 rsl38756 C/T T 0,466254 8284 rsl37868113 AA/- - 0,474441 8954 rsl38758 T/G G 0,47504 9002 rsl38759 G/A A 0,47504 9345 rsll2634351 -/GAGTG GAGTG 0,47484 10092 rsl38760 A/C A 0,352835 10370 rsl38761 T/- - 0,46845 10675 rsl38762 A/T T 0,47524 11969 rs59654138 G/A A 0,0746805 12970 rsl38763 -/c C 0,466254 13523 rsl38764 T/C C 0,464257 13532 rsl38765 A/G G 0,469649 13798 rsl38766 T/G G 0,46226 14944 rsl38767 T/C C 0,469449 14964 rsl38768 T/A T 0,0888578 15183 rsl38769 G/C c 0,470647 15606 rsl38770 T/- - 0,481629 15831 rs2267330 G/C G 0,452276 16276 rsl38771 A/G A 0,396765 16865 rs537199618 -/A/AA A 0,452476 16910 rsl38773 G/C C 0,451478 17286 rs3788509 G/A G 0,471046 17347 rs374453651 AA/- - 0,385982 19473 rs4465 C/T T 0,465455 19486 rsl38774 G/A A 0,454073 20583 rsl38775 G/A A 0,454073 21327 rs6480 -/TG TG 0,478634 21714 rs75034965 G/A A 0,117013 21979 rsll3100190 G/- - 0,0720847 22273 rsll3676195 -/TCATGAGA TCATGAGA 0,0549121 23023 rsl38777 A/G G 0,473842 26583 rsll704301 A/C C 0,101837 26744 rsl38778 C/T T 0,457268 26859 rsl38779 C/T T 0,455072 28564 rsl38780 A/G A 0,39357 28997 rsl38781 C/T T 0,461861 29019 rsll703973 G/T T 0,0952476 29392 rsll703977 G/A A 0,0942492 29548 rs3788511 G/A A 0,0934505 30271 rs4511 G/C G 0,400559 30527 rsl38783 / A/ AAAAAAAAAAAAAA/ G AAAAAAAAAAAAA A 0,128794 33199 rsl38784 T/C T 0,389976 33333 rs7289046 T/C c 0,0988419 34454 rs62233301 C/T T 0,081869 34818 rsl6995584 A/T T 0,0688898 35827 rsl0483190 G/A A 0,201478 35978 rs2267331 T/C C 0,0648962 37336 rs4466 A/G A 0,132388 37637 rs2267332 G/C C 0,0648962 37669 rsl2484487 G/A A 0,11242 37726 rsl38785 C/A A 0,447484 38069 rs715514 G/A A 0,0521166 38387 rs9622174 A/G G 0,215455 38441 rs79840063 G/A A 0,0539137 40493 rsl38786 T/C T 0,435503 40630 rsl38787 T/C c 0,136382 41441 rsl38788 G/A A 0,425719 41947 rsl38789 A/C A 0,349241 42194 rs5999796 G/A A 0,339457 43221 rs4467 T/C T 0,1252 43281 rs25015 C/G/T T 0,347843 43655 rsl38790 G/A A 0,420128 43690 rsl38791 T/- T 0,297524 43705 rsl38792 G/A A 0,443291 43748 rsl38793 G/C C 0,435104 44021 rsl38794 G/A A 0,424121 44070 rsl38795 C/T T 0,441294 44096 rs4820190 G/A G 0,223243 44244 rs35896033 A/- - 0,391174 44533 rs5755700 C/G G 0,0561102 44660 rs2267334 C/G G 0,367412 44861 rs2267335 G/A A 0,387979 45175 rs2283961 C/T C 0,21865 45376 rsl39602163 -/GGATCCTTGT GGATCCTTGT 0,0527157 45904 rsll6267779 A/G G 0,0852636 46499 rsl41356796 CAC/- CAC 0,465655 46553 rsl99968893 CT/- - 0,215056 46596 rsllll65352 C/T T 0,320487 47257 rs550534992 -/AC AC 0,455471 47658 rsl44221305 -/CA CA 0,341054 47857 rs201019697 -/CT CT 0,339457 rs201293385 T/C C 0,0557109 rs28491160 C/A A 0,319089 rsl33395 A/C C 0,21845 rs2267336 G/A A 0,353634 rsl33397 C/A A 0,205272 rs5750100 G/T T 0,0545128 rs4386 T/C T 0,326877 rs535786647 T/G G 0,163538 rsl33398 G/A A 0,197883 rsl33399 A/G A 0,311502 rsl29433 C/T C 0,433706 rs743810 T/G G 0,350839 rs2071745 G/A/C C 0,330272 rsl33400 G/A A 0,197284 rsl33401 C/T T 0,195088 rs6518949 A/G A 0,313898 rsl33402 A/G A 0,339457 rs6518950 T/G G 0,355831 rs5750101 G/A A 0,352436 rs71825175 GG/- GG 0,240815 rsll6701143 G/C G 0,240815 rsll5040127 G/A A 0,103834 rs4387 C/A C 0,341853 rsl33403 A/G G 0,201478 rs4388 A/G A 0,312899 rsl33404 C/G G 0,332468 rsll912593 G/A A 0,0648962 rs4820191 G/A A 0,288738 rs76782350 A/G G 0,0507189 Modulation of expression

The term "modulation of expression" as used herein is to be understood as an overall term for an oligonucleotide's ability to alter the amount of TOM1 when compared to the amount of TOM1 before administration of the oligonucleotide. Alternatively modulation of expression may be determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock). It may however also be an individual treated with the standard of care.

One type of modulation is an oligonucleotide's ability to inhibit, down-regulate, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of TOM1 , e.g. by degradation of mRNA or blockage of transcription. Another type of modulation is an oligonucleotide's ability to restore, increase or enhance expression of TOM1 , e.g. by repair of splice sites or prevention of splicing or removal or blockage of inhibitory mechanisms such as microRNA repression. High affinity modified nucleosides

A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T ^m ). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1 .5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2' substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213). Sugar modifications

The oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.

Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.

Such modifications include those where the ribose ring structure is modified, e.g. by

replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids (WO201 1/017521 ) or tricyclic nucleic acids (WO2013/154798). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.

Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions.

Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. Indeed, much focus has been spent on developing 2' substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.

2' modified nucleosides.

A 2' sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or comprises a 2' linked biradicle, and includes 2' substituted nucleosides and LNA (2' - 4' biradicle bridged) nucleosides. For example, the 2' modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2' substituted modified nucleosides are 2'-0-alkyl-RNA, 2 -0- methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, and 2'-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293- 213, and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Below are illustrations of some 2' substituted modified nucleosides.

2'-0-MOE 2'-0-AI!yl 2'-£ Ethyianiins Locked Nucleic Acid Nucleosides (LNA).

LNA nucleosides are modified nucleosides which comprise a linker group (referred to as a biradicle or a bridge) between C2' and C4' of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.

In some embodiments, the modified nucleoside or the LNA nucleosides of the oligomer of the invention has a general structure of the formula I or II:

Formula I Formula II

wherein W is selected from -0-, -S-, -N(R ^a )-, -C(R ^a R ^b )-, such as, in some embodiments -0-; B designates a nucleobase or modified nucleobase moiety;

Z designates an internucleoside linkage to an adjacent nucleoside, or a 5'-terminal group;

Z ^* designates an internucleoside linkage to an adjacent nucleoside, or a 3'-terminal group; X designates a group selected from the list consisting of -C(R ^a R ^b )-, -C(R ^a )=C(R ^b )-, - C(R ^a )=N-, -0-, -Si(R ^a ) ₂ -, -S-, -SO2-, -N(R ^a )-, and >C=Z

In some embodiments, X is selected from the group consisting of: -0-, -S-, NH-, NR ^a R ^b , -CH2-, CR ^a R , -C(=CH ₂ )-, and -C(=CR ^a R )-

In some embodiments, X is -O-

Y designates a group selected from the group consisting of -C(R ^a R ^b )-, -C(R ^a )=C(R ^b )-, - C(R ^a )=N-, -0-, -Si(R ^a ) ₂ -, -S-, -SO2-, -N(R ^a )-, and >C=Z

In some embodiments, Y is selected from the group consisting of: -CH2-, -C(R ^a R ^b )-, - CH2CH2-, -C(R ^a R ^b )-C(R ^a R ^b )-, -CH2CH2CH2-, -C(R ^a R ^b )C(R ^a R ^b )C(R ^a R ^b )-, -C(R ^a )=C(R ^b )-, and -C(R ^a )=N-

In some embodiments, Y is selected from the group consisting of: -CH2-, -CHR ^a -, - CHCH3-, CR ^a R ^b - or -X-Y- together designate a bivalent linker group (also referred to as a radicle) together designate a bivalent linker group consisting of 1 , 2, 3 or 4 groups/atoms selected from the group consisting of -C(R ^a R )-, -C(R ^a )=C(R )-, -C(R ^a )=N-, -0-, -Si(R ^a ) ₂ -, -S-, -SO2-, -N(R ^a )-, and >C=Z,

In some embodiments, -X-Y- designates a biradicle selected from the groups consisting of: -X-CH2-, -X-CR ^a R -, -X-CHR ^a" , -X-C(HCH ₃ )-, -0-Y-, -O-CH2-, -S-CH ₂ -, -NH-CH2-, -O- CHCH3-, -CH2-O-CH2, -0-CH(CH ₃ CH ₃ )-, -O-CH2-CH2-, OCH ₂ -CH2-CH2-,-0-CH ₂ OCH2-, - O-NCH2-, -C(=CH ₂ )-CH ₂ -, -NR ^a -CH ₂ -, N-O-CH2, -S-CR ^a R ^b - and -S-CHR ³ -.

In some embodiments -X-Y- designates -O-CH2- or -0-CH(CH3)-.

wherein Z is selected from -0-, -S-, and -N(R ^a )-,

and R ^a and, when present R ^b , each is independently selected from hydrogen, optionally substituted Ci-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, optionally substituted Ci-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6- alkoxycarbonyl, Ci-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(Ci-6- alkyl)amino, carbamoyl, mono- and di(Ci-6-alkyl)-amino-carbonyl, amino-Ci-6-alkyl- aminocarbonyl, mono- and di(Ci-6-alkyl)amino-Ci-6-alkyl-aminocarbonyl, Ci-6-alkyl- carbonylamino, carbamido, Ci-6-alkanoyloxy, sulphono, Ci-6-alkylsulphonyloxy, nitro, azido, sulphanyl, Ci-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents R ^a and R ^b together may designate optionally substituted methylene (=CH ₂ ), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation.

wherein R ¹ , R ² , R ³ , R ⁵ and R ^5* are independently selected from the group consisting of:

hydrogen, optionally substituted Ci-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, Ci-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6- alkoxycarbonyl, Ci-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(Ci-6- alkyl)amino, carbamoyl, mono- and di(Ci-6-alkyl)-amino-carbonyl, amino-Ci-6-alkyl- aminocarbonyl, mono- and di(Ci-6-alkyl)amino-Ci-6-alkyl-aminocarbonyl, Ci-6-alkyl- carbonylamino, carbamido, Ci-6-alkanoyloxy, sulphono, Ci-6-alkylsulphonyloxy, nitro, azido, sulphanyl, Ci-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene.

In some embodiments R ¹ , R ² , R ³ , R ⁵ and R ^5* are independently selected from C1-6 alkyl, such as methyl, and hydrogen.

In some embodiments R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen.

In some embodiments R ¹ , R ² , R ³ , are all hydrogen, and either R ⁵ and R ^5* is also hydrogen and the other of R ⁵ and R ⁵ 1s other than hydrogen, such as C1-6 alkyl such as methyl.

In some embodiments, R ^a is either hydrogen or methyl. In some embodiments, when present, R ^b is either hydrogen or methyl.

In some embodiments, one or both of R ^a and R ^b is hydrogen In some embodiments, one of R ^a and R ^b is hydrogen and the other is other than hydrogen

In some embodiments, one of R ^a and R ^b is methyl and the other is hydrogen

In some embodiments, both of R ^a and R ^b are methyl.

In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such LNA nucleosides are disclosed in WO99/014226, WO00/66604, WO98/039352 and WO2004/046160 which are all hereby incorporated by reference, and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides.

In some embodiments, the biradicle -X-Y- is -S-CH2-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99/014226 and

WO2004/046160 which are hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -NH-CH2-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99/014226 and

WO2004/046160 which are hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -0-CH ₂ -CH ₂ - or -0-CH ₂ -CH ₂ - CH ₂ -, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such LNA nucleosides are disclosed in

WO00/047599 and Morita et al, Bioorganic & Med.Chem. Lett. 12 73-76, which are hereby incorporated by reference, and include what are commonly known as 2'-0-4'C-ethylene bridged nucleic acids (ENA).

In some embodiments, the biradicle -X-Y- is -0-CH ₂ -, W is O, and all of R ¹ , R ² , R ³ , and one of R ⁵ and R ^5* are hydrogen, and the other of R ⁵ and R ^5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such 5' substituted LNA nucleosides are disclosed in WO2007/134181 which is hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -0-CR ^a R ^b -, wherein one or both of R ^a and R ^b are other than hydrogen, such as methyl, W is O, and all of R ¹ , R ² , R ³ , and one of R ⁵ and R ^5* are hydrogen, and the other of R ⁵ and R ^5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such bis modified LNA nucleosides are disclosed in WO2010/077578 which is hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O- CH(CH ₂ OCH ₃ )- (2' O-methoxyethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81 ). In some embodiments, the biradicle -X-Y- designate the bivalent linker group -0-CH(CH ₂ CH ₃ )- (2'O-ethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81 ). In some embodiments, the biradicle -X-Y- is -O-CHR ³ -, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such 6' substituted LNA nucleosides are disclosed in W010036698 and WO07090071 which are both hereby incorporated by reference. In some embodiments, the biradicle -X-Y- is -0-CH(CH ₂ OCH ₃ )-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such LNA nucleosides are also known as cyclic MOEs in the art (cMOE) and are disclosed in WO07090071.

In some embodiments, the biradicle -X-Y- designate the bivalent linker group -0-CH(CH3)-. - in either the R- or S- configuration. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -O-CH2-O-CH2- (Seth at al., 2010, J. Org. Chem). In some

embodiments, the biradicle -X-Y- is -0-CH(CH ₃ )-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such 6' methyl LNA nucleosides are also known as cET nucleosides in the art, and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010/036698 (alpha-L) which are both hereby incorporated by reference).

In some embodiments, the biradicle -X-Y- is -0-CR ^a R ^b -, wherein in neither R ^a or R ^b is hydrogen, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. In some embodiments, R ^a and R ^b are both methyl. Such 6' di-substituted LNA nucleosides are disclosed in WO

2009006478 which is hereby incorporated by reference.

In some embodiments, the biradicle -X-Y- is -S-CHR ^a -, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such 6' substituted thio LNA nucleosides are disclosed in W01 1 156202 which is hereby incorporated by reference. In some 6' substituted thio LNA embodiments R ^a is methyl.

In some embodiments, the biradicle -X-Y- is -C(=CH2)-C(R ^a R ^b )-, such as -C(=CH ₂ )-CH ₂ - , or - C(=CH ₂ )-CH(CH ₃ )-W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. Such vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647 which are both hereby incorporated by reference.

In some embodiments the biradicle -X-Y- is -N(-OR ^a )-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. In some embodiments R ^a is Ci-6 alkyl such as methyl. Such LNA nucleosides are also known as N substituted LNAs and are disclosed in WO2008/150729 which is hereby incorporated by reference. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -0-NR ^a -CH3- (Seth at al., 2010, J. Org. Chem). In some embodiments the biradicle -X-Y- is -N(R ^a )-, W is O, and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. In some embodiments R ^a is C1-6 alkyl such as methyl.

In some embodiments, one or both of R ⁵ and R ^5* is hydrogen and, when substituted the other of R ⁵ and R ^5* is C1-6 alkyl such as methyl. In such an embodiment, R ¹ , R ² , R ³ , may all be hydrogen, and the biradicle -X-Y- may be selected from -0-CH2- or -0-C(HCR ^a )-, such as -O- C(HCH3)-.

In some embodiments, the biradicle is -CR ^a R ^b -0-CR ^a R ^b -, such as CH ₂ -0-CH ₂ -, W is O and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. In some embodiments R ^a is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 which is hereby incorporated by reference.

In some embodiments, the biradicle is -0-CR ^a R ^b -0-CR ^a R ^b -, such as O-CH2-O-CH2-, W is O and all of R ¹ , R ² , R ³ , R ⁵ and R ^5* are all hydrogen. In some embodiments R ^a is Ci-6 alkyl such as methyl. Such LNA nucleosides are also known as COC nucleotides and are disclosed in

Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238, which is hereby incorporated by reference.

It will be recognized than, unless specified, the LNA nucleosides may be in the beta-D or alpha- L stereoisoform.

Certain examples of LNA nucleosides are presented in Scheme 1 .

Scheme 1

6'mettiyl β-D-oxy LNA 6'dimethyip-D-oxy LNA 5' methyl β-D-oxy LNA 5'methyl, 6'dimethyl

NA As illustrated in the examples, in some embodiments of the invention the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides.

Nuclease mediated degradation

Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence.

In some embodiments, the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers.

RNase H Activity and Recruitment

The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613 (hereby incorporated by reference).

Gapmer

The term gapmer as used herein refers to an antisense oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5' and 3' by regions which comprise one or more affinity enhancing modified nucleosides (flanks or wings). Various gapmer designs are described herein. Headmers and tailmers are oligonucleotides capable of recruiting RNase H where one of the flanks is missing, i.e. only one of the ends of the oligonucleotide comprises affinity enhancing modified nucleosides. For headmers the 3' flank is missing (i.e. the 5' flank comprises affinity enhancing modified nucleosides) and for tailmers the 5' flank is missing (i.e. the 3' flank comprises affinity enhancing modified nucleosides).

LNA Gapmer

The term LNA gapmer is a gapmer oligonucleotide wherein at least one of the affinity enhancing modified nucleosides is an LNA nucleoside. Mixed Wing Gapmer

The term mixed wing gapmer or mixed flank gapmer refers to a LNA gapmer wherein at least one of the flank regions comprise at least one LNA nucleoside and at least one non-LNA modified nucleoside, such as at least one 2' substituted modified nucleoside, such as, for example, 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA (MOE), 2'- amino-DNA, 2'-Fluoro-RNA and 2'-F-ANA nucleoside(s). In some embodiments the mixed wing gapmer has one flank which comprises only LNA nucleosides (e.g. 5' or 3') and the other flank (3' or 5' respectfully) comprises 2' substituted modified nucleoside(s) and optionally LNA nucleosides. Conjugate

The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region).

In some embodiments, the non-nucleotide moiety selected from the group consisting of a protein, such as an enzyme, an antibody or an antibody fragment or a peptide; a lipophilic moiety such as a lipid, a phospholipid, a sterol; a polymer, such as polyethyleneglycol or polypropylene glycol; a receptor ligand; a small molecule; a reporter molecule; and a non- nucleosidic carbohydrate.

WO 93/07883 and WO2013/033230 provides suitable conjugate moieties, which are hereby incorporated by reference. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr). In particular tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the the ASGPr, see for example WO 2014/076196, WO 2014/207232 and WO 2014/179620 (hereby incorporated by reference, in particular figure 13 of WO2014/076196 or claims 158-164 of WO 2014/179620).

Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S . Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.

Linkers

A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region (region C), e.g. a conjugate moiety to an oligonucleotide (region A) (e.g. connecting one of the termini of region A to C). In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B) which is positioned between the oligonucleotide or the contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 10 nucleosides, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA.

Phosphodiester containing biocleavable linkers are described in more detail in WO

2014/076195 (hereby incorporated by reference).

Conjugates may also be linked to the oligonucleotide via non-biocleavable linkers, or in some embodiments the conjugate may comprise a non-cleavable linker which is covalently attached to the biocleavable linker (region Y). Linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide (region A or first region), may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments the non-cleavable linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group. Conjugate linker groups may be routinely attached to an oligonucleotide via use of an amino modified oligonucleotide, and an activated ester group on the conjugate group.

Treatment

The term 'treatment' as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.

DETAILED DESCRIPTION OF THE INVENTION

The Oligonucleotides of the Invention

The invention relates to oligonucleotides capable of inhibiting expression of TOM1. The modulation is achieved by hybridizing an oligonucleotide (antisense) to a target nucleic acid encoding TOM1. The target nucleic acid may be a mammalian TOM1 sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 and 1 1 or naturally occurring variants thereof.

The oligonucleotide of the invention is an antisense oligonucleotide which targets TOM1 pre- mRNA of SEQ ID NO: 1. Alternatively, the antisense oligonucleotide target a TOM1 mature mRNAs of SEQ ID NO's: 2, 3, 4, 5, 6, 7, 8, 9 or 10. In some preferred embodiments the antisense oligonucleotide is complementary to or hybridizes to both SEQ ID NO:1 and SEQ ID NO:1 1 . In some preferred embodiments, the antisense oligonucleotide is complementary to or hybridizes to SEQ ID NO: 12. In some preferred embodiments, the antisense oligonucleotide is complementary to or hybridizes to SEQ ID NO: 29.

In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of the target transcript in the cell. . Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target. In some embodiments oligonucleotides of the invention may be capable of inhibiting expression levels of TOM1 mRNA by at least 60% or 70% in vitro using HeLa cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of TOM1 protein by at least 50% in vitro using HeLa cells. Suitably, the examples provide assays which may be used to measure TOM1 RNA or protein inhibition (e.g. example 1 ). The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches hybridization to the target nucleic acid may still be sufficient to show a desired modulation of TOM1 expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2' modified nucleosides, including LNA, present within the oligonucleotide sequence. The oligonucleotide of the invention comprises a contiguous nucleotide sequence which is complementary to or hybridizes to the target nucleic acid, such as a target nucleic acid sequence (sub-sequence) as described herein.

An aspect of the present invention relates to an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90%

complementarity to a TOM1 target nucleic acid.

In some embodiments, the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid or a target sequence.

In a preferred embodiment the oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acid or target sequence, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.

In some embodiments the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as fully (or 100%)

complementary, to a target nucleic acid region (target nucleic acid sequence) present in SEQ ID NO's: 1 , 2, 3,4 ,5, 6, 7, 8, 9 or 10. In some embodiments the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present in SEQ ID NO: 1 and SEQ ID NO: 1 1. In some embodiments the contiguous nucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO 1 1 .

In some embodiments, the target sequence is repeated within the target nucleic acid. A repeat (or repeated) target sequence in the context of the present application means that there is a number of independent regions located within the target nucleic acid which have at least 90% identity, preferably 95% identity, more preferably at least 100% identity. The repeat target sequences can be distributed independently from each other across the target nucleic acid (i.e. they are not necessarily adjacent to each other). The length of the repeated independent regions is generally between 8 and 50 nucleotides, such as between 10 to 30 nucleotides, such as between 12 and 25 nucleotides, such as between 13 and 22 nucleotides, such as between 14 and 25 nucleotides, such as between 13 and 22 nucleotides, such as between 14 and 20 nucleotides such as between15 and 19 nucleotides, such as between 16 and 18 nucleotides. In a preferred embodiment the independent region that is repeated is between 14 and 20 nucleotides and the repeated regions are 100% identical.

In one aspect the invention provides oligonucleotides that can hybridize to multiple repeated target sequences located at different positions in the target nucleic acid and exert its effect, such as cleavage or blockage, at several independent regions on the target nucleic acid, which potentially leads to an oligonucleotide that is more effective modulating the target, than an oligonucleotide that only hybridizes at one place on the target nucleic acid. In some

embodiments the oligonucleotide hybridizes to more than one independent region over the length of SEQ ID NO:1 , 2, 3, 4 ,5, 6, 7, 8, 9, or 10, such the oligonucleotide is complementary to at least 3 independent regions (target sequences), such as at least 4, 5, 6, 7, 8, 9 or 10 independent regions, such as more than 10 independent regions of SEQ ID NO: 12, 3, 4 ,5, 6, 7, 8, 9, or 10. Preferably the repeated independent regions are in SEQ ID NO: 1.

In some embodiments the invention provides an oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to at least three independent regions within a target nucleic acid selected from the group consisting of SEQ ID NO's: 1 , 2, 3, 4, 5, 6, 7, 8, 9 and/or 10. In a preferred embodiment the oligonucleotide is fully complementary to at least two of the independent regions.

In the present application the terms "independent region"," repeat target sequence" and

"repeated target sequence" can be used interchangeably. In a further embodiment the invention provides the antisense oligonucleotide of the previous embodiment, wherein at least one of the three independent regions or repeat target sequences of the target nucleic acid is located in an intron. In a preferred embodiment all the independent regions or repeat target sequences to which the oligonucleotide is complementary are located in intron sequences.

In a further embodiment, the invention provides the antisense oligonucleotide of the previous embodiments, wherein all the independent regions are located in one or more introns as indicated in table 1 . In a preferred embodiment the all the independent regions are in intron 12, which is defined as a nucleic acid region consisting of the positions between 39515-46450 of SEQ ID NO: 1 . Targeting intron sequences with antisense oligonucleotides allows modulation of pre-mRNA's, which, in some instances, may be very effective.

In some embodiments, the oligonucleotide according to the invention comprises a contiguous nucleotide sequence of 12 to 20 nucleotides in length which is at least 90% complementary, such as 100% complementary to a corresponding target nucleic acid region present in SEQ ID NO: 12. In some embodiments, the oligonucleotide according to the invention comprises a contiguous nucleotide sequence of 12 to 20 nucleotides in length which is at least 90% complementary, such as 100% complementary to a corresponding target nucleic acid region present in SEQ ID NO: 29. In some embodiments, the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of position 43483-43502, 43608-43627, 43726-43745, 43947-43966, 44249-44268, 44330-44349, 44437-44456; 43485-43502, 43610-43627, 43728- 43745, 43949-43966, 44251-44268, 44332-44349, 44439-44456; 43485-43500, 43610-43625, 43728-43743, 43949-43964, 44251-44266, 44332-44347, 44439-44454; 43485-43498, 43610- 43623, 43728-43741 , 43949-43962, 44251 -44264, 44332-44345, 44439-44452; 43497-43516, 43622-43641 , 43740-43759, 43863-43882, 43961-43980, 44158-44177, 44263-44282; 43497- 43512, 43622-43637, 43740-43755, 43863-43878, 43961-43976, 44078-44093, 44158-44173, 44263-44278, 44451 -44466; 43498-4351 1 , 43623-43636, 43741-43754, 43864-43877, 43962- 43975, 44079-44092, 44159-44172, 44264-44277, 44452-44465; 43499-43516, 43624-43641 , 43742-43759, 43865-43882, 43963-43980, 44160-44177, 44265-44282 of SEQ ID NO: 1.

In some embodiments, the oligonucleotide of the invention comprises or consists of 10 to 35 nucleotides in length, such as from 10 to 30, such as 1 1 to 22, such as from 12 to 20, such as from such as from 14 to 20, such as from 14 to 18 such as from 14 to 16, such as from 16 to 20 contiguous nucleotides in length.

In some embodiments, the oligonucleotide or contiguous nucleotide sequence thereof comprises or consists of 22 or less nucleotides, such as 20 or less nucleotides. It is to be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included.

In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of the sequences listed in Table 5.

In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 22, such as 12 to 20 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 13. 14, 15, 16, 17, 18, 19 and 20 (see motif sequences listed in Table 5).

In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 22, such as 12 to 20 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 21 , 22, 23, 24, 25, 26, 27 and 28 (see motif sequences listed in Table 5).

Oligonucleotide design

Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the oligonucleotide sequence. The oligonucleotides of the invention comprise sugar-modified nucleosides and may also comprise DNA or RNA nucleosides. In some embodiments, the oligonucleotide comprises sugar-modified nucleosides and DNA nucleosides. Incorporation of modified nucleosides into the oligonucleotide of the invention may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the modified nucleosides can be referred to as affinity enhancing modified nucleotides, the modified nucleosides may also be termed units.

In an embodiment, the oligonucleotide comprises at least 1 modified nucleoside, such as from 1 to 8 modified nucleosides, such as from 2 to 8 modified nucleosides, such as from 3 to 7 modified nucleosides, such as from 4 to 6 modified nucleosides. In a preferred embodiment the oligonucleotide comprises 3 to 6 modified nucleosides.

In an embodiment, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2' sugar modified nucleosides. Preferably the oligonucleotide of the invention comprise the one or more 2' sugar modified nucleoside independently selected from the group consisting of 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA, 2'-amino-DNA, 2'- fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. Even more preferably the one or more modified nucleoside is a locked nucleic acid (LNA).

In a further embodiment the oligonucleotide comprises at least one modified internucleoside linkage. In a preferred embodiment all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages.

In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as from 1 to 8 LNA nucleosides, such as from 2 to 8 LNA nucleosides, such as from 3 to 7 LNA nucleosides, such as from 4 to 6 LNA nucleosides.

In some embodiments, the oligonucleotide of the invention comprises at least one LNA nucleoside and at least one 2' substituted modified nucleoside.

In an embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H.

Gapmer design

In a preferred embodiment the oligonucleotide of the invention has a gapmer design or structure also referred herein merely as "Gapmer". In a gapmer structure the oligonucleotide comprises at least three distinct structural regions a 5'-flank, a gap and a 3'-flank, F-G-F' in '5 -> 3' orientation. In this design, flanking regions F and F' (also termed wing regions) comprise a contiguous stretch of modified nucleosides, which are complementary to the TOM1 target nucleic acid, while the gap region, G, comprises a contiguous stretch of nucleotides which are capable of recruiting a nuclease, preferably an endonuclease such as RNase, for example RNase H, when the oligonucleotide is in duplex with the target nucleic acid. Nucleosides which are capable of recruiting a nuclease, in particular RNase H. In preferred embodiments the gap region consists of DNA nucleosides. Regions F and F', flanking the 5' and 3' ends of region G, preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3' endo structure), more preferably one or more affinity enhancing modified nucleosides. In some embodiments, the 3' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. In some embodiments, the 5' flank comprises at least one LNA nucleoside. In some embodiments both the 5' and 3' flanking regions comprise a LNA nucleoside. In some embodiments all the nucleosides in the flanking regions are LNA nucleosides. In other embodiments, the flanking regions may comprise both LNA nucleosides and other nucleosides (mixed flanks), such as DNA nucleosides and/or non-LNA modified nucleosides, such as 2' substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (nucleosides with a 2' endo structure, preferably DNA) flanked at the 5' and 3' end by an affinity enhancing modified nucleoside, preferably LNA, such as beta-D-oxy-LNA.

Consequently, the nucleosides of the 5' flanking region and the 3' flanking region which are adjacent to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides or high affinity nucleosides.

Region F

Region F (5' flank or 5' wing) attached to the 5' end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, or at least 4 modified nucleosides. In an embodiment region F comprises or consists of from 1 to 4 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified

nucleosides, such as 1 , 2, 3 or 4 modified nucleosides. The F region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.

In some embodiments, the modified nucleosides in region F have a 3' endo structure.

In an embodiment, one or more of the modified nucleosides in region F are 2' modified nucleosides. In one embodiment all the nucleosides in Region F are 2' modified nucleosides.

In another embodiment region F comprises DNA and/or RNA nucleosides in addition to the 2' modified nucleosides. Flanks comprising DNA and/or RNA are characterized by having a 2' modified nucleoside in the 5' end and the 3'end (adjacent to the G region) of the F region. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. The length of the 5' flank (region F) in oligonucleotides with DNA and/or RNA nucleotides in the flanks may be longer, maintaining the number of 2' modified nucleotides at 1 to 4 as described above. In a further embodiment one or more of the 2' modified nucleosides in region F are selected from 2'- O-alkyl-RNA units, 2'-0-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units. In some embodiments the F region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.

In one embodiment of the invention all the modified nucleosides in region F are LNA

nucleosides. In a further embodiment all the nucleosides in region F are LNA nucleosides. In a further embodiment the LNA nucleosides in region F are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment region F comprises at least 1 beta-D-oxy LNA unit, at the 5' end of the contiguous sequence. In a further preferred embodiment region F consists of beta-D-oxy LNA nucleosides. Region G

Region G (gap region) preferably comprise, contain or consist of from 6 to 17, or from 7 to 16 or from 8 to 12 consecutive nucleotide units capable of recruiting RNase H nuclease.

The nucleoside units in region G, which are capable of recruiting nuclease are in an

embodiment selected from the group consisting of DNA, alpha-L-LNA, C4' alkylated DNA (as described in PCT/EP2009/050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296 - 2300, both incorporated herein by reference), arabinose derived nucleosides like ANA and 2'F- ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661 ), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039 incorporated herein by reference). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked "sugar" residue.

In some embodiments, region G consists of 100% DNA units.

In further embodiments the region G may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage.

In some embodiments, nucleosides in region G have a 2' endo structure. Region F

Region F' (3' flank or 3' wing) attached to the 3' end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, or at least 4 modified nucleosides. In an embodiment region F' comprises or consists of from 1 to 4 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified

nucleosides, such as 1 , 2, 3 or 4 modified nucleosides. The F' region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.

In some embodiments, the modified nucleosides in region F' have a 3' endo structure.

In an embodiment, one or more of the modified nucleosides in region F' are 2' modified nucleosides. In one embodiment all the nucleosides in Region F' are 2' modified nucleosides. In another embodiment region F' comprises DNA and/or RNA nucleosides in addition to the 2' modified nucleosides. Flanks comprising DNA and/or RNA are characterized by having a 2' modified nucleoside in the 5' end and the 3'end (adjacent to the G region) of the F' region. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. The length of the 3' flank (region F') in oligonucleotides with DNA and/or RNA nucleotides in the flanks may be longer, maintaining the number of 2' modified nucleotides at 1 to 4 as described above. In a further embodiment one or more of the 2' modified nucleosides in region F' are selected from 2'- O-alkyl-RNA units, 2'-0-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units.

In some embodiments the F' region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.

In one embodiment of the invention all the modified nucleosides in region F' are LNA

nucleosides. In a further embodiment all the nucleosides in region F' are LNA nucleosides. In a further embodiment the LNA nucleosides in region F' are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. In a preferred embodiment region F' comprises at least two beta-D-oxy LNA unit, at the 3' end of the contiguous sequence. In a further preferred embodiment region F' consists of beta-D-oxy LNA nucleosides.

Region D' and D"

Region D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively.

Region D' or D" may independently comprise 1 , 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. In this respect the oligonucleotide of the invention, may in some embodiments comprise a contiguous nucleotide sequence capable of modulating the target which is flanked at the 5' and/or 3' end by additional nucleotides. Such additional nucleotides may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5' and/or 3' end

nucleotides are linked with phosphodiester linkages, and may be DNA or RNA. In another embodiment, the additional 5' and/or 3' end nucleotides are modified nucleotides which may for example be included to enhance nuclease stability or for ease of synthesis. In an embodiment the oligonucleotide of the invention, comprises a region D' and/or D" in addition to the contiguous nucleotide sequence.

The gapmer oligonucleotide of the present invention can be represented by the following formulae: In some embodiments the oligonucleotide is a gapmer consisting of 14-20 nucleotides in length, wherein each of regions F and F' independently consists of 1 , 2, 3 or 4 modified nucleoside units complementary to the TOM1 target nucleic acid and region G consists of 6-17 nucleoside units, capable of recruiting nuclease when in duplex with the TOM1 target nucleic acid.

In preferred embodiments the F-G-F' design is selected from 1-17-2, 2-14-2, 4-10-2, 3-8-3, 1- 17-2, 4-10-2, 3-7-4, 2-14-2; 2-15-3, 3-1 1 -4, 4-8-4, 4-6-4, 2-16-2, 4-12-2, and 3-7-4.

In more preferred embodiments the F-G-F design is selected from 1-17-2, 2-14-2, 4-10-2, 3-8-3, 1-17-2, 4-10-2, 3-7-4, and 2-14-2.

In all instances the F-G-F' design may further include region D' and/or D", which may have 1 , 2 or 3 nucleoside units, such as DNA units. Preferably, the nucleosides in region F and F' are modified nucleosides, while nucleotides in region G are unmodified nucleosides.

In each design, the preferred modified nucleoside is LNA.

In another embodiment all the internucleoside linkages in the gap in a gapmer are

phosphorothioate and/or boranophosphate linkages. In another embodiment all the

internucleoside linkages in the flanks (F and F' region) in a gapmer are phosphorothioate and/or boranophosphate linkages. In another embodiment all the internucleoside linkages in the oligonucleotide with the F-G-F' design are phosphorothioate linkages. In another preferred embodiment all the internucleoside linkages in the D' and D" region in a gapmer are

phosphodiester linkages.

For specific gapmers as disclosed herein, when the cytosine (C) residues are annotated as 5- methyl-cytosine, in various embodiments, one or more of the C's present in the oligonucleotide may be unmodified C residues.

For certain embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO's: 13_1 , 14_1 , 15_1 , 17_1 , 18_1 , 19_1 , 20_1 , 21_1 , 22_1 , 23_1 , 24_1 , 26_1 , 27_1 , and 28_1 .

In a preferred embodiment of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO's: 21_1 , 22_1 , 23_1 , 24_1 , 26_1 , 27_1 , and 28_1 .

Method of manufacture

In a further aspect, the invention provides methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287- 313). In a further embodiment the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand). In a further aspect a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant. Pharmaceutical Composition

In a further aspect, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates or salts thereof and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300μΜ solution.

Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants (hereby incorporated by reference). Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091 .

Oligonucleotides or oligonucleotide conjugates of the invention may be mixed with

pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 1 1 , more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment. In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular with respect to oligonucleotide conjugates the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell.

Applications

The oligonucleotides of the invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.

In research, such oligonucleotides may be used to specifically modulate the synthesis of TOM1 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically the target modulation is achieved by degrading or inhibiting the pre-mRNA or mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.

If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.

The present invention provides an in vivo or in vitro method for modulating TOM1 expression in a target cell which is expressing TOM1 , said method comprising administering an oligonucleotide of the invention in an effective amount to said cell.

In some embodiments, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. In preferred embodiments the target cell is present in a number of tissues and in particular in skeletal muscle, lung, brain, skin, blood, kidney, heart, placenta and liver. In a preferred embodiment the target cell is a liver cell, such as a hepatocyte. In another preferred

embodiment the target cell is a brain cell such as a neuronal cell.

In diagnostics the oligonucleotides may be used to detect and quantitate TOM1 expression in cell and tissues by northern blotting, in-situ hybridization or similar techniques.

For therapeutics, an animal or a human, suspected of having a disease or disorder, which can be treated by modulating the expression of TOM1.

The invention provides methods for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease.

The invention also relates to an oligonucleotide, a composition or a conjugate as defined herein for use as a medicament. The oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount.

The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament for the treatment of a disorder as referred to herein, or for a method of the treatment of as a disorder as referred to herein.

The disease or disorder, as referred to herein, is associated with expression of TOM1 .

The methods of the invention are preferably employed for treatment or prophylaxis against diseases caused by abnormal levels and/or activity of TOM1 .

The invention further relates to use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the treatment of abnormal levels and/or activity of TOM1 .

In one embodiment, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from cystic fibrosis, Alzheimer's disease, and cancers. In some embodiments, the invention relates to oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of cystic fibrosis, Alzheimer's disease, and cancers, such as breast cancer or lung cancer. In a preferred embodiment the disease is Alzheimers disease. Without being bound by theory it is suggested that reduction of TOM1 will improve/restore the endocytic pathway in neurons and thereby have a positive effect on the plaque formation in Alzherimer's patients (Kimura and Yanagisawa 2017 Neurochemistry international online 8 July 2017,

https://doi.Org/10.1016/j.neuint.2017.07.002).

In a further embodiment the antisense oligonucleotides, conjugated and pharmaceutical compositions of the invention may be used to modulate the endocytic pathway in a mammal, such as a human. Such a modulation the endocytic pathway may serve to facilitate or restore malfunctioning protein degradation (Makioka et al. 2016 J Neurol Sci. 365:101 -7).

Administration

The oligonucleotides or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, by inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).

In a preferred embodiment the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial,

subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g. intracerebral or intraventricular, intravitreal administration. In one embodiment the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously.

In some embodiments, the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 - 15 mg/kg, such as from 0.2 - 10 mg/kg, such as from 0.25 - 5 mg/kg. The administration can be once a week, every 2 ^nd week, every third week or even once a month.

The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for subcutaneous administration. The invention also provides for the use of the oligonucleotide or oligonucleotide conjugate of the invention as described for the manufacture of a medicament wherein the medicament is in a dosage form for intravenous administration.

EMBODIMENTS

The following embodiments of the present invention may be used in combination with any other embodiments described herein.

1 . An antisense oligonucleotide which comprises or consists of a contiguous nucleotide sequence of 10 to 30 nucleotides in length capable of modulating expression of TOM1 in a cell.

2. The oligonucleotide of embodiment 1 , wherein the contiguous nucleotide sequence is at least 80%, or at least 85%, or at least 90% complementarity to a TOM1 target nucleic acid.

3. The antisense oligonucleotide of embodiment 1 or 2, wherein the contiguous nucleotide sequence is 100% complementary to a TOM target nucleic acid.

4. The antisense oligonucleotide of any one of embodiments 1 to 3, wherein the TOM1 target nucleic acid is selected from SEQ ID NO's: 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or natural variants thereof.

5. The antisense oligonucleotide of any one of embodiments 1 to 4, wherein the contiguous nucleotide sequence is complementary to at least one independent region of 10 to 50 nucleotides in length, and wherein said independent region is located in an intron within the target nucleic acid of SEQ ID NO: 1.

6. The antisense oligonucleotide of embodiment 1 to 5, wherein the contiguous nucleotide sequence is complementary to both SEQ ID NO: 1 and SEQ ID NO: 1 1.

7. The antisense oligonucleotide of any one of embodiments 1 to 6, wherein the contiguous nucleotide sequence is at least 90% complementary to a target sequence of 10-22 such as 14- 20 nucleotides in length of the target nucleic acid of SEQ ID NO: 1 , wherein the target sequence is repeated anyone of 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 times or more across said target nucleic acid. 8. The antisense oligonucleotide of embodiment 1 to 7, wherein the contiguous nucleotide sequence is complementarity to at least two repeat target sequences within the target nucleic acid.

9. The antisense oligonucleotide of embodiment 7 or 8, wherein at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 of said repeat target sequences across the target nucleic acid has at least 95% or at least

100% identity with each other.

10. The antisense oligonucleotide of any one of embodiments 7 to 9, wherein the repeat target sequences is present 3 to 5 times within the target nucleic acid.

1 1. The antisense oligonucleotide of any one of embodiments 7 to 10, wherein all the repeat target sequences are located in one or more introns of the target nucleic acid.

12. The antisense oligonucleotide of embodiment 1 1 , wherein at least one of the repeat target sequences is positioned in intron 12 in SEQ ID NO: 1

13. The antisense oligonucleotide of embodiment 1 to 12, wherein the contiguous nucleotide sequence is complementary to at least one independent region of from 14 to 20 nucleotides in length and said independent region(s) is located within the region between position 39515 to 46450 of SEQ ID NO 1.

14. The antisense oligonucleotide of any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence is fully complementary to at least 14 nucleotides in SEQ ID NO: 12 or SEQ ID NO: 29.

15. The antisense oligonucleotide of anyone of embodiments 1 to 14, wherein the contiguous nucleotide sequence is complementary to at least two of the target sequences selected from the group consisting of position 43483-43502, 43608-43627, 43726-43745, 43947-43966, 44249- 44268, 44330-44349, 44437-44456; 43485-43502, 43610-43627, 43728-43745, 43949-43966, 44251 -44268, 44332-44349, 44439-44456; 43485-43500, 43610-43625, 43728-43743, 43949- 43964, 44251 -44266, 44332-44347, 44439-44454; 43485-43498, 43610-43623, 43728-43741 , 43949-43962, 44251 -44264, 44332-44345, 44439-44452; 43497-43516, 43622-43641 , 43740- 43759, 43863-43882, 43961-43980, 44158-44177, 44263-44282; 43497-43512, 43622-43637, 43740-43755, 43863-43878, 43961-43976, 44078-44093, 44158-44173, 44263-44278, 44451- 44466; 43498-4351 1 , 43623-43636, 43741 -43754, 43864-43877, 43962-43975, 44079-44092, 44159-44172, 44264-44277, 44452-44465; 43499-43516, 43624-43641 , 43742-43759, 43865- 43882, 43963-43980, 44160-44177, 44265-44282 of SEQ ID NO: 1

16. The antisense oligonucleotide according to anyone of embodiments 1 to 15, wherein the oligonucleotide is capable of hybridizing to a target nucleic acid selected from the group consisting of SEQ ID NO's:1 to 10, 12 and 29 with a ΔΘ° below -10 kcal. 17. The antisense oligonucleotide of anyone of embodiments 1 to 16, wherein the target nucleic acid is RNA.

18. The antisense oligonucleotide of embodiment 17, wherein the RNA is mRNA.

19. The antisense oligonucleotide embodiment 18, wherein the mRNA is the pre-mRNA or mature mRNA.

20. The antisense oligonucleotide embodiment 19, wherein the pre-mRNA is SEQ ID NO: 1 .

21. The antisense oligonucleotide of any one of embodiments 1 -20, wherein the contiguous nucleotide sequence comprises or consists of from 12 to 22 nucleotides.

22. The antisense oligonucleotide of embodiment 21 , wherein the contiguous nucleotide sequence comprises or consists of from 14-20 nucleotides.

23. The antisense oligonucleotide of any one of embodiment 1 -22, wherein the oligonucleotide comprises or consists of 12 to 25 nucleotides in length.

24. The antisense oligonucleotide of any one of embodiments 1 -23, wherein the oligonucleotide or contiguous nucleotide sequence is single stranded.

25. The antisense oligonucleotide of any one of embodiments 1 -24, wherein the oligonucleotide is neither siRNA nor self-complementary.

26. The antisense oligonucleotide of any one of embodiments 1 -6 or 16-25, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ's ID NO: 13, 14, 15, 17, 18, 19 and 20.

27. The antisense oligonucleotide of any one of embodiments 1 -25, wherein the contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NO: 21 , 22, 23, 24, 26, 27 and 28.

28. The antisense oligonucleotide of anyone of embodiments 1-27, wherein the contiguous nucleotide sequence has zero to three mismatches compared to the target nucleic acid it is complementary to.

29. The antisense oligonucleotide of embodiment 28, wherein the contiguous nucleotide sequence has one mismatch compared to the target nucleic acid.

30. The antisense oligonucleotide of embodiment 28, wherein the contiguous nucleotide sequence is fully complementary to the target nucleic acid sequence.

31. The antisense oligonucleotide of anyone of embodiment 1 -30, comprising one or more modified nucleosides.

32. The antisense oligonucleotide of embodiment 31 , wherein the one or more modified nucleoside is a high-affinity modified nucleosides. 33. The antisense oligonucleotide of embodiments 31 or 32, wherein the modified nucleoside is a 2' sugar modified nucleosides.

34. The antisense oligonucleotide of embodiment 33, wherein the modified 2' sugar modified nucleoside is independently selected from the group consisting of 2'-0-alkyl-RNA, 2'-0-methyl- RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

35. The antisense oligonucleotide of any one of embodiments 31-34, wherein the antisense oligonucleotide comprise 3 to 6 2' sugar modified nucleosides.

36. The antisense oligonucleotide of any one of embodiments 1 -35, wherein the oligonucleotide comprises at least one modified internucleoside linkage.

37. The antisense oligonucleotide of embodiment 36, wherein the modified internucleoside linkage is nuclease resistant.

38. The antisense oligonucleotide of embodiments 36 or 37, wherein at least 75% of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages or boranophosphate internucleoside linkages.

39. The antisense oligonucleotide of embodiments 36 or 37, wherein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

40. The antisense oligonucleotide of anyone of embodiments 1 -39, wherein the oligonucleotide is capable of recruiting RNase H.

41. The antisense oligonucleotide of embodiment 40, wherein the oligonucleotide is a gapmer.

42. The antisense oligonucleotide of embodiment 40 or 41 , wherein the oligonucleotide is a gapmer of formula 5'-F-G-F'-3', where region F and F' independently comprise or consist of 1 - 4 2' sugar modified nucleosides according to embodiment 34 and G is a region between 6 and 17 nucleosides which are capable of recruiting RNaseH.

43. The antisense oligonucleotide of any one of embodiments 33 to 35 or 42, wherein one or more of the 2' sugar modified nucleosides is a LNA nucleoside.

44. The antisense oligonucleotide of embodiment 43, wherein all the 2' sugar modified nucleosides are LNA nucleosides.

45. The antisense oligonucleotide of embodiment 42, wherein region F and F' consist of LNA nucleosides. 46. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is selected from beta-D-oxy-LNA, alpha-L-oxy-LNA, beta-D-amino-LNA, alpha-L- amino-LNA, beta-D-thio-LNA, alpha-L-thio-LNA, (S)cET, (R)cET beta-D-ENA and alpha-L-ENA.

47. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is oxy-LNA.

48. The antisense oligonucleotide of any one of embodiments 43-47, wherein the LNA nucleoside is beta-D-oxy-LNA.

49. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is thio-LNA.

50. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is amino-LNA.

51. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is cET.

52. The antisense oligonucleotide of any one of embodiments 43-45, wherein the LNA nucleoside is ENA.

53. The antisense oligonucleotide of embodiment 43, wherein at least one of region F or F' further comprises at least one 2' substituted modified nucleoside independently selected from the group consisting of 2'-0-alkyl-RNA, 2'-0-methyl-RNA, 2'-alkoxy-RNA, 2'-0-methoxyethyl- RNA, 2'-amino-DNA and 2'-fluoro-DNA.

54. The antisense oligonucleotide of any one of embodiments 43-53, wherein the RNaseH recruiting nucleosides in region G are independently selected from DNA, alpha-L-LNA, C4' alkylated DNA, ANA and 2'F-ANA and UNA.

55. The antisense oligonucleotide of embodiment 54, wherein the nucleosides in region G is DNA nucleosides.

56. The antisense oligonucleotide of any one of embodiments 1 -6 or 16-55, wherein the oligonucleotide is selected from CMP ID NO: 13_1 , 14_1 , 15_1 , 17_1 , 18_1 , 19_1 , and 20_1.

57.

58. The antisense oligonucleotide of any one of embodiments 1 -55, wherein the oligonucleotide is selected from CMP ID NO: 21_1 ; 22_1 ; 23_1 ; 24_1 ; 26_1 ; 27_1 ; 28_1 .

59. A conjugate comprising the antisense oligonucleotide according to any one of embodiments 1-58, and at least one conjugate moiety covalently attached to said oligonucleotide.

60. The antisense oligonucleotide conjugate of embodiment 59, wherein the conjugate moiety is selected from carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins, vitamins, viral proteins or combinations thereof.

61. The antisense oligonucleotide conjugate of any one of embodiments 59 or 60, wherein the conjugate moiety is capable of binding to the asialoglycoprotein receptor.

62. The antisense oligonucleotide conjugate of any one of embodiments 59-61 , comprising a linker which is positioned between the oligonucleotide and the conjugate moiety.

63. The antisense oligonucleotide conjugate of embodiment 62, wherein the linker is a physiologically labile linker.

64. The oligonucleotide conjugate of embodiment 63, wherein the physiologically labile linker is nuclease susceptible linker.

65. The antisense oligonucleotide conjugate of any one of embodiments 63 to 64, wherein the oligonucleotide has the formula D'-F-G-F' or F-G-F'-D", wherein F, F' and G are as defined in embodiments 43-58 and D' or D" comprises 1 , 2 or 3 DNA nucleosides with phosphorothioate internucleoside linkages.

66. A pharmaceutical composition comprising the oligonucleotide of embodiment 1-58 or a conjugate of embodiments 59-65 and a pharmaceutically acceptable diluent, carrier, salt and/or adjuvant.

67. An in vivo or in vitro method for modulating TOM1 expression in a target cell which is expressing TOM1 , said method comprising administering an oligonucleotide of embodiment 1 - 58 or a conjugate of embodiments 59-65 or the pharmaceutical composition of embodiment 66 in an effective amount to said cell.

68. A method for alleviation or prevention of a disease comprising administering a

therapeutically or prophylactically effective amount of an oligonucleotide of embodiment 1 -58 or a conjugate of embodiments 59-65 or the pharmaceutical composition of embodiment 66 to a subject suffering from or susceptible to the disease.

69. The antisense oligonucleotide of any one of embodiments 1 -58 or a conjugate of embodiment 59-65 or the pharmaceutical composition of embodiment 66, for use as a medicament for treatment or prevention of a disease in a subject.

70. Use of the antisense oligonucleotide of anyone of embodiments 1 -58 or a conjugate of anyone of embodiments 59-65 for the preparation of a medicament for treatment or prevention of a disease in a subject.

71. The method, the oligonucleotide or the use of embodiments 68 - 70, wherein the disease is associated with in vivo activity of TOM1. 72. The method, the oligonucleotide or the use of embodiments 68 - 71 , wherein the disease is associated with overexpression of TOM1 and/or abnormal levels of TOM1 .

73. The method, the oligonucleotide or the use of embodiments 72, wherein TOM1 is reduced by at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95% compared to the expression without the oligonucleotide of embodiment 1-58 or a conjugate of embodiment 59-65 or the pharmaceutical composition of embodiment 66.

74. The method, the oligonucleotide or the use of embodiments 68 - 72, wherein the disease is Alzheimer's disease.

75. The method, the oligonucleotide or the use of embodiments 68 - 72, wherein the disease is cystic fibrosis.

76. The method, the oligonucleotide or the use of embodiment 68 - 72, wherein the disease is cancer, such as breast cancer or lung cancer.

77. The method, the oligonucleotide or the use of embodiments 68 - 76, wherein the subject is a mammal.

78. The method, the oligonucleotide or the use of embodiment 77, wherein the mammal is human.

EXAMPLES

Materials and methods

Table 5: list of oligonucleotide motif sequences (indicated by SEQ ID NO), designs of these, as well as specific oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence.

SEQ Motif sequence Design Oligonucleotide CMP Start position Intron ID NO Compound ID NO on SEQ ID

NO: 1

13 gcttacttaatgaacactct 2-15-3 GCttacttaatgaacacTCT 13_1 26685 6

14 gcttacttaatgaacact 3-1 1-4 GCTtacttaatgaaCACT 14_1 26687 6

15 gcttacttaatgaaca 4-8-4 GCTTacttaatgAACA 15_1 26689 6

16 cttacttaatgaac 26690 6

17 tggagttgtgtggtgcgttt 2-16-2 TGgagttgtgtggtgcgtTT 17_1 42484 12

18 gagttgtgtggtgcgttt 4-12-2 GAGTtgtgtggtgcgtTT 18_1 42484 12

19 gttgtgtggtgcgttt 4-8-4 GTTGtgtggtgcGTTT 19_1 42484 12

20 gttgtgtggtgcgt 3-7-4 GTTgtgtggtGCGT 20_1 42486 12

21 tgtagatgtgtgtgtggtgt 1-17-2 TgtagatgtgtgtgtggtGT 21_1 43483, 43608, 12

43726, 43947, 44249, 44330,

44437

22 tgtagatgtgtgtgtggt 2-14-2 TGtagatgtgtgtgtgGT 22_1 43485, 43610, 12

43728, 43949, 44251 , 44332,

44439

23 tagatgtgtgtgtggt 4-10-2 TAGAtgtgtgtgtgGT 23_1 43485, 43610, 12

43728, 43949, 44251 , 44332,

44439

24 gatgtgtgtgtggt 3-8-3 GATgtgtgtgtGGT 24_1 43485, 43610, 12

43728, 43949, 44251 , 44332,

44439

25 gtgtgtgtggtgggtgtaga 43497, 43622, 12

43740, 43863, 43961 , 44158,

44263

26 gtgtggtgggtgtaga 4-10-2 GTGTggtgggtgtaGA 26_1 43497, 43622, 12

43740, 43863, 43961 , 44158, 44263, 44451

27 tgtggtgggtgtag 3-7-4 TGTggtgggtGTAG 27_1 43498, 43623, 12

43741 , 43864, 43962, 44079, 44159, 44264,

44452

28 gtgtgtgtggtgggtgta 2-14-2 GTgtgtgtggtgggtgTA 28_1 43499, 43624, 12

43742, 43865, 43963, 44160,

44265

Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide.

Designs refer to the gapmer design, F-G-F', where each number represents the number of consecutive modified nucleosides, e.g2' modified nucleosides (first number=5' flank), followed by the number of DNA nucleosides (second number= gap region), followed by the number of modified nucleosides, e.g2' modified nucleosides (third number=3' flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is

complementary to the target nucleic acid.

Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, and 5-methyl DNA cytosines are presented by "e", all internucleoside linkages are

phosphorothioate internucleoside linkages.

Oligonucleotide synthesis

Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.

Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 μηηοΙ scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60 ^° C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS. Elongation of the oligonucleotide:

The coupling of β-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA- T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5'-0-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired

modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1 ). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1 . The rest of the reagents are the ones typically used for oligonucleotide synthesis.

For post solid phase synthesis conjugation a commercially available C6 aminolinker

phorphoramidite can be used in the last cycle of the solid phase synthesis and after

deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.

Purification by RP-HPLC:

The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10μ 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.

Abbreviations:

DCI: 4,5-Dicyanoimidazole

DCM: Dichloromethane

DMF: Dimethylformamide

DMT: 4,4'-Dimethoxytrityl

THF: Tetrahydrofurane

Bz: Benzoyl

Ibu: Isobutyryl

RP-HPLC: Reverse phase high performance liquid chromatography Tm Assay:

Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x T _m -buffer (200mM NaCI, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95°C for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (T _m ) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20°C to 95°C and then down to 25°C, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T _m .

Example 1 - Testing in vitro efficacy and potency

Oligonucleotides targeting one region as well as oligonucleotides targeting at least three independent regions on TOM1 were tested in an in vitro experiment in HeLa cells. EC50 (potency) and max kd (efficacy) was assessed for the oligonucleotides.

Cell lines

The HeLa cell line was purchased from European Collection of Authenticated Cell Cultures (ECACC) and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% C02. For assays, 2500 cells/well were seeded in a 96 multi well plate in Eagle's Minimum Essential Medium (Sigma, M4655) with 10% fetal bovine serum (FBS) as

recommended by the supplier.

Oligonucleotide potency and efficacy

Cells were incubated for 24 hours before addition of oligonucleotides. The oligonucleotides were dissolved in PBS and added to the cells at final concentrations of oligonucleotides was of 0.01 , 0.031 , 0.1 , 0.31 , 1 , 3.21 , 10, and 32.1 μΜ, the final culture volume was 100 μΙ/well. The cells were harvested 3 days after addition of oligonucleotide compounds and total RNA was extracted using the PureLink Pro 96 RNA Purification kit (Thermo Fisher Scientific), according to the manufacturer's instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Thermo Fisher Scientific) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction. Target transcript levels were quantified using FAM labeled TaqMan assays from Thermo Fisher Scientific in a multiplex reaction with a VIC labelled GAPDH control probe in a technical duplex- and biological triplex set up. TaqMan primer assays for the target transcript of interest TOM 1 (Hs00193953_m1 ), and a house keeping gene GAPDH (4326317E VIC®/MGB probe).

EC50 calculations were performed in GraphPad Prism6. The maximum TOM1 knock down level (efficacy) is shown in Table 6 as % of control.

Table 6: EC50 and maximal knock down (Max Kd) % of control

CMP ID EC50 Std Max kd std Start position(s) on SEQ ID NO: 1 NO

13 1 2.65 1.53 72.56 4.53 26685

14 1 2.37 0.67 39.07 5.65 26685

15 1 1.86 0.55 78.24 2.37 26689

17 1 1.86 0.57 27.50 6.79 42484

18 1 0.40 0.01 6.29 0.26 42484

19 1 0.31 0.03 5.98 1.70 42484

20 1 3.37 0.74 32.07 5.49 42486

21 1 0.19 0.24 94.56 1.82 43483, 43608, 43726, 43947,

44249, 44330, 44437 _1 1.04 1.89 84.57 1.03 43485, 43610 ,43728, 43949,

44251 , 44332, 44439_1 2.04 0.43 26.76 4.93 43485, 43610, 43728, 43949,

44251 , 44332, 44439_1 0.99 0.19 40.00 3.10 43485, 43610, 43728, 43949,

44251 , 44332, 44439_1 1.83 0.49 35.95 6.08 43497, 43622, 43740, 43863,

43961 , 44078, 44158, 44263, 44451

_1 0.64 0.15 63.12 2.22 43498, 43623, 43741 , 43864,

43962, 44079, 44159, 44264, 44452

_1 0.36 0.65 72.94 1.49 43499, 43624, 43742, 43865,

43963, 44160, 44265