TITLE

ONCOGENIC ALL-I FUSION PROTEINS FOR TARGETING DROSHA-MEDIATED microRNA PROCESSING

Inventor: Carlo M. Croce

GOVERNMENT SUPPORT

[0001] The invention was supported, in whole or in part, by a grant from the US Government. The Government may have certain rights in the invention.

CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of United States Provisional Application No. 60/934,707, filed June 15, 2007, and International Application No. PCT/US20xx/xxxxxx, filed xxxxx. The disclosures of both applications are fully and expressly incorporated herein by reference.

FIELD OF THE INVENTION

[0003] The present invention provides compositions and methods for modulation of small non-coding RNAs, particularly pri-miRNAs. In particular, this invention relates to compounds, particularly oligomeric compounds, which, in some embodiments, hybridize with or sterically interfere with nucleic acid molecules comprising or encoding small non- coding RNA targets, including pri-miRNAs.

SEQUENCE LISTING

[0004] The patent application contains a "Sequence Listing" section. A copy of the "Sequence Listing" is available in electronic form from the USPTO web site (seqdata.uspto.gov/sequence). A paper copy of the sequence listing and a computer- readable form of the sequence listing are herein incorporated by reference. An electronic copy of the "Sequence Listing" will also be available from the USPTO upon request and payment of the fee set forth in 37 CFR 1.19(b)(3).

BACKGROUND OF THE INVENTION

[0005] Acute leukemia is a rapidly progressive malignant disease of the bone marrow and blood that results in the accumulation of immature, functionless cells, called blast cells, in the marrow and blood. The accumulation of blast cells in the marrow blocks normal blood

cell development. As a result, red cells, white cells and platelets are not produced in sufficient numbers. When the disease originates in a marrow lymphocyte progenitor cell, it results in acute lymphoblastic leukemia (ALL) and when the disease originates in a myeloid progenitor, it results in acute myelogenous leukemia (AML).

[0006] ALL is a rapidly progressive cancer that starts by the malignant transformation of a marrow lymphocyte. ALL is the most common type of childhood leukemia, with 3,000 new cases per year in all age groups. The transformed, now malignant, cell multiplies and accumulates in the marrow as leukemic lymphoblasts. The lymphoblasts block normal blood cell-formation in the marrow, resulting in insufficient production of red cells, white cells and platelets.

[0007] High-grade lymphomas, also known as aggressive lymphoma, include several subtypes of lymphoma that progress relatively rapidly if untreated. These subtypes include, e.g., AIDS-associated lymphoma, anaplastic large cell lymphoma, Burkitt's lymphoma, diffuse large cell lymphoma, immunoblastic lymphoma, lymphoblastic lymphoma and small noncleaved cell lymphomas. Compared to diffuse large B-cell lymphomas, high-grade lymphomas behave more aggressively, require more intensive chemotherapy, and occur more often in children. Because rapidly dividing cells are more sensitive to anti-cancer agents and because the young patients usually lack other health problems, some of these lymphomas show a dramatic response to therapy. Acute lymphoblastic leukemia and high- grade lymphoma are the most common leukemias and lymphomas in children. These diseases are, for the most part, polyclonal, suggesting that only a few genetic changes are sufficient to induce malignancy.

[0008] ALL-I, also termed MLL has been cloned from chromosome band 1 Iq23, recurrent site involved in multiple chromosome abnormalities associated with both acute lymphoblastic (ALL) and acute myeloblasts (AML) leukemia (1, 2). The chromosome translocation results in the fusion of the ALLl gene with one of more than 50 different partner genes and the production of leukemogenic proteins composed of the N-terminal AlIl sequence and a portion of the partner protein encoded by the segment of the gene positioned 3' to the breakpoint (ibid). The most prevalent ALLl rearrangement in ALL is the ALL1/AF4 chimeric gene resulting from the t(4;ll) chromosome translocation. This rearrangement is associated with very poor prognosis in infants and adults (3). The molecular pathways deregulated by the AlIl fusion protein, which bring about the

aggressiveness of the disease are still largely unknown.

[0009] miRNAs are short 20-22 nucleotide RNA that negatively regulate the gene expression at the post-transcriptional level by base pairing to the 3' untranslated region of target messenger RNAs. More than 400 miRNAs have been identified in human and they are evolutionarily conserved. It has been shown that miRNAs regulate various physiological and pathological pathways such as cell differentiation, cell proliferation and tumorigenesis (reviewed in 4). Extensive studies to determine expression profile of miRNAs in human cancer has revealed cell-type specific miRNA fingerprint found in B cell chronic lymphocytic leukemia (B-CLL), breast cancer, colon cancer, gastric cancer, glioblastoma, hepatocellular carcinoma, papillary thyroid cancer, and endocrine pancreatic tumors (reviewed in 5).

[00010] Calin et al. showed that although miRNA genes represent only 1% of the mammalian genome, more than 50% of miRNA genes are located within region associated with amplification, deletion and translocation in cancer (6). Such somatic changes of miRNA genes definitively attribute to the specific expression pattern found in cancer. Additional factors, which attribute to the cancer specific deregulation of miRNAs, are unknown, although the most obvious candidate is transcriptional control. Other possibility is that miRNA maturation is such factor. Micro RNA biogenesis begins with a primary transcript, termed pri-miRNA, which is generated by RNA polymerase II (review in 7). Within the pri-miRNA, the miRNA itself is contained within a -60-80 nucleotide that can fold back on itself to form a stem-loop hairpin structure. This hairpin structure is recognized and excised from pri-miRNA by the microprocessor complex composed of nuclear RNase III enzyme, Drosha and its binding partner DGCR8. The excised miRNA hairpin, referred to as pre-miRNA, is transported to the cytoplasm in association with RAN-GTP and Exportin 5, where it is further processed by a second RNase III enzyme, Dicer, which releases a 22 nucleotide mature duplex RNA with 5' phosphate and 2-nucleotide 3' overhang. The antisense RNA strand is incorporated into the RISC complex, which target it to mRNA(s) by base-pairing and consequently interfere with translation of the mRNA or cleave it. In principle, any step during this maturation process could affect miRNA production.

[00011] Consequently, there is a need for agents that regulate gene expression via the mechanisms mediated by small non-coding RNAs. Identification of oligomeric compounds

that can increase or decrease gene expression or activity by modulating the levels of miRNA in a cell is therefore desirable.

[00012] The present invention therefore provides oligomeric compounds and methods useful for modulating the levels, expression, or processing of pri-miRNAs, including those relying on mechanisms of action such as RNA interference and dsRNA enzymes, as well as antisense and non-antisense mechanisms. One having skill in the art, once armed with this disclosure will be able, without undue experimentation, to identify compounds, compositions and methods for these uses.

SUMMARY OF THE INVENTION

[00013] The present invention is based on the discovery that AlIl fusion protein-mediates the recruitment of the enzyme Drosha to target genes encoding specific miRNAs. This recruitment is now believed to be the cause for the enhanced expression of the relevant miRNAs.

[00014] In one aspect, there is provided agents that regulate gene expression via the mechanisms mediated by small non-coding RNAs. Identification of oligomeric compounds that can increase or decrease gene expression or activity by modulating the levels of miRNA in a cell is therefore desirable.

[00015] In a particular aspect, there is provided oligomeric compounds and methods useful for modulating the levels, expression, or processing of pri-miRNAs, including those relying on mechanisms of action such as RNA interference and dsRNA enzymes, as well as antisense and non-antisense mechanisms. One having skill in the art, once armed with this disclosure will be able, without undue experimentation, to identify compounds, compositions and methods for these uses.

[00016] In a particular aspect, there is provided oligomeric compounds, especially nucleic acid and nucleic acid-like oligomeric compounds, which are targeted to, or mimic, nucleic acids comprising or encoding small non-coding RNAs, and which act to modulate the levels of small non-coding RNAs, particularly pri-miRNAs, or interfere with their function.

[00017] In a particular aspect, there is provided oligomeric compounds, especially nucleic acid and nucleic acid-like oligomeric compounds, which are targeted to pri-miRNAs, and which act to modulate the levels of pri-miRNAs, or interfere with their processing or

function.

[00018] In a particular aspect, there is provided oligomeric compounds that target a region flanking or overlapping a Drosha recognition region within a pri-miRNA.

[00019] Additionally, there is provided oligomeric compounds that target a region flanking or overlapping a Drosha cleavage site. There is also provided oligomeric compounds that increase levels of a pri-miRNA. For example, the present invention provides oligomeric compounds 15 to 30 nucleobases in length targeted to a Drosha recognition region within a polycistronic pri-miRNA transcript. The polycistronic pri-miRNA transcript can be that from which the miRNAs listed in Table 1 are derived.

[00020] In particular embodiments, the Drosha recognition region can be one or more of the miRNAs listed in Table 1. Such oligomeric compounds may be antisense oligonucleotides, and may contain one or more chemical modifications. Additionally, such oligomeric compounds are capable of increasing pri-miRNA levels.

[00021] Also provided are methods of modulating the levels of small non-coding RNAs, particularly pri-miRNAs, in cells, tissues or animals comprising contacting the cells, tissues or animals with one or more of the compounds or compositions of the invention.

[00022] Further provided are methods of modulating the levels of miRs derived from a polycistronic pri-miR transcript in a cell comprising selecting a polycistronic pri-miR transcript, selecting a Drosha recognition region of a single miRNA derived from the selected polycistronic pri-miR transcript, selecting an oligomeric compound 15 to 30 nucleotides in length targeted to or sufficiently complementary to the selected Drosha recognition region, and contacting the cell with the oligomeric compound.

[00023] Such methods include modulating the levels of a single mature miRNA derived from the selected polycistronic pri-miRNA, or alternatively modulating the levels of two or more mature miRNAs derived from the selected polycistronic pri-miRNA.

[00024] Also provided are methods of modulating the levels of pri-miRNAs from those listed in Table 1 comprising contacting a cell with an oligomeric compound targeted to or sufficiently complementary to Drosha-recognition regions on such pri-miRNAs.

[00025] There is also provided herein methods for selectively modulating a single member of a miR family in a cell comprising selecting a member of a miR family derived from a pri-

miR transcript, identifying one or more oligomeric compounds targeted to or sufficiently complementary to the Drosha recognition region of a the selected pri-miR transcript, wherein the identified oligomeric compounds lack sufficient complementarity to the Drosha recognition regions of pri-miR transcripts from which other members of the miR family are derived, and contacting the cell with such an identified oligomeric compound.

[00026] There is also provided herein oligomeric compounds comprising a first strand and a second strand wherein at least one strand contains a modification and wherein a portion of one of the oligomeric compound strands is capable of hybridizing to a small non-coding RNA target nucleic acid.

[00027] There is also provided herein oligomeric compounds comprising a first region and a second region and optionally a third region wherein at least one region contains a modification and wherein a portion of the oligomeric compound is capable of hybridizing to a small non-coding RNA target nucleic acid.

[00028] There is also provided herein methods for identifying oligomeric compounds capable of modulating pri-miRNA levels. A pri-miRNA is selected, and oligomeric compounds are designed such that they are targeted to or sufficiently complementary to various target segments within a pri-miRNA sequence, including oligomeric compounds targeted to and overlapping the mature miRNA sequence within the pri-miRNA. An increase in the level of a pri-miRNA in cells contacted with the oligomeric compounds as compared to cells not contacted with the oligomeric compounds indicates that the oligomeric compound modulates the pri-miRNA level.

[00029] There is also provided herein methods for identifying small molecules capable of modulating pri-miRNA levels. A pri-miRNA is selected, and small molecules are evaluated for their ability of modulate pri-miRNA levels. The small molecules may bind to the regions of the pri-miR containing or overlapping the mature miRNA sequence, or the Drosha recognition region. An increase in the level of a pri-miRNA in cells contacted with the small molecules as compared to cells not contacted with the small molecules indicates that the small molecule modulates the pri-miRNA levels.

[00030] There is also provided herein a decoy for treating and/or preventing ALL and - related diseases.

[00031] These as well as other important aspects of the invention will become more

apparent from the following detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[00032] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary.

[00033] Figure 1. RNase protection assay for the detection of miR-191 and miR-155 in leukemic cell lines with ALL-I rearrangements. 20 μg of total RNAs were hybridized overnight at 43 ⁰ C with in vitro transcribed anti-sense probe of miR-191 or miR-155 and subsequently treated with RNase. Protected probe fragments were resolved on a 15% polyacrylamide gel containing 8M urea. End-labeled φX174/Hinf I was used as a molecular weight marker. Because of the compression of the marker for sizes larger than 200 nucleotides, only fragments of 151 nt and below are shown. As a loading control, 10 μg of total RNA was also subjected to hybridization with Cyclophillin probe.

[00034] Figures 2A and 2B. Purification of Drosha protein from ALL-/-rearranged leukemic cells by Immunoprecipitation with anti-Drosha Ab.

[00035] Figure 2A) Western blot detection of immunoprecipitated proteins. Ab 169 reacting with AlIl N terminal epitope was utilized for the detection of AlIl /Af 4 and of Alll/Af9. For unambiguous identification of Drosha, recombinant Drosha exogenously expressed in K562 cells transfected with pCK-Drosha -Flag plasmid was purified by IP (Drosha:FLAG). 20 μg nuclear extracts of leukemic cells or around 2.5 μg of immuno- purified Drosha were used in the analysis. Note that endogenous Drosha was purified from nuclear extracts while Drosha:FLAG was from whole cell lyzate.

[00036] Figure 2B) Western blot detection of proteins immunoprecipitated with anti-Drosha Ab from SEMK2 nuclear extracts treated either with RNase or DNase.

[00037] Figure 3. In vitro cleavage assays of Drosha immuno-purified from plasmid- transfected cells and from ALZJ-associated leukemic cell lines. Equal amounts of Drosha, determined by Western analysis (Figure 2A) were used in all reactions; the corresponding volumes of the non-diluted samples were 10 μl of Drosha:FLAG, 5 μl of SEMK2 Drosha and 20 μl of PER377 Drosha. Cleaved products of miR-191 and miR-155

were resolved on denaturing 9 % polyacrylamide gel (left). The cleaved products were excised from the gel, electro-eluted, and subjected to further cleavage with recombinant Dicer enzyme. 15 % denaturing gel was used to resolve and identify the 22 nucleotides mature products (right).

[00038] Figures 4A-E. Alll/Af4-dependent localization of Drosha in miR-191 and miR- 23a genomic loci and the effect of Alll/Af4 knockdown on Drosha recruitment.

[00039] Figure 4a) Elimination of most of the Alll/Af4 protein from SEMK2 cells treated with SEMJ siRNA.

[00040] Figures 4B-4D) ChIP analysis for determination of recruitment of normal AlIl, Alll/Af4 and drosha proteins to genomic loci encoding miR-191, miR-155, miR-23a and miR-27a. Chromatins tested were from SEMK2 cells treated with the non-functional siRNA MVJ, or from cells treated with the SEMJ siRNA which knocks down most of Alll/Af4.

[00041] Figure 4E) The sequence listings for Nucleotide Sequence of Human Genomic fragment encoding microRNA-191 [SEQ ID N0.:xx], which was cloned into pGEM3Z vector (Promega) and was used as a probe in RNase protection assay; Nucleotide Sequence of Human Genomic fragment encoding microRNA-155 [SEQ ID N0.:xx], which was cloned into pGEM3Z vector (Promega) and was used as a probe in RNase protection assay; Nucleotide Sequence of Human Genomic fragment encoding microRNA-23a [SEQ ID N0.:xx], which was cloned into pGEM3Z vector (Promega) and was used as a probe in RNase protection assay; Nucleotide Sequence of Human Genomic fragment encoding microRNA-27a [SEQ ID N0.:xx], which was cloned into pGEM3Z vector (Promega) and was used as a probe in RNase protection assay.

[00042] Figure 5. Effect of All 1 /Af 4 knockdown on accumulation of pri miR- 191. Abundance of the precursors pri miR-191, pri miR-155, pri miR-23a and pri miR-27a, as well as of their processed products, was tested in SEMK2 cells treated with the non-active MVJ siRNA, or knocked down for either AlIl /Af 4 (SEMJ) or Drosha. The RNAs were identified by RNase protection assay (see text). Note that Drosha knockdown increased the abundance of all primary transcripts. In contrast, knockdown of Alll/Af4 (SEMJ) was associated with higher abundance of pri miR-191and pri miR-23a.

[00043] Figure 6. Upregulation of miR-191 in leukemic cell lines with the t(4;l 1) chromosome translocation. Northern analysis of RNAs (aliquots of 20 μg) from MV4;11,

RS4;11, and SEMK2 -all pro-B cells with t(4;ll), from the pro-B cells REH and 380, and from the pre-B cell line 697. RNAs were separated on 20% denaturing polyacryl amide gel and electro-blotted into a Nylon membrane. The 22 nucleotides miR-191 was identified by hybridization to an end-labelled oligonucleotide. Similar Northern analysis for KGl and K562 cells, both lacking ALLl rearrangement, indicated low level of expression like that of 380 and 697 cells (not shown).

[00044] Figures 7A and 7B. Identification by RNase protection assay (RPA) of miR precursor and processed RNAs produced in vivo (left gels), or produced by in vitro cleavage with Drosha and Dicer (right gels). Sequences of miR-191 [SEQ ID NO:xx] probe (Figure 7A) and miR-155 probe [SEQ ID NO:xx] (Figure 7B), synthesized by in vitro transcription with T7 RNA polymerase are shown. The mature micro RNA and the flanking pGEM 3Z vector sequences are shown in red and grey letters, respectively. Restriction sites used to generate run-off transcripts are indicated. Vertical arrows indicate Drosha cleavage sites, predicted from ref.ll for miR-191 or reported in ref. 9 for miR-155. Predicted RNase protected fragments of the products of hybridization between cell RNA and uniformly labeled probes, and of in vitro cleavage products (by Drosha or Dicer) are summarized below the probe sequence. Products of the RPA and of the in vitro cleavage assays were resolved on a single denaturing gel. For the in vitro cleavage assay, Drosha:FLAG was used. The cleavage products of 64 and 61 nt, derived from miR-191 and miR-155 probes, respectively, were digested with recombinant Dicer after excision and purification from the gel. In the assay for miR-155, the RPA protected fragments of 53 and 61 nt and the in vitro cleavage products could not be resolved in the gel and their relative positions are marked with arrows.

[00045] Figures 8A and 8B. miR-23a probe [SEQ ID NO:xx] (Figure 8A) and miR-27a probe [SEQ ID NO:xx] (Figure 8B) used in RNase Protection Assay in Figure 5. The mature micro RNA and the flanking pGEM 3Z vector sequences are shown in red and grey letters, respectively. The pGEM 3Z recombinants harboring miR-23a hairpin and miR- 27a hairpin were linearlized with Nael and Bsu36I, respectively and were used as the templates to generate anti-sense probes with SP6 RNA polymerase.

DETAILED DESCRIPTION OF THE INVENTION

[00046] A description of particular embodiments of the invention follows.

[00047] As used herein, the term "Drosha recognition region" within a pri-miRNA transcript encompasses the mature miRNA as well as up to 25 nucleotides in the 5' direction relative to the 5' Drosha cleavage site of such mature miRNA, and up to 50 nucleotides in the 3' direction relative to the 3' Drosha cleavage site of such mature miRNA. In additional embodiments, the Drosha recognition region encompasses the mature miRNA and up to 15 nucleotides in the 5' direction relative to the 5' Drosha cleavage site of such mature miRNA, and up to 40 nucleotides in the 3' direction relative to the 3' Drosha cleavage site of such mature miRNA. In some aspects, the Drosha recognition region is a region strongly affected by oligomeric compounds targeted to this region, i.e. the targeting of oligomeric compounds to this region of a pri-miRNA results in a greater than 3.5-fold increase in the level of the pri-miRNA. In other aspects, the level of the pri-miRNA is moderately affected by oligomeric compounds targeted to this region, i.e. the targeting of oligomeric compounds to this Drosha recognition region results in a 1.5 to 2.5-fold increase in the levels of the pri- miRNA.

[00048] As used herein, the term "Drosha cleavage site" is used to refer to a site approximately 22 nucleobases from the junction of the terminal hairpin loop and the stem of a pri-miRNA. One end of the miRNA is determined by selection of the cleavage site by the Drosha enzyme.

[00049] Identification of miRNAs deregulated in leukemic cell lines harboring ALLl rearrangements.

[00050] Applying miRNA microarray analysis, we determined the miRNA expression profiles of human leukemic cell lines harboring ALLl rearrangements. A total of 18 miRNAs were found to be upregulated at statistical significance in cell lines with rearranged ALLl, including SEMK2 and RS4;11 cells with the t (4; 11) and PER377 cells with the t (9;11). Two pro-B cell lines with no ALLl abnormalities, 380 and REH, did not show upregulation, as shown in Table 1.

[00051] Table 1 shows a comparison of micro RNA expression profiles of cells with and without ALLl rearrangement. Micro RNA expression profiles were determined in triplicate by probing micro RNA-chip with total RNAs from three cell lines expressing ALL-I fusion protein and two cell lines bearing similar phenotype but lacking ALL-I abnormalities.

Genomic loci of bold typed miRs have been previously identified as binding sites for normal ALL-I (U).

— — ^^

SAM FDR MicroRNA Score* (%)** upregulated micro RNAs hsa-mir-191 4.84 0 hsa-mir-24-1 4.42 0 hsa-mir-221 4.27 0 hsa-mir-24-2 3.91 0 hsa-mir-192 3.84 0 hsa-mir-222 3.75 0 hsa-mir-196a-l 3.59 0 hsa-mir-023b 3.27 0 hsa-mir-146a 3.26 0 hsa-mir-023a 3.10 0 hsa-mir-128b 2.83 0 hsa-mir-128a 2.69 0 hsa-mir-220 2.54 0 hsa-mir-196b 2.39 0 hsa-mir-223 2.26 0 hsa-mir-146b 2.20 0 hsa-mir-214 1.90 2.46 hsa-mir-135a-l 1.90 2.46 downregulated micro RNAs hsa-mir-125b-l -3.86 0 hsa-mir-125b-2 -3.19 0 hsa-mir-100 -2.45 2.97

[00052] *SAM identifies genes with statistically significant scores (i.e. paired t tests). Each gene is assigned a score on the basis of its change in gene expression relative to the standard deviation of repeated measurements for that gene. Genes with scores greater than a threshold are deemed potentially significant.

[00053] ** The percentage of such genes identified by chance is the q- value of False

Discovery Rate. miR-155 and 27a, investigated in this paper, are not upregulated in the cell lines with ALLl translocations.

[00054] Northern analysis supported and expanded these findings (see Figureό). To confirm and extend some of the results of the microarrays, the expression of miR-191, ranked top in the analysis, and miR-155 which did not show differential expression in lines with ALLl gene rearrangements, were determined by applying RNase protection assay (see Figurel).

[00055] While miR-191 mature species could hardly be detected in REH and 380 cells, it was abundant in lines expressing AlIl fusion proteins, including ML-2 with the t(6;ll) chromosome translocation, PER377, SEMK2 and RS4;11 cells. In contrast, mature miR- 155 was expressed in 380 and REH cells to considerably higher level compared to the other cells. This assay also showed that the degree of the pri-miR-191 protection (expression) was similar in all leukemic cells, except for RS4;11, regardless of the expression level of the mature species. This shows that the higher abundance of mature miR-191 in ALLl associated leukemias is not due to overproduction of the pri-miRNA.

[00056] AUl fusion proteins, Alll/Af4 and Alll/Af9, physically interact with Drosha in vivo.

[00057] The localization of both Drosha and AlIl fusion proteins to the cell nuclei indicates that the latter affects Drosha-mediated miR-191 processing. To test the physical interaction between Drosha and AlIl fusion proteins, we applied coimmunoprecipitation methodology. It has been previously reported that the exogenously expressed Drosha:FLAG assembles a complex, termed the microprocessor complex (8, 9, 10). In addition, Drosha:FLAG was found to assemble a second and larger multiprotein complex of > 2 MDa which contained many RNA binding proteins including EWS (10). We used anti-Drosha Ab to precipitate endogenous Drosha produced in SEMK2 and PER377 cell nuclei.

[00058] In parallel, Drosha-Flag was precipitated with anti-Flag mAb from whole cell lysates of transfected K562 cells. Drosha in the immunoprecipitates were eluted by adding excess amount of the synthetic peptide previously used to generate the Ab. The eluates were subjected to Western blot analysis (see Figure 2), as well as to in vitro cleavage assays to measure processing of miR-191 and miR-155 probes (see Figure3).

[00059] The Western blot analysis demonstrated co-immunoprecipitation of two known

Drosha- associated proteins, DGCR8 and EWS (see Figure2A). Strikingly, the fusion proteins Alll/Af4 and Alll/Af9 co-precipitated with Drosha (ibid). In contrast, normal p300 AlIl did not co-precipitate. Reciprocal immunoprecipitation directed against Alll/Af4 by using anti-Af4C-terminal Ab failed to co-immunoprecipitate Drosha, although this Ab effectively precipitates the fusion protein (data not shown). The co-immunoprecipitaion of the AlIl fusion proteins with Drosha is not due to cross-reaction, because the anti-Drosha Ab did not precipitate Alll/Af4 from SEMK2 cells in which the Drosha protein was downregulated by interference RNA (see Figure 2B).

[00060] The failure of anti-Af4 Ab to coprecipitate Drosha indicates that only a small portion of Alll/Af4 is associated with Drosha or that the association masks the relevant epitope on Af4 C-terminal region. We next sought to determine whether the association between Alll/Af4 and Drosha is RNA-dependent and/or DNA-dependent. To this end, SEMK2 nuclear extracts were treated extensively with either RNase or DNase and subjected to IP with anti-Drosha Ab. Western blot analysis showed the presence of Alll/Af4, Drosha, DGCR8 and EWS proteins in the immunoprecipitate of RNase-treated nuclear extracts (Figure2B). Significantly, DNase treatment abrogated the association of Drosha with Alll/Af4 while the association with other proteins was sustained (ibid). These results suggest that a genomic DNA is involved in the physical interaction between Alll/Af4 and the Drosha complex.

[00061] The in vitro cleavage assays showed that all Drosha preparations generated three species of miR-191 cleavage products. Of these, the species of approx. 66 nucleotides was identified as pre-miR-191 because of its cleavage by recombinant Dicer enzyme (see Figure3, right). Similarly, the mixture of miR-155 processed products, surmised to be composed of three species of 55, 59 and 65 nucleotides was shown to be further cleaved by Dicer, resulting in generation of 22 bases products (ibid). These results indicated that the three affinity-purified Drosha preparations were functionally active with both miR-191 and miR-155 templates. Drosha containing Alll/Af4 exhibited the strongest processing activity whereas Drosha containing Alll/Af9 had less processing activity, similar to that of the Drosha:FLAG preparation.

[00062] Alll/Af4-mediated Drosha recruitment to miRNA loci.

[00063] The dependency of the physical interaction between Alll/Af4 and Drosha on

cellular DNA prompted us to investigate the occupancy of the two proteins on the miR-191 gene. We have also discovered that normal AlIl binds to DNA regions located 3.5 and 1.5 kb upstream of miR-191 hairpin as well as to the region spanning the hairpin sequence itself (11). Chromatin immunoprecipitation analysis was done on: 1) SEMK2 cells transfected with SEMK2-fusion junction- specific siRNA; the latter downregulates the Alll/Af4 protein at an efficiency of >90%, 2) SEMK2 cells expressing siRNA which targets a different ALL1/AF4 junction and therefore does not affect the level of the fusion protein in the cells (the two siRNAs are referred to as SEMJ and MVJ siRNA, respectively; the amount of Alll/Af4 protein in the transfectants is shown in Figure 4A).

[00064] The analysis of chromatin of cells containing MVJ siRNA, as well as of intact SEMK2 cells (not shown), showed co-occupancy of normal AlIl, Alll/Af4 and Drosha proteins on the three regions within the miR-191 locus (see Figure 4B). In contrast, no occupancy of Alll/Af4 and Drosha on miR-155 hairpin was detected (see Figure 4C).

[00065] Knockdown of AlIl /Af 4 by treatment with SEMJ siRNA resulted in reduced occupancy of the fusion protein on the three sites within the miR-191 gene, and a concurrent loss of Drosha binding (see Figure 4B). This indicates Alll/Af4-mediated Drosha recruitment onto the miR-191 locus. The investigation was further extended to two additional micro RNA loci. The miR-23a and miR-27a genes are aligned in 5' to 3' configuration and are spaced by an interval of 84 nucleotides. The expression microarray analysis showed miR-23a, but not miR-27a, to be upregulated in leukemic cells expressing AlIl fusion proteins (see Table 1).

[00066] The protein binding profiles of normal AlIl, AlIl /Af 4 and Drosha within the miR- 23a and 27a regions spanning the hairpin sequences resembled the profiles of miR-191 and miR-155, respectively (see Figure 4D).

[00067] The binding of both AlIl /Af 4 and Drosha to the miR-23a gene is reduced or eliminated (ibid) in SEMK2 cells knocked out for Alll/Af4 (SEMJ).

[00068] AlIl /Af 4 knockdown causes accumulation of specific pri-miRNAs.

[00069] To investigate the consequence of the reduction in amounts of AlIl /Af 4 and Drosha bound to the genomic regions encoding miR-191 and miR-23a, we determined the expression level of primary and processed RNA products of the loci in comparison to those encoded by the miR-155 and miR-27a genes. The products from SEMK2 cells treated with

MVJ siRNA, or SEMJ siRNA or Drosha- specific siRNA were analyzed by RNase protection assay (see Figure 5).

[00070] Both Alll/Af4 and Drosha knockdown resulted in accumulation of the primary transcript of miR-191 and miR-23a indicating impairment of Drosha function by either manipulation. The apparent impairment caused by both knockdown of Drosha and Alll/Af4 is reflected in reduced abundance of the 22 bases mature miR-23a. In contrast, knockdown of Alll/Af4 in cells treated with SEMJ siRNA did not increase the abundance of pri-miR- 155 or pri-miR-27a compared to cells treated with the inert MVJ siRNA (knockdown of Drosha brought about accumulation of pri-miR-155 and pri-miR-27a). This indicates that elimination of Alll/Af4 impairs processing of pri-miR-191 and pri-miR-23a, but not of pri- miR-155 or pri-miR-27a.

[00071] Discussion

[00072] Presented herein are several micro RNAs that have been identified as being upregulated in ALLl -associated leukemias. Further, we show that leukemogenic AlIl fusion proteins, Alll/Af4 and Alll/Af9 physically interact with Drosha, the nuclear RNase III enzyme essential for micro RNA biogenesis. The notion that nuclear pri-miRNA processing mediated by Drosha and its associated protein(s) greatly affects miRNA production in vivo was first noticed in discrepancies between the levels of primary transcript, precursor, and mature miRNA species. Human embryonic stem cells express measurable amount of the primary transcript encoding let-7a-l but lack mature species (12). Similarly, the level of miR-155 in diffuse large B cell lymphoma showed only a weak correlation with the level of BIC RNA in which miR-155 is contained (13).

[00073] Recent study to determine let-7g expression of all three molecular forms in mouse embryo showed that the mature species is detectable at 10.5 d gestation and is high at 14.5, whereas the primary transcript is highly expressed throughout development (14). Similar discrepancies were also found in several miRNAs known to be associated with mouse development. Since the accumulation of the precursor species was not detected, the differentiation events that occur during embryonic development activate Drosha processing of specific miRNA. In the same study, the authors further extended their findings to primary human tumors by comparing the data sets of primary transcripts and corresponding miRNA expressions and showed evidence supporting the Drosha processing block, which may cause

the down-regulation of miRNAs observed in cancer (ibid). Apparently, exploration of molecular mechanisms underlying activation or inhibition of Drosha processing, directed against specific miRNA is the next need.

[00074] By applying ChIP analysis and RNase protection assay to leukemic cells expressing Alll/Af4, or impaired in this expression due to enforced taking in of siRNA directed against the latter, the inventor herein now shows recruitment of both Alll/Af4 and Drosha to a specific micro RNA genomic locus, and augmentation of processing of the primary transcript. The apparent enhanced production of the mature micro RNA in cell lines producing AlIl fusion proteins is now believed to be due to Drosha binding to the corresponding locus.

[00075] In a particular aspect, there is provided herein a new mechanism by which micro RNAs may be regulated, and a new function for AlIl leukemic proteins.

[00076] Upregulation of miR-191 is found to be associated with poor prognosis in acute myeloid leukemias (15). Upregulation of miR-191 is also observed in study of 6 different types of solid tumors including colon, breast and lung cancer (16)

[00077] EXAMPLES

[00078] Materials and Methods

[00079] Cell culture and antibodies.

[00080] Human pro-B ALL 380, pre-B ALL 697, ML-2 with the t(6;l 1), and SEMK2 and MV4;11 with the t(4;ll) were obtained from DSMZ. REH pro-B ALL, RS4;11 with the t(4;ll) and K562 were purchased from ATCC. PER377 with the t(9;ll) was obtained from Dr. Ursulla Kees. All cell lines were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum. Antibodies against Drosha (abl2286), DGCR8 (ab24162) and a Drosha synthetic peptide (abl2307) were purchased from Abeam. Ab against EWS was made by Bethyl Laboratories (A300-308A). Anti-FLAG M2 mAb and 3 x FLAG peptide were obtained from Sigma. Ab 169 directed against ALL-I N-terminus was described (17). Ab against AF4 C-terminus was generated in rabbit by using bacterially synthesized polypeptide spanning AF4 residues 2323 -2886.

[00081] Microarray analysis.

[00082] Microarray analysis was performed as previously described (18). Raw data were

normalized and analyzed in GENESPRING 7.2 software (zcomSilicon Genetics, Redwood City, CA). Expression data were median-centered by using both the GENESPRING normalization option and the global median normalization of the BIOCONDUCTOR package (www.hioconduclor.org) with similar results. Statistical comparisons were done by using the GENESPRING ANOVA tool and the significance analysis of microarray (SAM) software.

[00083] miRNA Detection.

[00084] RNase Protection assays (RPA) were performed using RPA III kit from Ambion, according to the manufacturer's instructions. 5 - 20 μg of total RNA extracted with TRIZOL reagent (Invitrogen) were used per reaction. Cyclophillin antisense control template was obtained from Ambion and was labeled by utilizing T7 RNA polymerase. For the identification of protected species corresponding to pri-, pre- and mature miR-191 and miR-155, see Figure7.

[00085] Vector construction and probe preparation.

[00086] A genomic fragment spanning miR-191 hairpin was prepared by digesting BAC clone RP13-131K19 with PflMI-Bsu36I , blunt-ending and subcloning into the Smal site of pGEM-3Z (Promega) in both orientations. These constructs were linearlized with BamHI and used as templates for generating RNA probes by using Riboprobe in vitro transcription kit with T7 RNA polymerase (Promega). Probes with sense and anti- sense orientation were purified on a denaturing gel, and used in in vitro cleavage assay and in RNase protection assay, respectively. miR-155 hairpin region, embedded within the third exon of the BIC gene, was PCR-amplified from the human IMAGE cDNA clone 5176657.

[00087] The forward primer ATGCCTCATCCTCTGAGTGCT [SEQ ID NO:xx] tethered with EcoRI site and the reverse primer CTCCC ACGGC AGC AATTTGTT [SEQ ID NO:xx] tethered with HindIII site, corresponding to nucleotides 261 - 281 and 401 - 421 (ref.13), respectively, were used for amplification.

[00088] Subsequently, the PCR product was cloned into the EcoRI - HindIII sites of the pGEM-3Z vector. Sense and anti-sense RNA probes were synthesized by using T7 RNA polymerase and SP6 RNA polymerase, respectively. Genomic regions spanning miR-23a and miR-27a hairpin sequences were PCR-amplified as shown in Figureδ and cloned into the Hindlll-EcoRI sites of the pGEM3Z vector.

[00089] Anti-*SAM identifies genes with statistically significant scores (i.e. paired t tests). Each gene is assigned a score on the basis of its change in gene expression relative to the standard deviation of repeated measurements for that gene. Genes with scores greater than a threshold are deemed potentially significant.

[00090] **The percentage of such genes identified by chance is the q- value of False

Discovery Rate. miR-155 and 27a, investigated in this paper, are not upregulated in the cell lines with ALLl translocations.

[00091] Probes of miR-23a and miR-27a were prepared by digesting the recombinants with Nael and Bsu36I, respectively, followed by in vitro transcription with Sp6 RNA polymerase.

[00092] Immunopredpitation.

[00093] K562 cells were transfected with pCK-drosha-flag by using a Nucleofector apparatus according to the manufacturer's instructions (AMAXA). 2 xlO ⁸ transfected cells were lysed and subjected to IP with anti-Flag M2 mAb as described in ref.ll. Briefly, 25 mg whole cell lysate were incubated with 500 μg mAb after preclearing with protein G Sepharose (GE Healthcare) at 4 ⁰ C, O/N. Immunocomplex was precipitated with protein G Sepharose, washed, and the Drosha:FLAG in the precipitate was eluted by adding 3 x FLAG peptide at a concentration of 0.4 mg/ml in a buffer containing 3OmM Hepes, pH7.4/ 10OmM KCl/ 5% Glycerol/ 0.2mM EDTA/ 7.5mM MgCl ₂ / 2mM DTT. Elution was repeated three times, each for 30 min at RT, and eluates were combined. For immunoprecipitation of endogenous Drosha, 50 mg of nuclear extracts from SEMK2 or PER377 cells prepared by the method of Dignam et al. (19) were subjected to IP with 300 μg of anti-Drosha Ab. The anti-Drosha Ab, purchased from Abeam, was generated in rabbit by immunizing with a synthetic peptide derived from the N-terminal region of Drosha, and the peptide is commercially available.

[00094] The examples with small scale IP showed that the addition of excess Drosha peptide to anti-Drosha-immunoprecipitate releases Drosha; this procedure enabled purification of the Drosha complex in a native form. The peptide was used for the elution of Drosha at a concentration of 0.4 mg/ml. In some IPs, as shown in Figure2B, 250 μg of SEMK2 nuclear extacts were mixed either with 50 μL of DNase-free RNase (Roche) or with 50 U of RQl DNase (Promega) and subjected to preclearing with protein A Sepharose (GE Healthcare) at RT for 60 min. This was followed by IP with 10 μg of anti-Drosha Ab.

[00095] In vitro processing of pri-miRNAs.

[00096] In vitro processing assay was done essentially as described (8). Amounts to be added of Drosha:FLAG and of two Drosha preparations were determined by measuring the content of Drosha by Western blot analysis. Briefly, 20 μL of reaction mixtures containing immuno-purified Drosha, 7.5mM MgCl ₂ , 2OU of RNase inhibitor (RNasin, Promega), 2mM ATP, 2mM DTT and 1 x 10 ⁵ cpm of the labeled probe were incubated at 37 ⁰ C for 90 min. The reactions were terminated by adding 20 μL of buffer containing 2OmM Tris, pH8.0/ 1OmM EDTA/ 1% SDS/ 2 μg of proteinase K (Roche), followed by incubation at 45 ⁰ C for 30 min. After extraction with phenol/chloroform and chloroform, the processed products were ethanol-precipitated and resolved on a polyacrylamide gel containing 8M urea.

[00097] RNA interference

[00098] siRNA duplexes targeting ALL-1/AF4 and Drosha mRNAs in SEMK2 cells were transfected by applying the Amaxa Nucleofector using kit V and program T-20. 24h after transfection, cells were harvested and subjected to a second transfection, and subsequently were grown in culture for additional 48 h. Target sequences of SEMJ siRNA and MVJ siRNA were 5'-AAGAAAAGCAGACCUACUCCA-S '[SEQ ID NO:xx], and 5'- AAGAAAAGGAAAUGACCCATT-3'[SEQ ID NO:xx], respectively.

[00099] The former si RNA targets ALL- 1/AF4 mRNA produced in SEMK2 cells, while the latter targets ALL-1/AF4 mRNA produced in MV4;11 cells. Note that the first 8 nucleotides in both siRNAs correspond to ALL-I mRNA sequence immediately 5' of the fusion point and are identical whereas the following 13 nucleotides correspond to AF4 sequences which vary between the fusions and accordingly between the siRNAs; thus, MVJ siRNA will be inactive in SEMK2 cells. The sequence of Drosha siRNA is from ref.10. The siRNAs were synthesized by Dharmacon.

[000100] Chromatin Immunoprecipitation (ChIP) assay.

[000101] ChIP assays were performed using the ChIP assay kit from Upstate with minor modifications. Briefly, 5 x 10 ⁷ formaldehyde-treated SEMK2 cells were lysed in 1 mL buffer containing 5OmM Hepes, pH7.4/ 14OmM NaCl/ 1% Triton X/ 0.1% Na- Deoxycholate/ 1 x Complete protease inhibitor (Roche). 50 μL aliquot of the preparation was treated to reverse the cross-linking, deproteinized with proteinase K, extracted with

phenol chloroform and determined for DNA concentration. An aliquot of chromatin preparation containing 25 μg DNA was used per ChIP. DNase free RNase (Roche) was added at a concentration of 200 μg/mL during reverse cross linking. After deproteiniztion with proteinase K, DNA was purified in 50 μL TE by using PCR-purification kit (QIAGEN) according to the manufacturer's instructions. 1 μL aliquot was used for PCR. Primer sequences are listed in Table 2.

[000102] Table 2. Sequences of primers used in ChIP analysis in Figure4 (shown 5' to 3')

[000103] Diagnostics, Drug Discovery and Therapeutics

[000104] The oligomeric compounds and compositions of the present invention can additionally be utilized for research, drug discovery, kits and diagnostics, and therapeutics.

[000105] For use in research, oligomeric compounds of the present invention are used to interfere with the normal function of the nucleic acid molecules to which they are targeted. Expression patterns within cells or tissues treated with one or more oligomeric compounds

or compositions of the invention are compared to control cells or tissues not treated with the compounds or compositions and the patterns produced are analyzed for differential levels of nucleic acid expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds that affect expression patterns.

[000106] For use in drug discovery, oligomeric compounds of the present invention are used to elucidate relationships that exist between small non-coding RNAs, genes or proteins and a disease state, phenotype, or condition. These methods include detecting or modulating a target comprising contacting a sample, tissue, cell, or organism with the oligomeric compounds and compositions of the present invention, measuring the levels of the target and/or the levels of downstream gene products including mRNA or proteins encoded thereby, a related phenotypic or chemical endpoint at some time after treatment, and optionally comparing the measured value to an untreated sample, a positive control or a negative control. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the process of target validation or to determine the validity of a particular gene product as a target for treatment or prevention of a disease.

[000107] For use in kits and diagnostics, the oligomeric compounds and compositions of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of non-coding or coding nucleic acids expressed within cells and tissues.

[000108] The specificity and sensitivity of compounds and compositions can also be harnessed by those of skill in the art for therapeutic uses. Antisense oligomeric compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Antisense oligonucleotide drugs, including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that oligomeric compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.

[000109] For therapeutics, an animal, preferably a human, suspected of having a disease or disorder presenting conditions that can be treated, ameliorated, or improved by modulating the expression of a selected small non-coding target nucleic acid is treated by administering the compounds and compositions. For example, in one non-limiting embodiment, the methods comprise the step of administering to or contacting the animal, an effective amount of a modulator or mimic to treat, ameliorate or improve the conditions associated with the disease or disorder. The compounds effectively modulate the activity or function of the small non-coding RNA target or inhibit the expression or levels of the small non-coding RNA target. In certain embodiments, the small non-coding RNA target is a polycistronic pri-miRNA, a monocistronic pri-miRNA, a pre-miRNA, or a miRNA. In additional embodiments, the small non-coding RNA target is a single member of a miRNA family. Alternatively, two or more members of an miRNA family are selected for modulation. In a further embodiment, the small non-coding RNA target is a selectively processed miRNA. In one embodiment, the level, activity or expression of the target in an animal is inhibited by about 10%. In another embodiment the level, activity or expression of a target in an animal is inhibited by about 30%. Further, the level, activity or expression of a target in an animal is inhibited by 50% or more, by 60% or more, by 70% or more, by 80% or more, by 90% or more, or by 95% or more.

[000110] In another embodiment, the present invention provides for the use of a compound of the invention in the manufacture of a medicament for the treatment of any and all conditions associated with miRNAs and miRNA families.

[000111] The reduction of target levels may be measured in serum, adipose tissue, liver or any other body fluid, tissue or organ of the animal known to contain the small non-coding RNA or its precursor. Further, the cells contained within the fluids, tissues or organs being analyzed contain a nucleic acid molecule of a downstream target regulated or modulated by the small non-coding RNA target itself.

[000112] Compositions and Methods for Formulating Pharmaceutical Compositions

[000113] In another aspect, there is provided herein pharmaceutical compositions and formulations that include the oligomeric compounds, small non-coding RNAs and compositions of the invention. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not

limited to, route of administration, extent of disease, or dose to be administered. Such considerations are well understood by those skilled in the art.

[000114] The oligomeric compounds and compositions of the invention can be utilized in pharmaceutical compositions by adding an effective amount of the compound or composition to a suitable pharmaceutically acceptable diluent or carrier. Use of the oligomeric compounds and methods of the invention may also be useful prophylactically.

[000115] The oligomeric compounds and compositions encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the oligomeric compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[000116] The term "prodrug" indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.

[000117] The term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds and compositions of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Suitable examples include, but are not limited to, sodium and potassium salts.

[000118] In some embodiments, an oligomeric compound can be administered to a subject via an oral route of administration. The subject may be a mammal, such as a mouse, a rat, a dog, a guinea pig, or a non-human primate. In some embodiments, the subject may be a human or a human patient. In certain embodiments, the subject may be in need of modulation of the level or expression of one or more pri-miRNAs as discussed in more detail herein. In some embodiments, compositions for administration to a subject will comprise modified oligonucleotides having one or more modifications, as described herein.

[000119] Cell Culture and Oligonucleotide Treatment

[000120] The effects of oligomeric compounds on target nucleic acid expression or function

can be tested in any of a variety of cell types provided that the target nucleic acid is present at measurable levels. This can be readily determined by methods routine in the art, for example Northern blot analysis, ribonuclease protection assays, or real-time PCR. Cell types used for such analyses are available from commercial vendors (e.g. American Type Culture Collection, Manassus, Va.; Zen-Bio, Inc., Research Triangle Park, N. C; Clonetics Corporation, Walkers ville, Md.) and cells are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, Calif.

[000121] Any of the methods for gene therapy available in the art can be used according to the present invention. For general reviews of the methods of gene therapy, see Goldspiel et al., 1993, Clinical Pharmacy 12:488 505; Wu and Wu, 1991, Biotherapy 3:87 95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573 596; Mulligan, 1993, Science 260:926 932; and Morgan and Anderson, 1993, Ann. Rev. Biochem. 62:191 217; May, 1993, TIBTECH 11(5):155 215). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John Wiley & Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY.

[000122] While the invention has been described with reference to various and preferred embodiments, it should be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed herein contemplated for carrying out this invention, but that the invention will include all embodiments falling within the scope of the claims.

[000123] REFERENCES

[000124] The relevant teachings of all publications cited herein that have not explicitly been incorporated by reference, are incorporated herein by reference in their entirety. While this invention has been particularly shown and described with references to preferred embodiments thereof, it will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims. Citation of a reference herein shall not be construed

an admission that such reference is prior art to the present invention.

1. Gu, Y., Nakamura, T., Alder, H., Prasad, R., Canaani, O., Cimino, G., Croce, CM. & Canaani, E. (1992) Cell 71, 701-709.

2. Tkachuk, D.C., Kohler, S. & Cleary, M.L. (1992) Cell 71,691-700.

3. Johansson, B., Moorman, A.V., Haas, O. A., Watmore, A. E., Cheung, K.L., Swanton, S. & Seeker-Walker, L.M. (1998) Leukemia 12,779-787.

4. Bartel, D.P. (2004) Cell 116, 281- 297.

5. Calin, G.A. & Croce, CM. (2006) Nature Rev. Cancer 6, 857-866 (2006).

6. Calin, G. A., Sevignani, C, Dumitru, CD., Hyslop, T., Noch, E., Yendamur, S., Shimizu, M., Rattan, S., Bulrich, F., Negrini, M., et al. (2004) Proc Natl Acad Sci U SA. 101, 2999-3004.

7. Kim, V.N. (2005) Nature Rev. MoI. Cell Biol. 6, 376-385.

8. Han, J., Lee, Y., Yeom, K.H., Kim, Y.K., Jin, H. & Kim, V.N. (2004) Genes Dev. 18, 3016-3027.

9. Landthaler, M., Yalcin, A. & Tuschl, T. (2004) Current Biology 14, 2162-2167.

10. Gregory, R.L., Yan, K-P., Amuthan, G., Chendrimada, T., Doratotaji, B., Cooch, N. & Shiekhattar, R. (2004) Nature 432, 235-240.

11. Guenther, M.G., Jenner, R.G., Chevailer, B., Nakamura, T., Croce, CM., Canaani, E. &Young, R.A. (2005) Proc. Natl. Acad. Sci. USA. 102, 8603-8608.

12. Suh, M.R., Lee, Y., Kim, J.Y., Kim, S.K., Moon, S.H., Lee, J.Y., Cha, K.Y., Chung, H.M., Yoon, H.S., Moon, S.Y., et al. (2004) Dev. Biol. 270, 488-498.

13. Eis, P. S., Tarn, W., Sun, L., Chadburn, A., Li, Z., Gomez, M.F., Lund, E. & Dahlberg, J.E. (2005) Proc Natl Acad Sci U SA. 102, 3627-3632.

14. Thomson, J.M., Newman, M., Parker, J. S., Morin-Kensicki, E.M., Wright, T. & Hammond, S.M. (2006) Genes Dev. 20, 2202-2207.

15. Garzon, R. et al. MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia. Submitted for publication.

16. Volinia, S., Calin, G.A., Liu, C-G., Ambs, S., Cimmino, A., Petrocca, F., Visone, R., Iorio, M., Roldo, C, Ferracin, M., et al. Proc Natl Acad Sci USA. 103, 2257- 2261 (2006).

17. Nakamura, T., Mori, T., Tada, S., Krajewski, W., Rozovskaia, T., Wassell, R., Dubois, G., Mazo, A., Croce, CM. & Canaani. E. (2002) MoI Cell 10, 1119-1128.

18. Liu, C-G., Calin, G. A., Meloon, B., Gamliel, N., Sevignani, C, Ferracin, M., Dumitru, D. C, Shimizu, M., Zupo, S. & Dono, M., et al. (2004) Proc. Natl. Acad. Sci. USA 101, 9740-9744.

19. Dignam, J.D., Lebovitz, R.M. & Roeder, R.G. (1983) Nucleic Acids Res. 11,

1475-1489.