The present invention relates to a pathogen detector assay device, method and kit for the detection of harmful pathogens in critical environments, such as healthcare and food preparation environments.

It is desirable to be able to quickly and simply detect the presence of harmful bacteria in critical environments, particularly in the healthcare and food preparation environments. Other critical environments where detection of harmful pathogens is beneficial include, but are not limited to, residential care homes, mass transit systems (subways, aircraft cabins) and leisure facilities. It is also highly desirable to be able to detect the presence of harmful viruses in a similar manner.

The incidences of hospital-acquired infections have increased dramatically over recent years. It is important to be able to detect the presence of harmful pathogens so that the necessary measures can be quickly put in place to reduce the spread of any infection. However, current methods of identifying harmful pathogens require the use of expensive equipment, specialised staff and generally require at least 24 hours for the results.

A one-step immunochromatographic assay for the detection of S. aureus in food has been reported by S.-H. Huang et al (Food Control, 2007, 18, 893; Sens Actuators B 2007 127, 335; latex agglutination, J. Food Protection, 1993, 56, 759). This uses a lateral flow device in which a sandwich assay formed from staphylococcal protein A, a cell wall protein of S. aureus, is trapped by an anti-protein A IgG immobilised on a nitrocellulose membrane and a second anti-protein A IgG that is conjugated to a gold nanoparticle. A limitation of this system is that protein A has to be separated from the bacteria before analysis, adding 24 hours to the 10 minutes required to run the lateral flow device. A substantial bacterial population (around 10 - 10 cells per ml) is also required to produce a detectable quantity of protein A.

It is object of the present invention to provide a pathogen detector which aims to overcome, or at least alleviate, the abovementioned drawbacks.

Accordingly, a first aspect of the present invention provides a pathogen detector assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold nanoparticles or other nanoparticles capable of providing a visible change due to their aggregation, each gold or other nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen.

In the context of this disclosure, the term "pathogen" describes any disease- producing biological agent, specifically bacteria, viruses and other microorganisms. Furthermore, the term "directly binding a recognition element" means that the GNP or other nanoparticle construct is able to bind to the recognition element, being a peptidoglycan, protein/peptidoglycan or glycoprotein, that is exposed on either the cell wall, the outer or cytoplasmic membranes of the pathogen or within the periplasmic space between the membranes, without any prior separation of the protein from the pathogen.

The cell envelope includes the cell membrane and cell wall. The recognition elements that may be recognised by the binding element include membrane proteins, the N-acetylmuramic acid-N-acetylglucosamine (NAG-NAM) oligosaccharide polymer of peptidoglycan; the polypeptide polymer of peptidoglycan; peptide linkers that anchor proteins to peptidoglycan; oligosaccaride/carbohydrate structures on the cytoplasmic or outer membranes; lipopolysaccharides on the membrane and proteins that make up the capsids of viruses.

Ideally, individual cells should bind multiple nanoparticles to provide sufficient aggregation to effect a visible change for detection of the pathogens.

In one embodiment of the present invention, the pathogen comprises a bacterium wherein each gold or other nanoparticle is conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a species or broad spectrum of bacteria.

In another embodiment of the present invention, the pathogen may comprise a virus particle or a fungal spore. The pathogen should have multiple copies of the recognition element for the binding element that is attached to the nanoparticle. Examples include, but are not limited to, the GP 120 protein on the HIV virus that can bind to the CD4 protein provided on the nanoparticle, the neuraminidase enzyme on influenza viruses that can bind to nanoparticles functionalised with tamiflu (also known as oseltamivir). Other tight binding competitive inhibitors of neuraminidase could also be used. The N- acetylneuraminyllactose ligand may also be provided on the nanoparticles for binding hemaglutinin found on influenza cell surfaces. Other lectin (sugar binding proteins) - carbohydrate interactions could also be included.

The fluidic medium may comprise a flow channel within a syringe, or a flow channel provided within a porous membrane. In the former, the syringe preferably comprises a vessel, a plunger, an inlet and an outlet, the vessel comprising a first compartment for receiving a test sample and a second compartment comprising the capture zone for receiving the gold nanoparticles conjugated with the binding elements. A coarse filter for preventing the passage of larger particles, such as any carrier material used for collection of the test sample, preferably separates the first and second compartments. For example, a suitable coarse filter may have a pore size greater than lμm. Ideally, a second filter is provided between the second compartment and the outlet for forming the detection zone. The second filter has a pore size sufficient to inhibit the passage of bound pathogen but allow unattached nanoparticles to pass through. For example, a suitable second filter may have a pore size of > O. lμm.

The aforementioned device allows for quick and easy detection of the presence or absence of pathogens, such as bacteria, in a test sample. A test sample, contained on a suitable absorbent compressible carrier, such as a cotton wool bud, is placed in the first compartment and water or an aqueous buffer solution is added thereto. The syringe plunger forces fluid from the carrier through the filter into the second compartment for mixing with the functionalised gold or other nanoparticles. The absorbent compressible carrier may be fixed to the plunger of the syringe device. Optionally, an easily cleavable seal or membrane may be provided below the filter to keep the nanoparticles within a specific region of the syringe, i.e to enable the syringe to be stored in a non- vertical position prior to use. After a predetermined period of time, the plunger is depressed further to expel the solution through the second filter. If bacteria are present, these will bind to multiple gold nanoparticles causing aggregation thereof resulting in their retention on the filter, visibly staining the filter (generally, a dark red, purple or blue). Alternatively, the functionalised nanoparticles may be provided within an easily punctured bag or pouch made of polyethylene or a similar material. The syringe plunger may be provided with means to puncture the bag or pouch during its depression.

In an alternative embodiment of the present invention, the fluidic medium may comprise a porous membrane defining a flow channel in the form of a lateral flow assay. In this embodiment, the fluidic medium comprises a porous membrane, such as a nitrocellulose membrane, having a sample pad, a wicking pad, a capture zone and a detection zone. The capture zone contains the gold (or other) nanoparticles conjugated with at least one binding element for binding a recognition element on or within the cell envelope of a pathogen and the detection zone preferably comprises a binding element for the pathogen, which may be the same or different to that attached to the nanoparticle, attached to the porous membrane.

The device may also include a control zone within the fluidic medium which does not contact the test sample or will not bind the binding element for comparing the colour of the fluidic medium having bound and non-bound bacteria.

According to a second aspect of the present invention, there is provided a method for detecting the presence or absence of a pathogen comprising obtaining a sample from a surface to be tested, introducing fluid to the test sample and contacting an assay device according to the first aspect of the present invention with the fluid test sample.

A third aspect of the present invention provides a pathogen. detector assay kit comprising a swab, preferably sterile, for obtaining a test sample, a container for mixing the sample with water or an aqueous buffer and an assay device comprising a fluidic medium having at least one capture and detection zone; the fluidic medium in said capture and detection zone being in fluid communication with a detection probe comprising a plurality of gold or other nanoparticles capable of providing a visible change due to their aggregation, each nanoparticle being conjugated with at least one binding element for directly binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen. In one embodiment of the present invention, the binding element conjugated to a gold nanoparticle for binding a recognition element on or within the cell envelope of a bacterium is the glycopeptide antibiotic vancomycin. Vancomycin is an example of a binding element which recognises a broad spectrum of Gram positive and Gram negative bacteria, specifically for vancomycin all those having the dipeptide sequence D-Alanine-D-Alanine in their cell wall structure. Other molecules which may be used include other glycopeptide antibiotics and molecules that bind the D-AIa-D-AIa motifs (including mono- and polyclonal antibodies and their fragments, such as sc-Fv's and Fabs) or its alternatives of D-Ala-D-Ser or D-Ala-D-Lac (where Ala is alanine, Ser is serine and Lac is Lactate), as found in vancomycin resistant bacteria.

In an alternative embodiment of the present invention, the binding element conjugated to a gold nanoparticle for binding a recognition element of a bacterium comprises at least part of lysostaphin, in particular the targeting domain of lysostaphin which recognises specific species S. aureus including methicillin resistant S.aureus (MRSA), vancomycin intermediate S.aureus (VISA) and glycopeptide intermediate S.aureus (GISA), the so-called "super-bugs". Other alternatives to lysostaphin include, for example, homologues thereof, ZoocinA, LytM, Millericin B and Stapylococcal and Streptococcal phase enzymes such as Twort and phi85 for Gram-positive bacteria and the colicin binding protein for Gram-negative bacteria. The colicin sequence (for colicin E9 residues 434-418) attach to a specific E.coli receptor binding protein for which the sequence in known (CN. Penfold et al. MoI Microbiol. 2000, 38, 639-649). Additional examples include the (bacterio)phage proteins, each of which bind specifically to one species of bacteria (which may be Gram-positive or Gram-negative), lysozyme that has been catalytically deactivated and binds the NAG-NAM polymer of peptidoglycan and lectins (sugar binding proteins) that bind to sugars on the surface of pathogens. A fourth aspect of the present invention provides the use of a functionalised gold or other nanoparticle construct conjugated with a binding element for binding a recognition element on or within the cell envelope of a pathogen for detecting the presence or absence of the pathogen, which may be specific to a single species of pathogen or bind to a broad spectrum of pathogens, for detecting the presence or absence of the pathogen in a test sample.

To this end, there is provided a functionalised gold or other nanoparticle comprising a gold nanoparticle having a lysostaphin-targeting domain attached thereto. Preferably, the lysostaphin targeting domain has the DNA sequence identified as Seq. ID No. 1 and has the amino sequence identified as Seq ID No. 2.

Homologues (isoproteins) of the binding elements may also be used for the functionalised GNP construct.

It is to be appreciated that in the present invention each gold or other nanoparticle will have one to multiple binding elements attached thereto and that multiple gold nanoparticles will bind to one or more cells simultaneously.

For a better understanding of the present invention and to show more clearly how it may be carried into effect reference will now be made by way of example only to the accompanying drawings in which:

Figure 1 is a schematic diagram illustrating the binding of vancomycin to a gold nanoparticle;

Figures 2a to 2c is a schematic diagram illustrating the steps involved in the detection of bacteria using a syringe-based device according to one embodiment of the present invention; Figure 3 is a schematic diagram illustrating the binding of lysostaphin to a gold nanoparticle according to an embodiment of the present invention;

Figures 4a to 4c illustrate the steps involved in the detection of bacteria using a lateral flow device according to a further embodiment of the present invention; and

Figures 5a to 5d is a schematic diagram illustrating the steps involved in the detection of bacteria using a syringe-based device according to yet a further embodiment of the present invention.

The present invention provides a method and device for the detection of dead and live pathogens, such as bacteria on a swabbed surface in minimal time and without the need for complex equipment and specially trained staff. The basic concept involves the attachment of a pathogen recognition binding site, in particular, but not exclusively, for binding a recognition element, such as a protein in the outer cellular membrane of a bacteria, to a gold nanoparticle (GNP) which is then able to bind a broad spectrum or specific species of bacteria present at low concentrations on a surface. A S. aureus cell is ~ lμm in diameter whilst the functionalised GNPs used in the present invention are in the range 10-100 nm allowing 100-100Os of GNPs to be accommodated on the surface of a single cell. Furthermore, the sites being recognised by the functionalised GNPs are present in large amounts per cell (> 50,000 per cell) causing multiple functionalised GNPs to bind to a single bacterial cell to cause aggregation of the cells, bringing the GNPs into close proximity causing a visual colour change (red to blue for a an aqueous solution) indicating the presence of a pathogen in a short period of time. This system requires no prior separation of the recognition element from bacterial cell envelope to allow for binding of the recognition element with the functionalised GNP. The device and method of the present invention allows for rapid detection using methodology and instrumentation that can be used daily by, for example, cleaning and nursing staff through a one-step process that is economically viable.

Example 1: A syringe-based device containing a GNP-vancomycin construct.

The use of gold nanoparticles functionalised with a broad spectrum bacterial binding element was investigated. A functionalised GNP construct was prepared having the antibiotic vancomycin attached thereto. This binds to a broad spectrum of both Gram positive and Gram negative bacteria. Vancomycin binds the D-Alanine-D-Alanine dipeptide sequence found in the cell walls of almost all bacteria including S. aureus, C. difficle and E. coli.

Vancomycin attached to a variety of nanoparticles, including gold, has previously been reported. (A. J. KeIl et al. ACS Nano, 2008, 2, 1777; A. J. KeIl and B. Simard, ChemComm, 2007, 1227; W.-C-Huang et al. Nanomed,, 2007, 2, 777; J. Gao et al Adv Matter., 2006, 18, 3145; G.H. Gu et al. Nano Lett. 2003, 3, 1261).

In the present example, we used the method of Sundram and Griffiths (J. Org. Chem., 2005, 60, 1 102; U.N. Sundram et al, J. Am. Chem. Soc, 1996, 118, 13107) to prepare 6w(cystamine)-vancomycin from vancomycin in a one step process using standard peptide coupling chemistry. The 6/5(cystamine)-vancomycin was then immobilised onto gold nanoparticles via the formation of a gold-sulfur bond, as described by W.-C-Huang (vide supra). The chemistry to achieve this linkage is illustrated in Figure 1 of the accompanying drawings. Alternative linkage chemistry such as via maleimide functionalised GNPs is also possible. The functionalised gold nanoparticles 10 were then provided within a syringe 2 having an inlet 4, plunger 6, coarse filter 8, a micro filter 12 (0.2 μm) and outlet port 14, as shown in Figures 2b and 2c.

The syringe, loaded with functionalised gold nanoparticles, is used to detect for a broad spectrum of bacteria present at low concentrations on a surface. The surface to be tested was wiped with a sterile cotton wool bud over a defined area (for example, 1 Ocm x 10cm), as illustrated in Figure 2a. The cotton wool bud was then placed within the syringe via the inlet and a volume of water (< 2ml) was added. The plunger 6 was then pressed down to force the water containing the pathogen from the cotton wool bud through the coarse filter (»1 μm) into the second compartment containing the functionalised nanoparticles. The water and nanoparticles were left to mix for a specified period of time (2-3 minutes), so that any bacteria present could bind with the nanoparticles. The plunger 6 was then depressed further expelling the solution through a white 0.2 μm filter 12. If any bacteria were present in the solution, these were retained by means of the aggregated gold nanoparticles on the filter 12, visibly staining the filter (generally purple-blue colour). Unattached gold nanoparticles passed through the filter. The solution expelled from the syringe was sterile as all bacteria were trapped by the filter 12. The whole pathogen detector process took around 10 minutes to complete. The expelled solution is retained within a receptacle for safe disposal.

Whilst the aforementioned example uses vancomycin-conjugated nanoparticles, it is to be appreciated that alternative conjugated nanoparticles may be utilised in the syringe device to identify other pathogens. For example, lysostaphin-conjugated nanoparticles may be incorporated into the device to recognise the bacterial species S. aureus. Example 2: A lateral flow device containing a GNP-lysostaphin construct.

In ongoing studies, the inventor and his team have cloned, expressed and re- engineered lysostaphin and a number of closely related enzymes (LytM, Ale 1, Zoocin A) and also produced versions of the proteins in which the targeting domain recognising specific types of bacteria was fused either genetically to green fluorescent protein (GFP) or to synthetic small molecule fluorescent labels such as fluorescein. One of the constructs engineered includes the Lss targeting domain (Lss-TD) fused to GFP which was found to retain its ability to bind to S, aureus. Whilst the exact receptor of the Lss-TD is unknown, it has been estimated that -100,000 Lss-TD-GFP fusion proteins can bind a single S. aureus cell (diameter ~1 μm).

In view of the above, it was decided to engineer a GNP construct conjugated with the Cys-mutant of the Lss-TD. A 5nm gold nanoparticle is ~10 ³ smaller than a bacterium and thus multiple GNPs can bind to a single cell. Nanopaiticles less than lOOnm are considered suitable for use with the present invention. The modified version of the lysostaphin targeting domain protein has a cysteine residue (the only one in the protein) introduced close to the exposed C-terminal of the protein. The cysteine residue has a thiol (-SH) group that reacts with gold to form a stable covalent bond anchoring the Lss-TD to the GNP surface.

The amino acid sequence for the Lysotaphin Targeting Domain + Linker region is shown below (SEQ. ID No. 2). The sequence was cloned into the pET-21a vector with C- terminal His-tag and Leucine to Cysteine mutation:

Construct' s DNA sequence: atgcctttctgcaagagcgcaggatatggaaaagcaggtggtacagtaactccaacgccg aatacaggttggaaaacaaacaaa tatggcacactatataaatcagagtcagctagcttcacacctaatacagatataataaca agaacgactggtccatttagaagcatgc cgcagtcaggagtcttaaaagcaggtcaaacaattcattatgatgaagtgatgaaacaag acggtcatgtttgggtaggttatacag gtaacagtggccaacgtatttacttgcctgtaagaacatggaataaatctactaatactt taggtgttctttggggaactataaagctcg agcaccaccaccaccaccac

(SEQ ID No. 1) Lss-T (Cys) amino-acid sequence:

MPFCKSAGYGKAGGTVTPTPNTGWKT^KYGTL^^

MPQSGVI&AGQTTHYDEVM^

LWGTIKLEHHHHHH

(SEQ. ID NO. 2)

Leu -> Cys mutation is underlined.

Amino acids not found in the lysostaphin gene (artefact of cloning) shown in bold.

The process for preparing the GNP-lysostaphin construct (Lss-TD@Au nanoparticle) is illustrated in Figure 3 of the accompanying drawings. Alternative maleimide-cysteine linkage is also possible.

The gold nanoparticles having Lss-TDs attached thereto were then incorporated into a lateral flow device. Lateral flow devices are currently available on the market, for example, in the form of home pregnancy kits for testing for the presence of human chorionic gonadotrophin in the urine of pregnant women. The basic design is shown in Figures 4a to 4c of the accompanying drawings. The fluidic medium comprises a nitrocellulose membrane 20 attached to a suitable backing sheet 22, such as a flat sheet of glass, metal or plastics material. One end of the membrane has a sample pad 24 for receiving a fluid sample and the other end has a wicking pad 28 for drawing fluid along the membrane 20 A conjugate pad 30 is provided adjacent to the sample pad containing the gold nanoparticles functionalised with Lss-TD 40' (the "capture zone"). Two further parallel strips of material are provided towards the wicking end of the membrane. A first strip 32 comprises the detection zone and has Lss-TD sites 40 attached to the membrane and a second strip 34 has a lysostaphin construct 40" attached to the cell membrane which has its targeting domain altered or removed so that it will not bind to a bacterial cell membrane. This strip forms the control zone.

A surface to be tested was again sampled with a sterile cotton wool ball and this was placed in a syringe with water or an aqueous buffer for transferring the aqueous sample S to the pad 24 (see Figure 4a). Any bacteria present in the sample bind to the Lss- TD recognition sites on the gold nanoparticles 40' on the conjugate pad 30. These were then drawn along the membrane by means of capillary flow (denoted by A in Figure 4a) where they contact further Lss-TD sites 40 provided in the detection zone 32. This caused aggregation of the GNPs to produce a colour change in the strip 32 to provide a positive test result. This can be compared with the colour in the neighbouring control zone 34 which will not allow binding of bacteria conjugated to the functionalised GNPs.

The aforementioned example uses lysostaphin-conjugated nanoparticles in a lateral flow device but other conjugated particles could equally be used, such as vancomycin- conjugated particles.

It is to be appreciated that the majority of the lateral flow device may be encased in a suitable housing with only the sample pad extending therefrom to allow contact with the fluid sample. A suitable viewing window may be provided within the housing to view the detection and control zones. '

Additionally, the assay device according to the invention may include different types of conjugated particles, such as both lysostaphin-conjugated nanoparticles and vancomycin-conjugated particles. GNPs bearing more than one type of detection (binding) element on a single nanoparticle could also be used. These may provide multiple detection zones for the detection of different types of pathogen.

Other suitable recognition elements for bacteria and viruses attached to gold nanoparticles or similar include homologues of the lysostaphin targeting/cellwall domain, as detailed below:

1. ALE-I Cell wall binding domain: Sugai,M., Fujiwara,T., Akiyama,T., Ohara,M., Komatsuzawa,H., Inoue,S. and Suginaka,H. "Purification and molecular characterization of glycylglycine endopeptidase produced by Staphylococcus capitis EPKl". (J. Bacteriol. 179 (4), 1193-1202 (1997)).

2. Putative N-acetylmuramoyl L-alanine amidase from S. haemolyticus Takeuchi,F., Watanabe,S., Baba,T., Yuzawa,H., Ito,T., Morimoto,Y., Kuroda,M., Cui,L., Takahashi,M., Ankai,A., Baba,S., Fukui,S., Lee,J.C. and Hiramatsu,K. "Whole-genome sequencing of staphylococcus haemolyticus uncovers the extreme plasticity of its genome and the evolution of human-colonizing staphylococcal species". ( J. Bacteriol. 187 (21), 7292- 7308 (2005)).

3. Staphylococcus phage TWORT. Loessner,M.J., Gaeng,S., Wendlinger,G., Maier,S.K. and Scherer,S. "The two-component lysis system of Staphylococcus Aureus bacteriophage Twort: a large TTG-start holin and an associated amidase endolysin". (FEMS Microbiol. Lett. 162 (2), 265-274 (1998)).

4. . Bacteriophage phiWMY. Yokoi,K.J., Kawahigashi,N., Uchida,M., Sugahara,K., Shinohara,M., Kawasaki, K., Nakamura,S., Taketo,A. and Kodaira,K. "The two-component cell lysis genes hoi WM Y and lysWMY of the Staphylococcus warneri M phage varphiWMY: cloning, sequencing, expression, and mutational analysis in Escherichia coli". (Gene 351 , 97-108 (2005)). 5. Bacteriophage 85. Kwan,T., Liu,J., Dubow,M., Gros,P. and Pelletier,J. "The complete genomes and proteomes of 27 Staphylococcus aureus Bacteriophages". (Proc. Natl. Acad. Sci. U.S.A. 102 (14), 5174-5179 (2005)).

6. Bacteriophage phiMR25. Hoshiba,H., Uchiyama,J., Rashel,M, Maeda,Y., Takemura,I., Sugihara,Y., Muraoka,A. and Matsuzaki,S. "Characterization of two staphylococcal bacteriophage". Unpublished.

7. Autolysin/endolysin. Howden,B.P., Stinear,T., Johnson,P.D.R., Ward,P.B.

and Davies,J.K. "Genome Sequencing Identifies a Point Mutation in a Sensor Gene graS that Leads to Vancomycin-Intermediate Resistance in a Clinical Staphylococcus aureus Isolate". Unpublished (dbilBAG48165.1 |)

8. Amidase (phage phi 1 1). Iandolo,J.J., Worrell,V., Groicher,K.H., Qian,Y., Tian,R.Kenton,S., Dorman,A., Ji,H., Lin,S., Loh,P., Qi,S., Zhu,H. and Roe,B.A. "Comparative analysis of the genomes of the temperate bacteriophages phil 1, phi 12 and phi 13 of Staphylococcus aureus 8325". (Gene 289 (1 -2), 109-1 18 (2002)).

9. Streptococcus (group B streptococcus secreted protein/choline binding protein [Streptococcus agalactiae]) Reinscheid,D.J., Stosser,C, Ehlert,K., Jack,R.W., Moller,K. Eikmanns,B.J. and Chhatwal,G.S. "Influence of proteins Bsp and FemH on cell shape and peptidoglycan composition in group B streptococcus". (Microbiology (Reading, Engl.) 148 (PT 10), 3245-3254 (2002)).

10. autolysin [Streptococcus equi subsp. zooepidemicus MGCS 10565] Beres,S.B., Sesso,R., Pinto,S.W., Hoe,N.P., Porcella,S.F., Deleo,F.R. and Musser,J.M. "Genome sequence of a lancefield group C Streptococcus zooepidemicus strain causing epidemic nephritis: new information about an old Disease". (PLoS ONE 3 (8), E3026 (2008)). 1 1. endolysin [Enterococcus faecalis V583]. Paulsen,L, Banerjei,L., Myers, G. S. A., Nelson,K.E., Seshadri,R., Read,T.D., Fouts,D.E., Eisen,J.A., Gill.S.R., Heidelberg,J.F.,Tettelin,H., Dodson,R.J., Umayam,L., Brinkac,L., Beanan,M., Daugherty,S., DeBoy.R.T., Durkin,S., KolonayJ., Madupu,R., Nelson,W., VamathevanJ., Tran,B., Upton,J., Hansen,T., Shetty,J., Khouri,H., Utterback,T., Radune,D., Ketchum,K.A., Dougherty,B.A. and Fraser,C.M. "Role of Mobile DNA in the Evolution of Vancomycin-Resistant. Enterococcus faecalis". (Science 299 (5615), 2071-2074 (2003)).

12. putative choline binding protein [Streptococcus pyogenes Ml GAS]. REFERENCE 1 (residues 1 to 374). FerrettiJ.J., McShan,W.M., Adjic,D., Savic,D., Savic.G., Lyon,K., Primeaux,C, Sezate,S.S., Surorov,A.N., Kenton,S., Lai, H., Lin,S.,Qian,Y., Jia,H.G., Najar,F.Z., Ren,Q., Zhu,H., Song.L., White,!, Yuan,X., Clifton,S.W., Roe,B.A. and McLaughlin,R.E. "Complete genome sequence of an Ml strain of Streptococcus pyogenes". (Proc. Natl. Acad. Sci. U.S.A. 98 (8), 4658-4663 (2001)).

Also highly similar sequences found in the following phage: SAP-2, 44AHJD, Staphylococcus phage 66, X2, 37, 812, K, EW, Gl, 52A, MRl 1, 92, 55, 11, 29, 69, RF122, 80alpha, 88, mu50, 2638A, 85.

For E. CoIi, a recognition element comprising a 76-residue of colicin E9 (residues 343-418), or its homologues can be used. See Penfold CN, Garinot-Schneider C, Hemmings AM, Moore GR, Kleanthous C, James R., (MoI Microbiol. 2000 Nov;38(3):639-49).

The protein sequence of the colicin receptor binding protein is:

nqerqakavq vynsrkseld aanktladai aeikqfnrfa hdpmagghrm wqmaglkaqr aqtdvnnkqa afdaaake

(SEQ. ID No. 3) DNA sequence: ccggttgaagcggctgagcgaaattatgaacgcgcgcgtgcagagctgaatcaggcaaat gaagatgttgccagaaatca ggagcgacaggctaaagctgttcaggtttataattcgcgtaaaagcgaacttgatgca'g cgaataaaactcttgctgatgcatagct gaaataaaacaatttaatcgatttgcccatgacccaatggctggcggtcacagaatgtgg caaatggccgggcttaaagctcagcg ggcgcagacggatgtaaataataagcaggctgcatttgatgctgctgcaaaagagaagtc agatgctgatgctgcattaagtgccg cgcaggagcgccgcaaacagaaggaaaataaagaaaaggacgctaaggataaatta

(SEQ. ID No 4)

This would require a cysteine residue to be introduced to allow it to be attached to the gold nanoparticles

Other potential proteins would include lysozyme which had been inactivated but still had a high affinity for peptidoglycan.

The use of GNPs bound to a binding element that directly recognises and binds to a cell surface protein of a bacterium incorporated into a fluid flow device of the present invention allows for simple, effective and quick detection of bacteria on a surface. The syringe or lateral flow device can be provided cheaply as single-use disposable systems. A yes/no result is obtained in a relatively short period of time (5-20 mins) without any off site analysis being required. Furthermore, the sampling techniques used with the present invention do not leave any undesirable material on the surface being tested

The present invention detects the presence of live and dead bacteria and therefore it is proposed that a positive test result using the device and method of the present invention be followed up with a subsequent test for live bacteria, such as a procedure to detect sugar consumption in a liquid sample (S. Nath et al Anal Chem 2008, 80, 1033). This takes longer and is more expensive than the test according to the present invention and hence, it is desirable to use this test only upon a positive detection of pathogens in a test area.

Figures 5a to 5d of the accompanying drawings illustrate a further embodiment of a syringe-based device according to the present invention. A plunger 206 for a syringe 200 has a sterile cotton wool ball 201 attached to one end thereof and includes a sharp point 202 The cotton wool ball is wiped over a defined area S to be tested (for example, 10cm x lOcm), as illustrated in Figure 5a. The syringe plunger is then mounted in a syringe body 200 having an inlet 204, a coarse filter 208, a micro filter 212 (around 0.2μm) and an outlet port 214. The coarse filter is in the form of a movable solid disc requiring signfϊcant pressure to move it from position C to D, as shown in the figures. The upper chamber of the syringe body above the coarse filter contains a pouch 217 holding the functionalised gold or other nanoparticles, together with a suitable amount of a buffer solution or water. Movement of the plunger downwardly (as indicated by arrow B in Figures 5b and 5c) pierces the pouch by means of the sharp point 202, thereby releasing GNPs in solution. The GNPs and any bacteria in solution picked up by the cotton wool bud are able to pass through the coarse filter 208 into a lower chamber where they are left to mix for a short period of time (2-3 minutes), thereby enabling the bacteria to bind with the GNPs to form bacteria-GNP aggregate 220. The plunger 206 is depressed further (see Fig. 5d) to expel the solution and any unbound GNPs through the fine filter 212 and out of the outlet 214 where it is collected in a receptacle 230. The bateria-GNP aggregate is retained on the filter, visibly staining the filter.