PEPTIDE AND USE OF SAID CANCER VACCINE TECHNICAL FIELD OF THE INVENTION

The present invention relates to immunogenecity and peptide chemistry.

BACKGROUND OF THE INVENTION

Cancer is one of the life-threatening diseases and a major health problem worldwide. Ongoing intensive research has been done to determine the origin and cause of cancer, and to understand the transformation of normal cells into cancerous cells. Unfortunately, the resolution to these issues has not been completely uncovered. Oral cancer is a debilitating disease that is the 8th and 13th most common malignancy worldwide for males and females respectively, as stated in Gene Expression in Human Oral Squamous Cell Carcinoma is Influenced by Risk Factor Exposure (Cheong et a/., 2009). Although the epidemiology of oral cancer is well-established, the prognosis and survival rates for oral cancer patients have not improved significantly over the past three decades. Further, many methods of treatment, which have recently been attempted, are limited in efficacy, particularly in respect to one-third of the oral cancer patients that experience recurrent or secondary tumours. Thus, there is a need for treatments that work effectively in prognosis, diagnosis and prohibition of recurrent tumours.

Immunotherapy has been a big research area since it is known to people skilled in the art that the immune system plays an important role in the elimination of tumour cells. However, due to the complexity of mammalian immune systems in recognizing or reacting to foreign or alien material, the outcomes are not always positive. Nevertheless, these outcomes have led and directed the production of many different types of treatments. One of the treatments based mainly on immunotherapy is the use of therapeutic monoclonal antibodies, for example, cetuximab, panitumumab, and matuzumab. Their capabilities in modulating the immune system allow them to be considered as one of the more successful immunotherapies. Based on this, the therapeutic monoclonal antibody has been used in the treatment of head and neck cancers. However, the production of therapeutic monoclonal antibodies is highly expensive and the cost for producing the therapeutic monoclonal antibodies seems to be the main limitation in the commercial development and production of these therapeutic monoclonal antibodies. Furthermore, the efficacy of these therapeutic monoclonal antibodies for the treatment of head and neck are considered to be on the low side.

In one of the clinical trials titled Phase I Clinical Trial of Survivin-derived Peptide Vaccine Therapy for Patients with Advanced or Recurrent Oral Cancer, Mizayaki et al. have reported the result of a survivin-derived peptide vaccine, namely survivin-2B80-88, in patients with advanced or recurrent oral cancer. Mizayaki et al. have also mentioned in the clinical trial that 'survivin' is a recently characterized member of the inhibitor of apoptosis family that is abundantly expressed in most malignancies but nearly undetectable in normal adult tissues. However, the results obtained in the clinical trial were negative as despite an increase of peptide-specific cytotoxic T lymphocyte, only one out of ten patients showed tumour regression.

In a separate clinical trial titled Effect of Dendritic Cell Vaccine Against a Tongue Squamous Cell Cancer Cell Line (Tca8113) in vivo and in vitro, Wang et al. have demonstrated the ability of the dendritic cells in killing Tca81 13 cells and inhibiting growth of tumour in mice upon the sensitization of the dendritic cells using cell lysates from Tca81 13. However, the generation of autologous tumour lysates is not always possible in the clinical settings. Further, the dendritic cell vaccines are very expensive to generate, as they require special facilities for their expansions. The treatment using dendritic cells is also expensive, as the cells need to be re-infused into patients. In another clinical trial titled Genetically Engineered Tumor Cell Vaccine in a Head and Neck Cancer Model, Couch et al. have demonstrated the vaccination of mice using irradiated cells expressing granulocyte-macrophage colony-stimulating factor (G -CSF) as the vaccine. The result of the vaccination showed that the vaccinated mice were protected from subsequent tumour challenge when compared to the control groups. Even with the positive results disclosed, the granulocyte-macrophage colony-stimulating factor (GM-CSF) may not be the ideal target for oral cancer, and the generation of cancer cells with high levels of a specific protein to be used as the vaccine may require the use of viral methods that may not be easily approved by the Food and Drug Administration (FDA).

To date, many patent documents can be found describing the use of immunotherapy in treating different types of cancers. These patent documents may have disclosed the method of treating, inhibiting or preventing the recurrence of cancer that involve the concept of immunotherapy, but the work that has been done in most of the patent documents are expressed specifically on a particular cancer. Therefore, the disclosed methods may not necessarily work in treating or inhibiting oral cancer, or preventing the recurrence of oral cancer.

Other than the methods involving immunotherapy, some of the methods being used as a single modality treatment or in combination for the treatment of oral cancer include surgery, radiotherapy and chemotherapy. However, for oral cancer patients, surgery is associated with high morbidity in particular, because the mouth is a vital organ, and surgical intervention will severely affect the quality of life. Further, extensive surgery to ensure that the surgical margins are clear is sometimes not possible as the mouth is located close to critical blood vessels and anatomical structures. In addition, typical oral cancer patients are those over 60 years of age and often have co-morbidity factors and may not be amenable to surgery. The use of radiotherapies and chemotherapies are far more limited than surgery due to the radiation toxicity in normal cells that lay close to the target tumor volume. Further, the radiotherapy and chemotherapy treatments cause side effects, which the nature, severity, and longevity of the side effects depends on the organs that receive the radiation, the type of radiation, dose, fractionation and concurrent chemotherapy, and the patient.

Based on what have been mentioned above, an alternative treatment strategy is crucial to prolong the life of the oral cancer patients. Therefore, it is an aim of this present invention to address the aforesaid technical disadvantages by introducing a peptide, a cancer vaccine derived from said peptide and a use of the cancer vaccine, which is capable of inducing the immune system of a subject to recognize oral cancer cells as being foreign wherein said subject is an oral cancer patient.

SUMMARY OF THE PRESENT INVENTION

The present invention relates to a peptide comprising at least an amino acid sequence selected from at least a portion of Melanoma antigen family D4b (MAGE-D4b) protein, wherein said peptide being capable of binding with at least a human leukocyte antigen (HLA) molecule. The amino acid sequence mentioned herein is selected from any one or a combination of SEQ ID NO. 1 to SEQ ID NO. 12 of said MAGE-D4b protein as listed in Table 1. In accordance with the present invention, the structure of the peptide sequences may be modified or changed, and the modification or change herein includes, but not limited to substitution, deletion or insertion. For substitution, at least one amino acid in said peptide is being substituted by another amino acid. For deletion, at least one amino acid in said peptide is being deleted. For insertion, said peptide is being inserted with at least one amino acid. Preferably, the additional amino acid is inserted at the C-terminus or the N- terminus. Upon binding with the human leukocyte antigen (HLA) molecule, said peptide is capable of inducing the immune system of a subject to recognize oral cancer cells as being foreign. The subject herein refers to an oral cancer patient. The peptide, as set forth in the present invention, is used to produce a cancer vaccine, wherein said cancer vaccine is capable of inducing the immune system of the subject to recognize oral cancer cells as being foreign.

Further, a cancer vaccine comprising at least one peptide as claimed in the present invention is disclosed. Due to the unique binding specificity between a human leukocyte antigen (HLA) and a peptide, the cancer vaccine is developed specifically using the peptide of the present invention, and the cancer vaccine is formulated for a subject whose antigen is able to bind to any one or a combination of human leukocyte antigen A2 (HLA-A2), human leukocyte antigen A1 1 (HLA-A1 1 ) and human leukocyte antigen A24 (HLA- A24). Moreover, the cancer vaccine further comprises an adjuvant that enhances the effectiveness of the cancer vaccine. The adjuvant preferably used herein is an immunomodulatory cytokine, and the immunomodulatory cytokine preferably used herein is a granulocyte-macrophage colony- stimulating factor (GM-CSF). The use of the cancer vaccine is also disclosed in the present invention, which the use of the cancer vaccine is capable of inducing the immune system of the subject to recognize oral cancer cells as being foreign. It is an object of the present invention to provide a peptide that comprises at least an amino acid sequence selected from any one or a combination of SEQ ID NO. 1 to SEQ ID NO. 12 of said MAGE-D4b protein as listed in Table 1 .

It is a further object of the present invention to provide a peptide that is capable of binding with at least a human leukocyte antigen (HLA) molecule.

It is a further object of the present invention to provide a peptide, which the binding with a human leukocyte antigen (HLA) molecule is capable of inducing the immune system of a subject to recognize oral cancer cells as being foreign.

It is a further object of the present invention to provide a use of the peptide to produce a cancer vaccine. It is a further object of the present invention to provide a cancer vaccine that is capable of inducing the immune system of a subject to recognize oral cancer cells as being foreign.

It is a further object of the present invention to provide a cancer vaccine that is formulated for the subject whose human leukocyte antigen (HLA) is any one or a combination of HLA-A02, HLA-A11 and HLA-A24. It is a further object of the present invention to provide a use of the cancer vaccine that is capable of inducing the immune system of a subject to recognize oral cancer cells as being foreign.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 illustrates the qPCR data, showing the over-expression of MAGE- D4b mRNA level that is significantly higher in oral squamous cell carcinoma (OSCC) as compared to normal tissues.

Figure 2 illustrates the expression of AGE-D4b in human tissues cDNA panel: 1) liver; 2) skeletal muscle; 3) kidney; 4) pancreas; 5) spleen; 6) thymus; 7) prostate; 8) testis; 9) ovary; 10) small intestine; 11) colon; 12) peripheral leukocytes; 13) 204T oral cancer cell line; 14) A549 lung cancer cell line. Figure 3 illustrates the binding ability of different peptides towards major histocompatibility complex ( HC) A2 molecules.

Figure 4 illustrates the dimer assay of the affinity of different peptides in attracting and binding with the CD8 ⁺ cytotoxic T cells.

Figure 5 illustrates the enzyme-linked immunosorbent spot (ELISPOT) assay: (a) The cytotoxic activities of the CD8 ⁺ cytotoxic T cells in secreting granzyme when exposed to the MAGE-D4b-HLA complex, (b) The cytotoxic activities of the CD8 ⁺ cytotoxic T cells in secreting IFN-g when exposed to the MAGE- D4b-HLA complex.

Figure 6 illustrates the over-expression of MAGE-D4b in oral squamous cell carcinoma (OSCC): (a) The distribution of the intensity of immunohistochemistry (IHC) staining in oral squamous cell carcinoma (OSCC) and normal oral mucosa that demonstrates the high levels of MAGE- D4b in oral squamous cell carcinoma (OSCC) and low levels of MAGE-D4b in normal oral mucosa, (b) The immunohistochemistry (IHC) staining of oral squamous cell carcinomas (OSCC) (I, II, III) that demonstrates the 3+ (I), 2+ (II), 1 + (III) intensity or lack of expression in normal oral mucosa (IV). (c) The Kaplan Meier curve indicating that MAGE-D4b expression is associated with disease-free survival. Figure 7 illustrates the over-expression of MAGE-D4b in promoting cellular growth: (a) qPCR data demonstrating high levels of MAGE-D4b in transduced cells, (b) Growth curves of ORL-48/MAGE-D4b and ORL-150/MAGE-D4b, and their respective controls (* = p < 0.05, ** = p < 0.001 , *** = p < 0.0001 ). (c) Tumour volume in mice injected with ORL-48/MAGE-D4b and ORL-48/pLenti (* = p < 0.05, ** = ? < 0.001 , *** = p < 0.0001 ). (d) Images depicting larger tumour in mice injected with ORL-48/MAGE-D4b compared to ORL-48/pLenti. (e) qPCR data comparing levels of cell cycle markers between ORL- 48/MAGE-D4b and ORL-150/MAGE-D4b, and their respective controls, (f) The immunohistochemistry of Ki67 in tumour formed in mice after injected with ORL-48/MAGED4B and ORL-48/pLenti. (g) The Ki67 staining in ORL- 48/MAGED4B-tumours and ORL-48/pLenti-tumours formed in mice.

Figure 8 illustrates the over-expression of MAGE-D4b in promoting evasion of apoptosis. (a) The kill curve of ORL-48/MAGE-D4b and ORL-195/MAGE-D4b compared to their respective controls, (b) The cell cycle analysis of ORL- 48/MAGE-D4b in comparison to the vector control cells, (c) The apoptotic index of ORL-48/MAGE-D4b in comparison to the vector control cells. Figure 9 illustrates the over-expression of MAGE-D4b in promoting cell migration but not invasion: (a) Wound closure images of ORL-48/MAGE-D4b and ORL-150/ AGE-D4b, and their respective control at 0 and 20 hour after the mitomycin C treatment, and a histogram indicating an increased of wound closure in ORL-48/MAGE-D4b and ORL-150/MAGE-D4b in comparison to their respective vector controls, (b) Wound closure images of ORL-48/MAGE- D4b and ORL-150/MAGE-D4b, and their respective control with and without MAGE-D4b siRNA knock-down, and a histogram showing reduced wound closure in cells with MAGE-D4b knocked-down. (c) Images of the organotypic 3D culture of ORL-48/MAGE-D4b and ORL-48/pLenti. (d) Invasion index for ORL-48/MAGE-D4b and ORL-48/pLenti. (e) Western blots of MAGE-D4b, Pan Rho + RAC (7, 2, 3) + CDC42 and ROCK1 in ORL-48/MAGE-D4b and ORL- 48/pLenti cells, (f) The immunohistochemistry (IHC) of MAGE-D4b and Pan Rho + RAC (1, 2, 3) + CDC42 in tumours formed in mice after injected with ORL-48/MAGE-D4b and ORL-48/pLenti.

DETAILED DESCRIPTION OF THE PRESENT INVENTION

The above mentioned and other features and objects of this invention will become more apparent and better understood by reference to the following detailed description. It should be understood that the detailed description made known below is not intended to be exhaustive nor limit the invention to the precise form disclosed as the invention may assume various alternative forms. On the contrary, the detailed description covers all the relevant modifications and alterations made to the present invention, unless the claims expressly state otherwise.

Immunotherapy has been used for the treatment of cancer by training the patient's self-immune system to recognize and eradicate the cancer cells. One of the molecules that is playing an essential role in the human immune system is the major histocompatibility complex (MHC) molecule, which the molecule determines the outcomes of many host immune responses. Generally, there are two types of major histocompatibility complex (MHC) molecules. The major histocompatibility complex (MHC) Class I molecules are presented on most nucleated cells whereby the major histocompatibility complex (MHC) Class II molecules are presented on professional antigen presenting cells (APC). The complexes formed between the major histocompatibility complex (MHC) Class I molecules and peptides are recognized by the CD8 ⁺ cytotoxic T cells and subsequently triggers a response from the CD8 ⁺ cytotoxic T cells. As for the complexes formed between the major histocompatibility complex (MHC) Class II molecules and peptides are recognized by CD4 ⁺ cytotoxic T cells. However, major histocompatibility complex (MHC) molecules are extremely polymorphic. The polymorphism of these major histocompatibility complex (MHC) molecules has consequently constituted challenges to T cell epitope discovery, since each of the major histocompatibility complex (MHC) molecules has unique binding specificity. In view of the huge number of human major histocompatibility complex (MHC) molecules, also known as human leukocyte antigen (HLA) molecules, the possibility of binding the human leukocyte antigen (HLA) molecules and peptides successfully is even lower.

One of the criteria used to identify the peptides that could be used for therapeutics is to determine whether the antigen is over-expressed in the oral cancer cells. In the present invention, molecular profiling of oral cancer revealed that Melanoma antigen family D4b (MAGE-D4b) is over expressed in oral squamous cell carcinoma (OSCC), in comparison to normal mucosa tissues, as disclosed in the inventors' work titled Gene Expression in Human Oral Squamous Cell Carcinoma is Influenced by Risk Factor Exposure (Cheong et al. 2009). Further studies have been done to further validate the over-expressions of MAGE-D4b in oral squamous cell carcinoma (OSCC) tissues at the m NA and protein levels. The results of these studies are shown in Figure 1 , Figure 6(a) and Figure 6(b). In Figure 1 , the quantitative real-time polymerase chain reaction data shows the range of MAGE-D4b expressions in oral squamous cell carcinoma (OSCC) tissues that is significantly higher as compared to normal tissues. As in Figure 6(b), the immunohistochemistry pictures of MAGE-D4b staining are illustrated. Further analysis has been done in order to determine whether the MAGE-D4b can be potentially developed as therapeutic target with negligible vital-organ related toxicity. The analysis employs polymerase chain reaction (PCR) on the complementary DNA (cDNA) panel of human tissues and the results of the analysis, as illustrated in Figure 2, have showed that MAGE-D4b was expressed at very low levels in majority of the normal tissues tested, except for ovary, thymus, and colon.

Based on the theory that the expression of MAGE-D4b can be regulated by the DNA methylation and demethylation processes, the inventors of the present invention have further analysed the oral squamous cell carcinoma (OSCC) cell lines by treating the oral squamous cell carcinoma (OSCC) cell lines with the demethylating agent of 5 Aza-deoxycitidine. The inventors have observed re-expressions of MAGE-D4b in oral squamous cell carcinoma (OSCC) cell lines after being treated with the demethylating agent. The observations clearly state that the expression of MAGE-D4b is due to loss of DNA methylation during tumour progression. As a result, the MAGE family proteins tend to be expressed in tumours rather than normal tissues.

According to the above results and observations made, which have illustrated that this protein is expressed in more than 50% of oral cancers but is expressed in very low levels of normal tissues, targeting the MAGE-D4b is deemed as an ideal way to treat oral cancer. Therefore, the present invention discloses a peptide comprising at least an amino acid sequence selected from at least a portion of MAGE-D4b protein, wherein said peptide is capable of binding with at least a human leukocyte antigen (HLA) molecule. Also disclosed in the present invention is the binding of said peptide with the human leukocyte antigen (HLA) molecule that is capable of inducing the immune system of a subject to recognize oral cancer cells as being foreign. As has been disclosed earlier, the binding between a human leukocyte antigen (HLA) and a peptide is distinctive. In order to induce the immune system of a subject to recognize the oral cancer cells as being foreign, the subject must possess the specific human leukocyte antigen (HLA) to accept and bind specifically with the peptide. The subject mentioned herein can be any mammal but preferably a human. More preferably, the human is an oral cancer patient with tumours having the expression of MAGE-D4b. The expression of MAGE-D4b may be determined by immunohistochemistry staining, quantitative polymerase chain reaction (PCR) or any other methods that could indicate whether the expression of MAGE-D4b is present and/or elevated in tumour tissue in comparison to normal tissues.

If MAGE-D4b is overexpressed in the subject, the subject will be considered as partially qualified for the treatment and the subject will be required to undergo further test to determine whether the subject possesses major histocompatibility antigen blood-typed as human leukocyte antigen A2 (HLA- A2), human leukocyte antigen A1 1 (HLA-A1 1 ) or human leukocyte antigen A24 (HLA-A24). This HLA-typing is performed using methods that are known to the person skilled in the art, for instant, polymerase chain reaction (PCR), Luminex, or fluorescence activated cell sorting analysis (FACS). Once the type of human leukocyte antigen (HLA) possessed by the subject is determined, the peptides corresponding to the same human leukocyte antigens HLA-type will be used. On the other hand, if the subject does not possess any one of the human leukocyte antigens (HLA) A2, A1 1 or A24, Class II peptides will be administered. Since the present invention involves HLA-specific peptides, the tests ensure that the subjects possess these genotypes that match to the HLA-specific peptides before employing any treatments disclosed in the present invention.

The amino acid sequence mentioned herein is selected from any one or a combination of SEQ ID NO. 1 to SEQ ID NO. 12 of said MAGE-D4b protein, as tabulated in Table 1 below:

SEQ ID NO. Peptide Sequences Specificity to HLA-type

1 EYDEHFPEI HLA-A24

2 SLGPGLRIL HLA-A2 3 LLQERANKL HLA-A2

4 CLPPRNVTL HLA-A2

5 ILSNEPWEL HLA-A2

6 RLSLLLVIL HLA-A2

7 AVLWEALRKM HLA-A11 & -A2

8 PFLGDLRKLI HLA-A24

9 LTSFDIHILR HLA-A2

10 RLSLLLVILGVIFMNGNRASEA Class II

11 IHILRAFGSLGPGLRILSNEPWELENP Class II

12 YEEFGAFGGYGTLTSFDIHILRAF Class II

Table 1 Peptide Sequences

In accordance with the present invention, the peptides may be prepared synthetically or isolated naturally from natural sources, such as native tumours or pathogenic organisms. Synthetic preparations may include recombinant DNA technology or chemical synthesis.

Further to the sequences tabulated above, modifications and changes may be made to the structure of these peptide sequences, which the modifications or changes mentioned herein refers to the change or modification of at least one amino acid in these peptide sequences. The change of amino acids include, but not limited to substitution, deletion or insertion. For substitution, at least one of the amino acid in any one of the peptide sequences in Table 1 may be replaced by another amino acid with similar chemical properties. For insertion, at least one additional amino acid may be inserted in any part of the peptide sequence selected from Table 1. More preferably, the additional amino acid is inserted at the N-terminus or the C-terminus of the peptide sequence. For deletion, any one of the amino acid in a peptide sequence selected from Table 1 may be removed. The amino acid is selected in a way that it will not deteriorate the immuno properties of the peptide, which the immuno properties of the peptide include the binding affinity between the human leukocyte antigen (HLA) molecule and the peptide, and the capability of inducing the immune system of the subject to recognize oral cancer cells as being foreign. However, the modified or changed peptide sequence may enhance the properties of the peptides, for instant, the peptide stability in an expression system or the stability of protein-protein binding such as HLA- peptide binding. The Table 2 below is used as a reference to the peptide sequences tabulated in Table 1.

Amino acids Codons

Alanine Ala A GCA GCC GCG GCU

Arginine Arg R AGA AGG CGA CGC CGG CGU

Asparagine Asn N AAC AAU

Aspartic acid Asp D GAC GAU

Cysteine Cys C UGC UGU

Glutamic acid Glu E GAA GAG

Glutamine Gin Q CAA CAG

Glycine Gly G GGA GGC GGG GGU

Histidine His H CAC CAU

Isoleucine He I AUA AUC AUU

Leucine Leu L UUA UUG CUA cue CUG CUU

Lysine Lys K AAA AAG

Methionine Met M AUG

Phenylalanine Phe F UUC UUU

Proline Pro P CCA CCC CCG ecu

Serine Ser S AGC AGU UCA UCC UCG UCU

Threonine Thr T ACA ACC ACG ACU

Tryptophan Trp w UGG

Tyrosine Tyr Y UAC UAU

Valine Val V GUA GUC GUG GUU

Table 2 Amino acids and their abbreviations

According to the present invention, the peptides may be used to manufacture a cancer vaccine, which the cancer vaccine is capable of inducing the immune system of the subject to recognize oral cancer cells. The peptide in the cancer vaccine comprises at least an amino acid sequence selected from at least a portion of MAGE-D4b protein wherein said amino acid sequence is selected from any one or a combination of SEQ ID NO. 1 to SEQ ID NO. 12 tabulated in Table 1. In accordance with the present invention, the cancer vaccine may be preventative or therapeutic. Due to the unique binding specificity in between a human leukocyte antigen (HLA) and a peptide, the cancer vaccine is developed specifically using the peptide of the present invention, so that the peptide can bind to the human leukocyte antigen (HLA) molecule successfully and subsequently triggers a response from the CD8 ⁺ cytotoxic T cells to eradicate oral cancer cells. Based on this reason, said cancer vaccine is formulated according to the type of antigen possessed by a particular subject. If the subject possesses any one or a combination of the human leukocyte antigens (HLA) A2, A1 1 or A24, said cancer vaccine may be formulated based on the amino acid sequences of SEQ ID NO. 1 to SEQ ID NO. 12, as listed in Table 1. On the other hand, if the subject does not possess any one or a combination of the human leukocyte antigens (HLA) A2, A11 or A24, the cancer vaccine may be formulated based on the amino acid sequences of SEQ ID NO. 10 to SEQ ID NO. 12 as listed in Table 1.

There are numerous embodiments of the cancer vaccine in accordance with the present invention. As mentioned earlier, the amino acids in the SEQ ID NO. 1 to SEQ ID NO. 12 can be changed or modified by non-limiting examples of substitution, insertion and deletion. Therefore, numerous cancer vaccine can be produced from these modified peptide sequences. It is believed that the changes or modifications made herein do not depreciate the immuno properties of the cancer vaccine in a way that these cancer vaccines may produce the equivalent or increased T cell stimulatory properties. The cancer vaccine of the present invention is developed based on the manner of administration of the cancer vaccine into the subject, which the manners of application includes non-limiting examples of oral application on a solid physiologically acceptable base or a physiologically acceptable dispersion, parenteral application, aerosol application, or the like. One of the examples for parenteral application is injection, which includes intradermal, intravenous, intramuscular, intracutaneous, subcutaneous, intrathecal, intraduodenal, intraperitoneally and the like. In the formulations of oral applications, excipient is normally employed, which the excipient employed herein is pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These oral formulations take the form solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders. As for aerosol applications, the cancer vaccine is preferably supplied in finely divided form along with a surfactant and a propellant, which the surfactant must be nontoxic, and preferably soluble in such propellant. Non-limiting examples of the surfactant are the esters or partial esters of fatty acids containing from 6 to 22 carbon atoms such as caproic, octanoic, lauric, palmitic, stearic, linoleic, linolenic, olesteric, and oleic acids with an aliphatic polyhydric alcohol or its cyclic anhydride. Mixed esters such as mixed or natural glycerides may also be employed. However, the cancer vaccine of the present invention is preferably administered to the subject via injection. The cancer vaccine may be formulated as freeze-dried or liquid preparations according to any means suitable in the art. The freeze-drying of the cancer vaccine may enhance the shelf life and may ease storage as freeze-drying removes the water and seals the cancer vaccine in a vial. Prior to the administration, the cancer vaccine is reconstituted into its original form ready to be injected to the subject. Liquid form preparations include but are not limited to solutions, suspension, syrups, slurries, and emulsions. The cancer vaccine may also be mixed with suitable liquid carrier or excipients that are pharmaceutically acceptable and compatible to the active ingredients in the cancer vaccine. The suitable liquid carrier or excipient may be organic or inorganic solvents. The examples of the inorganic solvents may include water, alcohol, saline solution, buffered saline solution, physiological saline solution, dextrose solution, water propylene glycol solutions, and the like, preferably in sterile form. Preferably, the cancer vaccine of the present invention is formulated as liquid solution.

The cancer vaccine may also be formulated in neutral or salt forms. The pharmaceutically acceptable salts include acid addition salts formed with inorganic or organic acids. The examples of the inorganic acids used herein may comprise hydrochloric acids, phosphoric acids and the like. The examples of the organic acids used herein may comprise acetic, oxalic, tartaric, mandelic acids and the like. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides. The salts formed with the free carboxyl groups may also be derived from organic bases such as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

Moreover, the cancer vaccine may be produced in sustained release formulation or depot preparation. Such formulation may be a capsule, sponge or gel that is composed of polysaccharides, for example. Such formulation can be prepared using any means suitable in the art. The cancer vaccine may be administered into a subject via inoculation, implantation, oral or rectal application. The implantation in this regard may be subcutaneously, intramuscularly or particularly at a desired target site. Such cancer vaccine formulation, comprising the peptide of the present invention, may be dispersed in a carrier matrix and/or contained within a reservoir surrounded by a rate-controlling membrane, which upon administration, effects a slow release of the cancer vaccine in the subject. Carriers or membrane being used herein are preferably biocompatible or biodegradable. Non-limiting examples of the carriers or membrane may include microparticles of poly(lactide-co-glycolide), polyacrylate, latex, starch, cellulose and dextran.

Furthermore, the cancer vaccine may be formulated to include a certain amount of auxiliary substances to enhance the effectiveness of the cancer vaccine, for instant, the immune response induced by the peptide may be enhanced, and/or the peptide may be stabilized. Further, the auxiliary substance may also reduce the frequency of administration necessary to generate a protective immune response. The auxiliary substances may include any one of wetting or emulsifying agents, pH buffering agents, adjuvants or the like. Preferably, the auxiliary substance used in the present invention is an adjuvant. Non-limiting examples of adjuvant are emulsifiers, muramyl dipeptides, pyridine, aqueous adjuvants such as aluminium hydroxide, chitosan-based adjuvants and any of the various saponins, oils and other substances known in the art.

Also acting as an adjuvant, the immunomodulatory cytokines is preferably used in the present invention. Other non-limiting examples of immunomodulatory cytokine that may also be used include interferons, imiquimods, granulocyte-macrophage colony-stimulating factor (GM-CSF) and the like. Preferably, the immunomodulatory cytokine being used in the present invention is granulocyte-macrophage colony-stimulating factor (GM-CSF). The cancer vaccine further comprising the adjuvant, as described herein, may be prepared using techniques that are known in the art, which includes, but not limited to mixing, sonication and microfluidation.

In some aspect of the present invention, the cancer vaccine may be formulated based on a mixture or a combination of peptide sequences that has been disclosed in the present invention as tabulated in Table 1. As previously mentioned, the peptide sequences may be changed or modified by non-limiting means of substitution, insertion or deletion. Therefore, numerous cancer vaccine may be formulated from these modified peptide sequences. Further, these peptide sequences may be used as a mix or in combination with the peptides disclosed in the present invention or other potential peptides that have already been discovered or to be discovered. The potential peptides mentioned herein may relate to MAGE-D4b or other proteins. However, It is believed that the mixtures or combinations made herein do not depreciate the immuno properties of the cancer vaccine in a way that these cancer vaccines may produce the equivalent or increased T cell stimulatory properties. The cancer vaccine is administered to a subject in a dosage formulation that is able to induce the immune system of the subject to recognize oral cancer cells as being foreign. The effective quantity of the cancer vaccine to be administered into a subject depend on various factors, for instant, the capacity of the subject's immune system to synthesize antibodies, the route of administration and the degree of protection desired. Other physical factors of the subject include the species, breed, size, height, weight, age and overall health condition of the subject.

The cancer vaccine can be administered to a subject based on any schedule, provided that the administration of the cancer vaccine is capable of inducing the immune system of the subject to recognize oral cancer cells as being foreign, or sustaining protective immunity against oral cancer relapse. The schedule of the administration together with the dosage formulation may be tailored according to the above-mentioned factors of the subject and also to meet the particular needs of the subject. Preferably, the precise amount of the cancer vaccine and the adjuvant to be administered, and the schedule of administration depend on the judgement of the practitioner. In the present invention, one or more boosters may be followed upon the administration of the cancer vaccine to bolster and/or maintain the protective immunity. The boosters may also be administered on an as-needed basis.

In further aspects of the present invention, the dosage of the cancer vaccine to be administered may be lower at the beginning of the administration process and a higher dosage over the administration process. On the other hand, the dosage of the cancer vaccine may be higher at the beginning of the administration process and a lower dosage over the administration process. In another aspect of the present invention, the administration schedule may include higher frequency of administration at the beginning of the administration process and a lower frequency of administration over the administration process to maintain the protective immunity. Theoretically, upon administration of the cancer vaccine to a subject, the peptides of the cancer vaccine approach the antigen presenting cells and these peptides are subsequently taken-up, digested and exhibited on the human leukocyte antigen (HLA) molecules, which are present on the cell surfaces of the antigen presenting cells. The human leukocyte antigen (HLA) Class I molecules bound with the MAGE-D4b peptides are then presented to the CD8 ⁺ cytotoxic T cells which would subsequently be activated to recognize the MAGE-D4b peptides. The activated CD8 ⁺ cells then survey the body and search for cells that have MAGE-D4b expressions. In this case, only oral cancer cells, which express MAGE-D4b, will have these peptides bound to the human leukocyte antigen (HLA) molecules on the cell surface. Hence, these cells will be targeted and destroyed by the CD8 ⁺ cytotoxic T cells. As for human leukocyte antigen (HLA) Class II molecules bound with the MAGE-D4b peptides, they would be presented to CD4 ⁺ cytotoxic T cells and these cells will be activated to secrete cytokines to further activate CD8 ⁺ cytotoxic T cells. In the present invention, experiments have been done to illustrate the binding between the AGE-D4b peptides and human leukocyte antigen (HLA) Class I molecules. Further experiments have also been done to illustrate the ability of the MAGE-D4b over-expressing oral cancer cells in triggering a response of the CD8 ⁺ cytotoxic T cells in particular subjects.

Figure 3 has illustrated the binding affinity of seven different peptides derived from MAGE-D4b towards the human leukocyte antigen (HLA) molecules. It is clearly stated in Figure 3 that all of the seven peptides have higher binding affinity towards the human leukocyte antigen (HLA) molecules as compared to the negative control. These results therefore clarify that these peptides are able to bind with human leukocyte antigen (HLA) molecules.

In Figure 4, the levels above the negative control of each of the patients tabulated in the dimer assay have illustrated that MAGE-D4b specific CD8 ⁺ cytotoxic T cells were detected directly in the peripheral blood mononuclear cells (PBMC) of multiple patients. This result has therefore clarified the ability of the MAGE-D4b-HLA complex to attract and bind with the CD8 ⁺ cytotoxic T cells.

In Figure 5(a) and 5(b), the enzyme-linked immunosorbent spot (ELISPOT) assays have demonstrated the cytotoxic activities of the CD8 ⁺ cytotoxic T cells when exposed to MAGE-D4b over-expressing oral cancer cells. The exposure of these MAGE-D4b over-expressing oral cancer cells to the CD8 ⁺ cytotoxic T cells has caused the CD8 ⁺ cytotoxic T cells to secrete granzyme and IFN-g. The secretions of granzyme and IFN-g are indicated by horizontal lines in enzyme-linked immunosorbent spot (ELISPOT) assays in Figure 5(a) and Figure 5(b) respectively. The elicitation showed in the results have therefore clarified that CD8 ⁺ cytotoxic T cells are able to eradicate oral cancer cells. However, exception has been made to peptide 3 and 6 as they have only induced lytic activity, which is the secretion of granzyme, and peptide 5 have only induced inflammatory activity, which is the secretion of IFN-g.

The following examples are included to further illustrate the preferred embodiments of the invention. It should be appreciated by those of skilled in the art that the techniques disclosed in the examples, which follow represent techniques discovered by the inventor to function well in the practice of the invention, thus can be considered to constitute preferred modes for its practice. However, those of skilled in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the scope of the invention.

EXAMPLE 1

Materials and Methods

Tumour tissues and cell lines

Forty-four tumour tissues and ten normal oral mucosa tissues in excess of diagnosis were obtained from Hospital Kuala Lumpur, University Malaya Medical Centre and Hospital Tengku Ampuan Rahimah with informed consent from patients. These tissues were used for the analysis of MAGE-D4b expression at the mRNA level. Human oral carcinoma cell lines, ORL-48, ORL-150 and ORL-195 were derived from primary explant cultures as described previously in Establishment and Characterization of Asian Oral Cancer Cell Lines as in vitro Models to Study a Disease Prevalent in Asia (Hamid et a/., 2007). All cell lines were maintained in DMEM-F12 (Lonza, USA) supplemented with 10% FBS. The 293FT cell line (Invitrogen, USA) used for the production of lentiviral stock was cultured in DMEM high glucose {Lonza, USA) supplemented with 10% FBS and 500 μ9/ιηΙ of Geneticin® (Invitrogen, USA). Human foetal foreskin fibroblast 1 (HFFF1 ) used as feeder cells in organotypic co-cultures were cultured in DMEM supplemented with 10% FBS (Lonza, USA). This study was approved by the University Malaya ethical review board (Ethical Approval Code: DF OP 03/06/0018/(L)).

RNA Extraction and cDNA synthesis

All samples were processed for RNA extraction as described previously in Gene Expression in Human Oral Squamous Cell Carcinoma is Influenced by Risk Factor Exposure (Cheong et al. , 2009). Total RNA was extracted from fresh frozen tissues and cell lines using the RNeasy® Micro kit (Qiagen, Germany) and Tri-Reagent (MRC, Ohio) respectively according to the manufacturer's instruction. The quality and quantity of RNA were evaluated using the Nanodrop spectrophotometer and Agilent 2100 bioanalyzer (Agilent Technologies, USA). RNA with 260/280 ratio of 1.8-2.1 or RNA integrity number of 6 and above were used to synthesize cDNA, as described in the work done by Cheong et al. , 2009.

Quantitative PCR (qPCR)

qPCR was performed with standard SYBR Green protocol using the ABI PRISM® 7000 Sequence Detection System (Applied Biosystems, Germany) as described in the work done by Cheong et al., 2009. The primers used are as follows:

MAGE-D4b: sense 5' CCAGAATCAGAACCGAGA 3' and antisense 5' CCAAAATCTCCGTCCTCA 3';

GAPDH: sense 5' GAAGGTGAAGGTCGGAGTC 3' and

antisense 5' G AAG ATG GTG ATG G G ATTTC 3';

Ki67: sense 5' ACGAGACGCCTGGTTACTATC 3' and

antisense 5' GCTCATCAATAACAGACCCATT 3';

CCNA1 : sense 5' TGGATCAGAAAATGCCTTCC 3' and

antisense 5' CCCCTGCTCTAGTTCATCCA 3';

CCNE1 : sense 5' CTGGATGTTGACTGCCTTGAATT 3' and

antisense 5' GCGACGCCCCTGAAGTG 3';

CCNB1 : sense 5' TCTG G ATAATG GTG AATG G ACA 3' and

antisense 5' CGATGTGGCATACTTGTTCTTG 5'

Cloning and generation of lentiviral constructs and stable oral cancer cell lines expressing MAGE-D4b

The full length MAGE-D4b gene was amplified from pCMV6-SPORT6-MAGE- D4b expression clone {Invitrogen Life Technologies, USA; Cat # MGC: 74882) and cloned into plentiviral6.3/V5 expression construct vector (Invitrogen, USA) according to the manufacturer's instruction. MAGE-D4b was exogenously expressed in ORL-48, ORL-150 and ORL-195. For viral production, the MAGE-D4b lentiviral construct or vector alone was co-transfected with ViraPower™ packaging mix using Lipofectamine™ (Invitrogen, USA) into 293FT viral producing cell lines. Viral supernatants were harvested 24 hours later and filtered using a 0.45 μηη syringe filter. The ORL-48, ORL-150 and ORL-195 were transduced with the viral supernatant using 10 g/ml of polybrene (Sigma, USA). Cells exogenously expressing MAGE-D4b and vector control cells were selected using 5μg/ml of blasticidin (Invitrogen, USA). The MAGE-D4b transduced cells will be referred to as ORL-48/MAGE-D4b, ORL- 150/MAGE-D4b or ORL-195/MAGE-D4b, and the cells that are transduced with the vector only are designated as ORL-48/pLenti, ORL-150/pLenti or ORL-195/pLenti herein. Immunohistochemistry (IHC)

The expression of MAGE-D4b was examined by immunohistochemistry (IHC) using the Dakocytomation Envision* Dual Link System-HRP (DAB ⁺ ) kit (Dako, USA) on 40 oral squamous cell carcinoma (OSCC) and 1 1 normal oral mucosa tissues. The demographic features of the oral squamous cell carcinoma (OSCC) patients included in the immunohistochemistry (IHC) analysis were summarized in Table 3 below. RHO expression was determined in ORL-48/MAGE-D4b and ORL-48/pLenti xenografts. Immunohistochemistry (IHC) was performed using MAGE-D4b {1:100: Sigma, USA), Pan Rho + RAC (1, 2) + CDC42 (1:300; Abeam, USA) based on the work done in Transcriptional Profiling of Oral Squamous Cell Carcinoma Using Formalin-fixed Paraffin- embedded Samples (Saleh et al., 2010). The immunoreactivity was scored by utilizing a 4-point intensity scoring system: 0 = negative expression; 1 = weak positive expression; 2 = moderate positive expression; 3 = strong positive expression. The receiver operating characteristic (ROC) curve was used to identify the best cut-off points in scoring the expression of MAGE-D4b for specificity and sensitivity. Any discrepancies were discussed and a consensus agreement was reached to obtain a final definitive score.

I More than 1 risk habit 10 (25.0)

Table 3 Demographic distributions of 40 oral squamous cell carcinoma (OSCC) cases used in MAGE-D4b immunohistochemistry (IHC) analysis. Western blotting

Total protein was extracted based on the work disclosed in Establishment and Characterization of Asian Oral Cancer Cell Lines as in vitro Models to Study a Disease Prevalent in Asia (Hamid et al, 2008). 50 μg/lane of crude protein extracts resolved by SDS-PAGE were transferred onto nitrocellulose membrane using the Bio-Rad mini gel electrophoresis apparatus for 1 hour in transfer buffer (25 mM Tris base, 192 mM glycine and 20% methanol, pH 8.3). Nitrocellulose membranes were treated with blocking solution (5% skimmed milk/PBS) for 1 hour at room temperature and probed with primary antibody (MAGE-D4b (1:100, Santa Cruz, USA); Pan Rho + RAC (1, 2, 3) + CDC42 (1:300; Abeam, USA); ROCK1 (1:200; Abeam, USA)). Following the incubation with the primary antibody, the blots were washed with PBS/0.1 % Tween 20 and probed with the secondary antibody conjugated with horseradish peroxidase (HRP) (1:10,000; Santa Cruz, USA) for 1 hour at room temperature, followed by washing with PBS/0.1 % Tween 20. The expression of MAGE-D4b was detected by enhanced chemiluminescence method (Pierce, USA) and visualized using the Chemilmager™ Imaging Systems (Alpha Innotech, USA). To normalize for loading, the blots were probed with anti-a-tubulin (1:1,000; Sigma, USA) monoclonal antibody for 1 hour at room temperature and processed as described above.

Proliferation Assay

The MAGE-D4b or vector transduced cells were seeded at 5x10 ⁴ in 60 mm tissue culture dishes, harvested and counted using CASY® cell counter (Innovatis, Germany) every 24 hours over a 9-day period. The doubling times of each of the cell lines were calculated by plotting the total cell number in log ² scale against time. The data was averaged from three experiments. The effect of MAGE-D4b over-expression on tumour growth was also assessed in 4-week-old athymic Nude-Foxn1 ^nu {Harlan Laboratories, USA). Briefly, ORL-48/MAGE-D4b and ORL-48/pLenti cells were subcutaneously injected into the flank of the animal at a concentration of 2x10 ⁶ cells. Five mice were used for each cell line. In post-transplantation, the mice were examined every other day for tumour development. Tumour volume was determined based on the formula 1 /2 (length χ width ² ). After 6 weeks of observations, all animals were euthanized and tumours were excised for histology evaluation. The experiments were performed twice. All experimental procedures were carried out as in accordance with National Institute of Health's Institutional Animal Care and Use Committee regulations.

Apoptosis and cell cycle study

Ultraviolet (UV) irradiation was used to induce apoptosis in this study. The sensitivity of each cell line against UV was determined by exposing the cells to a variation of ultraviolet (UV) doses (0-100 J/m ² ). After the ultraviolet (UV) irradiation, the cells were allowed to recover over a period of 16 hours. Subsequently, viable and dead cells were determined using CASY® cell counter. Further, using 2 doses of 30 J/m ² and 70 J/m ² , the cells were irradiated and harvested for cell cycle analysis by staining for propidium iodide (PI; Sigma, USA) , apoptotic index by double staining with Annexin V-FITC (BD Bioscience, USA) and propidium iodide (PI), and the cells were analyzed using the flow cytometer (BD Biosciences, USA). Monolayer wound healing assay

The monolayer wound healing assay was carried out based on the work done in Cell Migration and Invasion Assays (Valster et al., 2005). Briefly, 4x10 ⁵ cells were seeded in duplicate in 60 mm culture dish and grown over 16 hours. The cells were then treated with 10 μg/ml of mitomycin C for 2 hours and two parallel scratches were made on the monolayer using a yellow pipette tip. The wound areas were recorded under the microscope at the time point of 0th- hour and 20th-hour. The images of the open wound areas were then analyzed using the TScratch analysis software as described in A Novel and Simple Software Tool for Automated Analysis of Monolayer Wound Healing Assays (Geback er a/., 2009).

Organotypic co-culture

The invasion assay was performed based on the work done in Development of a Quantitative Method to Analyse Tumour Cell Invasion in Organotypic Culture (Nystrom et ai , 2005). Briefly, 1 ml gel mix (type I collagen, Matrigel, 10x DMEM, FBS [4:4: 1 : 1 ] containing 1 x10 ⁶ fibroblasts) at pH7 was added to each 12-well insert placed in the recesses of 12-well culture plates. The gel mix was left to solidify for 30 minutes at 37°C and fibroblast culture medium (DMEM containing 10% (v/v) foetal bovine serum and 2mM L-glutamine) was added and the culture plates were incubated overnight at 37°C. 1 x10 ⁶ of keratinocytes suspended in the 500 μΙ epithelial culture medium (DMEM-F12 (Lonza, USA) supplemented with 10% FBS) was added into the inner chamber. After the overnight incubation, all of the culture medium was replaced with epithelial culture fresh medium such that the bottom of the gel mix was just in contact with the culture medium and the top was exposed to air. The medium was changed every 2-3 days and the organotypic cultures were harvested at the 10th-day upon exposing the top of the gel mix to air. The inner chamber containing the gel mixture was fixed in formal-saline for 24 hours at room temperature and embedded in a 1 % agar solution (containing 10% [v/v] formaldehyde) for ease of manipulation. The agar-gel was dissected, embedded in paraffin, sectioned and stained with hematoxylin and eosin. The invasion index was calculated using Image J software as described in Fibroblast-led Collective Invasion of Carcinoma Cells with Differing Roles for RhoGTPases in Leading and Following Cells (Gaggioli et al., 2007) with minor modifications.

Statistical Analysis

All the statistical analyses were performed using the statistical software package SPSS 16 (SPSS Inc., Chicago, IL, USA). Mann-Whitney U test was used to compare MAGE-D4b mRNA expression level in tumour and normal tissues. Kaplan-Meier survival curve was used to correlate the disease-free survival rate with MAGE-D4b expression, and the survival probability differences were compared by the log-rank test. The independent t-test was used for the analyses of cell doubling time, monolayer wound healing assay, invasion and apoptosis study. Pearson χ ² and Fisher-exact tests were used to study the association between MAGE-D4b mRNA expression in tumours and various clinicopathological parameters, p value of less than 0.05 was considered statistical significant.

EXAMPLE 2

Results

Over-expression of MAGE-D4b in oral squamous cell carcinoma (OSCC)

MAGE-D4b was found to be over-expressed in the majority of oral squamous cell carcinoma (OSCC) tissues at both mRNA and at protein levels. The average MAGE-D4b expression was significantly higher in oral squamous cell carcinoma (OSCC) tissues with 24 over 44 (54.5%) oral squamous cell carcinomas (OSCC) having more than 2-fold increase in mRNA expression compared to levels in normal oral mucosa (p = 0.001 ; the results are as illustrated in Figure 1 ). Consistently, the immunohistochemistry (IHC) analysis demonstrated that 39 over 40 (97.5%) of the oral squamous cell carcinoma (OSCC) tissues had expression of MAGE-D4b protein (p < 0.001 ). MAGE- D4b was found to be predominantly expressed in the cytoplasm in majority of the oral squamous cell carcinoma (OSCC) tissues, whilst membrane staining was observed in some tissues. In contrast, the normal tissues appeared to have lower levels of MAGE-D4b and 8 over 1 1 normal tissues did not express MAGE-D4b at all, as illustrated in Figure 6(a) and 6(b). Notably, the high levels of MAGE-D4b expression were associated with invasion of oral squamous cell carcinoma (OSCC) cells to the lymph nodes, as tabulated in Table 4, and poorer disease-free survival (p=0.031 ; the results are as illustrated in Figure 6(c)).

Pearson test, Fisher's exact test

Table 4 Association of MAGE-D4b protein expressions with clinicopathological data

Over-expression of MAGE-D4b increases cell proliferation

As MAGE-D4b was consistently over-expressed in a large percentage of oral squamous cell carcinoma (OSCC), we have therefore determined its role in cell proliferation. MAGE-D4b was exogenousiy expressed in two oral cancer cell lines (ORL-48 and ORL-150). We confirmed that both O RL-48/M AG E-D4b and ORL-150/MAGE-D4b cells have increased levels of the MAGE-D4b after transduction, as illustrated in Figure 7(a), and these cells had an increase in proliferation rate compared to the control cells, as illustrated in Figure 7(b), where the mean doubling time for ORL-48/MAGE-D4b and ORL-150/MAGE- D4b was significantly shorter in comparison to the control cells respectively (33.1 ± 0.3 hour versus 37.6 ± 0.6 hour; p = 0.003; 32.0 ± 1.3 hour versus 38.8 ± 0.6 hour; p = 0.008). Furthermore, the proliferative effect of MAGE-D4b was also clearly observed in vivo where ORL-48/MAGE-D4b cells form larger tumours in the flanks of nude mice in comparison to ORL-48/pLenti cells, as illustrated in Figure 7(c) and 7(d). Taken together, the in vitro and in vivo data strongly supports the growth promoting properties of MAGE-D4b. As the control of cell proliferation is primarily governed by the cell cycle proteins, we have therefore determined whether the exogenous expression of MAGE-D4b alters the expression of cell cycle proteins and proliferation markers including CCNA1 , CCNB1 , CCNE1 , CCND1 and Ki67. Surprisingly, we did not see any significant increase in the expression of cell cycle proteins and proliferation markers at the mRNA (CCNA1 , CCNB1 , CCNE1 , and Ki67) and protein levels (CCND1 and Ki67; data not shown) between cells transduced with MAGE-D4b and vector control cells, as illustrated in Figure 7(e). Consistently, an increase in the Ki67 labelling index in ORL-48/MAGE- D4b tumours formed in mice was not observed in comparison with ORL- 48/pLenti tumours, as illustrated in Figure 7(f) and 7(g).

Over-expression of MAGE-D4b confers resistance to UV-induced cell death in oral squamous cell carcinoma (OSCC) cells

We have shown that the increase in cell proliferation was not driven by cell cycle proteins and we have further determined that the net increase in cell number of the cells exogenously expressing MAGE-D4b could be attributed to a gain in the ability to evade cell death. We irradiated ORL-48/MAGE-D4b and ORL-195/MAGE-D4b, and their respective vector controls with 0, 20, 40, 60, 80 and 100 J/m ² of ultraviolet C (UVC), and determined the cytotoxicity effects after 24 hours. From the killing curve, we demonstrated that both ORL- 48/MAGE-D4b and ORL-195/MAGE-D4b cells were relatively resistant to cell killing in comparison to the vector control cells, as illustrated in Figure 8(a). Further, after treating the cells with 30 and 70 J/m ² of ultraviolet C (UVC), the cell cycle analysis indicated that there is no change in the cell cycle profiles for both ORL-48/MAGE-D4b and ORL-48/pLenti, as illustrated in Figure 8(b). However, an increase of the sub-G1 population (apoptotic cells and necrotic cells) was observed in ORL-48/pLenti when compared to the ORL-48/MAGE- D4b treated with ultraviolet C (UVC). The apoptotic index was also lower in cells expressing MAGE-D4b in comparison to their respective vector control cells, as illustrated in Figure 8(c).

Over-expression of MAGE-D4b promotes tumour cell migration but not invasion

The monolayer wound healing assays is a simple and effective way to study the migration of tumour cells. The ability of ORL-48/MAGE-D4b and ORL- 150/MAGE-D4b cells to migrate in comparison to their respective vector control cells were measured by the rate of wound closure. As MAGE-D4b was shown to increase cell proliferation rate and this could lead to wound closure, we treated the cells with mitomycin C before conducting the wound healing assays. Further, to ensure that the mitomycin C has effectively blocked cell proliferation for the duration of the migration assay, we determined the levels of cell cycle proteins at the Oth-hour and 20th-hour of the post mitomycin C treatment. We demonstrated the levels of cell cycle proteins including CCNA1 , CCNB1 , CCNE1 , and Ki67 were consistently low throughout the assay (Oth- hour and 20th-hour, data not shown). As depicted in Figure 9(a), the closure of the open wound area in ORI_-48/MAGE-D4b and ORL-150/MAGE-D4b were significantly faster than the control cells (p < 0.001 ). To confirm that the increase of cell motility was directly due to the expression of MAGE-D4b, we knocked-down MAGE-D4b in ORL-48/MAGE-D4b and ORL-150/MAGE-D4b cells and demonstrated that both ORL-48/MAGE-D4b and ORL-150/M AG E- D4b cells with MAGE-D4b knock-down lost their migratory potential thus confirming the increase in migratory potential was conferred directly by MAGE-D4b over-expression, as illustrated in Figure 9(b).

Despite conferring an increase in migratory potential, using organotypic co- cultures, we demonstrated that the exogenous expression of MAGE-D4b in ORL-48 did not enhance the invasion capacity of oral cancer cells, as illustrated in Figure 9(c) and 9(d). Taken together, these data strongly supports the role of MAGE-D4b in enhancing the ability of oral cancer cells to migrate. However, no effect on cell invasion was observed. We further investigated if MAGE-D4b selectively regulates the expression of the Rho family of GTPases (Rho, Rac and CDC42), which is involved in cell migration. The expression of Rho/RAC/CDC42 proteins was shown to be up- regulated in the ORL-48/MAGE-D4b cells in comparison to ORL-48/pLenti cells, as illustrated in Figure 9(e). Furthermore, the immunohistochemistry (IHC) analysis of tumours formed in mice injected with the ORL-48/MAGE- D4b cells or vector control cells also demonstrated high expression of Rho/RAC/CDC42 proteins in the ORL-48/MAGE-D4b tumours where the expression was observed in both membrane and cytoplasm, as illustrated in Figure 9(f).

EXAMPLE 3 Discussions

The survival rate of oral squamous cell carcinoma (OSCC) has not improved significantly in the last few decades despite advances in treatment strategies, and the identification of key drivers of malignancy have shown promise in improving patient care. Previously, we identified MAGE-D4b to be differentially expressed in oral squamous cell carcinoma (OSCC) compared to normal oral mucosa tissues. This was the first study to demonstrate that MAGE-D4b is over-expressed in oral squamous cell carcinomas (OSCC), as disclosed in the work done by Cheong et a/. , 2009. Here, we confirmed the expression of MAGE-D4b in a large number of oral squamous cell carcinoma (OSCC) specimens while demonstrating that this gene is not expressed in the majority of normal oral mucosa tissues. Interestingly, although MAGE-D4b is a member of the Type II MAGE family and expected to be expressed more universally relative to Type I MAGE proteins, a growing body of evidence suggests that the expression of MAGE-D4b in normal tissues is limited, as stated in MAGE-E1, A New Member of the Melanoma-associated Antigen Gene Family and its Expression in Human Glioma (Sasaki et a/., 2001) and MAGE-D4B is a Novel Marker of Poor Prognosis and Potential Therapeutic Target Involved in Breast Cancer Tumourigenesis (Germano et a/., 201 1). Notably, previous reports titled MAGE-E1, A New Member of the Melanoma- associated Antigen Gene Family and its Expression in Human Glioma (Sasaki et al., 2001), MAGE-D4B is a Novel Marker of Poor Prognosis and Potential Therapeutic Target Involved in Breast Cancer Tumourigenesis (Germano et a/., 2011), and Expression of MAGE-D4, A Novel MAGE Family Antigen, is Correlated with Tumor-cell Proliferation of Non-small Cell Lung Cancer (Ito ei al. , 2006) have shown that MAGE-D4b is over-expressed in several different cancers including glioma, breast and non-small cell lung cancer. Taken together, this strongly suggests that MAGE-D4b is a cancer-specific antigen and its limited expression in normal tissues further suggest that MAGE-D4b could be a good therapeutic target. Comparing with the clinico-pathological characteristics of our patients, we demonstrated that high expression of MAGE-D4b was significantly associated with lymph node metastasis and poor survival in oral squamous cell carcinoma (OSCC) patients suggesting that MAGE-D4b is an important gene in driving oral squamous cell carcinoma (OSCC) progression. In breast cancer patients, MAGE-D4b was also found to be associated with tumour progression and poor disease outcome, as previously disclosed in the work done by Germano ei al., 201 1 thus indicating that the expression of MAGE-D4b has prognostic value, and its use as a prognostic marker should be explored further.

MAGE proteins have been investigated extensively for their use in immunotherapy. However, the development of effective therapeutic strategies often require an understanding of the role of the gene in driving carcinogenesis as many genetic abrogations in cancer could be merely "bystander" changes that may not necessarily contribute to cancer development. The only MAGE proteins that have been reported to be over-expressed in head and neck cancers were from the MAGE-A family of proteins, as disclosed in Expression of Melanoma-associated Antigens in Oral Squamous Cell Carcinoma (Ries et al., 2008), Expression of MAGE-A M in Oral Squamous Cell Carcinoma (Mollaoglu et al., 2008), The Role of MAGE A2 in Head and Neck Cancer (Glazer et al., 201 1 ). From these, only one report demonstrated the role of MAGE-A2 in head and neck cancers, which the work in the report is done by Glazer ei a/., 201 1. Information on the role of MAGE- D4b in cancer development is scarce with only one report on gene function in breast cancer, as illustrated in the work done by Germano ei a/., 201 1. As MAGE-D4b was up-regulated in a significant number of oral squamous cell carcinomas (OSCC), we investigated the biological role of MAGED4B in vitro and in vivo.

For the first time in oral cancer, we demonstrated that over-expression of MAGE-D4b could increase cell growth both in vitro and in vivo. We further demonstrated that the increase in cell growth was not accompanied by a change in the expression of cell cycle proteins, which prompted us to determine if cell growth was due to a decrease in cell death. Interestingly, we demonstrated that MAGE-D4b over-expressing cells were less sensitive to UV-induced cell death and significantly less MAGE-D4b over-expressing cells undergo apoptosis compared to those transduced with the vector alone, suggesting that MAGE-D4b protects cells from undergoing apoptosis. Ki-67 is a marker of cell proliferation. AGE-D4b expression has previously been associated with high Ki-67 labelling index, as previously disclosed in the works done by Ito ei a/., 2006 and Germano et a/., 201 1 , providing clues that MAGE-D4b could be involved in cell proliferation. For the first time, we demonstrated that MAGE-D4b has a direct role in driving cell growth both in vitro and in vivo, and could do this by conferring a resistance to apoptosis. This is perhaps not too surprising as other MAGE family members including MAGE-A2 have been reported to play a role in increasing cell growth in head and neck cancer cell lines, as disclosed in the work done by Glazer et al., 201 1. Furthermore, MAGE proteins have been shown to modulate apoptosis. In particular, MAGE-A2 was shown to down-regulate the expression of BAX whilst MAGE-D1 has been shown to interact with XIAP, a member of the inhibitor of apoptosis (IAP) family, as disclosed in Neurotrophin Receptor- interacting MAGE Homologue is an Inducible Inhibitor of Apoptosis Protein- interacting Protein that Augments Cell Death (Jordan ei al., 2001). Several mechanisms underlying this phenomenal has been put forward recently. For example, MAGE-A2 has been shown to bind with p53 and recruit the histone deacetylase 3 (HDAC) to down-regulate the transactivation function of p53, as disclosed in MAGE-A Tumor Antigens Target p53 Transactivation Function Through Histone Deacetylase Recruitment and Confer Resistance to Chemotherapeutic Agents (Monte et al. , 2006), which could cause a down- regulation of pro-apoptotic proteins, as disclosed in the work done by Glazer et al., 201 1 . Interestingly, recent evidence indicates that the MAGE homology domain (MHD) often conserved amongst MAGE family members, could bind directly to RING (Really Interesting New Gene) domain proteins, which include a family of E3 ubiquitin ligases, to enhance the ubiquitination of p53 and to suppress p53-dependent apoptosis in cancer cells, as disclosed in MDM2 Interaction with Nuclear Corepressor KAP1 Contributes to p53 Inactivation (Wang et al. , 2005) and MAGE-RING Protein Complexes Comprise A Family of E3 Ubiquitin Ligases (Doyle et al. , 2010), and MAGE-A, mMage-b, and MAGE-C Proteins Form Complexes with KAP1 and Suppress p53-dependent Apoptosis in MAGE-positive Cell Lines (Yang et al. , 2007) respectively. Whether or not the evasion of apoptosis conferred by MAGE- D4b is dependent on p53 remains to be determined and it would be interesting to investigate if an interaction between MAGE-D4b and p53 exists. Another hallmark of cancer is the gain in the ability of cells to metastasize, as described in The Hallmarks of Cancer (Hanahan & Weinberg, 2000) and Hallmarks of Cancer: The Next Generation (Hanahan & Weinberg, 201 1 ). In this study, we demonstrated that MAGE-D4b increased the ability of oral cancer cells to migrate but surprisingly, not invade. This is in contrast to the study published in breast cancer demonstrating that MAGE-D4b increases both migration and invasion of breast cancer cells, as described in the work done by Germano et al. , 201 1. In an attempt to understand the mechanism by which MAGE-D4b drive migration, we analysed the expression of the Rho family of small monomeric GTPases, which is involved in promoting migration, as described in Rho GTPases and Cell Migration (Ridley AJ, 2001) and Rho GTPases: Signaling, Migration, and Invasion (Schmitz et al. , 2000). Both in vitro and in vivo data in this study demonstrated that Rho was up-regulated in cells exogenously expressing MAGE-D4b suggesting that MAGE-D4b could induce Rho expression to promote cell migration. The ability for MAGE-D4b over-expressing cells in increasing migratory potential is in line with the association between high MAGE-D4b expressions in patients with lymph node metastasis and suggests that targeting MAGE-D4b could be effective in treating metastatic disease.

In conclusion, this is the first study to confirm that MAGE-D4b is over- expressed in a large proportion of oral squamous cell carcinoma (OSCC), and that the presence of MAGE-D4b in cancer directly drives cell growth, evasion of apoptosis and migration, all of which are hallmarks of cancer. We also demonstrated that the increase in cell migration is at least in part due to MAGE-D4b-induced up-regulation of Rho. As MAGE-D4b is significantly associated with lymph node metastasis and survival, its role as a prognostic marker should be investigated further. Furthermore, given that MAGE-D4b is up-regulated in a subset of oral squamous cell carcinoma (OSCC) and absence in normal oral mucosa tissues, MAGE-D4b can be an ideal target for immunotherapy. In addition, the direct roles of MAGE-D4b in driving oral carcinogenesis strongly suggest that it would be a good therapeutic target for oral cancer.

All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of the present invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the composition, methods and in the steps or in the sequence of steps of the method described herein without departing from the concept and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the scope and concept of the invention as defined by the appended claims. REFERENCES

The following literature citations as well as those cited above are incorporated in pertinent part by reference herein for the reasons cited in the above text.

Cheong et al., Gene Expression in Human Oral Squamous Cell Carcinoma is Influenced by Risk Factor Exposure, Oral Oncology, Volume 45, Issue 8, pages 712-719, August 2009. Couch et al. , Genetically Engineered Tumor Cell Vaccine in a Head and Neck Cancer Model, The Laryngoscope, Volume 113, Issue 3, pages 552-556, March 2003.

Doyle et al., MAGE-RING Protein Complexes Comprise A Family of E3 Ubiquitin Ligases, Molecular Cell, Volume 39, Issue 6, pages 963-974 September 2010

Gaggioli et al., Fibroblast-led Collective Invasion of Carcinoma Cells with Differing Roles for RhoGTPases in Leading and Following Cells, Nature Cell Biology, Volume 9, Issue 12, pages 1392-1400, December 2007.

Geback et al., A Novel and Simple Software Tool for Automated Analysis of Monolayer Wound Healing Assays, Biotechniques, Volume 46, Issue 4, pages 265-274, April 2009.

Germano et al., MAGE-D4B is a Novel Marker of Poor Prognosis and Potential Therapeutic Target Involved in Breast Cancer Tumourigenesis, International Journal of Cancer, May 201 1 [Epub ahead of print] Glazer et al., The Role of MAGEA2 in Head and Neck Cancer, Archives of Otolaryngol - Head & Neck Surgery, Volume 137, Issue 3, pages 286-293 March 201 1 . Hamid ef al. , Establishment and Characterization of Asian Oral Cancer Cell Lines as in vitro Models to Study a Disease Prevalent in Asia, International Journal Molecular Medicine, Volume 19, Issue 3, pages 453-460, March 2007.

Hanahan D and Weinberg RA, The Hallmarks of Cancer, Cell, Volume 100, Issue 1 , pages 57-70, January 2000.

Hanahan D and Weinberg RA, Hallmarks of Cancer: The Next Generation, Cell, Volume 144, Issue 5, pages 646-674, March 201 1

Ito ef al. , Expression of MAGE-D4, A Novel MAGE Family Antigen, is Correlated with Tumor-cell Proliferation of Non-small Cell Lung Cancer, Lung Cancer, Volume 51 , Issue 1 , pages 79-88, January 2006.

Jordan et al. , Neurotrophin Receptor-interacting MAGE Homologue is an Inducible Inhibitor of Apoptosis Protein-interacting Protein that Augments Cell Death, The Journal of Biological Chemistry, Volume 276, Issue 43, pages 39985-39989, September 2001 .

Miyazaki et al. , Phase I Clinical Trial of Survivin-derived Peptide Vaccine Therapy for Patients with Advanced or Recurrent Oral Cancer, Cancer Science, Volume 102, Issue 2, pages 324-329, February 201 1. Mollaoglu ef al. , Expression of MAGE-A12 in Oral Squamous Cell Carcinoma, Disease Markers, Volume 24, Issue 1 , pages 27-32, January 2008.

Monte et al. , MAGE-A Tumor Antigens Target p53 Transactivation Function Through Histone Deacetylase Recruitment and Confer Resistance to Chemotherapeutic Agents, Proceedings of the National Academy of Sciences, Volume 103, Issue 30, pages 1 1 160-1 1 165, July 2006. Nystrom et al. , Development of a Quantitative Method to Analyse Tumour Cell Invasion in Organotypic Culture, The Journal of Pathology, Volume 205, Issue 4, pages 468-475, March 2005. Ridley AJ, Rho GTPases and Cell Migration, Journal of Cell Science, Volume 1 14, Issue 15, pages 2713-2722, August 2001 .

Ries et al. , Expression of Melanoma-associated Antigens in Oral Squamous Cell Carcinoma, Journal of Oral Pathology & Medicine, Volume 37, Issue 2, pages 88-93, February 2008.

Saleh et al., Transcriptional Profiling of Oral Squamous Cell Carcinoma Using Formalin-fixed Paraffin-embedded Samples, Oral Oncology, Volume 46, Issue 5, pages 379-386, May 2010.

Sasaki et al. , MAGE-E1 , A New Member of the Melanoma-associated Antigen Gene Family and its Expression in Human Glioma, Cancer Research, Volume 61 , Issue 12, pages 4809-4814, June 2001 . Schmitz et al., Rho GTPases: Signaling, Migration, and Invasion, Experimental Cell Research, Volume 261 , Issue 1 , pages 1 -12 November 2000.

Valster er al. , Cell Migration and Invasion Assays, Methods, Volume 37, Issue 2, pages 208-215, October 2005.

Wang et al. , Effect of Dendritic Cell Vaccine Against a Tongue Squamous Cell Cancer Cell Line (Tca81 13) in vivo and in vitro, International Journal of Oral and Maxillofacial Surgery, Volume 35, Issue 6, pages 544-550, June 2006. Wang et al., MDM2 Interaction with Nuclear Corepressor KAP1 Contributes to p53 Inactivation, EMBO Journal, Volume 24, Issue 18, pages 3279-3290, September 2005. Yang et al., MAGE-A, mMage-b, and MAGE-C Proteins Form Complexes with KAP1 and Suppress p53-dependent Apoptosis in MAGE-positive Cell Lines, Cancer Research, Volume 67, Issue 20, pages 9954-9962, October 2007.