REFERENCE TO RELATED APPLICATIONS

This application claims the benefit under 35 U.S.C. Section 119(e) of co-pending and commonly-assigned U.S. Provisional Patent Application Serial No. 61/445,769, filed on February 23, 2011, entitled "PEPTIDE FOR THE INDUCTION OF IMMUNE TOLERANCE AS TREATMENT FOR SYSTEMIC LUPUS ERYTHEMATOSUS", the contents of which are incorporated herein by reference. This application is related to WO 2009/052415, filed October 17, 2008 the contents of which are incorporated herein by reference.

STATEMENT OF GOVERNMENT SUPPORT

This invention was made with Government support of Grant No. R37 AI 046776:07, awarded by the National Institutes of Health. The Government has certain rights in this invention.

FIELD OF THE INVENTION

The present invention relates to orally available tolerogenic peptides constructed of both L- and D-amino acid containing peptides and to pharmaceutical compositions comprising these peptides that are useful for the identification, monitoring and treatment of autoimmune diseases such as systemic lupus erythematosus (SLE) in humans.

BACKGROUND OF THE INVENTION

Autoimmune diseases are characterized by immune responses that are directed against self antigens. These responses are maintained by the persistent activation of self- reactive T lymphocytes. T lymphocytes are specifically activated upon recognition of foreign and/or self antigens as a complex with self major histocompatibility complex (MHC) gene products on the surface of antigen-presenting cells (APC).

Systemic lupus erythematosus (SLE) is a chronic, inflammatory, often multisystemic autoimmune disease which can be acute or insidious in onset. SLE is marked by a wide variety of abnormalities, including arthritis and arthralagias, nephritis, central nervous system manifestations, pleurisy, pericarditis, leukopenia or thrombocytopenia, and hemolytic anemia. One of the most serious complications of SLE is lupus nephritis. Renal involvement usually occurs early in the course of the illness and is the leading cause of death in SLE patients.

SLE is a challenging syndrome for medical professionals because its causes remain to be elucidated and further because it has heterogeneous clinical manifestations. Currently, no specific treatment aimed towards the prevention or cure of SLE is available. Despite the extensive research on the mechanisms underlying the induction of SLE, the information on the etiology of the disease is still limited. Diagnosis of SLE is made on the basis of a number of clinical symptoms such as the so-called "butterfly rash," an erythematous rash which frequently appears on the cheeks of afflicted individuals, crossing the bridge of the nose and becoming more pronounced upon exposure to sunlight; and arthritis which can affect any joint system. However, diagnosis is difficult to verify without appropriate laboratory tests. In this regard, antibodies directed to double-stranded DNA (dsDNA) are diagnostic of SLE and serum titers have long been known to correlate with disease activity in both humans and mice (see, e.g. Pearson et al., J.Immunol. 126:16 (1981)).

Currently, there is no target- specific treatment regimen for SLE, although physicians often prescribe widely immunosuppressive medications such as glucocorticoids. The choice of treatment regimen is typically determined by the individual patient's symptomatology and health status. Consequently, there is a need for broadly applicable highly targeted treatment regimens, especially for the nephritic manifestations of SLE.

SUMMARY

Therapeutic agents currently in use to treat SLE are predominantly immunosuppressive agents with limited target specificities. Inducing tolerance in SLE animal models with a variety of molecules ameliorates disease symptoms and increases survival. As disclosed herein, we show that oral administration of certain tolerogenic peptide compositions can decrease SLE severity and consequently provide a novel method of oral tolerance and SLE treatment.

As disclosed herein, when administered to BWF1 mice with systemic lupus erythematosus, certain novel peptide compositions induce T cells of several types known to prevent autoantibody production and nephritis when administered prior to disease, as well as suppress those features in established disease. Correlatively, humans with SLE have T cells that can be educated in vitro to become regulatory T cells that suppress T cells that help induce disease. In this context, BWF1 are the classic animal model for SLE as they closely mimic the human autoimmune disease with respect to autoantibody production, sex distribution, and the pathology of lupus nephritis (see, e.g. Steeves et al., The Journal of Immunology, 2004, 172: 6568-6577 and Lettesjo et al., The Journal of Immunology, 2000, 165: 4095-4104). The disclosure provides evidence that a number of pCons compositions can therefore be used to induce tolerance in individuals with SLE. In addition, the general principles associated with the disclosed compositions and methods for using them are applicable to other autoantibody-mediated diseases, such as myasthenia gravis, and immune hemolytic anemias and autoimmune thrombocytopenias.

The pCons peptide compositions used in these studies are based on the protein sequences of anti-dsDNA antibodies. As disclosed herein, a number of different forms of pCons, including multiple antigenic peptides (MAP) and cyclic peptides (eye) made up of L- and D-amino acids, at different concentrations, were fed to BWF1 SLE-susceptible mice for 30 weeks. Proteinuria was ten measured weekly. Serum was collected monthly and tested for the presence of anti-DNA antibodies, total IgG, and transforming growth factor β expression. Survival was measured through 47 weeks of age. Mice fed 100 μg of L-MAP or D-MAP had less cumulative proteinuria and serum anti-dsDNA antibody levels than controls, as well as higher levels of serum TGFbeta, which may be associated with the emergence of regulatory T cells. Most importantly, animals in these groups survived significantly longer than controls. Oral administration of a tolerogenic peptide is a safe, effective method for ameliorating SLE disease manifestations and prolonging survival in SLE -prone mice. Induction of oral tolerance using modified pCons peptides as disclosed herein provides strong evidence for their use in a novel targeted therapy for human SLE.

As discussed in detail below, a multiple antigenic D-pCons linked to a lysine backbone and given orally mimics the effects of L-pCons in vivo, with increase in TGF-β in the serum, reduction of anti-DNA and proteinuria, and prolonged survival. These discoveries, in addition to what is known about the relative stability of D-amino acid containing peptides, provides evidence that multiple antigenic D-pCons in certain formulations will induce tolerance when given orally. In this context, embodiments of the invention include methods for the oral administration of multiple antigenic D-pCons in a manner that induces immune tolerance to self (e.g. by decreasing the production of autoantibodies such as anti-DNA antibodies) with consequent prevention of (or suppression of) associated pathologies such as nephritis.

One embodiment of the invention is a method of inhibiting/ suppressing the production of autoantibodies in a mammal (e.g. those that bind nuclear components such as double stranded DNA), the method comprising administering to the mammal an isolated D- or L-amino acid peptide composition comprising the sequence: FIEWNKLRFRQGLEW, wherein the L-amino acid version of pCons binds to Major Histocompatibility Complex polypeptides expressed by T cells in the mammal; and further inhibits the production of autoantibodies that bind double stranded DNA in a mammal. In some embodiments, the peptide administered to the mammal is in a head- to-tail cyclic configuration; and/or multiple copies of the peptide are coupled to a polymeric matrix (e.g. polylysine as shown in Figure 17). In some embodiments, the mammal suffers from an autoimmune disorder comprising systemic lupus erythematosus (SLE) and/or nephritis. One specific illustrative embodiment comprises a method of inhibiting the production of autoantibodies that bind double stranded DNA in a mammal, the method comprising administering to the mammal a tolerogenic multiple antigenic peptide composition comprising a compound having at least two copies of a peptide having the sequence: FIEWNKLRFRQGLEW (SEQ ID NO: 1), wherein the copies of the peptide are coupled to a non-immunogenic polylysine backbone so that the production of autoantibodies that bind double stranded DNA in the mammal is inhibited.

Optionally, pCons is coupled to a heterologous amino acid sequence, for example a constant region from an immunoglobulin. In certain embodiments of the invention, L- or D-pCons is administered orally and can be combined with a pharmaceutically acceptable carrier comprising a composition that inhibits acidic or enzymatic degradation of the peptide. Typically in such embodiments, the administration of the peptide composition results in an induction of CD4+CD25+Foxp3+ T cells or CD8+Foxp3+ T cells in the mammal. In typical embodiments, the administration of the peptide composition reduces the number of the mammal's splenic B cells that make antibodies that bind double stranded DNA (and/or the relative levels of such antibodies in circulation) by at least about 10%, 20%, 30%, 40% or 50%. In certain embodiments, the administration of the peptide composition results in a decrease in the concentration of proteins present in the urine of the mammal by at least about 10%, 20%, 30%, 40% or 50%.

The invention disclosed herein also has a number of embodiments relating to compositions comprising a peptide having the sequence: FIEWNKLRFRQGLEW and methods for using such compositions in a variety of contexts. Typically, at least one amino acid moiety in the peptide is a D-amino acid; and/ or the peptide is in a head-to- tail cyclic configuration; and/or the composition comprises multiple copies of the peptide coupled to a polymeric matrix (see, e.g. the illustrative embodiment shown in Figure 17). D-amino acid forms of peptides are typically more resistant to degradation by acid and proteases and thus particularly well suited to be administered orally, making the peptide well suited for therapeutic administration to humans. In certain embodiments, the composition further comprises a pharmaceutically acceptable carrier used in orally administered medications, e.g. when pCons is coupled to a second compound such as avidin or biotin and/ or a polyol such as polyethylene glycol and/ or a heterologous amino acid sequence.

Embodiments of the invention also include a method of binding a multiple antigenic (MAP) or cyclic D-amino acid containing peptide having the sequence: FIEWNKLRFRQGLEW to a T lymphocyte, the method comprising combining the MAP or cyclic peptide with an antigen-presenting cell with the appropriate MHC so that it binds T lymphocyte receptors under conditions suitable for a binding interaction to occur and then allowing the peptide/MHC complex to bind the T lymphocyte. Typically, at least one amino acid moiety in the peptide is a D-amino acid; and/ or the peptide is in a head-to-tail cyclic configuration; and/ or multiple copies of the peptide are coupled to a polymeric matrix; and the peptide is capable of binding a T lymphocyte and/or modulating the immune response of an animal to whom the peptide is administered. Such embodiments can use the peptide as probe for example to identify the presence of a T lymphocyte in a biological sample as a CD4+CD25- helper T lymphocyte. In other embodiments, the binding of the peptide to the T lymphocyte is one of the steps in an assay that screens for the presence or susceptibility of a mammal to an immunological disorder, the assay comprising labeling the peptide with a detectable label, incubating the labelled peptide with the T cells so that the labelled peptide is bound to the T cells; and then observing the amount of peptide bound cells, wherein the extent of the binding of the peptide to the T cells is correlated to the presence or susceptibility to the disorder (e.g. an autoimmune disorder characterized by the production of autoantibodies). As disclosed below, such methods can be performed both in vitro and in vivo.

In an additional embodiment, the invention concerns articles of manufacture comprising a container and compositions contained within said container, wherein the composition includes peptides of the present invention. The article of manufacture may further comprise instructions for using the peptides in vitro or in vivo. Illustrative embodiments of the invention include a kit, comprising a container and, within the container, an isolated L- or D-amino acid containing peptide comprising the sequence: FIEWNKLRFRQGLEW, wherein the peptide is capable of binding a T lymphocyte. Optionally, the peptide is in a head-to-tail cyclic configuration; and/ or multiple copies of the peptide are coupled to a polymeric matrix (see, e.g. the illustrative embodiment shown in Figure 17). BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 provides a bar graph of data showing that the intravenous administration of either 500 or 250 ug of D-pCons is effective in suppressing anti-DNA antibody production by naive BWF1 CD4+CD25- helper T cells cultured with naive BWF1 B cells. The numbers of splenic B cells making IgG anti-DNA dropped from 65 per 10 ⁶ B cells in the untreated group to 30-32 in the tolerized groups.

Figure 2 provides a bar graph of data from studies of L-pCons. pCons peptides were given once i.v. and spleen cells harvested 2 weeks later. Note that for L-pCons, the combination of naive B cells plus CD4+CD25- helper T cells gave a mean of 160 anti- DNA antibody-forming cells per 10 ⁶ B cells (column 3), whereas addition of CD4+CD25+ Treg from tolerized mice to the culture reduced the AFC to 25 per 10 ⁶ B cells (column 4). These differences were statistically significant, p < 0.001. Note also that the suppression was abrogated by incubation of the cultures with antibodies to GITR (column 6) or TGFb-LAP (column 7), but not by CTLA4-Ig (column 8).

Figure 3 provides a graph of data showing the suppression of clinical disease that occurs in BWF1 mice treated monthly from age 10 weeks with 1 mg of L-pCons administered intravenously.

Figure 4 provides graphs of data showing the CD8+ Ti induced by i.v. administration of L-pCons are potent in suppressing nephritis (left panel) and prolonging survival in vivo (right panel) (see, e.g. Hahn et al., J Immunol 2005;175:7728-37). These data represent a single transfer of 10 x 10 ⁶ CD 8+ T cells from spleens of tolerized mice to sublethally irradiated syngeneic recipients.

Figure 5 provides a bar graph of data showing that the potency of CD 8+ Ti cells from tolerized mice can be demonstrated in vitro in the culture assays described in Examples below. It is necessary to activate Ti suppression by adding L-pCons to the culture, and the suppression can be abrogated by silencing Foxp3 expression (via transfection with siRNA) in the Ti, but not by silencing p53 or using a scrambled siRNA in the Ti (see, e.g. Singh et al., J Immunol 2007;178:7649-57).

Figure 6 shows a graph of the percentage numbers of CD4+CD25high T cells in SLE patients and controls after 5 days in culture, data showing the ability of L-pCons to mature the CD4+CD25hiFoxp3+ natural regulatory cells in patients with SLE. In these experiments, pCons and other stimulatory (peptides B and D) peptides and non- stimulatory peptides (peptide A) that are wild peptides from human monoclonal antibodies to DNA were incubated with peripheral blood mononuclear cells from patients with SLE. Cfsc labeling showed that the expansion seen after 5 days, and shown in the figures, was attributable to expansion of existing CD4+CD25+ T cells and not induction of such cells de novo.

Figure 7 shows a graph of the differences in FoxP3 expression in CD4+CD25high T cells in SLE patient and controls after 5 days in culture with L- pCons, data further showing the ability of L-pCons to mature the CD4+CD25hiFoxp3+ natural regulatory cells in patients with SLE. In these experiments, pCons and other stimulatory (peptides B and D) peptides and non-stimulatory peptides (peptide A) that are wild peptides from human monoclonal antibodies to DNA were incubated with peripheral blood mononuclear cells from patients with SLE. Cfsc labeling showed that the expansion seen after 5 days, and shown in the figures, was attributable to expansion of existing CD4+CD25+ T cells and not induction of such cells de novo.

Figure 8 provides bar graphs showing that pCons-induced Treg suppress proliferation and IFNg production by CD4+CD25- T cells at 1:1 ratios and that this effect depends in part on Foxp3 expression. T cells were also expanded and silencing of Foxp3 by transfection with specific siRNA for Foxp3 abrogated the suppressive capacity of the induced T reg by ½ (3 ^rd panel, Fig 8).

Figure 9 shows graphs of Foxp3 expression. These graphs show that the expression of Foxp3 in CD4+CD25+ T cells correlated positively with serum levels of IgG and of anti-dsDNA in the SLE patients, but correlation with the Selena-SLEDAI measure of disease activity was not significant (p<0.09).

Figure 10 shows the presence of anti-DNA antibodies (left) and proteinuria (right) in plasma of mice treated orally once a week from age 10 weeks with saline, D- pCons (250 ug), and L-pCons (250 ug) at 26 (top) and 34 weeks of age (bottom). Anti- DNA antibodies were measured by ELISA and proteinuria by Urostix (see, e.g. Yang et al., J. I., 2003, 171: 2142-2153). Data show at late time point a significant decrease in anti- DNA and proteinuria with the L-peptide and not the D-peptide. These are weak effects and suggested the need to design a different formulation for the peptides.

Figure 11 shows a timeline for BWF1 pCons peptide feeding schedule and blood/ urine sample collection. Vertical lines indicate weeks, either week of treatment (top) or mouse age (bottom). Arrows indicate oral pCons administration throughout the treatment period. The hash mark indicates the first week of urine collection for proteinuria determination, which occurred weekly until week 30 of treatment. The carats indicate blood collection for plasma anti-dsDNA determination.

Figure 12 shows cumulative proteinuria for each D- and L- pCons peptide group. Urine was collected weekly (24 collections total) and scored by a colorimetric assay with Urostix strips with a score range from 0-4. Means and standard deviation of cumulative proteinuria scores for each group were graphed and compared to the DMSO- fed and unfed controls using Student's / test, p value ranges for all groups versus the DMSO-fed control group are indicated by number of asterisks, as shown in the box. No asterisk indicates a non- significant difference versus DMSO-fed controls.

Figure 13 shows cumulative anti-dsDNA antibody titers and total IgG levels for each pCons peptide group. Serum was collected by retroorbital bleeding once per month (6 collections total), pooled for each treatment group at each time point, and examined by ELISA for the presence of anti-dsDNA antibodies (A) and total IgG (B). Serum from each mouse was diluted 1:100 and tested in duplicate at each time point. After ELISA from every time point was completed, the cumulative mean of anti-dsDNA antibodies and total IgG was plotted. Significance is indicated by asterisks, and significance versus unfed control is indicated by 'u' and versus DMSO-fed animals is indicated with 'D.' p values for anti-dsDNA in A: 100 μg D-MAP, p=0.0251 (u), p=0.0287 (D); 100 μg L-MAP, p=0.0081 (u), p=0.0043 (D); 500 μg D-MAP, p=0.0298 (u), p=0.0344 (D). p values for total IgG in B: 100 μg D-MAP, p=0.0329 (D); 100 μg L- MAP, p=0.0329 (D).

Figure 14 shows survival curves for 100 mg D-MAP and L-MAP- fed animals. Survival was monitored three times per week. Significant p values were determined by Cox regression using DMSO-fed and unfed animal groups as controls. The hatched line at 40 weeks indicates when feeding was stopped. Significant p values versus DMSO controls: 100 μg D-MAP (p=0.0018), 100 μg L-MAP (p=0.0040). Significant p values versus unfed controls: 100 μg L-MAP (p=0.0343).

Figure 15 shows higher serum GFP levels are present in two treatment groups with increased survival and decreased proteinuria/anti-dsDNA antibody levels. GFP levels were determined from pooled serum samples for each treatment group at each time point using a commercially available ELISA kit. Significance is indicated by an asterisk with significance versus unfed control indicated by 'u' and versus DMSO-fed with T>.' Significant p values: 100 mg D-MAP, p=0.0108 (u), p=0.0248 (D); 100 mg L- MAP, 0.0243 (u).

Figure 16 shows survival curves for each pCons treatment group. Survival was monitored three times per week. Each set of treatment groups are in an individual panel: (A) linear D-pCons, (B) D-cyc, (C) D-MAP, (D) linear L-pCons, (E) L-cyc, and (F) L- MAP. Significant p values were determined by Cox regression using DMSO-fed and unfed animal groups as controls and are indicated by color-matched asterisks. The hatched line at 40 weeks indicated when the feeding regimen was stopped. Significant p values versus DMSO controls: 100 μg linear D-pCons (p=0.0134); 100 μg D-cyc (p=0.0189), 100 μg D-MAP (p=0.0018), 100 μg L-MAP (p=0.0040), and 500 μg L-MAP (p=0.0371). Significant p values versus unfed controls: 100 μg L-MAP (p=0.0343).

Figure 17 shows a schematic of an illustrative embodiment of the invention where multiple copies of the L or D-peptide are coupled to a polymeric matrix; in this case, four peptides are coupled to a polylysine backbone (multiple antigen peptide, or MAP). DETAILED DESCRIPTION OF THE INVENTION

Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized molecular cloning methodologies described in Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995) and Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd. edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and/or parameters unless otherwise noted.

Before the present methods and assays are described, it is to be understood that this invention is not limited to the particular methodology, protocols, cell lines, animal species or genera, constructs, and reagents described as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

It must be noted that as used herein and in the appended claims, the singular forms "a", "and", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a probe" includes reference to one or more probes and equivalents thereof known to those skilled in the art, and so forth.

All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. Publications cited herein are cited for their disclosure prior to the filing date of the present application. Nothing here is to be construed as an admission that the inventors are not entitled to antedate the publications by virtue of an earlier priority date or prior date of invention. Further the actual publication dates may be different from those shown and require independent verification.

Autoimmune diseases are characterized by immune responses that are directed against self antigens. These responses are maintained by the persistent activation of self- reactive T lymphocytes. T lymphocytes are specifically activated upon recognition of foreign and/or self antigens as a complex with self major histocompatibility complex (MHC) gene products on the surface of antigen-presenting cells (APC).

Systemic lupus erythematosus (SLE) is an autoimmune disease caused primarily by pathogenic autoantibodies (autoAb) and immune complexes containing those autoAb. Although it is normal to make autoAb, individuals predisposed to SLE make higher quantities than healthy individuals and their autoAb repertoire contains Ig that can be pathogenic, i.e. attach to tissue either directly or in immune complexes. Our laboratory has proven that normal mice made transgenic for IgG H and L chains of a murine autoAb directly against DNA is sufficient to cause clinical glomerulonephritis (see, e.g. Tsao et al., J Immunol 1992;149:350-8).

Autoantibodies arise years before the first clinical symptom of disease in most individuals who later develop SLE (see, e.g. Arbuckle et al., N Engl J Med 2003;3349:1526-33). Many experts have suggested that a major cause of SLE is loss of ability to regulate quantities and quality of those autoAb.

It was our idea to induce immune tolerance to a family of autoAb represented by pathogenic monoclonal antibodies to DNA. In early work, we were able to induce immune tolerance by i.v. administration of high doses of wild Ig peptides derived from the variable (V) regions of the heavy (H) chains of NZB/NZW Fl (BWFa) murine IgG from monoclonal anti-DNA (see, e.g. Singh et al., J Clin Invest 1995;96:2990-6). BWF1 mice spontaneously develop SLE -like disease, worse in females than in males; females die by 50 weeks of age from lupus-like nephritis with renal failure. However, tolerance with wild IgG peptides showed little impact on survival of BWF1 mice. Therefore, we constructed an artificial peptide (L form of pConsensus— referred to as L-pCons) which contains both MHC Class I- (to activate CD8+ T cells) and MHC Class Il-binding amino acid sequences known to activate T cells.

Intravenous administration of L-pCons to young BWF1 mice delayed autoAb appearance and nephritis, and prolonged life by several months (see, e.g. Hahn et al., Arthritis Rheum 2001; 44:432-41 and Figure 3). The mechanism of this effect includes induction of anergy in CD4+CD25- helper T cells, and induction of both CD4+CD25+Foxp3+ regulatory T cells (Treg), and CD8+Foxp3+ suppressive T cells (Ti), both of which downregulate autoimmunity in BWF1 mice. See, e.g. La Cava et al., J Immunol 2004;173:3542-8; Hahn et al., Ann NY Acad Sci 2005;1051:433-41; Hahn et al., J Immunol 2005;175:7728-37; and Singh et al., J Immunol 2007;178:7649-57 and Figures 2, 4 and 5. We subsequently showed that these Treg and Ti differ from natural innate immunity Treg and CD8+ cytotoxic T cells. They require the tolerizing peptide for activation, whereas natural T cells are not antigen-specific. In addition, the CD4+ Treg express Foxp3 and work primarily by cell-cell contact, suppressing helper T cell proliferation via membrane-bound TGF and GITR (see, e.g. La Cava et al., J Immunol 2004;173:3542-8). CD8+ Ti also express Foxp3; they suppress CD4+CD25- helper T cells and B cells primarily by secretion of TGFb (see, e.g. Hahn et al., Ann NY Acad Sci 2005;1051:433-41; Hahn et al., J Immunol 2005;175:7728-37; Singh et al., J Immunol 2007;178:7649-57). More recently, we demonstrated that vaccinating BWF1 mice with DNA encoding pCons induced CD8+ T cells that were capable of suppressing disease (see, e.g. Ferrera et al., Ann NY Acad Sci 2007; 1110:99-111).

Similar observations have been made with related wild peptides from CDR1 and CDR3 of the VH region of other IgG murine antibodies to DNA by Mozes and her colleagues (see, e.g. Eilat et al., J Clin Immunol 2000;20:268-78; Zinger et al., Int Immunol 2003;15:205-14; Mauermann et al., Clin Exp Immunol 2004;137:513-20; Sharabi et al., Proc Natl Acad Sci USA 2006;103:8810-5; Sela et al., Eur J Immunol 2006;36:2971-80). In fact, one of the wild peptides from murine antibodies that was identified, "Edratide", administered by subcutaneous injection, has been the subject of clinical trials conducted in human SLE. In vivo, this tolerogenic peptide, Edratide (hCDRl), is confirmed to immunomodulate the expression of genes that play a role in SLE, consequently restoring the global immune dysregulation of lupus patients, consequently demonstrating the activity of this class of peptides in human subjects (see, e.g. Sthoeger et al., J Autoimmun. 2009 Aug;33(l):77-82. Epub 2009).

In the mouse experiments reported to date, and in the human clinical trials, Ig- related peptides are administered either intravenously (mouse) or subcutaneously (human and mouse). The methods and materials disclosed herein described can be used in studies to 1) improve immune tolerance by inducing not only the Treg and Ti described above, but also by inducing IL-10 and TGFP-secreting T cells derived from the gut-associated lymphoid system by oral tolerance, and 2) improving the practical utility of a therapeutic by administering it orally instead of by i.v. or subcutaneous routes. To this end, we have designed and synthesized D-forms of pConsensus. These enantiomeric molecules have a number of specific advantages over the use of L-pCons. For example, in general, D forms of small peptides resist degradation by gastrointestinal acid and proteases, are absorbed from the GI tract, and persist for several hours in circulation. Therefore these unique chemical compounds should provide ample time for induction of peripheral tolerance, and thus for control of SLE.

An L-enantiomer peptide having the sequence FIEWNKLRFRQGLEW is able to bind MHC class I and Class II polypeptides expressed on the surface of T cells in vivo (see Hahn BH et al., Lupus 1997 6(3):330-2; Hahn BH et al., Lupus 1998 7(5):307-13). As also disclosed herein, this D-enantiomer peptide exhibits additional activities, including biological activity including an ability to modulate immune functions (e.g. to reduce the number of the mammal's splenic B cells that make autoantibodies such as those that bind double stranded DNA).

The discovery that oral treatment of SLE-susceptible mice with the disclosed D- amino acid containing peptide enantiomer is as or more effective than oral iv L-pCons treatment suggests that D-pCons binds major histocompatibility complex proteins, even when exhibiting a 3-D architecture comprising a head-to-tail cyclic configuration; and/ or multiple copies of the peptide are coupled to a polymeric matrix (e.g. polylysine as shown in Figure 17). This is especially unexpected in view of art that teaches that MHC class I and II peptide binding interactions are dependent upon the 3-D architecture and/or chirality of the peptide. Specifically, art teaches that D-amino acids play different roles in immune phenomena and further that cross reaction between L- and D- sequences is limited at the T cell level, probably due to different sterical conformations of the MHC- antigen-T cell receptor complexes formed (see, e.g. Sela et al., FASEB J. 11, 449-456 (1997)). Such prior art studies show for example that less than half of a population of T cell hybridomas that are specific for a given L-enantiomer peptide can respond to the corresponding D-enantiomer. Consequently artisans cannot use the MHC class I or II binding activity of a L-amino acid peptide to reasonably predict the binding activity of a corresponding D-amino acid containing peptide, much less any functional activity that may result from such binding. While the reason for this discouraging lack of predictability is unclear, without being bound by a specific scientific theory, observations that L-amino and D-amino acid containing peptides exhibit differential hydration properties as well as structure and transition energies suggest that this phenomena may be governed by these differential material properties of the D and L enantiomers exerting dissimilar effects on the sensitive affinity and avidity coefficients that govern the equilibrium association and dissociation constants of the MHC Class I and Class II protein/peptide binding interactions (see, e.g. Scolnik et al., Phys Chem Phys 2006; 8(3): 333-9; and Berezhkovskiy et al., 2002; 308(2): 239-246). Therefore, clinical data described herein illustrating that the D-amino acid peptide compositions are as or more effective than L-pCons in improving survival in SLE-prone mice suggest that the mechanism of D-pCons action is similar to L-pCons in relation to MHC binding and presentation.

ILLUSTRATIVE EMBODIMENTS OF THE INVENTION

Embodiments of the invention related to peptides comprising D-amino acid residues and methods for making and using such peptides. In particular, every amino acid (except glycine) can occur in two isomeric forms, because of the possibility of forming two different enantiomers (stereoisomers) around the central carbon atom. By convention, these are called L- and D- forms, analogous to left-handed and right-handed configurations. L-amino acids are manufactured in cells and incorporated into proteins. Some D-amino acids are found in the cell walls of bacteria, but not in bacterial proteins. Glycine, the simplest amino acid, has no enantiomers because it has two hydrogen atoms attached to the central carbon atom. Only when all four attachments are different can enantiomers occur.

The invention disclosed herein has a number of embodiments. One is a composition comprising an isolated peptide having the sequence: FIEWNKLRFRQGLEW, wherein at least one amino acid moiety in the peptide is a D- amino acid. Typical embodiments of the invention include compositions comprising a peptide having the sequence FIEWNKLRFRQGLEW, wherein 14 of the 15 amino acids in this composition are D-amino acid moieties. Typically, the peptide is in a head-to-tail cyclic configuration; and/or multiple copies of the peptide are coupled to a non- immunogenic polymeric matrix such as polylysine.. In this context, as is known in the art, the D-form amino acids can be incorporated at any position in the peptide as desired. Thus, for example, in one embodiment, the peptide can comprise a single D-amino acid, while in other embodiments, the peptide comprises at least two, at least three, more at least four, or 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 D amino acids. In some embodiments, essentially every other amino acid is a D-form amino acid. In certain embodiments at least 90%-95% of the amino acids are D-form amino acids.

As noted herein embodiments of the invention comprise tolerogenic peptide compositions and methods for using them (e.g. by administering them to a mammal having SLE). Typically in these embodiments, the peptide within the peptide composition is soluble in vivo and/or the tolerogenic peptide composition does not include an adjuvant (i.e. a substance that enhances the body's immune response to an antigen such as a peptide).

Because the data disclosed herein shows that, like the L-enantiomer peptide, a peptide having sequence FIEWNKLRFRQGLEW wherein 14 of 15 amino acids in this composition are D-amino acid moieties can also bind T cells and modulate their activity, it is expected that those peptides that have L-amino residues in combination to D-amino acid residues (and are therefore stereochemically more similar to the L-enantiomer) will exhibit a similar activity. As is known in the art, D-amino acids are incorporated at one or more positions in the peptide simply by using a D-form derivatized amino acid residue in the chemical synthesis. D-form residues for solid phase peptide synthesis are commercially available from a number of suppliers (see, e.g., Advanced Chem Tech, Louisville; Nova Biochem, San Diego; Sigma, St Louis; Bachem California Inc., Torrance, etc.). Those of skill in the art understand that embodiments of the invention include the D-amino acid peptide (i.e. a peptide having at least one D-amino acid moiety) as well as the salts of this peptide (e.g. pharmaceutically acceptable salts known in the art). For example, as is known in the art, peptides can occur both as a free acid form as well as peptide sodium, potassium or ammonium salts, and other salts derived from alkaline earth elements or other metallic salts.

A similar embodiment of the invention is D-amino acid peptide selected from the group consisting of a peptide of at least 14 D-amino acid residues having the sequence FIEWNKLRFRQGLEW and/ or a salt thereof and/ or the reaction product thereof with an organic derivatizing agent capable of reacting with selected side chains or terminal residues, which reaction product retains at least a portion of the function of the peptide to inhibit specifically the proliferative response and cytokine secretion of T lymphocytes of mice that are high responders to SLE -inducing autoantibodies and/ or a chimeric peptide comprising the sequence FIEWNKLRFRQGLEW linked to a heterologous amino acid sequence.

In certain embodiments, the D-amino acid peptide is coupled to a second molecule. For example, the FIEWNKLRFRQGLEW peptide of the present invention can be modified to form a chimeric molecule comprising FIEWNKLRFRQGLEW conjugated to another molecule such as a polyol (e.g. polyethylene glycol), a small molecule such as avidin or biotin, or heterologous polypeptide or amino acid sequence such as the keyhole limpet hemocyanin protein. A variety of methods for conjugating such molecules are known in the art including for example those disclosed in U.S. Patent Application Nos. 20070111926 and 200501649523.

A chimeric molecule can comprise a fusion of FIEWNKLRFRQGLEW for example with a polyhistidine epitope tag or the like, which provides a further epitope for manipulation (e.g. an epitope to which immobilized nickel can selectively bind). A variety of such epitope tags are well known in the art and are generally placed at the amino- or carboxyl- terminus of peptides. In an alternative embodiment, the chimeric molecule can comprise a fusion of FIEWNKLRFRQGLEW with a polypeptide known to facilitate stability such as an immunoglobulin polypeptide sequence or a particular region of an immunoglobulin or the like. Such a fusion can be for example to the Fc region of an IgG molecule. The Ig fusions can include a substitution of an Ig region or domain or part thereof substituted with FIEWNKLRFRQGLEW. In one such embodiment, the immunoglobulin fusion can include the hinge and/or CH2 and/or CH3 regions, or the hinge, CHI, CH2 and/or CH3 regions of an IgGI molecule. Descriptions of methods for making and using such molecules are disclosed for example in Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); Presta, Curr. Op. Struct. Biol. 2:593-596 (1992); US Patent No. 5,428,130 issued June 27, 1995 and Chamow et al., TIBTECH, 14:52-60 (1996).

Another embodiment of the invention is a method of selecting peptides capable of inhibiting the proliferative response of T lymphocytes from a systemic lupus erythematosus (SLE) patient, comprising: (i) a peptide of at least 14 of 15 D-amino acid residues having the sequence FIEWNKLRFRQGLEW (e.g. a peptide is in a head-to-tail cyclic configuration; and/ or one where multiple copies of the peptide are coupled to a non-immunogenic polymeric matrix such as polylysine); (ii) coupling this peptide to a heterologous amino acid sequence to form a chimeric peptide; and (iii) testing said chimeric peptide for its ability to inhibit the proliferative response of T cells from a SLE patient, or an SLE associated T cell line or clone; and (iv) selecting and producing additional quantities of said chimeric peptide only if it is capable of inhibiting said proliferative response.

In certain embodiments, the peptides of the invention are combined with a pharmacologically acceptable excipient (e.g. an excipient suitable for oral administration to a mammal). An example of this is a D-amino peptide having the sequence FIEWNKLRFRQGLEW further comprising a pharmaceutically acceptable carrier used in orally administered medications. Another example of this is a D-amino peptide having the sequence FIEWNKLRFRQGLEW, further comprising a pharmaceutically acceptable carrier used in parenterally administered medications.

As noted above, the peptides of this invention (e.g. D-amino peptide having the sequence FIEWNKLRFRQGLEW and/ or this peptide coupled to a heterologous amino acid sequence to form a chimeric peptide) are typically combined with a pharmaceutically acceptable carrier (excipient) to form a pharmacological composition. Pharmaceutically acceptable carriers can contain one or more physiologically acceptable compound(s) that act, for example, to stabilize the composition or to increase or decrease the absorption of the active agent(s). For example, therapeutic compositions comprising an embodiment of the invention can be prepared by mixing the desired peptide having the appropriate degree of purity with pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations, aqueous solutions or aqueous suspensions (see, e.g. Remington: The Science and Practice of Pharmacy Iippincott Williams & Wilkins; 21 edition (2005), and Ansel's Pharmaceutical Dosage Forms and Drug Delivery Systems Lippincott Williams & Wilkins; 8th edition (2004)).

Physiologically acceptable compounds can include, for example, carbohydrates, such as glucose, sucrose, or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, protection and uptake enhancers such as lipids, compositions that reduce the clearance or hydrolysis of the active agents, or excipients or other stabilizers and/ or buffers. The peptide is preferably admixed with a carrier comprising a buffering agent and one or several agents selected from the group consisting of carbohydrates and modified carbohydrates and derivatives thereof, polyethylene and/ or polypropylene glycol and derivatives thereof, organic and inorganic core, filler or lubricating materials, fatty acids, their esters and salts, preservatives, antioxidants, and coating agents. The buffering agent should be able to buffer at a pH from about 3 to about 6, preferably at about pH 5.5, i.e. to exert substantial buffer capacity within this range and preferably at about pH 5.5. Since the composition according to the invention is intended for preferred release in the upper part of the small intestine where, during their passage, the acidic contents of the stomach are neutralized by influx of Na+, buffering inhibits or delays an increase of pH exceeding the preferred range or, in other words, in the direction of the upper limit of the preferred range and exceeding its upper limit. Preferred buffering agents are hydrogen and dihydrogen phosphates, such as sodium dihydrogen phosphate and mixtures of sodium dihydrogen phosphate with disodium hydrogen phosphate, calcium tetrahydrogen phosphate, citric acid and mixtures of citric acid and its monosodium salt, fumaric acid and its monosodium salt, adipic acid and its monosodium salt, tartaric acid and its sodium salt, ascorbic acid and its monosodium salt, glutamic acid, aspartic acid, betaine hydrochloride, hydrochlorides of amino acids, such as arginine monohydrochloride and glutamic acid hydrochloride, and saccharic acid. It is preferred for the buffering agent to comprise at least 10% by weight, more preferred at least 25% by weight, most preferred at least 40% by weight of the composition according to the invention. A mixture of two or more buffering constituents can be used.

Unlike typical peptide formulations, the peptides of this invention comprising D- form amino acids can be administered, even orally, without protection against proteolysis by stomach proteases, etc. Nevertheless, in certain embodiments, peptide delivery can be enhanced by the use of protective excipients. This is typically accomplished either by complexing the polypeptide with a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the polypeptide in an appropriately resistant carrier such as a liposome. Means of protecting polypeptides for oral delivery are well known in the art (see, e.g., U.S. Pat. No. 5,391,377 describing lipid compositions for oral delivery of therapeutic agents).

The compositions of the invention are useful in a variety of diagnostic and therapeutic contexts. In certain embodiments of the invention, the peptide can be coupled to a detectable marker and used as a probe, for example to identify T cells in a biological sample (e.g. a biopsy sample) and in particular, a Treg or Ti cell. In other embodiments, the peptide is used as a diagnostic tool to obtain evidence on the presence or susceptibility that a mammal may have for an immunological disorder such as SLE. For example, one embodiment of the invention is an assay for screening the presence of or susceptibility to a mammal to an immunological disorder, comprising labeling an L- or D-amino acid peptide composition comprising the sequence FIEWNKLRFRQGLEW with a detectable label, wherein the peptide comprises a T-cell epitope having a sequence corresponding to a stretch of the sequence of the antigen relevant to the disorder and binds to gene products of the major histocompatibility complex (MHC), classes I and II, on the surface of intact living antigen presenting cells; incubating intact living antigen- presenting cells with the labelled peptide, thus directly binding the peptide to the cells; and then monitoring the extent of binding by the addition of a probe that reacts with the ligand and measuring peptide bound cells versus peptide-unbound cells, whereby the extent of the binding of the peptide to the antigen-presenting cells is correlated to the presence of and/ or susceptibility to the disorder. Suitable labels in this context include, but are not limited to, a radioisotope, a fluorescent compound, a bioluminescent compound, chemiluminescent compound, a metal chelator or an enzyme. Optionally in such assays, the disorder screened for is systemic lupus erythematosus.

Embodiments of the invention further relate to therapeutic agents that will interfere with the binding to MHC gene products and thus, inhibit T-cell responses that are relevant to the disease. For example, in one embodiment, this invention provides methods for ameliorating and/or preventing one or more symptoms of SLE. The methods preferably involve administering to an organism, preferably a mammal, more preferably a human one or more of the peptides of this invention. The peptide(s) can be administered, as described herein, according to any of a number of standard methods including, but not limited to injection, suppository, nasal spray, time-release implant, transdermal patch, and the like. In one particularly preferred embodiment, the peptide(s) are administered orally (e.g. as a syrup, capsule, or tablet).

Embodiments of the invention also include a method of binding an L- or D- amino acid peptide having the sequence: FIEWNKLRFRQGLEW to a T lymphocyte, the method comprising combining the peptide with the T lymphocyte under conditions suitable for a binding interaction to occur and then allowing the peptide to bind the T lymphocyte. Such embodiments can use the peptide as probe for example to identify the presence of a T lymphocyte in a biological sample as a CD4+CD25- helper T lymphocyte. In other embodiments, the binding of the peptide to the T lymphocyte comprises an assay for screening the presence or susceptibility of a mammal to an immunological disorder, the assay comprising labeling the peptide with a detectable label, incubating the labelled peptide with the T cells so that the labelled peptide is bound to the T cells; and then observing the amount of peptide bound cells, wherein the extent of the binding of the peptide to the T cells is correlated to the presence or susceptibility to the disorder (e.g. an autoimmune disorder characterized by the production of autoantibodies. As disclosed below, such methods can be performed both in vitro and in vivo. In certain in vivo embodiments, the binding of the peptide to the T lymphocyte comprises a therapeutic method designed to treat an immune disorder such as SLE

Another embodiment of the invention is a method of inhibiting the production of autoantibodies that bind double stranded DNA in a mammal (e.g. a mouse or a human suffering from SLE), the method comprising administering to the mammal an isolated L- or D-amino acid peptide comprising the sequence: FIEWNKLRFRQGLEW in a head-to-tail cyclic configuration; and/ or multiple copies of the peptide are coupled to a polymeric matrix (e.g. polylysine as shown in Figure 17), wherein the isolated peptide binds to Major Histocompatibility Complex polypeptides expressed by T cells in the mammal; and further inhibits the production of autoantibodies that bind double stranded DNA in a mammal. In some embodiments, the mammal suffers from an autoimmune disorder comprising systemic lupus erythematosus (SLE) and/or nephritis. Optionally, the peptide is coupled to a heterologous amino acid sequence, for example a constant region from an immunoglobulin. In certain embodiments of the invention, the D-amino acid containing peptide is administered orally and can be combined with a pharmaceutically acceptable carrier comprising a composition that inhibits acidic or enzymatic degradation of the peptide. Typically in such embodiments, the administration of the L-amino acid peptide results in an induction of CD4+CD25+Foxp3+ T cells or CD8+Foxp3+ T cells in the mammal. In typical embodiments, the administration of the D- and L-amino acid peptide reduces the number of the mammal's splenic B cells that make antibodies that bind double stranded DNA by at least about 50%. In certain embodiments, the administration of the D-amino acid containing peptide results in a decrease in the concentration of proteins present in the urine of the mammal.

A related embodiment of the invention is a method of treating a subject (e.g. a mouse or a human) having systemic lupus erythematosus (SLE) and a SLE-associated manifestation of nephritis, autoantibodies, and inflammation associated with autoantibodies, said method comprising administering to said subject a therapeutically effective amount of an isolated peptide comprising the sequence: FIEWNKLRFRQGLEW in a head-to-tail cyclic configuration; and/ or multiple copies of the peptide are coupled to a polymeric matrix (e.g. polylysine as shown in Figure 17), wherein said isolated peptide is capable of specifically binding with a T cell receptor present on a T cell in a subject having SLE, and/or is capable of promoting immunological tolerance in a subject, thereby treating said SLE and said SLE-associated manifestation. Methods and materials that can be used and/or adapted for such methods are described for example in U.S. Patent Application No. 20070003543.

In the therapeutic embodiments of the invention, the peptides of the invention are administered in a therapeutically effective amount. The term "therapeutically effective amount" refers to an amount of an agent (e.g. a peptide comprising a sequence: FIEWNKLRFRQGLEW) effective to treat at least one sign or symptom of a disease or disorder in a human (e.g. SLE). Amounts of an agent for administration may vary based upon the desired activity, the diseased state of the patient being treated, the dosage form, method of administration, patient factors such as the patient's sex, weight and age, the underlying causes of the condition or disease to be treated, the route of administration and bioavailability, the persistence of the administered agent in the body, the formulation, and the potency of the agent. It is recognized that a therapeutically effective amount is provided in a broad range of concentrations. Such range can be determined based on in vitro and/ or in vivo assays.

Effective dosages and schedules for administering the peptides of the invention may be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage of peptide that must be administered will vary depending on, for example, the mammal which will receive the peptide, the route of administration, the particular type of peptide used and other drugs being administered to the mammal. Guidance in selecting appropriate doses is found in the literature, for example, on therapeutic uses of peptides such as for example: Therapeutic Peptides and Proteins: Formulation. Processing, and Delivery Systems. Second Edition by Ajay K. Banga (2005); Pharmaceutical Dosage Forms: Parenteral Medications. Volume I (Parenteral Medications, 1) by Kenneth E. Avis, Herbert A. Lieberman, and Leon Lachman (1992); and Goodman & Gilman's The Pharmacological Basis of Therapeutics by Laurence Brunton, John Lazo, and Keith Parker (2005). A typical daily dosage of peptide used alone might range from about 0.5 mg/kg to 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 and up to 100 mg/kg of body weight or more per day, depending on the factors disclosed herein (see, e.g. mouse dose data in Examples 2, 10, 12-16).

EXAMPLES

EXAMPLE 1: ILLUSTRATIVE METHODS AND MATERIALS ASSOCIATED WITH EMBODIMENTS OF THE INVENTION:

Mice

NZB (H-2 ^d/d ), NZW (H-2 ^2/2 ), Balb/c and (NZB x NZW) Fl (H-2 ^d/z ) mice were bred and maintained at the University of California Los Angeles (UCLA) or purchased from The Jackson Laboratories (Bar Harbor, ME). All mice were housed in pathogen free conditions and were treated in accordance with the guidelines of the University of California Los Angeles Animal Research Committee, an Institution accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). All experiments were conducted in female mice. Peptides

The peptides used in this study and the MHC molecules they bind are described in detail (see, e.g. Singh et al., J Immunol 2007;178:7649-57). The tolerizing peptide pCons (FIEWNKLRFRQGLEW (SEQ ID NO: 1)) is artificial; it contains T cell determinants based on the J558 V _H regions of several murine mAb anti-dsDNA from BWF1 mice. The negative control peptide pNeg (AIAWAKARARQGLEW) (SEQ ID NO: 3) binds I-Ed (expressed by BWF1) but is non-stimulatory and non-tolerogenic. Wild 12-mer or 15-mer peptides from V _H of BWF1 anti-DNA Ab that stimulate CD4 ⁺ T cells from BWF1 mice include p7 (GYFMNWVKQSHGKSL) (SEQ ID NO: 4), p34 (MNWVKQSHGKSL) (SEQ ID NO: 5) and p58 (FYNQKFKGKATL) (SEQ ID NO: 6) (see, e.g. Singh et al., J Immunol 2007;178:7649-57). PCDR1 (TGYYMQWVKQSPEKSLEWIG) (SEQ ID NO: 7) is a wild stimulatory peptide described by Eilat et al (see, e.g. Eilat et al., J Clin Immunol 2000;20:268-78) from a similar region in the V _H of a murine mAb anti-DNA Ig. Other non-stimulatory control peptides are pHyHEL (VKQRPGHGLEWIGEI) (SEQ ID NO: 8), derived from the CDR _j /Fr _j V _H region of a murine Ab against hen egg lysozyme (HEL), and pll and p93, which derive from the same V _H of the stimulatory wild Ig peptides as p7, p34 and p58 (BWF1 anti-DNA Ab A6.1). Peptides were synthesized at Chiron Biochemicals (San Diego, CA), purified to single peak on high-performance liquid chromatography, and analyzed by mass spectroscopy for expected amino acid content.

Treatment of mice

For tolerance induction, ten-to-twelve week-old BWF1 mice received a single i.v. dose of 1 mg of one of the peptides, dissolved in saline, as reported previously (see, e.g. Singh et al., J Clin Invest 1995;96:2990-6). Controls in selected experiments were either treated with saline or control peptides.

Cell isolation and staining

Spleen cells were isolated from saline-treated, naive or tolerized, BWF1 mice one- week after administration of pCons after lysis of red blood cells with ACK lysing buffer (Sigma, St. Louis, MO). Cell subsets were purified by incubation with anti-CD4, anti- B and anti-CD8+, anti NKl.l, anti Mac-3, anti Gr-1, microbeads from (Miltenyi Biotech, Auburn, CA). A total of lx 2 x 10 ⁶ freshly isolated spleen cells or CD8 ⁺ T cells were used for staining of cell surface molecules. Antibodies used to analyze the cells included anti-Thyl.2, Anti-CD4, Anti-B220, anti-CD8, anti-CD25 and anti-CD28 (all from BD Pharmingen, San Diego, CA).

Cell sorting

Cell sorting was performed on stained splenocytes from naive and pCons treated mice. Splenocytes were prepared after RBC lysing and lOxlO ⁶ cells/ml were stained with FITC conjugated anti-mouse CD8, APC conjugated CD28 Abs from BD Pharmingen, San Diego, CA. Cells were sorted with FACS SE Vantage (Becton Dickinson) at the UCLA Flow cytometry Core facility. Immunophenotyping

Isolated cells were washed with FACS buffer and 1-2 million cells were used for surface staining and immunophenotyping. Before staining, cells were incubated with rat anti-mouse CD16/CD32 (FCy III/II receptor) monoclonal antibody to block- nonspecific binding. Cells were then stained with Abs to anti-mouse CD3 (clone-145- 2C11), CD8a (Ly-2) (53-6.7), CD4 (L3T4), (clone-RM4-5), CD45R/B220 (RA3-6B2), NK1.1 (PK136), CD49b/Pan NK (Dx5), Mac-3 (M3/84), GR-1 (RB6-8C5), CDllc (HL-3), CD25 (PC61), CD28 (37.51), CD44 (IM7), CD56 (MEM-188), CD62L (MEL- 14), CD122 ( Μ-βΙ), CD137-41BB (1AH2), Granzyme B (16G6), Perforin (e BioOMAK-D) and CTLA-4 (UC10-4F10-11). Immunophenotyping of splenocytes from untreated and pCons-tolerized mice was performed with a FACSCalibur™ flow cytometer (BD Biosciences, San Jose, CA) using either Cell Quest (BD Biosciences) or FCS Express software (De Novo Software, Thorn hill, ON). Forward and side-scatter parameters were used to gate on live cells. Staining with multiple combinations of Ab was performed according to standard procedures described elsewhere (see, e.g. La Cava et al., J Immunol 2004;173:3542-8; Hahn et al., Ann NY Acad Sci 2005;1051:433-41). Staining with annexin V and with -7AAD was used to distinguish cells undergoing apoptosis from necrotic dead cells. The conjugated Abs used were purchased from BD Pharmingen and e Biosciences (San Diego, CA).

In vitro suppressive assay

Spleen cells were isolated from BWF1 mice after one- week of pCons treatment as described before. B220 ⁺ B cells, CD4 ⁺ , and CD8 ⁺ T cells were isolated via magnetic bead separation using Vario Macs apparatus (Miltenyi Biotech). CD4 ⁺ T cells, CD4 ⁺ CD25 cells, as responders, irradiated and non-irradiated B cells as antigen presenting cells, and CD8 ⁺ T cells as suppressors from pCons treated mice were used in the experiments, lxl 0 ⁵ isolated cells were cultured in triplicate in 96-well plates with varying amounts of CD8 ⁺ Tcells, 2x 10 ⁵ irradiated and non-irradiated B cells with 20μg/ ml of pCons or control peptides to activate suppression for 96 hours, then pulsed with 0.5 μθΛ εϋ ( ³ H) thymidine (Perkin Elmer, Wellesley, MA) during the last 18h of culture. Cells were harvested using an automated cell harvester onto filters, and radioactivity was counted in a Beckman scintillation counter.

Intracellular staining

For intracellular staining, cells were first stained for expression of cell surface markers and then fixed, permeabilized, and stained using the Cyto/n vitro suppressive assay

Spleen cells were isolated from BWF1 mice after one- week of pCons treatment as described before. B220 ⁺ B cells, CD4 ⁺ , and CD8 ⁺ T cells were isolated via magnetic bead separation using Vario Macs apparatus (Miltenyi Biotech). CD4 ⁺ T cells, CD4 ⁺ CD25 cells, as responders, irradiated and non-irradiated B cells as antigen presenting cells, and CD8 ⁺ T cells as suppressors from pCons treated mice were used in the experiments, lxl 0 ⁵ isolated cells were cultured in triplicate in 96-well plates with varying amounts of CD8 ⁺ Tcells, 2x 10 ⁵ irradiated and non-irradiated B cells with 2C^g/ ml of pCons or control peptides to activate suppression for 96 hours, then pulsed with 0.5 μθΛ εϋ ( ³ H) thymidine (Perkin Elmer, Wellesley, MA) during the last 18h of culture. Cells were harvested using an automated cell harvester onto filters, and radioactivity was counted in a Beckman scintillation counter.

Intracellular staining

For intracellular staining, cells were first stained for expression of cell surface markers and then fixed, permeabilized, and stained using the Cyto-fix/ cytoperm kit (BD Pharmingen, San Diego, CA) according to manufacturer's instructions.

Cytokine measurement

Cytokine measurement in the supernatant of cultured spleen cells was done with BD OptEIA™ ELISA kits (BD Biosciences and Bio legends Inc., San Diego, CA) for IFNy, IL-2, TGF and IL-10. Intracellular mRNA encoding IFNy, IL-10, Foxp3 and GF was analyzed by real-time RT PCR. GAPDH was used as a house-keeping gene for normalization.

Assays for measurement of anti-DNA Ab

Assays were performed to measure anti-DNA Ab according to art accepted protocols (see, e.g. Singh et al., J Clin Invest 1995;96:2990-6; Hahn et al., Arthritis Rheum 2001;44:432-41; La Cava et al., J Immunol 2004;173:3542-8; Hahn et al., Ann NY Acad Sci 2005;1051:433-41; Hahn et al., J Immunol 2005;175:7728-37; Singh et al., J Immunol 2007;178:7649-57). For optimal antibody production, we co-cultured B cells from old naive BWFl females with 2+ proteinuria or higher, with CD4 ⁺ T cells from young 10-12 week old naive BWFl females without proteinuria, and with CD8 ⁺ T cells from 10-12 week-old females treated one week prior with saline or pCons. Ratios are 1 B cell to 10 CD4 ⁺ T cells to 10 CD8 ⁺ T cells. After 5 days, culture supernatants were collected, concentrated, and analyzed for anti-DNA IgG by ELISA.

Real-time PCR

Real-time PCR was analyzed according to art accepted protocols (see, e.g. Hahn et al., Ann NY Acad Sci 2005;1051:433-41). Briefly, total RNA was isolated with TRIzol (Invitrogen Life Technologies, Carlsbad, CA) as per manufacturer's protocol. Reverse transcription used 50 ng of total RNA. The oligonucleotide sequences used for the primers and TaqMan probes are as follows; IFN-γ forward, 5' TGA GAC AGA AGT TCT GGG CTTCT 3' (SEQ ID NO: 9); reverse, 5' CAAGAT GCA GTG TGT AGC GTTCA 3' (SEQ ID NO: 10): probe, 6FAM TCC TGCGGCCTAGCTCTGAGA TAMRA (SEQ ID NO: 11). IL-10 forward, 5' CAG CCG GGA AGA CAA TAA CTG 3' (SEQ ID NO: 12); reverse, 5' CCG CAG CTC TAG GAG CAT GT 3' (SEQ ID NO: 13); probe 6FAM ACC CAC TTC CCA GTC GGC CAG AG TAMRA. TGF forward, 5' AAACGGAAGCGCATCGAA 3' (SEQ ID NO: 14); reverse, 5' GGGACTGGCGAGCCTTAGTT 3' (SEQ ID NO: 15), probe 6FAM CCATCCGTGGCCAGATCCTGTCC TAMRA (SEQ ID NO: 16). Foxp3 forward, 5 GCAGGGCAGCTAGGTACTTGTA 3' (SEQ ID NO: 17); reverse, 5' TCTCGGAGATCCCCTTTGTCT 3' (SEQ ID NO: 18); probe 6FAM TCCGAACAGCATCATCCTTCTTAGCATCC TAMRA (SEQ ID NO: 19). The amplification primers were at 900 nM and the probe at 200 nM. A passive reference dye (ROX) provided an internal standard for normalization of FAM fluorescence, correcting for fluctuations due to volume changes. For relative quantitation, a standard curve was constructed for each primer and probe set, using total RNA. RNA was isolated from spleen cells of 10-13 week-old naive or tolerized mice. Spleen cells from 2 to 3 mice in each group were pooled for each experimental group. For some experiments, CD4 ⁺ and CD8 ⁺ cells were isolated by positive selection using micro beads with Miltenyi AutoMACS as described above. A ribosomal RNA control primer and probe set (Applied Biosystems) were used for normalization purposes. The possibility of genomic DNA contamination was excluded by use of no reverse transcriptase controls in combination with ribosomal primers. GAPDH was used as endogenous control in each experimental set. All samples were run in duplicate. Normalization was employed as indicated in the figure legends. siRNA transfection

CD8 ⁺ CD28 ⁺ and CD8 ⁺ CD28 T s suppressive cells and CD8 ⁺ T cells isolated as described above were plated and cultured in 24 well plates for 24 hours in complete medium containing 10% FCS. For transfection, Silencer siRNA Transfection Kit from Ambion (Austin, TX) was used. OptiMEM reduced serum medium (Gibco BRL) was used to dilute the siPORT amine. Validated siRNA of FoxP3 and GAPDH were obtained from Ambion, as well as positive and negative siRNA controls. The negative control siRNA was a scrambled sequence that bears no homology to human, mouse or rat genomes. The transfection agent alone served as another control (siPORT amine). The agent was mixed with siRNA of Foxp3 (50-100nM) and GAPDH (50- lOOnM) or controls in serum free medium and incubated at RT for 30 min. Cells were transfected with siRNA complexes by overlaying siRNA drop-wise onto the cells. After 8-10 hours, medium was removed and fresh medium (1-2 ml) added. Viability was assayed with trypan blue staining. After 48 hours of culture, transfected CD8 ⁺ T cells were transferred to cultures of fresh BWF1 CD4 ⁺ T cells plus B cells plus pCons for measurement of suppression of anti-DNA Ab production. Some transfected cells were lysed with cell lysing solution (Invitrogen) and RNA isolated for real-time PCR, to validate knock down of the target gene.

Statistical analyses

Statistical analyses were performed using Prism 4 software (GraphPad, San Diego, CA). Parametric testing between two groups was performed by the paired /-test or by Mann Whitoey U test. Non-parametric testing among more than two groups was performed by one-way analysis of variance (ANOVA). P values less than 0.05 were considered significant RESULTS:

D-pCONS is equivalent to L-pCONS in ability to induce suppression of IgG anti- DNA production in BWF1 mice.

As shown in Example 1, intravenous administration of either 500 or 250 ug of

D-pCons, was effective in suppressing anti-DNA antibody production by naive BWF1 CD4+CD25- helper T cells cultured with naive BWF1 B cells. The numbers of splenic B cells making IgG anti-DNA dropped from 65 per 10 ⁶ B cells in the untreated group to 30-32 in the tolerized groups. In contrast, the 125 ug-dose of D-pCons was not effective in inducing suppression.

Compare these data with D-pCons to those with L-pCons, shown in Figure 2. L- pCons were given once i.v. and spleen cells harvested 2 weeks later. Note that for L- pCons in Figure 2, the combination of naive B cells plus CD4+CD25- helper T cells gave a mean of 160 anti-DNA antibody- forming cells per 10 ⁶ B cells (column 3), whereas addition of CD4+CD25+ Treg from tolerized mice to the culture reduced the AFC to 25 per 10 ⁶ B cells (column 4). These differences were statistically significant, p < 0.001. Note also that the suppression was abrogated by incubation of the cultures with antibodies to GITR (column 6) or TGF -LAP (column 7), but not by CTLA4-Ig (column 8).

The ability of D-pCons compared to L-pCons (linear peptides) to suppress anti-

DNA production when the peptide is fed were initially studied. Mice were fed by gavage every other day for 5 days out of each month. After the 2 ^nd month, spleen cells were harvested 2 weeks after the onset of the 2 ^nd round of feeding. Three different doses are being studied, based on survey of the literature for disease-reducing doses of short linear peptides fed to mice that develop EAE, diabetes type I, or collagen II-induced arthritis - all examples of autoimmune diseases. The doses are 25, 100 and 250 ug (Example 10).

Effect of D-pCons Feeding on Clinical Disease.

Data in example 3 show the suppression of clinical disease that occurs in BWF1 mice treated monthly from age 10 weeks with 1 mg of L-pCons intravenously. Using 50% mortality times, the lifespan is prolonged 30-32 weeks. Improved survival was accompanied by significant delay in the appearance of IgG anti-DNA in serum and of nephritis (see, e.g. Hahn et al., Arthritis Rheum 2001;44:432-41).

Assessments of various embodiments of the peptides of the invention are made according to art accepted procedures. For example, after the successful induction of regulatory/ suppressive T cells with the oral administration of a peptide embodiment, this peptide embodiment can be tested for its ability to generate similar cells from human lymphocytes in vitro. Identifying the T cells which Regulate SLE-like Disease

As shown in Figure 4, the CD 8+ Ti induced by i.v. administration of L-pCons are potent in suppressing nephritis and prolonging survival in vivo (see, e.g. Hahn et al., J Immunol 2005;175:7728-37). These data represent a single transfer of 10 x 10 ⁶ CD8+ T cells from spleens of tolerized mice to sublethally irradiated syngeneic recipients.

As shown in Figure 5, the potency of the CD8+ Ti from tolerized mice can be demonstrated in vitro in the culture assays described in Methods. It is necessary to activate Ti suppression by adding L-pCons to the culture, and the suppression can be abrogated by silencing Foxp3 expression (via transfection with siRNA) in the Ti, but not by silencing p53 or using a scrambed siRNA in the Ti (see, e.g. Singh et al., J Immunol 2007;178:7649-57).

Although not tested to date, we expect several different cells capable of downregulating anti-DNA production and therefore of preventing/ suppressing nephritis and improving survival in BWF1 mice treated orally with D-pCons, including the CD4+CD25+Foxp3+ Treg and CD8+Foxp3+ Ti already described in the i.v. system and in addition CD4+ IL10- and/or TGF -secreting T cells which are characteristics of oral tolerance. These cells will be searched for in the following ways: a) enumerating the surface phenotypes as well as intracellular Foxp3, TGF , IL-10, IL-12, IL17, IFNg in the cells from spleens and mesenteric lymph nodes of mice following gavage (we expect tolerized mice compared to mice gavaged with saline to have reduced IL-12, IL-17 and IFNg which mediate SLE in BWF1 mice, and increased Foxp3, TGF and possibly IL- 10. In general TGF-beta-expressing and Foxp3-expressing cells are increased numerically in the i.v. L-p Cons -treated mice, and we expect to detect them easily. Expression of IL- 10 tends to be quite low (<1% of spleen cells even in tolerized mice). Therefore, to be sure to detect changes in cytokines, one can analyze mRNA by PCR technology for Foxp3 and the cytokines mentioned.

As is described in the art, one can examine the cell subsets of interest for the cytokines of interest and for Foxp3. Those subsets will include total CD4+, CD4+CD25+, CD4+CD25-, CD8+CD28+, CD8+CD28-. Since the dendritic cells that mediate oral tolerance stay within the gut wall, one typically will not search for them in the periphery.

Finally, to ensure that the cells identified are functional suppressors, one can isolate the cells of interest from tolerized vs. saline-treated mice, and study them in vitro for ability to suppress proliferation of CD4+CD25- helper T cells as well as anti-DNA production, and in vivo for ability to delay disease, using the model shown in Figure 4 (see, e.g. Hahn et al., Ann NY Acad Sci 2005;1051:433-41).

Determining whether D-pCons can Induce Regulatory T cells in Human SLE

In Figures 6 and 7, we show data on the ability of L-pCons to mature the CD4+CD25hiFoxp3+ natural regulatory cells in patients with SLE. In these experiments, pCons and other stimulatory (peptides B and D) peptides and non- stimulatory peptides (peptide A) that are wild peptides from human monoclonal antibodies to DNA were incubated with peripheral blood mononuclear cells from patients with SLE. CFSC labeling showed that the expansion seen after 5 days, and shown in the figures, was attributable to expansion of existing CD4+CD25+ T cells and not induction of such cells de novo. Thirteen of 23 patients showed expansion of CD4+CD25hi cells to more than the usual 2-3% of the peripheral blood MNC, and most of those patients also overexpressed Foxp3 in those cells. Such cells are thought to be regulatory T cells. The ability to expand the cells was not confined to pCons, as expected (there is considerable degeneracy in the ability of human T cells to recognize Ig-derived peptides in patients with SLE. However the fact that L-pCons has this capacity provides evidence that it may be useful therapeutically in human SLE. Interestingly, the patients who responded with expansion of their Treg all had high titer antibody to DNA at the time the cultures were established. This may indicate a subgroup of patients likely to respond to this potential intervention.

EXAMPLE 2: SUPPRESSION OF SYSTEMIC LUPUS ERYTHEMATOSUS IN VIVO BY INDUCTION OF REGULATORY/SUPPRESSOR T

LYMPHOCYTES FOLLOWING ORAL OR SUBCUTANEOUS ADMINISTRATION OF AN AUTOANTIBODY-BASED IGG 15-MER

PEPTIDE D FORM OF PCONSENSUS (D-PCONS)

Autoantibodies contain amino acid sequences in variable regions that are T cell epitopes and can stimulate a) helper T cells to expand autoantibody production by autologous B cells, or b) regulatory/ suppressive T cells that suppress both autologous helper T and B cells. We identify several such T cell epitopes in the VH regions of several monoclonal antibodies to DNA made from NZB/NZW Fl female mice (BWF1) - a model of SLE - and from anti-DNA of several patients with SLE (see, e.g. Ebling et al., Arthritis Rheum. 1993; 36(3):355-64; and Kalsi J et al., Lupus 2004; 13:490-500). Anti-dsDNA are important in induction of nephritis in mice and some patients, and are specific markers for SLE clinically.

We administered i.v. high doses of selected stimulatory 12-to-15-mer VH peptides singly and in combination to young BWF1 mice before onset of clinical nephritis; the combination was effective in delaying anti-DNA production and nephritis and to prolong survival significantly (see, e.g. Singh et al., J Exp Med. 1995 (6):2017-27; 1995; Singh et al., J Clin Invest. 1995; 96(6):2990-6; Singh et al., J Clin Invest. 1998; 102(10):1841-9 J Exp Med. 1995; 183(4):1613-21; and Singh et al., Immunol Rev. 1998; 164:201-8). Since this increase in survival was small (6 weeks), we developed an algorithm based on 435 VH sequence peptides to create an artificial 15-mer peptide containing amino acid sequences which bind to I-Ed (one of the MHC Class II molecules in BWF1) and to be stimulatory for BWF1 T cells - which we called pConsensus or pCons. We administered the L form of pCons as a high dose i.v. tolerogen to BWF1 females once a month; this resulted in 24-week-prolongation of survival as well as significant delay in appearance of anti-DNA, anti-phospholipid, and proteinuria (Hahn et al., Arthritis Rheum. 2001 44(2):432-41). The control artificial 15- mer, pNegative (pNeg) was constructed to bind I-Ed but not stimulate T cells. Figures 3A and 3B respectively show: (1) the model of L-pCons and L-pNeg; and (2) the survival data for BWFl mice treated with the two peptides.

Subsequent data show the clinical benefit of pCons in BWFl mice result from the following factors. First, the induction of CD4+CD25+Foxp3 regulatory T cells (Treg) which are peptide-specific and directly suppress CD4+CD25- helper T cells on contact (probably both via membrane-bound TGFP and GITR) as well as B cells. This results in suppression of anti-DNA production, as shown disclosed for example in La Cava et al., J.I. 2004, 173: 3542-3548. Second, the induction of CD8+Foxp3+ non- cytotoxic suppressive T cells (Ts) which suppress directly both CD4+CD25- helper T cells and autologous anti-DNA-secreting B cells. These Ts are peptide-specific and work at least in part via secretion of TGF (see, e.g. Hahn et al Ann N Y Acad Sci. 2005; 1051:433-41; Singh RP et al., J. Immunol. 2007; 178(12):7649-57; and Singh et al., J Immunol. 2008; 180(4):2069-80). These Ts on adoptive transfer to young BWFl mice significantly delay appearance of anti-DNA and proteinuria and significantly prolong survival, as disclosed for example in Hahn et al., J.I. 2005, 175: 7728-7737. These cells can also be induced by vaccination of BWFl mice with DNA encoding human IgGl and pCons (see, e.g. Ferrera et al., Ann NY Acad Sci 2007; 1110:99-111). Third, pCons induces anergy in CD4+ helper T cells (See, e.g. La Cava et al., J.I. 2004, 173: 3542- 3548).

Next, we studied the ability of L-pCons to induce Treg in T cells from the peripheral blood of patients with SLE (36 patients, 32 healthy controls). Stimulatory control peptides B and D are wild peptides from human mAb anti-DNA; peptide A is a nonstimulatory negative control (see, e.g. Kalsi et al., Lupus 2004; 13:490-500). As shown in Figure 6, addition of pCons or peptides B and D to cultures of SLE T cells expanded CD4+CD25hi populations in some patients (and in some controls: we have not found a stimulatory Ig peptide that is exclusively recognized by SLE patients). These expanded cells were regulatory (Figure 8): they suppressed proliferation and IFNg synthesis by autologous CD4+CD25- cells in culture. Numbers of CD4+Foxp3+ T cells were also expanded and silencing of Foxp3 by transfection with specific siRNA for Foxp3 abrogated the suppressive capacity of the induced T reg by ½ (3 ^rd panel, Fig 8). Finally, as shown in FIG. 9, the expression of Foxp3 in CD4+CD25+ T cells correlated positively with serum levels of IgG and of anti-dsDNA in the SLE patients, but correlation with the Selena-SLEDAI measure of disease activity was not significant (p<0.09). Patients who were anti-DNA negative were unlikely to respond to pCons with expansion of Treg (see, e.g. La Cava et al, Lupus. 2008;17(5):421-5).

Lastly, we synthesized the D-amino acid form of pCons for the purpose of oral administration because D-amino acids are resistant to gut protease degradation.

We observed the clinical effects of feeding either D- or L-peptides with high dose (250 ug) feedings of D-peptide compared to the same dose of L-peptide. A control group was fed saline on the same schedule as the peptide feedings, which is daily for 5 days out of every 30 days. Each group contains 14 mice; treatment was begun at age 10 weeks. Observed effects on anti-DNA are as follows. At 24 weeks of age (first panel FIG. 10), there were trends to lower anti-DNA antibody levels in both D and L peptide groups. Differences did not reach statistical significance. However, at 34 weeks (third panel FIG. 10), with anti-DNA rising higher in the saline groups, ANOVA analysis showed statistically significant differences (p< 0.01), with anti-DNA in L-peptide significantly lower than saline group p<0.05 by Tukey's analysis. One-tailed t test analysis of data showed L-peptide significantly lower than saline (p = 0.03) and D-peptide borderline (p=0.17 by one-tailed t test). Note that the saline control group is lower than the positive control anti-DNA, which is serum from BWF1 mice with heavy proteinuria and imminent death.

Observed effects on Proteinuria are as follows. At 24 weeks of age (panel 2 in

Figure 10), there are no differences in mean level of proteinuria (measured as zero to 4+ using Azostix) in mice in any of the treatment groups. However, at 34 weeks (panel 4 in Figure 10), proteinuria is lower in the L-peptide group (p = 0.01) and lower in the D- peptide group (p = 0.18). These data suggest that only at late time points a significant decrease in anti- DNA and proteinuria with the L-peptide and not the D-peptide occurs. These are weak effects and suggested the need to both design a different formulation for the peptides and to alter dosing the dosing schedule.

EXAMPLE 3: ORAL ADMINISTRATION OF DIFFERENT FORMS OF A TOLEROGENIC PEPTIDE DEFINE THE PREPARATIONS AND DOSES THAT DELAY ANTI-DNA AND NEPHRITIS AND PROLONG SURVIVAL IN SLE-PRONE MICE

Inducing tolerance to autoreactive molecules is an emerging therapeutic method for multiple autoimmune diseases. In systemic lupus erythematosus (SLE), immune tolerance— the ability of immune cells to distinguish between self and non-self antigens— fails, leading to dysregulated immune responses and systemic tissue damage. Treatment options for SLE are largely limited to immune suppressive drugs and other immune system modifiers that do not specifically target the mechanistic basis behind the breakage of tolerance and autoreactivity to self-molecules. As many autoantigens are protein- based and MHC molecules typically present small peptides to T cells, it is logical that peptide-based tolerogenic treatments would be utilized to treat autoimmune disease (see, e.g. Ali et al., Expert Rev Vaccines. 2005; 4:881-9). Peptides based on self-antigen have been used to treat mouse models of rheumatoid arthritis (see, e.g. Isaacs et al., Rheumatology (Oxford). 2008;47:1461-8), multiple sclerosis (see, e.g. Fontoura et al., Int Rev Immunol. 2005;24:415-46), and SLE (see, e.g. Iikuni et al., Expert Opin Biol Ther. 2009;9:201-6; Wu et al., Clin Immunol. 2009;130:111-22).

Our group developed a tolerogenic 15-amino acid peptide based on sequences from heavy chains of four different NZBxNZW Fl (BWF1) anti-double stranded (ds)DNA antibodies. Optimal stimulatory amino acids at each position were determined by computer algorithm with the resulting consensus peptide named pConsensus (pCons) (see, e.g. Hahn et al., Arthritis Rheum. 2001;44:432-41; Ohnishi et al., Int Immunol. 1994;6:817-30; Tsao et al., J Clin Invest. 1990;85:530-40). WiUiams et al. iUustrated that, in addition to causing autoimmunity through binding dsDNA, anti-DNA antibodies themselves stimulate circulating T cells and augment SLE disease progression in humans (see, e.g. Williams et al., Lupus. 1995;4:464-71). Our lab observed similar results in BWF1 mice (see, e.g. Ebling et al., Arthritis Rheum. 1993;36:355-64), suggesting that the heavy chain of abundant autoantibodies are also potent autoantigens. Intravenous (i.v.) treatment of BWF1 mice with pCons significantly increased survival and delayed nephritis in BWF1 mice (see, e.g. Hahn et al., Arthritis Rheum. 2001;44:432-41), due in part to the ability of pCons to upregulate regulatory CD4+ and CD8+ T cells (see, e.g. La Cava et al., J Immunol. 2004;173:3542-8; Singh et al.,. J Immunol. 2008;180:2069-80; Singh et al., J Immunol. 2007;178:7649-57). The Mozes group has also examined inducing tolerance using a different tolerogenic epitope of anti-DNA antibodies (hCDRl) and found that it also ameliorates SLE symptoms in BWF1 mice (see, e.g. Eilat et al., Proc Natl Acad Sci U S A. 2001;98:1148-53; Sharabi et al., Proc Natl Acad Sci U S A. 2006;103:8810-5; Lapter et al., Arthritis Rheum. 2009;60:3744-54) via induction of regulatory T cells when administered subcutaneously (s.c.) (see, e.g. Sharabi et al., Proc Natl Acad Sci U S A. 2006;103:8810-5; Sharabi et al., Immunology. 2007;121:248-57; Sharabi et al., Clin Immunol. 2006;119:146-55; Sharabi et al., J Immunol. 2007;179:4979- 87; Sharabi et al., J Immunol. 2008;181:3243-51; Sthoeger et al., Hum Immunol. 2009;70:139-45). hCDRl has been examined clinically and decreases both disease activity and inflammatory cytokine production (see, e.g. Sthoeger et al., J Autoimmun. 2009;33:77-82). In addition, the Datta group used subcutaneously injected peptides derived from histones, the major autoantigen component of the nucleosome, to prolong survival and delay nephritis in the SNF1 SLE mouse model (see, e.g. Kang et al., J Immunol. 2005;174:3247-55; Skaggs et al.,. Hum Immunol. 2008;69:790-6).

As orally available therapeutics are easier to administer with better patient compliance than either i.v. or s.c. injections, we wanted to examine whether oral tolerance could be induced by pCons. Recent work illustrates that nasal and oral delivery of F(ab')2 fragments of anti-CD3 antibodies delays nephritis in the SWF1 and BWF1 SLE mouse models (see, e.g. Wu et al., Lupus. 2009;18:586-96; Wu et al., J Immunol. 2008;181:6038-50). In addition, Wu et al. used the Datta histone peptide to induce nasal tolerance, leading to delays in nephritis and the appearance of autoantibodies in SWF1 mice (see, e.g. Wu et al., J Immunol. 2002;169:1126-34). We tested whether multiple forms and doses of pCons affected disease in the BWF1 mouse model when delivered orally. METHODS

Mice

(NZB x NZW)F1 mice were purchased from Jackson Laboratory (Bar Harbor, ME USA). All mice were housed in pathogen-free conditions and treated in accordance with the guidelines of the University of California, Los Angeles Animal Research Committee, an institution accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). Only female mice were used. Peptides

The sequence and derivation of pCons (FIEWNKLRFRQGLEW) has been described elsewhere (see, e.g. Hahn et al., Arthritis Rheum. 2001;44:432-41). L-pCons, L-MAP (multiple antigenic peptide, see, e.g. the embodiment shown in Figure 17) pCons, D-MAP pCons, L-cyc (head-to-tail cyclic) pCons, and D-cyc pCons were synthesized by GenScript (Piscataway, NJ USA). D-pCons was synthesized by Bachem (Torrance, CA USA). All peptides were≥95% pure except the MAPs, which for synthesis reasons were only 75% pure. pCons MAPs were constructed on a four-branched polylysine backbone (see, e.g. Figure 16). All peptides were dissolved in DMSO then diluted in sterile water so that the final concentration of DMSO in all preparations was 1%. Diluted peptides were separated into aliquots for a single week's feeding and frozen at -80°C until the day of use.

Or l administr tion of pCons

Feeding by oral gavage was initiated at 11 weeks of age. During the first week, mice were fed three times on alternate days. Between 12-40 weeks of age, animals were fed once per week, totaling 30 weeks of treatment. 100 μΐ of peptide/ 1% DMSO solution was administered to each animal using a sterile glass syringe and a gavage needle. Control animals were either fed 1% DMSO (DMSO) or nothing (unfed).

Proteinuria Starting at 18 weeks of age (7 weeks after treatment initiation) and continuing through 44 weeks of age (4 weeks after termination of treatment), urine protein was determined weekly for all animals using urine reagent strips (CTMI 2PG, Cole-Taylor). Colorimetric proteinuria readings were determined for each animal and scored from 0-4 (0=no protein/trace, 1 = ~30 mg/dl, 2=~100 mg/dl, 3=~300 mg/dl, 4=~2000 mg/dl). Cumulative proteinuria (i.e., all weekly proteinuria scores for animals in each group were added and averaged, and the last score of a dead animal was carried through the last proteinuria reading) was compiled, graphed and statistically analyzed using Prism software (GraphPad, version 4).

Serum anti-dsDNA antibody determination

50-75 μΐ blood was collected monthly (between 20-40 weeks of age, 6 collections total) by retroorbital bleeding of anesthetized mice. After centrifugation to remove clotting factors and cells, serum was stored at -80°C until use. Anti-dsDNA antibody titers were determined by ELISA of pooled serum samples (see below) from each treatment group at each timepoint. Briefly, murine dsDNA (100 μg/ml, Sigma) was adsorbed onto 96-well high binding plates (Costar EIA plates, #3590). After blocking (2% BSA/ 0.05% Tween-20/PBS), pooled serum samples were added in triplicate (50 μΐ of a 1:100 dilution of straight serum). Bound anti-dsDNA antibodies were detected with alkaline phosphatase-conjugated goat anti-mouse IgG (Caltag). i>-nitrophenyl phosphate (Sigma) was used as substrate and absorbance was read at 405 nm. As each timepoint required multiple plates that would have to be directly compared to each other, a previously-determined individual serum sample with high anti-dsDNA titer was used as an inter-plate control for all experiments. This sample was represented in quadruplicate on each plate and every attempt to equalize the control serum sample to absorbance=0.8 on each plate was made to ensure readings in the linear range of the assay and to enable inter-plate absorbance comparisons. Pooled samples (1:100) were made for each treatment at each timepoint by adding 1 μΐ serum taken from individual mice in each treatment group to 792 μΐ PBS (n=8, all groups). If an animal died before the end point of the study, a 1 μΐ sample was taken from that animal's last bleed. Results from all timepoints were compiled, then analyzed and graphed using Prism.

Serum IgG determination

Diluted, pooled serum at 1:100 (identical to the dilutions analyzed for anti- dsDNA) for each treatment group at each timepoint was adsorbed onto 96 well high binding plates in triplicate. Wells were blocked and total serum IgG was identified as described for anti-dsDNA antibody detection. Cumulative total serum IgG for all timepoints was analyzed and graphed using Prism.

Longitudinal survival

Survival was monitored three times per week up to 47 weeks of age, and deaths were recorded as weekly events. Results were analyzed and graphed using Prism.

Serum GF concentration using ELISA

The TGF l Quantikine ELISA kit (R&D Systems, MBIOOB) was utilized to determine serum TGFP levels. 5 μΐ serum from individual animals in each treatment group at each timepoint were pooled (40 μΐ total) and acid activated per the manufacturer's directions. Samples were diluted and assayed in duplicate exactly as described by the manufacturer. Prism was used to construct a TGF standard curve and identify unknown sample TGF concentrations. Cumulative TGF levels over all timepoints were graphed using Prism.

Statistical analysis

Prism 4 software (GraphPad) was used for all statistical determinations. Testing between two groups (unfed control or DMSO-fed control versus individual treatment groups) was performed using the Mann- Whitney U test for proteinuria, anti-dsDNA antibody titer, total serum IgG, and TGF concentration. Cox regression was performed for survival curves. R values≤0.05 were considered significant.

RESULTS

pCons peptide variants and feeding schedule We were initially concerned that linear pCons would be sensitive to gut peptidases and proteases, as it is constructed of L-amino acids (see, e.g. Navab et al., Circulation. 2002;105:290-2). Therefore, we utilized a version of pCons in which every amino acid (except for the glycine at position 12) is a D-amino acid (D-pCons). Cyclic peptides such as the immunosuppressant cyclosporine, where the N- and C-termini are linked via a standard peptide bond, are more stable to proteolytic degradation (see, e.g. Pauletti et al., Adv Drug Deliv Rev. 1997;27:235-56; Humphrey et al., Drug Metab Rev. 1986;17:283-310). Therefore, we also tested cyclic peptides of L- and D-pCons (L-cyc and D-cyc, respectively). These cyclic peptides comprised the FIEWNKLRFRQGLEW sequence, where the N-terminal F amino acid moiety is linked to the C-terminal W amino acid moiety via a standard peptide bond (i.e. linked head-to-tail). Finally, the multiple antigen peptide (MAP) system is a unique way to multimerize tolerogens /antigens on a non-immunogenic background (polylysine) and has been postulated to make peptides more orally available (see, e.g. Tarn et al., Methods Enzymol. 1997;289:612-37). Both L-MAP and D-MAP, therefore, were constructed for these experiments. We used 10, 100, and 500 μg doses to attempt to distinguish between tolerogenic or immunogenic doses (see, e.g. Faria et al., Immunol Rev. 2005;206:232-59; Faria et al., Clin Dev Immunol. 2006;13:143-57). High doses of L-pCons (1 mg) are the most tolerogenic when administered i.v. (see, e.g. Hahn et al., Arthritis Rheum. 2001;44:432-41; La Cava et al., J Immunol. 2004;173:3542-8), although it was unclear if this would translate to oral delivery. As pCons is hydrophobic, we dissolved all peptides in a small amount of DMSO then diluted to a 1% aqueous solution. Control animals were fed either 1% DMSO or nothing (unfed). We utilized the BWF1 mouse model of SLE in these experiments because these animals spontaneously acquire SLE-like symptoms, such as nephritis and anti-dsDNA antibodies, without immunization or exogenous disease acceleration. There were eight mice per treatment group. Eleven- week old mice were initially fed three times in the first week of treatment, then fed once/week for the next 29 weeks. Proteinuria was measured weekly starting at week 7 of treatment, and monthly blood draws were started at week 11 of treatment (Figure 11). Survival was monitored over the course of 47 weeks (36 weeks post-initiation of treatment).

BWF1 mice fed multiple forms and concentrations of pCons had significantly lower proteinuria values than controls

Weekly measurements of proteinuria for animals in each group were averaged and plotted in Figure 12. Multiple treatment groups had significantly less proteinuria when compared to the unfed and DMSO-fed groups. Notably, all three pCons concentrations in both the D-MAP and L-MAP groups were significantly lower than controls. No other groups fed 500 μg (high concentration) pCons had altered proteinuria. Although treatment with the D-cyc form of pCons led to lower proteinuria, no L-cyc groups exhibited altered proteinuria, suggesting that L-amino acids in a cyclic configuration are not as effective a tolerogen via oral administration. There was no difference in cumulative proteinuria between linear L-pCons and D-pCons.

Specific MAP-pCons treatment groups had significantly lower anti-dsDNA antibody titers versus controls

Monitoring antibodies in serum that bind to dsDNA is a common method of monitoring SLE progression in humans and mouse models. Therefore, we tested for the presence of anti-dsDNA antibodies in monthly bleeds in all treatment groups by ELISA. Six separate bleeds were tested and cumulative anti-dsDNA antibody titers for each group are shown in Figure 13A. Three treatment groups - 100 μg D-MAP, 500 μg D- MAP, and 100 μg L-MAP - had significantly lower serum anti-dsDNA antibody levels than both DMSO-fed and unfed animals.

Total serum IgG levels are significantly lower in animals treated with 100 μg doses of D-MAP and L-MAP pCons versus DMSO-fed animals

We also examined whether the burden of total serum IgG was ameliorated with oral pCons administration. In a similar manner to anti-dsDNA antibody ELISAs, six separate bleeds were tested and cumulative IgG titers for each treatment group are shown in Figure 13B. 100 μg doses of D-MAP and L-MAP led to a significant decrease in total serum IgG. This drop in total IgG levels was only significant when treatment samples were compared to DMSO-fed control animals. Survival of BWF1 mice is significantly prolonged with multiple treatment regimens

We followed all animals until 47 weeks of age to determine whether oral pCons administration prolonged survival rates versus the control groups. Kaplan-Meier survival curves for animals fed 100 μg D-MAP and 100 μg L-MAP are shown in Figure 14, and all other treatment groups are shown in Figure 16. Five groups— 100 μg D-pCons, 100 μg D-cyc, 1, and 500 μg L-MAP - survived significantly longer than DMSO-fed controls. In addition, the 100 μg L-MAP group survived significantly longer than the unfed group.

Animals fed 100 μg D-MAP and L-MAP pCons have lower cumulative serum TGF levels

Because TGFP-secreting regulatory T cells are upregulated by both i.v. pCons and s.c. hCDRl treatment, and these cells directly contribute to amelioration of SLE manifestations (see, e.g. Sharabi et al., Proc Natl Acad Sci U S A. 2006;103:8810-5; Hahn et al., J Immunol. 2005;175:7728-37), we examined whether serum TGFP levels were higher in pCons-fed treatment groups. Quantitative TGFP ELISAs were performed and cumulative TGFP levels were determined, as shown in Figure 15. Notably, the group fed 100 μg D-MAP had significantly higher TGFP levels versus both DMSO-fed and unfed mice. The 100 mg L-MAP group had significantly higher TGF levels versus unfed animals but only approached significance against the DMSO-fed control group (p=0.0720).

DISCUSSION

Our laboratory has previously demonstrated that i.v. treatment of BWF1 mice with pCons, a peptide based on anti-dsDNA antibody heavy chain sequences, delays disease symptoms and mortality. For pCons to be clinically useful, however, it would be beneficial if the peptide could be administered orally. We describe herein that specific modified forms of pCons— specifically, MAPs made of either L- or D-amino acids— are effective at reducing proteinuria, decreasing anti-dsDNA antibody burden, increasing GF levels, and extending survival of treated BWF1 animals. Notably, these effects are dose-specific and do not appear to be solely dependent on the chirality of the 15 amino acids that make up pCons.

One possible mechanism for increase survival of BWF1 mice is that oral pCons, in specific, tolerogenic doses, somehow 'neutralizes' anti-dsDNA antibody-driven nephritis. This mechanism has been suggested in in vitro studies with low doses of the DNA-mimetic peptide sequence DWEYS in both D- and L-amino acid forms (see, e.g. Gaynor et al., Proc Natl Acad Sci U S A. 1997;94:1955-60). Notably, studies from the Diamond and Putterman labs illustrate that mice immunized subcutaneously with high doses of MAP-DWEYSVWLSN develop SLE-like symptoms (see, e.g. Beger et al., J Immunol. 2002;168:3617-26; Putterman et al., J Exp Med. 1998;188:29-38), suggesting that a) MAP delivery is an effective method for peptide delivery, whether orally or injected, and b) peptide dosage is critical to determining induction of either immunization or tolerance.

The classical view of oral tolerance is that low doses of tolerogen induce regulatory T cells and high doses cause autoreactive T cells to become anergic (see, e.g. Faria et al., Immunol Rev. 2005;206:232-59). As the range between 'low' and 'high' doses is quite varied in previous reports, ranging from 0.5-1000 μg for 'low' and approaching gram quantities for 'high' (see, e.g. Wu et al., J Immunol. 2008;181:6038-50; Chen et al., Nature. 1995;376:177-80; GonneUa et al., J Immunol. 1998;160:4708-18; Marth et al., J Immunol. 1996;157:2348-57; Khoury et al., J Exp Med. 1992;176:1355-64), and we planned on long-term pCons administration (allowing for smaller individual doses), we decided on the ranges discussed above that represented a 50-fold difference for our 'low' to 'high' doses. Interestingly, the 'middle' (100 μg) dose of both MAPs was the most effective. A second possibility is that oral pCons activates regulatory T cells, suggested by the observed increase in cumulative serum TGFP levels from the 100 mg D-MAP and L- MAP treatment groups. Preliminary data with a small number of mice fed 250 μg linear L-pCons and D-pCons showed that numbers of CD4+CD25+Foxp3+ T cells isolated from mesenteric lymph nodes increase to 2% and 5%, respectively, of all cells versus <1% in control animals. We have previously reported that CD8+ inhibitory T cells induced by i.v. administration of linear pCons secrete TGFP and depend upon it for their suppressive functions (see, e.g. Singh et al., J Immunol. 2007;178:7649-57). To this end, we have initiated experiments that will address whether 100 μg doses of MAP-pCons induce peripheral and/ or gut CD4+ Treg, induce CD8+ Treg, drive CD4+CD25- T cells to anergy, or all three, as in i.v. administration (see, e.g. La Cava et al., J Immunol. 2004;173:3542-8; Singh et al., J Immunol. 2007;178:7649-57; Hahn et al., J Immunol. 2005;175:7728-37). Other cellular mediators, such as IL-10 secreted from CD8+ gamma-delta T cells induced by nasal insulin in the NOD diabetic mouse (see, e.g. Hanninen et al., Inmmunol Rev. 2000;173:109-19), could play an additional role in this system.

These experiments addressed whether oral delivery of pCons is a viable therapeutic option for murine SLE, and, as survival was an obligatory determinant in our studies, we did not have enough animals in each group to examine whether T cell populations in spleen and lymph nodes were altered at specific time points of treatment. One obvious advantage in developing a model of immune tolerance for the treatment of SLE is the inherent specificity with the tolerogen(s) administered versus systematic immune suppression with currently available agents. Wu et al., in recent reports utilizing the SNF1 (see, e.g. Wu et al., Lupus. 2009;18:586-96; Wu et al., J Immunol. 2008;181:6038-50) and BWF1 (see, e.g. Wu et al., J Immunol. 2008;181:6038-50) SLE mouse models, have demonstrated that nasal tolerance is effectively induced with low (0.5 μg/dose) doses of F(ab')2 fragments of antibodies against CD3. Tolerized animals survive longer and have lower proteinuria, similar to pCons tolerization, due in part to upregulation of a CD4+CD25-LAP+ regulatory T cell population (see, e.g. Wu et al., Lupus. 2009;18:586-96; Wu et al., J Immunol. 2008;181:6038-50). As in our studies, there did not appear to be any adverse reactions to nasally administered anti-CD3, even after chronic treatment (tumor formation, cytokine release syndrome, etc.) (see, e.g. Wu et al., Lupus. 2009;18:586-96; Wu et al., J Immunol. 2008;181:6038-50), suggesting that orally/nasally available peptide/protein tolerogens could be a safe, effective, targeted alternative to cytotoxic, non-specific immunosuppressants.

In summary, we describe alternate forms of pCons that, when delivered orally, significantly delay onset of lupus in BWF1 mice. Future experiments will focus on repeated 100 μg doses of D-MAP and L-MAP pCons because these were consistently effective in reducing proteinuria, total IgG, and anti-dsDNA antibodies, in increasing plasma levels of GFP, and in improving survival. Our data also suggest that oral dosing may have to be continued through the lifetime of the mice, because deaths began in the effective groups after treatment was stopped (Figure 14). These results suggest that oral tolerance using specific peptides could lead to novel, safe human SLE therapeutics.