PEPTIDE TARGETING SARS-COV-2 NSP9 Field of the invention [001] The present invention relates to the field of a peptidomimetic antiviral having an antiviral effect on beta coronavirus (or SARS-like corona virus) infection, e.g. SARS CoV-2 infection, by targeting the Nsp9 protein through a protein-protein interaction. Background [002] To be prepared for future epidemics and pandemics, it is important to continue developing new antivirals such that emerging viral threats can be treated directly and immediately with approved drugs, preferably administered orally. This is particularly important for SARS-like coronaviruses, given the efficiency of human-to-human transmission, and has been demonstrated by recurrent outbreaks: severe acute respiratory syndrome coronavirus (SARS-CoV) in 2003, Middle East respiratory syndrome-related coronavirus (MERS-CoV) in 2012 and SARS-CoV-2 in 2019. Summary of the invention [003] In a first aspect, the present invention relates to a peptide consisting of 50 amino acid residues or less and comprising the motif XG(F/L/A/V/I/M/W/C)X(L/I/V)(G/D/P) (SEQ ID NO: 1), wherein X at position 4 is independently any amino acid and X at position 1 is independently any amino acid but not Arg, wherein the peptide is a coronaviral non- structural protein 9 binding peptide. [004] The G at position 2 and (G/D/P) at position 6 are critical for binding to NSP9 (non- structural protein 9), and the interaction is enforced through hydrophobic interactions with residues at the indicated positions. [005] In the peptide motif, the amino acid at position 3 may be F, L, A, V, I, M, W or C. The amino acid at position 5 may be any one of L, I or V, and the amino acids at position 6 may be any one of G, D and P. The selection of the amino acids at the different positions is independent of the selections of the amino acid at the other positions. [006] This peptide has an antiviral effect on betacoronavirus (SARS-like corona virus) infection, e.g. SARS-CoV-2 infection, and the peptide targets Nsp9 through a protein-protein interaction. The peptide can also be used as a research tool and a diagnostic tool. Nsp9 is a non-structural protein of the SARS-CoV-2 proteome. Nsp9 associates with the replication complex to promote 5’-capping of viral RNA ¹ . The addition of a 5’ cap to the viral RNA is crucial for RNA stability as well as efficient translation. This peptide was shown to function as an inhibitor of viral replication. The peptide with highly defined binding site can also be used to study the role of NSP9 proteins in virus replication and can potentially be used as lead sequence for innovative inhibitor design. [007] The interaction between this peptide and NSP9 falls within a particular class of protein-protein interactions, wherein an intrinsically disordered region (IDR) of a protein interacts with a folded domain of the binding partner. The most common interaction modules in IDRs are short linear motifs (SLiMs). SLiMs are short, usually less than 10 amino acid residues long, and degenerate, with only 3-4 residues accounting for most of the specificity and affinity. Consequently, SLiMs can be evolved rapidly ex nihilo through accumulation of a few mutations. Because viruses evolve relatively rapidly, viral mimicry of host protein SLiMs has been proposed as a commonly used strategy, and several examples have been described across most viral clades. Proteins expressed from viral genomes therefore often contain SLiMs, which compete with native host protein-protein interactions to hijack cellular machinery. Conversely, folded domains of the viral proteome can interact with both human and viral SLiMs. Each scenario provides a drug target, i.e., the folded domain of human or viral protein can be targeted with a peptide or peptidomimetic. Here, the peptide with the motif XG(F/L/A/V/I/M/W/C)X(L/I/V)(G/D/P) constitutes such a SLiM, which interacts with a folded domain of the NSP9. [008] The amino acid residue at position 1 is not Arg (R) but may independently be any other amino acid. Thereby, Nsp9 peptides are not included among the above defined Nsp9- binding peptides, in agreement with experimental results ²³ . [009] In some embodiments the peptide/polypeptide consists of 40 amino acid residues or less, such as 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 9 amino acid residues or less. [0010] The peptide may comprise at least 9 amino acids or 9-50 amino acid residues or 10- 50 amino acid residues. [0011] That X at position 4 and position 1, respectively, is any amino acid (except Arg at position 1) and may here include the natural amino acids present in nature as well as non- natural/unnatural amino acids, referring to amino acids other than the natural amino acids. Non-natural amino acids may be amino acid analogs, amino acid derivatives (such as derivatized amino acids with reactive side-chains such as Lys, Cys and Tyr) etc. The non- natural amino acids can include a wide range of functionalities, including but not limited to oxime, carbonyl, and/or hydroxy amine groups. The non-natural amino acids being incorporated such as for example to enhance affinity, selectivity of stability of the peptide. [0012] In one embodiment, the motif may be selected from XGFXLG (SEQ ID NO: 2), XGFXLD (SEQ ID NO: 3), XGFXLP (SEQ ID NO: 4), XGLXLG (SEQ ID NO: 5), XGLXLD (SEQ ID NO: 6), XGLXLP (SEQ ID NO: 7), XGAXLG (SEQ ID NO: 8), XGAXLD (SEQ ID NO: 9), XGAXLP (SEQ ID NO: 10), XGIXLD (SEQ ID NO: 11), XGMXLG (SEQ ID NO: 12), XGWXLG (SEQ ID NO: 13), XGLXIG (SEQ ID NO: 14), XGIXIG (SEQ ID NO: 15), XGWXLD (SEQ ID NO: 16), XGWXLP (SEQ ID NO: 17), XGVXIG (SEQ ID NO: 18), XGVXVG (SEQ ID NO: 19) and XGIXLD (SEQ ID NO: 20). [0013] In one embodiment, the motif may be selected from XGAWLG (SEQ ID NO: 21), XGVWLG (SEQ ID NO: 22), XGAYLG (SEQ ID NO: 23), XGFALG (SEQ ID NO: 24), and XGMVLG (SEQ ID NO: 25). [0014] The peptide may comprise or consist of an amino acid sequence selected from XG(F/L/A/V/I/M/W/C)X(L/I/V)GXXXXXX(Q/L)(Q/L)D (SEQ ID NO: 26), XG(F/L/A/V/I/M/W/C)X(L/I/V)GXXXXXXX(Q/L)(Q/L)D (SEQ ID NO: 27), and XG(F/L/A/V/I/M/W/C)X(L/I/V)GXXXXXXXX(Q/L)(Q/L)D (SEQ ID NO: 28).. [0015] The residues C-terminal to the binding motif in the above listed peptides may contribute to affinity to the Nsp9 protein. [0016] The residues C-terminal of the binding motif may contribute to the antiviral effect. [0017] The peptide may comprise or consist of an amino acid sequence selected from QGAWLGAPEPWEPLLD (SEQ ID NO: 29), QGVWLGAPEPWEPLLD (SEQ ID NO: 30), QGAWLGIPEPWEPLLD (SEQ ID NO: 31), QGAWLGAVEPWEPLLD (SEQ ID NO: 32), QGAWLGAPVPWEPLLD (SEQ ID NO: 33), QGAWLGAPEYWEPLLD (SEQ ID NO: 34), QGAWLGAPEPYEPLLD (SEQ ID NO: 35), QGAWLGAPEPWFPLLD (SEQ ID NO: 36), QGVWLGAVEPWEPLLD (SEQ ID NO: 37), PAHPDGFALGRAPLA (SEQ ID NO: 38), YPAHPDGFALGRAPLA (SEQ ID NO: 39), MNIQEQGFPLDLGASY (SEQ ID NO: 40), AEGIDIGEMPSYDLVL (SEQ ID NO: 41), NIQEQGFPLDLGASF (SEQ ID NO: 80), FQGVWLGAVEPWEPLL (SEQ ID NO: 81), and FQGAWLGAPEPW (SEQ ID N0: 82). [0018] The peptide may have incorporated therein a peptide sequence or lipid moiety conferring cell-permeating properties. [0019] Thereby, the peptide is modified or formulated to enhance delivery across the cell membrane. Cell-Penetrating Peptides (CPPs) are a family of various peptides, typically comprising 5–30 amino acids that can pass through tissue and cell membranes via energy- dependent or -independent mechanisms with no interactions with specific receptors. CPPs can thus be used to enhance biomembrane permeability of cargo molecules, such as therapeutic peptides. Lipid moieties can also be used to increase cell membrane permeability of peptide drugs ³¹ . The lipid groups increase affinity towards the cell membrane and promotes higher cellular uptake with potential implications for intracellular delivery ³² [0020] The CPP peptide chain can either be covalently joined to the peptide chain of the therapeutic peptide to provide a single peptide comprising both the CPP and the therapeutic peptide, or they can be brought together in a non-covalent complex, or as a nanoparticle. [0021] Examples of CPPS are HIV TAT, penetratin, polyarginine, DPV1047, MPG, Pep-1, pVEC, ARF(1-22), BPrPr(1-28), MAP, transportan, p28, VT5, BAC7, C105Y, PFVYLI, Pep-7 ² . [0022] CPPS are known since previously and have been suggested for use in making peptides cell-permeable ³⁵ . However, it is very unpredictable if any CPPS will provide such properties when fused with a given peptide sequence and if the function of the original peptide can be preserved and exerted given that the modified peptide is transferred through the cell membrane. [0023] Presently preferred cell-penetrating peptide is the peptide with amino acid sequence YGRKKRRQRRR (SEQ ID NO: 42). [0024] According to a second aspect, the peptide described above may be for use as a drug or in a medicine. [0025] In one embodiment, the peptide may be for use in a method for prevention or treatment of a betacoronavirus. [0026] Betacoronavirus (β-CoV or Beta-CoV) is one of four genera (Alpha-, Beta-, Gamma-, and Delta-) of coronaviruses. Member viruses are enveloped, positive-strand RNA viruses that infect mammals. [0027] In one embodiment the peptide may be for use in a method for prevention or treatment of a human coronavirus selected from OC43, HKU1, SARS-CoV, SARS-CoV-2 and MERS-CoV. [0028] The peptide for use as above may be administered intravenously, intradermally, intraarterially, intraperitoneally, intratracheally, intranasally, intramuscularly, intraperitoneally, subcutaneously, transmucosally, transdermally, per oral, topically, locally, and/or by inhalation. [0029] According to a third aspect there is provided a pharmaceutical composition comprising the peptide above, and optionally pharmaceutically acceptable excipients and carriers. [0030] The pharmaceutical may further comprise a cell-penetrating peptide. [0031] The pharmaceutical composition may be adapted to be administered intravenously, intradermally, intraarterially, intraperitoneally, intratracheally, intranasally, intramuscularly, intraperitoneally, subcutaneously, transmucosally, transdermally, per oral, topically, locally, and/or by inhalation. [0032] According to a fourth aspect there is a use of the peptide above in the manufacture of a pharmaceutical composition for the treatment of a viral infection. Abbreviations and definitions. [0033] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. All terms as used herein shall be considered to have the meaning usually given to them in the art. [0034] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of the subject with toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit/risk ratio. Compounds, materials, compositions, and/or dosage forms that are pharmaceutically acceptable are also considered cosmetically acceptable. [0035] The phrase "pharmaceutically acceptable excipient" as used herein refers to an acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, carrier, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), solvent or encapsulating material, involved in carrying or transporting the, optionally therapeutic, compound for administration to the subject. Each excipient should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject. Some examples of materials which can serve as pharmaceutically excipients include: ethanol, sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; gelatin; talc; waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as ethylene glycol and propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents; water; isotonic saline; pH buffered solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. If desired, certain sweetening and/or flavoring and/or coloring agents may be added. [0036] The present invention also relates to and makes use of pharmaceutically acceptable compositions which comprise a therapeutically-effective amount of at least the peptide/polypeptide according to the invention as an active ingredient, optionally combined with one or more additional therapeutically active ingredients, such as additional antiviral agents, formulated together with one or more pharmaceutically acceptable excipients. The active ingredients and excipient(s) may be formulated into compositions and dosage forms according to methods known in the art. The pharmaceutical compositions of the present invention may adapted to be administered intravenously, intradermally, intraarterially, intraperitoneally, intratracheally, intranasally, intramuscularly, intraperitoneally, subcutaneously, transmucosally, transdermally, per oral, topically, locally, and/or by inhalation. [0037] The medicaments, pharmaceutical compositions or therapeutic combinations according to the present invention may be in any form suitable for the application to humans and/or animals, preferably humans including infants, children and adults and can be produced by standard procedures known to those skilled in the art. The medicament, (pharmaceutical) composition or therapeutic combination can be produced by standard procedures known to those skilled in the art. [0038] An effective dose of the polypeptide/peptide according to the invention may include a "therapeutically effective dose or amount" or a "prophylactically effective dose or amount" as defined above. A therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability to elicit a desired response in the individual. A therapeutically effective dose/amount is also one in which any toxic or detrimental effects are outweighed by the therapeutically beneficial effects. A "prophylactically effective dose/amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired prophylactic result. Typically, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount. Brief description of the drawings [0039] Fig.1 shows the organization of the SARS-CoV-2 genome and proteome. The figure is adapted from Gordon et. al. ³ [0040] Fig.2 shows peptide motifs (SEQ ID NO: 43- SEQ ID NO: 52) obtained from selections with the SARS-CoV-2 protein Nsp9. The peptides being identified by proteomic peptide- phage display (ProP-PD) selections. [0041] Fig.3 shows representative fluorescence polarization (FP)-monitored displacement experiments measuring the affinity between Nsp9 and three human peptide ligands (NKRF _{8- 23} (SEQ ID NO: 54); NOTCH4 _1605-1620 (SEQ ID NO: 55); NSP9 _4237-4251 (SEQ ID NO: 62). Affinities are shown next to each peptide. Affinities are shown next to each peptide. [0042] Fig.4 shows SPOT array alanine scans for the peptide LMTK3 _22-36 (SEQ ID NO: 53). Residues involved in binding are shown in bold. Signal intensities were normalized to wild type (wt) and presented as percentage signal change. [0043] Fig.5 shows SPOT array alanine scans for the peptide NKRF _8-23 (SEQ ID NO: 54). Residues involved in binding are shown in bold. Signal intensities were normalized to wild type (wt) and presented as percentage signal change. [0044] Fig.6 shows a deep mutational scanning of the NOTCH41606-1621 (SEQ ID NO: 29) peptide by phage display to validate key residues of the binding motif and at the same time identify mutations that would enhance the affinity. Residues marked with a striped square indicate a favored residue. [0045] Fig.7 shows affinity measurements of different point mutations of the NOTCH41606- 1621 peptide. [0046] Fig.8 shows that enhanced green fluorescent protein (EGFP)- NOTCH41606-1621 (SEQ ID NO: 29) and EGFP-LMTK322-36 (SEQ ID NO: 53) constructs inhibit viral proliferation. [0047] Fig.9 shows a graph comparing the antiviral activity of three peptides NOTCH41606- 1621 (WT peptide, SEQ ID NO: 29), NOTCH41605-1620 control (negative control, SEQ ID NO: 65) and NOTCH4 tight (A3V/P8V) _1606-1621 (optimized peptide, SEQ ID NO: 18). [0048] Fig.10 shows viability data for different concentrations of the peptides NOTCH41606- ₁₆₂₁ (WT peptide, SEQ ID NO: 10), NOTCH4 _1605-1620 control (negative control, SEQ ID NO: 65) and NOTCH4 tight (A3V/P8V) _1606-1621 (optimized peptide, SEQ ID NO: 37). [0049] Fig.11a and Fig.11b show variants (SEQ ID NO: 67-71) of the NOTCH4 peptide (SEQ ID NO: 29) with antiviral effects at 300 µM and 150 µM, respectively. [0050] Fig.12a and Fig.12b show variants (SEQ ID NO: 72-75) of the NOTCH4 peptide (SEQ ID NO: 29) with antiviral effects at 300 µM and 150 µM, respectively. [0051] Fig.13a and Fig.13b show variants (SEQ ID NO: 76-79) of the peptide with antiviral effects at 300 µM and 150 µM, respectively. Sequences S N 1 2 3 4 5 6 7 8 9 1 1 1 1 1 1 1 1 1 1 2 2 22 XGVWLG XGAYLG MCM9796-811 DIGLLPSPGETGVPWR 62 NSP94237-4251 LNRGMVLGSLAATVR 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 7 7 8 8 8 Detailed description [0052] The SARS-CoV-2 proteome consists of 29 proteins, encoded by 14 open reading frames (ORF) ³ , see Fig.1. The first two reading frames, ORF1a and ORF1b, encode 16 non- structural proteins (Nsp1 to Nsp16), formed after post-translational proteolytic cleavage by viral proteases. In addition, the SARS-CoV-2 genome encodes for four structural proteins: spike (S), nucleocapsid (N), membrane (M), and envelope (E), as well as nine accessory proteins (ORFs 3a, 3b, 6, 7a, 7b, 8, 9b, 9c, and 10). The non-structural proteins facilitate viral mRNA replication and translation. Nsp1 is responsible for suppressing host translation while simultaneously promoting viral mRNA translation ⁴ . Nsp2 promotes viral evasion of the innate immune response ⁵ . Nsp3 serves as a central hub coordinating different steps of viral replication ^6,7 . In addition to Nsp3, Nsp4 and Nsp6 are also involved in double membrane vesicle formation and organization ^8,9 . Nsp5 serves as the main protease (MPro) that proteolytically processes the ORF1a and ORF1b into final proteins ¹⁰ . Nsp7, Nsp8, and Nsp12 form the core replication complex with Nsp12 being the RNA dependent RNA polymerase (RdRp) and Nsp7/Nsp8 forming a hexadecameric complex, which enhances processivity ^11-13 . In addition, Nsp9 also associates with the replication complex to promote 5’-capping of viral RNA ¹ . The addition of a 5’ cap to the viral RNA is crucial for RNA stability as well as efficient translation and requires several steps, with the Nsp10/Nsp14 and Nsp10/Nsp16 complexes also contributing to the final steps of the process ¹ . In both cases, Nsp10 activates the catalytic activity of Nsp14 and Nsp16. Apart from its function in the 5’-capping process, Nsp14 also functions as an exoribonuclease facilitating the proofreading function of the replication complex. Finally, Nsp13 is a helicase that unwinds the RNA and promotes efficient transcription ⁶ , while Nsp15 serves as a uridine-specific endoribonuclease that facilitates the evasion of the host immune response ¹⁵ . [0053] In the following section the focus is on the Nsp9 protein (SEQ ID NO: 56). Nsp9 binds to peptide ligands with consensus motifs, leading to the rearrangement of hydrophobic core and the disruption of dimerization. Nsp9 from SARS-CoV-2 is a 113 amino acid residue long RNA-binding protein with a stable fold that shares 98% sequence identity with its SARS-CoV homolog ^16,17 . Recent reports have established that Nsp9 is an essential component of the replication and transcription complex where it interacts with the Nidovirus RdRp-Associated Nucleotidyltransferase (NiRAN) domain of the RNA-dependent RNA polymerase Nsp1237. In this model, the monomeric Nsp9 binds to NiRAN via a C-terminal alpha helix and facilitates the addition of the GpppA-RNA cap to the 5’-end of the newly synthesized mRNA ¹ . [0054] In proteomic peptide-phage display (ProP-PD) selections, we identified 118 human Nsp9-binding peptides. Based on the peptides identified by ProP-PD-selections, consensus motifs AXIN14-13 (SEQ ID NO: 43); BBX431-440 (SEQ ID NO: 44); FBXO30283-292 (SEQ ID NO: 45); HNRNPK108-117 (SEQ ID NO: 46); LMTK324-33 (SEQ ID NO: 47); MVB12A165-174 (SEQ ID NO: 48); NACAD469-478 (SEQ ID NO: 49); NKRF7-16 (SEQ ID NO: 50); PCDH11X1081-1090 (SEQ ID NO: 51); PHF31442-1451 (SEQ ID NO: 52) could be established for Nsp9, XG(F/L/A/V/I/M/W/C)X(L/I/V)(G/D/P) (SEQ ID NO: 1), wherein X at position 4 is independently any amino acid and X at position 1 is independently any amino acid but not Arg, wherein the peptide is a coronaviral non-structural protein 9 binding peptide, see the table in Fig.2. [0055] We confirmed binding and determined the affinities for eight of the ligands: LMTK322- 36 (SEQ ID NO: 53), KD= 34μM; AXIN11-15 (SEQ ID NO: 57), KD= 49μM; NKRF8-23 (SEQ ID NO: 54), KD= 50μM; RIF1 _1780-1795 (SEQ ID NO: 58), KD= 88μM; NEK9 _737-751 (SEQ ID NO: 59), KD= 111μM; NOTCH41605-1620 (SEQ ID NO: 55), KD= 125μM; MVB12A166-180 (SEQ ID NO: 60), KD= 450μM; MCM9 _796-811 (SEQ ID NO: 61), KD~3200μM. [0056] The ligands with the highest affinities were peptides derived from the NF-kappa-B- repressing factor (NKRF8-23 (SEQ ID NO: 54)), the protein kinase LMTK3 (LMTK322-36 (SEQ ID NO: 53)), and the Axin-1 (AXIN _1-15 (SEQ ID NO: 57)), which bound to Nsp9 with KD values of 30-50 μΜ. Of these, NKRF has been found to interact with other SARS-CoV-2 proteins including Nsp1 and Nsp10, with the latter interaction thought to regulate interleukin-8 production. A peptide from the Neurogenic locus notch homolog protein 4 (NOTCH4 _1605-1620 (SEQ ID NO: 55) displayed lower affinity, and bound to Nsp9 with a KD ~130 μM. We further tested binding to the C-terminal peptide of Nsp9 (Nsp9 _4237-4251 (SEQ ID NO: 62)), as it shares the GXXXG motif, but did not detect any measurable binding within the concentration range used. This as the amino acid residue at position 1 of the motif in the Nsp9 peptide is Arg. [0057] Fig.3 shows representative fluorescence polarization (FP)-monitored displacement experiments measuring the affinity between Nsp9 and three human peptide ligands: NKRF _{8- 23} (SEQ ID NO: 54); NOTCH4 _1605-1620 (SEQ ID NO: 55); NSP9 _4237-4251 (SEQ ID NO: 62). Affinities are shown next to each peptide. [0058] To further dissect which residues of the peptides are essential for binding we performed a SPOT array alanine scan of the NKRF8-23 (SEQ ID NO.54) and LMTK322-36 (SEQ ID NO: 53) peptides. For the NKRF8-23 peptide the analysis confirmed the consensus motif, with a substantial decrease in binding intensity when either of the two glycines at the positions P2 and P6 of the motif or the isoleucine at the position P5 were mutated to alanine. A minor effect was also observed upon mutation of the isoleucine at the position P3 (not illustrated). Based on these results, we adjusted the motif to XGΦXΦ(G/D/P), where Φ is a hydrophobic residue. To define the binding pocket of the motif, we performed ColabFold prediction for peptide binding to either monomeric or dimeric Nsp9. This analysis, however, showed low confidence scores (pLDDT < 30; not shown) and did not converge on a similar binding mode for the three peptides. [0059] Because the peptide ligands have a GΦXΦ(G/D/P) motif, that is also found in the C- terminal helix of Nsp9 and facilitates dimerization, we hypothesized that Nsp9-binding peptides might interact with the dimerization interface and therefore interfere with the dimer formation. ^18,19 To address this question and map the residues involved in the interaction between Nsp9 and the peptides, we recorded nuclear magnetic resonance (NMR) ¹ H ¹⁵ N heteronuclear single quantum coherence (HSQC) spectra of ¹⁵ N labelled Nsp9 at increasing concentrations of NKRF _8-23 (SEQ ID NO: 54), LMTK3 _22-36 (SEQ ID NO: 53) and NOTCH4 _1605-1620 (SEQ ID NO: 55), respectively. Well-resolved spectra confirmed a folded protein and allowed us to monitor the changes in chemical shift perturbations upon addition of peptides (not shown). The substantial overlap of chemical shift perturbation changes upon binding of the three peptides suggested an overall conserved binding interface. We focused on the residues that exhibited chemical shift changes of at least one standard deviation above average for all three peptides. The data suggested significant rearrangements of residues in the hydrophobic core of Nsp9 in the ß1-ß5 region while ß6 and ß7 remained unperturbed. Importantly, chemical shifts for the C-terminal alpha helix were not observed, leaving open the possibility that the peptides could interact with the helix without showing any perturbations in the NMR HSQC spectra. [0060] To determine whether the Nsp9 is a dimer in solution, we measured the T1 and T2 relaxation times, which report on global motion of individual residues of the protein. The ratio of the two relaxation times, gives the rotational correlation time τc, which was 15.3 ns for the free Nsp9 protein and 9.9 ns for the protein in complex with NOTCH41605-1620 peptide corresponding to estimated molecular weights of 29 and 18.8 kDa respectively. Because the molecular weight calculation from τc is highly dependent on the shape of the molecule, the experiments provide an estimate of the size, which nonetheless correlates well with the predicted molecular weight for a Nsp9 homodimer (25.7 kDa) and a Nsp9 monomer bound to the NOTCH4 peptide (14.7 kDa) implying that the addition of the peptide disrupts the formation of Nsp9 homodimer. To confirm that the peptides bind via the C-terminal helix we constructed a Nsp9Δα construct (SEQ ID NO: 63), which is missing 20 residues of the C- terminus. As expected, the Nsp9Δα did not interact with a FITC (Fluorescein-5- Isothiocyanate) -NKRF8-23 probe (SEQ ID NO: 54), confirming our hypothesis that the identified peptides bind to the C-terminal helix of Nsp9 and interfere with Nsp9 homodimer formation. [0061] Fig.4 shows SPOT array alanine scans for the peptide LMTK322-36 (SEQ ID NO: 53). Residues involved in binding are shown in bold. Signal intensities were normalized to wild type (wt) and presented as percentage signal change. [0062] Fig.5 shows SPOT array alanine scans for the peptide NKRF8-23 (SEQ ID NO: 54). Residues involved in binding are shown in bold. Signal intensities were normalized to wild type (wt) and presented as percentage signal change. [0063] Using the NOTCH41606-1621 peptide (SEQ ID NO: 29) as a model, we pinpointed key residues for this particular peptide. This confirmed the importance of the ”GAWLG” core of the peptide and in this particular case, the W is also a key residue, which can be replaced by Y (see affinity measurements). [0064] A deep mutational scanning of the NOTCH4 _1606-1621 (SEQ ID NO: 29) peptide by phage display was performed to validate key residues of the binding motif and at the same time identify mutations that would enhance the affinity, Fig.6. Residues marked in a striped square indicate a favored residue. [0065] Guided by the deep mutational scanning the point mutations shown in Fig.7 (mutations indicated in boxes as compared to the wild type version of the peptide, NOTCH4 _1606-1621 (SEQ ID NO: 29) were tested on binding to Nsp9. The table in Fig.7 shows affinity measurements of the different point mutations (NOTCH4 A3V _1606-1621 (SEQ ID NO: 30); NOTCH4 A711606-1621 (SEQ ID NO: 31); NOTCH4 P8V1606-1621 (SEQ ID NO: 32); NOTCH4 E9V _1606-1621 (SEQ ID NO: 33); NOTCH4 P10Y _1606-1621 (SEQ ID NO: 34); NOTCH4 W11Y _1606-1621 (SEQ ID NO: 35); NOTCH4 E12F1606-1621 (SEQ ID NO: 36); NOTCH4 tight (A3V/P8V)1606-1621 (SEQ ID NO: 37); NOTCH4 week1606-1621 (SEQ ID NO: 64) of the NOTCH41606-1621 peptide (SEQ ID NO: 29). [0066] As can be seen from the table, the highest affinity (lowest KD) was obtained for the peptide called NOTCH4 A3V1606-1621 (SEQ ID NO: 30), and NOTCH4 tight (A3V/P8V)1606-1621 (SEQ ID NO: 37). Residues beyond the core motif may also contribute to affinity and specificity as shown by the peptide NOTCH4 P8V1606-1621 (SEQ ID NO: 32) and NOTCH4 E12F1606-1621 (SEQ ID NO: 36) mutations (see Fig.7). [0067] The peptide ligand targeting Nsp9 inhibits viral proliferation. To investigate the role of the identified protein-protein interactions in viral replication we designed lentiviral expression constructs, expressing four repeats of each peptide interspaced by flexible GlySerThr linkers and conjugated C-terminally to an enhanced green fluorescent protein (EGFP). VeroE6 cells were first transduced with the lentiviruses and, after 72 hours, infected with SARS-CoV-2 for 16 hours, after which the number of infected cells was measured. We found that the lentiviral constructs inhibited the production of viral particles, namely the Nsp9 binding EGFP- NOTCH41606-1621 and EGFP- LMTK322-36 constructs. In Fig.8 inhibition is shown as percent infection of eGFP. [0068] Additionally, we confirmed the interference of the ligands with viral replication by treating the infected cells with peptides fused to the cell-penetrating (CP) HIV Tat-derived sequence (YGRKKRRQRRRGSG, SEQ ID NO: 66). These experiments confirmed the inhibitory effects of the Nsp9 binding NOTCH4 _1606-1621 (SEQ ID NO: 29) establishing this ligand as potential starting point for the development of peptidomimetic inhibitors of SARS-CoV-2 infection. To investigate if the peptides specifically inhibit SARS-CoV-2 replication, we also treated human coronavirus 229E (HCoV-229E) infected MRC5 cells with the cell penetrating constructs. Interestingly, the peptides failed to inhibit HCoV-229E infection, suggesting a beta-coronavirus specific inhibitory effect. [0069] Fig.9 shows a graph comparing the antiviral activity of three peptides, NOTCH4 _1606- 1621 (WT peptide, SEQ ID NO: 29), NOTCH41605-1620 negative control (SEQ ID NO: 65) and NOTCH4 tight (A3V/P8V) _1606-1621 (optimized peptide, SEQ ID NO: 37). All peptides being fused with the CPP: YGRKKRRQRRR (SEQ ID NO: 42). NOTCH4 tight had an improved antiviral activity compared to NOTCH4 and NOTCH 4 control. NOTCH4 tight (A3V/P8V)1606-1621 had a stronger inhibitory effect at lower concentrations. At higher concentrations they introduce the opposite effect. [0070] Fig.10 shows viability data for different concentrations of the peptides NOTCH41606- 1621 (WT peptide, SEQ ID NO: 29), NOTCH41605-1620 negative control (SEQ ID NO: 65) and NOTCH4 tight (A3V/P8V)1606-1621 (optimized peptide, SEQ ID NO: 37). The viability data showed that none of the peptides were toxic. [0071] The sequence of Nsp9 homologs is conserved among betacoronoaviruses, making it plausible that the peptide sequences indicated will inhibit also these viruses. Nsp9 from SARS-CoV-2 shares 97% sequence identity with Nsp9 from SARS, and lower (44%) sequence identity with Nsp9 from HCoV. ³⁴ [0072] Figs 11a and 11b show variants (SEQ ID NO: 67-71) of the NOTCH4 peptide (SEQ ID NO: 29) with antiviral effects (% SARS COV-2 replication) at 300 µM and 150 µM, respectively. As can be seen from the graphs all variants had antiviral effects, while the control, NOTCH4 cont (SEQ ID NO: 71), showed no viral replication inhibition. This confirms that G, P or D are tolerated at position 6 of the general motif XG(F/L/A/V/I/M/W/C)X(L/I/V)(G/D/P). [0073] Fig.12a and Fig.12b show variants (SEQ ID NO: 72-75) of the NOTCH4 peptide (SEQ ID NO: 29) with antiviral effects (% SARS COV-2 replication) at 300 µM and 150 µM, respectively. As can be seen from the graphs a peptide having 8 amino acids in the peptide sequence does not give an antiviral effect, while a peptide with 12 amino acids in the peptide sequence show an anti-viral effect. This supports that residues C-terminal of the general binding motif contribute to the antiviral effect. The antiviral effect is observed at the higher peptide concentration. [0074] Fig.13a and Fig.13b show variants (SEQ ID NO: 76-79) of the peptide with antiviral effects at 300 µM and 150 µM, respectively. As can be seen, the NSP9 binding peptides (SEQ ID NO: 77 and 79) have antiviral effects in comparison to the negative controls (SEQ ID NO: 76 and 78). Experimental [0075] Experimental materials and methods useful in understanding the present disclosure are provided below. They are provided solely for the understanding of the disclosure and shall not be construed as limiting the scope of the invention, which is that of the appended claims. All references cited in the present disclosure are included in their entirety by reference. Protein expression and purification [0076] Synthetic genes encoding SARS-CoV-2 Nsp9 was ordered from Genescript in pETM33 expression plasmids. The plasmid encoded an N-terminal His-tagged GST, a PreScisson protease cleavage site and the SARS-CoV-2 protein of interest. The proteins were expressed in BL21(DE3) gold E. coli. Bacteria was grown in 2YT medium (16 mg/mL peptone, 10 mg/mL yeast extract, 5 mg/mL NaCl) supplemented with 50 µg/mL kanamycin until OD ₆₀₀ reached 0.6, when the protein expression was induced by the addition of 0.5 mM isopropyl β-D-1- thiogalactopyranoside (IPTG). Proteins were expressed overnight at 18°C, bacterial cultures were harvested by centrifugation (4,500 g, 10 minutes) at 4°C and re-suspended in lysis buffer A (50 mM Tris/HCl pH 7.8, 300 mM NaCl, 10 µg/mL DNase I and RNase, 4 mM MgCl2, 2 mM CaCl2 and cOmplete EDTA-free Protease Inhibitor Cocktail). [0077] For Proteomic peptide-phage display (ProP-PD) selections, protein domains were purified on a GSH affinity column (Pierce glutathione agarose) according to the manufacturer’s instructions. Following elution with 10 mM GSH in buffer A, the sample was used in selections where the His-GST moiety was immobilized on the plate according to the protocol described previously ²² . [0078] For fluorescence polarization experiments, after the initial GSH affinity purification step, the His-GST was cleaved off by PreScission protease (1:100 dilution; produced in- house) overnight at 4°C. Following the cleavage, the samples were applied on a nickel Sepharose excel resin column to remove the His-GST tag. The SARS-CoV-2 protein was recovered in unbound fraction from the nickel column. [0079] The purity of the samples was inspected by SDS-PAGE and if needed an additional purification step was introduced, where the SARS-CoV-2 protein sample was applied to a size-exclusion chromatography column (Superdex 75, Cytiva). The identity of pure protein samples was confirmed with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Finally, protein samples were dialyzed against 50 mM potassium phosphate buffer pH 7.4 and flash frozen until further use. [0080] For NMR experiments the Nsp9 expression construct was expressed in M9 minimal medium containing 1 g/L ¹⁵ NH ₄ Cl. After OD ₆₀₀ reached 0.6 the protein expression was induced with 1 mM IPTG, and expressed overnight at 18 °C. After expression, the purification protocol was the same as described above. Proteomic peptide phage display (Prop-PD) [0081] We recently published the design of a Pro-PD library expressing disordered regions found in the human proteome and a pipeline to quickly analyze data from deep sequencing of enriched phages ^22,33 . Briefly, GST-tagged bait proteins were immobilized in a 96-well Flat bottom Nunc MaxiSorp plates (Nunc, Roskilde, Denmark) at 4°C for 18 hours (10 µg per protein in 100 µl PBS). GST was immobilized in adjacent well as control. After immobilization the wells were blocked with blocking buffer (0.5% (w/v) BSA in PBS) for 1h at 4°C and washed 4 times with PT buffer (PBS supplemented with 0.05% Tween20). [0082] The phage library (prepared according to Benz et. al. ²² ) was added (100 µl in PBS) to the wells with immobilized GST for 1 hour, to remove nonspecifically binding phages, before being transferred to the wells with bait proteins. After 2 hours the unbound phages were removed by washing the wells 5 times with 200 µl of PT buffer, and the bound phages were eluted by the addition of 100 µl of E. coli OmiMAX in log phase with subsequent incubation for 30 minutes at 37°C. Bacteria were hyperinfected by the addition of M13KO7 helper phage and further incubated for 45 minutes at 37°C. After successful infection, 100 µl of bacteria were transferred into 1 ml of 2xYT media supplemented with 100 µg/ml carbenicillin, 30 µg/ml kanamycin and 0.3 mM IPTG, followed by incubation for 18 hours at 37°C under agitation. next, bacteria were palleted at 2000g for 10 minutes and phage supernatant was transferred to a fresh 96-well plate, where the pH was adjusted by the addition of 1/10 volume of 10 x PBS and heat inactivated at 65°C for 10 minutes. The resulting phages were used next day as in-phages in the second round of selection, where the whole procedure was repeated. To ensure high enrichment of binding phages the selection procedure was repeated four times. After the final day of selection, the phage enrichment was evaluated by pooled phage ELISA in 384-well Flat bottom Nunc MaxiSorp plates (Nunc, Roskilde, Denmark). [0083] Bait proteins and GST control were immobilized (5 µg in 50 µl PBS per well) at 4°C for 18 hours followed by blocking of the remaining well surface with 100 µl of 0.5% BSA in PBS, at 4°C for 1 hour. Enriched phages from third and fourth rounds of selections (50 µl) were incubated with the corresponding bait protein for 1h and the unbound phages were washed away 4 times with 100 µl PT buffer. Bound phages were incubated for 1 hour with 50 µl of M13 HRP-conjugated M13 bacteriophage antibody (Sino Biological Inc; 1:5,000 diluted in PT, 0.05% BSA). The wells were again washed 4 times with PT buffer followed by one wash with PBS. Substrate was added (40 µl of TMB substrate, Seracare KPL) and the enzymatic reaction was quenched by the addition of 40 µl of 0.6 M sulfuric acid. Finally, the absorbance at 450 nm was measured to quantify the phage enrichment with an iD5 plate reader (Molecular Devices). Fluorescence polarization [0084] Fluorescence polarization experiments were performed as previously described in detail ²³ . Briefly, peptides were ordered either unlabeled or as FITC-labelled constructs from GeneCust. First, KD of the FITC labelled peptide for a certain interaction was determined by varying the protein concentration at a constant FITC-peptide concentration and fitting a hyperbolic function to the data. Next, a displacement experiment was performed to determine KD for the unlabelled peptide. Labelled peptide (10 nM) was pre-incubated with protein such that approximately 50-60% of the labelled peptide was bound to protein Nsp9: 17.4-25 µM. Unlabelled peptide was then added at increasing concentration to compete out the binding of the labelled peptide. Results were analyzed in GrafPad Prism (version 9.4.1). From this data set, the sigmoidal dose-response fitting function was used to obtain IC50 values. These IC50 values were further converted to K _i (=K _D ) of unlabelled peptide as described by Nikolovska-Coleska et. al. ²⁴ Nuclear magnetic resonance spectroscopy [0085] Before NMR experiments the ¹⁵ N Nsp9 sample was dialyzed into 50 mM potassium phosphate buffer pH 6.7 supplemented with and supplemented with 1mM TCEP and 10% D ₂ O. The final concentration of the sample was between 175-225 μM. All NMR experiments were performed on a 600 MHz Avance Neo HD NMR spectrometer (Bruker) equipped with a 5 mm TCI cryogenic probe. All ¹ H- ¹⁵ N TROSY HSQC spectra were recorded at 25°C making use of the BEST pulse sequence with 512 points in the direct and 256 points in the indirect dimension. Two or four scans per datapoint were taken with the relaxation delay of 200 μs. Similar experiments were performed upon addition of the Nsp9 binding peptide ligands. Final concentrations of NKRF _8-23 (SEQ ID NO: 54), LMTK3 _22-36 (SEQ ID NO: 53) and NOTCH41605-1620 (SEQ ID NO.55) were 416 ^M, 230 ^M and 323 ^M, respectively. All Spectra were processed with TopSpin 3.2 and subsequently analyzed by MestReNova 14.1.0. The chemical peak shifts of Nsp9 residues were assigned based on comparison with previous assignments ^25,19 . The perturbation of the chemical peak shifts upon addition of the peptides were calculated using equation 1: ^( ^ _^^^^^ Where ∆δH is chemical shift change in the hydrogen chemical shift dimension and ∆δN is the chemical peak shift change in the nitrogen chemical shift dimension upon addition of peptide. Rscale is a scaling factor set to 6.5 as described before ²⁶ . [0086] To determine T1 and T2 relaxation times, TROSY HSQC based experiments were employed ^66,67 . The overall rotational correlation time τc was estimated from the ratio of T1/T2 times. The same Nsp9 - NOTCH41605-1620 sample was used as for the previous experiments. For Nsp9 T1/T2 measurements fresh sample of Nsp9 was used at the concentration of 221 µM. The molecular weight of the species present in the sample was ^.^ further estimated according to the equation 2: ^ _^ ≈ × τ _^ as described previously ^27-29 . Alanine scanning SPOT arrays [0087] 20-mer, N-acetylated peptides on cellulose membranes were ordered from JPT (PepSpots). The membranes were activated with 5 ml methanol for 5 min at room temperature and washed with 10 ml TBST (50 mM Tris, 137 mM NaCl, 2.7 mM KCl, pH adjusted to 8.0 with HCl, 0.05% Tween-20) three times for 3 min at room temperature. The membranes were then incubated with 10 ml blocking buffer (5% skim milk powder (Merck Millipore, 115363) in TBST) for 2 hours at room temperature while rotated. The blocked membranes were incubated with concentrated GST-HA-tagged proteins of interest in blocking buffer overnight, at 4 °C, while rotated. After three quick rinses with ice-cold TBST, the membranes were incubated with HRP-conjugated anti-GST antibody (Cytiva, RPN1236) in blocking buffer for 1 hour at 4°C, while rotated. Following three quick washes with ice- cold TBST, the chemiluminescent readout was carried out using ECL reagent (Clarity Max Western ECL substrate, 1705062, Bio-Rad) and ChemiDoc Imaging system (Bio-Rad). The acquired raw tiff images were analyzed using Image Studio Lite Ver.5.2., and all values were normalized to the wild type results. SARS-CoV-2 infection assay. [0088] Vero E6 (Cercopithecus aethiops) cells (ATCC, CRL-1586) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Sigma) supplemented with 10 % fetal bovine serum (FBS) (HyClone) and 100 units/ml penicillin G with 100 μg/ml streptomycin solution (Gibco) at 37°C, 5 % CO2, humidified chamber. MRC5, human lung fibroblast (ATCC CCL-171) cells were cultured in MEM medium (Gibco) supplemented with 10 % FBS, and 100 units/ml penicillin G with 100 μg/ml streptomycin solution (Gibco) at 37°C, 5 % CO ₂ , humidified chamber. [0089] SARS CoV-2 (SARS-CoV-2/01/human2020/SWE accession no/GeneBank no MT093571.1, provided by the Public Health Agency of Sweden), was grown in VeroE6 cells, and used at passage number four. Human coronavirus 229E (HCoV-229E) was grown and titrated in MRC5 cells and used at passage one. [0090] VeroE6 cells were transduced using the indicated lentiviruses as previously described ³⁰ . After 72 h of transduction cells were infected with SARS CoV-2 for 16 h with MOI: 0.05 at 37°C, 5 % CO2. For peptide treatments cells were first infected with SARS CoV-2 MOI: 0.05 at 37°C, 5 % CO2, the inoculum was replaced with medium containing the indicated concentration of peptide and cells were incubated at 37°C, 5 % CO ₂ for 16 h. After the infections, cells were fixed in 4 % formaldehyde, permeabilized in 0.5 % triton X-100 in PBS. Viral infected cells were revealed by staining using primary monoclonal antibodies directed against SARS CoV-2 nucleocapsid (SARS CoV-2, Sino Biological Inc., 40143-R001) or primary monoclonal mouse antibodies directed against J2 (HCoV-229E, Scicons 10010500), and secondary antibodies either donkey anti-mouse or donkey anti-rabbit IgG Alexa Fluor 555 secondary antibody (Invitrogen). Nuclei were counterstained with DAPI, to get cell number of each well and number of infected cells were determined using a TROPHOS Plate RUNNER HD® (Dioscure, Marseille, France). Number of infected cells were normalized to DAPI count and presented as percentage infection of mutated control peptide for the lentivirus transduced cells or as percentage of mock treated cells in the case of peptide treatment. Results were analyzed in GraphPad Prism (version 9.4.1) and the sigmoidal dose- response fitting function was used to obtain IC50 values. Viral inhibition assay [0091] VeroE6 cells were infected with SARS CoV-2 (MOI:1) for 1 h at 37°C and 5% CO2. Then inoculum was removed and replaced with medium with the indicated peptide at a concentration of either 300μM or 150 μM . After 8 h of infection cells were lyzed and total RNA was isolated from cells using nucleospin rna Plus xs (Macherey Nagel) according to the manufacturer’s instructions. cDNA synthesis using High-capacity cDNA Reverse Transcription kit (Thermo Fisher). SARS-CoV-2 RNA was quantified using qPCRBIO probe mix Hi-ROX (PCR Biosystems) and the following primers and probes: GTCATGTGTGGCGGTTCACT, CAACACTATTAGCATAAGCAGTTGT and FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ. GAPDH was used as a reference gene, detected by RT² qPCR Primer Assay (NM_001195426, Qiagen) and the qPCRBIO SyGreen mix Hi-ROX (PCR Biosystems). SARS CoV-2 replication was normalized to the infection of the control. qPCR was run on a StepOnePlus real-time PCR system (Applied Biosystems). REFERENCES 1. Park, G. J. et al. The mechanism of RNA capping by SARS-CoV-2. Nature (2022). 2. Guidotti et al. (2017). Cell-Penetrating Peptides: From Basic Research to Clinics. Trends in Pharmacological Sciences, 38(4), 406-424. 3. Gordon, D. E. et al. A SARS-CoV-2 protein interaction map reveals targets for drug repurposing. Nature 583, 459-468 (2020). 4. Thoms, M. et al. Structural basis for translational shutdown and immune evasion by the Nsp1 protein of SARS-CoV-2. Science 369, 1249-1255 (2020). 5. Xu, Z. et al. SARS-CoV-2 impairs interferon production via NSP2-induced repression of mRNA translation. Proc Natl Acad Sci U S A 119, e2204539119 (2022). 6. Mariano, G., Farthing, R. J., Lale-Farjat, S. L. M. & Bergeron, J. R. C. Structural Characterization of SARS-CoV-2: Where We Are, and Where We Need to Be. Front Mol Biosci 7, 605236 (2020). 7. Arya, R. et al. Structural insights into SARS-CoV-2 proteins. J Mol Biol 433, 166725 (2021). 8. Ricciardi, S. et al. The role of NSP6 in the biogenesis of the SARS-CoV-2 replication organelle. Nature 606, 761-768 (2022). 9. Oudshoorn, D. et al. Expression and Cleavage of Middle East Respiratory Syndrome Coronavirus nsp3-4 Polyprotein Induce the Formation of Double-Membrane Vesicles That Mimic Those Associated with Coronaviral RNA Replication. mBio 8 (2017). 10. Lee, J. et al. Crystallographic structure of wild-type SARS-CoV-2 main protease acyl-enzyme intermediate with physiological C-terminal autoprocessing site. Nat Commun 11, 5877 (2020). 11. Wang, Q. et al. Structural Basis for RNA Replication by the SARS-CoV-2 Polymerase. Cell 182, 417-428.e413 (2020). 12. Gao, Y. et al. Structure of the RNA-dependent RNA polymerase from COVID-19 virus. Science 368, 779-782 (2020). 13. te Velthuis, A. J., van den Worm, S. H. & Snijder, E. J. The SARS-coronavirus nsp7+nsp8 complex is a unique multimeric RNA polymerase capable of both de novo initiation and primer extension. Nucleic Acids Res 40, 1737-1747 (2012). 14. Newman, J. A. et al. Structure, mechanism and crystallographic fragment screening of the SARS-CoV-2 NSP13 helicase. Nat Commun 12, 4848 (2021). 15. Kim, Y. et al. Crystal structure of Nsp15 endoribonuclease NendoU from SARS-CoV-2. Protein Sci 29, 1596-1605 (2020). 16. Littler, D. R. et al. A natural product compound inhibits coronaviral replication in vitro by binding to the conserved Nsp9 SARS-CoV-2 protein. J Biol Chem 297, 101362 (2021). 17. El-Kamand, S. et al. A distinct ssDNA/RNA binding interface in the Nsp9 protein from SARS- CoV-2. Proteins 90, 176-185 (2022). 18. Sutton, G. et al. The nsp9 replicase protein of SARS-coronavirus, structure and functional insights. Structure 12, 341-353 (2004). 19. Buchko, G. W., Zhou, M., Craig, J. K., Van Voorhis, W. C. & Myler, P. J. Backbone chemical shift assignments for the SARS-CoV-2 non-structural protein Nsp9: intermediate (ms - μs) dynamics in the C-terminal helix at the dimer interface. Biomol NMR Assign 15, 107-116 (2021). 20. Gorgulla, C. et al. A multi-pronged approach targeting SARS-CoV-2 proteins using ultra-large virtual screening. iScience 24, 102021 (2021). 21. Hu, T. et al. Structural basis for dimerization and RNA binding of avian infectious bronchitis virus nsp9. Protein Sci 26, 1037-1048 (2017). 22. Benz, C. et al. Proteome-scale mapping of binding sites in the unstructured regions of the human proteome. Mol Syst Biol 18, e10584 (2022). 23. Mihalic, F. et al. Large-scale phage-based screening reveals extensive pan-viral mimicry of host short linear motifs, Nat Communications.14: 2409 (2023). 24. Nikolovska-Coleska, Z. et al. Development and optimization of a binding assay for the XIAP BIR3 domain using fluorescence polarization. Anal Biochem 332, 261-273 (2004). 25. F Dudás, E. et al. Backbone chemical shift spectral assignments of SARS coronavirus-2 non- structural protein nsp9. Biomol NMR Assign 15, 235-241 (2021). 26. Mulder, F. A., Schipper, D., Bott, R. & Boelens, R. Altered flexibility in the substrate-binding site of related native and engineered high-alkaline Bacillus subtilisins. J Mol Biol 292, 111-123 (1999). 27. García de la Torre, J., Huertas, M. L. & Carrasco, B. HYDRONMR: prediction of NMR relaxation of globular proteins from atomic-level structures and hydrodynamic calculations. J Magn Reson 147, 138-146 (2000). 28. Aragon, S. & Hahn, D. K. Precise boundary element computation of protein transport properties: Diffusion tensors, specific volume, and hydration. Biophys J 91, 1591-1603 (2006). 29. Bae, S. H., Dyson, H. J. & Wright, P. E. Prediction of the rotational tumbling time for proteins with disordered segments. J Am Chem Soc 131, 6814-6821 (2009). 30. Kruse, T. et al. Large scale discovery of coronavirus-host factor protein interaction motifs reveals SARS-CoV-2 specific mechanisms and vulnerabilities. Nat Commun 12, 6761 (2021). 31. Menacho-Melgar, R., Decker, J. S., Hennigan, J. N., Lynch, M. D., A review of lipidation in the development of advanced protein and peptide therapeutics, J Control Release 295, 1-12 (2019). 32. Zhang, R., Qin, X., Kong, F., Chen, P., Pan, G., Improving cellular uptake of therapeutic entities through interaction with components of cell membrane, Drug Deliv 26, 328-342 (2019). 33. Ali, M., Simonetti, L. & Ivarsson, Y. Screening Intrinsically Disordered Regions for Short Linear Binding Motifs. Methods Mol Biol 2141, 529-552 (2020). 34. Littler, D. R., Gully, B. S., Colson, R. N., Rossjohn, J. Crystal Structure of the SARS-CoV-2 Non- structural Protein 9, Nsp9, iScience 24, 101258 (2020). 35. Guidotti et al. (2017). Cell-Penetrating Peptides: From Basic Research to Clinics. Trends in Pharmacological Sciences, 38(4), 406-424.