Title:
PESTICIDAL FUSIONS
Document Type and Number:
WIPO Patent Application WO/2000/066755
Kind Code:
A2
Abstract:
Disclosed are polynucleotides encoding a pesticidal fusion polypeptide comprising (i) a toxin domain; and (ii) a heterologous binding domain capable of binding non-specifically to a cell membrane without disrupting that membrane. Preferably the toxin domain is derived from a Bacillus thuringiensis cry toxin (e.g. CryIA (b) or (c)) and the binding domain is derived from a lectin (e.g. ricin toxin B chain). The use of such fusions may help to inhibit the acquisition of resistance in a pest population treated with the polypeptide. A further aspect of the invention is a method of assessing the toxicity of a polypeptide to a pest species by expressing a nucleic acid encoding said polypeptide in a host cell from that species, observing the viability of the cell and correlating the results of the observation with the toxicity of the polypeptide, wherein the viability is determined by assessing esterase activity or membrane integrity.
Inventors:
CHRISTOU PAUL (GB)
MEHLO LUKE (ZW)
MEHLO LUKE (ZW)
Application Number:
PCT/GB2000/001633
Publication Date:
November 09, 2000
Filing Date:
April 27, 2000
Export Citation:
Assignee:
PLANT BIOSCIENCE LTD (GB)
CHRISTOU PAUL (GB)
MEHLO LUKE (ZW)
CHRISTOU PAUL (GB)
MEHLO LUKE (ZW)
International Classes:
A01H5/00; A01N63/00; C07K14/325; C07K14/415; C07K14/42; C07K19/00; C12N5/10; C12N15/09; C12P21/02; C12Q1/02; C12Q1/44; (IPC1-7): C12N15/62; C07K14/32; C07K14/415; A01N63/00; C12N15/10; C12N15/63; C12N15/866; C12N5/14; C12P21/00; C12Q1/00
Domestic Patent References:
| WO1998018820A1 | 1998-05-07 | |||
| WO1996010083A1 | 1996-04-04 |
Foreign References:
| US5668255A | 1997-09-16 | |||
| US5763245A | 1998-06-09 |
Other References:
PATENT ABSTRACTS OF JAPAN vol. 018, no. 542 (C-1261), 17 October 1994 (1994-10-17) & JP 06 192295 A (TOAGOSEI CHEM IND CO LTD), 12 July 1994 (1994-07-12)
RAJEMOHAN F. ET AL.: "Bacillus thuringiensis insecticidal proteins: molecular mode of action" PROGRESS IN NUCLEIC ACID RESEARCH AND MOLECULAR BIOLOGY, vol. 60, 1998, pages 1-27, XP000926040
RAJEMOHAN F. ET AL.: "Bacillus thuringiensis insecticidal proteins: molecular mode of action" PROGRESS IN NUCLEIC ACID RESEARCH AND MOLECULAR BIOLOGY, vol. 60, 1998, pages 1-27, XP000926040
Attorney, Agent or Firm:
Kremer, Simon M. (Mewburn Ellis York House 23 Kingsway London
WC2B 6HP, GB)
Download PDF:
Claims:
Claims
| 1. | 1 A nucleic acid molecule encoding a pesticidal fusion polypeptide comprising (i) a toxin domain; and (ii) a heterologous binding domain capable of binding non specifically to a cell membrane without disrupting that membrane. |
| 2. | A nucleic acid as claimed in claim 1 wherein the toxin domain is derived from a Bacillus thuringiensis cry toxin. |
| 3. | A nucleic acid as claimed in claim 2 wherein the Bacillus thuringiensis cry toxin is CryIA (b) or (c). |
| 4. | A nucleic acid as claimed in any one of the preceding claims wherein the binding domain binds carbohydrate. |
| 5. | A nucleic acid as claimed in claim 4 wherein the binding domain has galactose or galactosyl affinity. |
| 6. | A nucleic acid as claimed in claim 4 or claim 5 wherein the binding domain is derived from a lectin. |
| 7. | A nucleic acid as claimed in claim 6 wherein the lectin is a type two ribosome inactivating protein. |
| 8. | A nucleic acid as claimed in claim 7 wherein the binding domain is derived from the ricin toxin B chain. |
| 9. | A nucleic acid as claimed in any one of claims 2 to 8 which comprises all or part of Seq ID No 1 (CryIA (b)) or Seq ID No 2 (CryIA (c)) or a sequence degeneratively equivalent thereto. |
| 10. | A nucleic acid as claimed in any one of claims 2 to 9 which comprises all or part of Seq ID No 3 (RTB1), Seq ID No 4 (RTB2) or Seq ID No 5 (RTB3 or a sequence degeneratively equivalent thereto. |
| 11. | A nucleic acid as claimed in claims 9 or claim 10 which comprises the CryIARTB combination shown in any one of Seq ID No 6 (CryIA (b)RTBl); Seq ID No 7 (CryIA (b)RTB2); Seq ID No 8 (CryIA (b)RTB3) ; Seq ID No 9 (CryIA (c)RTB1); Seq ID No 10 (CryIA (c)RTB2); or Seq ID No 11 (CryIA (c)RTB3) or a sequence degeneratively equivalent thereto. |
| 12. | A nucleic acid as claimed in any one of claims 2 to 8 which comprises a nucleotide sequence which is a homologous variant of any of Seq ID Nos 1 to 11. |
| 13. | A method of producing the nucleic acid of any one of claims 1 to 12, which method comprises the step of combining a nucleic acid encoding a toxin with a nucleic acid encoding a heterologous binding domain, wherein said binding domain is capable of binding nonspecifically to a cell membrane without disrupting it. |
| 14. | A method as claimed in claim 13 wherein the method further comprises the step of modifying the sequence of the toxin or binding domain be by way of addition, insertion, deletion or substitution of one or more nucleotides in the nucleic acid. |
| 15. | A method as claimed in claim 14 wherein the modification of the sequence causes an alteration in the codon usage of the sequence. |
| 16. | A recombinant vector comprising a nucleic acid as claimed in any one of claims 1 to 12. |
| 17. | A vector as claimed in claim 16 wherein the nucleic of any one of claims 1 to 12 is operably linked to a promoter. |
| 18. | A vector as claimed in claim 17 which is an inducible promoter which is switched on in response to an elicitor or other plant signal which is triggered in response to predation. |
| 19. | A vector as claimed in any one of claims 16 to 18 which is a baculovirus vector or a vector suitable for use in a plant. |
| 20. | A method for transforming a host cell which method includes the step of introducing a vector of any one of claims 16 to 19 into the cell and causing or allowing recombination between the vector and the cell genome to introduce the nucleic acid into the genome. |
| 21. | A host cell containing the nucleic acid of any one of claims 1 to 12 or the vector of any one of claims 16 to 19. |
| 22. | A host cell transformed with the nucleic acid of any one of claims 1 to 12 or the vector of any one of claims 16 to 19. |
| 23. | A host cell as claimed in claim 21 or claim 22 which is a plant cell. |
| 24. | A host cell as claimed in claim 23 wherein the plant is a monocot plant. |
| 25. | A host cell as claimed in claim 24 wherein the monocot is maize or rice. |
| 26. | A process for producing a transgenic plant, which process comprises the steps of: (a) performing the method of claim 20 to produce a transformed plant cell; (b) regenerating a plant from said transformed host cell. |
| 27. | A plant obtainable by the process of claim 26, which comprises the host cell of any one of claims 23 to 25. |
| 28. | A plant which is a clone, selfed or hybrid progeny, or other descendant of the plant of claim 27, and which comprises the host cell of any one of claims 23 to 25. |
| 29. | A plant as claimed in claim 27 or claim 28 which is a monocot. |
| 30. | A plant as claimed in claim 29 wherein the monocot is maize or rice. |
| 31. | A part or propagule of the plant of any one of claims 27 to 30 which comprises the host cell of any one of claims 23 to 25. |
| 32. | A method of influencing or affecting the toxicity of a plant to a pest, which method includes the step of causing or allowing expression from a nucleic acid of any one of claims 1 to 12 in the plant. |
| 33. | A pesticidal fusion polypeptide encoded by the nucleic acid of any one of claims 1 to 12. |
| 34. | A method for producing the polypeptide of claim 33 which method comprises the step of causing expression from a nucleic acid of any one of claims 1 to 12 in a suitable host cell. |
| 35. | A composition comprising the polypeptide of claim 33 plus at least one additional component. |
| 36. | A commodity which has been treated with the composition of claim 35 such that it has a reduced susceptibility to attack by a pest. |
| 37. | A method for controlling pests comprising the use of the polypeptide of claim 33. |
| 38. | A method of assessing the toxicity of a polypeptide to a pest species comprising: (i) introducing a nucleic acid encoding said polypeptide into a host cell from that species, (ii) causing or allowing the nucleic acid to be expressed in a host cell from that species, (iii) observing the viability of the cell and correlating the results of the observation with the toxicity of the polypeptide, wherein the viability is determined by assessing esterase activity or membrane integrity. |
| 39. | A method as claimed in claim 37 or claim 38 wherein the pest is a species of insect. |
| 40. | A method as claimed in claim 39 wherein the species is selected from Lepidoptera, Coleoptera, Culicidae, Simuliidae, Hymenoptera, Homoptera, Orthoptera and Diptera. |
| 41. | An oligonucleotide selected from the group consisting of: LF1=5CAACAACAAAGGAATTCATGCTGATG 3 LB1=5 GGACACACACACTGCAAGCTTGTAATC 3, LB2=53', or LB3=5'GCTTGCAAGCTTAGACCATATAGCCC 3''. |
Description:
INTERNATIONALSEARCHREPORT S ional ApNlQtion No IMv ional dpplicatlonNo PCT/GB00/01633 C.(Coritinuction)DOCUMENTSCONSIDEREDTOBERELEVANT CategoryCitationofdocument,withindication, where appropriate, ofthereievant passages RelevanttodaimNo. XUS5668255A(MURPHYJOHNR)1,10,13 16September1997(1997-09-16) column2,line29-column3,line14; claims1,3,4,9,17 XUS5763245A(GREENPLATEJOHNTETAL)38-40 9June1998(1998-06-09) column1,line26-line47 column19,line34-line37 APATENTABSTRACTSOFJAPAN1,2,13 vol.018,no.542(C-1261), 17October1994(1994-10-17) &JP06192295A(TOAGOSEICHEMINDCO LTD),12July1994(1994-07-12) abstract ARAJEMOHAN F. ET AL.:"Bacillus1-41 thuringiensisinsecticidalproteins: molecularmodeofaction" PROGRESSINNUCLEICACIDRESEARCHAND MOLECULARBIOLOGY, vol.60,1998,pages1-27,XP000926040 thewholedocument 2 lKTERNATIONALSEARCHREPORT IM Bonal Application No Information on patent famlly members PCT/GB00/01633 Patent document Publicabon Patent tamily Publicabon citedinsearchreportdate member (s) date WO9818820A07-05-1998AU 5003597 A 22-05-1998 WO9610083A04-04-1996US 5849870 A 15-12-1998 AU 692934 B 18-06-1998 AU 3743395 A 19-04-1996 BG 101384 A 31-10-1997 BR 9509099 A 30-09-1997 CA 2199049 A 04-04-1996 CN 1160420 A 24-09-1997 EP 0792363 A 03-09-1997 HU 77449 A 28-04-1998 JP 10506532 T 30-06-1998 TR 960263 A 21-06-1996 US 6107279 A 22-08-2000 US 6066783 A 23-05-2000 US 5888801 A 30-03-1999 US 5990383 A 23-11-1999 US 5872212 A 16-02-1999 US 5889174 A 30-03-1999 US 5770696 A 23-06-1998 US 5840868 A 24-11-1998 US 5866326 A 02-02-1999 US 5877012 A 02-03-1999 ZA 9508121 A 29-04-1996ZA 9508121 A 29-04-1996 US5668255A16-09-1997US 6022950 A 08-02-2000 US 5965406 A 12-10-1999 AU 657087 B 02-03-1995 AU 7168991 A 24-07-1991 AU 8032194 A 27-04-1995 CA 2071969 A 23-06-1991 EP 0439954 A 07-08-1991 JP 5502880 T 20-05-1993 NO 922447 A 19-08-1992 WO 9109871 A 11-07-1991 AT 79136 T 15-08-1992 AU 592310 B 11-01-1990 AU 4491685 A 10-01-1986 DE3586456A 10-09-1992 DE 3586456 D 10-09-1992 DE 3586456 T 25-03-1993 EP 0185076 A 25-06-1986 ES 543938 D 01-09-1987 ES 8708014 A 16-11-1987 ES 557103 D 16-12-1987 ES 8801376 A 01-03-1988 FI 860541 A 06-02-1986 JP 6205684 A 26-07-1994 JP 2510984 B 26-06-1996 JP 61502304 T 16-10-1986 NO 176807 B 20-02-1995 NZ 212312 A 29-09-1988 W0 8600090 A 03-01-1986WO 8600090 A 03-01-1986 US5763245A09-06-1998US 5558862 A 24-09-1996 US 5554369 A 10-09-1996 US 5518908 A 21-05-1996 AT 147231 T 15-01-1997 INTERNATIONALSEARCHREPORT| «, isl Apficatlon No Information on patent family members PCT/GB00/01633 PatentdocumentPublicationPatentfamilyPublication citedinsearchreportdatemember (s)date US5763245AAU686200B05-02-1998 AU7214094A24-01-1995 BR9406965A27-08-1996 CA2163120A12-01-1995 CN1126423A10-07-1996 DE69401436D20-02-1997 DE69401436T26-06-1997 DK706320T07-07-1997 EP0706320A17-04-1996 ES2097656T01-04-1997 GR3023050T30-07-1997 HU73324A29-07-1996 JP9500528T21-01-1997 NZ268794A27-08-1996 PL312277A15-04-1996 WO9501098A12-01-1995 MX9205383A01-03-1993 JP06192295A12-07-1994NONE
Previous Patent: MODIFIED VITAMIN K-DEPENDENT POLYPEPTIDES
Next Patent: CLONED AND ENGINEERED PLANTS AND METHODS OF USE FOR BIOREMEDIATION
Next Patent: CLONED AND ENGINEERED PLANTS AND METHODS OF USE FOR BIOREMEDIATION