Technical Field of the Invention

The invention relates to a pharmaceutical composition for use as a pr edicament in the prevention or treatment of disease in an animal, the pharmaceutical composition comprising: a first formulation comprising a bioactive component, microcrystal excipient and solubility modifier; and a second formulation comprising a bioactive component, amphiphile and oil excipient; wherein the first formulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively. The invention also relates to associated pharrr aceutical kits and use of the pharmaceutical composition and/or pharmaceutic al kits as a medicament in the prevention or treatment of plague infection, or the prevention of treatment of Middle East Respiratory Syndrome (MERS) infection.

Background to the Invention

Outbreaks of disease among animal populations, in particular human populations, may require a rapid response from healthcare professionals to identity the causative agent of disease and initiate downstream measures to control the spread of disease and implement appropriate prophylaxis or treatment to eradicate the oui break.

Control of disease outbreaks, in particular those outbreaks considered emergency situations and/or associated with low-to-middle income countries, can be hampered by factors that include: a lack of effective healthcare infrastructure; a shortage of funds which can be re-distributed to support humanitarian efforts; and incidents occurring in remote locations with insufficient transport networks that namper rapid healthcare response. A further logistical complication in the provision of effective medicines (e.g. vaccines, antibiotics) to sites of disease outbreaks, in particular in low-to-middle income countries with high-temperature climates, is the requirement for cold chain storage i.e. maintaining medicines at an uninterrupted low-temperature during production, storage and distribution in order to preserve the life span of such products and ensure medicinal efficacy when administered to patients.

Epidemic diseases can be caused by bacterial or viral agents.

The West African Ebola outbreak that occurred in 2013-2016 is a recent example of a rapidly spreading viral disease that caused significant morbidity and mortality in humans, conservatively estimated at 28,616 suspected cases and 1 1 ,310 deaths over the course of the epidemic (http://apps.who.int/gho/da1a/view.ebola- sitrep.ebola-summary-latest?lang=en).

Since first emerging in September 2012 in Saudi Arabia, there hnve been an estimated 2,123 laboratory-confirmed cases of Middle East Respiratc ry Syndrome (MERS). The causative organism is the MERS coronavirus (ME ¾S-CoV), an enveloped, positive-sense, single-stranded RNA virus of the betacoron avirus genus. During 2012-2017, 720 deaths due to MERS were reported from a total of 27 countries, typically in the eastern Mediterrane? n region (http://www.who.int/emergencies/mers-cov/en/). Saudi Arabia remains the main focus of infection and a disease outbreak in South Korea involving 1 f -6 cases was traced back to an index case that had travelled from Saudi Arabi a. Whilst the incidence of MERS in Saudi Arabia peaked in 2014, there are still a significant number of cases reported from the country. For example, in the period of May to June 2017, there have been 86 cases including 22 deaths. Evidence of human-to- human transmission comes from the reporting of outbreaks in countries remote from Saudi Arabia such as the UK, Europe, USA, and China where small oi tbreaks have also occurred. There is thus an urgent need for an effective vaccine.

Plague is an ancient bacterial disease which is still endemic today in cilobal regions and parts of Asia and Africa. Plague has demonstrated potential for epidemic disease, and can be spread from an index case by human-to-human contact. Treatment is difficult, unless infections are identified early, resulting in a high mortality rate. During August 2017, an outbreak of plague in Madagascar was reported to the World Health Organisation. During the outbreak, a total of greater than 2500 cases have been reported, with a high rate (70%) of pneumonic plague and a fatality rate of 8.6% (202 deaths) documented to date (http://www.who.int/csr/don/27-november-2017-plague-madagasc ar/en/). While the causative organism of plague, Yersinia pestis, is susceptible to antibiotics, antibiotic- resistant strains of Y. pestis are known. Therefore, prolonged antibiotic use in a population with endemic plague is undesirable. There is no readily ava lable vaccine with a licence for global use.

Thus, there is a continued need to develop pharmaceutical products toat provide a safe, reliable and effective stimulation of immunity in animals, in particular pharmaceutical products that can be deployed to outbreaks considered emergency situations and/or associated with low-to-middle income countries, and which require minimal cold chain to ease the logistic burden of administering such products to individuals.

Summary of the Invention

According to a first aspect, the invention provides a pharmaceutical cc mposition for use as a medicament in the prevention or treatment of disease in a i animal, the pharmaceutical composition comprising: a first formulation comprisin g a bioactive component, microcrystal excipient and solubility modifier; and a second formulation comprising a bioactive component, amphiphile and oil-based excipient; wherein the first formulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively.

The term ‘bioactive component’ refers to one, or at least one (i.e. encompassing more than one), component capable of inducing a biological effect on an animal, in particular a biological effect on tissue or cell(s) within the animal. The term‘bioactive component’ includes therapeutic constituents, for example drugs such as antibiotics, and/or biological molecules capable of performing as vaccines, such a s an antibody or an element (e.g. protein, glycoprotein) expressed by a particular biological agent such as bacteria, yeast or virus, and particularly those biological entities considered to be pathogens capable of causing disease. Preferably, the te -m ‘bioactive component’ refers to an immunogenic component, typically an immunogenic component with hydrophilic properties, with the ability to stimulate an immune response in an animal, such as a human. Preferably the immune response is a systemic and/or mucosal immune response, for example in the gui and/or lung mucosa. In particular, the bioactive component has an ability to stimulate a humoral and/or cell-mediated immune response. More particularly, the bioactive component may represent an epitope or target (‘antigen’) associated with a specific agent, for example a peptide, polypeptide, protein, glycoprotein, polysaccharide, nucleic acid or any variant or fragment thereof associated with a bacterium or vims capable of causing disease in an animal. The bioactive component may be an antigen capable of stimulating, or assisting in stimulating, an agent-specific immune response in an animal. Examples of bioactive components associated with specific agents, that can be prepared in a pharmaceutical composition according to the invention, include antigen(s) from Y. pestis, the causative agent of plague, and antigen(s) from MERS- CoV, the causative agent of MERS. In the case of more than one individual element providing a bioactive component, each element may have immunogenic properties. As understood by the skilled person, a protein-based or glycoprotein-besed bioactive component may be one, or at least one, recombinant protein or glycoprotein antigen. As further understood by the skilled person, the first formulation and second formulation may provide the same, or different, bioactive components:, in particular the same or different bioactive component(s) for a particular agert such as a bacterial or viral agent.

The term‘microcrystal excipient’ refers to a crystalline carrier, in particular suitable for delivery of biomolecules (see for example: Murdan S et al. Immobilisation of vaccines onto micro-crystals for enhanced thermal stability. Irt J Pharm. 2005;296:117-21 ; and W02009/077732 A2). Such microcrystal excipients as understood by the skilled person are generated from material that includes sugar, amino-acid or salt, which can be combined with a molecule of interest, such as a biomolecule, the latter typically provided in an aqueous solution. Dehydration of the resultant mixture, for example by further adding a water-miscible organic solvent (e.g. methanol, ethanol, propan-1 -ol, acetone, various polyethylene glycols, polyols, or combinations thereof) promotes the generation of a microcrystal arrangement (e.g. lattice, matrix) in which the molecule of interest is immobilised, for example on the surface of the microcrystal.

The term‘solubility modifier’ refers to a further excipient in the first for ulation that, when combined with the microcrystal excipient and bioactive component of interest in an aqueous solution (for example a pharmaceutically-acceptable diluent), reduces the aqueous solubility of the first formulation such as to preferab ly provide a suspension rather than a solution.

The term ‘oil-based excipient’ (see for example: New R.R.C. and Kirby C.J. Solubilisation of hydrophilic drugs in oily formulations. Advanced Drug Delivery Reviews. 1997;25:59-69; and WO2012/152709 A1 ) refers to a pharmaceutically acceptable oil excipient, such as a hydrophobic phase preparation as L nderstood by the skilled person, for example hydrocarbon-based oil phases e.g. non-polar oil such as vegetable oils, straight chain hydrocarbons, long chain fatty acids with unsaturated fatty acids, alcohols halogenated oils, medium or long chain mono-, di- or tri-glycerides. The purpose of the oil excipient is to act as an anhydrous delivery vehicle for a bioactive component, in particular a delivery vehicle which is readily absorbed for oral delivery.

The term ‘amphiphile’ refers to an amphiphilic molecule, typically a collection of amphiphilic molecules, each comprising a hydrophobic (e.g. lipophilic) chain and hydrophilic head group. Different types of amphiphiles are known io the skilled person and include a phospholipid. Due to their polar and non-polar properties, amphiphiles are capable or arranging around hydrophilic molecules, fcr example as ‘reverse micelles’, wherein the head region of each amphiphile molecule is associated with the hydrophilic molecule and the hydrophilic tail of each amphiphile molecule tail is directed away from the hydrophilic molecule. This arrangement allows the amphiphile to form a protective barrier around a hydrophilic molecule, for example in a solute. The solute can be subsequently replaced with an oil phase to provide for co-dispersed amphiphile and hydrophilic molecule within the; oil phase. In the context of the invention, the amphiphile enables dispersion o ^: a bioactive component (e.g. an immune component) throughout an oil excipient (see for example: New R.R.C. and Kirby C.J. Solubilisation of hydrophilic drugs in oily formulations. Advanced Drug Delivery Reviews. 1997;25: 59-69; and WO2012/152709 A1 ).

The term ‘sequentially administered’ refers to the second formulation being administered to an animal following a period of time after the first iormulation is administered to the animal, or vice versa (i.e. the first formulation being administered to an animal following a period of time after the second formulation is administered to the animal). However, preferably the second formulation is administered to an animal after the first formulation is administered to the animal. The period of time may be envisaged to be relatively small i.e. the second formulation may be ac ministered to an animal immediately after the first formulation is administered to the animal (or vice versa i.e. the first formulation may be administered to an animal immediately after the second formulation is administered to the animal). Thus, in the context of disease outbreaks in human populations, only one visit to a clinic would be required by a human subject to receive both the first and second formations. However, it may be that the period of time is measured in a timeframe of e.g. days, weeks or months. In the case of such durations of time periods, it would be envisaged that an animal typically receives the first formulation via a parenteral route, follov/ed by (self) administration of the second formulation via the oral route (or vice versa i.e. an animal typically (self) administers the second formulation via the oral route, followed by receiving the first formulation via the parenteral route) when required.

The term‘parenteral route’ refers to administration of a substance to £in animal via, for example, injection or infusion and includes intramuscular (into muscle), subcutaneous (under the skin), intra-dermal (into skin) and intravenous (into a vein) administration. The inventors have successfully generated formulations of bioactive component(s) for injected priming and oral boosting respectively. This has required formulation optimisation for each vaccination route and iterative testing to demonstrate that administering the formulations in a sequential injected prime and oral boost regimen is an efficacious approach to vaccination.

Advantageously, the invention offers a solution to emergency use situations and/or incidents of disease outbreaks in low-to-middle income countries, in pa ticular where there is a requirement for minimal medical intervention, by offering the following benefits.

Firstly, as demonstrated by the inventors, the pharmaceutical composition of the invention provides a two-formulation, dual-route vaccination approach capable of inducing both systemic and mucosal (e.g. the lungs, respiratory sy tem, gastrointestinal system, genito-urinary tract) immunity. In particular, the inventors have optimised each arm of the vaccination regimen such that the respective parenteral and oral formulations are additive in terms of immunogenicity and protective efficacy. Furthermore, it has been demonstrated that successive administration of each formulation by a parenteral and oral route respectively can stimulate high titres of IgG and IgA in an animal, showing the applicability in terms of the prevention or treatment of disease caused by a pathogen.

Secondly, vaccination of individuals by the pharmaceutical composition of the invention would only require one clinic visit to receive an initial, parentei ally-delivered priming dose of the first formulation. With respect to the first formulation, use of microcrystals with a solubility modifier as the delivery vehicle ol a bioactive component can: assist in the slowed, delayed and/or sustained in vivo release of a bioactive component; increase the thermal stability of a bioactive component; and/or protect a bioactive component against denaturation. The second formulation could be issued by a clinician for administration to an animal, typically a human, as an oral booster dose at a later time as desired/stated. With respect to the second formulation, use of an oil excipient and amphiphile as the delivery vehicle of a bioactive component can ensure the bioactive component is provided ir a stable and homogenously dispersed manner.

Thirdly, neither the first formulation nor second formulation require cold chain distribution or storage and have been shown to be stable at elevated temperatures. Both formulations are highly stable so that neither requires cold chain storage. The microcrystal formulation may be presented as a dry powder which wo jld simply be vialled or filled into a dual-barrel syringe and rehydrated in a phai maceutically- acceptable diluent prior to administration. The second formulation may be presented as an encapsulated form, which can be self-administered e.g. swallowed by a subject. Typically, the first formulation and second formulation do not provide for a significant alteration of the configuration of the bioactive component’:; structure at any point in the vaccine’s shelf life (e.g. during manufacture, storage and/or preparation prior to administration), ensuing that in particular the bioactive component retains a level of immunogenicity capable of stimulating an immune response in the host following administration of the first formulation and/or second formulation.

Thus, the pharmaceutical composition of the invention is particularly suited to low-to- middle income countries lacking medical resources, and/or for emergency use, in particular due to the lack of cold chain for the first and second formulations, and that the second formulation can be easily and safely self-administered via the oral route.

Fourthly, since the pharmaceutical compositions can accommodate bioactive components such as recombinant antigens, the formulations can be readily produced without biocontainment in a standard microbial fermentation facility. Technology transfer of manufacturing and/or formulation processes to a low-to- middle income country, for example, would be feasible since neither process would require biocontainment/specialist facilities beyond those found in a standard pharmaceutical plant. The pharmaceutical composition of the invention is suitable for use in the prevention or treatment of disease in an animal. Examples of disease include but are not limited to, infection (for example infection caused by a bacterial or viral pathogen), cancer, inflammatory dysfunction (for example arthritis), diabetes, and/or allergies. The pharmaceutical composition of the invention can act to ameliorate the animal’s condition by modifying the animal’s immune response in order to counteract the disease.

Preferably, the pharmaceutical composition of the invention is suitable for use in the prevention or treatment of disease in a human.

The bioactive component may be any suitable immunogenic component. Suitable bioactive components may be selected by any suitable technique, fo · example by bioinformatics or immunological analysis.

Preferably, the bioactive component is a peptide, polypeptide, protein, glycoprotein, polysaccharide, nucleic acid or any variant or fragment thereof. Preferably, the bioactive component is an immunogenic peptide, polypeptide, protein, glycoprotein, polysaccharide, nucleic acid or any variant or fragment thereof. Preferably, the bioactive component comprises at least one putative B- and/or T-cell epitope, more preferably a T-cell epitope predicted to bind to at least one h uman Major Histocompatibility Complex molecule. This feature provides a positive indicator from a potential immunogen perspective, and may be selected using bioinformatics analysis.

The term‘variant’ with respect to a bioactive component may refer to s sequence of amino acids, sugars or nucleic acids which differs from the wild-lype or base sequence from which they are derived, but wherein the variant retains the desired properties of the wild-type or base sequence. For example, a variant derived from an immunogenic protein or glycoprotein would retain a desired level of immunogenicity relative to the original immunogenic protein or glycoprotein, and thus be considered an immunogenic variant. As understood by the skilled person, amino acid substitutions can be‘conservative’ i.e. replacing an amino acid with another amino acid with similar properties; or‘non-conservative’ i.e. replacing with another amino acid with different properties. As further understood by the skilled person, suitable variants are preferably at least 70% identical, for example at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical and preferably at least 95% identical compared to the wild-type or base sequence.

The term‘fragment’ with respect to a bioactive component may refer to any amino acid portion, sugar portion or nucleic acid portion of the wild-type or base sequence, typically wherein the fragment retains the desired properties of the wild -type or base sequence. For example, an immunogenic fragment may be a sequence of 5-10 amino acids of the wild-type or base sequence of an immunogenic protein or glycoprotein which encodes a particular immunogenic epitope, and thus be considered to be an immunogenic fragment.

The bioactive component may be modified in other ways as understood by the skilled person. For example, a protein bioactive component (or variant or fragment thereof) may be recombinantly expressed as a fusion protein. For example, a bioactive protein, variant or fragment thereof may be recombinantly expressed as a His6-tagged fusion protein or glutathione-S-transferase fusion, or as a usion protein co-expressed with another bioactive (protein) component. A bioactive protein may be co-expressed with an antibody or variant or fragment, for example co-e:cpressed with an Fc region or variant or fragment thereof of an IgG antibody. Alternative or further attributes which may be used alone or in any combination to select a potential bioactive component for inclusion in the pharmaceutical composition are: whether the bioactive component is exposed or surface-located on an agent, such as a bacterial or viral pathogen, and hence potentially -nore likely to be recognised as non-self by a host immune system; specific characteristics of any possible B- and/or T- cell motifs such as high affinity binding or promiscuous binding to multiple human Major Histocompatibility Complex (MHC) class I aid/or class II molecules; and/or whether expression of the bioactive component by an agent, such as a bacterial or viral pathogen, is up-regulated in an animal during infection, relative to e.g. non-/n vivo environments, or found to be important in the virulence of the agent in vivo.

The microcrystal excipient may be formed from, or include, molecule:; that include amino acids, zwitterions (e.g. betaines), peptides, sugars, sugar iilcohols (e.g. mannitol), buffer components, organic salts, inorganic salts (e.g ammonium bicarbonate), polyols (e.g. myoinositol) and/or other compounds unde stood by the skilled person to be capable of forming a crystalline carrier, in particular suitable for delivery of biomolecules to animals.

Preferaby, the microcrystal excipient comprises an amino acid. This provides a first formulation with a core material of a physiologically acceptable water soluble excipient.

Excipients are preferably processed into microcrystal formulations at an aqueous concentration that is greater than 25% of their solubility limit. Microcrystal excipients with an aqueous solubility of less than about 50 mg/ml at 25 °C are therefore preferred because they can be processed into effective particles using low aqueous concentrations of the bioactive component. Thus the mass-ratio of bioactive component to microcrystal excipient in the final formulation is determined by the ratio of the components present in the aqueous processing solution.

Suitable amino acids include, but are not limited to, alanine, arginine, asparagine, glycine, glutamine, histidine, lysine, leucine, isoleucine, norleucine, D-valine, L- valine, methionine, phenylalanine, proline, and serine or any combination or mixture thereof. Such amino acids where applicable can be in their L- and/or D entantiomers configuration. Such amino acids can also be provided in a salt, for example sodium glutamate.

Preferably, the amino acid is a low solubility amino acid. Particularly preferred amino acids are selected from a group comprising glutamine and histidine. Thus, a bioactive component may be delivered associated with either glutamine - or histidine- based microcrystal excipient. Alternatively, the bioactive component can be delivered on both a glutamine- and histidine-based microcrystal excipient. For the latter, the arrangement is particularly applicable for a plurality of bioactive components, for example two different antigens from a specific agent capable of causing disease in an animal.

A plurality of bioactive components may be delivered as a mixture associated together on the same microcrystal excipient particles, or each individual bioactive component may be delivered associated on separate microcrystal excipient particles. For example, the plurality of bioactive components may be delivered together on histidine and/or glutamine particles. Alternatively, a plurality of bioactiv£> components may be associated with separate microcrystal particles respectively, for example such particles comprising the same glutamine or histidine microcrystal excipient. Alternatively, one bioactive component(s) may be associated with histidine microcrystal excipient and a further bioactive component associated w ith glutamine excipient. The most preferred microcrystal excipient is glutamine because it is neutral and therefore easier to process at different pH. Preferably, the solubility modifier may comprise a salt component, fo·· example an inorganic salt, added during the preparation of the first formulation such that it is integrated with the microcrystal excipient. Suitable salts, for example nclude metal phosphates, metal carbonates and metal hydroxides. Examples of such salts include calcium phosphate, calcium pyrophosphate, aluminium phosphate, aluminium hydroxide, calcium carbonate, iron hydroxide, magnesium phosphate, magnesium carbonate, zinc phosphate and combinations thereof. Such salts may provide a water-insoluble, sparingly soluble or poorly water-soluble metal salt. Without being bound by theory, the inclusion of a salt in the microcrystal excipient may: assist the slow or delayed release of the bioactive component, for example in aqueous solution or following administration of the first formulation in an animal; prevent degradation of the bioactive component, for example from enzymes such as proteases, especially when the bioactive component is delivered in vivo and provide an adjuvant effect when the first formulation is administered to an animal. As a result of such delayed release, inclusion of the salt may further assist in reducing the amount of bioactive component co-administered with the microcrystal excipient, and/or reduce the number of doses of the first formulation administered h an animal, preferably one priming dose at the start of the vaccination regime.

Such salts can be associated with the microcrystal excipient during production of the microcrystal excipient as would be understood by the skilled person (see methods described in W02009/077732 A2).

Preferably, the solubility modifier comprises calcium phosphate. For example, for the primary vaccination, microcrystals incorporating amino acids and comprised of calcium phosphate provide a matrix to which the bioactive component has been absorbed, become associated with or become embedded within. Including calcium phosphate in the microcrystal excipient can be achieved by a reaction between sodium phosphate or potassium phosphate and calcium chloride when preparing the microcrystal excipient.

The modification of the first formulation with calcium phosphate may provide for: a slower release of a bioactive component. In the case of the bioactive component being an immunogenic component a slower release may in turn prolong exposure of the bioactive component to host immune cells; stimulate a more mixed Th1/Th2 immune response; and/or contribute to the adjuvant effect of the first formulation, thus promoting an enhanced immunogenicity of the first formulation e.g. increasing a bioactive component-specific IgG response.

Preferably, the bioactive component is associated with or embedded in the calcium phosphate. For example, the antigen is embedded in calcium phosphate formed from a reaction between sodium phosphate or potassium phosphate and calcium chloride. Such co-arrangement may enhance the immunogenicity of the bioactive component, for example due to the adjuvant effect of the calcium phosphate. Preferably, the bioactive component embedded in the calcium phosphate is incorporated on the surface of the microcrystal excipient. Such arrangement may improve the immunogenic properties of the formulation, for example the presence of the calcium phosphate on the surface of the microcrystal excipient may alter the morphology of the microcrystal excipient, which may in turn cont ibute to the adjuvant activity.

The first formulation may further comprise one or more additional adjuvants as understood by the skilled person, which may increase the host immune response towards the bioactive component of the pharmaceutical composition and/or modulate the immune response towards a particular type of response e.g. Th1 , T!i2. Additional adjuvants(s) may be bound to or associated with the microcrystal excipient or else co-administered with the microcrystal excipient. Examples of adjuvants: that may be bound to or associated with the microcrystal excipient are alum salts and derivatives e.g. Adju-Phos, Toll-Like Receptor agonists and other molecules exhibiting Pathogen Associated Molecular Patterns (PAMPs). Examples of adjuvants that may be co- administered with the first formulation are vitamins e.g. vitamin D and derivatives, squalene-based emulsions (for example MF59®) and analogs, sapins and analogs and PAMPs.

Preferably, the first formulation further comprises a squalene-based emulsion.

Suitable amphiphiles are known to the skilled person (see for example PCT/EP201/058279).

Preferably, the amphiphile is selected from the group comprising phosphatidyl choline, pegylated conjugates of straight-chain hydrocarbons, and/or combinations thereof. Phosphatidyl choline (also known as lethicin) could be either naturally or synthetically produced, for example natural or synthetic soya phosphatidyl choline. Examples of straight-chain hydrocarbons include Brij 52, sodium docusate, and/or combinations thereof. Other examples of amphiphiles include phospholipid. Preferably, the combination of amphiphile is phosphatidyl choline, Brij 52 and sodium docusate. Further preferably, the combination of phosphatidyl choline , Brij 52 and sodium docusate is at a respective weight ratio in the range of 0.8:2.4:2.4 to 2.6:3.2:3.2.

Preferred combinations of phosphatidyl choline, Brij 52 and sodium docusate are at a respective weight ratio of 1 :2:2, 1.4:2.6:2.6 or 2:3:3.

Combination of the bioactive component and amphiphile in the second formulation enables protecting the bioactive component from denaturation; anc assisting in greater dispersion of the bioactive component throughout the host, which in turn potentially prevents unfavourable localised reactions displayed by the host.

Suitable oil-based excipients are known to the skilled person (see for example PCT/EP201/058279).

Preferably, the oil-based excipient is selected from a group comprising medium- chain triglyceride, mineral oil and phytol. M818 is a medium chain triglyceride. Other glycerides can be used, for example medium-chain monoglycerides.

The second formulation may comprise at least one immunostimulant to promote the immune response stimulated in the host. In particular the inclusion of an immunostimulant in addition to the bioactive component can assist in e nhancing the antibody responses achieved.

Preferably, the second formulation comprises at least one immunostimulant selected from the group comprising imiquimod, vitamin A or derivative thereof, vitamin D or derivative thereof, vitamin E and/or alpha tocopheryl acetate (ATA) or derivative thereof, didodecyldimethylammonium bromide (DDAB), trehalose ditehenate and cholera toxin B (CTB). Preferably, the vitamin A or derivative thereof is the vitamin A metabolite retinoic acid.

ATA is a non-toxic derivative of vitamin E.

Combinations of immunostimulant selected from the group described above have been shown to be particularly beneficial at stimulating immune responses, for example mucosal immunity as evidenced by the detection of specific IgA in blood serum and faecal extracts.

Imiquimod is an immunomodulatory compound that has activity as a tol -like receptor 7 agonist, and can be used a topical treatment, for example against skin conditions such as warts.

Vitamins A, D and E or derivatives thereof offer immunostimulant p operties that include enhancing dendritic cell activation, which in turn induces effector T-cells. Vitamin A, in particular retinoic acid, stimulates gut-resident dendritic cells to induce the expression of CCR9 and apha-4-beta-7 integrin on T-cells anc induce guthoming of T-cells through the binding of ligands (e.g. MAdCAM-1 , CCL 25) which are selectively expressed on intestinal cells. ATA also activates dendritic cells and has adjuvant properties.

DDAB is a cationic surfactant with properties that include promoting electrostatic contact with Peyer’s Patch cells in the small intestine as, as a consequence, promoting vaccine uptake.

Trehalose dibehenate is a synthetic derivative of the mycobacterial trehalose dimycolate and a potent macrophage activate and Th1/Th7 adjuvant.

CTB can act as both an anti-inflammatory and an immunomodulatory molecule, in particular a mucosal adjuvant which promotes binding of mucosal antigen presenting cells. It is understood by the skilled person that CTB may include a variant or fragment thereof. It is envisaged that other aspects of the cholera toxin, including whole cholera toxin, could also be provided.

Alternative immunostimulants may be envisaged by the skilled person, for example CpG constructs, chitosan, monophosphoryl lipid A, and bacterial or viral constituents, including whole virus particles.

The second formulation may be encapsulated in order to protect such an orally- delivered formulation from degradation in the acidic environment of the stomach. Such physical protection can ensure the second formulation would be released after the stomach, for example in the upper tract of the intestine, thus providing for targeted stimulation of a mucosal immune response. For example the second formulation may be provided with an enteric-coating in the form of a polymer barrier, for example a fatty acid, wax, gelling agent or plastic coating, in particular hydroxypropyl methylcellulose or gelatin. Due to the anhydrous nature of the second formulation, such coating can provide the second formulation in an easy-to- administer arrangement, for example as a tablet, lozenge or capsule form.

Preferably, the second formulation is encased in a capsule comprising gelatin. Thus, the second formulation would be provided in an encased form which could be self- administered as an oral booster.

It is to be understood that other components suitable for pharmaceutical formulations may be provided in the first and/or second formulations, including but limited to stabilizers, surfactants, isotonicity modifiers and/or pH buffering agents.

Preferably, the parenteral route is via subcutaneous injection. This route in particular provides a rapid exposure of a pharmaceutical composition in the host, aiding delivery to immune cells capable of mounting an immune response.

Preferably, the second formulation is administered to the animal at least 14 days after the first formulation. For example, the second formulatic n could be administered, preferably self-administered, at least 14, 15, 16, 17, 18, 19 or 20 days after receiving the first formulation.

More preferably, the second formulation is administered to the animal at least 21 days after the first formulation. For example, the second formulaton could be administered, preferably self-administered, at least 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 42, 49 or 56 days after receiving the first formulation.

Such a delay in the administration of the second (booster) formulation may provide for re-exposure of an administered bioactive component such that a host immune response against that bioactive component is heightened, and in the case of protective efficacy may assist in stimulating a protective immune response in the host.

Preferably, the second formulation is self-administered. This aspect of administration reduces the burden from a medical resources perspective.

Preferably, the invention provides a pharmaceutical composition for use in the prevention or treatment of plague. Infection by Y. pestis leads to the disease plague. The inventors have applied the pharmaceutical composition immunisation regimen of the invention to a two-dose, dual route pharmaceutical composition directed against Y. pestis, wherein a first formulation is delivered by a parenteral route (e.g. via subcutaneous injection), followed by a second formulation delivered by the oral route. This dual route vaccination is advantageous in inducing both rapid-onset systemic and mucosal immunity, thus preventing the several manifes :ations of the disease of plague (bubonic, gastro-intestinal and pneumonic). Such approach would be suitable to curtail incidents of plague in endemic regions and may tie convenient to use in emergency situations.

The inventors have demonstrated that these formulations are compatible in a two- dose dual-route dosing regimen, such that the oral booster dose significantly enhances the F1 - and V-specific IgG titres, achieving values equivalent to those achieved with three injected doses. F1 and V-specific circulating IgG was detectable at 14 days after the priming dose, with specific IgA present in the blood at day 35, 14 days after a single oral booster. Furthermore, the first formulation in vie lied form has been shown to demonstrate stability at 40 °C and 75% relative humidity for 29 weeks, indicating that no cold chain for storage or distribution is required.

Preferably, the pharmaceutical composition comprises a bioactive ; component comprising a Yersinia protein or variant or fragment thereof. More preferably, the bioactive component comprises a Y. pestis protein or variant or fragment thereof. It is to be understood that the bioactive component may provide for at least one Yersinia protein or variant or fragment thereof, in particular at least one Y. pestis protein or variant or fragment thereof.

Preferably, the bioactive component comprises the Yersinia F1 and \! proteins or variants or fragments thereof. Preferably, the Yersinia F1 and V proteins or variants or fragments thereof are Y. pestis F1 and V proteins or variants or fragments thereof. It is to be understood that the F1 and/or V protein is provided as a protein or variant or fragment thereof. The inventors have demonstrated that F1 and V a e compatible in a two dose dual route regimen such that the oral booster dose· significantly enhances the F1 - and V-specific serum IgG tires, surprisingly achieving values equivalent to those achieved with three injected doses. The effect of combining these formulations into a dual route vaccination regimen resulted in lgG1 as the predominant isotype for both the F1 and V, suggesting a Th2 polarised response overall.

M. de O. Domingos et al. (A new Oil-Based Antigen Delivery Formulation for both Oral and Parenteral Vaccination. The Open Drug Delivery Journal. 2008;2:52-60) discloses an oil-based carrier vehicle for delivery of Yersinia pests F1 and V antigens. In animal studies, 60% of mice were shown to survive an aerosol challenge of 1000 Colony Forming Units (CFU) (100 Median Lethal Doses (MLD)) of virulent Y. pestis when administered with three doses of an orally gavaged formulation of 250 pg F1 and V antigens in a synthetic triglyceride Miglyol 818 (M818) oil delivery vehicle with Cholera Toxin B. For this study, mice were challenged on day 91 , 39 days after completion of the immunisation schedule.

In contrast, the effectiveness of the invention as exemplified as a pharmaceutical composition against Y. pestis strain C092 surprisingly demonstrated 100% survival in mice against subcutaneous challenge of 2.2 x 10 ⁴ CFU (2.2x 10 ⁴ MLD) Y. pestis, and at least 90% survival against subcutaneous challenge of 2.2 x 10 ⁶ CFU (2.2x 10 ⁶ MLD) Y. pestis. For this challenge, mice only received 10 pg of F1 plus 10 pg of V in 0.1 ml, whereas for all oral dosing, mice received 25pg of each antigen in a total volume of 0.1 ml volume, by oral gavage. Furthermore, mice were challenged at only 25 days after the second oral booster dose. Thus, the inventors have demonstrated that the dual-route dosing regimen of the invention using F1 and V proteins of Y. pestis can provide a simple, safe, stable and highly efficacious vaccine against plague.

Preferably, the invention provides a pharmaceutical composition comprising; a first formulation comprising Y. pestis F1 and V proteins or variants or fragments thereof, microcrystal excipient and solubility modifier; and a second formulation comprising Y. pestis F1 and V proteins or variants or fragment thereof, amphiphile and oil-based excipient comprising at least one immunostimulant selected from the group comprising imiquimod, vitamin A or derivative thereof, vitamin D or derivative thereof, vitamin E and/or ATA or derivative thereof, ATA, DDAB, trehalose dibehenate and CTB; wherein the first formulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively.

The Yersinia F1 and V bioactive components may be delivered as a mixture associated together on the same microcrystal excipient particles, or each individual Yersinia F1 and V bioactive component may be delivered associated on separate microcrystal excipient particles.

Preferably, the first formulation comprises Yersinia F1 and V proteins or variants or fragments thereof, for example Y. pestis F1 and V proteins or variants or fragments thereof, associated with glutamine microcrystal excipient or histidine microcrystal excipient. For example, the Yersinia F1 and V bioactive components may be delivered together on histidine and/or glutamine particles. Alternatively, Yersinia F1 and V bioactive components may be associated with separate microcrystal particles respectively, for example such particles comprising the same glutamine or histidine microcrystal excipient. Alternatively, one of Yersinia F1 and V bioactive component may be associated with histidine microcrystal excipient and the other of Yersinia F1 and V bioactive component may be associated with glutamine microcryntal excipient. The most preferred microcrystal excipient is glutamine because it k· neutral and therefore easier to process at different pH.

Preferably, the solubility modifier comprises calcium phosphate.

The first formulation may additionally include a squalene-based emulsion adjuvant, for example MF59®. The inclusion of MF59® in the injected arm of ihe two-dose, dual route regimen resulted in a pharmaceutical composition that wa s surprisingly fully protective against high challenge levels of up to 2.2.x10 ⁶ MLD of virulent Y. pestis C092, at only 25 days after the oral booster dose. This result was obtained despite the inclusion of MF59® shown to be associated with a significantly depressed serum IgG (predominantly igG1 ) and IgA titres to both F1 and V proteins. While not wishing to be bound by theory, the paradoxical effects observed for MF59® may be partly attributable to the Th2-polarising effect of the oral boost curtailing the influence of MF59® to induce Th1 responses. It is considered that MF59® may also offer a beneficial effect with respect to antibody maturation and affinity.

Preferably, the second formulation comprises Yersina F1 and V proteins or variants or fragment thereof, and an amphiphile associated with an oil-based excipient. Preferably, the proteins are Y. pestis F1 and V proteins or variants or fragments thereof. The oil-based excipient may incorporate CTB. Alternative or additional immunostimulants to CTB may include ATA and/or DDAB. The choice of oil-based excipient may include M818, mineral oil or phytol. The inventors have shown that providing an oral boosting dose with Y. pestis F1 and V proteins ormulated in mineral oil with added CTB gave a significantly enhanced IgG response to F1 compared with subcutaneous boosting with Y. pestis F1 and V proteins in MF59®. Preferably, the second formulation comprises Yersina F1 and V proteins or variants or fragment thereof and an amphiphile associated with an oil-based excipient, the oil- based excipient comprising at least one i munostimulant selected from the group comprising imiquimod, vitamin A or derivative thereof, vitamin D or deriv ative thereof, vitamin E and/or ATA or derivative thereof, DDAB, trehalose dibehenate and CTB. Preferably, the proteins are Y. pestis F1 and V proteins or variants or fragments thereof.

More preferably, the second formulation comprises Yersinia F1 and \/ proteins or variants or fragments thereof and an amphiphile associated with mineral oil incorporating retinoic acid, vitamin D, vitamin E, DDAB, trehalose dibehenate and CTB. Preferably, the proteins are Y. pestis F1 and V proteins or variants or fragments thereof.

Preferably, the amphiphile is selected from the group comprising phosphatidyl choline, pegylated conjugates of straight-chain hydrocarbons, and/or combinations thereof. Phosphatidyl choline (also known as lethicin) could be either naturally or synthetically produced, for example natural or synthetic soya phosphatidyl choline. Examples of straight-chain hydrocarbons include Brij 52, sodium docjsate, and/or combinations thereof. Other examples of amphiphiles include phospholipid.

Preferably, the combination of amphiphile is phosphatidyl choline, Brij 52 and sodium docusate. Further preferably, the combination of phosphatidyl choline , Brij 52 and sodium docusate is at a respective weight ratio in the range of 0.8:2.4:2.4 to 2.6:3.2:3 2.

Preferred combinations of phosphatidyl choline, Brij 52 and sodium docusate are at a respective weight ratio of 1 :2:2, 1.4:2.6:2.6 or 2:3:3. The inventors have shown that a significant increase in fecal IgA for both F1 and V can be achieved using a second formulation comprising phytol with added retinoic acid, or MO with DDAB or ATA added to the formulation.

Preferably, the invention provides a pharmaceutical composition comprising: a first formulation comprising Y. pestis F1 and V proteins or variants or fragments thereof, glutamine microcrystal excipient and/or histidine microcrystal excipienl and calcium phosphate solubility modifier; and a second formulation comprising Y. pestis F1 and V proteins or variants or fragments thereof, amphiphile and mineral oil incorporating retinoic acid, vitamin D, vitamin E, DDAB, trehalose dibehenate and CTB; wherein the first formulation and second formulation are sequentially admini stered to the animal via a parenteral route and an oral route respectively.

Further preferably the invention provides a pharmaceutical composition consisting of: a first formulation consisting of Y. pestis F1 and V proteins or variants or fragments thereof, glutamine-calcium phosphate microcrystal excipient or hisiidine-calcium phosphate microcrystal excipient; and a second formulation consisting of Y. pestis F1 and V proteins or variants or fragments thereof, amphiphile and mineral oil incorporating retinoic acid, vitamin D, vitamin E, DDAB, trehalose dibehenate and CTB; wherein the first formulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively.

Preferably, the amphiphile is selected from the group comprising phosphatidyl choline, pegylated conjugates of straight-chain hydrocarbons, and/or combinations thereof. Phosphatidyl choline (also known as lethicin) could be either naturally or synthetically produced, for example natural or synthetic soya phosphatidyl choline. Examples of straight-chain hydrocarbons include Brij 52, sodium docusate, and/or combinations thereof. Other examples of amphiphiles include phospholipid.

Preferably, the combination of amphiphile is phosphatidyl choline, Brij 51 and sodium docusate. Further preferably, the combination of phosphatidyl choline , Brij 52 and sodium docusate is at a respective weight ratio in the range of 0.8:2.4:2.4 to 2.6:3.2:3.2.

Preferred combinations of phosphatidyl choline, Brij 52 and sodium docusate are at a respective weight ratio of 1 :2:2, 1.4:2.6:2.6 or 2:3:3.

Preferably, the invention provides a pharmaceutical composition for use in the prevention or treatment of MERS. The inventors have applied th vaccination regimen of the invention to design a safe and efficacious two-dos e, dual-route pharmaceutical composition to maximise both mucosal and systemic ir tmunity in an animal against MERS-CoV. The platforms each have inherent advant ages for their respective routes of delivery in terms of stability and no requirement lor cold chain storage. In addition to these desirable physical properties, both form ilations have been shown to be highly immunogenic, enabling a reduction of th a vaccination regimen to only two doses and rapidly inducing specific systemic and mucosal immunity. Again, such an approach would be suitable for curtailing incidents of MERS in endemic regions and may be convenient to use in emergency situations.

Preferably, the pharmaceutical composition comprises a bioactive component comprising a MERS-CoV protein or variant or fragment thereof. The pharmaceutical composition may comprise a bioactive component that comprises a protein encoded by the MERs-CoV genome i.e. one or more of the 16 non-structural pioteins and/or the four structural proteins identified as the spike, envelope, membrane and nucleocapsid respectively. It is to be understood that the bioactive component may provide for at least one MERS-CoV protein or variant or fragment thereof.

The spike protein of MERS-CoV is an envelope-anchored trimeric spike protein which binds to the human receptor dipeptidyl peptidase 4 (DPP4 or CD: >6) and gains host cell entry by the fusion of viral and host membranes. The spike protein comprises an S1 sub-unit and a membrane fusion S2 sub-unit. In the c Dronaviruses, the S1 sub-units are further divided into N-terminal and C-terminal sub domains. For MERS-CoV, it is the C-terminal sub-domain that comprises a Recuptor Binding Domain (RBD). The RBD also incorporates a receptor binding motif at ii s C-terminal.

Preferably, the bioactive component may comprise the spike protein, or variant or fragment thereof, S1 sub-unit or variant or fragment thereof, the S sub-unit C- terminal subdomain or variant or fragment thereof, and/or the RBD or variant or fragment thereof.

Preferably, the bioactive component comprises MERS-CoV Rece ptor Binding Domain (RBD) or variant or fragment thereof. The RBD or variant or fragment thereof may be provided as a conjugate protein, for example conjugated to C- terminal Fc region or variant or fragment thereof of an IgG antibody, in particular the C-terminal Fc region or variant or fragment thereof of a human IgG antibody. The inventors have shown that the pharmaceutical composition of the invention can be readily produced and is rapidly effective in inducing both systemic and mucosal immunity. For example, when combined in a two-dose, dual-route immunisation regimen, these formulations have induced high titres of neutralising IgG and IgA specific for the RBD of the viral Spike protein. The RBD-Fc protein eno impasses the authentic receptor binding sequence from MERS-CoV and when for nulated as a vaccine, induced antibody which effectively neutralised two different cl nical isolates of MERS-CoV. Furthermore, the expression and purification of a recombinant RBD- Fc protein in milligram quantities offers the advantages of being a scalable and reproducible product.

Whilst the microcrystal formulation of RBD was as effective as RBD in MF59® in inducing a primary IgG response, the inventors have shown that an or al formulation of RBD in an oil-based excipient with selected amphiphiles and imm nostimulants was as effective as an MF59® formulation when used as a booster immunisation. Additionally, the inventors have shown that injected priming with RBD in the microcrystal formulation together with oral formulation boosting is a > effective at inducing a specific mucosal response, non-invasively measured as s iecific IgA in serum and faeces, when compared to RDB-specific serum IgA levels following oral priming and boosting. In contrast, subcutaneous prime and boost did not induce RDB-specific serum IgA. The inventors predicted vaccine efficacy by indirect means, testing murine antisera in a plaque reduction assay in vitro, using two different MERS-CoV cli lical isolates. The two-dose dual route immunisation was as effective at inducing neutralising antisera. In contrast, alternative protein-based MERS Co-V vaccin s candidates require administration via a single route only in multiple doses, for example three separate doses given via the intramuscular or subcutaneous route on y, to achieve efficacy against MERs-CoV (Okba NMA et at. Middle East respiratory syndrome coronavirus vaccines: current status and novel approaches. Current Opinion in Virology. 2017; 23:49-58). Furthermore, the inventors achieved neutralising antibody activity in vitro with two vaccinations (via the subcutaneous and oral route respectively) with an initial subcutaneous dose of 2.5 pg RBD. In contrast, alternative approaches have required 10 pg RBD to be delivered via three subcutaneous injections (Du et al A Truncated Receptor-Binding Domain of MERS-CoV Spike Protein Potently Inhibits MERS-CoV Infection and Induces Strong Neutralizing Antibody Responses: Implications for Developing Therapeutics and Vaccines. PLoS One. 2013; 8:e81587). Furthermore, RBD-specific murine antisera, induced by the two respective formulations and passively administered to naive recipient mice, was shown to significantly reduce MERS-CoV viral load in the lungs of challenged animals, relative to negative controls, thus demonstrating in vivo neutralisation ability. Thus, the invention has demonstrated the advantages of achieving neutralising efficacy with comparatively fewer immunisations and a lower dose level of subcutaneously-delivered antigen.

Preferably, the invention provides a pharmaceutical composition comprising: a first formulation comprising MERS-CoV RBD or variant or fragment thereof, microcrystal excipient and solubility modifier; and a second formulation comprising MERS-CoV RBD or variant or fragment thereof, amphiphile and oil-based excipient comprising at least one immunostimulant selected from the group comprising imiquimod, vitamin A or derivative thereof, vitamin D or derivative thereof, vitamin E and/or alpha tocopheryl acetate (ATA) or derivative thereof, DDAB, trehalose dit ehenate and CTB; wherein the first formulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively.

Preferably the MERS-CoV RBD or variant for fragment thereof is MERS-CoV RBD or variant or fragment thereof conjugated to a C-terminal Fc region or variant or fragment thereof of an IgG antibody.

Preferably, the first formulation comprises MERS-CoV RBD or variant or fragment thereof associated with glutamine microcrystal excipient and/or histidine microcrystal excipient. More preferably, the first formulation comprises MERS-CoV RBD or variant or fragment thereof associated with glutamine microcrystal excipient.

Preferably, the solubility modifier comprises calcium phosphate.

The first formulation may additionally include a squalene-based emulsion adjuvant, for example MF59®. The use of MF59® to formulate the RBD-Fc protf in resulted in high titres of specific IgG in serum.

Preferably, the second formulation comprises MERS-CoV RBD or variant or fragment thereof and an amphiphile associated with an oil-based excipient, the oil- based excipient comprising at least one immunostimulant selected from the group comprising imiquimod, vitamin A or derivative thereof, vitamin D or derivative thereof, vitamin E and/or ATA or derivative thereof, DDAB, trehalose dibehen te and CTB. The choice of oil-based excipient may include M818, mineral oil or phytol.

More preferably, the second formulation comprises MERS-CoV RED protein or variants or fragments thereof and an amphiphile associated with mineral oil incorporating imiquimod, retinoic acid, vitamin D, vitamin and E, trehalose dibehenate and CTB. Preferably, the amphiphile is selected from the group comprising phosphatidyl choline, pegylated conjugates of straight-chain hydrocarbons, and/or combinations thereof. Phosphatidyl choline (also known as lethicin) could be either naturally or synthetically produced, for example natural or synthetic soya phosphatidyl choline. Examples of straight-chain hydrocarbons include Brij 52, sodium doc jsate, and/or combinations thereof. Other examples of amphiphiles include phospholipid.

Preferably, the combination of amphiphile is phosphatidyl choline, Brij 52 and sodium docusate. Further preferably, the combination of phosphatidyl choline , Brij 52 and sodium docusate is at a respective weight ratio in the range of 0.8:2.4:2.4 to 2.6:3.2:3.2.

Preferred combinations of phosphatidyl choline, Brij 52 and sodium docusate are at a respective weight ratio of 1 :2:2, 1 4:2.6:2.6 or 2:3:3.

Preferably, the invention provides a pharmaceutical composition comprising: a first formulation comprising MERS-CoV RBD-Fc conjugate or variant or fragment thereof, glutamine microcrystal excipient or histidine microcrystal excipient and solubility modifier; and a second formulation comprising MERS-CoV RBD-Fc or variant or fragment thereof, amphiphile and mineral oil incorporating imiquimod, retinoic acid, vitamin D, vitamin E, trehalose dibehenate and CTB; wherein the first formulation and second formulation are sequentially administered to the animal vie a parenteral route and an oral route respectively.

Further preferably the invention provides a pharmaceutical composition consisting of: a first formulation consisting of MERS-CoV RBD-Fc conjugate or variant or fragment thereof, glutamine-calcium phosphate microcrystal excipient and solubility modifier; and a second formulation consisting of MERS-CoV RBD-Fc conjugate or variant or fragment thereof, amphiphile and mineral oil incorporating retinoic acid, vitamin D, vitamin E, DDAB, trehalose dibehenate and CTB; wherein the first foimulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively.

Preferably, the amphiphile is selected from the group comprising phosphatidyl choline, pegylated conjugates of straight-chain hydrocarbons, and/or combinations thereof. Phosphatidyl choline (also known as lethicin) could be either naturally or synthetically produced, for example natural or synthetic soya phosphatidyl choline. Examples of straight-chain hydrocarbons include Brij 52, sodium docjsate, and/or combinations thereof. Other examples of amphiphiles include phospholipid.

Preferably, the combination of amphiphile is phosphatidyl choline, Brij 51 and sodium docusate. Further preferably, the combination of phosphatidyl choline, Brij 52 and sodium docusate is at a respective weight ratio in the range of 0.8:2.4:2.4 to 2.6:3.2:3.2.

Preferred combinations of phosphatidyl choline, Brij 52 and sodium docusate are at a respective weight ratio of 1 :2:2, 1.4:2.6:2.6 or 2:3:3.

According to a second aspect, the invention provides a pharmaceutical kit comprising the pharmaceutical composition of the first aspect i.e. comprising a first formulation comprising a bioactive component, microcrystal excipient and solubility modifier; and a second formulation comprising a bioactive component, amphiphile and oil-based excipient. The pharmaceutical kits of the invention are su itable for use in the prevention or treatment of infection in an animal. However, the pharmaceutical kits may be applied to other disease conditions, for example cancer, inflammatory dysfunction (for example arthritis), diabetes, and/or allergies. The pharmaceutical kits of the invention can act to ameliorate the animal’s condition by modifying the animal’s immune response in order to counteract the disease. Preferably, the invention provides a pharmaceutical kit wherein ihe bioactive component is a peptide, polypeptide, protein, glycoprotein, polysacch aride, nucleic acid or any variant or fragment thereof. Preferably, the bioactive component comprises the Yersinia protein or variant or fragment thereof. Further preferably, the bioactive component comprises the Y. pestis F1 and V proteins or variants or fragments thereof.

Alternatively, the bioactive component comprises a MERS coronavius protein or variant or fragment thereof. Further alternatively, the bioactive component comprises MERS-CoV Receptor Binding Domain (RBD) or variant or fragment theieof.

Preferably, the microcrystal excipient comprises an amino acid selected from a group comprising glutamine and histidine. Preferably, the microcrystal excipient comprises glutamine.

Preferably, the solubility modifier is calcium phosphate.

Preferably, the first formulation further comprises one or more additional adjuvants, for example vitamins e.g. vitamin D and derivatives, squalene-based e mulsions (for example MF59®) and analogs, sapins and analogs and PAMPs.

Preferably, the first formulation further comprises a squalene-based emulsion.

Preferably, the combination of amphiphile is phosphatidyl choline, Brij 51 and sodium docusate. Further preferably, the combination of phosphatidyl choline, Brij 52 and sodium docusate is at a respective weight ratio in the range of 0.8:2.4:2.4 to 2.6:3.2:3.2.

Preferred combinations of phosphatidyl choline, Brij 52 and sodium docusate are at a respective weight ratio of 1 :2:2, 1.4:2.6:2.6 or 2:3:3.

Preferably, the oil-based excipient is selected from a group comprising medium- chain triglyceride, mineral oil and phytol. Preferably, the second formulation comprises at least one immunostimulant selected from the group comprising imiquimod, vitamin A or derivative thereof, vitamin D or derivative thereof, vitamin E and/or alpha tocopheryl acetate (ATA) or derivative thereof, didodecyldimethylammonium bromide (DDAB), trehalose dibehenate and cholera toxin B (CTB).

Preferably, the second formulation is encased in a capsule comprising g elatin.

According to a third aspect, the invention provides for use of a pharmaceutical composition according to the first aspect, or a pharmaceutical kit act ording to the second aspect, as a medicament.

Preferably, the invention provides for use of a pharmaceutical composif on according to the first aspect, or a pharmaceutical kit according to the second aspect, as a medicament in the prevention or treatment of plague.

Preferably, the invention provides for use of a pharmaceutical composil on according to the first aspect, or a pharmaceutical kit according to the second aspect, as a medicament in the prevention or treatment of MERS.

Any feature in one aspect of the invention may be applied to any other aspects of the invention, in any appropriate combination. In particular, pharmaceutical composition aspects may be applied to pharmaceutical kit aspects and vice versa. The invention extends to pharmaceutical compositions and pharmaceutical kits su ostantially as herein described, with reference to the Examples.

In all aspects, the invention may comprise, consist essentially of, or consist of any feature or combination of features.

The present invention will now be described, with reference to the following non- limiting examples and Figures in which: Brief Description of the Figures

Figure 1 shows graphs demonstrating the immunogenicity of F1 +V in a 3-dose (days 0, 10, 31 ), dual-route immunisation schedule;

Figure 2 shows graphs of immunogenicity of F1 +V formulated on rotein-coated microcrystals (PCMCs) of different composition, with and without MF59®, following immunisation in a 3-dose subcutaneous only schedule (days 0, 10, 31 ); Figure 3 shows graphs of the determination of IgG isotypes induced to F1 and V at day 57, by protein-coated microcrystal formulations, with and without MF59®, in a 3- dose subcutaneous only schedule (days 0, 10, 31 );

Figure 4 shows graphs of immunogenicity of F1 +V in dual-route, 2-d ise schedule (subcutaneous prime on day 0, oral booster on day 21 );

Figure 5 shows a graph of protective efficacy of two-dose dual-route immunisation against Y. pestis challenge; Figure 6 shows a graph of stability of calcium phosphate modified protein-coated microcrystal samples after storage at 40 °C / 75% relative humidity for 29 weeks and analysed by ELISA;

Figure 7 shows graphs of the stability of oral formulation B as analysed by HPLC;

Figure 8 shows graphs of the development of IgG titres in mice over time in response to RBD-Fc in MF59® or alhydrogel;

Figure 9 shows graphs of murine antisera to RBD-Fc effectively neutralising clinical isolates of MERS-CoV in vitro ; Figure 10 shows graphs of serum IgG to RBD-Fc after dual- oi single-route immunisation;

Figure 1 1 shows graphs comparing induction of RBD-Fc-spe· :ific IgA by subcutaneous priming with oral boosting and oral priming and boosting;

Figure 12 shows graphs of in vitro neutralisation of MERS-CoV strains by individual murine antisera induced to RBD-Fc in either a dual-route or single-route immunisation regimen; and

Figure 13 shows time-course expression (days 3-17) of CD26 in murir e lung tissue following the administration of Ad5hDPP4 to mice via the intranasal route (A); and the effect of passively immunising mice with murine antisera on the content of MERS-CoV in murine lungs at day 3 post-infection.

Detailed Description

The pharmaceutical composition or kits of the invention comprise: a first formulation comprising a bioactive component, microcrystal excipient and solubility modifier; and a second formulation comprising a bioactive component, amphiphile and oil excipient; wherein the first formulation and second formulation are sequentially administered to the animal via a parenteral route and an oral route respectively. Various studies have been carried out to demonstrate that use of the two-dose, dualroute vaccination regimen using the pharmaceutical composition of the invention can produce an immune response in animals. In particular, the invention has been demonstrated to effectively and rapidly induce systemic and mucosal immunity with high titres of specific IgG and IgA detectable in blood and faeces.

As shown below, an agent-specific pharmaceutical composition of the invention, adapted for protection against, or treatment of, a bacterial pathogen (Y. pestis) or viral pathogen (MERS-CoV) respectively, has been demonstrated to generate immunity in animals. In particular, the inventors have demonstrated that the pharmaceutical composition of the invention can stimulate an efficacious immune response against Y. pestis challenge.

Pharmaceutical composition for prevention or treatment of Y. pest s

Materials and Methods

Animals

Specific pathogen-free female Balb/c mice (6-8 weeks of age) were obtained from a commercial breeder and used throughout this study. On receipt mice were randomised for allocation to cages and given free access to food, water and environmental enrichment. Mice were fully acclimatised to the animal housing facility for at least five days prior to any procedure. All animal procedures were performed in accordance with UK legislation as stated in the UK Animal (Scientific Procedures) Act 1986. The Institutional Animal Care and Use Committee approved the relevant Project licence.

Protein antigens

The recombinant F1 and V antigens were expressed from E.coli and purified as previously described (Jones S. M. et a/. Protection conferred by a fully recombinant subunit vaccine against Yersinia pestis in male and female mice of four inbred strains. Vaccine. 2001 ;19:358-366) (F1 GenBank reference CAA43966.1 ; https://www.ncbi.nlm.nih.goV/protein/CAA43966.1. V UniProtKB/Swiss-Prot reference P23994.1 ; https://www.ncbi.nlm.nih.goV/protein/P23994.1 ). The antigens were supplied in PBS or ammonium acetate buffer for formulation.

Vaccine formulation for subcutaneous dosing

For injected delivery initially the F1 and V proteins were admixed in PBS and MF59® (Novartis) was added in a 50:50 ratio by volume such that 10pg of eacn protein was contained in 100mI of vehicle for delivery to each mouse by the subcutaneous route. For subsequent studies, novel formulations rF1 and rV were prepared as calcium phosphate modified microcrystals. Briefly, aqueous solutions containing either L- glutamine (30 mg/ml) or L-histidine (30 mg/ml) excipient in the presence of sodium phosphate (Sigma-Aldrich) were prepared in endotoxin-free sterile water (Sigma- Aldrich) and filtered through a 0.22 pm PVDF syringe filter (Millipore). Carrier solutions were then mixed with aqueous solutions of rF1 or rV proteins in the correct ratio to provide the required dose and antigen loading. Calcium chloride was added to the water miscible solvent isopropanol (VWR, UK) with a molar ratio of 2:1 calcium chloride to sodium phosphate in the aqueous blend. To prepare a single batch of the first formulation (CaP-PCMC), the aqueous mixture (e.g. 3.5 ml) was added dropwise to an excess of the solvent (e.g. 66.5 ml) with mixing at about 1500 rpm using a PTFE stirrer bar (VWR, UK). Following precipitation of the microcrystal excipient and associated antigen(s), the suspension was mixed for sufficient time to allow the calcium phosphate later to form (e.g. 16 mins). The Cap-PCMC were then isolated from the solvent by vacuum filtration onto a sterile PES filter membrane (Pall Corporation, US) and allowed to air dry overnight for storage as a dry powder. Typically the resulting microcrystalline excipient formulations contained about 5 pg of rF1 or rV proteins perl mg of dry powder. Typically where rF1 and rV were coimmobilised on the same particle, 1 mg of dried microcrystals containe d about 5 pg of rF1 protein and 5 pg of rV protein. The PCMCs were isolated by vacuum filtration and dried to a powder. Protein content and integrity was determined by ELISA and SDS-Page.

Several iterations of the CaP PCMC were tested in a series of immunogenicity studies. The final formulation selected for the efficacy study in mice consisted of rF1 presented on glutamine-coated and rV on histidine-coated CaP PCMC.

Vaccine formulation for oral dosing

The preparation of oral formulations of the rF1 and rV proteins was adapted from a published methodology. In brief, F1 , V and CTB, dissolved in 0.1 M ammonium acetate solution, were added to an amphiphile solution in cyclohexane, comprising a combination of soya phosphatidyl choline, Brij 52 and sodium docusate This mixture was vortexed to give a water-in-oil emulsion, cooled to -30°C and lyophilised overnight at 4°C. Next day, clinical grade oil containing the remaining excipients, was added to the dry residue.

Iterations of the oral formulation were prepared for immunogenicity testing comprising either mineral oil (MO), M818 or phytol and containing the vitamins A (retinoic acid), D, and E (d-alpha tocopheryl acetate, ATA), trehalose dibehenate and rCTB (BrisSynBio, UK) and DDAB. The optimum combination selected for efficacy testing comprised F1 and V proteins contained in reverse m celles in MO with the excipients detailed above (annotated as Formulation B), and compared with Formulation A (which was identical, except for the omission of rCTB).

Stability testing

The formulations were subjected to stability testing in a temperature range of +4 °C - 40°C for defined time periods and relative humidity. The integrity of the proteins after this time was determined by SDS-PAGE, HPLC size exclusion chromatography (SEC-HPLC) and ELISA.

Immunisation protocol

Mice were immunised in groups of 5 with either 1): a subcutaneous priming dose followed either by two subcutaneous or two per oral (p.o.) booster doses, given at 10 and 31 days after the prime; or 2) a subcutaneous priming dose followed by a single p.o. or subcutaneous booster dose 21 d. after the prime. For subcutaneous immunisation, mice received 10 pg of F1 + 10 pg of V in 0.1 ml, whereas for p.o. dosing, mice received 25 pg F1 + 25 pg V in 0.1 ml by oral gavage. For assay of antibody titre, serial blood samples were collected from the tail vein, whilst final samples were collected by cardiac puncture under terminal anaesthesia. Faecal pellets were collected from each treatment group and rapidly frozen (-80°C).

Immunogenicity assessments

Titres of F1 and V -specific antibody in serum samples were determinec by ELISA as previously described. In brief, test sera were bound to microtitre platc:s pre-coated with either F1 or V and antibody binding was detected with an HRPO-labelled secondary antibody to mouse IgG, lgG1 , lgG2a or IgA (Bio-Rad). A standard curve for calibration comprising the relevant murine Ig isotype (Sigma) capaired with an anti-Fab reagent, was included on each plate. Plates were developed by the addition of 2,2’-Azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) substrate (Sigma) and OD was read at 414nm (Multiskan plate reader).

For assay of antibody in faecal samples, faecal pellets were extracted in supplemented PBS. In brief, 10 ml of cold PBS was prepared containing 1 tablet of complete mini protease inhibitor cocktail (Sigma) and 5 mI Tween 20. To 0.1 g faecal pellets, 1 ml of PBS was added and left at room temperature for 5 mini tes. Samples were vortexed for approximately 30 seconds, incubated on ice or a further 20minutes and then centrifuged (15,000g, 5min). Supernatants were retained and stored at -80°C pending assay. The faecal extracts were assayed for specific IgG and IgA content, by ELISA, as for serum samples.

Antibody concentrations were determined from the standard curves using Ascent software with four parameter logistic curve-fitting and reported in n /ml or pg/ml serum or faecal extract, as appropriate.

Efficacy assessments

At 20 days after the booster immunisation, mice were transferred to ACDP3 biocontainment for live organism challenge, where they were housed in their treatment groups in rigid isolators with both inflowing and out-flowing HEPA filtered air. Animals were acclimatised to the isolator for a minimum of 5 working days prior to challenge. Y. pestis C092, a clinical isolate, was cultured in blood agar broth and then diluted in PBS to an estimated challenge dose of 2x10 ⁷ /ml or 2x1 C ^,5 /ml by serial dilution. The actual challenge dose used was determined retrospectivel by culturing the inoculum on blood agar plates for 48 hours. Groups of mice were challenged with 0.1 ml of the appropriate inoculum via the subcutaneous route and then closely monitored for 14 days post immunisation, with those showing clinical signs representing the humane endpoint, being culled by cervical dislocation. At 14 days post immunisation surviving mice were terminally anaesthetised by inhalation of halothane and blood was collected by cardiac puncture. Mice wers culled and spleens removed into PBS.

Bacteriology

Spleens were macerated through a wire mesh into sterile PBS Splenocyte suspensions were serially diluted and 100 pi of each suspension added to blood agar plates in duplicate. Similarly, blood serum was serially diluted and spread onto blood agar plates. Plates were incubated at 37 °C for 48 hours before cDlony forming units (CFU) were enumerated.

Statistical analysis

All data were analysed using Graph Pad Prism software v.6 and expressed as mean ± s.e.m. Statistical comparisons were made using one-way ANOVA or paired t-test. The survival data were expressed as Kaplan-Meier survival curves and statistical significance was determined by Log-rank test. P<0.05 was considered statistically significant.

Results

Vaccine formulation for dual route dosing

In order to develop a dual route dosing approach, the subcutaneous priming dose (day 0) of F1 and V was initially held constant by formulation in the conventional adjuvant MF59®, whilst the formulation of the oral booster dose (days 10 and 31 ) was varied in terms of oil vehicle and immunostimulant used. The effect of varying the oral formulation on serum IgG and IgA titres to F1 and V at the end of the immunisation schedule (day 67) can be seen in Figure 1 (mean serunr IgG and IgA titres per group to F1 (A) and (C) and to V (B) and (D) as determined at day 67).

Oral boosting with F1 +V formulated in mineral oil or M818 with added rCTB gave a significantly enhanced IgG response to F1 , but not to V, compared with subcutaneous boosting with F1 +V in MF59®. However, mineral o l was better tolerated by the mice than either M818 or phytol, and since there was little differential effect of these oil vehicles on IgG titre to either F1 or V, mineral oil was down- selected to take forward into subsequent studies. Analysis of IgA in faecal pellets at the day 42 timepoint (11 days -after the oral booster dose) demonstrated a benefit of including retinoic acid, DDA and ATA in the mineral oil vehicle (Table 1 ).

Table 1 : Immunogenicity of F1 +V in 3 doses (days 0, 10, 31 ) dual-rc ute schedule (standardised subcutaneous dosing in MF59® and variation in oral doling (different amphiphiles, oils and immunostimulants).

s.c. = subcutaneous However, serum IgA tires for each group primed with F1+V/MF59® were boosted by oral delivery with mineral oil containing any of the individual immunostimulants CTB/DDAB/ATA (Fig. 1 C, D). Since the excipients CTB, DDAB arid ATA each contribute differently to enhance immunity, and were compatible in the mineral oil formulation, they were subsequently combined into the same oral fo rmulation for subsequent studies.

Optimisation of the subcutaneous dosing formulation

For the subcutaneous arm of the dual route vaccine, a number of permutations of F1 and V formulated on microcrystals and with or without MF59® were tr ailed. Initially this was carried out in a 3-dose subcutaneous regimen, with doses spaced at 0, 10 and 31 days, as in the dual route regimen. The development of specific IgG titres in serum was determined at days 25 and 57 (Figure 2). The absolute tit re induced to the V antigen was greater than that induced to the F1 antigen. However the specific titre to either F1 or V, when both were formulated on glutamine micrccrystals, was significantly enhanced at days 25 and 57 by the addition of MF59®. When different microcrystals were used to present F1 and V (glutamine and histidine respectively), only the response to V was significantly enhanced by the inclusion of MF59® in the formulation.

At day 57 of this subcutaneous dosing regimen, the predominant iso:ype to either F1 or V by approximately 3 to 6-fold was determined to be lgG1 (Figure 3). However, the addition of MF59® to the microcrystal formulations significantly ent anced lgG2a titres, particularly where F1 and V were both presented on glutamine mhrocrystals.

Optimisation of the dual route dosing regimen

From the immunogenicity data gained, the formulations optimised for subcutaneous priming and oral boosting were combined in a dual route dosing regimen. For the subcutaneous priming dose, F1 and V were presented on glutamine and histidine microcrystals respectively, with or without MF59®. For the oral booste dose at day 21 , F1 and V were combined for formulation in mineral oil, with the addition of vitamin D, retinoic acid, ATA, DDAB, trehalose dibehenate and rCTB (formulation B). The serum IgG response was determined two weeks after each dose, and is shown at days 14 and 35 (Figure 4 panels A-B).

In this dual-route, two-dose regimen, the effect of adding MF 59® to the subcutaneous priming dose was to significantly consolidate but reduce the titres achieved to F1 and V at day 35, 14 days after the oral boost. However, in the presence of MF59® in the priming formulation, the ratio of serum lgG:k|2a to F1 and V was 28 and 20 respectively, whereas in the absence of MF59® serum lgG1 predominated, with ratios of 102 and 170 respectively for F1 and V.

Characterisation of the effect of MF59® on the immune response to F1 and V The effect of including or omitting MF59® from the priming vaccine formulation was further investigated in a subsequent study, in which mice were primed with protein- coated microcrystals ± MF59® and either no booster dose, or one of two different oral formulations (A or B) were administered. It was again observed that inclusion of MF59® in the priming formulation suppressed the anti-F1 serum IgG or IgA titres achieved after oral boosting, while also reducing intra-group variability (Figure 4 panels C-D). Suppression of titre was independent of the exact oral formulation used. From these studies, F1 on glutamine and V on histidine protein-coated microcrystals without MF59® were selected as the priming formulation, with oral formulation B (including CTB) as the booster formulation, to take into an efficacy study.

Protective Efficacy against Y. pestis challenge

Mice immunised in the dual-route dosing regimen on days 0, 21 with F I /glutamine + V/histidine protein-coated microcrystals and boosted orally with formu ation B were challenged with Y. pestis C092 by the subcutaneous route on day 46 with 2.2x10 ⁴ MLD (2.2 x 10 ⁴ CFU) (Figure 5). Day 5 post infection, all naive mice had succumbed to the challenge and all immunised mice survived to day 14 post infecticn.

In order to determine the limits of protective efficacy, two further groups were challenged on day 46 with 2.2.x 10 ⁶ MLD Y. pestis. At this 100-fold hig ier challenge level, 90% survival was observed at 14 pays post infection with no survivors in the naive group.

All surviving mice were culled at day 14 and their blood and spleens were collected for 48 hour microbial culture. Y. pestis was not recovered from any surv ving animal.

Stability assessment

CaP-PCMC formulations held at 40 °C and 75% RH for 29 weeks were examined by SDS-Page. By comparison with unformulated stock F1 and V and thermo-stressed F1 stock, the latter showed significant breakdown products. F1 and V proteins formulated on CaP PCMC were significantly more conserved with heavy bands at the expected positions (15 and 37kDa respectively). Conservation of immunoreactivity after storage of the CaP PCMC at 4 °C, 25 °C and 40 °C for 29 weeks was also demonstrated by ELISA (Figure 6).

Oral formulations which had been held at 4 °C for 1 month also showec preservation of structure when analysed by HPLC (Figure 7; (A): storage for one week (JS17); (B): storage for two weeks (JS20); (C): storage for four weeks (JS26)). The retention time of the F1 peak at (3.1 1-3.16 min.) remained consistent for consecutive samples taken after 1 , 2 or 4 weeks of storage. Similar data were obtained for the V protein (not shown).

Pharmaceutical composition for prevention or treatment of MERS-CoV

Materials and Methods

Expression and purification of RBD

RBD was synthesised and expressed according to previously descr ed methods (Du et at. 2103). In brief, DNA encoding aa377-588 of the MERS-CoV spike protein (S protein GenBank reference AFS88936.1 ; https://www.ncbi.nlm.nih.gov/protein/407076737) was synthesised in e plasmid and cloned into a mammalian expression vector (Invitrogen) designed tc express the target sequence with C-terminal Fc tag. The vectored DNA was transfe .ted into HEK cells is suspension (FSHEK) or adherent HEK cells stably expressing the Sv40 large T antigen (293FT). Small scale purifications were performed usit g Protein A chromatography (RBD-Fc). For this, medium from the transfected cell·; was treated with ammonium sulphate to precipitate the protein, prior to dialysis and ^suspension in buffers for binding to protein A beads. The latter were washed and eluted with buffer containing 1M urea. Protein concentration was determined by U'/ absorbance spectroscopy and purity was estimated by SDS-Page with Coomassie staining and subsequent optical densitometry using a Syngene G:Box imaging syste n. Formulation of RBD for injected and oral immunisation

RBD was incorporated on glutamine or histidine CaP microcrystals for : ubcutaneous immunisation, using methodology adapted from Jones et al, 2014 (Jones et al. Protein coated microcrystals formulated with model antigens and modified with calcium phosphate exhibit enhanced phagocytosis and immunogen: city. Vaccine 2014;32:4234-4242). RBD was incorporated in mineral oil with added excipients, for oral dosing, using methodology adapted from Domingos et al, 2008 an i Prabakaran et al, 2008. (Domingos M et al. A New Oil-Based antigen Delivery Formulation for both Oral and Parenteral Vaccination. The Open Drug Delivery Journal 2008;2:52- 60; Prabakaran M et al. Reverse micelle-encapsulated recombinant baculovirus as an oral vaccine against H5N1 infection in mice. Antiviral Research 2010;86(2):180- 187).

Immunisation and sampling of mice

Specific pathogen-free female Balb/c mice (6-8 weeks of age) were obtained from a commercial breeder and used throughout this study. On receipt mice were randomised for allocation to cages and given free access to food, water and environmental enrichment. Mice were fully acclimatised to the animal h using facility for at least five days prior to any procedure. All animal procedures were performed in accordance with UK legislation as stated in the UK Animal (Scientific Procedures) Act 1986. The Institutional Animal Care and Use Committee approved the relevant Project licence.

Naive mice were randomised for allocation to a treatment group (typically 5 per group) and immunised in one of two regimens: either with a subcutaneous priming dose followed by two subcutaneous doses, given at 10 and 31 days after the prime; alternatively, mice received a subcutaneous priming dose followed by an oral or subcutaneous booster dose 21 days after the prime. For s ubcutaneous immunisation, mice received 2.5 pg of RBD-Fc in 0.1 ml, whereas for all oral dosing, mice received 25pg of RBD-Fc in a total volume of 0.1ml volume, by oral gavage. MF59® (Novartis) was used in a 1 :1 ratio by volume with RBD-Fc in PBS, for subcutaneous dosing. At regular intervals after dosing, mice were blood-sampled from the tail vein for assay of specific antibody titre. At the end of the immunisation schedule, individual mice were terminally anaesthetised for collection of blood by cardiac puncture and of faecal pellets for extraction of IgA.

Serological assays for titre and neutralising antibody

Titres of RBD-specific antibody in serum samples were determined by ELISA. In brief, test sera were bound to microtitre plates pre-coated with RBD-Fc and antibody binding was detected with an HRPO-labelled secondary antibody to mouse IgG, lgG1 , lgG2a or IgA (Bio-Rad). A standard curve for calibration comprising the relevant murine Ig isotype (Sigma) captured with an anti-Fab reagent, was included on each plate. Plates were developed by the addition of 2,2’-Azino-bis(3- ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS) subsirate (Sigma) and OD was read at 414 nm (Multiskan plate reader). For assay of antibody in faecal samples, faecal pellets were extracted in supplemented PBS. In brief, 10 ml of cold PBS was prepared containing 1 tablet of complete mini protease inhibitor cocktail (Sigma) and 5 pi Tween 20. To 0.1 g faecal pellets, 1 ml of PBS was added and left at room temperature for 5 minutes. Samples were vortexed for approximately 30 seconds, incubated on ice for a further 20 minutes and then centrifuged (15,000g, 5min). Supernatants were retained and stored at -80°C pending assay. The faecal extracts were assayed for specific IgG and IgA content, by ELISA, as for serum samples. Antibody concentrations in all samples were determined from the relevant standard curves using Ascent software with four-parameter logistic cuive-fitting and reported in ng/ml or pg/ml serum or faecal extract, as appropriate.

Neutralisation of virus in vitro

To determine if the antibody induced to RBD-FC was neutralising for the MERS virus in vitro, a plaque assay was performed. For this, two strains of MERS-CoV were used: England 1 (Engl ) (also termed London1 -2012; GenBank accession number KC164505.2) and Erasmus Medical Center (EMC) 2012 (GenBank accession number JX869059). The England 1 strain was obtained from the National Collection of Pathogen Viruses, PHE Porton, Salisbury, UK and the EMC strain was kindly provided by the Erasmus University Medical Center Rotterdam, Nethe 'lands. Either strain was prepared in serum-free media (Gibco) at an MOI or 0.01 , equivalent to 10 ³ plaque-forming units. The antiserum for testing was prepared at a dilution range from undiluted to 1 :20 in PBS and co-mixed in equal volume with the virus; 200 pi of this mixture was then added to confluent Vero E6 cells in a 24-well microtit e plate. After incubation (1 hour, 37°C), an overlay comprising a 1 :1 dilution of carboxymethyl cellulose with serum-free media was added to the cells and incubation continued for a further 4 days (37°C) prior to fixing (7.4% formaldehyde) and staining (0.2% crystal violet) with enumeration of the number of plaques per well.

Murine infection with the MERS virus

Mice are not naturally susceptible to infection with MERS-CoV, since they lack the human DPP4 receptor. To induce transient susceptibility in Balb/C mice, an Ad5 construct (Oxford Genetics) was used to express the human DPP4 receptor (Ad5hDPP4). Mice were administered the Ad5hDPP4 construct (2.5 x 10 ⁸ pfu in 50 pi) by the intranasal (i.n.) route under light sedation with inhalational isofluorane and then monitored by serial blood sampling for serum levels of hDPP4/CD26 by ELISA (ThermoScientific). At peak levels of expression of hDPP4 (days 5-7), mice were lightly sedated as before and challenged by the i.n. route with MERS-CoV (EMC2012 strain) at 10 ⁴ pfu in 50 mI per mouse. Mice were weighed prior to challenge on each subsequent day to monitor changes in body weight during infection.

Neutralisation of virus in vivo bv passive transfer of antibody

To test the in vivo neutralising capacity of murine antiserum raised to the RBD-Fc construct, naive mice (n=10 per treatment group) were passively immunised by the i.p. route at 24 hours prior to i.n. challenge with the MERS Co-V (EMC2012 strain), as described above. The murine antiserum, pooled from 4 mice who had been primed with RBD-Fc PCMC and boosted orally (regimen 2, treatment group 2), was delivered at a dilution of 1 :10 in PBS and delivered in a total volume of 100 mI per mouse. A further group of 10 mice received a purified polyclonal human IgG at a single dose level (150 Mg/mouse in 100 mI i.p.), which had been raised to inactivated MERS-CoV. Control mice received a non-specific human IgG at a single dose-level (200 pg/mouse in 100 pi, i.p.). Both sets of human IgG (specific and non-specific) were raised in a bovine transchromosomal model and purified prior to use in the mouse model. A further group of 10 negative control mice were inc luded, which received PBS in place of either the Ad5DPP4 construct or the MERS-CoV-specific antibody, and were also challenged i.n. with MERS-CoV (EMC2012 strain) at 10 ⁴ pfu/mouse. To determine the protection afforded by the passive immunisation, pairs of mice from each treatment group were culled on days 1 -8 after challenge and their lungs were removed and weighed and then rapidly frozen (-80° C) prior to the determination of viral load.

Determination of viral load in lungs

Pairs of lungs from each of 2 mice per treatment group were individual! / thawed and homogenised in serum-free media (2ml). RNA was extracted from 140 mI of each homogenate using the QiAamp Viral RNA kit (Qiagen), following the manufacturers’ instructions. Real-time PCR was conducted on duplicate 5 mI aliquots of each RNA extract, using the MERS-CoV-specific N3 assay and reaction conditions (Lu et al. Real-time Reverse Transcription-PCR Assay Panel for Middle Easi Respiratory Syndrome Coronavirus. J. Clin. Micro. 2014. 52(1 ):67-75). As in Lu ef al, we used the forward primer GGGTGTACCTCTTAATGCCAATTC and reverse primer T CT GT CCT GT CTCCGCCAAT with probe ACCCCTGCGCAAAATGC GGG. Each 25 mI reaction contained 6.25 mI TaqMan Fast Virus 1 -Step mastermix (ThermoFisher Scientific); forward and reverse primers (0.5 mM each), probe (0.1 mM), 5 mI RNA template and 10.25 mI water. A standard curve was constructed by spiking naive lung homogenate with MERS-CoV (EMC 2012) (final concentration 5 * 10 ⁴ pfu/ml) and diluting in naive lung homogenate to 0.5 pfu/ml. RNA was extracted from duplicate 140 mI aliquots of each concentration and PCR conducted using the above method. The amount of virus in tested samples was determined in duplicate using the standard curve and reported as pfu/g lung tissue.

Results Expression and purification of RBD

The RBD protein was expressed in both adherent 293FT and suspensi in HEK cells, but with greater expression in adherent cells. Purification of protein f om adherent cells with Protein A was very effective, yielding protein which was >9! '% pure, with molecular weight of approximately 100kDa. The use of 1M urea fo elution was optimum, as it was sufficient to solubilise the protein without denaturi ig it, yielding RBD-Fc in optimum yield (0.2mg/ml) and predominantly in a dimeric form.

Optimisation of RBD immunoqenicitv and assay of neutralising activity

RBD, formulated for either subcutaneous or oral immunisation, was tested for immunogenicity and the formulations optimised. Initially a subcutaneous dosing regimen was used in which RBD-Fc was formulated in either alhydroge or MF59® to deliver 2.5pg of protein on each of three occasions at 0, 10 and 31 da 's. Mice were monitored for 26 days after the final boost and IgG titre determined ( ^r igure 8). At day 57, the total IgG titres achieved with RBD-Fc in alhydrogel or M ^r 59® did not differ significantly.

To determine if the presentation of RBD-Fc in either alhydrogel or MF5 )® influenced the ability to develop virus-neutralising antibody, two sera were select 3d from each immunisation group and tested in a plaque assay for neutralisation ol two different clinical isolates of MERS-CoV: the Engl strain and the EMC strain (Fig ire 9). Figure 9 panel A shows the neutralisation of the Engl isolate, while Figure 9 p anel B shows the neutralisation of the EMC isolate. All four sera were able to neutralise viral activity, although at a 1 :20 dilution, sera 136 and 169 were more pot mt than sera 132 and 150, against both viral isolates. Sera 136 and 169 were der ved from the treatment group immunised with MF59®-adjuvanted RBD-Fc whereas sera 132 and 150 were derived from alhydrogel-adjuvanted RBD-Fc (Figure 8).

Induction of systemic and mucosal immunity to RBD-Fc

Flaving demonstrated that the RBD-Fc, when delivered in conventior al adjuvants, can induce a high titre of functional antibody, the next investigation wa; how to tailor an RBD vaccine to optimally induce both systemic and mucosal immi nity, with the aim of reducing to a two-dose regimen. Formulations were selected in v fhich RBD-Fc was coated onto the surface of CaP microcrystals for injected priming and incorporated into mineral oil with the excipients CTB, imiquimod, RA, a id vitamins D and E for oral boosting. The serum IgG response achieved from this t /vo-dose dual route immunisation was compared with RBD-Fc delivered in MF59®, s s before, in a two-dose injected regimen (Figure 10). At 1 month after the booster do _> e, at day 49, there was no significant difference in the serum IgG titres achieved fron using these different dosing regimens, so that the two-dose dual route immunisatior with RBD-Fc on glutamine microcrystals for subcutaneous priming and incorporate d in MO with excipients for oral boosting was just as immunogenic as the two-dose : ;ubcutaneous immunisation with RBD-Fc in MF59® (Figure 10 panel A). At day 43, the serum response to RBD-Fc in the dual route regimen was predominantly lgG1 biased, whereas the single route regimen in the presence of MF59® induced t oth lgG1 and lgG2a (Figure 10 panel B). Additionally, day 49 sera from all immui ised animals were fully neutralising for both MERS clinical isolates (EMC and ENG1 ) when tested at 1 :20 dilution in vitro (data not shown).

Since dual route immunisation effectively induced serum IgG to RBD Fc, it was of interest to determine whether it could also effectively induce mucosa! immunity. In this study, the RBD-Fc-specific IgA response was determined in faecal pellet extracts from individual animals on day 49 and also by the assay of their serum collected on the same day. In this case, the specific IgA respor ses of mice immunised in the two-dose dual route regimen was compared with that of mice immunised by the oral route only in two doses, and with mice immi nised by the subcutaneous route in MF59® only in two doses, on exactly the sam 3 days (0,21 ) (Figure 1 1 ). This comparison showed that subcutaneous immunisation n MF59® did not induce serum IgA. However priming with oral boosting effectively i iduced RBD- FC-specific IgA and was not inferior to oral priming and boosting in this effect in either serum (Figure 1 1 panel A) or faecal extracts (Figure 1 1 panel B). Of the three different oral formulations tested (A: mineral oil, retinoic acid, vitamin D, vitamin E, trehalose dibehenate, CTB; B: mineral oil, imiquimod, retinoid acid, vitamin D, vitamin E, trehalose dibehenate; C: mineral oil, imiquimod, retinoid ac d, vitamin D, vitamin E, trehalose dibehenate, CTB) formulation A induced more IgA in faecal extracts than formulation B, but paradoxically induced less serum Ig \ than either formulations B and C. However the use of formulation C in either the o al/oral or the subcutaneous/oral regimen was equally effective at inducing RB D-FC-specific mucosal IgA and was selected as the optimum oral formulation to us 3 in this dual route regimen.

Additionally, day 49 sera from mice in all treatment groups were te sted for their ability to neutralise either strain of MERS-CoV in vitro (Table 2). From this it can be seen that sera from 4 out of 5 mice in the dual route regimen were full / neutralising in vitro for both strains (EMC2012 and London1 -2012), when tested at 1 :60 dilution. (Figure 12A, 12B). In order to test whether the in vitro neutralising acti' ity translated into viral neutralisation in vivo, sera from these 4 mice (highlighted in ^‘ able 2) were pooled in equal aliquots at 1 :10 dilution to enable a subsequent pa ssive transfer study.

O

Table 2: Neutralisation of MERS-CoV in vitro (murine antisera derived from different treatment groups at day 49 were tested in the dilution range 1 :10 to 1 :60 for their ability to neutralise either strain (EMC2012 or Enq1 ) of the virus, in a plaque-forming assay. The serum from the 4 animals highlighted was pooled in equal aliquots at 1 :10 dilution, to provide the sample for assay of neutralising ability in vivo. TNTC denotes too numerous to be counted; n.d. is not done).

5

n

H

O

w o o o\

Use of Ad5hDPP4 to induce CD26 expression in naive mice

In order to design the passive transfer study, it was necessary to define the duration of expression of CD26 in murine lungs in vivo, following induct ion with the Ad5hDPP4 construct. Mice dosed with Ad5hDPP4 i.n. at To were culled in pairs and lung homogenates prepared and assayed for CD26 expression. CD26 in lung tissue was expressed in a time-dependent manner, with levels peaking c t day 3 and declining to day 17 (Figure 13A), setting a sufficient window to use the model for the determination of the protection against viral challenge afforded by the passive transfer of MERS-specific antibody.

Neutralisation of virus in vivo by passive transfer of antibody

To determine the protection afforded by the passive transfer of murine antiserum raised in the dual route immunisation regimen, against infection, susceptibility to MERS-CoV was induced at T ₀ with i.n. administration of Ad5hDPP4 to groups of 10 mice. Passive transfer by the i.p. route of the pooled serum sample derived from the 4 mice highlighted in Table 2, which had previously been shown to be neutralising in vitro (Table 2) was conducted 5 days later and mice were challenged after a further 24 hours with MERS-CoV EMC2012. Additional groups of mice, which had been transduced with Ad5hDPP4, were passively immunised with a MERS -CoV specific human IgG and a non-specific human IgG. At 1-8 days after challenge, pairs of mice were culled for the determination of viral load in lungs, which was cetermined to peak at 3 days p.i. (data not shown). At 3 days p.i., the pooled murine antiserum significantly reduced viral titres in lungs, to the same extent as the specific human IgG, and contrasting with the negative control human IgG, demonstrating significant in vivo neutralising activity (Figure 13B). No significant differences in body weight were detected between treatment groups challenged with MERS-CoV, which was attributed to the short time period of the study.

It will be understood that the present invention has been described above purely by way of example, and modification of detail can be made within the scope of the invention. Each feature disclosed in the description, and (where appropriate) the claims and may be provided independently or in any appropriate combination. Moreover, the invention has been described with specific reference to a pharmaceutical composition and associated kits, and more specifically with reference to pharmaceutical compositions and associated kits for use against plague (caused by Y. pestis) and MERS (caused by MERS-CoV). Additional applications of the invention will occur to the skilled person.