WANG TIAN-LI PH D (US)
SAMUELS YARDENA (US)
BARDELLI ALBERTO (IT)
LENGAUER CHRISTOPHER (US)
VELCULESCU VICTOR (US)
KINZLER KENNETH W (US)
VOGELSTEIN BERT (US)
PARSONS DONALD WILLIAM (US)
WANG TIAN-LI PH D (US)
SAMUELS YARDENA (US)
BARDELLI ALBERTO (IT)
LENGAUER CHRISTOPHER (US)
VELCULESCU VICTOR (US)
KINZLER KENNETH W (US)
VOGELSTEIN BERT (US)
US20050019746A1 | 2005-01-27 | |||
US20050032185A1 | 2005-02-10 |
KANG ET AL.: 'Phosphatidylinositol 3-kinase mutations identified in human cancer are oncogenic' PNAS vol. 102, no. 3, 18 January 2005, pages 802 - 807
PARSONS ET AL.: 'Colorectal cancer Mutations in a signalling pathway' NATURE vol. 436, no. 1, 01 August 2005, page 792
1. | A method of screening test substances for use as anticancer agents, comprising: contacting a test substance with an activated protein kinase selected from the group consisting of: PDKl, AKT2, and PAK4; testing activity of the activated protein kinase, wherein a test substance which inhibits the activity of the activated protein kinase is a potential anticancer agent. |
2. | The method of claim 1 wherein the activated protein kinase is in a cell. |
3. | The method of claim 1 wherein the activated protein kinase is isolated from a cell. |
4. | The method of claim 1 wherein the activated protein kinase is in a cell of a cancer cell line. |
5. | The method of claim 1 wherein the activated protein kinase is in a cell which has been modified to express the activated protein kinase. |
6. | The method of claim 1 wherein the activated protein kinase is PDKl . |
7. | The method of claim 1 wherein the activated protein kinase is AKT2. |
8. | The method of claim 1 wherein the activated protein kinase is PAK4. |
9. | The method of claim 6 wherein the activated PDKl protein kinase has a mutation selected from the group consisting of T354M and D527E. |
10. | The method of claim 7 wherein the activated AKT2 protein kinase has a mutation selected from the group consisting of S302G and R371H. |
11. | The method of claim 8 wherein the activated PAK4 protein kinase has an E329K or an A229T mutation. |
12. | The method of claim 1 further comprising the step of identifying a test substance which inhibits the activity of the activated protein kinase as a potential anticancer agent. |
13. | The method of claim 1 further comprising the step of identifying a test substance which inhibits the activity of the activated protein kinase as a potential anticolorectal cancer agent. |
14. | The method of claim 1 further comprising the step of identifying a test substance which inhibits the activity of the activated protein kinase as a potential anticancer agent for treating cancers that have PI3KCA mutations. |
15. | The method of claim 3 wherein the cell is a colorectal cancer cell. |
16. | The method of claim 4 wherein the cancer cell line is a colorectal cancer cell line. |
17. | An isolated, activated protein kinase selected from the group consisting of: PDKl, AKT2, and PAK4. |
18. | The isolated, activated protein kinase of claim 17 wherein the activated protein kinase is PDKl. |
19. | The isolated, activated protein kinase of claim 17 wherein the activated protein kinase is AKT2. |
20. | The isolated, activated protein kinase of claim 17 wherein the activated protein kinase is PAK4. |
21. | The isolated, activated protein kinase of claim 18 wherein the activated PDKl protein kinase has a mutation selected from the group consisting of T354M and D527E. |
22. | The isolated, activated protein kinase of claim 19 wherein the activated AKT2 protein kinase has a mutation selected from the group consisting of S302G and R371H. |
23. | The isolated, activated protein kinase of claim 20 wherein the activated PAK4 protein kinase has an E329K or an A229T mutation. |
24. | A method of categorizing cancers, comprising: determining (a) the sequence of one or more protein kinase family members selected from the group consisting of PDKl, AKT2, and PAK4; or (b) amplification of AKT2, PAK4, or IRS2 in a sample of a cancer tissue; identifying (a) a somatic mutation of said one or more protein kinase family members or (b) amplification of AKT2, PAK4, or IRS2 in the cancer tissue relative to a normal tissue; assigning the cancer tissue to a set based on (a) the presence of the somatic mutation or (b) the amplification. |
25. | The method of claim 24 wherein the cancer tissue is a colorectal cancer tissue. |
26. | The method of claim 24 wherein a somatic mutation is identified which activates protein kinase activity. |
27. | The method of claim 24 wherein a somatic mutation is identified which activates protein kinase family member PDKl . |
28. | The method of claim 24 wherein a somatic mutation is identified which activates protein kinase family member AKT2. |
29. | The method of claim 24 wherein a somatic mutation is identified which activates protein kinase family member PAK4. |
30. | The method of claim 24 wherein amplification is determined. |
31. | The method of claim 24 wherein amplification of AKT2 is determined. |
32. | The method of claim 24 wherein amplification of PAK4 is determined. |
33. | The method of claim 24 wherein amplification of IRS2 is determined. |
34. | The method of claim 24 wherein amplification of at least 5fold is determined. |
35. | The method of claim 24 further comprising the step of using the set to analyze or design clinical trials. |
36. | The method of claim 24 further comprising the step of using the set to correlate with prognostic data. |
37. | The method of claim 24 further comprising the step of using the set to correlate with recurrence data. |
38. | The method of claim 24 further comprising the step of selecting an appropriate therapeutic agent based on presence in the set. |
39. | A method of categorizing cancers, comprising: determining the sequence of one or more protein kinase family members selected from the group consisting of: MARK3, MYLK2, CDC7, and PDlKlL in a sample of a cancer tissue; identifying a somatic mutation of said one or more protein kinase family members in the cancer tissue; assigning the cancer tissue to a set based on the presence of the somatic mutation. |
40. | The method of claim 39 wherein the cancer tissue is a colorectal cancer tissue. |
41. | The method of claim 39 wherein the mutation is one which activates the protein kinase family member activity. |
42. | The method of claim 39 wherein the protein kinase family member is MARK3. |
43. | The method of claim 39 wherein the protein kinase family member is MYLK2. |
44. | The method of claim 39 wherein the protein kinase family member is CDC7. |
45. | The method of claim 39 wherein the protein kinase family member is PDlKlL. |
46. | The method of claim 39 further comprising the step of using the set to analyze or design clinical trials. |
47. | The method of claim 39 further comprising the step of using the set to correlate with prognostic data. |
48. | The method of claim 39 further comprising the step of using the set to correlate with recurrence data. |
49. | The method of claim 39 further comprising the step of selecting an appropriate therapeutic agent based on presence in the set. |
50. | A method of screening test substances for use as anticancer agents, comprising: contacting a test substance with an activated protein kinase selected from the group consisting of: MARK3, MYLK2, CDC7, and PDlKlL; testing activity of the activated protein kinase, wherein a test substance which inhibits the activity of the activated protein kinase is a potential anticancer agent. |
51. | The method of claim 50 wherein the activated protein kinase is in a cell. |
52. | The method of claim 50 wherein the activated protein kinase is isolated from a cell. |
53. | The method of claim 50 wherein the activated protein kinase is in a cell of a cancer cell line. |
54. | The method of claim 52 wherein the cell is a colorectal cell. |
55. | The method of claim 53 wherein the cancer cell line is a colorectal cancer cell line. |
56. | The method of claim 50 further comprising the step of identifying the test substance as a potential anticancer agent. |
57. | The method of claim 50 further comprising the step of identifying the test substance as a potential anticolorectal cancer agent. |
58. | The method of claim 50 wherein the activated protein kinase is in a cell which has been modified to express the activated protein kinase. |
59. | The method of claim 50 wherein the activated protein kinase is MARK3. |
60. | The method of claim 50 wherein the activated protein kinase is MYLK2. |
61. | The method of claim 50 wherein the activated protein kinase is CDC7. |
62. | The method of claim 50 wherein the activated protein kinase is PDlKlL. |
63. | The method of claim 59 wherein the activated MARK3 protein kinase has a R173Q mutation. |
64. | The method of claim 60 wherein the activated MYLK2 protein kinase has a mutation selected from the group consisting of A2E, S72N, G119D, R340H, G365R, andN542K. |
65. | The method of claim 61 wherein the activated CDC7 protein kinase has an L210I mutation. |
66. | The method of claim 62 wherein the activated PDlKlL has a K288R mutation. |
67. | An isolated, activated protein kinase selected from the group consisting of: MARK3, MYLK2, CDC7, and PDlKlL. |
68. | The isolated, activated kinase of claim 67 wherein the activated protein kinase is MARK3. |
69. | The isolated, activated kinase of claim 67 wherein the activated protein kinase is MYLK2. |
70. | The isolated, activated kinase of claim 67 wherein the activated protein kinase is CDC7. |
71. | The isolated, activated kinase of claim 67 wherein the activated protein kinase is PDlKlL. |
72. | The isolated, activated kinase of claim 68 wherein the activated MARK3 protein kinase has a R173Q mutation. |
73. | The isolated, activated kinase of claim 69 wherein the activated MYLK2 protein kinase has a mutation selected from the group consisting of A2E, S72N, Gl 19D, R340H, G365R, and N542K. |
74. | The isolated, activated kinase of claim 70 wherein the activated CDC7 protein kinase has an L210I mutation. |
75. | The isolated, activated kinase of claim 71 wherein the activated PDlKlL protein has a K288R mutation. |
[01] This application claims the benefit of provisional application serial number 60/683,738, filed on May 23, 2005, the disclosure of which is expressly incorporated herein.
[02] Funds from the U.S. government were used to make this invention. Therefore, the U.S. government retains certain rights in the invention according to the terms of grants from the National Institutes of Health CA43460 and CA62924.
TECHNICAL FIELD OF THE INVENTION
[03] This invention is related to the area of anti-cancer therapeutics and drug discovery. In particular, it relates to identification of targets suitable for development of specific therapies and to stratification of patients based on status of these targets.
BACKGROUND OF THE INVENTION
[04] Tumors of the colon and rectum are a major health problem: in 2002 alone, a million new cancer cases occurred in the world, resulting in ~590,000 deaths. Half of the population of the United States will develop at least one benign colorectal tumor, and in one-tenth of these, the tumors will eventually become malignant.
[05] Although genetic alterations in tyrosine kinases (TKs) have been firmly implicated in tumorigenesis, only a few serine/threonine kinases (STKs) are known to be mutated in human cancers 1"4 . There is a continuing need in the art to identify genes which are mutated in cancer and which may be good candidates for pharmacological intervention...
SUMMARY OF THE INVENTION
[06] According to one embodiment of the invention a method is provided for screening test substances for use as anti-cancer agents. A test substance is contacted with an activated protein kinase selected from the group consisting of: PDKl, AKT2, and PAK4. The activity of the activated protein kinase is tested. A test substance which inhibits the activity of the activated protein kinase is a potential anti-cancer agent.
[07] Also provided by the present invention is an isolated, activated protein kinase selected from the group consisting of: PDKl, AKT2, and PAK4.
[08] An additional aspect of the invention is a method of categorizing cancers. The sequence of one or more protein kinase family members is determined in a sample of a cancer tissue. The family member is selected from the group consisting of PDKl, AKT2, and PAK4. Alternatively, amplification of AKT2, PAK4, or IRS2 is determined in a sample of a cancer tissue. Either a somatic mutation of said one or more protein kinase family members or amplification of AKT2, PAK4, or IRS2 is detected in the cancer tissue relative to a normal tissue. The cancer tissue is assigned to a set based on the presence of the somatic mutation or the amplification.
[09] An additional aspect of the invention is a method of categorizing cancers. The sequence of one or more protein kinase family members is determined in a sample of a cancer tissue. The family member is selected from the group consisting of MARK3, MYLK2, CDC7, and PDlKlL. A somatic mutation of said one or more protein kinase family members or amplification of MARK3, MYLK2, CDC7, and PDlKlL is detected in the cancer tissue relative to a normal tissue. The cancer tissue is assigned to a set based on the presence of the somatic mutation.
[10] According to one embodiment of the invention a method is provided for screening test substances for use as anti-cancer agents. A test substance is contacted with an activated protein kinase selected from the group consisting of: MARK3, MYLK2, CDC7, and
PDlKlL. The activity of the activated protein kinase is tested. A test substance which inhibits the activity of the activated protein kinase is a potential anti-cancer agent.
[11] Also provided by the present invention is an isolated, activated protein kinase selected from the group consisting of: MARK3, MYLK2, CDC7, and PDlKlL.
[12] These and other embodiments which will be apparent to those of skill in the art upon reading the specification provide the art with tools for improving cancer therapy.
BRIEF DESCRIPTION OF THE DRAWINGS
[13] Fig. 1. Mutations of PBK pathway genes in colorectal cancers. Schematic of the components of the PDK pathway (reviewed in Ref. 7): Receptor tyrosine kinases (RTKs) recruit IRS adaptor proteins which induce proper assembly of the p85/PIK3CA complex, PIK3CA phosphorylates phosphatidylinositol 4,5 biphosphate (PIP2) to phosphatidylinositol 3,4,5 triphosphate (PIP3), while PTEN normally reverses this process, PDKl is recruited to the cell surface by PIP3 and directly phosphorylates and activates AKT, and activation of PAK4 is dependent on PI3K signaling, presumably through AKT. Members of the pathway indicated in bold-face type were found to be genetically altered in the colorectal cancers examined in this study.
[14] Fig. 2 Serine / threonine kinome genes analyzed.
[15] Fig. 3 Mutations in the serine/threonine kinome in colorectal cancer
[16] Fig. 4 PI3K pathway genes analyzed.
[17] Fig. 5. Mutations of PI3K pathway genes in colorectal cancer. Double-lined border indicates likely activating mutations. Bold-lined border indicates likely inactivating mutations.
[18] Fig. 6A and 6B. Amplification of AKT2 and PAK4 in colorectal cancers. Amplification of the genomic region containing the AKT2 and PAK4 genes was confirmed in colorectal cancer Co82 by Digital Karyotyping (Fig. 6A) and by FISH on metaphase chromosomes (Fig. 6B) using a probe containing AKT2 and a chromosome 19 control probe.
DETAILED DESCRIPTION OF THE INVENTION
[19] The inventors have identified therapeutic targets for cancers, including without limitation, colorectal cancer, head and neck cancer, pancreatic cancer, lung cancer, breast cancer, prostate cancer, stomach cancer, and brain cancer. The targets are in two overlapping classes: (a) serine-threonine kinases, and (b) members of the PDK pathway. Interestingly, the alterations that have been detected in the serine-threonine kinase (STK) members of the PI3K pathway occur in different tumors which do not overlap with tumors containing mutations in PIK3CA or other non-STK members of the PDK pathway. This suggests that mutations in any of these genes have equivalent tumorigenic effects.
[20] The great majority of the mutations are activating mutations which increase the amount o phosphorylation activity of the kinases. These can be targeted by pharmacological inhibitors to reduce the amount of phosphorylation activity. Specific inhibitors for specific kinases can be rationally designed or screened for. In order to screen for useful anti-cancer agents, such as anti-colorectal cancer agents, one can contact an activated protein kinase with a test substance. The activated protein kinase can be in a cell, such as a cancer cell, a recombinant host cell, or a cell of a cancer cell line, or it can be isolated from a cell. Typically the activated protein kinase will be one that is found in cancer cells as the result of a somatic mutation. Such activated protein kinases may be PDKl, AKT2, PAK4, MARK3, MYLK2, CDC7, or PDlKlL. Specific activating mutations which may be employed are shown in Figs. 3 and 5. A test substance which inhibits the activated kinase is a potential anti-cancer agent, and it can be identified as such. It may have particular use as an anti-colorectal cancer agent. Agents which are found to inhibit PDKl, AKT2, and/or PAK4 can be used in particular to treat cancers that have or which
have been identified Io have PI3KCA mutations. Because these protein kinases are downstream of PI3KCA in the signaling pathway, inhibition of them, even if they are not mutated or activated, may result in reduced signaling from the pathway. Because PDKCA is one of the most frequently mutated genes in cancers, inhibition of its signaling pathway should be widely effective.
[21] Isolated, activated protein kinases according to the invention are in cell-free preparations. They can be isolated from cancer cells or from recombinant cells. They can be the result of synthetic or semi-synthetic reactions. They can be naturally occurring, activated protein kinases found in actual cancer cells. For purposes of the screening assays, the kinases can be in solution or attached to a solid support, such as a bead, well, column packing material, filter paper, agarose plate, array, etc. Although specific wild-type sequences in databases are referred to in Figures 2 and 4, these are of necessity individual sequences of individual humans. Any human sequence can be used for these purposes. Such other human sequences will typically differ very little from the database sequence, perhaps by as little as one, two, three, four, or five amino acid residues. Often such allelic sequences will be conservative changes in which a residue of a certain charge or polarity is replaced with a residue of a similar charge or polarity. Any sequences that are referred to in databases are those sequences as they existed on May 23, 2005.
[22] Samples of cancer tissue from individuals can be tested for the presence of any of the activating mutations of the present invention or amplification of the amplified genes of the present invention. Mutations can be determined by any technique known in the art that is dependent on the sequence of the gene or protein. Direct sequencing of all or part of a gene can be used, for example. Somatic mutations can be determined by comparing a gene or protein sequence in a cancer tissue to that found in a matched tissue of a non- cancer tissue of the same individual. In the absence of a matched tissue, tissues of non- tumor, control individuals can be used. Exemplary mutations are non-synonymous point mutations, splice site alterations, insertions, and deletions. Many techniques are known in the art and any can be used as is convenient. These may include without limitation, allele-specific hybridization, allele-specific amplification, primer extension, mutant-
specific antibodies, etc. Amplification can be determined by any technique that permits absolute or relative quantification of a gene sequence. Typically amplification is determined if the sequence is present at least 2-fold, at least 3-fold, at least 5-fold, or at least 10-fold more than in the control. Quantitative PCR, fluorescence in situ hybridization (FISH), and digital karyotyping are techniques that can be used in this regard.
[23] Activating or inactivating mutations can be determined by assaying for kinase (phosphorylation) activity. Any of the multitude of assays known in the art can be used. These include those using radioactive or fluorescent substrates, as well as those in which the substrate is linked to a solid support, tag sequence, or second protein. Typically these assays monitor the amount of phosphorylated protein product. Althernatively, the can monitor the diminution of the amount of one or more substrates. The same assays can be used to test for inhibition of protein kinase activity by test substances. Once an inhibitor is identified in a cell-free or in-cell assay, other assays and tests can be employed to confirm activity and to test for side-effects. Other assays and tests may be in other formats, in other cell types, in whole animals, and in animal models of disease.
[24] If an activating mutation or amplification is detected, then the tissue sample and/or the individual from whom the tissue sample was taken can be assigned to a group or set. The group or set can be used for testing clinical agents for their effects. The group or set can be used to prescribe a treatment regime to the patient. The group or set can be correlated with prognostic information such as life expectancy data or recurrence data. The sets can be tested and/or correlated with drug efficacy data.
[25] The above disclosure generally describes the present invention. All references disclosed herein are expressly incorporated by reference. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for purposes of illustration only, and are not intended to limit the scope of the invention.
EXAMPLE 1
Identification of somatic mutations in serine/threonine kinases
[26] On the basis of a recent bioinformatics study that identified the protein kinase complement encoded by the human genome 5 , we selected 340 serine/threonine kinases for mutational analysis in colorectal cancers. These included 63 A/G/C protein kinases;
74 calcium/calmodulin-dependent protein kinases; 12 casein kinases; 61 CMGC kinases;
47 homologs of yeast sterile 7/11/20 kinases, and 83 other kinases (Fig. 2;).
[27] As the catalytic domains of these genes are most likely to harbor mutations that activate the gene product 1 , we focused our efforts on the exons containing the kinase domains. These exons were amplified using polymerase chain reaction on template DNA derived from 24 colorectal cancers and directly sequenced (for methods, see Example 4). Any observed change was evaluated in DNA from patient-matched normal tissue to identify somatic (i.e., tumor-specific) mutations. The entire coding regions of those genes found to contain mutations were then further evaluated in a larger panel of 180 colorectal tumors.
[28] Using this approach, a total of 23 changes, including 20 nonsynonymous point mutations, one insertion and one splice site alteration, were identified among the cancers analyzed (Fig. 3). The mutations affected eight different genes: six in mitogen-activated protein kinase kinase 4 (MKK4/JNKK1), six in myosin light chain kinase 2 (MYLK2), three in phosphoinositide dependent protein kinase- 1 (PDKl) (of which two mutations affected the same residue in the kinase domain), two in p21 -activated kinase 4 (PAK4), two in v- akt murine thymoma viral oncogene homolog 2 kinase (AKT2), and two in MAP/microtubule affinity-regulating kinase 3 (MARK3). One alteration was observed in cell division cycle 7 kinase (CDC7) and another in a hypothetical casein kinase (PDIKlL). Eighteen of the 23 somatic mutations occurred at evolutionarily conserved residues.
EXAMPLE 2
Identification of somatic mutations in serine/threonine kinase members of the PI3K signaling pathway
[29] Alterations of MKK4/JNKK1 have previously been reported in a variety of various tumor types 6 , but none of the other genes had been previously observed to be mutated in colorectal cancers. Interestingly, three of the altered genes, PDKl, AKT2, and PAK4, encoded proteins known to be involved in the phosphatidylinositol-3-kinase (PDK) signaling pathway (Fig. I) 7 ' 8 , and two of these (AKT2 and PAK4) have been shown to be overexpressed in human cancers 1 . On the basis of these data, we determined whether any of these kinases were altered by amplification, an alternate mechanism for apparent kinase activation. Quantitative PCR analyses of 146 colorectal tumors showed co- amplification of AKT2 and PAK4 on chromosome 19ql3.2 in two samples, and these were independently confirmed by Digital Karyotyping 9 and fluorescence in situ hybridization (FISH) (Fig. 6).
EXAMPLE 3
Identification of somatic mutations in non-serine/threonine kinase members of PI3K pathway
[30] To complement these analyses, we evaluated other non-STK members of the PI3K pathway in the same 146 samples (Fig. 1 and 4) 7 . These assays revealed one mutation in the insulin related receptor INSRR, one in the v-Erb-B erythroblastic leukemia viral oncogene homolog ERBB4, seven in the phosphatase and tensin homolog PTEN, and three cases of amplification of the insulin receptor substrate IRS2 (Fig. 5). When these alterations were compared to those previously observed in PIK3CA 10 , it was found that they were distributed in a striking manner: all but two of the 58 alterations were in different tumors (p=0.02, chi square test). This paucity of overlapping mutations provides strong support for the hypothesis that the mutated genes have equivalent tumorigenic effects and are operating through the same biochemical pathway.
[31] Overall, nearly 40% of colorectal tumors had alterations in one of eight PBK pathway genes. As most of these genes encode protein kinases, they serve as potential therapeutic targets in tumors containing mutant proteins. In addition, targeting of genes that act downstream in this pathway, such as AKT2 or PDKl, may be effective in targeting the much larger fraction of tumors containing mutations in PIK3CA or PTEN.
EXAMPLE 4
Methods
Selection of STKs and PI3K pathway genes for analysis
[32] All STKs that were members of the following groups identified by Manning et al. l were selected for mutational analysis: the A/G/C protein kinase group (63 genes), the calcium/calmodulin-dependent protein kinase group (74 genes), the casein kinase group (12 genes), the CMGC kinase group (61 genes), the sterile 7/11/20 kinase group (47 genes), and 83 unclassified other protein kinases. Tyrosine kinases and related genes, including members of the TK, TKL, and RGC groups, were not included for analysis as these have been previously examined in colorectal cancers 2 . PI3K pathway genes were identified on the basis of their reported involvement in the PI3K signaling pathway. All STK and PI3K pathway genes analyzed along with Celera and Genbank Accession numbers are listed in Figs. 2 and 3.
PCR, sequencing, and mutational analysis
[33] Sequences for all annotated exons and adjacent intronic sequences containing the kinase domain of identified STKs and PI3K pathway genes were extracted from the Celera (www.celera.com) or public (http://genome.ucsc.edu/) draft human genome sequences. Primers for PCR amplification and sequencing were designed using the Primer 3 program which is available as an http document at server computer frodo.wi.mit.edu at a file named cgi-bin/primer3/primer3_www.cgi, and were synthesized by MWG (High Point, NC) or IDT (Coralville, IA). PCR amplification and sequencing were performed on tumor DNA from early passage cell lines or primary tumors as previously described 2 using a 384 capillary automated sequencing apparatus (Spectrumedix, State College, PA).
Sequence traces were assembled and analyzed to identify potential genomic alterations using the Mutation Surveyor software package (SoftGenetics, State College, PA). Sequences of all primers used for PCR amplification and sequencing are available from the authors upon request,
[34] Digital karyotyping
A Digital karyotyping library of colorectal cancer Co82 was constructed as previously described 3 . Briefly, genomic DNA was isolated using a DNeasy kit (Qiagen, Chatsworth, CA). For each sample, 1 μg of genomic DNA was sequentially digested with mapping enzyme Sad (New England Biolabs, Beverly, MA), ligated to 20-40 ng of biotinylated linkers (Integrated DNA Technologies, Coralville, IA), and digested with the fragmenting enzyme Mαlll (New England Biolabs, Beverly, MA). DNA fragments containing biotinylated linkers were isolated by binding to streptavidin-coated magnetic beads (Dynal, Oslo, Norway). Captured DNA fragments were ligated to linkers containing MmA. recognition sites, and tags were released with Mmel (New England Biolabs, Beverly, MA). Tags were self-ligated to form ditags which were then further ligated to form concatemers and cloned into pZero (Invitrogen, Carlsbad, CA). Clones were sequenced using Big Dye terminators (ABI, Foster City, CA) and analyzed using a 384 capillary automated sequencing apparatus (Spectrumedix, State College, PA) or with a 96 capillary ABI 3700 instrument at Agencourt Biosciences (Beverly, MA). Digital karyotyping sequence files were trimmed using Phred sequence analysis software (CodonCode, MA) and 21 bp genomic tags were extracted using the SAGE2000 software package. Tags were matched to the human genome (UCSC human genome assembly, July 2003 freeze) and tag densities were evaluated using the digital karyotyping software package. Genomic densities were calculated as the ratio of experimental tags to the number of virtual tags present in a fixed window. Sliding windows of sizes ranging from 100 to 300 virtual tags were used to identify regions of increased and decreased genomic density. Digital karyotyping protocols and software for extraction and analysis of genomic tags are available as an http document, at server computer
www.digitalkaiyotyping.org.
[35] FISH
Metaphase chromosomes were analyzed by FISH as previously described 4 . BAC clone CTC-425023 (located at chrl9: 45,387,867-45,566,201bp) and RPl 1-21 J15 (located at chi-19: 49,726,611-49,900,195) were obtained from Bacpac Resources (Children's Hospital Oakland, CA) and used as probes for the AKT2 gene and a reference region on chromosome 19, respectively. CTC-425023 and RP11-21J15 were labeled by nick translation with biotin-dUTP and digoxigenin-dUTP, respectively. To detect biotin- labeled and digoxigenin-labeled signals, slides were first incubated with FITC-avidin (Vector, Burlingame, CA) and an anti-digoxigenin mouse antibody (Roche, Indianapolis, IN). The slides were subsequently incubated with a biotinylated anti-avidin antibody (Vector, Burlingame, CA) and TRITC-conjugated rabbit anti-mouse antibody (Sigma, St. Louis, MO), then finally incubated with FITC-avidin and TRITC-conjugated goat anti- rabbit antibody (Sigma). Slides were counterstained with 4',6'-diamidino-2-phenylindole stain (DAPI) (Sigma, Burlingame, CA). FISH signals were evaluated with a Nikon fluorescence microscope E800.
Quantitative PCR
[36] Amplification of AKT2, PAK4, and IRS2 genes was determined by quantitative real-time PCR using an iCycler apparatus (Bio-Rad, Hercules, CA) as previously described 3 ' 4 . DNA content was normalized to that of Line-1, a repetitive element for which copy numbers per haploid genome are similar among all human cells. PCR primers with the following sequences were used to amplify AKT2, PAK4, and IRS2 respectively: AKT2- F 5' - GGACAGGGAAGAGACCCTTTTT - 3' (SEQ ID NO: 1) , AKT2-R 5' - TAACACGAGGATGGGATGTTTG - 3(SEQ ID NO: 2)', PAK4-F 5' - TAGGCCATTTGTCCTGGAGTTT - 3'(SEQ ID NO: 3), PAK4-R 5' - CTTCTCAACCCACTCGCTTTTT - 3'(SEQ ID NO: 4), IRS2-F: 5'- CAAGGAAGACCAACCATGGAG - 3'(SEQ ID NO: 5) and IRS2-R 5'-
AGGAGCAGAGACACCTGCAAC - 3'(SEQ ID NO: 6). PCR reactions for each sample were performed in triplicate and threshold cycle numbers were calculated using iCycler software v2.3 (Bio-Rad Laboratories, Hercules, CA).
References for Example 4 only
1. Manning, G., Whyte, D. B., Martinez, R., Hunter, T. & Sudarsanam, S. The protein kinase complement of the human genome. Science 298, 1912-34. (2002).
2. Bardelli, A. et al. Mutational analysis of the tyrosine kinome in colorectal cancers. Science 300, 949 (2003).
3. Wang, T. L. et al. Digital karyotyping. Proc Natl Acad Sd USA 99, 16156-61 (2002).
4. Wang, T. L. et al. Digital karyotyping identifies thymidylate synthase amplification as a mechanism of resistance to 5-fluorouracil in metastatic colorectal cancer patients. Proc Natl Acad Sd USA 101, 3089-94 (2004).
5. Vivanco, I. & Sawyers, C. L. The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer !, 489-501 (2002).
6. Wells, C. M., Abo, A. & Ridley, A. J. PAK4 is activated via PI3K in HGF-stimulated epithelial cells. J Cell Sd 115, 3947-56 (2002).
7. Steck, P. A. et al. Identification of a candidate tumour suppressor gene, MMACl, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15, 356-62 (1997).
8. Li, J. et al. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943-7 (1997).
9. Samuels, Y. et al. High frequency of mutations of the PDGCA gene in human cancers. Science 304, 554 (2004).
10. Philp, A. J. et al. The phosphatidylinositol 3'-kinase p85alpha gene is an oncogene in human ovarian and colon tumors. Cancer Res 61, 7426-9 (2001).
11. Zhang, B. & Roth, R. A. The insulin receptor-related receptor. Tissue expression, ligand binding specificity, and signaling capabilities. J Biol Chem 267, 18320-8 (1992).
12. Cohen, B. D., Green, J. M., Foy, L. & Fell, H. P. HER4-mediated biological and biochemical properties in NIH 3T3 cells. Evidence for HER1-HER4 heterodimers. J Biol Chem 271, 4813-8 (1996).
References
The disclosure of each reference cited is expressly incorporated herein.
1. Blume- Jensen, P. & Hunter, T. Oncogenic kinase signalling. Nature 411, 355-65. (2001).
2. Bardelli, A. et al. Mutational analysis of the tyrosine kinome in colorectal cancers. Science 300, 949 (2003).
3. Davies, H. et al. Mutations of the BRAF gene in human cancer. Nature 417, 949-54 (2002).
4. Futreal, P. A. et al. A census of human cancer genes. Nat Rev Cancer 4, 177-83 (2004).
5. Manning, G., Whyte, D. B., Martinez, R., Hunter, T. & Sudarsanam, S. The protein kinase complement of the human genome. Science 298, 1912-34. (2002).
6. Teng, D. H. et al. Human mitogen-activated protein kinase kinase 4 as a candidate tumor suppressor. Cancer Res 57, 4177-82 (1997).
7. Vivanco, I. & Sawyers, C. L. The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2, 489-501 (2002).
8. Wells, C. M., Abo, A. & Ridley, A. J. PAK4 is activated via PI3K in HGF-stimulated epithelial cells. JCeIl Sd 115, 3947-56 (2002).
9. Wang, T. L. et al. Digital karyotyping. Proc Natl Acad Sci USA 99, 16156-61 (2002).
10. Samuels, Y. et al. High frequency of mutations of the PHC3CA gene in human cancers. Science 304, 554 (2004).
Next Patent: EFFICIENT FINDER PATTERNS AND METHODS FOR APPLICATION TO 2D MACHINE VISION PROBLEMS