Title:
PLANT DEFENSE GENE REGULATORY ELEMENTS
Document Type and Number:
WIPO Patent Application WO/1989/012059
Kind Code:
A1
Abstract:
The present invention discloses plant defense gene regulatory elements that can be ''turned on'', induced or otherwise activated by exogenous elicitors.
More Like This:
| JPS63123325 | TRANSGENIC MONOCOT,ITS SEED AND PREPARATION OF PLANT |
| WO/1998/048610 | METHOD OF MAKING AMYLOSE MUTANT INBREDS AND HYBRIDS |
| JP2014076052 | NEMATODE RESISTANT TRANSGENIC PLANTS |
Inventors:
LAMB CHRISTOPHER JOHN (US)
DRON MICHEL (FR)
WINGATE VINCENT PAUL MARY (US)
DRON MICHEL (FR)
WINGATE VINCENT PAUL MARY (US)
Application Number:
PCT/US1989/002150
Publication Date:
December 14, 1989
Filing Date:
May 18, 1989
Export Citation:
Assignee:
SALK INST FOR BIOLOGICAL STUDI (US)
International Classes:
A01H1/00; A01H5/00; A01N63/00; C07H21/04; C07K5/037; C07K14/415; C12N9/10; C12N9/88; C12N15/09; C12N15/29; C12N15/82; C12Q1/68; (IPC1-7): C07H15/12; C12N15/00; G01N33/00; G01N33/48
Other References:
Molecular General Genetics, Volume 202, issued March 1986, (Heidelberg, FRG) SOMMER et al., "Structure of the Chalcone Synthase Gene of Antirrhinum Majus" pages 429-434, page 431 in particular.
Proceedings of The National Academy of Sciences Volume 81, issued September 1984, (Washington DC, USA), RYDER et al. "Elicitor Rapidly Induces Chalcone Synthase mRNA in Phaseolus Vulgaris Cells pages 5724-5728, page 5726 in particular.
Nucleic Acid Research, Volume 14, issued July 1986, (Oxford, England), KOES et al., Floral Tissues of Petunia Hybrida (V30) Expresses only one Member of Chalcone Synthase Multigene Family," pages 5229-5239 see page 5233 in particular.
The EMBO Journal, Volume 3, No. 1, issued January 1984, (Oxford, England) CORUZZI et al. "Tissue Specific and Light-Regulated Expression of a Pea Nuclear Gene Encoding the Small Subunit of Ribulose -1,5-Bisphosphate Carboxylase", pages 1671-1679, see page 1673 in particular.
Nucleic Acids Research, Volume 15 issued November 1987, (Oxford, England) CULLEN et al. "Sequence and Centromere Proximal Location of a Transformation Enhancing Fragment Ansl from Aspergillus Nidulans", pages 9163-9175, see pages 9170-9175 in particular.
Nucleic Acids Research, Volume 13 issued March 1985, (Oxford, England) SKERN et al., "Human Rhinovirus 2: Complete Nucleotide Sequence and Proteolytic Processing Signals in the Capsid Protein Region". pages 2111-2126, see pages 2117-2121 in particular
Cell, Volume 45 issued April, 1986, (Cambridge, MA, USA) LEFRANC et al., "Diversity and Rearrangement of the Human T Cell Rearranging gamma Genes: Nine Germ-Line Variable Genes Belonging to two Subgroup", pages 237-246, see pages 240-243 in particular.
Molecular General Genetics, Volume 202, issued October 1987, (Heidelberg, FRG) CALZA et al., "Cloning of DNA Fragments Complementary to Tobacco Nitrate Reductase mRNA and Encoding Epitomes Common to the Nitrate Reductase from Higher Plants", pages 552-562, see page 558 in particular.
The EMBO Journal, Volume 5, No.1, issued January 1986 (Oxford, England) KAULENS et al., "Light-Induced Expression of Chimeric Chalcone Synthase-NPTII Gene in Tobacco Cells", see page 1-8.
The EMBO Journal, Volume 3, No.1 issued January 1984 (Oxford, England) DE BLOCK et al., "Expression of Foreign Genes in Regenerated Plants and their Progeny", see page 1681-1689.
Archives of Biochemistry and Biophysics Volume 249, No 2 issued September 1986, San Diego, USA) LOW et al., "Elicitor Stimulation of Defense Response in Cultured Plant Cells Monitored by Fluorescent Dyes", pages 472-479, see the Abstract and last paragraph page 478 in particular.
Preceedings of the National Academy of Sciences Volume 84, issued February 1987 (Washington DC, USA THORNBURG et al., "Wound-Inducible Expression of al Potato Inhibitor II-Chloramphenicol Acetyl-Transferase Gene Fusion in Transgenic Plants", see pages 744-748, see the Abstract and pages 747-748 in particular.
See also references of EP 0414809A4
Proceedings of The National Academy of Sciences Volume 81, issued September 1984, (Washington DC, USA), RYDER et al. "Elicitor Rapidly Induces Chalcone Synthase mRNA in Phaseolus Vulgaris Cells pages 5724-5728, page 5726 in particular.
Nucleic Acid Research, Volume 14, issued July 1986, (Oxford, England), KOES et al., Floral Tissues of Petunia Hybrida (V30) Expresses only one Member of Chalcone Synthase Multigene Family," pages 5229-5239 see page 5233 in particular.
The EMBO Journal, Volume 3, No. 1, issued January 1984, (Oxford, England) CORUZZI et al. "Tissue Specific and Light-Regulated Expression of a Pea Nuclear Gene Encoding the Small Subunit of Ribulose -1,5-Bisphosphate Carboxylase", pages 1671-1679, see page 1673 in particular.
Nucleic Acids Research, Volume 15 issued November 1987, (Oxford, England) CULLEN et al. "Sequence and Centromere Proximal Location of a Transformation Enhancing Fragment Ansl from Aspergillus Nidulans", pages 9163-9175, see pages 9170-9175 in particular.
Nucleic Acids Research, Volume 13 issued March 1985, (Oxford, England) SKERN et al., "Human Rhinovirus 2: Complete Nucleotide Sequence and Proteolytic Processing Signals in the Capsid Protein Region". pages 2111-2126, see pages 2117-2121 in particular
Cell, Volume 45 issued April, 1986, (Cambridge, MA, USA) LEFRANC et al., "Diversity and Rearrangement of the Human T Cell Rearranging gamma Genes: Nine Germ-Line Variable Genes Belonging to two Subgroup", pages 237-246, see pages 240-243 in particular.
Molecular General Genetics, Volume 202, issued October 1987, (Heidelberg, FRG) CALZA et al., "Cloning of DNA Fragments Complementary to Tobacco Nitrate Reductase mRNA and Encoding Epitomes Common to the Nitrate Reductase from Higher Plants", pages 552-562, see page 558 in particular.
The EMBO Journal, Volume 5, No.1, issued January 1986 (Oxford, England) KAULENS et al., "Light-Induced Expression of Chimeric Chalcone Synthase-NPTII Gene in Tobacco Cells", see page 1-8.
The EMBO Journal, Volume 3, No.1 issued January 1984 (Oxford, England) DE BLOCK et al., "Expression of Foreign Genes in Regenerated Plants and their Progeny", see page 1681-1689.
Archives of Biochemistry and Biophysics Volume 249, No 2 issued September 1986, San Diego, USA) LOW et al., "Elicitor Stimulation of Defense Response in Cultured Plant Cells Monitored by Fluorescent Dyes", pages 472-479, see the Abstract and last paragraph page 478 in particular.
Preceedings of the National Academy of Sciences Volume 84, issued February 1987 (Washington DC, USA THORNBURG et al., "Wound-Inducible Expression of al Potato Inhibitor II-Chloramphenicol Acetyl-Transferase Gene Fusion in Transgenic Plants", see pages 744-748, see the Abstract and pages 747-748 in particular.
See also references of EP 0414809A4
Download PDF:
Claims:
AMENDED CLAIMS
| 1. | [received by the International Bureau on 5 January 1990 (05.01.90); original claims 7,9 and 13 amended; other claims unchanged (3 pages)] A substantially. ure plant defense gene promoter that directs stressregulated expression of an operatively linked gene, said promoter selected from the group consisting of: promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonialyase (PAL) , chalcone synthase (CHS), and 4coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyprolinerich glycoproteins. |
| 2. | A substantially pure functional domain in the promoter of Claim 1, wherein said functional domain is selected from the group consisting of (1) an elicitorregulated activator domain, and (2) an upstream silencer domain. |
| 3. | A DNA sequence comprising: ACCAATTATTGGTTACTAAATTTAACAGTGAATGAATGAATGAGTTATA. |
| 4. | A DNA sequence comprising: CACGTGATACTCACCTACCCTAC. |
| 5. | A DNA sequence having substantial sequence homology with the DNA sequences in any of Claims 3 or 4. |
| 6. | Chimeric plasmids selected from the group consisting of pCHCl and pCHC2. |
| 7. | A chimeric gene cassette (CGC) comprising: (a) a promoter selected from the group consisting of promoters for the plant genes that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4 coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode cell wall hydroxyprolinerich glycoproteins; wherein said promoter is operatively linked to (b) at least one reporter gene; and (c) a 3' terminator. |
| 8. | A chimeric gene cassette (CGC) according to Claim 7 wherein said reporter gene is selected from the . group consisting of chlora phenicol acetyltransferase j (CAT) and beta glucuronidase (GUS) . |
| 9. | A chimeric gene cassette (CGC) comprising: (a) a promoter selected from the group consisting of 5 promoters for the plant genes that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4 coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode cell wall hydroxyprolinerich glycoproteins; wherein said promoter is 10 operatively 10 linked to (b) at least one structural gene capable of being expressed in plants; and (c) a 3'terminator. |
| 10. | 10 A chimeric gene cassette (CGC) according to any of Claims 7 or 9 wherein said 3' terminator is selected from the group consisting of the 3' flanking 15 region of the nopaline synthase (NOS) gene and the 3' flanking region of the octopine synthase (OCS) gene. |
| 11. | The reduced form of glutathione when used exogenously to activate plant defense genes. |
| 12. | A method for activating plant genes, said 20 method comprising: applying reduced glutathione exogenously to plant material that contains a structural gene operatively linked to a promoter that is activated by reduced glutathione. |
| 13. | A method according to Claim 12 wherein said 25 promoter is selected from the group consisting of promoters for the plant genes that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4 coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode the cell wall hydroxyprolinerich 30 glycoproteins. |
| 14. | Plant material engineered with human effort wherein said plant material contains the chimeric gene cassette (CGC) any of Claims 7 or 9. |
| 15. | Plant material according to Claim 14 wherein said plant material is selected from the group AMENDED CLAIMS [received by the International Bureau on 5 January 1990 (05.01.90); original claims 7,9 and 13 amended; other claims unchanged (3 pages)] 1 A substantially pure plant defense gene promoter that directs stressregulated expression of an operatively linked gene, said promoter selected from the group consisting of: promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonialyase (PAL) , chalcone synthase (CHS), and 4coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyprolinerich glycoproteins. |
| 16. | 2 A substantially pure functional domain in the promoter of Claim 1, wherein said functional domain is selected from the group consisting of (1) an elicitorregulated activator domain, and (2) an upstream silencer domain. |
| 17. | 3 A DNA sequence comprising: ACCAATTATTGGTTACTAAATTTAACAGTGAATGAATGAATGAGTTATA. |
| 18. | 4 A DNA sequence comprising: CACGTGATACTCACCTACCCTAC. |
| 19. | A DNA sequence having substantial sequence homology with the DNA sequences in any of Claims 3 or 4. |
| 20. | Chimeric plasmids selected from the group consisting of pCHCl and pCHC2. |
| 21. | A chimeric gene cassette (CGC) comprising: (a) a promoter selected from the group consisting of promoters for the plant genes that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4 coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode cell wall hydroxyprolinerich glycoproteins; wherein said promoter is operatively linked to (b) at least one reporter gene; and (c) a 3' terminator. |
| 22. | A chimeric gene cassette (CGC) according to Claim 7 wherein said reporter gene is selected from the group consisting of chloramphenicol acetyItransferase (CAT) and beta glucuronidase (GUS) . |
| 23. | A chimeric gene cassette (CGC) comprising: (a) a promoter selected from the group consisting of promoters for the plant genes that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4 cou arate:CoA ligase (4CL) , and promoters for the plant genes that encode cell wall hydroxyprolinerich glycoproteins; wherein said promoter is 10 operatively linked to (b) at least one structural gene capable of being expressed in plants; and (c) a 3'terminator. |
| 24. | A chimeric gene cassette (CGC) according to any of Claims 7 or 9 wherein said 3' terminator is selected from the group consisting of the 3 r flanking region of the nopaline synthase (NOS) gene and the 3' flanking region of the octopine synthase (OCS) gene. |
| 25. | The reduced form of glutathione when used exogenously to activate plant defense genes. |
| 26. | A method for activating plant genes, said method comprising: applying reduced glutathione exogenously to plant material that contains a structural gene operatively linked to a promoter that is activated by reduced glutathione. |
| 27. | A method according to Claim 12 wherein said promoter is selected from the group consisting of promoters for the plant genes that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4 coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode the cell wall hydroxyprolinerich glycoproteins. |
| 28. | Plant material engineered with human effort wherein said plant material contains the chimeric gene cassette (CGC) any of Claims 7 or 9. |
| 29. | Plant material according to Claim 14 wherein said plant material is selected from the group WHAT IS CLAIMED IS: 1 A substantially pure plant defense gene promoter that directs stressregulated expression of an operatively linked gene, said promoter selected from the group consisting of: promoters for the plant genes that encode the phenylpropanoid biosynthetic enzymes phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , and 4coumarate:CoA ligase (4CL) , plus promoters for the plant genes that encode the cell wall hydroxyprolinerich glycoproteins. |
| 30. | 2 A substantially pure functional domain in the promoter of Claim 1, wherein said functional domain is selected from the group consisting of (1) an elicitorregulated activator domain, and (2) an upstream silencer domain. |
| 31. | 3 A DNA sequence comprising: ACCAATTATTGGTTACTAAATTTAACAGTGAATGAATGAATGAGTTATA. |
| 32. | 4 A DNA sequence comprising: CACGTGATACTCACCTACCCTAC. |
| 33. | A DNA sequence having substantial sequence homology with the DNA sequences in any of Claims 3 or . |
| 34. | Chimeric plasmids selected from the group , consisting of pCHCl and pCHC2. |
| 35. | A chimeric gene cassette (CGC) comprising: (a) at least one promoter selected from the group consisting of phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode cell wall hydroxyprolinerich glycoproteins; wherein said promoter is operatively linked to (b) at least one reporter gene; and (c) at least one 3' terminator. |
| 36. | A chimeric gene cassette (CGC) according to Claim 7 wherein said reporter gene(s) is selected from the group consisting of chloramphenicol acetyltransferase (CAT) , beta glucuronidase (GUS) , β lactamase (lacZ) and firefly luciferase. |
| 37. | A chimeric gene cassette (CGC) comprising: (a) at least one promoter selected from the group consisting of phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode cell wall hydroxyprolinerich glycoproteins; v/herein said promoter is operatively linked to (b) at least one structural gene capable of being expressed in plants; and (c) at least one 3' terminator. |
| 38. | A chimeric gene cassette (CGC) according to any of Claims 7 or 9 wherein said 3' terminator(s) is selected from the group consisting of the 3 ' flanking region of the nopaline synthase (NOS) gene and the 3' flanking region of the octopine synthase (OCS) gene. |
| 39. | The reduced form of glutathione when used exogenously to activate plant defense genes. |
| 40. | A method for activating plant genes, said method comprising: applying reduced glutathione exogenously to plant material that contains at least one structural gene operatively linked to at least one promoter that is activated by reduced glutathione. |
| 41. | A method according to Claim 12 wherein said promoter(s) is selected from the group consisting of promoters that encode phenylalanine ammonialyase (PAL) , chalcone synthase (CHS) , 4coumarate:CoA ligase (4CL) , and promoters for the plant genes that encode the cell wall hydroxyprolinerich glycoproteins. |
| 42. | Plant material engineered with human effort wherein said plant material contains the chimeric gene cassette (CGC) any of Claims 7 or 9. |
| 43. | Plant material according to Claim 14 wherein said plant material is selected from the group S3 consisting of tobacco, potato, carrot, flax, eggplant, tomato, chili pepper, sunflower, rapeseed, rice, maize and loblolly pine plant material. |
Description:
International Bureau
INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)
(51) International Patent Classification 4 : (11) International Publication Number: WO 89/1205
C07H 15/12, G01N 33/00 Al
(43) International Publication Date: 14 December 1989 (14.12.8 C12N 15/00, G01N 33/48
(21) International Application Number: PCT/US89/02150 (72) Inventors; and
(75) Inventors/Applicants (for US only) : LAMB, Christophe
(22) International Filing Date: 18 May 1989 (18.05.89) John [GB/US]; 6444 Farley Drive, San Diego, C 92122 (US). DRON, Michel [FR/FR]; 7, residen
(30) Priority data: Foncs-Fanettes, F-91190 Gif (FR). WINGATE, Vincen
197,122 20 May 1988 (20.05.88) US Paul, Mary [US/US]; Steptoe Village, P-109, Pullma 343,445 26 April 1989 (26.04.89) US WA 99163 (US).
(60) Parent Applications or Grants (74) Agents: WATT, Phillip, H. et al.; Fitch, Even, Tabin
(63) Related by Continuation Flannery, Room 900, 135 South LaSalle Street, Chicag US 197,122 (CIP) IL 60603 (US).
Filed on 20 May 1988 (20.05.88) US 343,445 (CIP) (81) Designated States: AT (European patent), BE (Europea Filed on 26 April 1989 (26.04.89) patent), CH (European patent), DE (European patent FR (European patent), GB (European patent), IT (Eur
(71) Applicant (for all designated States except US): THE SALK pean patent), JP, LU (European patent), NL (Europea INSTITUTE FOR BIOLOGICAL STUDIES [US/US]; patent), SE (European patent), US, US. 10010 North Torrey Pines Road, La Jolla, CA 92037 (US). Published
With international search report With amended claims.
Date of publication of the amended claims:
25 January 1990 (25.01.9
(54) Title: PLANT DEFENSE GENE REGULATORY ELEMENTS
(57) Abstract
The present invention discloses plant defense gene regulatory elements that can be "turned on", induced or otherwise activated by exogenous elicitors.
-326
GGCTTTGGTGTTGCACGTGATACTCACCTACCCTACTTCCTATCCACCCTTGCATAC ATATAAAATGCTAACTCCTCCAA -PCHC4 -pCHC5
+1
CATCTTCAAACACACAACTrCAGCAACCAAACCAACAACCCTCTCTACCACTCAAGT GCTGTGAACTTGGTCACTTCTTT
"transcript Ion start tlOO ! Xba I BamH 1
CAΓCTΠIAACCAAATCGCAGTGCTTGACITCGACTCTAGAGGATCCGAAATTTCA GGAGCTAAGGAAGCTAAAATGG 'polyI Inker -CAT —> »ot
FOR THE PURPOSES OF INFORMATION ONLY
Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT.
AT Austria ES Spain MG Madagascar
AU Australia FT Finland ML Mali
BB Barbados FR France MR Mauritania
BE Belgium GA Gabon MW Malawi
BF Burkina Fassα GB United Kingdom NL Netherlands
BG Bulgaria HU Hungary NO Norway
BJ Benin tr Italy RO Romania
BR Brazil JP Japan SD Sudan
CA Canada KP Democratic People's Republic SE Sweden ce Central African Republic of Korea SN Senegal
CG Congo KR Republic of Korea SU Soviet Union
CH Switzerland U Liechtenstein TO Chad
CM Cameroon LK Sri Lanka TG Togo
DE Germany; Federal Republic of LU Luxembourg US United States of America
DK Denmark MC Monaco