The present invention concerns a family of pathogenesis-related (PR) proteins referred to as P14 proteins, functionally equivalent protein analogues thereof, fungicidal compositions containing the proteins and their use in combating fungal diseases in plants. The present invention is further directed to biotechnological processes for producing such proteins as well as transgenic plant cells and plants that demonstrate resistance to fungal diseases.

BACKGROUND OF THE INVENTION

When a plant is subjected to a stress, e.g. an abiotic stress such as UV-irradiation, or a biotic stress caused by pathogenic organisms such as fungi, bacteria, viruses or by insects, the plant defends itself through several mechanisms, including thickening of cell walls by deposition of additional callose or lignin at the site of infection and production of substances that are toxic to the organism.

It has also been observed that stressed plants synthesize a number of proteins. These proteins are generally characterized as being acid soluble, protease resistant, relatively small in size, accumulating predominantly in the intercellular space of the plant, and as producing a characteristic pattern in gel electophoresis. Some of these proteins have been identified as hydrolytic enzymes (e.g. chitinases, β-1,3 glucanases and proteases), peroxidases and proteinase inhibitors.

Stressed plants are also found to produce a group of proteins having a molecular weight between 10 and 20 k Daltons. One such protein described in the literature is the PR-protein produced by a tomato plant upon infection by a pathogen, this protein being referred to as the P14 protein of tomato. This protein has been described as

having a molecular weight of about 15.5 kD and an amino acid sequence thought to correspond to P14 has been published (Lucas et al., The EHBO Journal, vol. 4, no. 11, pp.2745-2749, 1985).

SUMMARY OF THE INVENTION

It has now been found that the P14 protein is actually a family of related proteins.We have purified P14 from tomato and have found at least three proteins, hereinafter referred to as P14a, P14b and P14c. We have also cloned genes coding for P14 proteins in the tomato. To date we have found genes coding for five different P14 proteins in tomato, hereinafter referred to as P14a, P14b, P14d, P14e and P14f. The c-DNA coding sequences and corresponding amino acid sequences including leader peptide sequences, for these five tomato P14 proteins are given hereinafter in the SEQUENCE LISTING as SEQ.ID N0:1, 2, 3, 4 and 5. We have not yet identified the gene which corresponds to the P14c protein purified from the tomato. The present invention includes P14a, P14b, P14c, P14d, P14e and P14f per se, e.g. in purified or isolated form.

The amino acid sequence published by Lucas et al. appears to correspond to P14a but lacks an internal sequence of five amino acids, amino acid residues 99 to 103 of the mature protein of SEQ ID NO 1.

The five P14 proteins have been synthesised and found to possess potent fungicidal activity. This invention is therefore directed to fungicidal compositions that are effective in protecting plants and plant loci against fungal attack comprising a fungicidally effective amount of a P14 protein.

In a further aspect, the P14 protein amino acid sequences can be modified by adding, substituting or removing one or more amino acids to provide modified products which are fungicidally active. Thus, this invention is further directed to fungicidally active modified P14 proteins hereinafter referred to as P14 analogues.

Moreover, a DNA sequence coding for a P14 protein or analogue or portions of such a sequence can be incorporated into a vector by conventional techniques and used to transform or transfect host cells in order to produce the P14 protein product in useful quantities.

Finally, such DNA, portions thereof, including genomic DNA sequences derivable directly from plant material, can also be incorporated into the genome of a plant in order to give the plant resistance to fungal disease.

The proteins and compositions of the invention are typically intended for use in agriculture. However, the proteins and compositions may also be employed in pharmaceutical and veterinary uses to protect or treat humans or animals against fungal diseases.

DESCRIPTION OF THE INVENTION

Any fungicidally active P14 protein or analogue may be used in the present invention. In addition to the five P14 proteins identified to date in the tomato, there may be further fungicidally active tomato P14 proteins. Such further tomato P14 proteins, as well as fungicidally active P14 proteins from other plant sources, may be used in the present invention.

For the purposes of the present description a P14 protein is a protein, typically produced by a stressed plant, having a molecular weight of about 15 kD, e.g. about from 14 kD to about 16 kD, and having an amino acid sequence which is at least 70%, preferably at least about 80%, homologous to the mature protein amino acid sequence of any one of the tomato P14 proteins the sequences of which are disclosed herein (i.e. P14a, P14b, P14d, P14e and P14f), but especially P14a (i.e. the amino acid sequences of residues 1 to 135 inclusive of the amino acid sequence of SEQ ID NO 1).

In this latter regard, and elsewhere in the present description the terms "homology" or "homologous" when applied to sequences, either amino acid or nucleotide, are intended to indicate the level of identity between the sequences concerned. Thus the amino acid sequences of two related proteins, or the DNA sequence coding therefor, may be aligned with one another at regions of identical, i.e. homologous, sequence, and the differences between one sequence and the other, whether these be by way of substitution deletion or insertion of amino acid or nucleotide residues, identi ^t -ed. The percentage homology between the two sequences is determined with respect to one of the sequences, the reference sequence, by calculating the percentage of changes between the other sequence or sequences and the reference sequence with respect to the reference sequence. The homology by percentage is then 100 minus the percentage of changes between the other sequence or sequences and the reference sequence.

Thus with reference to the specific tomato P14 protein sequences disclosed herein, the mature P14b protein is about 96% homologous to the mature P14a protein (5 amino acid substitutions, both 135 amino acids in length). Similarly the mature P14d protein is about 88% homologous (16 substitutions, both 135 amino acids in length), the mature P14e protein about 90% homologous (2 substitutions and 9 deletions in 135 amino acid residues) and the mature P14f protein about 78% homologous (29 substitutions, both 135 amino acids in length) to the mature P14a protein.

P14 proteins for use in the present invention may be obtained from plant material by extraction and purification procedures. For example, the P14 family of proteins of tomato can be obtained from tomato plants and separated into the individual protein components by the procedures described in detail in Example 1.

The P14 proteins can be altered, i.e. functionally equivalent analogues can be prepared by standard techniques. This invention therefore also concerns itself with P14 protein analogues in which the amino acid sequence of a mature P14 protein has been modified by adding, substituting or removing one or more of the amino acids without substantially reducing the level of fungicidal activity, i.e. which retain substantially the same level of fungicidal activity as the P14a protein or possess an even higher level of fungicidal activity.

Such altered sequences preferably possess substantial sequence homology to a P14 protein, typically at least 70%, preferably at least 80% homology. Preferably the fungicidally active P14 analogues have mature protein amino acid sequences which are at least 70% homologous, or more preferably a least 80% homologous to one ore more of the mature protein sequences of the specific tomato P14 proteins (P14a, P14b, P14d, P14e or P14f) disclosed herein. In particular altered sequences that demonstrate P14-like fungicidal activity are at least 70% homologous to the protein extending from amino acid position 1 to 135 of SEQ ID NO 1, more preferably at least 80% homologous.

For the purposes of the present description a protein or protein analogue is fungicidally active if it has a fungicidal activity at least one tenth of that of P14a when tested in a standard fungicidal activity test. Preferably, however, the proteins and analogues have a level of fungicidal activity substantially the same as, or more preferably higher than, P14a.

Although the P14 proteins may be obtained from plant material, the P14 proteins and analogues are preferably prepared by recombinant DNA techniques.

Thus in further aspects the invention includes DNA sequences coding for the P14 proteins and analogues, vectors containing these DNA

sequences and host cells transformed with these DNA sequences.

The DNA sequences of the invention may code for any fungicidally active P14 proteins or analogues as hereinbefore defined. Preferred DNA sequences are sequences coding for P14a, P14b, P14d, P14e or P14f or analogues thereof i.e. proteins having at least 70%, preferably at least 80% homology with any one of these proteins. In particular the DNA sequence encodes a fungicidally active protein having an amino acid sequence having at least 70% homology to the protein extending from amino acid position 1 to 135 of SEQ ID NO 1, more preferably at least 80% homology.

The DNA sequences may be obtained by methods well known in the recombinant DNA art. c-DNA or genomic DNA sequences may be derived or obtained from plant tissue. Sequences coding for P14 analogues may be synthesised in whole or in part using oligonucleotide synthesis techniques well known in the art or adaptable therefrom.

The DNA sequences may include 5' sequences which code for signal sequences, which may be natural or analogue P14 signal sequences or alternate signal sequences including those derived from other proteins. If DNA coding for a signal sequence is not present it will normally be necessary to include a translation start cordon (ATG) at or adjacent to the 5' end of the protein coding sequence.

For expression of the protein product the DNA sequences are incorporated under the control of appropriate regulatory sequences (e.g. promoter/enhancer sequences) into expression vectors and such vectors are used to prepare transformed host cells which may be cultured to express the proteins. The presence of an N terminal signal sequence in the expressed protein advantageously facilitates the processing and secretion of the mature protein from the host cell.

In preferred embodiments the DNA sequences may be used to transform plant cells and thus provide transformed plant cells and transgenic

plants which express the P14 protein products and which are thereby resistant to fungal disease.

As indicated above, production of the P14 and P14 analogue proteins involves transforming or transfecting a host cell with a recombinant DNA vector as previously described and subsequently culturing the transformed or transfected host cell to produce the protein. While a variety of transformed or transfected cell systems may be employed, it is generally preferred to transform or transfect bacterial cells of either the gram-negative or gram-positive type. One preferred type of gram-negative bacteria is E. Coli with which considerable experience in biotechnology has already been achieved and for which a wide variety of suitable and operatively functional plasmid and transfer and expression vector systems are known and available. Pseudomonas fluorescens represents another type of gram-negative bacteria into which plasmids carrying the protein sequences have been incorporated. Further suitable host cells include Bacillus thuringiensis (B.t. ), B.cereus, and B.subtilis. Typical promoters to be used in transformation of E. Coli include Ptaci F rp _> Ftre- P _> T ₃ , and T , all of which are commercially available, e.g. from Pharmacia.

The invention is further described by way of illustration only in the following Examples which refer to the accompanying diagrams:

Figure 1, which is a plasmid diagram of plasmid pBTlOO, the plasmid constructed for expression of a methionyl P14a product and

Figure 2, which is a plasmid diagram of plasmid pBT103", the plasmid constructed for expression of a P14a protein product including its signal sequence peptide.

Example 1 Purification of P14 Proteins from Tomato

The P14 family of proteins of tomato were obtained from tomato plants and separated into the individual protein as described below.

Extraction

Fresh tomato leaf material from uv-irradiated or P. infestans infected tomato plants was mixed and homogenised in a 5% acetic acid solution containing 0.1% Beta mercaptoethanol pH2.8, then centrifuged at 15000 r.p.m. for 20 minutes. The supernatant was adjusted to pH 5.5 and centrifuged again at 15000 r.p.m. for 20 minutes. The supernatant was precipitated by adding solid ammonium nitrate to give a final saturation of 80%. After 1 hour at 4°C, the precipitate was centrifuged at 10000 r.p.m. for 30 minutes to obtain a pellet. The pellet was combined with the minimum volume of 50 mM Tris/HCl, 1 mM EDTA, 1 M NaCl and pH 7.5 buffer required to effect dissolution. This so-formed acidic leaf homogenate preparation was then subjected to overnight dialysis.

Purification

The mixture of proteins described above were incubated with Con A Sepharose R (Pharmacia), and equilibrated with 50 mM Tris/HCl, pH 7.5 buffer, 1 mM EDTA, IM NaCl for 30 minutes with gentle shaking. The mixture was packed on a column and the non-bound proteins were washed out with the same buffer. The bound fractions were eluted with IM methyl-αD-glucopyranoside. The non-bound proteins fraction containing the P14 family of proteins was then subjected to further purification.

P14 purification

The P14 proteins were separated from the non-bound proteins fraction obtained above using a Mono Q anion exchange column (Pharmacia) in a

50 mM 1,3 diaminopropane, pH 10 buffer. The P14 proteins were eluted directly in the flow-through. This fraction, having a basic pH, was then separated on a Mono S cation exchange column (Pharmacia) in a 50 mM acetate buffer pH 4.4. From this column, three peaks corresponding to the P14a, P14b and P14c proteins, were eluted.

The P14 proteins were further purified on a double Superose 12 gel filtration column (Pharmacia) in a 100 mM tris/HCl, pH 7.5 buffer. Finally, the proteins are desalted by G25 gel filtration. The purity was monitored by a SDS-PAGE and silver staining.

The precise molecular weight of one of these proteins, P14a, obtained according to the above-described procedure was measured by Electrospray Mass Spectrometry (ESMS) according to the procedure described by Van Dorsselaer et al. , ("Application of Electrospray Mass Spectrometry to the Characterization of Recombinant Proteins up to 44 kDa", Biomedical and Environmental Mass Spectrometry, Vol. 19, 692-704 (1990))This procedure is disclosed to have an accuracy of better than 0.01% for proteins having a molecular weight under 30 kDa. According to the ESMS procedure, the P14a protein has a molecular weight of about 14877 Daltons.

Example 2: Cloning of cDNA Sequences Coding for Tomato P14 proteins

This Example describes the identification of DNA sequences coding for five different tomato P14 proteins. Conventional and well known molecular biology techniques were used, such as described by Maniatis et al. (Molecular Cloning, A Laboratory Manual, 2 ^nd Edition, Sambrook, Fritsch and Maniatis) and thus a detailed description of these techniques is not included.

First of all a cDNA library was established from infected tomato plants (Lambda-ZAP, STRATAGENE, 1.5xl0 ⁵ clones). The library was then screened for P14 genes using a degenerate oligonucleotide probe based upon the known P14 amino acid sequence (Lucas et al. ibid. - amino acid residues 113 to 119 of SEQ ID NO 1.) given in the SEQUENCE LISTING AS SEQ ID NO. 6

5' AT (A,G) AACCACCA(A,C,G,T)CC(A,G)TT(A,G)TT 3'

This resulted in the isolation of a number of clones hybridising to the oligonucleotide. Sequencing data indicated that clones of about 0.8 kb in length would contain the complete cDNA coding for P14. One such clone was isolated and completely sequenced. The cDNA protein coding sequence and corresponding amino acid sequence are given in the SEQUENCE LISTING as SEQ ID NO:1, i.e. the cDNA sequence coding for P14a. This sequence comprises a cDNA sequence of 480 nucleoclides coding for a protein of 159 amino acids in length comprising a 24 amino acid signal peptide (residues - 24 to - 1) and a 135 amino acid mature protein sequence (residues 1 to 135). This protein contains an additional stretch of 5 additional amino acids (residues 99-103 inclusive) as compared with the P14 protein sequence published by Lucas et al.. (ibid.).

Tr - next step was the cloning of a genomic library into the Lambda-GEM 4 vector from PROMEGA (10 ⁶ clones) this library was screened with the P14a cDNA and 27 independent clones containing P14

genes were isolated and some of them purified to individual Lambda clones.

A number of further rounds of screening were necessary to isolate additional single Lambda clones containing P14 genes. Restriction fragments containing P14 coding sequences were subcloned into plasmid vectors (Bluescript, KS+) and prepared for sequencing (ERASE A BASE, deletion kit, PROMEGA). An overall total of 6 different genes were identified, of which 5 are located within a 50 kb stretch in the tomato genome, one of the genes appearing to be a pseudogene. The genomic DNA sequences and corresponding amino acid sequences of the four additional genes, coding for the proteins designated P14b, P14d, P14e and P14f are given in the SEQUENCE LISTING AS SEQ ID NO 2, 3, 4 and 5 respectively. These genomic protein coding sequences did not contain introns. Similar to P14a the P14b coding sequence comprises a DNA sequence 480 nucleotides in length coding for a 159 amino acid protein having 24 amino signal peptide and 135 amino acid mature protein portions. P14b has 5 amino acid substitutions with respect to the P14a protein sequence all of these being present in the mature protein (residues 77, 90, 92, 130 and 132), representing a homology of about 96% between the P14a and P14b mature protein sequences. The P14e protein is very similar to the P14a protein though has a stretch of 9 amino acids (residues 127 to 135) deleted from its c-terminus and the last two c-terminal amino acids (residues 125 and 126) substituted with respect to P14a (i.e. a homology of about 90% between the P14e and P14a mature proteins). In comparison P14d mature protein has a homology of about 88% with P14a mature protein (16 amino acid substitutions in the mature protein sequence plus 2 amino acid substitutions and one insertion in the leader peptide sequence). P14f, similar to P14a, has a 24 amino acid leader peptide and 135 amino acid mature protein sequence, but has 29 amino acid substitutions in the mature peptide sequence, thus representing a homology of about 78% between the P14a and P14f mature protein sequences.

In the P14b, P14d, P14e and P14f nucleotide and amino acid sequences

given in the SEQUENCE LISTING changes with respect to the P14a sequences are shown in bold.

Example 3: Constructions of a Plasmid for Expression of Methionyl P14 Protein in E. Coli and Transformation of E. Coli cells

The commercially available E. Coli expression plasmid pKK233.2 (Pharmacia) was cut with Ncol and Hindlll restriction enzymes and the resultant plasmid DNA gel purified. The large plasmid DNA fragment was then treated with calf intestinal phosphatase to remove phosphates.

Two oligonucleotide primers, TB3 and TB5, shown below, were synthesized using standard procedures. Primer TB3 corresponds to SEQ ID NO 7 and TB5 to SEQ ID NO 8.

TB3: 5' TCATAAGGATCCATAAGCTTAGTAAGG 3' TB5: 5' ACTCTTGTGCCATGGAAAATTCACCCC 3'

Primer TB5 is homologous to 5' terminus of the nucleotide sequence extending from nucleotide position 59 to position 480 in SEQ ID NO 1 and is designed to provide a Ncol site and ATG translation initiation codon adjacent to the 5' terminus of the DNA sequence coding for the mature P14 a protein. Primer TB3 is homologous to the 3' terminus of the aforementioned nucleotide sequence and is designed to provide a Hindlll site at the 3' terminus. These primers were used to amplify through polymerase chain reaction (PCR) a nucleotide sequence containing the nucleotide sequence extending from nucleotide position 73 to position 480 in SEQ ID NO 1, and further containing the aforementioned additional restriction sites and ATG translation initiation codon. After amplification this sequence was purified using standard procedures and digested with Ncol and Hindlll. The product of this digestion was then mixed with the Ncol-Hindlll cut pKK233.2 vector fragment prepared above and the two fragments ligated. The resulting plasmid pBTlOO is shown in Figure 1. This plasmid was then used to transform competent JM105 E. Coli cells. Transformed colonies were subsequently screened for their plasmid content and their ability to express the P14 protein

after induction according to standard techniques.

Example 4

Construction of a plasmid for expression of a P14 protein including its signal peptide and Transformation of E. Coli

Plasmid PKK233.2 was cut with Ncol and Hindlll and purified as described in Example 2.

Two oligonucleotide primers, TB3 from Example 3, and TB4, shown below, were synthesized using standard procedures. Primer TB4 corresponds to SEQ ID NO 9.

TB4: 5' CCTAAAGAACCATGGGGTTGTTGTTCA 3'

Primer TB4 is homologous to the 5' terminus of a nucleotide sequence including the nucleotide sequence extending from nucleotide position 1 to position 480 in SEQ ID NO 1 and is designed to provide a Ncol site adjacent to the 5' terminus of the cDNA sequence coding for P14a including the leader peptide.

Primers TB3 and TB4 were used to amplify via PCR a nucleotide sequence containing the nucleotide sequence extending from nucleotide position 1 to position 480 in SEQ ID No. 1, and further containing a Ncol restriction site at the 5' terminus and a Hindlll restriction site at the 3' terminus. After amplification this sequence was purified and digested by Ncol and Hindlll and a ligation mixture was formed with the Ncol-Hindlll cut pKK233.2 vector as described in Example 4. The resulting plasmid pBT103 is shown in Figure 2. Transformation of competent JM105 E. Coli cells and screening was carried out as in Example 3.

Using substantially similar procedures to those described in Examples 3 and 4 vectors for expression of the P14b, P14d P14e and P14f genes are constructed. Such vectors are used to transform competent E. Coli cells. The transformed E. Coli cells are cultured

and the various P14 proteins (P14a, P14b, P14d, P14e and P14f) expressed. All the P14 proteins are tested for fungicidal activity and found to have a fungicidal activity similar to that of P14a.

Example 5: Fungicidal Compositions

In practice, the P14 and modified P14 proteins of this invention are formulated in fungicidal compositions together with agriculturally acceptable diluents. The term diluents as used herein means a liquid or solid which is added to the protein to bring it into an easier or better applicable form. Such diluents may include water, xylene, talc, kaolin, and diatomaceous earth, agents which stabilise the formulation, e.g. buffers, and surfactants for enhancing contact between the proteins and the plant to be treated.

Formulations used in spray form, such as water dispersible concentrates or wettable powders, may contain surfactants such as wetting and dispersing agents. Especially suitable surfactants include Tween-80 and Trixton-X-100.

The P14 proteins and modified P14 proteins are typically stable throughout a range of pH's and therefore water is often a suitable carrier. However, where necessary, the composition additionally contain a buffer to maintain the composition within a desirable pH range. Any buffer solution may be used which is compatible with the proteins and does not otherwise deleteriously affect the plant. Suitable buffers include, for example, a 50 mM tris/HCl, sodium succinate or sodium citrate.

Typically, the amount of P14 protein in the fungicidal composition is between about 1 and 1000 μg/ml, although amounts outside such range might also be acceptable, depending upon the particular protein being employed and the plant being treated.

Where the composition additionally contains a surfactant, the amount required is readily ascertainable by persons skilled in the art and will typically range from between about 0.001 and about 20 % by weight.

The above-described formulations, containing the P14 protein or modified P14 proteins and optional diluents and additives are then applied to the plant or plant loci. Application of the composition can be carried out in accordance with techniques well known to persons skilled in the art such as by preparing a spray for application to the plant. It will be appreciated that the amount of solution required for treatment of the plant or plant loci will depend on the subject of the treatment (plant, soil), the type of treatment (e.g. drenching, sprinkling, spraying), the purpose of the treatment (prophylactic or therapeutic), the type of fungi to be treated and the application time.

Further active ingredients, e.g., fungicides with similar or complementary fungicidal activity or other beneficially acting materials such as insecticides may be applied together with the P14 or P14 analogue proteins in order to increase their spectrum of activity or agricultural utility.

The following are examples setting forth suitable fungicidal compositions for use in this invention.

Example 5 (a)

P14a protein 20 μg/ml water

Example 5 (b)

P14a protein 20 μg/ml water Buffer 10 mM sodium phosphate pH 7.0

Example 5 (c)

P14a protein 20 μg/ml water Triton X-100 0.05 % wt/vol

Example 5 (d)

P14a protein 20 μg/ml water

Buffer 10 mM sodium phosphate pH 7.0

Triton X-100 0.05 % wt/vol

The fungicidal compositions of this application are desirably applied to plants that are attacked by pathogens at a rate ranging from 100 to 1000 1/ha. It may be desired with many plants to repeat the treatment after several weeks if necessary to provide the desired protection from the pathogens present on the plant. Moreover, as a preventive measure, plants that are susceptible to pathogenic attack may be sprayed with the fungicidal compositions of this application prior to the first sign of the presence of pathogen or of the infection of the plant by pathogen.

Transformed Plants

The DNA sequences according to the present invention can also be inserted into the genome of a plant that is vulnerable to a fungal disease. Any suitable method may be employed for such incorporation of the P14 and P14 analogue protein-coding DNA sequences into a host plant cell genome, such as for example, via Ti plasmid of Agrobacterium tumefaciens, electroporation, electrotransformation, ballistic gun, micro-injection, viral infection or the use of chemicals that induce or increase free DNA uptake, and the like. Such procedures and the use of such in the transformation of plants are well known to one skilled in the art; cf. Genetically Engineering Plants for Crop Improvement, Gasser, C.S. and Froley, R.T., Science 244, 1293-99 (1989); Depicker, A. et al., Genetic Eng. of Plants, Ag. Perspective, Plenum Press, Editors Kosuge, Meredith, Hollaender, pp. 144-148 (1983); Shaw, CH. et al. , Gene, 23(3): 315-330 (1983). Preferably the DNA sequence encoding the P14 and P14 analogue proteins will be associated with appropriate regulatory sequences, such as for example, 5' promoter and 3' regulatory (e.g. terminator and poly A sequences) sequences which are functional in plants, and the whole

will be incorporated into a vector. The promoter may express the DNA constitutively or differentially. Suitable examples of promoters differentially regulating DNA expression are promoters inducible by disease vectors, e.g. so-called wound inducible promoters. Suitable promoters include the known plant viral promoters such as CaMV 35S and the promoter associated with the P14 gene. Such transformation of plant cells, followed by regeneration and development of cells into whole plants, enables the DNA sequence to become a stable and permanent part of the plant genome, such that it is passed on from one generation to the next via mitosis and meiosis and upon expression results in a protein endowing the plant with inheritable resistance to fungicide attack.

FUNGICIDAL ACTIVITY

The fungicidal compositions of this application are suitably used to combat fungal diseases including rust fungi and powdery mildews in various plants. The following is a list of fungi which may be treated using the protein products of the invention. The list further identifies crop plants which are effected by these fungi.

Fungus Plant

Uromyces appendiculatus bean

Hemileia spp coffee

Puccinia spp wheat, pelargonium

Uromyces pisi peas, alfalfa

Uromyces spp snapdragon, bean

Erysiphe graminis f.sp. hordei barley

Sphaerotheca fuliginea barley

E. graminis f. sp. tritici wheat

E. cichoracearum apple

E. polygoni apple

Podospaera leucotricha apple

Uncinula necator grapes

Plasmopara viticola grapes

Pseudoperonospora humuli hop

Peronospora brassicae cabbage

Bremia lactuca lettuce

Fungicidal activity is also demonstrated against Phytophthora infestans and Phytophthora megasperma.

The proteins and compositions may also be used in pharmaceutical and veterinary applications. For such uses pharmaceutically or veterinarily acceptable components are used in the fungicidal compositions.

SEQ. ID NO: 1

SEQUENCE TYPE: Nucleotide with corresponding protein

SEQUENCE LENGTH: 480 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: c-DNA

ORIGINAL SOURCE ORGANISM: plant

FEATURES: from 1 to 72 bp signal peptide from 73 to 477 bp mature peptide

ATG GGG TTG TTC AAC ATC TCA TTG TTA CTC ACT TGT CTC ATG GT* TTA GCC ATA 5 MET Gly Leu Phe Asn lie Ser Leu Leu Leu Thr Cys Leu MET Val Leu Ala He -20 -15 -10

TTT CAC TCT TGT GAG GCC CAA AAT TCA CCC CAA GAC TAT CTT GCG GTT CAT AAC 10 Phe His Ser Cys Glu Ala Gin Asn Ser Pro Gin Asp Tyr Leu Ala Val His Asn -5 1 5 10

GAT GCC CGT GCC CAA GTC GGA GTC GGG CCT ATG TCT TGG GAT GCC AAC TTG GCA 16 Asp Ala Arg Ala Gin Val Gly Val Gly Pro MET Ser Trp Asp Ala Asn Leu Ala 15 20 25 30

TCC CGA GCA CAA AAC TAT GCC AAC TCA AGA GCT GGT GAT TGT AAC TTG ATT CAT 21 Ser Arg Ala Gin Asn Tyr Ala Asn Ser Arg Ala Gly Asp Cys Asn Leu He His 35 40 45

TCT GGT GCT GGG GAG AAT CTT GCC AAG GGT GGT GGT GAC TTC ACG GGG AGG GCA 27 Ser Gly Ala Gly Glu Asn Leu Ala Lys Gly Gly Gly Asp Phe Thr Gly Arg Ala 50 55 60 65

GCC GTG CAA TTG TGG GTG TCC GAG AGG CCA AGC TAT AAC TAC GCT ACC AAC CAA 324 Ala Val Gin Leu Trp Val Ser Glu Arg Pro Ser Tyr Asn Tyr Ala Thr Asn Gin 70 75 80

TGT GTT GGT GGA AAA AAG TGT AGA CAT TAT ACT CAA GTA GTC TGG CGC AAC TCA 378 Cys Val Gly Gly Lys Lys Cys Arg His Tyr Thr Gin Val Val Trp Arg Asn Ser 85 90 95 100

GTC CGA CTA GGT TGT GGT CGG GCA CGT TGC AAC AAC GGA TGG TGG TTC ATT TCT 432 Val Arg Leu Gly Cys Gly Arg Ala Arg Cys Asn Asn Gly Trp Trp Phe He Ser 105 110 115 120

TGC AAC TAT GAT CCT GTA GGC AAC TGG ATC GGA CAA CGT CCT TAC TAA 480 Cys Asn Tyr Asp Pro Val Gly Asn Trp He Gly Gin Arg Pro Tyr . 125 130 135

SEQ. ID NO: 2

SEQUENCE TYPE: Nucleotide with corresponding protein

SEQUENCE LENGTH: 480 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: genomic DNA

ORIGINAL SOURCE ORGANISM: plant

FEATURES: from 1 to 72 bp signal peptide from 73 to 477 bp mature peptide

ATG GGG TTG TTC AAC ATC TCA TTG TTA CTC ACT TGT CTC ATG GTA TTA GCC ATA MET Gly Leu Phe Asn He Ser Leu Leu Leu Thr Cys Leu MET Val Leu Ala He -20 -15 -10

TTT CAC TCT TGT GAG GCC CAA AAT TCA CCC CAA GAC TAT CTT GCG GTT CAC AAC 1 Phe His Ser Cys Glu Ala Gin Asn Ser Pro Gin Asp Tyr Leu Ala Val His Asn -5 1 5 10

GAT GCC CGT GCC CAA GTC GGA GTC GGG CCA ATG TCT TGG GAT GCC AAC TTG GCA 1 Asp Ala Arg Ala Gin Val Gly Val Gly Pro MET Ser Trp Asp Ala Asn Leu Ala 15 20 25 30

TCC CGA GCA CAA AAC TAT GCC AAC TCA AGA GCG GGT GAT TGT AAT TTG ATT CAT 2 Ser Arg Ala Gin Asn Tyr Ala Asn Ser Arg Ala Gly Asp Cys Asn Leu He His 35 40 45

TCT GGT GCT GGG GAG AAC CTT GCC AAG GGT GGT GGT GAC TTC ACG GGG AGG GCA 2 Ser Gly Ala Gly Glu Asn Leu Ala Lys Gly Gly Gly Asp Phe Thr Gly Arg Ala 50 55 60 65

GCC GTG CAA TTG TGG GTG TCC GAG AGG CCA GAC TAT AAC TAC GCT ACC AAC CAA 3 Ala Val Gin Leu Trp Val Ser Glu Arg Pro Asp Tyr Asn Tyr Ala Thr Asn Gin 70 75 80

TGT GTT GGT GGA AAA ATG TGT GGA CAT TAT ACT CAA GTA GTC TGG CGC AAC TCA 3 Cys Val Gly Gly Lys Met Cys Gly His Tyr Thr Gin Val Val Trp Arg Asn Ser 85 90 95 100

GTC CGA CTA GGT TGT GGT CGG GCT CGT TGC AAC AAT GGG TGG TGG TTC ATT TCT 4 Val Arg Leu Gly Cys Gly Arg Ala Arg Cys Asn Asn Gly Trp Trp Phe He Ser 105 110 115 120

TGC AAC TAC GAT CCT GTA GGC AAC TGG GTT GGA GAA CGT CCT TAT TAA 4 Cys Asn Tyr Asp Pro Val Gly Asn Trp Val Gly Glu Arg Pro Tyr . 125 130 135

SEQ. ID NO: 3

SEQUENCE TYPE: Nucleotide with corresponding protein

SEQUENCE LENGTH: 483 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: genomic DNA

ORIGINAL SOURCE ORGANISM: plant

FEATURES: from 1 to 75 bp signal peptide from 76 to 480 bp mature peptide

ATG GGG TTG TTT AAC ATG TCA TTG TTA CTT ATG ACT TGT CTC ATG GTA TTA GCC A MET Gly Leu Phe Asn MET Ser Leu Leu Leu MET Thr Cys Leu MET Val Leu Ala

-20 -15 -10

TTT CAC TCT TGT GAT GCT CAA AAT TCA CCC CAA GAC TAT CTT GAG GTT CAC AAC 11 Phe His Ser Cys Asp Ala Gin Asn Ser Pro Gin Asp Tyr Leu Glu Val His Asn -5 1 5 10

GAC GCC CGT GCC CAA GTC GGA GTC GGG CCA ATG TCT TGG GAT GCC GAC TTG GAA 16 Asp Ala Arg Ala Gin Val Gly Val Gly Pro MET Ser Trp Asp Ala Asp Leu Glu 15 20 25 30

TCC CGA GCA CAA AGC TAT GCC AAC TCA AGA GCG GGT GAT TGT AAC TTG ATT CAT 21 Ser Arg Ala Gin Ser Tyr Ala Asn Ser Arg Ala Gly Asp Cys Asn Leu He His 35 40 45

TCT GGT TCA GGG GAG AAT CTT GCC AAG GGT GGT GGT GAC TTC ACG GGG AGG GCC 27 Ser Gly Ser Gly Glu Asn Leu Ala Lys Gly Gly Gly Asp Phe Thr Gly Arg Ala 50 55 60 65

GCT GTG GAA TTG TGG GTG TCG GAA AAG CCA AAC TAC AAC TAC GAT ACG AAT GAA 32 Ala Val Glu Leu Trp Val Ser Glu Lys Pro Asn Tyr Asn Tyr Asp Thr Asn Gin 70 75 80

TGT GTT AGC GGA AAA ATG TGC GGA CAT TAT ACT CAA GTA GTC TGG CGT GAC TCA 38 Cys Val Ser Gly Lys MET Cys Gly His Tyr Thr Gin Val Val Trp Arg Asp Ser 85 90 95 100

GTT CGA CTA GGT TGT GGT CGG GCT CTT TGC AAC GAC GGG TGG TGG TTT ATT TCT 43 Val Arg Leu Gly Cys Gly Arg Ala Leu Cys Asn Asp Gly Trp Trp Phe He Ser 105 110 115 120

TGC AAC TAT GAT CCT GTA GGC AAT TGG GTC GGA CAA CGT CCT TAC TAA 48 Cys Asn Tyr Asp Pro Val Gly Asn Trp Val Gly Gin Arg Pro Tyr . 125 130 135

SEQ. ID NO: 4

SEQUENCE TYPE: Nucleotide with corresponding protein

SEQUENCE LENGTH: 453 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: genomic DNA

ORIGINAL SOURCE ORGANISM: plant

FEATURES: from 1 to 72 bp signal peptide from 73 to 450 bp mature peptide

ATG GGG TTG TTC AAC ATC TCA TTG TTA CTC ACT TGT CTC ATG GTA TTA GCC ATA MET Gly Leu Phe Asn He Ser Leu Leu Leu Thr Cys Leu MET Val Leu Ala He -20 -15 -10

TTT CAC TCT TGT GAG GCC CAA AAT TCA CCC CAA GAC TAT CTT GCG GTT CAT AAC 1 Phe His Ser Cys Glu Ala Gin Asn Ser Pro Gin Asp Tyr Leu Ala Val His Asn -5 1 5 10

GAT GCC CGT GCC CAA GTC GGA GTC GGG CCT ATG TCT TGG GAT GCC AAC TTG GCA 1 Asp Ala Arg Ala Gin Val Gly Val Gly Pro MET Ser Trp Asp Ala Asn Leu Ala 15 20 25 30

TCC CGA GCA CAA AAC TAT GCC AAC TCA AGA GCT GGT GAT TGT AAC TTG ATT CAT 2 Ser Arg Ala Gin Asn Tyr Ala Asn Ser Arg Ala Gly Asp Cys Asn Leu He His 35 40 45

TCT GGT GCT GGG GAG AAT CTT GCC AAG GGT GGT GGT GAC TTC ACG GGG AGG GCA 2 Ser Gly Ala Gly Glu Asn Leu Ala Lys Gly Gly Gly Asp Phe Thr Gly Arg Ala 50 55 60 65

GCC GTG CAA TTG TGG GTG TCC GAG AGG CCA AGC TAT AAC TAC GCT ACC AAC CAA 3 Ala Val Gin Leu Trp Val Ser Glu Arg Pro Ser Tyr Asn Tyr Ala Thr Asn Gin 70 75 80

TGT GTT GGT GGA AAA AAG TGT AGA CAT TAT ACT CAA GTA GTC TGG CGC AAC TCA 3 Cys Val Gly Gly Lys Lys Cys Arg His Tyr Thr Gin Val Val Trp Arg Asn Ser 85 90 95 100

GTC CGA CTA GGT TGT GGT CGG GCA CGT TGC AAC AAC GGA TGG TGG TTC ATT TCT 4 Val Arg Leu Gly Cys Gly Arg Ala Arg Cys Asn Asn Gly Trp Trp Phe He Ser 105 110 115 120

TGC AAC TAT GAT CAA TAC TAG 4 Cys Asn Tyr Asp Gin Tyr . 125

SEQ. ID NO: 5

SEQUENCE TYPE: Nucleotide with corresponding protein

SEQUENCE LENGTH: 480 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: genomic DNA

ORIGINAL SOURCE ORGANISM: plant

FEATURES: from 1 to 72 bp signal peptide from 73 to 477 bp mature peptide

ATG GGG TTA TTC GAA AAC ACA TTG TTT CTC TTT TGT TTC ATG ATA TTA GCC ATA 5 MET Gly Leu Phe Glu Asn Thr Leu Phe Leu Phe Cys Phe MET He Leu Ala He -20 -15 -10

TTT CAC TCT TGT GAC GCT CAA AAT TCA CCA CAA GAC TAT CTT GTG GTT CAC AAC 10 Phe His Ser Cys Asp Ala Gin Asn Ser Pro Gin Asp Tyr Leu Val Val His Asn -5 1 5 10

AAT GCT CGT GGT CAA GTC GGG GTT GGG CCT ATG TCT TGG GAT GAT GCC TTG GCA 16 Asn Ala Arg Gly Gin Val Gly Val Gly Pro MET Ser Trp Asp Asp Ala Leu Ala 15 20 25 30

ACC AAA GCA CAA AGG TAT.GCT GAC TCA AGA AGA GGT GAT TGC AAC TTG ATT CAT 21 Thr Lys Ala Gin Arg Tyr Ala Asp Ser Arg Arg Gly Asp Cys Asn Leu He His 35 40 45

TCT GGT CCA GGG GAG AAT CTT GCC AAG GGT ΔGT GGA GAT TTC ACA GGG AGG CGT 270 Ser Gly Pro Gly Glu Asn Leu Ala Lys Ser Gly Gly Asp Phe Thr Gly Arg Arg 50 55 60 65

GCC TCG TAA TTG TGG GTG GCG GAG AAG CCA AAC TAC AAC TAT GGT ACC AAC CAA 324 Ala Ser Glu Leu Trp Val Ala Glu Lys Pro Asn Tyr Asn Tyr Gly Thr Asn Gin 70 75 80

TGT GCT ΔGT GGG AAA GTG TGC GGA CAC TAT ACT CAA GTA GTT TGG CGT ACC TCG 378 Cys Ala Ser Gly Lys Val Cys Gly His Tyr Thr Gin Val Val Trp Arg Thr Ser 85 90 95 100

ATC AGG CTA GGT TGT GGT CGG GCT CGT TGT AAC AAC GGG TGG TGG TTC ATT TGT 432 He Arg Leu Gly Cys Gly Arg Ala Arg Cys Asn Asn Gly Trp Trp Phe He Cys 105 110 115 120

TGC AAC TAT GCT CCT TTT GGT AAC ATC ATC GGA CAA CGT CCT TAC TAA 480 Cys Asn Tyr Ala Pro Phe Gly Asn He He Gly Gin Arg Pro Tyr . 125 130 135

SEQ. ID NO: 6

SEQUENCE TYPE: Nucleotide

SEQUENCE LENGTH: 23 base pairs

STANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: Oligonucleotide DNA

5' AT(A,G)AACCACCA(ACGT)CC(A,G)TT(A,G)TT 3'

SEQ. ID NO: 7

SEQUENCE TYPE: Nucleotide

SEQUENCE LENGTH: 27 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: Oligonucleotide DNA

5' TCATAAGGATCCATAAGCTTAGTAAGG 3'

SEQ. ID NO: 8

SEQUENCE TYPE: Nucleotide

SEQUENCE LENGTH: 27 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: Oligonucleotide DNA

5' ACTCTTGTGCCATGGAAAATTCACCCC 3'

SEQ. ID NO: 9

SEQUENCE TYPE: Nucleotide

SEQUENCE LENGTH: 24 base pairs

STRANDEDNESS: single

TOPOLOGY: linear

MOLECULE TYPE: Oligonucleotide DNA

5' CCTAAAGAACCATGGGGTTGTTCA 3'