Plants with an intense fruit phenotype FIELD OF THE INVENTION

[00011 The present invention relates to the field of plant breeding, in particular tomato or Cucurbitaceae breeding. The invention provides for a plant comprising a modified amount, activity or function of AGL1 1 -like protein, wherein the plant is a member of plant family Cucurbitaceae or of species Solarium lycopersicum; characterized in that the plant is not a Solarium lycopersicum plant having a deletion from nucleotide 1042 to nucleotide 637 upstream of the ATG start codon of SEQ ID NO: 1 (See also Figure 3). The invention further provides seeds, parts and fruits from such plant. Also provided is the use of marker for the identification of the intense phenotype in Solarium lycopersicum, a method of producing tomato plants and tomato plants with intense and old-gold-crimson (ogc) phenotype and optionally powdery mildew resistance.

BACKGROUND

[0002] Intense tomato varieties, such as commercial varieties NUN 3155 TO Fl and NUN 3362 TO (Nunhems B.V.) comprise a mutation in an unknown gene (of which also the location in the genome was unknown), which converts the locular gel found in the seed cavities of tomato fruits into fleshy tissue. To see this "intense phenotype" the mutation needs to be present in homozygous form, i.e. the intense allele which confers the intense phenotype is recessive. As the mutant intense allele is present in the cultivated S. lycopersicum genome, which has a low degree of polymorphism in many genomic regions, it is difficult to map the responsible gene. [0003] PCT/EP2013/055044 discloses a Solanum lycopersicum plant comprising a TYLCV resistance phenotype and an intense fruit phenotype, wherein said plant comprises at least one recombinant chromosome 6 comprising the recessive intense allele and an introgression fragment comprising an allele conferring TYLCV resistance in coupling configuration. This application shows that the recessive intense allele is located on chromosome 6 of Solanum. lycopersicum, close to the locus of Ty-1 and Ty-3. This application does not show which gene, or genomic mutation, is responsible for the intense phenotype, nor does it show markers to identify the intense phenotype.

[0004] Tomato fruits with the intense phenotype have essentially no gel in the seed cavities surrounding the seeds and the locular gel (i.e. placenta tissue) is replaced by fleshy tissue. Such a phenotype is also of interest in breeding with other plant species having gel or non-fleshy tissue around the seeds.

[0005] A problem vegetable breeders are faced with is that no marker for the intense phenotype is known. Consequently, a breeder can only select plants with intense phenotype once the plant has mature fruit. [0006] It is an object of the invention to find the genetic cause for the intense phenotype in tomato and to identify othologs of this gene in other plant species. It is also an object to provide tomato plants and plants of other species (especially cucumber and melon plants), which produce fruits having an intense phenotype, conferred by one or more mutations in the endogenous intense gene or ortholog of the gene, whereby said mutations lead to an altered expression, function or activity of the encoded protein. It is a further object to develop a marker that can be used in the selection of plants with an intense phenotype.

SUMMARY OF THE INVENTION

1 007| It was surprisingly found by the inventors that plants of species Solanum lycopersicum having a deletion in the promoter of the Tomato AGLl 1 -l ike (TAGLl l -like) gene sequence produced intense phenotype tomato fruits (such as for example NUN 3155 TO Fl and NUN 3362 TO). It is known in the art that promoters are extremely diverse and have regulatory elements several kilobases (kb) away from the transcriptional start site. They thereby influence the degree of transcription of DNA into RNA and consequently also the amount of protein being generated. [0008] It is generally assumed that orthologs have the same biological functions in different species. Identification of orthologs allows for creating groups of genes with the same biological functions across crops. Orthologs of AGLl 1 -like protein in other species are likely to be involved in fruit texture or fruit tissue characteristics, too.

[0009] The intense phenotype according to the present invention is based on a modified or altered, level, activity or function of the wild type AGLl 1 -like protein in planta. The term AGLl 1 -like protein in this respect relates to the AGL 1 1 -like gene product, such as the protein encoded by the NCBI accession number XP_004241906 (version XP_004241906.1 GL460392605) for tomato.

[0010] The invention thus relates to a plant comprising a modified amount, activity or function of (wild type) AGLl 1 -like protein, wherein the plant is a member of plant family Cucurbitaceae or of species Solanum lycopersicum; characterized in that the plant is not a Solanum lycopersicum plant having a deletion from nucleotide 1042 to nucleotide 637 upstream of the ATG start codon of SEQ ID NO: 1 (counting the A of the ATG start codon as number 1 , see also Figure 3). In one specific aspect the plant is a cucumber plant, melon plant or tomato plant comprising one or more mutations in the endogenous AGLl I -like gene, which result in a modified (especially reduced) amount, activity or function of the AGLl 1 -like protein encoded by the gene, and thereby result in an intense fruit phenotype (cucumber fruits, melon fruits or tomato fruits having an intense fruit phenotype). GENERAL DEFINITIONS

[0011] The indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements.

The indefinite article "a" or "an" thus usually means "at least one". [0012] As used herein, the term "plant" includes the whole plant or any parts or derivatives thereof, such as plant organs (e.g., harvested or non-harvested storage organs, tubers, fruits, leaves, seeds, etc.), plant cells, plant protoplasts, plant cell or tissue cultures from which whole plants can be regenerated, plant calli, plant cell clumps, and plant cells that are intact in plants, or parts of plants, such as embryos, pollen, ovules, ovaries, fruits (e.g., harvested tissues or organs, such as harvested tomatoes or parts thereof), flowers, leaves, seeds, tubers, bulbs, clonally propagated plants, roots, root-stocks, stems, root tips and the like. Also any developmental stage is included, such as seedlings, immature and mature, etc.

[0013] A plant part can be regenerable or non-regenerable ; alternatively a plant part can be propagating or non-propagating, for example a non-propagating plant cell, in particular a non- propagating plant cell comprising in its genome an allele causing the modified amount, activity or function of AC i l . ! 1 -like protein of the invention as disclosed herein is provided.

[0014] "Plant variety" is a group of plants within the same botanical taxon of the lowest grade known, which (irrespective of whether the conditions for the recognition of plant breeder's rights are fulfilled or not) can be defined on the basis of the expression of characteristics that result from a certain genotype or a combination of genotypes, can be distinguished from any other group of plants by the expression of at least one of those characteristics, and can be regarded as an entity, because it can be multiplied without any change. Therefore, the term "plant variety" cannot be used to denote a group of plants, even if they are of the same kind, if they are all characterized by the presence of one or two loci or genes (or phenotypic characteristics due to these specific loci or genes), but which can otherwise differ from one another enormously as regards the other loci or genes.

[0015] "Fi, F2, etc." refers to the consecutive related generations following a cross between two parent plants or parent lines. The plants grown from the seeds produced by crossing two plants or lines is called the Fl generation. Selfing the Fl plants results in the F2 generation, etc.

[0016] "Fl hybrid" plant (or Fl hybrid seed) is the generation obtained from crossing two inbred parent lines. Thus, Fl hybrid seeds are seeds from which Fl hybrid plants grow.

[0017] The term "allele(s)" means any of one or more alternative forms of a gene at a particular locus, all of which alleles relate to one trait or characteristic at a specific locus. In a diploid cell of an organism, alleles of a given gene are located at a specific location, or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes. A diploid plant species may comprise a large number of different alleles at a particular locus. These may be identical alleles of the gene (homozygous) or two different alleles (heterozygous).

[0018] The term "gene" means a DNA sequence comprising a region (transcribed region), which is transcribed into a messenger RNA molecule (mRNA) in a cell, and an operably linked regulatory region (e.g. a promoter). Herein in certain embodiments the "promoter" sequence and the "gene sequence" of the AGL11 -like gene are distinguished, whereby the "gene sequence" thus refers to the DNA sequence downstream of the promoter, comprising the transcribed region (genomic DN A, transcribed into precursor-mRNA and spliced into mRNA, which is translated into protein).

[0019] The term "locus" (loci plural) means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found. The intense locus is thus the location in the genome where the intense gene is found on chromosome 6 of the tomato genome or where the ortholog of the intense gene is found in cucumber or melon. Likewise the 01-6 locus (or ogc locus) is the S. lycopersicon locus where the 01-6 gene (or ogc gene) is found on chromosome 6.

[0020] "Genetic distance" between loci on the same chromosome is measured by frequency of crossing-over, or recombination frequency (RF) and is indicated in centimorgans (cM). One cM corresponds to a recombination frequency of 1%. If no recombinants can be found, the RF is zero and the loci are either extremely close together physically or they are identical. The further apart two loci are, the higher the RF.

[0021] "mtrogression fragment" or "introgression segment" refers to a chromosome fragment (or part) which has been introduced into another plant of the same or related species by crossing or traditional breeding techniques. In tomato, wild relatives of tomato are often used to introgress fragments of the wild genome into the genome of cultivated tomato, S. lycopersicum. Such a cultivated tomato plant thus has a "genome of S. lycopersicum", but comprises in the genome a fragment of a wild relative of tomato, e.g. an introgression fragment of a related wild species' genome, such as Solanum chilense or another wild relative of tomato. It is understood that the term "introgression fragment" never includes a whole chromosome, but only a part of a chromosome.

[0022] "Intense allele" (or "Int") or "intense allele" (or "i") refers herein refers to an allele conferring a "normal fruit phenotype" (Int) or an "intense phenotype" (i), respectively. The "Intense allele" is herein used interchangeably with "AGL1 1 -like allele" (leading to expression of a wild type, functional AGL11 -like protein) and the "intense allele" is used interchangeably with agl 11 -like allele (leading to reduced amount, activity or function of the wild type AGL11 -like protein). In Solanum lycopersicum, and likely also in cucumber and melon, the Intense allele is dominant, i.e. it is the allele which, when present in the genome in one (heterozygous) or two (homozygous) copies confers normal tomato fruits, having normal seed cavities, i.e. with gel around the seeds (locular gel). Tomato fruits having a "normal fruit phenotype" thus refer to fruits which have locular gel, as shown for example in Figure 1, left side. The intense allele is recessive, i.e. only when the dominant Intense allele is lacking from the genome is the intense phenotype seen. Thus Solanum lycopersicum (or cucumber or melon)plants having an Intense /Intense (Int/Int) or Intense / intense (Int i) genotype have a normal fruit phenotype, while homozygous intense / intense (i/i) plants have an "intense fruit phenotype", as shown e.g. in Figure 1 , right side (see further below).

1 02 1 Epicarp is a botanical term for the outermost layer of the pericarp (or fruit). The epicarp forms the tough outer skin of the fruit. The epicarp is sometimes called the exocarp. Mesocarp is the botanical term for the succulent and fleshy middle layer of the pericarp of a fruit, between the epicarp and the endocarp; it is usually the major part of the fruit that is eaten, for example, mesocarp makes up a considerable proportion of a tomato. This term may also refer to any fruit that is fleshy throughout.

Endocarp is a botanical term for the inside layer of the pericarp (or fruit), which directly surrounds the seeds..

[0024] Endocarp tissue in cucumber refers to the gelatinous tissue surrounding the seeds and includes the associated placental tissue. Mesocarp tissue refers the fleshy tissue between the peel and gelatinous endocarp tissue, i.e. the edible fruit tissue.

[0025] The "intense phenotype" or "intense fruit phenotype" is the phenotype conferred by the presence of two mutant Solanum lycopersicum (or Cucumis sativus or Cucumis melo) intense alleles in the genome, whereby in tomato the homozygous intense alleles (intense/intense) cause the locular gel (i.e placenta tissue) found in the seed cavities of tomato fruits to become fleshy tissue. The mature tomato fruits therefore have essentially no gel in the seed cavities surrounding the seeds and the locular gel is replaced by fleshy tissue. The intense phenotype of tomato is depicted e.g. in Figure 1 , fruit on the right. In other crops the intense phenotype can be present in a similar way, i.e. altering the inner fruit tissue characteristics, especially making the inner fruit tissue (e.g. the placental tissue or tissue around the seeds) more solid than in normal fruits. In Cucurbiteae, e.g. Cucumis melo, which normally has a cavity in the middle comprising the melon seeds and a gel-like texture (placenta tissue), the intense phenotype may cause the placenta tissue to become more solid. The degree of solidity may depend on several parameters such as type of fruit variety and ripeness of fruit. In some cases the intense phenotype may cause the placenta tissue to be so solid that it binds the majority of (melon) seeds to each other. E.g., at least 50% of the seeds or at least 60%, 70%, 80 %, 90%, or even at least 95% or 99% of the seeds are bound to together by the placenta tissue of the fruit.

[0026] In other cases, like for example in seedless fruits, the intense phenotype causes the (placenta) tissue at the position where the seeds are normally located, to become more solid, this can for example be the case in cucumber.

[0027] The "normal fruit phenotype" or "wild type fruit phenotype" refers to the tomato or Cucurbitaceae (especially cucumber and melon) fruits comprising gel or softer tissue in the seed cavities or around the seeds or where normally seeds would be (e.g. locular gel or placenta tissue) compared to the outer fruit tissue, due to the presence of an (wild type) Intense allele, either in homozygous or heterozygous form (Intense/Intense or Intense/intense). The normal fruit phenotype in tomato is depicted e.g. in Figure 1 , fruit on the left. [0028] The "ogc allele" refers to an old-gold-crimson-conferring allele on Solanum lycopersicum chromosome 6 (ogc). The recessive allelic mutations old-gold-crimson (ogc), has the phenotype of deep red fruits that lack b-carotene and tawny orange flowers. The locus ogc was found to be on chromosome 6 of the tomato (Ron en et al 2000 PNAS vol 97 pp 1 1 102-11 107). Ogc has been used extensively in processing tomato breeding programs for the midwe stern and eastern United States. This gene works through a biochemical mechanism that is distinct from the high pigment genes, as it increases iycopene content and reduces β-carotene content (Sacks et al 2001, J. Amer. Soc. Hon. Sci. vol 126 pp 22 1 -226 ).

[0029] The "ogc phenotype" or "ogc fruit phenotype" is the phenotype conferred by the presence of two recessive Solanum. lycopersicum ogc alleles in the genome. It presenc e can be easily determined visually by analysing ripe tomato fruits: cut the ripe tomato fruit into two halves and determine the tomato flesh colour. Compare the colour to a normal fruit type like e.g. Heinz or Moneymaker. Ogc phenotype has deep red flesh colour (red towards purple red) while a normal tomato has a less red flesh colour (red towards yellow-red). Pericarp of a normal tomato sometimes even has a white or green-white colour.

100 01 Alternatively the Ogc phenotype can be objective measured using a colorimeter as described by Darrigues et al (Darrigues et al 2008, J Amer Soc Hon Scir vol 133 pp 579-586).

[0031] The "01-6 allele" refers to a dominant Oidium lycopersicum resistance conferring allele on chromosome 6.

[0032] An "Oidium resistance phenotype" or "Oidium lycopersici resistance" or refers to resistance against powdery mildew (Oidium neolycopersici) conferred by the 01-6 allele when present in the tomato genome in one or two copies.

[0033] A "Oidium resistance assay" or powdery mildew resistance test can be carried out in different ways, either as an artificial inoculation assay or as a field test, as commonly known in the art. For example using the method as described by Bai et al (Bai Y. et al. 2003 Molecular Plant Microbe Interactions, vol 16/2, pp 169-176). [0034] The "01-6 marker assay" is a molecular marker assay which can be used to test the presence of 01-6 allele

[0035] "Tomato plants" or "cultivated tomato plants" are plants of the Solanum lycopersicum, i.e. varieties, breeding lines or cultivars of the species Solanum lycopersicum, cultivated by humans and having good agronomic characteristics; preferably such plants are not "wild plants", i.e. plants which generally have much poorer yields and poorer agronomic characteristics than cultivated plants and e.g. grow naturally in wild populations. "Wild plants" include for example ecotypes, PI (Plant Introduction) lines, landraces or wild accessions or wild relatives of a species. The so-called heirloom varieties or cultivars, i.e. open pollinated varieties or cultivars commonly grown during earlier periods in human history and often adapted to specific geographic regions, are in one aspect of the invention encompassed herein as cultivated tomato plants.

100.161 Tomato and the wild relatives of tomato is/are diploid and has/have 12 pairs of homologous chromosomes, numbered 1 to 12. "Tomato chromosome 6" refer to the Solarium lycopersicum chromosome 6, as known in the art. "Orthologous chromosome 6" refers to the chromosome 6 of wild relatives of tomato, parts of which can be introgressed into tomato chromosome 6.

1 0 71 "Wild relatives of tomato" include S. arcanum, S. chmielewskii, S. neorickii ( = L.

parviflorum), S. cheesmaniae, S. galapagense, S. pimpinellifolium, S. chilense, S. corneliomulleri, S. habrochaites ( = L. hirsutum), S. huaylasense, S. sisymbriifolium, S. peruvianum, S. hirsutum or S. penneliii.

10038| "Cucumber plants" or "cultivated cucumber plants" as used here denotes varieties, breeding lines or cultivars of Cucumis sativus L. cultivated by humans and having good agronomic characteristics; preferably such plants are not "wild plants", i.e. plants which generally have much poorer yields and poorer agronomic characteristics than cultivated plants and e.g. grow naturally in wild populations. "Wild plants" include for example ecotypes, PI (Plant Introduction) lines, landraces or wild accessions or wild relatives of a species. The term "cucumber fruit" is used to refer specifically to the fruit. This cucumber fruit can be a gherkin, a long-, a short-, a mini-cucumber (Beith Alpha cucumber) or a midi-cucumber.

[0039] "Melon" or "muskmelon" refers herein to plants of the species Cucumis melo. Melons or 'muskmelons', Cucumis melo, can be classified into: C. melo cantalupensis, C. melo inodorous and C. melo reticulatus. C. melo cantalupensis are also referred to as Cantaloupes and are primarily round in shape with prominent ribs and almost no netting. Most have orange, sweet flesh and they are usually very fragrant. In contrast to the European cantaloupe, the North American 'Cantaloupe' is not of this type, but belongs to the true muskmelons. C. melo inodorous (or winter melons) can be subdivided into different types, such as Honeydew melon, Piel de Sapo. Sugar melon, Japanese melon, etc. C. melo reticulatus is the true muskmelon, with reticulated skin (netted) and includes Galia melons, Sharlyn melons and the North American cantaloupe.

[0040| "Cultivated melon" refers to plants of Cucumis melo i.e. varieties, breeding lines or cultivars of the species C. melo, cultivated by humans and having good agronomic characteristics, especially producing edible and marketable fruits of good size and quality and uniformity; preferably such plants are not "wild plants", i.e. plants which generally have much poorer yields and poorer agronomic characteristics than cultivated plants and e.g. grow naturally in wild populations. "Wild plants" include for example ecotypes, PI (Plant Introduction) lines, landraces or wild accessions or wild relatives of a species. [00411 "Average" refers herein to the arithmetic mean.

[0042] "In coupling phase" or "in coupling configuration" or "in cis" refers to the genetic condition in which the alleles of two different loci are genetically and physically linked together as a unit on one chromosome and inherit together as a unit. Preferably the loci are in close proximity to one another, reducing the likelihood that they will be separated again by recombination. 1 04 1 A "recombinant chromosome" refers to a chromosome having a new genetic makeup arising through crossing over between homologous chromosomes, e.g. a "recombinant chromosome 6",

1. e. a chromosome 6 which is not present in either of the parent plants and arose through a rare crossing- over event between homologous chromosomes of a chromosome 6 pair. Herein, for example, a recombinant tomato chromosome 6 comprising ogc and intense in coupling phase (in cis) is provided, as is a recombinant tomato chromosome 6 comprising ogc and intense and 01-6 in coupling phase (in cis).

[0044] The term "traditional breeding techniques" encompasses herein crossing, selfmg, selection, double haploid production, embryo rescue, protoplast fusion, marker assisted selection, mutation breeding etc. as known to the breeder (i.e. methods other than genetic

modification/transformation/transgenic methods), by which, for example, a recombinant chromosome 6 or a mutant intense allele can be obtained and/or transferred.

[0045] The term "mutation in a gene sequence" refers to an addition of one or more (e.g. at least I ,

2, 3, 4, 5, 10, 20, 50 or more) nucleotides in the gene sequence; or alternatively to a deletion of one or more nucleotides (e.g. at least 1 , 2, 3, 4, 5, 10, 20, 40, 80, 100, 150, 200, 300, 400, 500 or more) in the gene sequence; or alternatively a replacement of one or more (e.g. at least 1 , 2, 3, 4, 5, 10, 20, 50 or more) nucleotides in the gene sequence. Also combinations of mutations can occur e.g. an addition and a deletion or replacement, or a deletion and a replacement or addition, or even two or more additions, or two or more deletions, or two or more replacements.

[0046] Similarly, the term "mutation in the promoter of a gene sequence" refers to an addition of one or more nucleotides in said promoter sequence; or alternatively to a deletion of one or more nucleotides in said promoter sequence; or alternatively a replacement of one or more nucleotides in said promoter sequence.

[0047] Mutations in a gene sequence or promoter sequence may be caused by methods known in the art such as Ti l. UNC I (vide infra). 100481 The term "AGL 11 -like protein" is defined as the "Agamous Like 1 1 like" (AGL 11 -like) gene product, such as the protein encoded by the NCBI accession number XP_ 004241906 (version XPJ)04241906.1 GI:460392605) for tomato (Tomato AGLl 1 -like or TAG L I 1-like protein). In one aspect of the invention "AGLl 1 -like protein" refers to orthologs of the tomato AGLl 1-like protein, such as AGLl 1-like protein orthologs in cucumber or melon.

1 04 1 Tomato AGLl 1 -like protein is a MADS box protein. MADS box proteins are known to form dimers with itself or to form heterodimers with other MA S box proteins (Shore et al (1995) Eur. J. Biochemistry vol 229 pp 1 -13). In one aspect of the invention "AGLl 1 -like protein" refers to heterodimers comprising one AGLl 1 -like protein or ortholog thereof. [0050] A modified amount, activity or function of AGLl ! -like protein therefor also refers to a modified (e.g. decreased) amount of heterodimer of an AGLl 1-like protein or ortholog thereof, with another MADS box protein.

[0051] The term ortholog is defined as genes in different species that have evolved through speciation events. It is generally assumed that orthologs have the same biological functions in different species. Identification of orthologs accomplishes two goals: delineating the genealogy of genes to investigate the forces and mechanisms of evolutionary process, and creating groups of genes with the same biological functions (Fang G, et al (2010) Getting Started in Gene Orthology and Functional Analysis. PLoS Comput Biol 6(3): el 000703. doi: 10.1371/journal.pcbi.1000703). Orthologs of a specific gene or protein can be identified using sequence alignment or sequence identity of the gene sequence of the protein of interest with gene sequences of other species. Gene alignments or gene sequence identity determinations can be done according to methods known in the art. In one aspect f the invention an ortholog of AGLl l-iike protein has at least 45% (e.g. at least 48%, 50%, 52%, 54%, 55%, 58%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or more) amino acid sequence identity with SEQ ID NO: 3. [0052] Orthologs of tomato AGL l 1 -like protein (TAGL11 -like protein) in other species can also be identified based on their role in fruit formation, especially in fruit phenotype, texture of locular gel (i.e placenta tissue) or fruit flesh characteristics, especially orthologs of tomato AGLl 1 -like proteins lead to an intense fruit phenotype when the promoter r gene is mutated, so that the fruit produced a reduced amount of functional (wild type) AGLl 1 -like orthologous protein (e.g. due to a mutation in the promoter sequence) or produces a mutant agll 1 -like orthologous protein having reduced activity or function compared to the wild type AGLl 1 -like protein .

[0053] "Stringent hybridisation conditions" can be used to identify nucleotide sequences, which are substantially identical to a given nucleotide sequence. Stringent conditions are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T _m ) for the specific sequences at a defined ionic strength and pH. The T _m is the temperature ( under defined ionic strength and pH ) at which 50% of the target sequence hybridises to a perfect ly matched probe. Typically stringent condit ions will be chosen in which the salt concentration is about

0.02 molar at pH 7 and the temperature is at least 60°C. Lowering the salt concentration and/or increasing the temperature increases stringency. Stri ngent condit ions for RNA-DNA

hybridisat ions (Northern blots using a probe of e.g. lOOnt) arc for example those which include at least one wash in 0.2X SSC at 63°C for 20m in. or equivalent conditions. Stringent conditions for DNA-DNA. hybridisation ( Southern blots using a probe of e.g. l OOnt ) arc for example those which include at least one wash (usually 2) in 0.2X SSC at a temperature of at least 50' C, usually about 55°C, for 20 min, or equivalent conditions. See also Sambrook et al. (1989) and Sambrook and Russell (2001).

[0054] "Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms. Sequences may then be referred to as "substantially identical" or "essentially similar" when they are optimally aligned by for example the programs GAP or BESTFIT or the Emboss program "Needle" (using default parameters, see below) share at least a certain minimal percentage of sequence identity (as defined further below). These programs use the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimises the number of gaps. Generally, the default parameters are used, with a gap creation penalty = 10 and gap extension penalty = 0.5 (both for nucleotide and protein alignments). For nucleotides the default scoring matrix used is DNAFULL and for proteins the default scoring matrix is Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 10915- 10919). Sequence alignments and scores for percentage sequence identity may for example be determined using computer programs, such as EMBOSS

(http://www.ebi.ac.uk/Tools/psa/emboss_needl e,/). Alternatively sequence similarity or identity may be determined by searching against databases such as FASTA, BLAST, etc., but hits should be retrieved and aligned pairwise to compare sequence identity. Two proteins or two protein domains, or two nucleic acid sequences have "substantial sequence identity" if the percentage sequence identity is at least 75%, 85%, 90%, 95%, 98%, 99% or more (e.g. at least 99.1 , 99.2 99.3 99.4, 99.5, 99.6, 99.7, 99.8, 99.9 or more (as determined by Emboss "needle" using default parameters, i.e. gap creation penalty = 10, gap extension penalty = 0.5, using scoring matrix DNAFULL for nucleic acids an Blosum62 for proteins).

[0055] Putative TAG L I 1 -like protein orthologs can be identified in silico, e.g. by identifying nucleic acid r protein sequences in existing nucleic acid or protein database (e.g. GEN BAN , SWiSSPROT. TrEMBL) and determine sequence identity (vide supra) with the protein of interest or using standard sequence analysis software, such as sequence similarity search tools (BLASTN,

BLASTP. BLASTX, TBLAST, FASTA, etc). [0056] The "promoter of a gene sequence" is defined as a region of DNA that initiates transcription of a particular gene. Promoters are located near the genes they transcribe, on the same strand and upstream on the DNA. Promoters can be about 100-1000 base pairs long. In one aspect the promoter is defined as the region of about 1000 base pairs or more e.g. about 1500 or 2000, upstream of the start codon (i.e. ATG) of the protein encoded by the gene.

1 0571 A genetic element, an introgression fragment, or a (mutant) gene or allele conferring a trait is said to be "obtainable from" or can be "obtained from" or "derivable from" or can be "derived from" or "as present in" or "as found in" a plant or seed or tissue or cell if it can be transferred from the plant or seed in which it is present into another plant or seed in which it is not present (such as a line or variety) using traditional breeding techniques without resulting in a phenotypic change of the recipient plant apart from the addition of the trait conferred by the genetic element, locus, introgression fragment, gene or allele. The terms are used interchangeably and the genetic element, locus, introgression fragment, gene or allele can thus be transferred into any other genetic background lacking the trait. Not only seeds deposited and comprising the genetic element, locus, introgression fragment, gene r allele can be used, but also progeny /descendants from such seeds which have been selected to retain the genetic element, locus, introgression fragment, gene or allele, can be used and are encompassed herein, such as commercial varieties developed from the deposited seeds or from descendants thereof. Whether a plant (or genomic DNA, cell or tissue of a plant) comprises the same genetic element, locus, introgression fragment, gene or allele as obtainable from the deposited seeds can be determined by the skilled person using one or more techniques known in the art, such as phenotypic assays, whole genome sequencing, molecular marker analysis, trait mapping, chromosome painting, allelism tests and the like.

[0058] The term "traditional breeding techniques" encompasses herein crossing, backcrossing, selfing, selection, double haploid production, embryo rescue, protoplast fusion, marker assisted selection, mutation breeding etc. as known to the breeder (i.e. methods other than genetic

modification/transformation/transgenic methods), by which, for example, a recombinant chromosome or mutant can be obtained, identified and/or transferred.

[0059] "Human induced mutation" or "human induced recombinant" refers to a mutation (e.g. in the AGL1 1 -like ortholog gene or promoter) r recombination event (e.g. recombinant chromosome 6) induced and identified/selected by human intervention, i.e. not occurring in nature. BRIEF DESCRIPTION OF THE SEQUENCE LISTING

[0060] SEQ I D NO: 1 Shows the Solarium lycopersicum wild type fully functional tomato AGL1 1 -like promoter sequence as provided by the International Tomato Annotation Group (IT AG), I TAG Release 2.3 (201 1 -04-26) official annotations on the SL2.40 genome build by the International Tomato Annotation Group (IT AG). Data is openly and freely available on SGN (solgenomics.net/), SL2.40ch06 36808000.. 36817500. [0061] SEQ ID NO: 2 deletion in promoter sequence of wild type TAGLl 1-like sequence (as given in SEQ ID NO: 1) causing the intense fruit phenotype in tomato.

[0062] SEQ ID NO: 3 wild type Tomato AGL11 -like protein sequence based upon NCBI Reference Sequence of locus XMJ)04241858, version XMJ)04241858.1 GI: 460392604, as given by NCBI on ncbi.nIm.nih.gov/nuccore/XM___004241858.1.

1006 1 SEQ ID NO: 4 wild type Tomato AGL11 -like cDNA based upon NCBI Reference

Sequence of locus XM 004241 58, version XMJ)04241858.1 GI: 460392604, as given by NCBI on ncbi.nlm.nih.gov/nuccore/XM_004241858.1.

[0064] SEQ ID NO: 5 wild type Tomato AGL11 -like genomic DNA without promoter (obtained from the same source as SEQ ID NO: 1).

[0065] SEQ ID NO: 6 first AGL11-like ortholog in cucumber protein CU100500 (CI)

[00661 SEQ ID NO: 7 2 ^nd AGL11-like ortholog in cucumber protein CU 105950 (C2)

[0067] SEQ ID NO: 8 3 ^rd AGL11-like ortholog in cucumber protein AAC08528 (C3)

[0068] SEQ ID NO: 9 4 ^th AG LI 1-like ortholog in cucumber protein CU107465 (C4)

[0069] SEQ ID NO: 10 first AGLl 1-like ortholog in cucumber cDNA (CI).

[0070] SEQ ID NO: 11 2 ^nd AGLl 1 -like ortholog in cucumber cDNA (C2).

[0071] SEQ ID NO: 12 3 ^rd AGLl 1-like ortholog in cucumber cDNA (C3).

[0072] SEQ ID NO: 13 4 ^th AGLl 1-like ortholog in cucumber cDNA (C3).

[0073] SEQ ID NO: 14 first AGLl 1 -like ortholog in melon protein Mu43977 (Ml)

[0074] SEQ ID NO: 15 2 ^nd AGLl 1-like ortholog in melon protein Mu45645 (M2)

[0075] SEQ ID NO: 16 3 ^rd AGLl 1 -like ortholog in melon protein Mu50731 (M3)

[0076] SEQ ID NO: 17 4 ^th AGLl 1 -like ortholog in melon protein Mu48843 (M4)

[0077] SEQ ID NO: 18 first AGLl 1-like ortholog in melon cDNA (Ml).

[0078] SEQ ID NO: 19 2 ^nd AGLl 1-like ortholog in melon cDNA (M2).

[0079] SEQ ID NO: 20 intense promoter sequence (SEQ ID NO: 1 without SEQ ID NO: 2)

[0080] SEQ ID NO: 21 3 ^rd AGLl 1-like ortholog in melon cDNA (M3).

[0081] SEQ ID NO: 22 4 ^th AGLl 1-like ortholog in melon cDNA (M4).

[0082] SEQ ID NO: 23 first AGLl 1-like ortholog in cucumber genomic DNA (CI).

[0083] SEQ ID NO: 24 2 ^nd AGLl 1-like ortholog in cucumber genomic DNA (C2).

[0084] SEQ ID NO: 25 3 ^rd AGLl 1-like ortholog in cucumber genomic DNA (C3). 100851 SEQ ID NO: 26 4 ^th AGLl 1 -like ortholog in cucumber genomic DNA (C4).

1 086| SEQ ID NO: 27 Solarium lycopersicum wild type, fully functional, tomato AGLl 1 -like genomic DNA sequence (i.e. sequence as depicted in Figure 3), obtained from the same source as SEQ I D NO: 1.

[0087] SEQ ID NO: 28 Forward primer to detect intense phenotype in Solanum lycopersicum.

[0088] SEQ ID NO: 29: Reverse primer to detect intense phenotype in Solanum lycopersicum.

FIGURE LEGENDS

[0089] Figure 1 : Photograph of a cut-open tomato fruit having the intense phenotype (right) and a fruit having the normal fruit phenotype (left). [0090] Figure 2: Protein Tomato AGL l I -like sequence alignment with AGLl I -like orthologs in melon (Ml, M2, M3, M4) and cucumber (CI, C2, C3, C4).

[009 ! I Figure 3: Solanum lycopersicum wild type fully functional genomic DNA of AGLl l-like gene + promoter sequence, taken from the International Tomato Annotation Group (ITAG), official annotations on the SL2.40 genome build by the International Tomato Annotation Group (ITAG) (http://solgenomics.net/) Solgenomics web site, SL2.40ch06 36808000.. 36817500; Annotation is given between brackets [ ]. The deletion in the promoter causing the intense phenotype in tomato has been indicated (residue 1042 to (not including) 637) upstream of the ATG start codon. Exon 1-8 (in bold) and Intron 1-8 are indicated. The stop codon (TAG) starts 4 nucleic acids before the end of Exon 8.

[0092] Figure 4: Relative mRNA level of four AGLl 1 -like orthologs in different samples of cucumber plant

DETAILED DESCRIPTION OF THE INVENTION

1009 1 The present invention relates to a plant comprising a modified amount, activity or function of AGLl I -like protein or AGLl l-like protein ortholog, wherein the plant is a member of plant family

Cucurbitaceae or of species Solanum lycopersicum; characterized in that the plant is not a Solanum lycopersicum plant having a deletion from nucleotide 1042 to nucleotide 637 upstream of the AT start codon of SEQ ID NO: 1 (as indicated in Figure 3).

100941 In one aspect the invention relates to a plant comprising a modified amount, activity or function of AGLl 1 -like protein or ortholog, wherein the plant is a member of plant family

Cucurbitaceae or of species Solanum lycopersicum; characterized in that the plant is not a Solanum lycopersicum plant having a sequence identical to SEQ ID NO: 2 on chromosome 6.

[0095] In one aspect of the invention the plant is a non-transgenic plant, e.g. a plant obtainable by traditional breeding methods. [0096] i n another aspect of the invention the plant of the invention is a member of genus Cucumis or of species Solarium ly coper sicum. In yet another aspect the invention relates to the plant of species Solarium lycopersicum, Cucumis melo, or Cucumis sativus. In yet another aspect the invention relates to a plant of the species Solarium lycopersicum. In still another aspect the invention relates to a plant of the family Cucurbitaceae. In another aspect the plant is of the genus Cucumis. In still another aspect the plant is of the species Cucumis melo. In an even further aspect the plant is of the species Cucumis sativus.

[0097] In one aspect the plant of the invention is of species Solarium lycopersicum, Cucumis melo, or Cucumis sativus. [0098] Modifying the amount of AGLl I -l ike protein or AGLl i -iike protein ortholog in a plant can be an increased amount or a reduced (decreased) amount of (wild type; functional) AGLl l-like protein r ortholog when compared to normal plants comprising a normal fruit phenotype . The amount of a protein can be changed by mutation (e.g. additions, substitutions, or deletions of nucleic acids in the promoter sequence of a gene encoding an AGLl l-like protein r ortholog. Alternatively, mutations (e.g. additions, substitutions, or deletions) in the coding sequence of a protein may lead to non- functional or reduced- function protein. In one aspect of the invention, the modified amount is an increased amount. In another aspect the modified amount is a decreased amount. In yet a further aspect, the modified amount is an absence of the AGLl l -like protein or ortholog.

100991 A modified activity or function of the AGLl 1 -like protein or ortholog can be caused by one or more mutations in the amino acid sequence of the protein (compared to wild type AGLl l-like protein or AGLl l-like protein ortholog). Such mutations can have a natural cause (spontaneous) or can be induced via methods known in the art such as mutagenesis and identified by e.g. TILLING (vide infra).

In one aspect, plants of the invention are tomato, cucumber or melon mutant plants, especially TILLING mutants, which comprise and intense phenotype due to one or more mutations in the promoter or gene sequence of the endogenous AGLl 1 -like protein (or ortholog), said mutation(s) leading to a reduced amount of wild type AG L-l ike protein (or wild type ortholog) or to a reduced activity or function of the

AGLl l-like protein (or otholog).

[ 01 00] I n one aspect the invention relates to a plant of the invention wherein the modified amount, activity or function of AGLl l -like protein or ortholog can be determined during fruit formation. In a further aspect the modified amount, activity or function of AGLl I -like protein or ortholog in the plant of the invention can be determined during fruit formation in the fruit or flowers of the plant.

[0101] I n a further aspect fruits of the plant of the invention have an intense phenotype. In another aspect fruits of the plants of the invention hav e placenta tissue with a similar toughness as fruit flesh of the fruit. I n one aspect the toughness of the placenta tissue is at least 50% of the fruit flesh, in another at least 55%, in another at least 60%, in another at least 65%, in another at least 70%>, in another at least 75%, in another at least 80%>, in another at least 85%, in another at least 90%, in another at least 95%>, in another at least 98%.

[0102] Fruit tissue toughness can be measured for example using a penetrometer by measuring the force needed to punch a hole of a certain size through / or in the material. [0103] In one aspect the plant of the invention is homozygous for the allele causing the modified amount, activity or function of AGLl 1 -like protein or ortholog. In another embodiment the plant of the invention is heterozygous for the allele causing the modified amount, activity or function of AGLl 1 -like protein or ortholog. Crossing two inbred lines yields an Fl hybrid. Such an Fl hybrid can be homozygous or heterozygous depending on either one or both parents being homozygous for the allele causing the modified amount, activity or function of AGLl 1 -like protein or ortholog.

[0104] Commercial vegetable varieties often are hybrids obtained from a crossing of two inbred parental lines. In one aspect the plant of the invention is a Fl hybrid.

[0105] In another aspect the modified amount, activity or function of AGLl 1 -like protein or ortholog is due to one or more mutations in the gene sequence of AGLl I -like protein or AGLl 1 -like protein ortholog (i.e. the sequence encoding the protein) or in the promoter thereof.

[0106] In another aspect the modified amount, activity or function of AGLl 1 -l ike protein or ortholog is due to one or more mutations in the gene sequence of AGLl 1-like protein or ortholog (i.e. the sequence encoding the protein), in another aspect it is due to a mutation in the promoter of the gene sequence of AGLl 1 -like protein or ortholog. [0107] in one aspect the invention relates to a plant of the invention wherein the plant is of species Solarium lycopersicum and wherein the AGLl 1 -like protein has at least 75% amino acid sequence identity to SEQ I D NO: 3, e.g. at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%. Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 3. [0108] In another aspect the invention relates to a plant of the invention wherein the plant is of species Solarium lycopersicum and wherein the cDNA encoding the AGLl 1 -like protein has at least 75% nucleic acid sequence identity to SEQ I D NO: 4. e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0109] In another aspect the invention relates to a plant of the invention wherein the plant is of species Solarium lycopersicum and wherein the genomic D A encoding the AGLl I -like protein has at least 60% nucleic acid sequence identity to SEQ I D NO: 5, e.g at least 65%, or at least 70%, 75%, 80%, 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%) nucleic acid identity.

[0110] In a further aspect the invention relates to a plant of the invention wherein the plant is of species Solarium lycopersicum, and wherein the modified amount, activity or function of AGL l 1-like protein is due to one or more mutations in the promoter of the gene sequence of the AGLl 1-like protein, as depicted in SEQ I D NO: 1 , and wherein the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 or even the complete promoter as depicted in SEQ I D NO: 1 is missing.

|01 1 11 This invention is based on research performed on fruit phenotypes in tomato plants {Solarium lycopersicum) and the genetic cause(s) for such phenotypes. As orthologs of proteins in one plant have a similar function in other plants, this invention can be more generally applied in plants, in particular in crop plants that have fruits with gel-like fruit cavities. Examples of such plants are plants of family Cucurbitaceae like those of the genus cucumis, like for example Cucumis sativus and Cucumis melo.

[01 12] When the modification of the amount of AGLl 1 -like protein in a plant is to be achieved via genetic modification of the AGLl 1-like gene or via the identification of mutations in the AGLl 1-like gene, and the gene is not yet known, it must first be identified. This means that orthologs of the tomato AGLl I -like protein must be identified and optionally isolated in non-tomato plants.

[0113] Various methods are known in the art for the identification of orthologous sequences in other plant species. For example by designing primers based on the tomato AGLl 1 -like gene, based on conserved domains (which are common in MADS box proteins) as determined by multiple nucleotide sequence alignment, and used to PC R amplify the orthologous sequence. Such primers are suitably degenerate primers (e.g. as described in WO2008/092505).

[01 14| Another method to assess a given sequence as being a AGLl 1 -like ortholog is by identification of the reciprocal best hit. A candidate orthologous AGLl 1 -like sequence of a given plant species identified as the best hit from DNA databases (e.g. from NCBI or TAI R ) when searching with tomato AGLl 1 -like protein or nucleotide sequence. [0115] AGLl 1-like protein is encoded by a single gene in tomato. In the genome of cucumber

(Cucumis sativus) 4 orthologs have been identified, and in the genome of melon (Cucumis melo) also 4 orthologs have been identified. These orthologs were identified by nucleotide and amino acid comparisons with the information that is present in public databases (see examples). The alignment of these orthologous sequences (protein) are shown in Figure 2. T G L I 1 -like represents the Tomato AG L I 1 -like protein, M1 -M4 represent 4 ortholog sequences in melon (Cucumis melo), C1 -C4 represent 4 orthoiog sequences in cucumber (Cucumis sativus). It is noted that the consensus (last line) between the orthologs is largest in the first half of the proteins.

[0116] Alternatively, if no DNA sequence is available for the desired plant species, orthologous sequences can be isolated by heterologous hybridization using DNA probes of the AGL1 1 -like gene of Solarium lycopersicum or by PCR methods, making use of the conserved domains MADS box proteins in general (AGLl l -like protein is a MADS box protein).

|01 17] In one aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is a member of plant family Cucurbitaceae, and the AGL1 1 -like protein is an ortholog of the TAG L I 1 -like protein represented by SEQ I D NO: 3 (i.e. the AG 1. 1 I - like protein of tomato). In a further aspect the invention relates to a plant of the invention wherein the plant is a member of plant family Cucurbitaceae, and the AG L I 1 -like protein is an ortholog of the TAG 1. 1 1- like protein represented by SEQ ID NO: 3, wherein the ortholog comprises at least 40% amino acid sequence identity to SEQ I D NO: 3, e.g. at least 45%, 48%, 50%, 52%, 55%, or at least 60%, 65%, 70%, 75%, 80%, 85%, or even at least 90%, or at least 95%, or at least 99% amino acid identity to SEQ I D NO: 3 (using a pairwise alignment and the program Needle).

[0118] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 ! -like protein ortholog) wherein the plant is a member of species Cucumis sativus, and the

AGL1 1 -like protein is an ortholog of the TAGL 1 1 -l ike protein represented by SEQ I D NO: 3, wherein the ortholog comprises at least 40% amino acid sequence identity to SEQ I D NO: 3, e.g. at least 45%, 48%, 50%, 52%, 55%, or at least 60%, 65%, 70%, 75%, 80%, 85%, or even at least 90%, or at least 95%), or at least 99% amino acid identity. In one aspect the ortholog is a Cucumis sativus orthoiog comprising at least least 40% amino acid sequence identity to SEQ I D NO: 6, 7, 8 or 9, e.g. at least 45%, 48%, 50%, 52%, 55%, or at least 60%, 65%, 70%, 75%, 80%, 85%, or even at least 90%, or at least 95%), or at least 99% amino acid identity.

[0119] I n a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1 -like protein ortholog) wherein the plant is a member of species Cucumis melo, and the AGLl l - like protein is an ortholog of the TAGL 1 1 -like protein represented by SEQ I D NO: 3, and has at least 40% amino acid sequence identity to SEQ I D NO: 3, e.g. at least 45%, 48%, 50%, 52, 55%, or at least 60%, 65%, 70%, 75%, 80%, 85%, or even at least 90%, or at least 95%, or at least 99% amino acid identity. In one aspect the ortholog is a Cucumis melo ortholog comprising at least least 40%> amino acid sequence identity to SEQ I D NO: 14, 15, 16 or 17, e.g. at least 45%, 48%, 50%, 52%, 55%, or at least 60%, 65%, 70%, 75%, 80%, 85%, or even at least 90%, or at least 95%, or at least 99% amino acid identity.

[0120] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the AGL1 1 -l ike protein has at least 75% amino acid sequence identity to SEQ ID NO: 6, or SEQ I D NO: 7, or SEQ I D NO: 8, or SEQ I D NO: 9, e.g. at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% amino acid identity.

[0121] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- i ike protein ortholog) wherein the plant is of species Cucumis sativus and wherein the AGL1 1 -like protein has at least 75%> amino acid sequence identity to SEQ I D NO: 6, e.g. at least 80%o, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%). Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 6.

[0122] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- iike protein ortholog) wherein the plant is of species Cucumis sativus and wherein the AGLl 1 -like protein has at least 75%) amino acid sequence identity to SEQ I D NO: 7, e.g. at least 80%), or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%). Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 7.

[0123] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the AGLl 1 -like protein has at least 75%o amino acid sequence identity to SEQ I D NO: 8, e.g. at least 80%), or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%). Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 8. [0124] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the AGLl 1 -like protein has at least 75%> amino acid sequence identity to SEQ I D NO: 9, e.g. at least 80%), or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%. Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ ID NO: 9.

[0125] In one aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or in the gene sequence of the gene encoding the AGLl 1 -like protein as depicted in SEQ ID NO: 6, 7, 8, or 9 or encoding any one of the cucumber AG L l 1 -like orthologs above . In one aspect the one or more mutations in the gene sequence lead to a protein comprising one or more amino acid insertions, deletions or replacements compared to the protein of SEQ I D NO: 6,7,8 or 9 or compared to a AGLl 1 -like orthologous protein comprising at least 75%, 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% sequence identity to SEQ I D NO: 6,7,8 or 9.

[0126] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL l 1-like protein ortholog) wherein the plant is of species Cucumis sativus, and wherein the modified amount, activity o function of AGLl 1-like protein is due to one or more mutations in the promoter or in the gene sequence of the gene encoding the AGLl I -l ike protein, as depicted in SEQ I D NO: 6; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides.

[0127] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1-like protein ortholog) wherein the plant is of species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1-like protein is due to one or more mutations in the promoter or in the gene sequence of the gene encoding the AGL 1 1 -like protein, as depicted in SEQ I D NO: 7; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide, in yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides.

[0128] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1 -like protein ortholog) wherein the plant is of species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or in the gene sequence of the gene encoding the AGL 1 1 -like protein, as depicted in SEQ I D NO: 8; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides r even at least 450 or 500 nucleotides.

[0129] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous

AGLl 1-like protein ortholog) wherein the plant is of species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1-like protein is due to one or more mutations in the promoter or in the gene sequence of the gene encoding the AGL l ! -like protein, as depicted in SEQ ID NO: 9; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. I n yet another aspect said deletion is at least 2, or even at least 3. 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. I n still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides. j 01 0 j I n another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the cDNA encoding the AGLl I -like protein has at least 75% nucleic acid sequence identity to SEQ ID NO: 10, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0131] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1-like protein ortholog) wherein the plant is of the species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or in the gene sequence encoding the AGLl 1 -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ I NO: 10, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0132] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the cDNA encoding the AGLl 1-like protein has at least 75% nucleic acid sequence identity to SEQ I D NO: I 1 . e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0133] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1-like protein ortholog) wherein the plant is of the species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or in the gene sequence encoding the AGL l 1 -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ ID NO: 1 1, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[Θ134] In another aspect the invention relates to a plant of the invention (i.e. havin an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL11- 1 ike protein ortholog) wherein the plant is of species Cucumis sativus and wherein the cDNA encoding the AGLl 1-like protein has at least 75% nucleic acid sequence identity to SEQ I D NO: 12, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0135] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AC iL l 1-like protein ortholog) wherein the plant is of the species Cucumis sativus, and wherein the modified amount, activity or function of AGL I 1 -like protein is due to one or more mutations in the promoter or in the gene sequence encoding the AGLl 1-like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ I D NO: 12, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity. [Θ136] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the cDNA encoding the AGLl 1-like protein has at least 75% nucleic acid sequence identity to SEQ I D NO: 13, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0137] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1 -like protein ortholog) wherein the plant is of the species Cucumis sativus, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or in the gene sequence encoding the AGL 1 1 -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ I D NO: 13, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0138] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the genomic DNA encoding the AGLl 1 -like protein has at least 65% nucleic acid sequence identity to SEQ ID NO: 23, e.g at least 70%, 75% or 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity. [0139] in another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the genomic DNA encoding the AGLl 1 -like protein has at least 65%> nucleic acid sequence identity to SEQ I D NO: 24, e.g at least 70%, 75% or 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0140| In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- I ike protein ortholog) wherein the plant is of species Cucumis sativus and wherein the genomic DNA encoding the AGLl 1 -like protein has at least 65% nucleic acid sequence identity to SEQ I D NO: 25, e.g at least 70%, 75% or 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0141] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1- like protein ortholog) wherein the plant is of species Cucumis sativus and wherein the genomic DNA encoding the A L l 1 -like protein has at least 65% nucleic acid sequence identity to SEQ I D NO: 26. e.g at least 70%, 75% or 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

|0142| In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the AGLl 1 -like protein has at least 75% amino acid sequence identity to SEQ I D NO: 14, or SEQ I D NO: 15, or SEQ I D NO: 16, or SEQ I D NO: 17, e.g. at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% amino acid identity or encoding any one of the cucumber AGl. 1 ! - like orthologs above . In one aspect the one or more mutations in the gene sequence lead to a protein comprising one or more amino acid insertions, deletions or replacements compared to the protein of SEQ I D NO: 14,15,16 or 17 or compared to a AGLl 1-like orthologous protein comprising at least 75%, 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% sequence identity to SEQ I D NO: 14,15,16 or 17.

[0143] I n another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the AGLl 1 -like protein has at least 75% amino acid sequence identity to SEQ I D NO: 14, e.g. at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%. Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ ID NO: 14.

[0144] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl l- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the AGLl 1 -like protein has at least 75% amino acid sequence identity to SEQ I D NO: 15, e.g. at least 80%, or at least 85%>, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%. Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 1 .

|0145| In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL11- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the AGLl l-like protein has at least 75%o amino acid sequence identity to SEQ I D NO: 16, e.g. at least 80%, or at least 85%o, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%. Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 16. [0146] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl l- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the AGLl l-like protein has at least 75%o amino acid sequence identity to SEQ I D NO: 17, e.g. at least 80%, or at least 85%o, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%. Differences in sequence identity may be caused by one or more amino acid deletions, insertions or replacements compared to SEQ I D NO: 17.

[0147] In one aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl l- like protein ortholog) wherein the plant is of species Cucumis melo, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or the gene sequence of the gene encoding the AGLl 1 -like protein, as depicted in SEQ I D NO: 14, 1 5. 16, or 17.

[0148] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous A L l I -like protein ortholog) wherein the plant is of species Cucumis melo, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or the gene sequence of the gene encoding the AGLl I -like protein, as depicted in SEQ ID NO: 14; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250. 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides.

[0149] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1 -like protein ortholog) wherein the plant is of species Cucumis melo, and wherein the modified amount, activity or function of AGLl I -like protein is due to one or more mutations in the promoter or the gene sequence encoding the gene of the AGLl ! -like protein, as depicted in SEQ ID NO: 15; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides. [0150] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1 -like protein ortholog) wherein the plant is of species Cucumis melo, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or the gene sequence of the gene encoding the AGLl 1 -like protein, as depicted in SEQ ID NO: 16; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides.

[0151] In a further aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous

AGLl 1 -like protein ortholog) wherein the plant is of species Cucumis melo, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or the gene sequence of the gene encoding the AGLl 1 -like protein, as depicted in SEQ ID NO: 17; in another aspect the mutation is a deletion, insertion or nucleotide replacement. In yet another aspect said mutation is a deletion of at least 1 nucleotide. In yet another aspect said deletion is at least 2, or even at least 3, 5, 10, 20, 30, 40, 50, 80, 100, 150, 200, 250, 300, 350 nucleotides. In still another aspect said deletion is at least 400 nucleotides or even at least 450 or 500 nucleotides.

[0152] In another aspect the invention relates to a plan of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL11- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the cDNA encoding the AGLl I -like protein has at least 75% nucleic acid sequence identity to SEQ ID NO: 18, e.g at least 80%), or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0153] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 ! -like protein ortholog) wherein the plant is of the species Cucumis melo, and wherein the modified amount, activity or function of AGLl l -like protein is due to one r more mutations in the promoter or the gene sequence encoding the AGL l ! -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ ID NO: 18, e.g at least 80%>, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

|0154| In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl l- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the cDNA encoding the AGL1 1 -like protein has at least 75 %> nucleic acid sequence identity to SEQ ID NO: 19, e.g at least 80%o, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%> nucleic acid identity.

[0155] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGL1 1 -like protein ortholog) wherein the plant is of the species Cucumis melo, and wherein the modified amount, activity or function of AGL1 1 -like protein is due to one or more mutations in the promoter or the gene sequence encoding the AGL l I -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ I D NO: 19, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity. [0156] In another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl l- like protein ortholog) wherein the plant is of species Cucumis melo and wherein the cDNA encoding the AGLl 1 -like protein has at least 75% nucleic acid sequence identity to SEQ I D NO: 21, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9%o nucleic acid identity.

[0157] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1 -like protein ortholog) wherein the plant is of the species Cucumis melo, and wherein the modified amount, activity or function of AGLl l -like protein is due to one or more mutations in the promoter or the gene sequence encoding the AGLl 1 -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75% nucleic acid sequence identity to SEQ I D NO: 21, e.g at least 80%>, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0158] In another aspect the invention relates to a plant of the invention (i.e. havin an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1- 1 ike protein ortholog) wherein the plant is of species Cucumis melo and wherein the cDNA encoding the AGLl 1-like protein has at least 75 %> nucleic acid sequence identity to SEQ I D NO: 22, e.g at least 80%, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity. [0159] In yet another aspect the invention relates to a plant of the invention (i.e. having an intense fruit phenotype due to an altered, especially reduced, amount activity or function of the endogenous AGLl 1 -like protein ortholog) wherein the plant is of the species Cucumis melo, and wherein the modified amount, activity or function of AGLl 1 -like protein is due to one or more mutations in the promoter or the gene sequence encoding the AGLl 1 -like protein wherein the gene sequence encodes a cDNA, said cDNA has at least 75%o nucleic acid sequence identity to SEQ I D NO: 22, e.g at least 80%o, or at least 85%, 90%, 94%, 96%, 98%, 99%, or even at least 99.2%, or at least 99.4%, 99.6%, 99.8%, or at least 99.9% nucleic acid identity.

[0160] in one aspect, the one or more mutations in the AGLl 1 -like ortholog gene and/or promoter are human induced mutations. In a further aspect the gene, protein and/or promoter is isolated, i.e. is no longer in the natural environment from which it is isolated.In still another aspect the invention relates to seed from which a plant of the invention can be grown.

[0161] In one aspect the invention relates to a plant cell, tissue or plant part of the plant of the invention; in one embodiment the plant part is a seed. In another aspect the invention relates to a plant cell of the plant of the invention. In yet another aspect the invention relates to a non-propagating cell of a plant of the invention.

[01 2] In another aspect the invention relates to a plant cell, tissue or plant part of a seed from which a plant of the invention can be grown. In yet another aspect the invention relates to a non- propagating part of a seed from which a plant of the invention can be grown.

[0163] In one aspect the invention relates to a fruit from a plan of the invention. In another aspect the invention relates to a part of a fruit from a plant of the invention. In still another aspect the fruit from the plant of the invention has essentially no gel in the seed cavities. I n yet another aspect the fruit from the plant of the invention has an intense fruit phenotype.

[0164] The inventors of the current application surprisingly found that plants of species Solarium lycopersicum having a deletion in the promoter of the Tomato AGLl 1 -like gene sequence produced intense phenotype tomato fruits. This now allows for screening for mutant AGLl 1 -like protein or cDNA sequences or promoter sequences thereof. SEQ I D NO: 1 can be used as a marker to identify plants with a normal fruit phenotype.

|0165] SEQ I D NO: 2 and 20 can be used as a marker to identify tomato plants with an intense phenotype. When used as a marker, the complete sequence of SEQ I D NO: 2 or 20 can be used, or a part of the sequence. When a part of the sequence is used, the part must be long enough to prevent false positives when screening for occurrence of the sequence, the part should for example be at least 5 consecutive nucleic acids long, e.g. at least 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 1 5, 16, 20, 25, 30, 40, or 50 consecutive nucleic acids long. In one embodiment the sequence is at least 15 nucleic acids long. False positives can be prevented by verifying if the marker sequence occurs in tomato plants having a normal fruit phenotype.

[0166] In one aspect the invention relates to the use of SEQ I D NO: 1 or SEQ I D NO: 2 or SEQ I D NO: 20 or parts thereof as a marker for the identification of the intense phenotype in Solanum lycopersicum. In another aspect the invention relates to SEQ I D NO: 1 or parts thereof as a marker for the identification of the intense phenotype in Solanum lycopersicum. In another aspect the invention relates to SEQ I D NO: 2 or parts thereof as a marker for the identification of the intense phenotype in Solanum lycopersicum. In another aspect the invention relates to SEQ I D NO: 20 or parts thereof as a marker for the identification of the intense phenotype in Solanum lycopersicum. When using parts of SEQ I D NO:20 as a marker, especially those parts that do not occur as a consecutive sequence part in SEQ I D NO: 1 are of interest as they can be used to identify plants with intense fruit phenotype; e.g. parts that comprise both the A located 637 nucleotides before ATG start codon, and the A located 1043 nucleotides before the ATG start codon in Figure 3, can be used as a markers.

[0167] In a further aspect the invention relates to a process to identify Solanum lycopersicum plants having an intense fruit phenotype, said process comprising the use of SEQ I D NO: 1 , 2, or 20 or parts thereof.

[0168] In still a further aspect the invention relates to a method to identify Solanum lycopersicum plants having an normal fruit phenotype, said method comprising the use of SEQ I D NO: 2, or parts thereof. In this method the presence of SEQ I D NO: 2 is established to confirm normal fruit phenotype.

[0169] I n still another aspect the invention relates to a method of producing Solanum lycopersicum plants comprising step a) selecting a tomato plant using SEQ I D NO: 2 or parts thereof; or SEQ I D NO: 20 or parts thereof.

[0170] In another aspect the invention relates to a method for producing Solanum lycopersicum plants comprising an intense fruit phenotype comprising steps: a. selecting a tomato plant using SEQ I D NO: 2 or parts thereof; or SEQ I D NO: 20 or parts thereof; b. crossing said tomato plant with a second tomato plant; said second tomato plant optionally being selected using SEQ ID NO: 2 or parts thereof; or SEQ ID NO: 20 r parts thereof; and

c. optionally selecting progeny plants using SEQ ID NO: 2 or parts thereof; or SEQ ID NO: 20 or parts thereof. [0171] As indicated above, the intense fruit phenotype in Solanum lycopersicum is caused by a mutation on chromosome 6. Chromosome 6 is known to have many loci of relevance to tomato breeders (e.g. PCT/EP2013/055044) . Making plants with combinations of traits, the genes of which lying on one chromosome is a challenging task for plant breeders. Especially when no markers for the traits of interest are present, the breeder needs to grow full plants and determine if the desired phenotype is present in the plant. The current invention allows for a rapid screening of plants with an intense fruit phenotype already on young plants r seedling stage. This is especially useful when different loci need to be combined on chromosome 6.

[0172] The recessive allelic mutation old-gold-crimson (ogc) has a phenotype of deep red fruits that lack β-carotene and tawny orange flowers. The locus ogc previously was found to be on chromosome 6 of the tomato linkage map (Ronen et al, FN AS 2000, vol 97 pp 11102-11107).

[0173] Tomato powdery mildew caused by Oidium neolycopersici isa globally important disease of tomato (Lycopersicon esculentum). Bai et al described an integrated genetic map showing that all the dominant resistance genes (Ol-l, 01-3, 01-4, 01-5, and 01-6) are located on tomato chromosome 6 (Bai et al 2005 Molecular Plant-Microbe Interactions vol 18, pp354-362). [0174] In another aspect the invention relates to a method for producing Solanum lycopersicum plants comprising an intense fruit phenotype and having the ogc phenotype comprising steps: a. providing a tomato plant comprising at least one recombinant chromosome 6 having the intense allele and the ogc allele as found in seeds deposited under accession number NCIMB 42161 or a recombinant chromosome 6 obtained (or derived) therefrom;

b. crossing said tomato plant with a second tomato plant; and

c. optionally selecting progeny plants.

In yet another aspect the invention relates to a plant obtainable by this method.

[0175] In another aspect the invention relates to a method for producing Solanum lycopersicum plants comprising an intense fruit phenotype and having the ogc phenotype and resistance to powderey mildew comprising steps: a. providing a tomato plant comprising at least one recombinant chromosome 6 having the intense allele, the ogc allele and 01-6 allele as found in seeds deposited under accession number NCIMB 42162 or a recombinant chromosome 6 obtained (or derived) therefrom; b. crossing said tomato plant with a second tomato plant; and

c. optionally selecting progeny plants.

In yet another aspect the invention relates to a plant obtainable by this method.

10176 j In another aspect the invention relates to a method for producing Solarium lycopersicum plants comprising an intense fruit phenotype and having the ogc phenotype comprising steps: a. providing a tomato plant comprising at least one recombinant chromosome 6 having the intense allele and the ogc allele as found in seeds deposited under accession number NCI MB 42161 or NCIMB 42162 or a recombinant chromosome 6 obtained (or derived) from either of these two deposited lines; b. crossing said tomato plant with a second tomato plant; and

c. optionally selecting progeny plants. in yet another aspect the invention relates to a plant obtainable by this method.

|0177|

[0178] In still another aspect the invention relates to a cultivated plant of the species Solanum lycopersicum comprising an intense fruit phenotype and ogc phenotype. [0179] In yet another aspect the invention relates to a cultivated plant of the species Solanum lycopersicum comprising an intense fruit phenotype, ogc phenotype and powdery mildew resistance.

[0180] In one aspect the invention relates to a tomato plant obtainable by crossing a plant of the invention e.g. as deposited under accession number NCIMB 42161 or NCIMB 42 ! 62 with another tomato plant. [01811 In one aspect the invention relates to a Solanum lycopersicum plant comprising a recombinant chromosome 6 comprising SEQ ID NO: 20 and allele conferring ogc and / or powdery mildew resistance. In another aspect the invention relates to a Solanum lycopersicum plant comprising a recombinant chromosome 6 comprising SEQ I D NO: 20 and allele conferring ogc and / or an 01-6 allele conferring resistance against powdery mildew. [0182] In another aspect the invention relates to a method of producing plants comprising: a. providing a plant according to the invention;

b. crossing and / or selfing said plant with another plant;

c. collect seed of the crossing or selfing;

d. optionally selecting progeny plants. [0183] In yet another aspect this method is a method to produce Solanum lycopersicum plants and at least one of the plants of step a or b is comprises the recombinant chromosome 6 as found in seeds deposited under NCIMB 42161 or NCI M B 42162 r a recombinant chromosome 6 obtained (or derived) therefrom. I n still another aspect the invention relates to seeds or plants obtained by using this method.

|0 I 84| In one aspect of the invention the recombinant chromosome (e.g. chromosome 6 in Solarium lycopersicum or a chromosome comprising the AGL1 1 -like ortholog sequence ) is a human induced recombinant chromosome.

|01851 Fruits harvested from a plant of the invention are also an embodiment. Such fruits thus have an intense phenotype. In one aspect such fruits are tomato fruits comprising a recombinant chromosome 6 according to the invention. The tomato fruits may be of any color (yellow, pink, red, orange, white, purple, black, multicolored, striped, etc.), shape (round, oblong, elongated, pear, etc.) and size (cherry, micro, mini, beefsteak, grape, slicing or globe, plum, pear, etc.). The fruits may be bi-loculate r multi- loculate types. The fruits may be suitable for fresh markets or processing. As the fruits have an intense phenotype, they are particularly suited for sandwiches and salads. Also included are food- or feed products comprising fruits or parts of fruits according to the invention, such as diced fruits, sliced fruits, chopped, fruits, dried fruits, processed fruits (tomato paste, puree, soups, juice, sauces, ketchup, etc.), canned fruits, etc.

[0186] In one embodiment the invention relates to a method of identifying a mutant of AGL1 1 -like protein or orthologs thereof comprising the steps of: i. taking a sample from a plant of the invention (e.g. a Solanum lycopersicum or Cucurbiteae plant; ii. determine the gene sequence of the AGL1 1 -like protein or ortholog thereof; and or the promoter of said gene sequence;

iii. optionally compare the sequence of step b) with a reference sequence. Such reference sequence for Solanum lycopersicum can be a sequence as represented by SEQ ID NO: 1 , 2, 4, 5, 20, or parts thereof; for Cucumis sativus can be a sequence as represented by SEQ I D NO: 10, 1 1 , 12, 13, or parts thereof; for Cucumis melo can be a sequence as represented by SEQ I D NO: 18, 19, 21 , 22, or parts thereof. In another embodiment, such reference sequence can be selected from the group consisting of SEQ I D NO: 2, 5, 20, 10, 1 1, 12, 13 18, 19, 21 , and 22; or parts thereof, in yet another embodiment, the method comprises a further step iv) of determine if the fruits of the plant of step i) have an intense fruit phenotype.

[0187] Accessions of wild tomato relatives, such as accessions obtainable from the TGRC (Tomato Genetic Resource Center) or other seed collections, can be screened for powdery mildew resistance using phenotypic and/or 01-6 markers assays, and/or OI-6 ortholog marker assays. These wild accessions can also be screened for ogc phenotype using phenotypic assays. Accessions of interest (having resistance and / or ogc phenotype) can be crossed with a Solanum lycopersicum plant comprising an intense allele in heterozygous or homozygous form. The F2 generation (or further generation, such as the F3 or a backcross generation) can then be screened for recombinant plants having the combination of intense fruit phenotype and ogc phenotype and optionally powdery mildew resistance. This combination will only be found if the Solanum lycopersicum chromosome 6 (comprising the intense allele) has recombined with the chromosome 6 comprising the ogc and/or Oi-6 allele.

[0188] In one embodiment a tomato plant is provided which comprises two homologous recombinant chromosomes 6, each with the intense and ogc allele; or in another embodiment each with the intense , ogc and 01-6 allele, in one embodiment the two homologous recombinant chromosomes 6 are identical, whereby the introgression fragments are of the same size and origin and comprise the same intense and ogc allele and optionally the same Oi-6 resistance conferring allele. A tomato plant with such identical chromosomes can be generated by selfing and selecting homozygous progeny plants. In another embodiment the two homologous recombinant chromosomes may be different, e.g. one may comprise a shorter introgression fragment than the other.

[0189] I n an embodiment the plants of the invention are Fl hybrids, produced by crossing two parent plants, PI and P2 each being homozygous for chromosomes 6.

[0190] Tomato plants having the intense phenotype and the ogc phenotype can be generated by crossing a tomato plant (Solanum lycopersicum) comprising the intense allele or, preferably, comprising the intense phenotype (i.e. homozygous for the intense allele); with a plant comprising ogc phenotype (i.e. comprising ogc allele on chromosome 6) and selecting recombinant plants in the progeny generations which have both the intense and ogc phenotype. Plants with both the intense and ogc phenotype can be crossed with a plant comprising powdery mildew resistance (i.e. comprising 01-6 allele on chromosome 6, preferably in homozygous form); and selecting recombinant plants in the progeny generations which have both the intense and ogc phenotype and are powdery mildew resistant.

[0191] Plants having the intense phenotype are commercially available, e.g. varieties sold by Nunhems B.V. under the trade name Intense™ . The phenotype is easily recognized and selected for by allowing mature tomato fruits to develop, cutting these in hal and visually determining whether the phenotype is "intense" or "normal", i.e. essentially without gel in the seed cavities or with gel in the seed cavities of the fruit, as seen e.g. in Figure 1 (the right fruit has the "intense phenotype" and left fruit has a "normal phenotype", i.e. a non-intense phenotype). Alternatively, plants with intense fruit phenotype can be selected using (part of ) SEQ ID NO: 2 or 20. It is noted that the development of air- cavities ("puffy" fruit) can also develop in intense fruits. Puffy-ness is a problem caused by factors affecting fruit set (such as temperature). Yet, the intense fruit will be equally easy be distinguishable from the normal fruit phenotype, as no locular gel is present. "Essentially no gel" or "essentially without gel" in the seed cavities means in one aspect that the tomato fruits comprise on average seed cavities with at least 98% fleshy tissue and at most 2% gel, more preferably at least 99% fleshy tissue and at most 1 % locular gel, most preferably 100% fleshy tissue and no locular gel. [0192] Plants with powdery mildew resistance conferred by the 01-6 allele are commercially available e.g. variety Foose sold by Syngenta. The phenotype is easily recognized and selected for using the 01-6 resistance test as described herein. Alternatively, molecular markers can be generated for this allele to identify the allele in young plants. [0193] Plants comprising ogc phenotype are commercially available. Alternatively, plants comprising ogc phenotype can be wild relatives of tomato, or preferably Solarium lycopersicum plants comprising an introgression fragment on chromosome 6 from such a wild relative of tomato.

[0194] Thus, after a cross has been made between a tomato plant having an intense phenotype and a tomato plant havin a ogc phenotype conferred by an introgession fragment on chromosome 6, a large number of progeny needs to be screened in order to identify the very rare recombinant plant, having both the intense phenotype and the ogc phenotype. It is understood that appropriate control plants are preferably included in any such test (field or greenhouse), such as S. lycopersicum plants having an intense fruit phenotype, plants having a normal fruit phenotype (e.g. cv Moneymaker), plants with ogc phenotype and 'normal" plants (such as cv Moneymaker). [0195] It is known in the art that to observe a recessive trait phenotype, like ogc or intense, one must generate a F2 population in order to be able to observe the phenotype, as two copies of the recessive allele need to be present in the plant of interest.

[0196] Progeny plants can, for example, be of the F2, F3, F4, BC1 , BC2, BC1 S1, BC1 S2, etc. generations. As mentioned above, the intense phenotype is screened by visual assessment of the mature fruits or using SEQ ID NO: 1, 2 or 20 or parts thereof.

[0197] Once a progeny plant has been identified which comprises both the intense fruit phenotype and ogc phenotype, this plant is selected for further analysis and use, for example to generate tomato plants comprising ntense fruit phenotype and ogc phenotype and powdery mildew resistance. A tomato plant having the intense phenotype and ogc phenotype can only arise through a rare chromosome cross- over event of homologous chromosomes 6, in between the intense locus and the ogc locus. Without such a rare recombination event, plants have either an intense phenotype, but have non-ogc phenotype (normal skin), or have a normal fruit phenotype and have ogc phenotype.

[0198] A combination of 3 different traits, all with alleles on tomato chromosome 6, e.g. intense, ogc, and 01-6, can be made by first generating a plant with an intense and ogc phenotype after crossing this plant with another plant having the 01-6 allele of interest the progeny of this cross can be screened for the desired combination of 3 traits. Alternatively, one can start by making the combination of intense with 01-6 and add ogc afterwards, or first make the an 01-6 and ogc phenotype combination after which this can be crossed with another plant having the intense phenotype. [0199] "About 25% of plants" and "about 50% of plants" is well understood by the skilled person having knowledge of genetics and heredity as referring to Mendelian segregation of a certain characteristic. In a population of 1000 plants segregating for a certain characteristic in a 1 :2: 1 ratio, i.e. about 25%o : about 50% : about 25% of plants, it is understood that it is not necessary that exactly 250, 500 and 250 plants have the described phenotypes or genotype, but that statistically about 25%, 50% and 25% are of the mentioned phenotypes or genotypes.

10200] in one embodiment marker analysis involves extracting ON A from plant tissue of a plant comprising an intense fruit phenotype, using said DNA as template in a PG R reaction with primer pairs suitable to show the deletion of SEQ ID NO: 2 in the wild type tomato promoter sequence (of SEQ ID NO: 1), restriction of the amplified DNA with a restriction enzyme, separating the digested DNA fragments on an agarose gel and visualizing the digested fragments under UV light (as known in the art, e.g. as described by Verlaan et al. 201 1, Plant Journal 68: 1093-1 103). One or more of these markers can thus be used to determine whether the tomato plant comprises the deletion in the promoter sequence of TAGL1 1 -like allele, in order to confirm the presence of the introgression fragment in recombinant plants and optionally the size of the introgression fragment. Obviously, markers can be developed using methods known in the art.

[0201 ] The markers can also be used to transfer a recombinant chromosome 6 (from e.g. a plant having an intense and ogc phenotype and optionally powdery mildew resistance) into progeny plants, i.e. to select progeny plants for the presence / retention of the recombinant chromosome 6. The markers, or alternative markers, can thus be easily used in breeding, in order to select plants having a recombinant chromosome 6 according to the invention. However, as already mentioned, phenotypic selection of the phenotype and resistance profile of interest can equally or additionally be used.

10202] In one embodiment the plant of the invention is a transgenic plant comprising a modified amount, activity or function of AG LI I -like protein, wherein the plant is a member of plant family Cucurbitaceae or of species Solanum lycopersicum. In another embodiment the transgenic plant is characterized in that the plant is not a Solanum lycopersicum plant having a deletion from nucleotide 1042 to nucleotide 637 of SEQ I D NO: 1 , counting the A of the ATG start codon as nucleotide 1 (see Figure 3).

1020 1 In a further embodiment, seeds and containers comprising seeds from which plants according to the invention can be grown are provided.

[0204] Also plants grown from said seeds and having an intense fruit phenotype are provided. The plants may be determinate or indeterminate or semi-determinate. The intense phenotype according to the invention can easily be introduced into any plant of the same species by crossing and phenotypic and/or marker selection. The intense phenotype can thus be combined with other genes and genomes of S. lycopersicum or Cucurbitaea. For example, other disease or insect resistance genes, genes for fruit quality characteristics, fruit size, plant or fruit uniformity, plant size, flowering characteristics, fruit shape, taste, stress tolerance, fruit texture, fruit lycopene, beta-carotene or vitamin content, total soluble solids content (brix), long shelf life, etc.

[0205] in one embodiment the plant of the invention is a cultivated tomato of the species S.

lycopersicum, i.e. a line or variety yielding high yields, such as fruit of at least 40 or 50 g average fresh weight or more, e.g. at least about 80g, 90g, lOOg, 120g, 150 g, 200g, 250g, 300g, or even up to 600 g (beef tomato types). However, also small types, such as cherry or cocktail tomato are encompassed (having e.g. fruit weights of 30 g or less, such as 25g, 15 g, 1 2g or less). The fruits may be Roma type, cluster type, round, etc. It may be a processing type tomato or a fresh market type. Also both open pollinated and hybrids are encompassed herein. In one embodiment the tomato plant is an Fl hybrid plant, grown from an Fl hybrid seed. In another embodiment the tomato plant is an inbred parent line, suitable as a parent in Fl hybrid seed production. In one embodiment the tomato plant comprises only one recombinant chromosome 6 according to the invention, while in another embodiment the tomato plant comprises two recombinant chromosomes 6 (which may be identical chromosomes or different). The tomato plant may also be a double haploid plan ( DH ). produced from a cell- or tissue culture of a plant according to the invention, whereby the DH plant comprises two identical recombinant chromosomes 6 of the invention.

[0206] Also vegetatively propagated plants are encompassed herein, for example plants produced from cuttings of a tomato (or melon or cucumber) plant of the invention. Tomato plants are easily vegetatively propagated by taking cuttings, allowing these to develop roots and growing a whole plant. The vegetatively propagated plant is genetically identical to the plant part (cutting) which was used to start with.

[0207] In a further aspect a method of introducing a desired trait into a plant of the invention is provided, said method comprising: (a) crossing a plant of the invention with another tomato plant that comprises one or more desired traits, to produce Fl progeny plants; (b) optionally seifing the F l progeny plants one or more times to produce an F2, or F3, or further generation progeny plants; (c) selecting from said progeny plants those plants that have the intense fruit phenotype and the desired trait; (d) optionally, backcrossing the selected progeny plants with the parent plant of a) to produce backcross progeny plants; (e) optionally, selecting for backcross progeny plants that have the intense phenotype and the desired trait; (f) optionally, repeating steps (d) and (e) one, two or more times in succession to produce selected third or higher backcross progeny plants; (g) optionally, selfing selected backcross progeny in order to identify homozygous plants comprising the intense phenotype and the desired trait; (h) optionally, crossing at least one of said backcross progeny or selfed plants with another parent plant to generate a hybrid variety with the desired trait and an intense phenotype. The desired trait may be any trait, but is in one embodiment a trait not located the same chromosome as the intense allele (i.e. chromosome 6 in tomato). T e desired trait may be a trait conferring any of the characteristics mentioned further above, such as high brix, disease or insect resistance, fruit shape, color, plant size, flowering characteristics, herbicide resistance, etc. The desired trait may also be a transgenic trait, conferred by a transgene, such as a transgene encoding a Bacillus thuringiensis endotoxin or part thereof, a transgene conferring herbicide resistance (against e.g. glufosinate, glyphosate, imidazolinone, triazine, sulfonylurea), etc.

[0208] A tomato plant comprising a recombinant chromosome 6 obtainable from seed deposited under Accession number NCIMB 42161 or NCIMB 42612 is also encompassed herein as is the recombinant chromosome 6 as such and its use in generating tomato plants having intense fruit phenotype. 1020 1 Also provided is a tomato plant, or part thereof, a representative sample of seeds of which having been deposited under Accession Number NCIMB 42162 or NCIMB 42162.

[0210] Also provided is a tomato seed, a representative sample of seeds having been deposited under Accession Number NCIMB 42161 or NCIMB 42612 and a plant, or a part thereof, produced by growing the seed. In another aspect a progeny plant of tomato variety deposited under Accession Number NCIMB 42161 or NCIMB 42 162 is provided, obtained by further breeding with said variety, wherein said progeny plant has essentially all physiological and morphological characteristics of the tomato variety (of which seeds have been deposited under NCIMB 42161 or NCIMB 42612) when grown under the same environmental conditions.

[0211] In yet a further embodiment a transgenic plant (or plant seed, plant cell, plant part) is provided comprising a modified amount, activity or function of AGL11 -like protein, wherein the plant is a member of plant family Cucurbitaceae or of species Solanum lycopersicum; characterized in that the plant is not a Solanum lycopersicum plant having a deletion from nucleotide 1042 to nucleotide 637 upstream of the ATG start codon of SEQ I D NO: 1 (see Figure 3).

[0212] TILLING (Targeting Induced Local Lesions IN Genomes) is a general reverse genetics technique that uses traditional chemical mutagenesis methods to create libraries of mutagenized individuals that are later subjected to high throughput screens for the discovery of mutations. TILLING combines chemical mutagenesis with mutation screens of pooled PCR products, resulting in the isolation of missense and non-sense mutant alleles of the targeted genes. Thus, TILLING uses traditional chemical mutagenesis (e.g. EMS or MNU mutagenesis) or other mutagenesis methods (e.g. radiation such as UV) followed by high-throughput screening for mutations in specific target genes, such as AGL11-like according to the invention. SI nucleases, such as CEL. 1 or EN IX) ! , are used to cleave heteroduplexes of mutant and wild type target ON A and detection of cleavage products using e.g.

electrophoresis such as a LI-COR gel analyzer system, see e.g. Henikoff et al. Plant Physiology 2004, 135: 630-636. TILLING has been applied in many plant species, such as tomato, (see

http://tilling.ucdavis.edu/index.php/Tomato Tilling ), rice (Till et al. 2007, BMC Plant Biol 7: 19), Arabidopsis (Till et al. 2006, Methods Mol Biol 323 : 127-35),-Brassica, mai/e (Till et al. 2004, BMC Plant Biol 4: 12), etc. Also EcoTILLING, whereby mutants in natural populations are detected, has been widely used, see Till et al. 2006 (Nat Protoc 1 : 2465-77) and Comai et al. 2004 (Plant J 37: 778-86).

[0213] In one embodiment of the invention (cDNA or genomic) nucleic acid sequences encoding such mutant AGL1 1-iike proteins comprise one or more non-sense and/or missense mutations, e.g. transitions (replacement of purine with another purine (A *→ G) or pyrimidine with another pyrimidine (C <→ T)) or transversions (replacement of purine with pyrimidine, or vice versa (C/'T <- A/G). In one embodiment the non-sense and/or missense mutation(s) is/are in the nucleotide sequence encoding any of the Myb 1 2 exons, or an essentially similar domain of a variant AGL11 -iike protein, i.e. in a domain comprising at least 80%, 90%, 95%, 98%>, 99% amino acid sequence identity to amino acids of SEQ ID NO: 3 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ ID NO: 6 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ ID NO: 7 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ ID NO: 8 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ I D NO: 8 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ I D NO: 14 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ I D NO: 15 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ I D NO: 16 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ I D NO: 3 or at least 80%, 90%, 95%, 98%, 99% amino acid sequence identity to amino acids of SEQ I D NO: 17.

[0214] In one embodiment an aglll-like nucleotide sequence comprising one or more non-sense and/or missense mutations in one of the exon- encoding sequence are provided, as well as a plant comprising such a mutant allele resulting in intense fruit phenotype.

|0215| In a specific embodiment of the invention plants and plant parts (fruits, seeds, etc.) comprising a mutant loss-of-function or reduced- function aglll-like allele according to the invention are provided.

[0216] Also provided are nucleic acid sequences (genomic DNA, cDNA, RNA) encoding loss-of- function agl 1 1 -like protein or reduced- function agl I I -like proteins. Due to the degeneracy of the genetic code various nucleic acid sequences may encode the same amino acid sequence. [0217] It is understood that when sequences are depicted as DNA sequences while RNA is referred to, the actual base sequence of the RNA molecule is identical with the difference that thymine (T) is replace by uracil (U). When referring herein to nucleotide sequences (e.g DNA or RNA) italics are used, e.g. myb 12 allele, while when referring to proteins, no italics are used, e.g. myb 12 protein. Mutants are in small letters (e.g aglll-like allele or agl 1 1 -like protein), while wild type / functional forms start with a capital letter (Aglll-like allele or Agl ! I -like protein). [0218] Also provided are nucleic acid sequences (genomic DNA, cDNA, RNA) encoding mutant agll I -like proteins, i.e. loss-of-function agl 1 1 -like protein or reduced function agl 1 1 -like proteins, as described above, and plants and plant parts comprising such mutant sequences. For example, aglll-like nucleic acid sequences comprising one or more non-sense and/or missense mutations in the wild type Aglll-like coding sequence, rendering the encoded protein having a loss-of-function or reduced function in vivo. Also sequences with other mutations are provided, such as splice-site mutants, i.e. mutations in the genomic aglll-like sequence leading to aberrant splicing of the pre-mRNA, and/or frame-shift mutations, and/or insertions (e.g. transposon insertions) and/or deletions of one or more nucleic acids.

|0219| Also included arc variants and fragments οϊ agll 1 -like nucleic acid sequences, such as nucleic acid sequences hybridizing to AGLll-like nucleic acid sequences, e.g. to SEQ ID NO: 4, 10, 1 1 , 12, 13, 18, 19, 2 1 , or 22 under stringent hybridizat ion condit ions as defined. Variants of AGLll-like nucleic acid sequences also include nucleic acid sequences which have a sequence ident ity to S EQ I D NO: 4, 10, 1 1, 12, 1 3, 18, 19, 2 1 , or 22 of at least 50% or more, preferably at least 55%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% or more (as determined by Emboss "needle ^" using default parameters, i.e. gap creation penalty = 10, gap extension penalty = 0.5, scoring matrix nwsgapdna ).

[0220] It is clear that many methods can be used to identify, synthesise or isolate variants or fragments of aglll-like nucleic acid sequences, such as nucleic acid hybridization, PCR technology, in silico analysis and nucleic acid synthesis, and the like. Variants of SEQ ID NO: 4, 10,. 11 , 12, 13, 18, 19, 21 , or 22, may either encode wild type, functional Agll l -like proteins, or they may encode loss-of- function agl 1 1 -like protein or reduced- function mutant alleles of any of these, as for example generated e.g. by mutagenesis and/or identified by methods such as TILLING or EcoTILLING, or other methods. j 0221 J A plant of the invention can be used in a conventional plant breeding scheme to produce more plants with the same characteristics or to introduce the mutated aglll-like allele into other plant lines or varieties of the same or related plant species.

10222] in another embodiment, the plant comprising the mutant aglll-like allele (e.g. tomato) is crossed with another plant of the same species or of a closely related species, to generate a hybrid plant ( or hybrid seed) comprising the mutant aglll-like allele. Such a hybrid plant is also an embodiment of the invention. j 0223 J Also a method for transferring traits from a plant of the invention to another plant is provided, comprising providing a plant of the invention, crossing said plant with another plant and obtaining the seeds of said cross. Optionally plants obtained from these seeds may be further selfed and/or crossed and progeny selected comprising the desired trait. [0224] As mentioned, it is understood that other mutagenesis and/or selection methods may equally be used to generate mutant plants according to the invention. Seeds may for example be radiated or chemically treated to generate mutant populations. Also direct gene sequencing of aglll-like may be used to screen mutagenized plant populations for mutant alleles. For example Key Point screening is a sequence based method which can be used to identify plants comprising mutant mybl2 alleles (Rigola et al. PloS One, March 2009, Vol 4(3):e4761).

[0225] Thus, non-transgenic mutant plant comprising a modified amount, activity or function of AGLl 1 -like protein, wherein the plant is a member of plant family Cucurbitaceae or of species Solarium lycopersicum; characterized in that the plant is not a Solarium lycopersicum plant having a deletion from nucleotide 1042 to nucleotide 637 upstream of the ATG start codon of SEQ ID NO: 1 (See also Figure 3) are provided. These mutants may be generated by mutagenesis methods, such as TILLING or variants thereof, or they may be identified by EcoTILLING or by any other method. Aglll-like alleles encoding loss-of-function Agl 1 1 -like protein or reduced- functional Agl 1 ! -l ike protein may be isolated and sequenced or may be transferred to other plants by traditional breeding methods. [0226] An aspect of the invention is a method of producing a plant of the invention comprising the steps of:

a. obtaining plant material, preferably seeds, of a plant of the invention;

b. treating said plant material with a mutagen to create mutagenized plant material, e.g. mutagenized seeds;

c. grow plants from the mutated seed or part of step b.

[0227] Said mutagenized plant material, e.g. the mutagenized seeds or progeny thereof obtained by selflng, may be analysed to identify a plants producing a modified amount, activity or function of AGLl 1 -like protein. The method may further comprise analyzing the fruit flesh of the selected plant or progeny of the plant and selecting a plant of which the fruits have intense fruit phenotype. In this method, the plant material of step a) is preferably selected from the group consisting of seeds, pollen, plant cells, or plant tissue of a tomato or Cucurbiteae plant line or cultivar. Plant seeds being more preferred. In another aspect, the mutagen used in this method is ethyl methanesulfonate. In step b) and step c) the mutagenized plant material is preferably a mutant population, such as a TILLING population. Optionally the method may comprise a further step d. to determine the gene sequence encoding an AGLl 1 -like protein or the promoter sequence of said gene. Said step d. may be followed by step e. of comparing the determined sequence obtained in step d. with a reference sequence such as for Solanum lycopersicum as represented by SEQ ID NO: 1 , 2, 4, 5, 20, or parts thereof; for Cucumis sativus as represented by SEQ I D NO: 10, 1 1 , 12, 13, or parts thereof; for Cucumis melo as represented by SEQ I D NO: 18, 19, 21 , 22, or parts thereof. In another embodiment, such reference sequence can be selected from the group consisting of SEQ I D NO: 2, 5, 20, 10, 1 1 , 12, 13 18, 19, 21 , and 22; or parts thereof. In yet another embodiment, the method comprises a further step f) to determine if the fruits of the plant of step c) have an intense fruit phenotype (optional step f) may be included with or without steps d) or [d) and e)].

[0228] Thus, in one aspect a method for producing a plant comprising a modified amount, activity or function of At rL I ! -like protein is provided comprising the steps of: a. providing a tomato TILLING population, b. screening said TILLING population for mutants in the aglll-like gene, and c. selecting from the mutant plants of b) those plants (or progeny of those plants) of which the fruits have intense fruit phenotype.

|022 | Mutant plants (Ml) are preferably selfed one or more times to generate for example M2 populations or preferably M3 or M4 populations for phenotyping in step c). in M2 populations the mutant allele is present in a ratio of 1 (homozygous for mutant allele) : 2 (heterozygous for mutant allele): 1 (homozygous for wild type allele).

[0230] In yet a further aspect the invention relates to a method for producing a hybrid plant, said method comprising: i) obtaining a first plant of the invention or from a seed from which a plant of the invention can be grown; and ii) crossing said first plant with a second plant to obtain hybrid seeds wherein said hybrid plant comprises a modified amount, activity or function of AGL11 -like protein, wherein the plant is a member of plant family Cucurbitaceae or of species Solanum lycopersicum.

[0231] Plants and plant parts (e.g. fruits, cells, etc.) of the invention can be homozygous or heterozygous for the mutant allele. [0232] Other putative AGL ! 1 -like genes/proteins can be identified in silico, e.g. by identifying nucleic acid or protein sequences in existing nucleic acid or protein database (e.g. GENBANK, SWiSSPROT. TrEMBL) and using standard sequence analysis software, such as sequence similarity search tools ( B1.ASTN, BLASTP, BLASTX, T I. A ST. FA ST A, etc.).

Seed Deposits 102331 A representative sample of seeds of two tomato variety comprising a recombinant chromosome 6 were deposited by Nunhems B.V. on September 10, 2013 at the NCIMB Ltd. (Ferguson Building, Craibstone Estate, Bu ks burn Aberdeen, Scotland AB21 9YA, UK) according to the Budapest Treaty, under the Expert Solution (EPC 2000, Rule 32(1)). Seeds were given the following deposit numbers: NCIMB 42161 : Solanum lycopersicum with intense and ogc phenotype

NCIMB 421 62 : Solanum lycopersicum with intense and ogc phenotype and 01-6 resistance. [0234] The Applicant requests that samples of the biological material and any material derived therefrom be only released to a designated Expert in accordance with Rule 32(1) EPC or related legislation of countries or treaties having similar rules and regulation, until the mention of the grant of the patent, or for 20 years from the date of filing if the application is refused, withdrawn or deemed to be withdrawn.

[Θ235] Access to the deposit will be available during the pendency of this application to persons determined by the Director of the U.S. Patent Office to be entitled thereto upon request. Subject to 37 C.F.R. § 1.808(b), all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent. The deposit will be maintained for a period of 30 years, or 5 years after the most recent request, or for the enforceable life of the patent whichever is longer, and will be replaced if it ever becomes nonviable during that period. Applicant does not waive any rights granted under this patent on this application or under the Plant Variety Protection Act (7 USC 2321 et seq.).

EXAMPLES

Analysis of ogc fruit phenotype

[0236] The "ogc phenotype" or "ogc fruit phenotype" is the phenotype conferred by the presence of two recessive Solanum lycopersicum ogc alleles in the genome. Its presence was determined visually by analysing ripe tomato fruits by cutting the ripe tomato fruit into two halves and determining the tomato flesh colour; omparing the colour to a normal fruit type like e.g. Heinz or Moneymaker. Ogc phenotype has deep red flesh colour (red towards purple red) while a normal tomato has a less red flesh colour (red towards yellow-red). Pericarp of a normal tomato sometimes even has a white or green-white colour. |0237| Fruit flesh was exposed for measurement by cutting the proximal end of the tomato transversely with a sharp knife, such that only the pericarp and the top of locular partitions were visible. The geiatinous placental tissue was not measured. Two measures were made on opposite sides of the exposed fleshy surface.

Analysis of intense fruit phenotype [0238] The intense fruit phenotype was determined visually in mature fruits by cutting these open. The seed cavities of the cross-section were compared to the seed cavities of the cross-section of normal fruits of control plants.

[0239] As standard reference commercial hybrid Nun 3155 was used (intense but not ogc).

Genetic mapping of causal intense mutation 10240) Rough genetic mapping: Because degree of polymorphism in cultivar crosses is limiting, genetic mapping was executed in a S. lycopersicum (intense phenotype) x S. pimpinellifolium F2 population. Twelve intense phenotyped F2's were genotyped on the Illumina 6032 tomato SNP array

(Alumina Custom Select Genotyping Array, as is known in the art) which resulted in a map interval of ~15cM interval on tomato chromosome 6. [0241] Fine mapping: Two thousand (2000) F2 individuals from the same cross were screened with "intense" flanking markers, based upon the Illumina rough genetic mapping. Recombinant F2 plants were phenotyped and recombinant plants for which the phenotype was not clear were propagated to F3 and subsequently F3 families were phenotyped. Additional SNPs were developed by "in silico SNP mining" in the intense genetic interval by comparing the Heinz 1706 reference genome sequence with a public Whole Genome re-Sequencing (WGre-S) of a S. pimpinellifolium accession. The intense interval was reduced to a 90kbp physical interval. [0242] Identification of a candidate causal by re-seqeunce the physical interval: The genomes of a homozygous intense line and the wild type cultivar Savantas were re-sequenced 15x Illumina hiseq sequencing (also WGre-S). The sequence reads were mapped against the Heinz 1706 public genome sequence and the 90kb physical interval of the lines was mined for sequence variation. A 405 bp deletion in the Intense line was identified in the promoter of the TAGL11 -like gene in tomato.

As this gene is expressed in phase II of tomato fruit development , a mutation in this gene or its promoter makes sense in relation to the intense phenotype. The 405 bp deletion sequence is shown in SEQ ID NO: 2 which corresponds to nucleotides 1042 to nucleotide 637 upstream of the ATG start codon of SEQ ID NO: 1. [ 024 1 Genetic validation of the candidate causal mutation: A SCAR marker was developed on the 405 bp deletion of the TAGLll-like gene:

Forward primer: TTGACTTCTGAAAGTGTTAGGC

Reverse primer: ATTGCTATTTTCCGGCGAAC.

This SCAR marker showed full association with the intense phenotype on a panel consisting of about 200 different lines. In one aspect the invention relates to the use of this Forward or Reverse primer. In another aspect the invention relates to a method for identifying tomato plants with intense phenotype using this Forward or Reverse primer.

Orthologs in melon and cucumber

Input data

[0244] Thirty-nine Arabidopsis, twenty-seven Solanum lycopersicum, twenty-two Petunia x hybrida, six Antirrhinum majus, and three Nicotiana tabacum MIKC-type MADS-box genes were downloaded from the public domain. The input sets were combined to one with a total of 97 sequences, consisting of complete gene sequences (intron and exons regions) and mRNA sequences (exons regions only). This dataset was used as input for the identification of TAGL1 1 -like homologs in melon

(Cucumis melo) and cucumber (Cucumis sativus). A pipeline was developed for that, which is explained in the next section.

Pipeline

[0245] A pipeline ('GenFamGenomeScan') was developed for the automation of several steps in this study. The pipeline consists of python scripts written for this project, in-house (Nunhems) developed scripts, and open source software, which is all executable on the command line of a Linux server. The scripting was done in a software development environment, Eclipse [Eclipse for PHP developers], and most of the python scripts interact with a MySQL database, designed in Microsoft Visio Professional 2007, and set up in Toad for MySQL [version 5.0]. WinSC [Windows Secure CoPy] was used for the safe copying of files fr m the local computer to the external Linux server, and vice versa. The MySQL database allowed for storing and retrieving relevant data in a relational way. The database was designed so it was dynamic, and data redundancy was avoided as much as possible, while there is still the ability to retrieve all necessary information of a specific project. The database basically consisted of three tables. In one table information about the predicted gene models (potential homologs) was stored: name, genomic location, number of introns, and gene product. In the other two the information about the basic local alignment searches was stored (BLAST results) [S.F. Altschul et al (1990) Journal of Molecular Biology 215(3). 403-410].

10246] First, the MIKC-type MADS-box input data from literature searches, was used to identify homologous sequences in the melon and cucumber genomes. The tblastx algorithm of the bias tall program [Altschul et al, vide supra], which compares the sequences at amino acid level, was used. Another used parameter was a cut-off value for non-significant e- values greater than 0.1. The resulting

BLAST results in XML format were parsed and written to a tab-delimited file by a Nunhems in-house developed python script called, ' blastXMLpars e .py ' . [0247] For every input query sequence the best three hits were retrieved and a python script

( ' S earch Annotations .py ' ) checked if there was a FGENESH [A.A. Salamov AA, et al (2000). Genome Research 1 (4 ): 516-522] predicted gene model in every hit region. FGENESH gene predictions are stored in a GFF3 file [Stein I. (2013). Generic Feature Format Version 3. Retrieved from:

http://gmod.org/wiki/GFF3], which was loaded into the Generic Genome Browser (GGB), an open- source web-based application to browse annotated genomic DNA [Stein LD et al (2002), The generic genome browser: a building block for a model organism system database. Genome Research

12(10): 1599-1610].

[0248] The python program then stored ail uniquely found genes together with the corresponding BLAST results in the MySQL database. FGENESH is a gene-prediction algorithm that makes use of Hidden Markov Models (HMM) and it is based on the recognition of sequence patterns of different types of exons, promoter sequenc es and polyadenylation signals. Basically, it uses a set of known sequences to predict new genes. For melon and cucumber, a training file for Medicago truncatula genomic DNA, was used.

[0249] Ab initio gene predictions, based on training data, are obviously not always 100% accurate. Another way of identifying protein- coding regions, introns, and even alternative splicing, is by using experimental sequence data. This gene validation step helped us to confirm a gene was predicted right (true positive), to notice possibly wrong predicted genes (false positive), or wrong gene structures. This gene validation step was performed manually in GGB [Stein et al, vide supra], by looking at mapped melon and cucumber unigenes, coming from ICUGI [International Cucurbit Genomics Initiative ( at icugi.org/ cgi-bin/ICuGI/index.cgi] . Conserved motif and functional domain analysis

|0250| Besides annotations on ON A level it was essential to make comparisons at protein level, and to find conserved motifs and functional domains. Predicted protein sequences by FGENESH were written to a fasta file with ' SearchAnnotations.py ' . [0251 1 For the identification of conserved motifs, we used the CLCBio Main Workbench (6.0). After importing the protein sequences into the workbench, an automated PFAM [Finn RD et al (2010). The Pfam Protein Families Database. Nucleic Acids Research 38:21 1-222] functional domain scan was done. This was a first step in identifying potential MADS-box proteins, which should contain a MADS- box and a K-box domain [Leseberg CH et all (2008). Interaction study of MADS-domain proteins in tomato. Journal of Experimental Botany 59(8):2253-2265; Hileman 1.C et all (2006). Molecular and

Phyiogenetic Analyses of the MADS-Box Gene Family in Tomato. Molecular Biology and Evolution 23 (11):2245-2258; Parenicova L et all (2003). Molecular and Phyiogenetic Analyses of the Complete MADS-Box Transcription Factor Family in Arabidopsis: New Openings to the MADS World. The Plant Cell. 15: 1538-1551]. Phylogenetics

[0252] Phyiogenetic analyses were performed within CLC Bio Main Workbench as well. Multiple alignments were done with Clustal [Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD (2003). Multiple Sequence Alignment with the Clustal series of programs. Nucleic Acids Research 31 :3497-3500] using default parameters. Besides a whole protein alignment, an alignment of only the MADS-box domain was done, because this is a well conserved domain and it should give the true evolutionary distance between different MADS-box proteins. The phyiogenetic trees were constructed using neighbor-joining (NT) [Saitou N, Nei M (1987). The neighbor-joining method: a new method for reconstructing phyiogenetic trees. Molecular Biology and Evolution 4(4):406-425] with bootstrap analysis (100 replicates). [0253] Using this method, 4 (four) orthologs for the tomato AGL11 -like protein in melon and cucumber were identified:

* also referred to as Cul 06150

The protein, cDNA and gene sequence of each of these is given in the sequence listing. [0254] The sequence identity of these orthologs towards tomato AGL11 -like (TAGL1 1 -like) protein sequence and each other is given in the table below:

[0255] The sequence identity reveals that each ortholog in cucumber has a closely related orthoiog in melon: Cl-Ml ; C2-M2; C3-M3; C4-M4; with a sequence identity of more than 90% (e.g. more than 92%, more than 97 % or even more than 99%). This was confirmed the phylogenetic tree data which showed only a small distance between each of the members of ortholog pairs Cl-Ml ; C2-M2; C3-M3; and C4-M4.

[0256] The relative amount of mRNA of the four orthologs in cucumber (C1 -C4) was determined using methods known in the art. The amount was determined in 5 samples: a mixed leaf sample, a mixed root sample, female flower, male flower and mixed fruit stages sample. All four orthologs had a positive relative mRNA level score in the mixed fruit stage sample, indicating that proteins of C1 -C4 are being produced in the cucumber fruit. C4 being most active.

[0257] Population development of Solanum lycopersicum plants with intense + ogc phenotype. [0258] Individuals of an inbred L. esculentum line (i.e. Solanum lycopersicum line) comprising two copies of the gene conferring the intense phenotypic trait (i.e. homozygous for intense), were crossed with a L. esculentum line carrying at homozygous level the gene ogc, conferring darker internal colour and lacking the mutant intense allele. Both parents were selected as carrying a similar fruit shape (round) and for the indeterminate plant habit which made it easier to select progenies suitable to be grown in greenhouse.

[0259] The Fl population was backcrossed into the recurrent parent (the line carrying intense). BC1 and BC2 were performed, ensuring the presence of ogc gene as well as the homozygosity of indeterminate habit (lack of sp mutant gene). One hundred and fifty (150) individuals of the population BC2F1 were sowed in a nursery and then transplanted into a breeding greenhouse. Plants were planted according to the local area growing conditions. Cycle was a typical spring cycle, with transplant at the end of winter and harvest in the first part of summer. Alternated spring growing season in Italy was alternated with one autumn season in Spain to have two full cycles/year. Fifteen (15) BC2F1 individuals were selected carrying both intense and ogc gene (scored by the use of molecular markers and selected by phenotyping). |0260] The BC2F2 progenies were checked for intense fruit phenotype and for ogc presence, using molecular marker analysis and phenotype observation. Once the 2 genes were scored as fixed and homozygous, only phenotypic selection was performed, looking for the progenies more suitable to be used in future crossing blocks and as suitable source of the 2 genes for further populations.

[0261] Association of phenotype and confirmation with molecular marker analysis (Markers for ogc- phenotype are known in the art; Markers for in tewse-phenotyp e have been described above) showed that in the BC3F2 population individuals segregated in coupling for ogc and intense. One of these (ogc/ogc, i/i) was selected and submitted to NCIMB under number NO MB 42161.

|0262| Population development of Solanum lycopersicum plants with intense + ogc + Ql-6 phenotype. [0263] Individuals of an inbred L. esculentum line comprising two copies of the gene conferring the intense phenotypic trait and of the ogc gene (i.e. homozygous for intense+ogc), were crossed with a L. esculentum line (lacking the mutant intense allele) carrying at homozygous level the gene 01-6, conferring resistance to Powdery Mildew Oidium neolycopersici. Both parents were selected as carrying indeterminate plant habit, making the final product more suitable to be grown in greenhouse. [0264] The Fl population was grown and F2 population produced.

[0265] F2 population was screened through molecular markers to find out individuals carrying the combination of all the three genes. One hundred and twenty (120) individuals of the population F2 were tested in the nursery and 2 individuals were found to carry the recombination of in tense + ogc +01-6 in homozygous form. One of these was selected and submitted under accession number NCIMB 42162.