ZHAO, Jing (8875 Costa Verde Blvd, San Diego, California, 92122, US)
SARMA, Kavitha (3905 Stearns Hill Road, Waltham, Massachusetts, 02451, US)
BOROWSKY, Mark (584 Hunnewell Street, Needham, Massachusetts, 02494, US)
OHSUMI, Toshiro Kendrick (29 Otis Street, Unit 107Cambridge, Massachusetts, 02141, US)
LEE, Jeannie T. (185 Cambridge St, Boston, Massachusetts, 02114-2790, US)
ZHAO, Jing (8875 Costa Verde Blvd, San Diego, California, 92122, US)
SARMA, Kavitha (3905 Stearns Hill Road, Waltham, Massachusetts, 02451, US)
BOROWSKY, Mark (584 Hunnewell Street, Needham, Massachusetts, 02494, US)
OHSUMI, Toshiro Kendrick (29 Otis Street, Unit 107Cambridge, Massachusetts, 02141, US)
| WHAT IS CLAIMED IS: 1. An inhibitory nucleic acid that specifically binds, or is complementary to, an RNA that is known to bind to Polycomb repressive complex 2 (PRC2), selected from the group consisting of SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to 934,931, for use in the treatment of disease, wherein the treatment involves modulating expression of a gene targeted by the RNA, wherein the inhibitory nucleic acid is between 5 and 40 bases in length, and wherein the inhibitory nucleic acid is formulated as a sterile composition. 2. A process of preparing an inhibitory nucleic acid that specifically binds, or is complementary to, an RNA that is known to bind to Polycomb repressive complex 2 (PRC2), selected from the group consisting of SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to 934,931, the process comprising the step of designing and/or synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, optionally single stranded, that specifically binds to the RNA. 3. The process of claim 2 wherein prior to designing and/or synthesizing the inhibitory nucleic acid the process further comprises identifying a region of the RNA that binds to PRC2. 4. The process of claim 2, wherein the sequence of the designed and/or synthesized inhibitory nucleic acid is based on a said RNA sequence that binds to PRC2, or a portion thereof, said portion of said RNA sequence having a length of from 15 to 100 contiguous base pairs. 5. The process of claim 2, wherein the sequence of the designed and/or synthesized inhibitory nucleic acid is based on a nucleic acid sequence that is complementary to said RNA sequence that binds to PRC2, or is complementary to a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs. 6. The process of any one of claims 2 to 5, wherein the inhibitory nucleic acid is for use in the manufacture of a pharmaceutical composition or medicament for use in the treatment of disease, optionally wherein the treatment involves modulating expression of a gene targeted by the RNA binds to PRC2. 7. The inhibitory nucleic acid or process of any of claims 1-6 wherein themodulating is increasing gene expression. 8. A sterile composition comprising an inhibitory nucleic acid that specifically binds, or is complementary to, an RNA sequence of any one of SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to 934,931, and is capable of modulating expression of a gene targeted by the RNA according to Table 2. 9. A sterile composition comprising an inhibitory nucleic acid that specifically binds, or is complementary to, a human RNA sequence corresponding to a mouse RNA sequence of any one of SEQ ID NOS: 1 to 616,428 or 934,762 to 934,863. 10. The sterile composition of claim 9 wherein (a) the human RNA sequence is obtainable by mapping of highly conserved regions from the mouse to human genome, or by mapping of syntenic positions from the mouse to human genome, e.g., mouse-to-human LiftOver analysis, or (b) the human RNA sequence is at least 90% identical over at least 15 bases to the mouse RNA sequence. 11. The sterile composition of any of claims 8-10 which is for parenteral administration. 12. The sterile composition of any of claims 8-10 wherein the inhibitory nucleic acid is capable of upregulating expression of a gene targeted by the RNA. 13. An inhibitory nucleic acid for use in the treatment of disease, wherein said inhibitory nucleic acid specifically binds, or is complementary to, an RNA sequence of any one of SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to 934,931, and wherein the treatment involves modulating expression of a gene targeted by the RNA according to Table 2. 14. A method of modulating gene expression comprising administering to a mammal an inhibitory nucleic acid that specifically binds, or is complementary to, an RNA sequence of any one of SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to 934,931, in an amount effective for modulating expression of a gene targeted by the RNA according to Table 2. 15. An inhibitory nucleic acid for use in the treatment of disease, wherein said inhibitory nucleic acid specifically binds, or is complementary to a human RNA sequence corresponding to a mouse RNA sequence of any one of SEQ ID NOS: 1 to 616,428 or 934,762 to 934,863, wherein the human RNA sequence is (a) obtainable by mapping of highly conserved regions from the mouse to human genome, or by mapping of syntenic positions from the mouse to human genome, e.g., mouse-to- human LiftOver analysis, or (b) is at least 90% identical over at least 15 bases to the mouse RNA sequence, and wherein the treatment involves modulating expression of a gene targeted by the RNA. 16. A method of modulating expression of a gene comprising administering to a mammal an inhibitory nucleic acid that specifically binds, or is complementary to, a human RNA sequence corresponding to a mouse RNA sequence of any one of SEQ ID NOS: 1 to 616,428 or 934,762 to 934,863, wherein the human RNA sequence is (a) obtainable by mapping of highly conserved regions from the mouse to human genome, or by mapping of syntenic positions from the mouse to human genome, e.g., mouse-to-human LiftOver analysis, or (b) is at least 90% identical over at least 15 bases to the mouse RNA sequence, and wherein the treatment involves modulating expression of a gene targeted by the RNA. 17. An inhibitory nucleic acid of about 5 to 50 bases in length that specifically binds, or is complementary to, a fragment of any of the RNA transcripts of SEQ ID NOS: 1 - 47,407 or 934,762 - 934,863 or 616,429 - 652,255 or 916,210 - 916,625 or 934,864 - 934,968 or 916,626 to 934,761, said fragment about 500 bases in length or about 100 bases in length, wherein the fragment of RNA comprises a stretch of at least five consecutive bases within any of SEQ ID NOS: 47,408 to 616,428 or 652,256 to 916,209, optionally for use in the treatment of disease, wherein the treatment involves modulating expression of a gene targeted by the RNA. 18. A method of modulating expression of a gene comprising administering to a mammal an inhibitory nucleic acid of claim 17 in an amount effective for modulating expression of a gene targeted by the RNA as set forth in Table 2. 19. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the modulating is upregulating gene expression, optionally wherein the gene targeted by the RNA is selected from the group set forth in Table 2, and wherein the RNA sequences are selected from the group listed in the same row as the gene. 20. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is 5 to 40 bases in length (optionally 12-30, 12-28, or 12-25 bases in length). 21. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is 10 to 50 bases in length. 22. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid comprises a base sequence at least 90% complementary to at least 10 bases of the RNA sequence. 23. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid comprises a sequence of bases at least 80% or 90% complementary to, e.g., at least 5-30, 10-30, 15-30, 20-30, 25-30 or 5-40, 10-40, 15-40, 20-40, 25-40, or 30-40 bases of the RNA sequence. 24. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) in complementary base pairing over 10, 15, 20, 25 or 30 bases of the RNA sequence. 25. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid comprises a sequence of bases at least 80% complementary to at least 10 bases of the RNA sequence. 26. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid comprises a sequence of bases with up to 3 mismatches over 15 bases of the RNA sequence. 27. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is single stranded. 28. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is double stranded. 29. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof. 30. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is an antisense oligonucleotide, LNA molecule, PNA molecule, ribozyme or siRNA. 31. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is double stranded and comprises an overhang (optionally 2-6 bases in length) at one or both termini. 32. The inhibitory nucleic acid, process, composition or method of any of the preceding claims wherein the inhibitory nucleic acid is selected from the group consisting of antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, micro RNAs (miRNAs); small, temporal RNAs (stRNA), and single- or double-stranded RNA interference (RNAi) compounds. 33. The inhibitory nucleic acid, process, composition or method of claim 32 wherein the RNAi compound is selected from the group consisting of short interfering RNA (siRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); and small activating RNAs (saRNAs). 40. The inhibitory nucleic acid, process, composition or method of claim 30 wherein the antisense oligonucleotide is selected from the group consisting of antisense RNAs, antisense DNAs, and chimeric antisense oligonucleotides. 41. The inhibitory nucleic acid, process, composition or method of claim 29 wherein the modified internucleoside linkage comprises at least one of: alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof. 42. The inhibitory nucleic acid, process, composition or method of claim 29 wherein the modified sugar moiety comprises a 2'-0-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-0-alkyl modified sugar moiety, or a bicyclic sugar moiety. 43. The inhibitory nucleic acid, process, composition or method of claim 29 comprising: 2'-OMe, 2'-F, LNA, PNA, FANA, ENA or morpholino modifications. 44. A sterile composition comprising an isolated nucleic acid that is a mouse RNA sequence of any one of any one of SEQ ID NOS: 632,564, 1 to 916,209, or 916,626 to 934,931, or a fragment thereof at least 20 bases in length that retains PRC2 -binding activity. 45. An isolated nucleic acid for use in a method of decreasing expression of an oncogene, comprising an RNA sequence as set forth in Table 2 that targets a gene in category 205 (proto-oncogene or oncogene) as set forth in Table 3, or a fragment thereof at least 20 bases in length that retains PRC2 -binding activity. 46. A method of decreasing expression of an oncogene in a cell, the method comprising contacting the cell with an RNA sequence as set forth in Table 2 that targets a gene in category 205 (proto-oncogene or oncogene) as set forth in Table 3, or a fragment thereof at least 20 bases in length that retains PRC2-binding activity. |
FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was made with Government support under Grant No. RO 1 - GM-090278 awarded by the National Institutes of Health. The Government has certain rights in the invention.
RELATED APPLICATIONS
This application claims priority to U.S. provisional Nos. 61/425,174 filed on December 20, 2010, and 61/512,754 filed on July 28, 2011, and International Patent Appliation No. PCT/US201 1/060493, filed November 12, 201 1, the disclosures of which are incorporated herein by reference in their entireties.
TECHNICAL FIELD
This invention relates to polycomb-associated long non-coding RNAs (lncRNAs) that function to modulate gene expression, and methods of using them or inhibitory nucleic acids that bind them, to modulate gene expression.
BACKGROUND
Transcriptome analyses have suggested that, although only 1-2% of the mammalian genome is protein-coding, 70-90% is transcriptionally active (Carninci et al, 2005; Kapranov et al, 2007; Mercer et al, 2009). Ranging from 100 nt to >100 kb, these transcripts are largely unknown in function, may originate within or between genes, and may be conserved and developmentally regulated (Kapranov et al, 2007; Guttman et al, 2009). Recent discoveries argue that a subset of these transcripts play crucial roles in epigenetic regulation. For example, genes in the human HOX-D locus are regulated in trans by HOTAIR RNA, produced by the unlinked HOX-C locus (Rinn et al., 2007), and during X-chromosome inactivation, Tsix, RepA, and Xist RNAs target a chromatin modifier in cis to control chromosome-wide silencing (Zhao et al, 2008). Interestingly, all four RNAs bind and regulate Polycomb Repressive Complex 2 (PRC2), the complex that catalyzes trimethylation of histone H3-lysine27 (H3-K27me3)(Schwartz and Pirrotta, 2008). These observations support the idea that long ncRNAs are ideal for targeting chromatin modifiers to specific alleles or unique locations in the genome (Lee, 2009) (Lee, 2010). RNA-mediated recruitment is especially attractive for Polycomb proteins. First identified in Drosophila as homeotic regulators, Polycomb proteins are conserved from flies to mammals and control many aspects of development (Ringrose and Paro, 2004; Boyer et al, 2006; Lee et al, 2006; Schuettengruber et al, 2007; Pietersen and van Lohuizen, 2008; Schwartz and Pirrotta, 2008). Mammalian PRC2 contains four core subunits, Eed, Suzl2, RbAp48, and the catalytic Ezh2. In humans, aberrant PRC2 expression is linked to cancer and disease (Sparmann and van Lohuizen, 2006; Bernardi and Pandolfi, 2007; Miremadi et al, 2007; Rajasekhar and Begemann, 2007; Simon and Lange, 2008). Despite growing recognition of
Polycomb's role in health, little is known about their regulation in vivo. In flies, Polycomb complexes may contain sequence-specific DNA-binding factors, such as Zeste, Pipsqueak (PSQ), or Pho, to help bind Polycomb-response elements (PRE) (Ringrose and Paro, 2004; Schwartz and Pirrotta, 2008). By contrast, mammalian Polycomb complexes are not thought to contain such subunits. Therefore, their mechanism of recruitment to thousands of genomic locations remains poorly understood, though PRE-like elements (Sing et al, 2009; Woo et al, 2010) and Jarid2 may facilitate binding (Li et al; Pasini et al; Peng et al, 2009; Shen et al, 2009). Interestingly, several PRC2 subunits have potential RNA-binding motifs (Denisenko et al, 1998; Bernstein and Allis, 2005; Bernstein et al, 2006b) - a possibility borne out by postulated functional interactions between Tsix/RepA/Xist RNA and PRC2 for X-inactivation (Zhao et al, 2008) and by HOTAIR and PRC2 for HOX regulation (Rinn et al., 2007). Recent work also identified several short RNAs of 50-200 nt as candidate PRC2 regulators (Kanhere et al, 2010). Control of Polycomb repressive comp lex 1 (PRC1) may also involve RNA (Yap et al, 2010).
In spite of their ubiquity, the structure and function of many long ncRNAs remain largely uncharacterized. Recent studies suggest that some long ncRNAs may have a function as an epigenetic regulator/RNA cofactor in chromatin remodeling and tumor suppression. Although knockdown technologies employing siRNAs and shRNAs have become staples in functional analysis of microRNAs (miRNAs) and cytoplasmically localized messenger RNAs (mRNAs) (4-6), these methods have been reported in some instances to be less consistently effective for long ncRNAs localized to the nucleus (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). SUMMARY
A method, referred to herein as "RNA immunoprecipitation (RlP)-seq," was used to identify a genome-wide pool of >57,000 polycomb repressive complex 2 (PRC2)-interacting RNAs in embryonic stem cells (referred to herein as the
"expanded PRC2 transcriptome"). The transcriptome includes antisense, intergenic, and promoter-associated transcripts, as well as many unannotated RNAs. A large number of transcripts occur within imprinted regions, oncogene and tumor suppressor loci, and stem-cell-related bivalent domains. Evidence for direct RNA-protein interactions, some via the Ezh2 subunit, is provided. Further evidence is provided that inhibitory oligonucleotides that specifically bind to these PRC2-interacting RNAs can successfully up-regulate gene expression in a variety of separate and independent examples, presumably by inhibiting PRC2-associated repression. Thus, Polycomb proteins interact with a genome-wide family of RNAs, some of which may be used as biomarkers and therapeutic targets for human disease.
In one aspect, described herein are methods for preparing a plurality of validated cDNAs complementary to a pool of nuclear ribonucleic acids (nRNAs). The methods include providing a sample comprising nuclear ribonucleic acids, e.g., a sample comprising nuclear lysate, e.g., comprising nRNAs bound to nuclear proteins; contacting the sample with an agent, e.g., an antibody, that binds specifically to a nuclear protein or protein complex such as PRC2, under conditions sufficient to form complexes between the agent and the protein; isolating the complexes; synthesizing DNA complementary to the nRNAs to provide an initial population of cDNAs; PCR- amplifying, if necessary, using strand-specific primers; purifying the initial population of cDNAs to obtain a purified population of cDNAs that are at least about 20 nucleotides (nt) in length, e.g., at least 25, 50, 75, 100, 150, 200, or 250 nt in length; sequencing at least part or substantially all of the purified population of cDNAs; aligning reads to a reference genome and retaining only those that are aligned;
selecting high-confidence cDNA sequences, optionally, based on criteria that (1) the candidate transcript has a minimum read density in reads per kilobase per million reads (RPKM) terms (e.g., above a desired threshold); and/or (2) the candidate transcript is enriched in the wildtype library versus a suitable control library (such as an IgG pulldown library or a protein-null pulldown library); thereby preparing the plurality of cDNAs. In some embodiments, described herein are methods for preparing a plurality of validated cDNAs complementary to a pool of nuclear ribonucleic acids (nRNAs). The methods can include providing a sample comprising nuclear ribonucleic acids, e.g., a sample comprising nuclear lysate, e.g., comprising nRNAs bound to nuclear proteins; contacting the sample with an agent, e.g., an antibody, that binds specifically to a nuclear protein or protein complex such as PRC2, under conditions sufficient to form complexes between the agent and the protein, e.g., such that the nRNAs remain bound to the proteins; isolating the complexes; synthesizing DNA complementary to the nRNAs to provide an initial population of cDNAs; optionally PCR-amplifying the cDNAs using strand-specific primers; purifying the initial population of cDNAs to obtain a purified population of cDNAs that are at least about 20 nucleotides (nt) in length, e.g., at least 25, 50, 100, 150 or 200 nt in length; sequencing at least part or substantially all of the purified population of cDNAs; comparing the high-confidence sequences to a reference genome, and selecting those sequences that have a high degree of identity to sequences in the reference genome, e.g., at least 95%, 98%, or 99% identity, or that have fewer than 10, 5, 2, or 1 mismatches; and selecting those cDNAs that optionally have (i) reads per kilobase per million reads (RPKM) above a desired threshold, and/or (ii) are enriched as compared to a control library (e.g., a protein-null library or library made from an IgG pulldown done in parallel); thereby preparing the library of cDNAs.
In some embodiments, the method is used to prepare a library representing a transcriptome associated with the protein of interest.
In some embodiments, the agent is an antibody and isolating the complexes comprises immunoprecipitating the complexes. In some embodiments, the cDNAs are synthesized using strand-specific adaptors.
In some embodiments, the methods further include sequencing substantially all of the cDNAs.
In another aspect the invention features an inhibitory nucleic acid that specifically binds to, or is complementary to, an RNA that binds to Polycomb repressive complex 2 (PRC2), for example, any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931. Without being bound by a theory of invention, these inhibitory nucleic acids are able to interfere with the binding of and function of PRC2, by preventing recruitment of PRC2 to a specific chromosomal locus. For example, data herein shows that a single administration of inhibitory nucleic acids designed to specifically bind a IncRNA can stably displace not only the IncRNA but also the PRC2 that binds to the IncRNA, from binding chromatin. After displacement, the full complement of PRC2 is not recovered for up to 24 hours. Data provided herein also indicate that putative IncRNA binding sites for PRC2 show no conserved primary sequence motif, making it possible to design specific inhibitory nucleic acids that will interfere with PRC2 interaction with a single IncRNA, without generally disrupting PRC2 interactions with other IncRNAs. Further, data provided herein support that IncRNA can recruit PRC2 in a cis fashion, repressing gene expression at or near the specific chromosomal locus from which the IncRNA was transcribed, thus making it possible to design inhibitory nucleic acids that inhibit the function of PRC2 and increase the expression of a specific target gene. In some embodiments, the inhibitory nucleic acid is provided for use in a method of modulating expression of a "gene targeted by the PRC2 -binding RNA" (e.g., an intersecting or nearby gene, as set forth in Tables 1-4 below), meaning a gene whose expression is regulated by the PRC2- binding RNA. The term "PRC2-binding RNA" or "RNA that binds PRC2" is used interchangeably with "PRC2-associated RNA" and "PRC2-interacting RNA", and refers to an RNA transcript or a region thereof (e.g., a Peak as described below) that binds the PRC2 complex, directly or indirectly. Such binding may be determined by immunoprecipitation techniques using antibodies to a component of the PRC2 complex, e.g., Ezh2. SEQ ID NOS: 1 to 934,968 represent murine RNA sequences containing portions that have been experimentally determined to bind PRC2 using the RIP-seq method described herein, or human RNA sequences corresponding to these murine RNA sequences.
Such methods of modulating gene expression may be carried out in vitro, ex vivo, or in vivo. Table 2 displays genes targeted by the PRC2-binding RNA; the SEQ ID NOS: of the PRC2-associated RNA are set forth in the same row as the gene name. In some embodiments, the inhibitory nucleic acid is provided for use in a method of treating disease, e.g. a disease category as set forth in Table 3 or 4. The treatment may involve modulating expression (either up or down) of a gene targeted by the PRC2 -binding RNA, preferably upregulating gene expression. The inhibitory nucleic acid may be formulated as a sterile composition for parenteral administration. It is understood that any reference to uses of compounds throughout the description contemplates use of the compound in preparation of a pharmaceutical composition or medicament for use in the treatment of a disease. Thus, as one nonlimiting example, this aspect of the invention includes use of such inhibitory nucleic acids in the preparation of a medicament for use in the treatment of disease, wherein the treatment involves upregulating expression of a gene targeted by the PRC2-binding RNA.
Diseases, disorders or conditions that may be treated according to the invention include cardiovascular, metabolic, inflammatory, bone, neurological or neurodegenerative, pulmonary, hepatic, kidney, urogenital, bone, cancer, and/or protein deficiency disorders. Examples of categories of diseases are set forth in Tables 3 and 4.
In a related aspect, the invention features a process of preparing an inhibitory nucleic acid that modulates gene expression, the process comprising the step of synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, or about 8 to 40, or about 5 to 50 bases in length, optionally single stranded, that specifically binds, or is complementary to, an RNA sequence that has been identified as binding to PRC2, optionally an RNA of any of Tables 1 -4 or any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931. This aspect of the invention may further comprise the step of identifying the RNA sequence as binding to PRC2, optionally through the RIP-seq method described herein.
In a further aspect of the present invention a process of preparing an inhibitory nucleic acid that specifically binds to an RNA that binds to Polycomb repressive complex 2 (PRC2) is provided, the process comprising the step of designing and/or synthesizing an inhibitory nucleic acid of between 5 and 40 bases in length, or about 8 to 40, or about 5 to 50 bases in length, optionally single stranded, that specifically binds to an RNA sequence that binds to PRC2, optionally an RNA of any of Tables 1-4 or any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931 .
In some embodiments prior to synthesizing the inhibitory nucleic acid the process further comprises identifying an RNA that binds to PRC2.
In some embodiments the RNA has been identified by a method involving identifying an RNA that binds to PRC2.
In some embodiments the inhibitory nucleic acid is at least 80%
complementary to a contiguous sequence of between 5 and 40 bases, or about 8 to 40, or about 5 to 50 bases in said RNA sequence that binds to PRC2. In some
embodiments the sequence of the designed and/or synthesized inhibitory nucleic acid is based on a said RNA sequence that binds to PRC2, or a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs, or about 8 to 40 bases, or about 5 to 50 bases.
In some embodiments the sequence of the designed and/or synthesized inhibitory nucleic acid is based on a nucleic acid sequence that is complementary to said RNA sequence that binds to PRC2, or is complementary to a portion thereof, said portion having a length of from 5 to 40 contiguous base pairs, or about 8 to 40 base pairs, or about 5 to 50 base pairs.
The designed and/or synthesized inhibitory nucleic acid may be at least 80% complementary to (optionally one of at least 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the portion of the RNA sequence to which it binds or targets, or is intended to bind or target. In some embodiments it may contain 1, 2 or 3 base mismatches compared to the portion of the target RNA sequence or its complement respectively. In some embodiments it may have up to 3 mismatches over 15 bases, or up to 2 mismatches over 10 bases.
The inhibitory nucleic acid or portion of RNA sequence that binds to PRC2 may have a length of one of at least 8 to 40, or 10 to 50, or 5 to 50, or 5 to 40 bases, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases. Where the inhibitory nucleic acid is based on an RNA sequence that binds to PRC2, a nucleic acid sequence that is complementary to said RNA sequence that binds to PRC2 or a portion of such a sequence, it may be based on information about that sequence, e.g. sequence information available in written or electronic form, which may include sequence information contained in publicly available scientific publications or sequence databases.
Where the design and/or synthesis involves design and/or synthesis of a sequence that is complementary to a nucleic acid described by such sequence information the skilled person is readily able to determine the complementary sequence, e.g. through understanding of Watson-Crick base pairing rules which form part of the common general knowledge in the field.
In the methods described above the RNA that binds to PRC2 may be, or have been, identified, or obtained, by a method that involves identifying RNA that binds to PRC2.
Such methods may involve the following steps: providing a sample containing nuclear ribonucleic acids, contacting the sample with an agent that binds specifically to PRC2 or a subunit thereof, allowing complexes to form between the agent and protein in the sample, partitioning the complexes, synthesizing nucleic acid that is complementary to nucleic acid present in the complexes.
If necessary, the method may further comprise the steps of amplifying the synthesized nucleic acid, and/or purifying the nucleic acid (or amplified nucleic acid), and/or sequencing the nucleic acids so obtained, and/or filtering/analysing the nucleic acids so obtained to identify high-probability PRC2 (or subunit thereof)-interacting transcripts.
In one embodiment the method involves the Rip-Seq method described herein.
In accordance with the above, in some embodiments the RNA that binds to PRC2 may be one that is known to bind PRC2, e.g. information about the sequence of the RNA and/or its ability to bind PRC2 is available to the public in written or electronic form allowing the design and/or synthesis of the inhibitory nucleic acid to be based on that information. As such, an RNA that binds to PRC2 may be selected from known sequence information and used to inform the design and/or synthesis of the inhibitory nucleic acid.
In other embodiments the RNA that binds to PRC2 may be identified as one that binds PRC2 as part of the method of design and/or synthesis.
In preferred embodiments design and/or synthesis of an inhibitory nucleic acid involves manufacture of a nucleic acid from starting materials by techniques known to those of skill in the art, where the synthesis may be based on a sequence of an RNA (or portion thereof) that has been selected as known to bind to Polycomb repressive complex 2.
Methods of design and/or synthesis of an inhibitory nucleic acid may involve one or more of the steps of:
Identifying and/or selecting an RNA sequence that binds to PRC2;
Identifying and/or selecting a portion of an RNA sequence that binds to PRC2
Designing a nucleic acid sequence having a desired degree of sequence identity or complementarity to an RNA sequence that binds to PRC2 or a portion thereof;
Synthesizing a nucleic acid to the designed sequence;
Mixing the synthesized nucleic acid with at least one pharmaceutically acceptable diluent, carrier or excipient to form a pharmaceutical composition or medicament. Inhibitory nucleic acids so designed and/or synthesized may be useful in method of modulating gene expression as described herein.
As such, the process of preparing an inhibitory nucleic acid may be a process that is for use in the manufacture of a pharmaceutical composition or medicament for use in the treatment of disease, optionally wherein the treatment involves modulating expression of a gene targeted by the RNA binds to PRC2.
In yet another aspect, the invention provides isolated nucleic acids comprising a sequence referred to in any of Tables 1-4, or in Appendix I of U.S. Prov. Appln. No. 61/425, 174 filed on December 20, 2010, which is not attached hereto but is incorporated by reference herein in its entirety, or a fragment comprising at least 20 nt thereof, e.g., as shown in Appendix I. In some or any embodiments, the invention provides an isolated nucleic acid comprising (a) an RNA sequence as set forth in Table 2 that targets a gene in category 205 (proto-oncogene or oncogene) as set forth in Table 3, or (b) a fragment of (a) that is at least 20 bases in length that retains PRC2- binding activity, or (c) a derivative of (a) or (b) that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous thereto, or (d) a nucleic acid of (a), (b), or (c) in which one or more bases has been replaced with a base of similar base-pairing capacity, such as replacing U with T. In preferred embodiments, the isolated nucleic acid of (a), (b) or (c) is for use in a method of decreasing expression of an oncogene. In some embodiments, the isolated nucleic acid is synthetic. In some embodiments, the isolated lncRNA comprises a SEQ ID NO. associated with Pvtl in Table 2, or a fragment thereof. Pvtl is known in the art to be disrupted in some cases of Burkitt's lymphoma as well as in plasmacytomas (e.g., by translocations from another chromosome). Therefore, Pvtl is likely to act by targeting PRC2 to c-Myc in order to repress its expression. Accordingly, exogenous administration of any of the RNA sequences associated with Pvtl in Table 2, or fragments thereof could rescue Pvtl loss-of- function phenotypes contributing to various cancers.
In a further aspect, the invention provides methods for decreasing expression of an oncogene in a cell. In some embodiments, the methods include contacting the cell with a long non-coding RNA, or PRC2-binding fragment thereof described in any of Tables 1-3, or a nucleic acid sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to a lncRNA sequence, or PRC2 -binding fragment thereof, as referred to in any of Tables 1-3. In exemplary methods, the IncRNA is (a) an RNA sequence as set forth in Table 2 that targets a gene in category 205 (proto-oncogene or oncogene) as set forth in Table 3, or (b) a fragment thereof at least 20 bases in length that retains PRC2 -binding activity, or (c) a derivative of (a) or (b) that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous thereto, or (d) a nucleic acid of (a), (b), or (c) in which one or more bases has been replaced with a base of similar base-pairing capacity, such as replacing U with T. PRC2 -binding fragments of murine or orthologous lncRNAs, including human IncRNA, which retain the lncRNA's ability to bind PRC2, are contemplated.
In yet another aspect, the invention features methods for increasing expression of a tumor suppressor in a mammal, e.g. human, in need thereof. The methods include administering to said mammal an inhibitory nucleic acid that specifically binds, or is complementary, to a human PRC2-interacting IncRNA corresponding to a tumor suppressor locus of any of Tables 1-3 or a human IncRNA corresponding to an imprinted gene of Table 4, and/or a human IncRNA corresponding to a growth suppressing gene of any of Tables 1-3, or a related naturally occurring IncRNA that is othologous or at least 90%, (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 100) nucoleobases thereof, in an amount effective to increase expression of the tumor suppressor or growth suppressing gene. It is understood that one method of determining human orthologous IncRNA that corresponds to murine IncRNA is to identify a
corresponding human sequence at least 90% identical (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to at least 15 nucleobases of the murine sequence (or at least 20, 21, 25, 30, 40, 50, 60, 70, 80, 90 or 100 nucleobases).
In an additional aspect, the invention provides methods for inhibiting or suppressing tumor growth in a mammal, e.g. human, with cancer, comprising administering to said mammal an inhibitory nucleic acid that specifically binds, or is complementary, to a human PRC2-interacting IncRNA corresponding to a tumor suppressor locus of any of Tables 1-3, or a human IncRNA corresponding to an imprinted gene of Table 4, and/or a human IncRNA corresponding to a growth- suppressing gene of any of Tables 1-3, or a related naturally-occurring IncRNA that is orthologous or at least 90%, (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof, in an amount effective to suppress or inhibit tumor growth. In another aspect, the invention features methods for treating a mammal, e.g., a human, with cancer comprising administering to said mammal an inhibitory nucleic acid that specifically binds, or is complementary, to a human IncRNA corresponding to a tumor suppressor locus of any of Tables 1-3, or a human IncRNA corresponding to an imprinted gene of Table 4, and/or a human IncRNA corresponding to a growth- suppressing gene of any of Tables 1-3, or a related naturally occurring IncRNA that is orthologous or at least 90% (e.g.,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof, in a therapeutically effective amount.
In some or any embodiments, the inhibitory nucleic acid is an oligomeric base compound or oligonucleotide mimetic that hybridizes to at least a portion of the target nucleic acid and modulates its function. In some or any embodiments, the inhibitory nucleic acid is single stranded or double stranded. A variety of exemplary inhibitory nucleic acids are known and described in the art. In some examples, the inhibitory nucleic acid is an antisense oligonucleotide, locked nucleic acid (LNA) molecule, peptide nucleic acid (PNA) molecule, ribozyme, siRNA, antagomirs, external guide sequence (EGS) oligonucleotide, microRNA (miRNA), small, temporal RNA
(stRNA), or single- or double-stranded RNA interference (RNAi) compounds. It is understood that the term "LNA molecule" refers to a molecule that comprises at least one LNA modification; thus LNA molecules may have one or more locked nucleotides (conformationally constrained) and one or more non-locked nucleotides. It is also understood that the term "LNA" includes a nucleotide that comprises any constrained sugar that retains the desired properties of high affinity binding to complementary RNA, nuclease resistance, lack of immune stimulation, and rapid kinetics. Exemplary constrained sugars include those listed below. Similarly, it is understood that the term "PNA molecule" refers to a molecule that comprises at least one PNA modification and that such molecules may include unmodified nucleotides or internucleoside linkages.
In some or any embodiments, the inhibitory nucleic acid comprises at least one nucleotide and/or nucleoside modification (e.g., modified bases or with modified sugar moieties), modified internucleoside linkages, and/or combinations thereof. Thus, inhibitory nucleic acids can comprise natural as well as modified nucleosides and linkages. Examples of such chimeric inhibitory nucleic acids, including hybrids or gapmers, are described below. In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, and/or a modified internucleoside linkage, and/or a modified nucleotide and/or combinations thereof. In some embodiments, the modified internucleoside linkage comprises at least one of:
alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate,
carboxymethyl ester, or combinations thereof. In some embodiments, the modified sugar moiety comprises a 2'-0-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-0-alkyl modified sugar moiety, or a bicyclic sugar moiety. Other examples of modifications include locked nucleic acid (LNA), peptide nucleic acid (PNA), arabinonucleic acid (ANA), optionally with 2'-F modification, 2'- fluoro-D-Arabinonucleic acid (FANA), phosphorodiamidate morpholino oligomer (PMO), ethylene -bridged nucleic acid (ENA), optionally with 2'-0,4'-C-ethylene bridge, and bicyclic nucleic acid (BNA). Yet other examples are described below and/or are known in the art.
In some embodiments, the inhibitory nucleic acid is 5-40 bases in length (e.g., 12-30, 12-28, 12-25). The inhibitory nucleic acid may also be 10-50, or 5-50 bases length. For example, the inhibitory nucleic acid may be one of any of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases in length. In some embodiments, the inhibitory nucleic acid is double stranded and comprises an overhang (optionally 2-6 bases in length) at one or both termini. In other
embodiments, the inhibitory nucleic acid is double stranded and blunt-ended. In some embodiments, the inhibitory nucleic acid comprises or consists of a sequence of bases at least 80% or 90% complementary to, e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of, the target RNA, or comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases of the target RNA.
Thus, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 80% complementary to at least 10 contiguous bases of the target RNA, or at least 80% complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 80% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 80% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 80% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 80%
complementary to at least 40 contiguous bases of the target RNA. Moreover, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 90% complementary to at least 10 contiguous bases of the target RNA, or at least
90%complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 90% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 90% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 90% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 90% complementary to at least 40 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases fully complementary to at least 5, 10, or 15 contiguous bases of the target RNA.
Complementarity can also be referenced in terms of the number of mismatches in complementary base pairing, as noted above. Thus, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 3 mismatches over 10 contiguous bases of the target RNA, or up to 3 mismatches over 15 contiguous bases of the target RNA, or up to 3 mismatches over 20 contiguous bases of the target RNA, or up to 3 mismatches over 25 contiguous bases of the target RNA, or up to 3 mismatches over 30 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 2 mismatches over 10 contiguous bases of the target RNA, or up to 2 mismatches over 15 contiguous bases of the target RNA, or up to 2 mismatches over 20 contiguous bases of the target RNA, or up to 2 mismatches over 25 contiguous bases of the target RNA, or up to 2 mismatches over 30 contiguous bases of the target RNA. Similarly, the the inhibitory nucleic acid can comprise or consist of a sequence of bases with one mismatch over 10, 15, 20, 25 or 30 contiguous bases of the target RNA.
As such, in some embodiments the inhibitory nucleic acid comprises or consists of a sequence of bases about 5 to 40, or 8 to 40, or 10 to 50, or 5 to 50 bases in length, comprising a base sequence at least 80% complementary to (optionally one of at least 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) a contiguous sequence of at least 5 to 40 bases, or 8 to 40, or 10 to 50, or 5 to 50 bases (optionally one of at least 10, 15, 20, 25 or 30 bases, or one of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) of the target IncRNA. Thus, in some embodiments the inhibitory nucleic acid may comprise or consist of a sequence of at least 5 to 40, or 8 to 40, or 5 to 50,or 10 to 50, bases (optionally one of at least 10, 15, 20, 25 or 30 bases, or one of 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) having at least 80% identity to (optionally one of at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to) a contiguous sequence of bases of the same length of an antisense nucleic acid that is completely complementary in sequence to the target IncRNA. In some embodiments the sequence of the inhibitory nucleic acid may contain 1, 2 or 3 mismatches in complementary base pairing compared to the target IncRNA sequence, over 10, 15, 20, 25 or 30 bases (optionally one of 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases) of the target IncRNA.
In some or any embodiments, the inhibitory nucleic acid is 5 to 40, or 8 to 40, or 10 to 50 bases in length (e.g., 12-30, 12-28, 12-25, 5-25, or 10-25, bases in length), and comprises a sequence of bases with up to 3 mismatches in complementary base pairing over 15 bases of , or up to 2 mismatches over 10 bases.
In some embodiments, gene expression is modulated in a cell. In some embodiments, the cell is a cancer cell, e.g., a tumor cell, in vitro or in vivo, e.g., in a subject. In other embodiments, the cell is a stem cell that is contacted with the inhibitory nucleic acid, PRC2-binding IncRNA, or fragment thereof, ex vivo, for example to enhance pluripotency, enhance differentiation, or induce the stem cell to differentiate to a particular cell type, e.g. nerve^neuron, dopaminergic neuron, muscle, skin, heart, kidney, liver, lung, neuroendocrine, retinal, retinal pigment epithelium, pancreatic alpha or beta cells, hematopoietic, chondrocyte, bone cells and/or blood cells (e.g., T-cells, B-cells, macrophages, erythrocytes, platelets, and the like).
In an additional aspect, the invention provides methods for enhancing pluripotency of a stem cell. The methods include contacting the cell with a long non- coding RNA, or PRC2-binding fragment thereof, as referred to in Table 4 or a nucleic acid sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to a IncRNA sequence, or PRC2-binding fragment thereof, as referred to in Table 4 . PRC2 -binding fragments of murine or orthologous IncRNAs, including human IncRNA, are contemplated in the aforementioned method. In a further aspect, the invention features methods for enhancing
differentiation of a stem cell, the method comprising contacting the cell with an inhibitory nucleic acid that specifically binds, or is complementary, to a long non- coding RNA as referred to in Table 4.
In some embodiments, the stem cell is an embryonic stem cell. In some embodiments, the stem cell is an iPS cell or an adult stem cell.
In an additional aspect, the invention provides sterile compositions including an inhibitory nucleic acid that specifically binds to or is at least 90% complementary to (e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of) a IncRNA of any of Tables 1-4, or any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931, or a related naturally occurring IncRNA at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to at least 15 (e.g., at least 20, 21, 25, 30, 100) nucleobases of an IncRNA of any of Tables 1-4 or any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931, for parenteral administration. In some embodiments, the inhibitory nucleic acid is selected from the group consisting of antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, micro RNAs (miRNAs); small, temporal RNAs (stRNA), and single- or double-stranded RNA interference (RNAi) compounds. In some embodiments, the RNAi compound is selected from the group consisting of short interfering RNA (siRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); and small activating RNAs (saRNAs).
In some embodiments, the antisense oligonucleotide is selected from the group consisting of antisense RNAs, antisense DNAs, chimeric antisense oligonucleotides, and antisense oligonucleotides.
In some embodiments, the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof. In some embodiments, the modified internucleoside linkage comprises at least one of: alkylphosphonate, phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof. In some embodiments, the modified sugar moiety comprises a 2'-0-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'- O-alkyl modified sugar moiety, or a bicyclic sugar moiety. Other examples of modifications include locked nucleic acid (LNA), peptide nucleic acid (PNA), arabinonucleic acid (ANA), optionally with 2'-F modification, 2'-fluoro-D- Arabinonucleic acid (FANA), phosphorodiamidate morpholino oligomer (PMO), ethylene -bridged nucleic acid (ENA), optionally with 2'-0,4'-C-ethylene bridge, and bicyclic nucleic acid (BNA). Yet other examples are described below and/or are known in the art.
PRC2-binding fragments of any of the RNA set forth in the sequence listing as summarized below are contemplated. In some aspects, the fragments may recruit PRC2 and enhance PRC2 activity, thereby repressing gene expression, while in other instances the fragments may interfere with PRC2 activity by masking the lncRNA- binding sites on PRC2. In particular, the invention features uses of fragments of the RNA below to modulate expression of any of the genes set forth in Tables 1-4, for use in treating a disease, disorder, condition or association described in any of the categories set forth in Table 3 or 4 (whether in the "opposite strand" column or the "same strand" column).
Moreover, inhibitory nucleic acids that specifically bind to any of the RNA set forth in the sequence listing as summarized below, any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931, are also contemplated. In particular, the invention features uses of these inhibitory nucleic acids to upregulate expression of any of the genes set forth in Tables 1 -4, for use in treating a disease, disorder, condition or association described in any of the categories set forth in Table 3 or 4 (whether in the "opposite strand" column or the "same strand"); upregulations of a set of genes grouped together in any one of the categories is contemplated. Evidence is provided herein that such inhibitory nucleic acids increased expression of mRNA
corresponding to the gene by at least about 50% (i.e. 150% of normal or 1.5-fold), or by about 2-fold to about 5-fold. In some embodiments it is contemplated that expression may be increased by at least about 15-fold, 20-fold, 30-fold, 40-fold, 50- fold or 100-fold, or any range between any of the foregoing numbers. In other experiments, increased mRNA expression has been shown to correlate to increased protein expression.
A summary of the sequences in the sequence listing is set forth below in Table 1.
Table 1
Type Organism Starting Ending
SEQ ID NO. SEQ ID NO. Transcripts Mus musculus 1 47407
Peaks Mus musculus 47408 616428
Transcripts Homo sapiens 616429 652255
Peaks Homo sapiens 652256 916209
Transcripts Homo sapiens 916210 916625 (prior transcriptome)
Peaks+ Homo sapiens 916626 934761 (region around Peak)
Transcripts Mus musculus 934762 934863 (imprinted-Table 4)
Transcripts Homo sapiens 934864 934931 (imprinted-Table 4)
Transcripts Homo sapiens 934932 934968 (prior transcriptome)
The SEQ ID number refers to the RNA that associates (binds) with PRC2 (i.e., the RNA against which inhibitory nucleic acids would be directed). Each of (a) the reference genes described in the tables, (b) the PRC2-binding transcripts or Peaks (i.e., smaller regions of RNA that bind to PRC2) that target (modulate expression of) these genes, and (c) the inhibitory nucleic acids that specifically bind to, or are complementary to, the PRC2 -binding transcripts or Peaks, may conveniently be grouped into any of these categories, represented by numbers in Table 3 as follows:
Diseases are marked by category numbers 1 1, 14, 15, 17, 21, 24, 26, 42, 44, 49, 58, 69, 82, 103, 1 19, 120, 126, 143, 163, 167, 172, 177, 182, 183, 184, 187, 191, 196, 200, 203, 204, 219, 220, 221, 227, 234, 239, 240, 244, 249, any one of 300-323, or any one of 400-643.
Other functional groups are marked by category numbers 10, 12, 13, 16, 18, 19, 20, 22, 23, 25, 27, 28, 29, 30, 31, 32, 33, 34, 36, 37, 38, 39, 40, 41, 43, 45, 46, 47, 48, 50, 51, 52, 54, 55, 56, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98,
100, 101, 102, 104, 105, 106, 107, 108, 109, 110, 1 11, 1 12, 1 13, 114, 115, 116, 1 17, 118, 121, 122, 123, 124, 125, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 158, 160, 161, 162, 164, 165, 166, 168, 169, 170, 171, 173, 174, 175, 176, 178, 179, 180, 181, 185, 186, 188, 189, 190, 192, 193, 194, 195, 197, 198, 199, 201 , 202, 205, 206, 207, 208, 209, 210, 21 1, 213, 215, 216, 217, 218, 222, 223, 224, 226, 228, 229, 230, 231, 232, 233, 235, 236, 237, 238, 241, 242, 243, 245, 246, 247, 248, 250, 251, 252, or 253. Category
No. Name:
10 actin cytoskeleton organization
11 Acute myeloid leukemia, also in category 644
12 Adherens j unction
13 Adipocytokine signaling pathway
14 aging
15 Alzheimer's disease
16 Amino sugar and nucleotide sugar metabolism
17 Amyotrophic lateral sclerosis (ALS)
18 angiogenesis
19 Apoptosis
20 Arginine and proline metabolism
21 Arrhythmogenic right ventricular cardiomyopathy (ARVC)
22 Axon guidance
23 B cell receptor signaling pathway
24 Basal cell carcinoma, also in category 644
25 Basal transcription factors
26 Bladder cancer, also in category 644
27 blood coagulation
28 blood vessel development
29 bone development
30 Calcium signaling pathway
31 Cardiac muscle contraction
32 cation channel activity
33 cell adhesion
34 cell cycle
36 cell motion
37 cell surface receptor linked signal transduction
38 cellular response to stress
39 channel activity
40 Chemokine signaling pathway
41 cholesterol metabolic process
42 Chronic myeloid leukemia, also in category 644 Citrate cycle (TCA cycle)
Colorectal cancer, also in category 644
Complement and coagulation cascades
cytokine activity
cytoskeletal protein binding
cytosol
Dilated cardiomyopathy
DNA binding
DNA repair
DNA replication
Drug metabolism
embryonic morphogenesis
endocytosis
Endometrial cancer, also in category 644
endoplasmic reticulum
ErbB signaling pathway
extracellular region
eye development
fatty acid metabolism
Fructose and mannose metabolism
G-protein coupled receptor protein signaling pathway gamete generation
Gap junction
gene silencing by miRNA
Glioma, also in category 644
glucose metabolic process
Glycolysis / Gluconeogenesis
Golgi apparatus
growth factor activity, also in category 644
GTPase regulator activity
heart development
Hedgehog signaling pathway
Hematopoietic cell lineage
hemopoiesis 79 hemopoietic or lymphoid organ development
80 histone modification
81 Huntington's disease
82 Hypertrophic cardiomyopathy (HCM)
83 immune response
84 immune system development
85 inflammatory response
86 Insulin signaling pathway
87 intracellular signaling cascade
88 ion channel activity
89 ion transport
90 Jak-STAT signaling pathway
91 learning or memory
92 leukocyte activation
93 Leukocyte transendothelial migration
94 limb development
95 locomotory behavior
96 Long-term potentiation
97 lung development
98 lysosome
100 MAPK signaling pathway
101 MAPKKK cascade
102 Melanogenesis
103 Melanoma, also in category 644
104 Mismatch repair
105 mitochondrion
106 mitochondrion organization
107 mTOR signaling pathway
108 muscle tissue development
109 ncRNA metabolic process
110 neuron development
11 1 Neurotrophin signaling pathway
112 Non-small cell lung cancer, also in category 644
113 Notch signaling pathway 114 nucleolus
115 Oocyte meiosis
116 oxidation reduction
117 Oxidative phosphorylation
118 p53 signaling pathway
119 Pancreatic cancer, also in category 644
120 Parkinson's disease
121 Pathways in cancer, also in category 644
122 phosphatase activity
123 phosphoprotein phosphatase activity
124 positive regulation of cellular biosynthetic process
125 PPAR signaling pathway
126 Prostate cancer, also in category 644
127 Proteasome
128 protein amino acid dephosphorylation
129 protein folding
130 protein kinase activity
131 protein serine/threonine kinase activity
132 Purine metabolism
133 Pyrimidine metabolism
134 Ras protein signal transduction
135 Regulation of actin cytoskeleton
136 Regulation of autophagy
137 regulation of cell death, also in category 644
138 regulation of cell proliferation, also in category 644
139 regulation of cell size
140 regulation of protein ubiquitination
141 regulation of Ras protein signal transduction
142 regulation of transcription
143 Renal cell carcinoma, also in category 644
144 response to hypoxia
145 response to steroid hormone stimulus
146 response to virus
147 ribosome 148 RNA degradation
149 RNA processing
150 RNA splicing, via transesterification reactions
151 secretion
152 skeletal system development
153 skeletal system morphogenesis
154 Small cell lung cancer, also in category 644
155 small GTPase regulator activity
156 spermatogenesis
157 Sphingolipid metabolism
158 spliceosome
158 Spliceosome
160 stem cell differentiation
161 Steroid biosynthesis
162 synapse
163 Systemic lupus erythematosus
164 T cell activation
165 T cell receptor signaling pathway
166 TGF-beta signaling pathway
167 Thyroid cancer, also in category 644
168 Toll-like receptor signaling pathway
169 transcription activator activity
170 transcription factor activity
171 translation
172 Type II diabetes mellitus
173 Ubiquitin mediated proteolysis
174 Vascular smooth muscle contraction
175 vasculature development
176 VEGF signaling pathway
177 Viral myocarditis
178 Wnt signaling pathway
179 amino-acid biosynthesis
180 ank repeat
181 bromodomain 182 Cardiomyopathy
183 cataract
184 charcot-marie-tooth disease
185 cytokine
186 cytokine receptor
187 deafness
188 disease mutation
189 egf-like domain
190 endosome
191 epilepsy
192 glycoprotein
193 growth factor, also in category 644
194 Growth factor binding, also in category 644
195 growth factor receptor, also in category 644
196 Ichthyosis
197 Immunoglobulin domain
198 ionic channel
199 leucine -rich repeat
200 leukodystrophy
201 methylation
202 methyltransferase
203 neurodegeneration
204 neuropathy
205 nucleus
206 obesity
207 protein phosphatase
208 protein phosphatase inhibitor
209 Proto-oncogene or oncogene, also in category 644
210 Secreted
21 1 serine/threonine-specific protein kinase
213 transmembrane
215 tumor suppressor, also in category 644
216 tyrosine-protein kinase
217 ubl conjugation pathway 218 wd repeat
219 Allograft rejection
220 Asthma
221 Autoimmune thyroid disease
222 autophagy
223 BMP signaling pathway
224 cardiac muscle
226 complement alternate pathway
227 diabetes mellitus
228 glycosylation
229 Graft-versus-host disease
230 induction of apoptosis
231 innate immune response
232 iron transport
233 lipid metabolism
234 Maturity onset diabetes of the young
235 metalloprotease
236 myeloid cell differentiation
237 neurogenesis
238 neuron differentiation
239 non-syndromic deafness
240 osteogenesis
241 Pentose phosphate pathway
242 positive regulation of cell death, also in categoiy 644
243 Primary bile acid biosynthesis
244 Primary immunodeficiency
245 regulation of I-kappaB kinase/NF-kappaB cascade
246 regulation of leukocyte activation
247 Renin-angiotensin system
248 response to corticosteroid stimulus
249 retinitis pigmentosa
250 Serine protease
251 Starch and sucrose metabolism
252 tumor antigen, also in category 644 253 wound healing
300 Downregulated in Bladder cancer, also in category 644
301 Downregulated in Leukemia, also in category 644
302 Downregulated in Brain cancer, also in category 644
303 Downregulated in Breast cancer, also in category 644
304 Downregulated in Cervical cancer, also in category 644
305 Downregulated in Colon cancer, also in category 644
306 Downregulated in Esophageal cancer, also in category 644
307 Downregulated in Gastric cancer, also in category 644
308 Downregulated in Head and Neck cancer, also in category 644
309 Downregulated in Renal cancer, also in category 644
310 Downregulated in Liver cancer, also in category 644
31 1 Downregulated in Lung cancer, also in category 644
312 Downregulated in Lymphoma, also in category 644
313 Downregulated in Melanoma, also in category 644
314 Downregulated in Multiple Myeloma, also in category 644
315 Downregulated in Ovarian cancer, also in category 644
316 Downregulated in Pancreatic cancer, also in category 644
317 Downregulated in Prostate cancer, also in category 644
318 Downregulated in Sarcoma, also in category 644
319 Downregulated in Non-melanoma skin cancer, also in category 644
320 Downregulated in Uterine cancer, also in category 644
321 Downregulated in Mesothelioma, also in category 644
322 Downregulated in Adrenal cancer, also in category 644
323 Downregulated in Parathyroid cancer, also in category 644
400 Upregulated in Clear cell sarcoma of kidney, also in category 644
401 Upregulated in Acute lung injury
402 Upregulated in Acute megakaryoblastic leukemia, also in category 644
403 Upregulated in Acute myelocytic leukemia, also in category 644 404 Upregulated in Acute pancreatitis unspecified
405 Upregulated in Adenocarcinoma of esophagus, also in category 644
406 Upregulated in Adenocarcinoma of lung, also in category 644
407 Upregulated in Adenoma of small intestine, also in category 644
408 Upregulated in Adenovirus infection 409 Upregulated in AIDS with encephalitis
410 Upregulated in Alcohol poisoning
41 1 Upregulated in Alexander disease
412 Upregulated in alpha- 1 -Antitrypsin deficiency
413 Upregulated in Alzheimer's disease
414 Upregulated in Anaplastic oligoastrocytoma, also in category 644
415 Upregulated in Androgen insensitivity syndrome
416 Upregulated in Astrocytoma, also in category 644
417 Upregulated in Atrophy - muscular
418 Upregulated in Autoimmune hepatitis
419 Upregulated in Bacterial infection
420 Upregulated in Barrett's esophagus
421 Upregulated in Carcinoma in situ of small intestine, also in category
422 Upregulated in Cardiomyopathy
423 Upregulated in Chronic granulomatous disease
424 Upregulated in Chronic lymphocytic leukemia, also in category 644
425 Upregulated in Chronic obstructive airway disease
426 Upregulated in Chronic polyarticular juvenile rheumatoid arthritis
427 Upregulated in Cirrhosis of liver
428 Upregulated in Cocaine dependence
429 Upregulated in Complex dental caries
430 Upregulated in Crohn's disease
431 Upregulated in Decompensated cardiac failure
432 Upregulated in Dehydration
433 Upregulated in Dilated cardiomyopathy
434 Upregulated in Dilated cardiomyopathy secondary to viral myocarditis
435 Upregulated in Epithelial proliferation
436 Upregulated in Escherichia coli infection of the central nervous system
437 Upregulated in Essential thrombocythemia
438 Upregulated in Exhaustion due to excessive exertion
439 Upregulated in Familial hypophosphatemic bone disease
440 Upregulated in Fracture
441 Upregulated in Fracture of femur 442 Upregulated in Generalized ischemic myocardial dysfunction
443 Upregulated in Glioblastoma, also in category 644
444 Upregulated in Hamman-Rich syndrome
445 Upregulated in Helicobacter pylori gastrointestinal tract infection
446 Upregulated in Hepatitis C
447 Upregulated in HIV infection
448 Upregulated in Huntington's disease
449 Upregulated in Hypercholesterolemia
450 Upregulated in Hypertrophy
451 Upregulated in Idiopathic thrombocytopenic purpura
452 Upregulated in Infection by Yersinia enterocolitica
453 Upregulated in Infertility due to azoospermia
454 Upregulated in Injury of heart
455 Upregulated in ISM - In situ melanoma of skin, also in category 644
456 Upregulated in Leber's amaurosis
457 Upregulated in Liver carcinoma, also in category 644
458 Upregulated in Macular degeneration
459 Upregulated in Malignant lymphoma, also in category 644
460 Upregulated in Malignant neoplasm of cervix uteri, also in category 644
461 Upregulated in Malignant neoplasm of duodenum, also in category 644
462 Upregulated in Malignant neoplasm of prostate, also in category 644
463 Upregulated in Malignant neoplasm of stomach, also in category 644
464 Upregulated in Malignant neoplasm of testis, also in category 644
465 Upregulated in Malignant tumor of colon, also in category 644
466 Upregulated in Multiple benign melanocytic nevi
467 Upregulated in Nephropathy - diabetic
468 Upregulated in Non-insulin dependent diabetes mellitus
469 Upregulated in Nutritional deficiency
470 Upregulated in Obstructive sleep apnea
471 Upregulated in Oligodendroglioma, also in category 644
472 Upregulated in Papillary thyroid carcinoma, also in category 644
473 Upregulated in Parkinson disease
474 Upregulated in Porcine nephropathy 475 Upregulated in Pre-eclampsia
476 Upregulated in Primary cardiomyopathy
477 Upregulated in Primary open angle glaucoma
478 Upregulated in Primary pulmonary hypoplasia
479 Upregulated in Pseudomonas infection
480 Upregulated in Pulmonary emphysema
481 Upregulated in Pulmonary hypertension
482 Upregulated in Renal disorder associated with type II diabetes mellitus
483 Upregulated in Retinal damage
484 Upregulated in Retinitis pigmentosa
485 Upregulated in Rheumatoid arthritis
486 Upregulated in Squamous cell carcinoma, also in category 644
487 Upregulated in Squamous cell carcinoma of lung, also in category 644
488 Upregulated in Status epilepticus
489 Upregulated in Systemic infection
490 Upregulated in Thrombocytopenia
491 Upregulated in Thymic carcinoma, also in category 644
492 Upregulated in Transitional cell carcinoma, also in category 644
493 Upregulated in Transitional cell carcinoma in situ, also in category 644
494 Upregulated in Ulcerative colitis
495 Upregulated in Uterine fibroids
496 Upregulated in Ventilator-associated lung injury
497 Upregulated in Ventricular hypertrophy
498 Upregulated in Ventricular hypertrophy (& [left])
499 Upregulated in Vitamin A deficiency
500 Downregulated in Clear cell sarcoma of kidney, also in category 644
501 Downregulated in Acute lung injury
502 Downregulated in Acute megakaryoblastic leukemia, also in category
503 Downregulated in Acute myelocytic leukemia, also in category 644
504 Downregulated in Acute pancreatitis unspecified
505 Downregulated in Adenocarcinoma of esophagus, also in category 644
506 Downregulated in Adenocarcinoma of lung, also in category 644
507 Downregulated in Adenoma of small intestine, also in category 644 508 Downrej julated in
509 Downrej julated in
510 Downrej julated in
51 1 Downrej julated in
512 Downrej julated in
513 Downrej julated in
514 Downrej julated in
515 Downrej julated in
516 Downrej julated in
517 Downrej julated in
518 Downrej julated in
519 Downregulated in
520 Downrej julated in
521 Downrej julated in
644
522 Downrej julated in Cardiomyopathy
523 Downrej julated in Chronic granulomatous disease
524 Downrej julated in Chronic lymphocytic leukemia, also in category 644
525 Downrej julated in Chronic obstructive airway disease
526 Downrej julated in Chronic polyarticular juvenile rheumatoid arthritis
527 Downrej julated in Cirrhosis of liver
528 Downrej julated in Cocaine dependence
529 Downrej julated in Complex dental caries
530 Downrej julated in Crohn's disease
531 Downrej julated in Decompensated cardiac failure
532 Downrej julated in Dehydration
533 Downrej julated in Dilated cardiomyopathy
534 Downrej julated in Dilated cardiomyopathy secondary to viral myocarditis
535 Downrej julated in
536 Downrej julated in
system
537 Downrej julated in
538 Downrei mlated in Downregulated in Familial hypophosphatemia bone disease
Downregulated in Fracture
Downregulated in Fracture of femur
Downregulated in Generalized ischemic myocardial dysfunction Downregulated in Glioblastoma, also in category 644
Downregulated in Hamman-Rich syndrome
Downregulated in Helicobacter pylori gastrointestinal tract infection
Downregulated in Hepatitis C
Downregulated in HIV infection
Downregulated in Huntington's disease
Downregulated in Hypercholesterolemia
Downregulated in Hypertrophy
Downregulated in Idiopathic thrombocytopenic purpura Downregulated in Infection by Yersinia enterocolitica Downregulated in Infertility due to azoospermia
Downregulated in Injury of heart
Downregulated in ISM - In situ melanoma of skin, also in category 644
Downregulated in Leber's amaurosis
Downregulated in Liver carcinoma, also in category 644
Downregulated in Macular degeneration
Downregulated in Malignant lymphoma, also in category 644
Downregulated in Malignant neoplasm of cervix uteri, also in category
Downregulated in Malignant neoplasm of duodenum, also in category 644
Downregulated in Malignant neoplasm of prostate, also in category
644
Downregulated in Malignant neoplasm of stomach, also in category
Downregulated in Malignant neoplasm of testis, also in category 644 Downregulated in Malignant tumor of colon, also in category 644 Downregulated in Multiple benign melanocyte nevi
Downregulated in Nephropathy - diabetic
Downregulated in Non-insulin dependent diabetes mellitus Downregulated in Nutritional deficiency
Downregulated in Obstructive sleep apnea
Downregulated in Oligodendroglioma, also in category 644
Downregulated in Papillary thyroid carcinoma, also in category 644
Downregulated in Parkinson disease
Downregulated in Porcine nephropathy
Downregulated in Pre-eclampsia
Downregulated in Primary cardiomyopathy
Downregulated in Primary open angle glaucoma
Downregulated in Primary pulmonary hypoplasia
Downregulated in Pseudomonas infection
Downregulated in Pulmonary emphysema
Downregulated in Pulmonary hypertension
Downregulated in Renal disorder associated with type II diabetes
Downregulated in Retinal damage
Downregulated in Retinitis pigmentosa
Downregulated in Rheumatoid arthritis
Downregulated in Squamous cell carcinoma, also in category 644 Downregulated in Squamous cell carcinoma of lung, also in category
Downregulated in Status epilepticus
Downregulated in Systemic infection
Downregulated in Thrombocytopenia
Downregulated in Thymic carcinoma, also in category 644
Downregulated in Transitional cell carcinoma, also in category 644
Downregulated in Transitional cell carcinoma in situ, also in category
Downregulated in Ulcerative colitis
Downregulated in Uterine fibroids
Downregulated in Ventilator-associated lung injury
Downregulated in Ventricular hypertrophy
Downregulated in Ventricular hypertrophy (& [left])
Downregulated in Vitamin A deficiency 600 is associated w th Bone diseases
601 is associated w th Cancer diseases, also in category 644
602 is associated w th Cardiovascular diseases
603 is associated w th Connective tissue disorder diseases
604 is associated w th Dermatological diseases
605 is associated w th Developmental diseases
606 is associated w th Ear,Nose,Throat diseases
607 is associated w th Endocrine diseases
608 is associated w th Gastrointestinal diseases
609 is associated w th Hematological diseases
610 is associated w th Immunological diseases
61 1 is associated w th Metabolic diseases
612 is associated w th multiple diseases
613 is associated w th Muscular diseases
614 is associated w th Neurological diseases
615 is associated w th Nutritional diseases
616 is associated w th Ophthamological diseases
617 is associated w th Other diseases
618 is associated w th Psychiatric diseases
619 is associated w th Renal diseases
620 is associated w th Respiratory diseases
621 is associated w th Skeletal diseases
622 is decreased in Bone diseases
623 is decreased in Cancer diseases, also in category 644
624 is decreased in Cardiovascular diseases
625 is decreased in Connective tissue disorder diseases
626 is decreased in Dermatological diseases
627 is decreased in Developmental diseases
628 is decreased in Ear,Nose,Throat diseases
629 is decreased in Endocrine diseases
630 is decreased in Gastrointestinal diseases
631 is decreased in Hematological diseases
632 is decreased in Immunological diseases
633 is decreased in Metabolic diseases 634 is decreased in multiple diseases
635 is decreased in Muscular diseases
636 is decreased in Neurological diseases
637 is decreased in Nutritional diseases
638 is decreased in Ophthamological diseases
639 is decreased in Other diseases
640 is decreased in Psychiatric diseases
641 is decreased in Renal diseases
642 is decreased in Respiratory diseases
643 is decreased in Skeletal diseases
644 is involved in cancer
Thus, in various aspects, the invention features inhibitory nucleic acids that specifically bind to any of the RNA sequences of any of Tables 1-4, for use in modulating expression of a group of reference genes that fall within any one or more of the categories set forth in the tables, and for treating the corresponding diseases, disorders or conditions in any one or more of the categories set forth in Table 3 or 4 (which sets forth the diseases, disorders or conditions associated with each reference gene).
In another aspect, the invention also features inhibitory nucleic acids that specifically bind, or are complementary, to any of the RNA sequences of SEQ ID NOS: 47,408 to 616,428 [mouse Peaks] or 652,256 to 916,209 [human Peaks] or 916,626 to 934,761 [longer region surrounding human Peaks], whether in the "opposite strand" column or the "same strand" column of Table 2. In some embodiments, the inhibitory nucleic acid is provided for use in a method of modulating expression of a gene targeted by the PRC2-binding RNA (e.g., an intersecting or nearby gene, as set forth in any of Tables 1-4 below). Such methods may be carried out in vitro, ex vivo, or in vivo. In some embodiments, the inhibitory nucleic acid is provided for use in methods of treating disease, e.g. as described in Table 3 below. The treatments may involve modulating expression (either up or down) of a gene targeted by the PRC2 -binding RNA, preferably upregulating gene expression. In some embodiments, the inhibitory nucleic acid is formulated as a sterile composition for parenteral administration. The reference genes targeted by these RNA sequences are set forth in Tables 2-4 and are grouped according to categories 1-644 in Table 3 or are imprinted genes set forth in Table 4. Thus, in one aspect the invention describes a group of inhibitory nucleic acids that specifically bind, or are complementary to, a group of RNA sequences, either transcripts or Peaks, in any one of categories 1-644. In particular, the invention features uses of such inhibitory nucleic acids to upregulate expression of any of the reference genes set forth in Tables 2-3, for use in treating a disease, disorder, condition or association described in any of the categories set forth in Table 3 (e.g., any one or more of category numbers 11, 14, 15, 17, 21, 24, 26, 42, 44, 49, 58, 69, 82, 103, 119, 120, 126, 143, 163, 167, 172, 177, 182, 183, 184, 187, 191, 196, 200, 203, 204, 212, 300- 323, and/or 400-644).
By way of nonlimiting example, category 45 (Complement and coagulation cascades) includes reference genes selected from the group consisting of A2M, SERPINC1, BDKRB1, BDKRB2, CFB, SERPING1, C1QA, C1QB, C1QC, C1R, CIS, C2, C3, C3AR1, C4A, C4B, C4BPA, C4BPB, C5, C5AR1, C6, C7, C8A, C8B, C9, CD59, CPB2, CR1, CR2, CD55, CFD, F2, F3, F5, F7, F8, F9, F10, Fl l, F12, F13A1, F13B, FGA, FGB, FGG, SERPIND1, CFH, CFI, KLKB1, KNG1, MBL2, CD46, SERPINE1, SERPINA1, PLAT, PLAU, PLAUR, PLG, SERPINF2, PROC, PROS1, MASP1, TFPI, THBD, VWF and/or MASP2
In turn, each of A2M, SERPINC1, BDKRB1, BDKRB2, CFB, SERPING1, C1QA, C1QB, C1QC, C1R, CIS, C2, C3, C3AR1, C4A, C4B, C4BPA, C4BPB, C5, C5AR1, C6, C7, C8A, C8B, C9, CD59, CPB2, CR1, CR2, CD55, CFD, F2, F3, F5, F7, F8, F9, F10, Fl l, F12, F13A1, F13B, FGA, FGB, FGG, SERPIND1, CFH, CFI, KLKB1, KNG1, MBL2, CD46, SERPINE1, SERPINA1, PLAT, PLAU, PLAUR, PLG, SERPINF2, PROC, PROS1, MASP1, TFPI, THBD, VWF and/or MASP2 are targeted by PRC2-associated RNA having the SEQ ID NOs displayed in the applicable row of Table 2. For example, F2-targeting SEQ ID NOs include SEQ ID NOS: 620037 [F], 620035 [-4027], 790730 [-4752], 4539 [-2059], 341288 [-3278], 4537 [-4639] on the same strand as the coding gene, and SEQ ID NOS: 620036 [F], 790731 [F], 4538 [F], 341286 [F], 341287 [F] on the opposite strand from the coding gene, according to Table 2.
The group of inhibitory nucleic acids that specifically bind to, or are complementary to, any one of these SEQ ID NOS: that are listed in Table 2 as targeting refGenes A2M, SERPINC1, BDKRB1, BDKRB2, CFB, SERPING1, C1QA, C1QB, C1QC, C1R, CIS, C2, C3, C3AR1, C4A, C4B, C4BPA, C4BPB, C5, C5AR1, C6, C7, C8A, C8B, C9, CD59, CPB2, CR1, CR2, CD55, CFD, F2, F3, F5, F7, F8, F9, F10, Fl l, F12, F13A1, F13B, FGA, FGB, FGG, SERPIND1, CFH, CFI, KLKB 1, K G1, MBL2, CD46, SERPINE1, SERPINA1, PLAT, PLAU, PLAUR, PLG, SERPINF2, PROC, PROS1, MASP1, TFPI, THBD, VWF and/or MASP2 are contemplated for use in any of the compositions and methods described herein, including but not limited to use in treating a disease of category 45 (Complement and coagulation cascades), the treatment involving modulation of any of the refGenes A2M, SERPINC1, BDKRB 1, BDKRB2, CFB, SERPING1, C1QA, C1QB, C1QC, C1R, CI S, C2, C3, C3AR1, C4A, C4B, C4BPA, C4BPB, C5, C5AR1, C6, C7, C8A, C8B, C9, CD59, CPB2, CR1, CR2, CD55, CFD, F2, F3, F5, F7, F8, F9, F10, Fl l, F12, F13A1, F13B, FGA, FGB, FGG, SERPI D1, CFH, CFI, KLKB1, KNG1,
MBL2, CD46, SERPI E1, SERPINA1, PLAT, PLAU, PLAUR, PLG, SERPINF2, PROC, PROS1, MASP1, TFPI, THBD, VWF and/or MASP2.
Similarly, inhibitory nucleic acids that specifically bind to, or are
complementary to, genes in category 643 ("is decreased in Skeletal disease") are contemplated for use in any of the compositions and methods described herein, including but not limited to use in treating Skeletal disease. Inhibitory nucleic acids that specifically bind to, or are complementary to, genes in the categories that are also part of category 644 (involved in cancer) are contemplated for use in any of the compositions and methods described herein, including but not limited to use in treating cancer..
It is understood that inhibitory nucleic acids of the invention may be complementary to, or specifically bind to, Peaks, or non-Peak regions of transcripts disclosed herein, or regions adjacent to Peaks. In various aspects, the invention also features inhibitory nucleic acids that bind to the R A sequence between two or more Peaks that correspond to chromosomal coordinates that are near each other, e.g. within 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, lkb, or 2kb, of each other, and that are preferably associated with the same reference gene in Table 2. For example, the invention features inhibitory nucleic acids that specifically bind, or are complementary to, a fragment of any of the RNA transcripts of SEQ ID NOS: 1 - 47,407 or 934,762 - 934,S63[mouse transcripts] or 616,429 - 652,255 or 916,210 - 916,625 or 934,864 - 934,968 [human transcripts] or 916,626 to 934,76 \ \larger region surrounding human Peaks], said fragment about 2000, about 1750, about 1500, about 1250 nucleotides in length, or preferably about 1000, about 750, about 500, about 400, about 300 nucleotides in length, or more preferably about 200, about 150, or about 100 nucleotides in length, wherein the fragment of RNA comprises a stretch of at least five (5) consecutive nucleotides within any of SEQ ID NOS: 47,408 to 616,428 [mouse Peaks] or 652,256 to 916,209 [human Peaks], or Appendix I of U.S. Prov. Appl. No. 61/425, 174 filed on December 20, 2010, which is not attached hereto but is incorporated by reference herein in its entirety. In exemplary embodiments the fragment of RNA comprises at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 consecutive nucleotides within any of SEQ ID NOS: 47,408 to 616,428 [mouse Peaks] or 652,256 to 916,209 [human Peaks], or the reverse complement of any of the cDNA sequences of Appendix I of U.S. Prov. Appl. No. 61/425, 174 filed on December 20, 2010.
Thus, for example, this description includes inhibitory nucleic acids that bind to fragments about 2000, about 1750, about 1500, about 1250 nucleotides in length, or preferably about 1000, about 750, about 500, about 400, about 300 nucleotides in length, or more preferably about 200, about 150, or about 100 nucleotides in length, which are:
(a) fragments of any of SEQ ID NOs: 1-47407 [mouse transcripts] that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 47408-616428 [mouse Peaks], preferably associated with the same reference gene in Table 2;
(b) fragments of any of SEQ ID NOs: 616429-652255 [human transcripts] that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 652256-916209 [human Peaks], preferably associated with the same reference gene in Table 2;
(c) fragments of any of SEQ ID NOs: 916626-934761 [longer regions around human Peaks] that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 652256- 916209 [human Peaks], preferably associated with the same reference gene in Table 2;
(d) fragments of any of SEQ ID NOs: 934762-934863 [mouse imprinted transcripts] that encompass that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 47408-616428 [mouse Peaks], preferably associated with the same reference gene in Table 2 or 4; (e) fragments of any of SEQ ID Os: 629991, 629992, 630983, 630984, 630990, 631003, 631004, 632396, 632397, 632402, 632403, 632419, 632422, 634959, 638303, 638304, 647595, 647596, 647597, 647598, 647601, 649028, and 934864-934931 [human imprinted transcripts] that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 652256-916209 [human Peaks], preferably associated with the same reference gene in Table 2 or 4;
(f) fragments of any of SEQ ID NOs: 916210- 916625 [human transcripts] that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 652256-916209
[human Peaks], preferably associated with the same reference gene in Table 2; or
(g) fragments of any of SEQ ID NOs: 934932-934968 [human transcripts] that comprise a stretch of at least five (5) consecutive nucleotides, or 6, 7, 8, 9 or 10 or more consecutive nucleotides, within any of SEQ ID NOs: 652256-916209
[human Peaks], preferably associated with the same reference gene in Table 2.
In some or any embodiments, the inhibitory nucleic acids are, e.g., about 5 to 40, about 8 to 40, or 10 to 50 bases, or 5 to 50 bases in length. In some
embodiments, the inhibitory nucleic acid comprises or consists of a sequence of bases at least 80% or 90% complementary to, e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of, the target RNA (i.e., any one of SEQ ID NOs: 1 to 916,209, or 916,626 to 934,931), or comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases of the target RNA.
Thus, as noted above, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 80% complementary to at least 10, or 10-30 or 10-40 contiguous bases of the target RNA, or at least 80% complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 80% complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 80% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 80% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 80% complementary to at least 40 contiguous bases of the target RNA. Moreover, the inhibitory nucleic acid can comprise or consist of a sequence of bases at least 90% complementary to at least 5, or 5-30 or 5-40 or 8-40 contiguous bases of the target RNA, or at least 90% complementary to at least 10, or 10-30, or 10-40 contiguous bases of the target RNA, or at least 90%complementary to at least 15, or 15-30, or 15-40 contiguous bases of the target RNA, or at least 90%
complementary to at least 20, or 20-30, or 20-40 contiguous bases of the target RNA, or at least 90% complementary to at least 25, or 25-30, or 25-40 contiguous bases of the target RNA, or at least 90% complementary to at least 30, or 30-40 contiguous bases of the target RNA, or at least 90% complementary to at least 40 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases fully complementary to at least 5, 10, or 15 contiguous bases of the target RNA. It is understood that some additional non-complementary bases may be included. It is understood that inhibitory nucleic acids that comprise such sequences of bases as described may also comprise other non-complementary bases. For example, an inhibitory nucleic acid can be 20 bases in total length but comprise a 15 base portion that is fully complementary to 15 bases of the target RNA. Similarly, an inhibitory nucleic acid can be 20 bases in total length but comprise a 15 base portion that is at least 80% complementary to 15 bases of the target RNA.
Complementarity can also be referenced in terms of the number of mismatches in complementary base pairing, as noted above. Thus, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 3 mismatches over 10 contiguous bases of the target RNA, or up to 3 mismatches over 15 contiguous bases of the target RNA, or up to 3 mismatches over 20 contiguous bases of the target RNA, or up to 3 mismatches over 25 contiguous bases of the target RNA, or up to 3 mismatches over 30 contiguous bases of the target RNA. Similarly, the inhibitory nucleic acid can comprise or consist of a sequence of bases with up to 2 mismatches over 10 contiguous bases of the target RNA, or up to 2 mismatches over 15 contiguous bases of the target RNA, or up to 2 mismatches over 20 contiguous bases of the target RNA, or up to 2 mismatches over 25 contiguous bases of the target RNA, or up to 2 mismatches over 30 contiguous bases of the target RNA. Similarly, the the inhibitory nucleic acid can comprise or consist of a sequence of bases with one mismatch over 10, 15, 20, 25 or 30 contiguous bases of the target RNA.
In some or any of the embodiments of inhibitory nucleic acids described herein (e.g. in the summary, detailed description, or examples of embodiments) or the processes for designing or synthesizing them, the inhibitory nucleic acids may optionally exclude (a) any one or more of the specific inhibitory nucleic acids made or actually disclosed (i.e. specific chemistry, single or double-stranded, specific modifications, and specific base sequence), set forth in the following SEQ ID NOs:; and/or (b) the general base sequence of any one or more of the inhibitory nucleic acids of (a); and/or (c) the group of inhibitory nucleic acids that specifically bind or are complementary to the same specific portion of RNA (a stretch of contiguous bases) as any one or more of the inhibitory nucleic acids of (a); as disclosed in any one or more of the following publications: as target HOTAIR RNA (Rinn et al., 2007), Tsix, RepA, or Xist RNAs ((Zhao et al, 2008) [SEQ ID NOs: 936166 - 936170], or (Sarma et al, 2010) [SEQ ID NOs: 936177 - 936186] or (Zhao et al, 2010) [SEQ ID NOs: 936187 - 936188] or (Prasnath et al, 2005) [SEQ ID NOs: 936173-936176 ]. or (Shamovsky et al, 2006) [SEQ ID NO: 936172] or (Mariner et al, 2008) [SEQ ID NO: 936171] or (Sunwoo et al, 2008) or (Bernard et al, 2010) [SEQ ID NO: 936189]; or as targeting short RNAs of 50-200 nt that are identified as candidate PRC2 regulators (Kanhere et al, 2010); or (Kuwabara et al, US
2005/0226848) [SEQ ID NOs: 936190 - 936191] or (Li et al, US 2010/0210707) [SEQ ID NOs: 936192 - 936227] or (Corey et al, 7,709,456) [SEQ ID NOs: 936228 - 936245] or (Mattick et al, WO 2009/124341), or (Corey et al, US 2010/0273863) [SEQ ID NOs: 936246 - 936265], or (Wahlstedt et al, US 2009/0258925) [SEQ ID NOs: 935060 - 935126], or BACE: US 2009/0258925 [SEQ ID NOs: 935060 - 935126]; ApoAl : US 2010/0105760 / EP235283 [SEQ ID NOs: 935127 - 935299], P73, p53, PTEN, WO 2010/065787 A2 / EP2370582 [SEQ ID NOs: 935300 - 935345]; SIRT1 : WO 2010/065662 A2 / EP09831068 [SEQ ID NOs: : 935346 - 935392]; VEGF: WO 2010/065671 A2 / EP2370581 [SEQ ID NOs: 935393 - 935403]; EPO: WO 2010/065792 A2 / EP09831152 [SEQ ID NOs: 935404 - 935412]; BDNF: WO2010/093904 [SEQ ID NOs: 935413 - 935423], DLK1 : WO 2010/107740 [SEQ ID NOs: 935424 - 935430]; NRF2/NFE2L2: WO 2010/107733 [SEQ ID NOs: 935431 - 935438]; GDNF: WO 2010/093906 [SEQ ID NOs: 935439 - 935476]; SOX2, KLF4, Oct3A/B, "reprogramming factors: WO 2010/135329 [SEQ ID NOs: 935477 - 935493]; Dystrophin: WO 2010/129861 [SEQ ID NOs: 935494 - 935525]; ABCAl, LCAT, LRPl, ApoE, LDLR, ApoAl: WO 2010/129799 [SEQ ID NOs: 935526 - 935804]; HgF: WO 2010/127195 [SEQ ID NOs: 935805 - 935809]; TTP/Zfp36: WO 2010/129746[SEQ ID NOs: 935810 - 935824]; TFE3, IRS2: WO 2010/135695 [SEQ ID NOs: 935825 - 935839]; RIG1, MDA5, IFNA1 : WO
2010/138806 [SEQ ID NOs: 935840 - 935878]; PON1 : WO 2010/148065 [SEQ ID NOs: 935879 - 935885]; Collagen: WO/2010/148050 [SEQ ID NOs: 935886 - 935918]; DyrklA, Dscrl, "Down Syndrome Gene": WO/2010/151674 [SEQ ID NOs: 935919 - 935942]; TNFR2: WO/2010/151671 [SEQ ID NOs: 935943 - 935951]; Insulin: WO/2011/017516 [SEQ ID NOs: 935952 - 935963]; ADIPOQ:
WO/2011/019815 [SEQ ID NOs: 935964 - 935992]; CHIP: WO/2011/022606 [SEQ ID NOs: 935993 - 936004]; ABCB1: WO/2011/025862 [SEQ ID NOs: 936005 - 936014]; NEUROD1, EUROD1, HNF4A, MAFA, PDX, KX6, "Pancreatic development gene": WO/2011/085066 [SEQ ID NOs: 936015 - 936054]; MBTPS1 : WO/2011/084455 [SEQ ID NOs: 936055 - 936059]; SHBG: WO/2011/085347 [SEQ ID NOs: 936060 - 936075]; IRF8: WO/2011/082409 [SEQ ID NOs: 936076 - 936080]; UCP2: WO/2011/079263 [SEQ ID NOs: 936081 - 936093]; HGF:
WO/2011/079261 [SEQ ID NOs: 936094 - 936104]; GH: WO/2011/038205 [SEQ ID NOs: 936105 - 936110]; IQGAP: WO/2011/031482 [SEQ ID NOs: 936111 - 936116]; NRF1: WO/2011/090740 [SEQ ID NOs: 936117 - 936123 -]; P63:
WO/2011/090741 [SEQ ID NOs: 936124 - 936128]; RNAseHl: WO/2011/091390 [SEQ ID NOs: 936129 - 936140]; ALOX12B: WO/2011/097582 [SEQ ID NOs: 936141 - 936146]; PYCR1: WO/2011/103528 [SEQ ID NOs: 936147 - 936151]; CSF3: WO/2011/123745 [SEQ ID NOs: 936152 - 936157]; FGF21 :
WO/2011/127337 [SEQ ID NOs: 936158 - 936165]; SIRTUIN (SIRT):
WO2011/139387 [SEQ ID NOs: 936266 -936369 and 936408-936425]; PAR4: WO2011/143640 [SEQ ID NOs: 936370 - 936376 and 936426]; LHX2:
WO2011/146675 [SEQ ID NOs: 936377 - 936388 and 936427-936429]; BCL2L11 : WO2011/146674 [SEQ ID NO: 936389 - 936398 and 936430-936431]; MSRA: WO2011/150007 [SEQ ID NOs: 936399 - 936405 and 936432]; ATOH1 :
WO2011/150005 [SEQ ID NOs: 936406 - 936407 and 936433] of which each of the foregoing is incorporated by reference in its entirety herein. In some or any of the embodiments, optionally excluded from the invention are of inhibitory nucleic acids that specifically bind to, or are complementary to, any one or more of the following regions: Nucleotides 1-932 of SEQ ID NO: 935128; Nucleotides 1-1675 of SEQ ID NO: 935306; Nucleotides 1-518 of SEQ ID NO: 935307; Nucleotides 1-759 of SEQ ID NO: 935308; Nucleotides 1-25892 of SEQ ID NO: 935309; Nucleotides 1-279 of SEQ ID NO: 935310; Nucleotides 1-1982 of SEQ ID NO: 935311; Nucleotides 1-789 of SEQ ID NO: 935312; Nucleotides 1-467 of SEQ ID NO: 935313; Nucleotides 1- 1028 of SEQ ID NO: 935347; Nucleotides 1-429 of SEQ ID NO: 935348;
Nucleotides 1-156 of SEQ ID NO: 935349; Nucleotides 1-593 of SEQ ID NO:935350; Nucleotides 1-643 of SEQ ID NO: 935395; Nucleotides 1-513 of SEQ ID NO: 935396; Nucleotides 1-156 of SEQ ID NO: 935406; Nucleotides 1 -3175 of SEQ ID NO: 935414; Nucleotides 1-1347 of SEQ ID NO: 935426; Nucleotides 1- 5808 of SEQ ID NO: 935433; Nucleotides 1-237 of SEQ ID NO: 935440;
Nucleotides 1 -1246 of SEQ ID NO: 935441 ; Nucleotides 1-684 of SEQ ID NO: 935442; Nucleotides 1-400 of SEQ ID NO: 935473; Nucleotides 1-619 of SEQ ID NO: 935474;Nucleotides 1-813 of SEQ ID NO: 935475; Nucleotides 1-993 of SEQ ID NO: 935480; Nucleotides 1-401 of SEQ ID NO: 935480; Nucleotides 1 -493 of SEQ ID NO: 935481; Nucleotides 1-418 of SEQ ID NO: 935482; Nucleotides 1-378 of SEQ ID NO: 935496; Nucleotides 1-294 of SEQ ID NO: 935497; Nucleotides 1- 686 of SEQ ID NO: 935498; Nucleotides 1 -480 of SEQ ID NO: 935499; Nucleotides 1-501 of SEQ ID NO: 935500; Nucleotides 1-1299 of SEQ ID NO: 935533;
Nucleotides 1 -918 of SEQ ID NO: 935534; Nucleotides 1-1550 of SEQ ID NO: 935535; Nucleotides 1-329 of SEQ ID NO: 935536; Nucleotides 1-1826 of SEQ ID NO: 935537; Nucleotides 1-536 of SEQ ID NO: 935538; Nucleotides 1-551 of SEQ ID NO: 935539; Nucleotides 1-672 of SEQ ID NO: 935540; Nucleotides 1 -616 of SEQ ID NO: 935541; Nucleotides 1-471 of SEQ ID NO: 935542; Nucleotides 1-707 of SEQ ID NO: 935543; Nucleotides 1-741 of SEQ ID NO: 935544; Nucleotides 1- 346 of SEQ ID NO: 935545; Nucleotides 1 -867 of SEQ ID NO: 935546; Nucleotides 1-563 of SEQ ID NO: 935547; Nucleotides 1-970 of SEQ ID NO: 935812;
Nucleotides 1-1 117 of SEQ ID NO: 935913; Nucleotides 1-297 of SEQ ID NO: 935814; Nucleotides 1-497 of SEQ ID NO: 935827; Nucleotides 1-1267 of SEQ ID NO: 935843; Nucleotides 1-586 of SEQ ID NO: 935844; Nucleotides 1-741 of SEQ ID NO: 935845; Nucleotides 1-251 of SEQ ID NO: 935846 ; Nucleotides 1 -681 of SEQ ID NO: 935847; Nucleotides 1-580 of SEQ ID NO: 935848; Nucleotides 1-534 of SEQ ID NO: 935880; Nucleotides 1-387 of SEQ ID NO: 935889; Nucleotides 1- 561 of SEQ ID NO: 935890; Nucleotides 1-335 of SEQ ID NO: 935891; Nucleotides 1-613 of SEQ ID NO: 935892; Nucleotides 1-177 of SEQ ID NO: 935893;
Nucleotides 1-285 of SEQ ID NO: 935894; Nucleotides 1-3814 of SEQ ID NO: 935921 ; Nucleotides 1-633 of SEQ ID NO: 935922; Nucleotides 1-497 of SEQ ID NO: 935923 Nucleotides 1-545 of SEQ ID NO: 935924; Nucleotides 1-413 of SEQ ID NO: 935950; Nucleotides 1-413 of SEQ ID NO: 935951; Nucleotides 1 -334 of SEQ ID NO: 935962; Nucleotides 1-582 of SEQ ID NO: 935963; Nucleotides 1-416 of SEQ ID NO: 935964; Nucleotides 1-3591 of SEQ ID NO: 935990; Nucleotides 1- 875 of SEQ ID NO: 935991; Nucleotides 1-194 of SEQ ID NO: 935992; Nucleotides 1-2074 of SEQ ID NO: 936003; Nucleotides 1-1237 of SEQ ID NO: 936004;
Nucleotides 1-4050 of SEQ ID NO: 936013; Nucleotides 1-1334 of SEQ ID NO: 936014; Nucleotides 1-1235 of SEQ ID NO: 936048; Nucleotides 1-17,964 of SEQ ID NO: 936049; Nucleotides 1-50,003 of SEQ ID NO: 936050; Nucleotides 1-486 of SEQ ID NO: 936051; Nucleotides 1-494 of SEQ ID NO: 936052; Nucleotides 1-1992 of SEQ ID NO: 936053; Nucleotides 1-1767 of SEQ ID NO: 936054; Nucleotides 1- 1240 of SEQ ID NO: 936059; Nucleotides 1-3016 of SEQ ID NO: 936074;
Nucleotides 1-1609 of SEQ ID NO: 936075; Nucleotides 1-312 of SEQ ID NO: 936080; Nucleotides 1-243 of SEQ ID NO: 936092; Nucleotides 1-802 of SEQ ID NO: 936093; Nucleotides 1-514 of SEQ ID NO: 936102; Nucleotides 1-936 of SEQ ID NO: 936103; Nucleotides 1-1075 of SEQ ID NO: 936104; Nucleotides 1-823 of SEQ ID NO: 936110; Nucleotides 1-979 of SEQ ID NO: 9361 16; Nucleotides 1-979 of SEQ ID NO: 936123; Nucleotides 1-288 of SEQ ID NO: 936128; Nucleotides 1- 437 of SEQ ID NO: 936137; Nucleotides 1-278 of SEQ ID NO: 936138; Nucleotides 1-436 of SEQ ID NO: 936139; Nucleotides 1-1 140 of SEQ ID NO: 936140;
Nucleotides 1-2082 of SEQ ID NO: 936146; Nucleotides 1-380 of SEQ ID NO: 936151 ; Nucleotides 1-742 of SEQ ID NO: 936157; Nucleotides 1-4246 of SEQ ID NO: 936165; Nucleotides 1-1028 of SEQ ID NO: 936408; Nucleotides 1-429 of SEQ ID NO: 936409; Nucleotides 1-508 of SEQ ID NO: 936410; Nucleotides 1 -593 of SEQ ID NO: 93641 1; Nucleotides 1-373 of SEQ ID NO: 936412; Nucleotides 1-1713 of SEQ ID NO: 936413; Nucleotides 1-660 of SEQ ID NO:936414; Nucleotides 1- 589 of SEQ ID NO: 936415; Nucleotides 1-726 of SEQ ID NO: 936416; Nucletides 1-320 of SEQ ID NO: 936417; Nucletides 1-616 of SEQ ID NO: 936418; Nucletides 1-492 of SEQ ID NO: 936419; Nucletides 1-428 of SEQ ID NO: 936420; Nucletides 1-4041 of SEQ ID NO: 936421 ; Nucletides 1-705 of SEQ ID NO: 936422; Nucletides 1-2714 of SEQ ID NO: 936423; Nucletides 1-1757 of SEQ ID NO: 936424;
Nucletides 1-3647 of SEQ ID NO: 936425; Nucleotides 1-354 of SEQ ID NO:
936426; Nucleotides 1-2145 of SEQ ID NO: 936427, Nucleotides 1-606 of SEQ ID NO: 936428; Nucleotides 1-480 of SEQ ID NO: 936429; Nucleotides 1-3026 of SEQ ID NO: 936430; Nucleotides 1-1512 of SEQ ID NO: 936431 ; Nucleotides 1-3774 of SEQ ID NO: 936432; Nucleotides 1-589 of SEQ ID NO: 936433.
In some or any of the embodiments of inhibitory nucleic acids described herein, or processes for designing or synthesizing them, the inhibitory nucleic acids will upregulate gene expression and may specifically bind or specifically hybridize or be complementary to the PRC2 -binding RNA that is transcribed from the same strand as a protein coding reference gene. The inhibitory nucleic acid may bind to a region of the PRC2-binding RNA, that originates within or overlaps an intron, exon, intron- exon junction, 5' UTR, 3' UTR, a translation initiation region, or a translation termination region of a protein-coding sense-strand of a reference gene (refGene).
In some or any of the embodiments of inhibitory nucleic acids described herein, or processes for designing or syntheisizing them, the inhibitory nucleic acids will upregulate gene expression and may specifically bind or specifically hybridize or be complementary to a PRC2 binding RNA that transcribed from the opposite strand (the antisense-strand) of a protein-coding reference gene.
The inhibitory nucleic acids described herein may be modified, e.g. comprise a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or combinations thereof. In addition, the inhibitory nucleic acids can exhibit one or more of the following properties: do not induce substantial cleavage or degradation of the target RNA; do not cause substantially complete cleavage or degradation of the target RNA; do not activate the RNAse H pathway; do not activate RISC; do not recruit any Argonaute family protein; are not cleaved by Dicer; do not mediate alternative splicing; are not immune stimulatory; are nuclease resistant; have improved cell uptake compared to unmodified oligonucleotides; are not toxic to cells or mammals; may have improved endosomal exit; do interfere with interaction of IncRNA with PRC2, preferably the Ezh2 subunit but optionally the Suzl2, Eed, RbAp46/48 subunits or accessory factors such as Jarid2; do decrease histone H3- lysine27 methylation and/or do upregulate gene expression.
In some or any of the embodiments of inhibitory nucleic acids described herein, or processes for designing or synthesizing them, the inhibitory nucleic acids may optionally exclude those that bind DNA of a promoter region, as described in Kuwabara et al, US 2005/0226848 or Li et al, US 2010/0210707 or Corey et al, 7,709,456 or Mattick et al, WO 2009/124341, or those that bind DNA of a 3' UTR region, as described in Corey et al, US 2010/0273863.
Inhibitory nucleic acids that are designed to interact with RNA to modulate gene expression are a distinct subset of base sequences from those that are designed to bind a DNA target (e.g., are complementary to the underlying genomic DNA sequence from which the RNA is transcribed). Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.
REFERENCE TO TABLES SUBMITTED ON A COMPACT DISC
This application includes ten (10) compact discs containing a Sequence
Listing in .txt format, split into ten separate files over the ten discs. The sequence listing files are identified on the compact discs as follows.
The entire content of each of these files is hereby incorporated by reference. DESCRIPTION OF DRAWINGS
Figure 1 is an exemplary RIP-seq schematic.
Table 1 displays the SEQ ID NOs of mouse transcripts and mouse Peaks, along with the SEQ ID NOs of the corresponding human transcript and human Peaks.
Table 2: Intersection of the expanded PRC2 transcriptome, and Peaks generated by overlapping reads in Appendix I, with target genes
The sequence reads in Appendix I (obtained from sequencing cDNA according to Examples 1 -2) represent regions protected from endogenous nucleases during the RIP procedure and thus represent regions of RNA that bind to PRC2. As noted above, Appendix I appears in U.S. Prov. Appln. No. 61/425, 174 filed on December 20, 2010, which is not attached hereto but is incorporated by reference herein in its entirety. The Appendix I sequence reads were overlapped to generate longer contiguous regions of sequence referred to herein as a "Peak." The corresponding nucleotide sequences of the mouse Peaks (converted to RNA by replacing T with U) appear in the sequence listing as SEQ ID NOS: 47,408 to 616,428 [mouse Peaks]. Mouse-to- human LiftOver of the mouse chromosome coordinates and strand of these mouse Peaks was performed in the UCSC genome browser as described herein, to generate orthologous human chromosome coordinates. Each corresponding human Peak RNA sequence (i.e., the nucleotide sequence of the human chromosomal coordinates and strand, converted to RNA by replacing T with U) appear in the sequence listing as SEQ ID NOS: 652,256 to 916,209 [human Peaks].
These human Peaks and the expanded human PRC2 transcriptome (i.e., human sequences of PRC2 binding transcripts referenced in Tables 1-4) were intersected with known genes from the NCBI refGene database to identify genes targeted by the PRC2 -binding RNA (i.e. an intersecting or nearby gene). Similarly, the mouse Peaks and the expanded mouse PRC2 transcriptome of Tables 1-4 were intersected with known genes from the NCBI refGene database to identify genes targeted by the PRC2 -binding RNA (i.e. an intersecting or nearby gene).
For each of the human Peaks that did not match a longer human transcript sequence, a longer 2kb fragment of surrounding human chromosomal sequence was identified, and appears in the sequence listing as SEQ ID NOs 916,626-934,761
[larger region surrounding human Peaks].
Columns 1 and 2 display the SEQ ID NO: of the sequence of all of (a) the human PRC2-binding transcripts, (b) the human Peak sequence within the PRC2- binding RNA, (c) the mouse PRC2 -binding transcripts, and (d) the mouse Peak sequence within the PRC2 -binding RNA, which target the NCBI gene (i.e., are intersecting or nearby) shown in Column 3. Column 3 shows the NCBI gene name and unique NCBI gene ID number (National Library of Medicine (US), National Center for Biotechnology Information; chapter 19, Entrez Gene: A Directory of Genes, ncbi.nlm.nih.gov/gene/). Human gene names appear as all capitals, while mouse gene names appear with only the first letter capitalized.
Column 1 displays SEQ ID NOs for "same strand" PRC2-binding RNA that will have the same strand as the reference NCBI gene (for example, if the NCBI gene is transcribed from the minus strand of the chromosome, then the PRC2-binding RNA is also transcribed from the minus strand). Column 2 displays SEQ ID NOs for "opposite strand" PRC2 -binding RNA that is transcribed from the opposite strand, or antisense-strand, to the reference NCBI gene. SEQ ID NOs. from 1 - 47,407 or 934,762 - 934,863 represent mouse transcripts, while SEQ ID NOs. from 616,429 - 652,255 or 916,210 - 916,625 or 934,864 - 934,968 represent human transcripts, and SEQ ID NOs. 916,626 to 934,761 represent a larger approximately 2kb region surrounding human Peaks. SEQ ID NOs. from 47,408 to 616,428 represent mouse Peaks, while SEQ ID NOs. 652,256 to 916,209 represent human Peaks.
In columns 1 and 2, the degree of overlap between (a) the transcript or Peak coordinates and (b) the NCBI gene coordinates appears in square brackets.A positive number indicates the number of overlapping nucleotides between the two, and a negative number represents the size of the gap between the two (i.e. the number of nucleotides of distance between the two). For Peaks, an "F" within the square brackets indicates that the Peak coordinates fully overlap the gene coordinates. For transcripts, an "F" within the square brackets indicates that the transcript coordinates fully overlap the gene coordinates, or vice versa.
Table 3: Categories of PRC2-binding RNA, genes targeted by the RNA, and uses in treatment of disease
Column 1 shows the NCBI gene name and unique gene ID. Column 2 are the categories of functional groups of genes, and the diseases, disorders or conditions that are associated with these genes and can be treated by modulating their expression. Column 3 is the description of the gene from NCBI.
Table 4: Imprinted regions hit by the expanded PRC2 transcriptome.
Intersection of the expanded PRC2 transcriptome with imprinted gene coordinates (available online at geneimprint.com). The murine imprinted gene (i.e., an intersecting or nearby gene) targeted by the PRC2 -binding transcript is shown in column 1. Column 1 also shows the chromosome strand of the murine imprinted gene ("+"sign indicates that the gene is transcribed from the top or plus strand, while "-" sign indicates that the PRC2 -binding transcript is transcribed from the bottom or minus strand of the chromosome). The chromosome localization and nucleotide coordinates in mm9 of the PRC2-binding transcript are shown in column 2, as well as a "+"sign or "-" sign that indicates whether the PRC2 -binding transcript is transcribed from the top strand (plus strand hit) or bottom strand (minus strand hit) of the chromosome. Column 3 displays the SEQ ID NO: of the mouse PRC2 -binding transcript (i.e., the nucleotide sequence transcribed from the mouse chromosomal coordinates and strand of column 2, converted to RNA by replacing T with U).
Column 4 shows the corresponding human gene name for the murine imprinted gene of column 1, obtained from the Mouse Genome Database (MGD), Mouse Genome Informatics, The Jackson Laboratory, Bar Harbor, Maine. World Wide Web
(informatics.jax.org). Mouse-to-human LiftOver of the mouse chromosome coordinates in column 2, performed in the UCSC genome browser as described herein, generated the orthologous human chromosome coordinates which appear in Column 5. 50% conservation was used for LiftOver analysis. Additional human chromosome coordinates were generated by mapping of highly conserved or homologous regions from the mouse to human genome. Column 6 displays the SEQ ID NO: of the predicted human PRC2 -binding transcript (i.e., the nucleotide sequence transcribed from the human chromosomal coordinates and strand of column 5, converted to RNA by replacing T with U). When the PRC2-interacting transcript is transcribed from the opposite strand compared to the imprinted reference gene in column 1, that implies that the PRC2 -interacting RNA is complementary, or antisense-strand ("opposite strand") in orientation, to the reference imprinted gene. Note that the PRC2-binding transcript need not be the reference imprinted gene itself, but a distinct transcript that overlaps in position.
APPENDIX I, of U.S. provisional application 61/425,174 filed on December 20, 2010, the entirety of which is incorporated by reference herein, is a listing of the complete RIP-seq dataset, showing all of the reads in the dataset. Appendix I is not attached hereto. The sequence reads in Appendix I come directly off the Illumina GA- II genome analyzer and are in an orientation that is the reverse complement of the PRC2 -binding transcript. Appendix I is a filtered subset of all of the reads after bioinformatic filtering removed adaptor/primer dimers, mitochondrial RNA, rRNA, homopolymers, reads with indeterminate nucleotides, and truncated reads (<15nt).
DETAILED DESCRIPTION
The RIP-seq technology described herein was used to capture a genome-wide pool of long transcripts (>200 nt) that bind with the PRC2 complex, directly or indirectly. The expanded PRC2 transcriptome described herein consists of >57,000 RNAs in mouse ES cells. Transcriptome characterization has identified classes of medically significant targets. Many if not all of the mouse PRC2-transcripts have direct counterparts in the human epigenome.
As demonstrated herein, at least a subset of RNAs directly interacts with Polycomb proteins in vivo and, in many cases, the interacting subunit is Ezh2. A recent study indicates that Suzl2 also interacts with RNA (Kanhere et al, 2010). Differences between bacterially- and baculovirus-produced subunits could result in varying post-translational modifications with effects on binding properties. However, it is likely that multiple subunits of PRC2 can be regulated by RNA (especially Ezh2 and Suzl2, both of which have nucleic-acid binding motifs), which could modulate binding between PRC2 subunits, binding affinities of PRC2 for chromatin, and/or Ezh2 catalytic rates. This scenario would amplify the number of potential mechanisms by which RNA regulates Polycomb. The present study suggests thousands of RNA cofactors for Ezh2, the bait used for RIP-seq, specifically as part of the PRC2 complex. To the present inventors' knowledge, Ezh2 is only present in Polycomb complexes, as biochemical purification using tagged Ezh2 identifies only Polycomb- related peptides (Li et al, 2010) and knocking out other subunits of PRC2 results in rapid degradation of Ezh2 (Pasini et al., 2004; Montgomery et al., 2005; Schoeftner et al, 2006).
Both cis and trans mechanisms may be utilized by RNAs in the PRC2 transcriptome. While it has been postulated that HOTAIR works in trans (Rinn et al, 2007; Gupta et al), the large number of antisense transcripts in the transcriptome suggests that many, like Tsix, may function by directing PRC2 to overlapping or linked coding loci in cis.
The evidence presented herein demonstrates that RNA cofactors are a general feature of Polycomb regulation and that inhibitory nucleic acids as described herein that target RNA in the PRC2 transcriptome can successfully up-regulate gene expression, presumably by inhibiting PRC2-associated repression. Genes in cis, in either antisense-strand orientation or same strand orientation, and extending lkb or more, e.g. 5kb, from the location of the PRC2-binding RNA, can be regulated.
Because chromatin modifiers such as PRC2 play a central role in maintaining stem cell pluripotency and in cancer, a genome-wide profile of regulatory RNAs will be a valuable resource in the quest to diagnose and treat disease. RIP-seq - Methods of Producing Long Non-Coding RNAs Described herein are methods for producing libraries of IncRNAs. These methods were used to identify RNAs that bind the Ezh2 portion of the PRC2 complex, but does not exclude contacts with other PRC2 subunits or associated proteins. In some embodiments, the methods include the steps shown in Fig. 1 ; one of skill in the art will appreciate that other techniques can be substituted for those shown.
In some embodiments, the methods include providing a sample comprising nuclear ribonucleic acids ("nRNAs"), e.g., a sample comprising nuclear lysate, e.g., comprising nRNAs bound to nuclear proteins; contacting the sample with an agent, e.g., an antibody, that binds specifically to a nuclear protein or protein complex such as PRC2.
In some embodiments, the methods are applied under conditions sufficient to form complexes between the agent and the protein, and include some or all of the following: isolating the complexes; synthesizing DNA complementary to the nRNAs to provide an initial population of cDNAs; PCR-amplifying, if necessary, using strand-specific primers; purifying the initial population of cDNAs to obtain a purified population of cDNAs that are at least 20 nucleotides (nt) in length; and high- throughput sequencing the purified population of cDNAs. Homopolymer reads are filtered, and reads matching the mitochondrial genome and ribosomal RNAs are excluded from all subsequent analyses. Reads that align to a reference genome with <1 mismatch are retained, excluding homopolymers, reads that align to the mitochondrial genome, and ribosomal RNAs. High probability PRC2 -interacting transcripts are then called based on criteria that reads were significantly enriched in the wildtype library versus control library (such as a protein-null library or library made from an IgG pulldown done in parallel) for any given transcript. For example, under one set of criteria published in Zhao et al, 2010, the transcripts were enriched 3: 1 in the wildtype library over the Ezh2-null library, and each transcript had an RPKM minimum of 0.4. The criteria can be adjusted up or down based on empirical control data suggesting what cutoffs could be reasonably used.
In general, to construct RIP-seq libraries, cell nuclei are prepared, treated with DNAse, and incubated with antibodies directed against a chromatin-associated factor of interest, along with a control IgG reaction in parallel. RNA-protein complexes are then immunoprecipitated with agarose beads, magnetic beads, or any other platform in solution or on a solid matrix (e.g., columns, microfluidic devices). RNAs are extracted using standard techniques. To capture all RNAs (not just polyA RNAs) and to preserve strand information, asymmetric primers are used to generate cDNA from the RNA template, in which the first adaptor (adaptor 1) to make the first strand cDNA contains a random multimer sequence (such as random hexamers) at the 3' end. A reverse transcriptase is used to create the first strand. A distinct second adaptor (adaptor2) is used to create the second strand. One example is as follows: If Superscript II is used, it will add non-template CCC 3' overhangs, which can then be used to hybridize to a second adaptor containing GGG at the 3' end, which anneal to the non-template CCC overhangs. Other methods of creating second strands may be substituted. PCR using adaptor 1- and adaptor2-specific primer pairs is then the performed to amplify the cDNAs and the products sequenced via standard methods of high throughput sequencing. Prior to sequencing, a size-selection step can be incorporated (if desired) in which RNAs or cDNAs of desired sizes are excised after separation by gel electrophoresis (e.g., on a Nu-Sieve agarose gel or in an acrylamide gel) or other methods of purification, such as in a microfluidic device or in standard biochemical columns.
IncRNAs and IncRNA Libraries
The present invention includes the individual IncRNAs described herein, as well as libraries of IncRNAs produced by methods described herein. In some embodiments, the libraries are in solution, or are lyophilized. In some embodiments, the libraries are bound to a substrate, e.g., wherein each member of the library is bound to an individually addressable member, e.g., an individual area on an array (e.g., a microarray), or a bead. The PRC2-interacting RNA transcript, although non- coding, may include a protein-coding sequence of bases if it is a distinct transcript that overlaps in position with a protein-coding reference gene (e.g. the gene whose expression is modulated in cis).
In one embodiment, a IncRNA includes a nucleotide sequence that is at least about 85% or more homologous or identical to the entire length of a IncRNA sequence shown herein, e.g., in any of Tables 1-4, or a fragment comprising at least 20 nt thereof (e.g., at least 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 nt thereof, e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 50% or more of the full length IncRNA). In some embodiments, the nucleotide sequence is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous or identical to a IncRNA sequence shown herein. In some embodiments, the nucleotide sequence is at least about 85%, e.g., is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous or identical to a IncRNA sequence described herein, in a fragment thereof or a region that is much more conserved, such as Repeat A, but has lower sequence identity outside that region.
Mouse-to-human LiftOver analysis and analysis in the UCSC genome browser of syntenic positions indicate the existence of similar transcripts in the human genome. This process and LiftOver chains are generally described in Kent et al, Proc. Nat l Acad. Sci., 100(20) 11484-1 1489 (2003). Given the geographic and sequence similarities between the mouse and human transcripts, we believe that a similar number of PRC2-interacting transcripts occur in the human system. The data suggest that many if not all of the mouse PRC2 -transcripts have direct counterparts in the human epigenome. Such direct counterparts in other species are termed
"orthologous" herein.
LncRNAs may be functionally conserved without being highly conserved at the level of overall nucleotide identity. For example, mouse Xist shows only 76% overall nucleotide identity with human XIST using sliding 21 -bp windows, or an overall sequence identity of only 60%. However, within specific functional domains, such as Repeat A, the degree of conservation can be >70% between different mammalian species. The crucial motif in Repeat A is the secondary structures formed by the repeat. A IncRNA interacting with PRC2 may therefore be similarly low in overall conservation but still have conservation in secondary structure within specific domains of the RNA, and thereby demonstrate functional conservation with respect to recruitment of PRC2.
Calculations of homology or sequence identity between sequences (the terms are used interchangeably herein) are performed as follows.
To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The length of a reference sequence aligned for comparison purposes is at least 80% of the length of the reference sequence, and in some embodiments is at least 90% or 100%. The nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein nucleic acid "identity" is equivalent to nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
For purposes of the present invention, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
There are several potential uses for the IncRNAs described herein in the expanded PRC2 transcriptome: The RNAs themselves, or antagomirs and small molecules designed against them, can be utilized to modulate expression (either up or down) of Polycomb target genes.
In various related aspects, including with respect to the targeting of long ncRNAs by LNA molecule, long ncRNAs can include endogenous cellular RNAs that are greater than 60 nt in length, e.g., greater than 100 nt, e.g., greater than 200 nt, have no positive-strand open reading frames greater than 100 amino acids in length, are identified as IncRNAs by experimental evidence, and are distinct from known (smaller) functional-RNA classes (including but not limited to ribosomal, transfer, and small nuclear/nucleolar RNAs, siRNA, piRNA, and miRNA). See, e.g., Lipovich et al, "MacroRNA underdogs in a microRNA world: Evolutionary, regulatory, and biomedical significance of mammalian long non-protein-coding RNA" Biochimica et Biophysica Acta (2010) doi: 10.1016/j.bbagrm.2010.10.001; Ponting et al, Cell 136(4):629-641 (2009), Jia et al, RNA 16 (8) (2010) 1478-1487, Dinger et al, Nucleic Acids Res. 37 1685 (2009) D122-D126 (database issue); and references cited therein. LncRNAs have also been referred to as long RNA, large RNA, macro RNA, intergenic RNA, and NonCoding Transcripts.
The methods described herein can be used to target nuclear-localized
IncRNAs. Known classes of IncRNAs include large intergenic non-coding RNAs (lincRNAs, see, e.g., Guttman et al, Nature. 2009 Mar 12;458(7235):223-7. Epub 2009 Feb 1, which describes over a thousand exemplary highly conserved large non- coding RNAs in mammals; and Khalil et al, PNAS 106(28)11675-1 1680 (2009)); promoter associated short RNAs (PASRs; see, e.g., Seila et al, Science. 2008 Dec 19;322(5909): 1849-51. Epub 2008 Dec 4; Kanhere et al, Molecular Cell 38, 675- 688, (2010)); endogenous antisense RNAs (see, e.g., Numata et al, BMC Genomics. 10:392 (2009); Okada et al, Hum Mol Genet. 17(11): 1631-40 (2008); Numata et al, Gene 392(1-2): 134-141 (2007); and Rosok and Sioud, Nat Biotechnol. 22(1): 104-8 (2004)); and RNAs that bind chromatin modifiers such as PRC2 and LSD1 (see, e.g., Tsai et al., Science. 2010 Aug 6;329(5992):689-93. Epub 2010 Jul 8; and Zhao et al, Science. 2008 Oct 31;322(5902):750-6).
Exemplary IncRNAs include XIST, TSIX, MALAT1, RNCR2, and HOTAIR. The sequences for more than 17,000 long human ncRNAs can be found in the NCode™ Long ncRNA Database on the Invitrogen website. Additional long ncRNAs can be identified using, e.g., manual published literature, Functional Annotation of Mouse (FANTOM3) project, Human Full-length cDNA Annotation Invitational (H- Invitational) project, antisense ncRNAs from cDNA and EST database for mouse and human using a computation pipeline (Zhang et al, Nucl. Acids Res. 35 (suppl 1): D156-D161 (2006); Engstrom et al., PLoS Genet. 2:e47 (2006)), human snoRNAs and scaRNAs derived from snoRNA-LBME-db, RNAz (Washietl et al. 2005), Noncoding RNA Search (Torarinsson, et al. 2006), and EvoFold (Pedersen et al. 2006).
Methods of Modulating Gene Expression
The IncRNAs described herein, including fragments thereof that are at least 20 nt in length, and inhibitory nucleic acids and small molecules targeting (e.g., complementary to) them, can be used to modulate gene expression in a cell, e.g., a cancer cell, a stem cell, or other normal cell types for gene or epigenetic therapy. The cells can be in vitro, including ex vivo, or in vivo (e.g., in a subject who has cancer, e.g., a tumor).
The methods described herein can be used for modulating expression of oncogenes and tumor suppressors in cells, e.g., cancer cells. For example, to decrease expression of an oncogene in a cell, the methods include introducing into the cell a long non-coding RNA, including a PRC2-binding fragment thereof, that regulates the oncogene set forth in Table 2, imprinted genes in Table 4, and/or other growth- promoting genes in Table 2.
As another example, to increase expression of a tumor suppressor in a cell, the methods include introducing into the cell an inhibitory nucleic acid or small molecule that specifically binds, or is complementary, to a long non-coding RNA targeting a tumor suppressor as set forth in Table 2, imprinted genes in Table 4, and/or other growth-promoting genes in Table 2, e.g., in subjects with cancer, e.g., lung adenocarcinoma patients. In some embodiments, the methods include introducing into the cell an inhibitory nucleic acid that specifically binds, or is complementary, to a long non-coding RNA targeting an imprinted gene as set forth in Table 4. A nucleic acid that binds "specifically" binds primarily to the target IncRNA or related lncRNAs to inhibit regulatory function of the IncRNA but not of other non-target RNAs. The specificity of the nucleic acid interaction thus refers to its function (e.g. inhibiting the PRC2-associated repression of gene expression) rather than its hybridization capacity. Inhibitory nucleic acids may exhibit nonspecific binding to other sites in the genome or other mRNAs, without interfering with binding of other regulatory proteins and without causing degradation of the non-specifically-bound RNA. Thus this nonspecific binding does not significantly affect function of other non-target RNAs and results in no significant adverse effects.
These methods can be used to treat a cancer in a subject by administering to the subject a composition (e.g., as described herein) comprising an IncRNA (e.g., a IncRNA that inhibits a cancer-promoting oncogene or imprinted gene) or a PRC2- binding fragment thereof and/or an inhibitory nucleic acid that binds to a long non- coding RNA (e.g., an inhibitory nucleic acid that binds to a IncRNA that inhibits a tumor suppressor, or cancer-suppressing gene, or imprinted gene and/or other growth- suppressing genes in any of Tables 1-4). Examples of genes involved in cancer and categories of cancer are shown in Table 3 or 4. Examples of cellular proliferative and/or differentiative disorders include cancer, e.g., carcinoma, sarcoma, metastatic disorders or hematopoietic neoplastic disorders, e.g., leukemias. A metastatic tumor can arise from a multitude of primary tumor types, including but not limited to those of prostate, colon, lung, breast and liver origin.
As used herein, treating includes "prophylactic treatment" which means reducing the incidence of or preventing (or reducing risk of) a sign or symptom of a disease in a patient at risk for the disease, and "therapeutic treatment", which means reducing signs or symptoms of a disease, reducing progression of a disease, reducing severity of a disease, in a patient diagnosed with the disease. With respect to cancer, treating includes inhibiting tumor cell proliferation, increasing tumor cell death or killing, inhibiting rate of tumor cell growth or metastasis, reducing size of tumors, reducing number of tumors, reducing number of metastases, increasing 1-year or 5- year survival rate.
As used herein, the terms "cancer", "hyperproliferative" and "neoplastic" refer to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. Hyperproliferative and neoplastic disease states may be categorized as pathologic, i.e., characterizing or constituting a disease state, or may be categorized as non-pathologic, i.e., a deviation from normal but not associated with a disease state. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. "Pathologic hyperproliferative" cells occur in disease states characterized by malignant tumor growth. Examples of non-pathologic
hyperproliferative cells include proliferation of cells associated with wound repair.
The terms "cancer" or "neoplasms" include malignancies of the various organ systems, such as affecting lung (e.g. small cell, non-small cell, squamous, adenocarcinoma), breast, thyroid, lymphoid, gastrointestinal, genito-urinary tract, kidney, bladder, liver (e.g. hepatocellular cancer), pancreas, ovary, cervix, endometrium, uterine, prostate, brain, as well as adenocarcinomas which include malignancies such as most colon cancers, colorectal cancer, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus.
The term "carcinoma" is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas,
gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the disease is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures.
The term "sarcoma" is art recognized and refers to malignant tumors of mesenchymal derivation. Additional examples of proliferative disorders include hematopoietic neoplastic disorders. As used herein, the term "hematopoietic neoplastic disorders" includes diseases involving hyperplastic/neoplastic cells of hematopoietic origin, e.g., arising from myeloid, lymphoid or erythroid lineages, or precursor cells thereof. Preferably, the diseases arise from poorly differentiated acute leukemias, e.g., erythroblastic leukemia and acute megakaryoblastic leukemia. Additional exemplary myeloid disorders include, but are not limited to, acute promyeloid leukemia (APML), acute myelogenous leukemia (AML) and chronic myelogenous leukemia (CML) (reviewed in Vaickus, L. (1991) Crit Rev. in Oncol. /Hemotol. 1 1 :267-97); lymphoid malignancies include, but are not limited to acute lymphoblastic leukemia (ALL) which includes B-lineage ALL and T-lineage ALL, chronic lymphocytic leukemia (CLL), prolymphocyte leukemia (PLL), hairy cell leukemia (HLL) and
Waldenstrom's macroglobulinemia (WM). Additional forms of malignant lymphomas include, but are not limited to non-Hodgkin lymphoma and variants thereof, peripheral T cell lymphomas, adult T cell leukemia/lymphoma (ATL), cutaneous T- cell lymphoma (CTCL), large granular lymphocytic leukemia (LGF), Hodgkin's disease and Reed-Sternberg disease.
In some embodiments, specific cancers that can be treated using the methods described herein are listed in the categories herein or in Table 3, for example, and include, but are not limited to: breast, lung, prostate, CNS (e.g., glioma), salivary gland, prostate, ovarian, and leukemias (e.g., ALL, CML, or AML). Associations of these genes with a particular cancer are known in the art, e.g., as described in Futreal et al, Nat Rev Cancer. 2004;4; 177-83; and The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website, Bamford et al, Br J Cancer. 2004;91;355- 8; see also Forbes et al, Curr Protoc Hum Genet. 2008;Chapter 10;Unit 10.11, and the COSMIC database, e.g., v.50 (Nov. 30, 2010). It is understood that reference to any particular type of cancer herein, for example in Table 3, means that patients with other types of cancer, i.e., cancer in general, may be treated.
In addition, the methods described herein can be used for modulating (e.g., enhancing or decreasing) pluripotency of a stem cell and to direct stem cells down specific differentiation pathways to make endoderm, mesoderm, ectoderm, and their developmental derivatives. To increase, maintain, or enhance pluripotency, the methods include introducing into the cell an inhibitory nucleic acid that specifically binds to, or is complementary to, a long non-coding RNA as set forth in any of Tables 1-4. To decrease pluripotency or enhance differentiation of a stem cell, the methods include introducing into the cell a long non-coding RNA as set forth in any of Tables 1-4. Stem cells useful in the methods described herein include adult stem cells (e.g., adult stem cells obtained from the inner ear, bone marrow, mesenchyme, skin, fat, liver, muscle, or blood of a subject, e.g., the subject to be treated); embryonic stem cells, or stem cells obtained from a placenta or umbilical cord; progenitor cells (e.g., progenitor cells derived from the inner ear, bone marrow, mesenchyme, skin, fat, liver, muscle, or blood); and induced pluripotent stem cells (e.g., iPS cells).
In some embodiments, the methods described herein include administering a composition, e.g., a sterile composition, comprising an inhibitory nucleic acid that is complementary to an IncRNA described herein, e.g., as set forth in any of Tables 1-4, or SEQ ID NOS: 1 to 916,209, or 916,626 to 934,931. Inhibitory nucleic acids for use in practicing the methods described herein can be an antisense or small interfering RNA, including but not limited to an shRNA or siRNA. In some embodiments, the inhibitory nucleic acid is a modified nucleic acid polymer (e.g., a locked nucleic acid (LNA) molecule).
Inhibitory nucleic acids have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Inhibitory nucleic acids can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
For therapeutics, an animal, preferably a human, suspected of having cancer is treated by administering an IncRNA or inhibitory nucleic acid in accordance with this invention. For example, in one non-limiting embodiment, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of an IncRNA or inhibitory nucleic acid as described herein.
Inhibitory Nucleic Acids
Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, molecules comprising modified bases, locked nucleic acid molecules (LNA molecules), antagomirs, peptide nucleic acid molecules (PNA molecules), and other oligomeric compounds or oligonucleotide mimetics which hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., WO 20100401 12.
In some embodiments, the inhibitory nucleic acids are 10 to 50, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies oligonucleotides having antisense (complementary) portions of 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. It is understood that non-complementary bases may be included in such inhibitory nucleic acids; for example, an inhibitory nucleic acid 30 nucleotides in length may have a portion of 15 bases that is complementary to the targeted RNA. In some embodiments, the oligonucleotides are 15 nucleotides in length. In some embodiments, the antisense or oligonucleotide compounds of the invention are 12 or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having antisense
(complementary) portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin.
Preferably the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, and/or a modified internucleoside linkage, and/or a modified nucleotide and/or combinations thereof. It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the modifications described herein may be incorporated in a single
oligonucleotide or even at within a single nucleoside within an oligonucleotide.
In some embodiments, the inhibitory nucleic acids are chimeric
oligonucleotides that contain two or more chemically distinct regions, each made up of at least one nucleotide. These oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, US patent nos. 5,013,830; 5, 149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,71 1; 5,491, 133; 5,565,350; 5,623,065;
5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2' position of the sugar, most preferably a 2'-0-alkyl, 2'-0- alkyl-O-alkyl or 2'-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2'-fluoro, 2'-amino and 2' O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these
oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2'-deoxyoligonucleotides against a given target.
A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH 2 -NH-O-CH 2 ,
CH,~N(CH 3 )~0~CH 2 (known as a methylene(methylimino) or MMI backbone], CH 2 -O-N (CH 3 )-CH 2 , CH 2 -N (CH 3 )-N (CH 3 )-CH 2 and O-N (CH 3 )- CH 2 -CH 2 backbones, wherein the native phosphodiester backbone is represented as O- P— O- CH,); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366- 374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al, Science 1991, 254, 1497). Phosphorus- containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters,
aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3 '-amino phosphoramidate and aminoalkylphosphoramidates,
thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos. 3,687,808; 4,469,863;
4,476,301 ; 5,023,243; 5, 177,196; 5, 188,897; 5,264,423; 5,276,019; 5,278,302;
5,286,717; 5,321,131 ; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677;
5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550, 1 11 ; 5,563, 253; 5,571,799;
5,587,361 ; and 5,625,050.
Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001 ; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al, Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al, J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).
Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang et al, J. Am. Chem. Soc, 2000, 122, 8595-8602.
Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl
internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones;
methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see US patent nos. 5,034,506; 5, 166,315; 5,185,444; 5,214, 134; 5,216, 141 ; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967;
5,489,677; 5,541,307; 5,561,225; 5,596, 086; 5,602,240; 5,610,289; 5,602,240;
5,608,046; 5,610,289; 5,618,704; 5,623, 070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
Modified oligonucleotides are also known that include oligonucleotides that are based on or constructed from arabinonucleotide or modified arabinonucleotide residues. Arabinonucleosides are stereoisomers of ribonucleosides, differing only in the configuration at the 2'-position of the sugar ring. In some embodiments, a 2'- arabino modification is 2'-F arabino. In some embodiments, the modified
oligonucleotide is 2'-fluoro-D-arabinonucleic acid (FANA) (as described in, for example, Lon et al, Biochem., 41 :3457-3467, 2002 and Min et al, Bioorg. Med. Chem. Lett., 12:2651-2654, 2002; the disclosures of which are incorporated herein by reference in their entireties). Similar modifications can also be made at other positions on the sugar, particularly the 3' position of the sugar on a 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide.
PCT Publication No. WO 99/67378 discloses arabinonucleic acids (ANA) oligomers and their analogues for improved sequence specific inhibition of gene expression via association to complementary messenger RNA.
Other preferred modifications include ethylene-bridged nucleic acids (ENAs) (e.g., International Patent Publication No. WO 2005/042777, Morita et al, Nucleic Acid Res., Suppl 1 :241-242, 2001 ; Surono et al, Hum. Gene Ther., 15:749-757, 2004; Koizumi, Curr. Opin. Mol. Ther., 8: 144-149, 2006 and Horie et al, Nucleic Acids Symp. Ser (Oxf), 49: 171-172, 2005; the disclosures of which are incorporated herein by reference in their entireties). Preferred ENAs include, but are not limited to, 2'-0,4'-C-ethylene -bridged nucleic acids.
Examples of LNAs are described in WO 2008/043753 and include compounds of the following formula.
where X and Y are independently selected among the groups -0-,
-S-, -N(H)-, N(R)-, -CH2- or -CH- (if part of a double bond),
-CH 2 -O-, -CH 2 -S-, -CH 2 -N(H)-, -CH 2 -N(R)-, -CH 2 -CH 2 - or -CH 2 -CH- (if part of a double bond),
-CH=CH-, where R is selected from hydrogen and Ci-4-alkyl; Z and Z* are independently selected among an internucleoside linkage, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety; and the asymmetric groups may be found in either orientation.
Preferably, the LNA used in the oligomer of the invention comprises at least one LNA unit according any of the formulas
wherein Y is -0-, -S-, -NH-, or N(R ); Z and Z* are independently selected among an internucleoside linkage, a terminal group or a protecting group; B constitutes a natural or non-natural nucleotide base moiety, and RH is selected from hydrogen and Ci-4-alkyl.
Preferably, the Locked Nucleic Acid (LNA) used in the oligomeric compound, such as an antisense oligonucleotide, of the invention comprises at least one nucleotide comprises a Locked Nucleic Acid (LNA) unit according any of the formulas shown in Scheme 2 of PCT/DK2006/000512.
Preferably, the LNA used in the oligomer of the invention comprises internucleoside linkages selected from -0-P(O) 2 -O-, -0-P(0,S)-0-, -0-P(S) 2 -O-, -S- P(0) 2 -0-, -S-P(0,S)-0-, -S-P(S) 2 -0-, -0-P(O) 2 -S-, -0-P(0,S)-S-, -S-P(0) 2 -S-, -o- PO(R H )-0-, 0-PO(OCH 3 )-0-, -0-PO(NR H )-0-, -0-PO(OCH 2 CH 2 S-R)-O-, -O- PO(BH 3 )-0-, -0-PO(NHR H )-0-, -0-P(0) 2 -NR H -, -NR H -P(0) 2 -0-, -NR H -CO-0-, where R H is selected from hydrogen and Ci_4-alkyl. Specifically preferred LNA units are shown in scheme 2:
Scheme 2
The term "thio-LNA" comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from S or -CH2-S-. Thio-LNA can be in both beta-D and alpha-L-configuration.
The term "amino-LNA" comprises a locked nucleotide in which at least one of X or Y in the general formula above is selected from -N(H)-, N(R)-, ϋ¾-Ν(Η)-, and - C]¾-N(R)- where R is selected from hydrogen and Ci-4-alkyl. Amino-LNA can be in both beta-D and alpha-L-configuration.
The term "oxy-LNA" comprises a locked nucleotide in which at least one of X or Y in the general formula above represents -O- or -CH 2 -O-. Oxy-LNA can be in both beta-D and alpha-L-configuration.
The term "ena-LNA" comprises a locked nucleotide in which Y in the general formula above is -CH 2 -0- (where the oxygen atom of -CH 2 -0- is attached to the 2'- position relative to the base B).
LNAs are described in additional detail below.
One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH 3 , F, OCN, OCH 3 OCH 3 , OCH 3 0(CH 2 )n CH 3 , 0(CH 2 )n NH 2 or 0(CH 2 )n CH 3 where n is from 1 to about 10; Ci to CIO lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; CI; Br; CN; CF3 ; OCF3; 0-, S-, or N-alkyl; 0-, S-, or -alkenyl; SOCH3; S02 CH3; ON02; N02; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino;
substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. A preferred modification includes 2'- methoxyethoxy [2'-0-CH 2 CH 2 OCH 3 , also known as 2'-0-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2'- methoxy (2'-0-CH 3 ), 2'-propoxy (2'-OCH 2 CH 2 CH 3 ) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as "base") modifications or
substitutions. As used herein, "unmodified" or "natural" nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me- C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, isocytosine, pseudoisocytosine, as well as synthetic nucleobases, e.g., 2- aminoadenine, 2- (methylamino)adenine, 2-(imidazolylalkyl)adenine, 2- (aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2- thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 5-propynyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine, 6-aminopurine, 2-aminopurine, 2-chloro- 6-aminopurine and 2,6-diaminopurine or other diaminopurines. See, e.g., Kornberg, "DNA Replication," W. H. Freeman & Co., San Francisco, 1980, pp75-77; and Gebeyehu, G., et al. Nucl. Acids Res., 15:4513 (1987)). A "universal" base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C. (Sanghvi, in Crooke, and Lebleu, eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.
It is not necessary for all positions in a given oligonucleotide to be uniformly modified, and in fact more than one of the modifications described herein may be incorporated in a single oligonucleotide or even at within a single nucleoside within an oligonucleotide.
In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, US patent nos.
5,539,082; 5,714,331 ; and 5,719,262, each of which is herein incorporated by reference . Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
Modified nucleobases comprise other synthetic and natural nucleobases such as 5- methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7- deazaguanine and 7-deazaadenine and 3- deazaguanine and 3-deazaadenine. Further, nucleobases comprise those disclosed in United States Patent No. 3,687,808, those disclosed in "The Concise Encyclopedia of Polymer Science And Engineering", pages 858-859, Kroschwitz, ed. John Wiley & Sons, 1990;, those disclosed by Englisch et al, Angewandle Chemie, International Edition, 1991, 30, page 613, and those disclosed by Sanghvi, Chapter 15, Antisense Research and Applications," pages 289- 302, Crooke, and Lebleu, eds., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2- aminopropyladenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6- 1.2<0>C (Sanghvi, et al, eds, "Antisense Research and Applications," CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.
Modified nucleobases are described in US patent nos. 3,687,808, as well as
4,845,205; 5, 130,302; 5, 134,066; 5, 175, 273; 5, 367,066; 5,432,272; 5,457,187;
5,459,255; 5,484,908; 5,502, 177; 5,525,711 ; 5,552,540; 5,587,469; 5,596,091;
5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.
In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. For example, one or more inhibitory nucleic acids, of the same or different types, can be conjugated to each other; or inhibitory nucleic acids can be conjugated to targeting moieties with enhanced specificity for a cell type or tissue type. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al, Bioorg. Med. Chem. Let., 1994, 4, 1053- 1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al, Bioorg. Med. Chem. Let, 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al, Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al, FEBS Lett., 1990, 259, 327-330; Svinarchuk et al, Biochimie, 1993, 75, 49- 54), a phospholipid, e.g., di- hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl- rac-glycero-3-H- phosphonate (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al, Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al, Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al, Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al, J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also US patent nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731 ; 5,580,731 ; 5,591,584; 5, 109, 124; 5, 118,802; 5, 138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830; 5, 112,963; 5,214,136; 5,082,830; 5, 112,963; 5,214, 136; 5, 245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391, 723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810; 5,574, 142; 5,585,481 ; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941, each of which is herein incorporated by reference.
These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the
pharmacodynamic properties of oligomers, and groups that enhance the
pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No.
6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731 ; 5,580,731 ; 5,591,584; 5,109, 124; 5, 118,802; 5, 138,045;
5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735;
4,667,025; 4,762,779; 4,789,737; 4,824,941 ; 4,835,263; 4,876,335; 4,904,582;
4,958,013; 5,082,830; 5, 112,963; 5,214, 136; 5,082,830; 5, 1 12,963; 5,214, 136;
5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098;
5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785;
5,565,552; 5,567,810; 5,574, 142; 5,585,481 ; 5,587,371 ; 5,595,726; 5,597,696;
5,599,923; 5,599,928 and 5,688,941.
The inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target IncRNA, e.g., hybridize sufficiently well and with sufficient biological functional specificity, to give the desired effect.
"Complementary" refers to the capacity for pairing, through base stacking and specific hydrogen bonding, between two sequences comprising naturally or non- naturally occurring (e.g., modified as described above) bases (nucleosides) or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a IncRNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required. As noted above, inhibitory nucleic acids can comprise universal bases, or inert abasic spacers that provide no positive or negative contribution to hydrogen bonding. Base pairings may include both canonical Watson- Crick base pairing and non- Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). It is understood that for complementary base pairings, adenosine-type bases (A) are complementary to thymidine-type bases (T) or uracil- type bases (U), that cytosine-type bases (C) are complementary to guanosine-type bases (G), and that universal bases such as such as 3-nitropyrrole or 5-nitroindole can hybridize to and are considered complementary to any A, C, U, or T. Nichols et al, Nature, 1994;369:492-493 and Loakes et al., Nucleic Acids Res., 1994;22:4039-4043. Inosine (I) has also been considered in the art to be a universal base and is considered complementary to any A, C, U, or T. See Watkins and SantaLucia, Nucl. Acids Research, 2005; 33 (19): 6258-6267. In some embodiments, the location on a target IncRNA to which an inhibitory nucleic acids hybridizes is defined as a target region to which a protein binding partner binds. These regions can be identified by reviewing the data submitted herewith in Appendix I and identifying regions that are enriched in the dataset; these regions are likely to include the protein binding sequences. The identification of such regions, termed Peaks, is described in Example 8 below. Routine methods can be used to design an inhibitory nucleic acid that binds to this sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, methods of designing oligonucleotides similar to the inhibitory nucleic acids described herein, and various options for modified chemistries or formats, are exemplified in Lennox and Behlke, Gene Therapy (2011) 18: 1 1 11-1 120, which is incorporated herein by reference in its entirety, with the understanding that the present disclosure does not target miRNA 'seed regions'.
While the specific sequences of certain exemplary target segments are set forth herein, one of skill in the art will recognize that these serve to illustrate and describe particular embodiments within the scope of the present invention. Additional target segments are readily identifiable by one having ordinary skill in the art in view of this disclosure. Target segments 5-500 nucleotides in length comprising a stretch of at least five (5) consecutive nucleotides within the protein binding region, or immediately adjacent thereto, are considered to be suitable for targeting as well. Target segments can include sequences that comprise at least the 5 consecutive nucleotides from the 5 '-terminus of one of the protein binding regions (the remaining nucleotides being a consecutive stretch of the same RNA beginning immediately upstream of the 5 '-terminus of the binding segment and continuing until the inhibitory nucleic acid contains about 5 to about 100 nucleotides). Similarly preferred target segments are represented by RNA sequences that comprise at least the 5 consecutive nucleotides from the 3 '-terminus of one of the illustrative preferred target segments (the remaining nucleotides being a consecutive stretch of the same IncRNA beginning immediately downstream of the 3 '-terminus of the target segment and continuing until the inhibitory nucleic acid contains about 5 to about 100 nucleotides). One having skill in the art armed with the sequences provided herein will be able, without undue experimentation, to identify further preferred protein binding regions to target with complementary inhibitory nucleic acids.
In the context of the present disclosure, hybridization means base stacking and hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Complementary, as the term is used in the art, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a IncRNA molecule, then the inhibitory nucleic acid and the IncRNA are considered to be complementary to each other at that position. The inhibitory nucleic acids and the IncRNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases. Thus, "specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the inhibitory nucleic acid and the IncRNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a IncRNA, then the bases are considered to be complementary to each other at that position. 100%
complementarity is not required.
It is understood in the art that a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically
hybridizable. A complementary nucleic acid sequence for purposes of the present methods is specifically hybridizable when binding of the sequence to the target IncRNA molecule interferes with the normal function of the target IncRNA to cause a loss of activity (e.g., inhibiting PRC2-associated repression with consequent up- regulation of gene expression) and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target IncRNA sequences under conditions in which avoidance of the non-specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency. For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30° C, more preferably of at least about 37° C, and most preferably of at least about 42° C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30° C in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37° C in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42° C in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25° C, more preferably of at least about 42° C, and even more preferably of at least about 68° C. In a preferred embodiment, wash steps will occur at 25° C in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42° C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68° C in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS.
Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196: 180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
In general, the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an IncRNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al, J. Mol. Biol, 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Antisense and other compounds of the invention that hybridize to an IncRNA are identified through routine experimentation. In general the inhibitory nucleic acids must retain specificity for their target, i.e., either do not directly bind to, or do not directly significantly affect expression levels of, transcripts other than the intended target.
Target-specific effects, with corresponding target-specific functional biological effects, are possible even when the inhibitory nucleic acid exhibits nonspecific binding to a large number of non-target RNAs. For example, short 8 base long inhibitory nucleic acids that are fully complementary to a IncRNA may have multiple 100% matches to hundreds of sequences in the genome, yet may produce target-specific effects, e.g. upregulation of a specific target gene through inhibition of PRC2 activity. 8-base inhibitory nucleic acids have been reported to prevent exon skipping with with a high degree of specificity and reduced off-target effect. See Singh et al, RNA Biol, 2009; 6(3): 341-350. 8-base inhibitory nucleic acids have been reported to interfere with miRNA activity without significant off-target effects. See Obad et al, Nature Genetics, 201 1; 43: 371-378.
For further disclosure regarding inhibitory nucleic acids, please see
US2010/0317718 (antisense oligos); US2010/0249052 (double-stranded ribonucleic acid (dsRNA)); US2009/0181914 and US2010/0234451 (LNA molecules); US2007/0191294 (siRNA analogues); US2008/0249039 (modified siRNA); and WO2010/129746 and WO2010/0401 12 (inhibitory nucleic acids).
Antisense
In some embodiments, the inhibitory nucleic acids are antisense
oligonucleotides. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to an IncRNA in vitro, and are expected to inhibit the activity of PRC2 in vivo. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient biological functional specificity, to give the desired effect.
Modified Base, including Locked Nucleic Acids (LNAs)
In some embodiments, the inhibitory nucleic acids used in the methods described herein comprise one or more modified bonds or bases. Modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acids (LNAs). Preferably, the modified nucleotides are part of locked nucleic acid molecules, including [alpha]-L-LNAs. LNAs include ribonucleic acid analogues wherein the ribose ring is "locked" by a methylene bridge between the 2'-oxgygen and the 4'-carbon - i.e., oligonucleotides containing at least one LNA monomer, that is, one 2'-0,4'-C-methylene- ?-D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al, Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA.
These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., IncRNAs as described herien.
The modified base/LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the IncRNA. The modified base/LNA molecules can be chemically synthesized using methods known in the art.
The modified base/LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al, Nuc. Acids. Res.
34:e60 (2006); McTigue et al, Biochemistry 43:5388-405 (2004); and Levin et al, Nuc. Acids. Res. 34:el42 (2006). For example, "gene walk" methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of a modified base/LNA molecule; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target IncRNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30--60 %. General guidelines for designing modified base/LNA molecules are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA molecule. Contiguous runs of three or more Gs or Cs, or more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides). In some embodiments, the LNAs are xylo-LNAs.
In some embodiments, the modified base/LNA molecules can be designed to target a specific region of the IncRNA. For example, a specific functional region can be targeted, e.g., a region comprising a known RNA localization motif (i.e., a region complementary to the target nucleic acid on which the IncRNA acts), or a region comprising a known protein binding region, e.g., a Polycomb (e.g., Polycomb Repressive Complex 2 (PRC2), comprised of H3K27 methylase EZH2, SUZ12, and EED)) or LSDl/CoREST/REST complex binding region (see, e.g., Tsai et al, Science. 2010 Aug 6;329(5992):689-93. Epub 2010 Jul 8; and Zhao et al, Science. 2008 Oct 31;322(5902):750-6). Sarma et al., "Locked nucleic acids (LNAs) reveal sequence requirements and kinetics of Xist RNA localization to the X chromosome." PNAS published ahead of print December 6, 2010, doi: 10.1073/pnas. l009785107. Alternatively or in addition, highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity.
Percent identity can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol, 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), e.g., using the default parameters.
For additional information regarding LNA molecules see U.S. Pat. Nos. 6,268,490; 6,734,291 ; 6,770,748; 6,794,499; 7,034, 133; 7,053,207; 7,060,809;
7,084, 125; and 7,572,582; and U.S. Pre-Grant Pub. Nos. 20100267018;
20100261 175; and 20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 (1998); Jepsen et al, Oligonucleotides 14: 130-146 (2004); Kauppinen et al, Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4):629-641 (2009), and references cited therein.
In a related aspect, the present disclosure demonstrates the ability of LNA molecules to displace a cis-acting nuclear long ncRNA with fast kinetics (e.g., RNA/PRC2 disassociation from the chromosome after 2, 5, 10 seconds up to 60 minutes as described herein) - a property that enables the modification and study of the function of long ncRNAs in ways not previously possible. Using 17 kb Xist RNA as a model, the present inventors showed that LNA molecules designed to specifically target the transcript leads to extremely rapid displacement of the RNA from the inactive X-chromosome. Interestingly, while the RNA is displaced, transcript stability is not affected. Targeting different Xist regions has allowed the
identification of a localization domain and show that Polycomb repressive complex 2 (PRC2) is displaced together with Xist. Thus, PRC2 depends on RNA for both initial targeting to and stable association with chromatin. Time-course analysis of RNA relocalization suggests that Xist and PRC2 spread along X at the same time but does not reach saturating levels for 24 hours, providing a window of opportunity to reprogram the chromatin, if necessary.
It is remarkable that targeting a small region within a 17-kb RNA could produce such dramatic effects. The rapid effects suggest that the Xist RNA-protein complex may be anchored to the inactive X chromosome (Xi) chromatin via Repeat C. Alternatively, the LNA molecule's binding to Repeat C could change RNA conformation and interfere with a remote anchoring domain. While RNA
displacement occurs with rapid kinetics, the recovery period is prolonged. Although full Xist clouds are restored within 8 hours, the full complement of PRC2 is not recovered for up to 24 hours. This implies that, during the spread of X-chromosome inactivation (XCI), synthesis of the RNA is not the rate-limiting step; rather, it is the recruitment of associated silencing proteins such as PRC2. The rapid displacement of Xist and the slow kinetics of recovery provided a large window of opportunity to investigate Xist's spreading pattern relative to that of PRC2. Time-course analysis during the recovery phase indicates that Xist RNA binds most strongly near the Xist locus at first but spreads to the rest of Xi at the same time. Similarly, PRC2 is recruited synchronously throughout the X. Interestingly, neither Xist nor PRC2 levels reach saturation immediately, as the coating of Xist is not complete until t=8 hr and binding of PRC2 does not peak until t=24 hr. Combined, this analysis implies that establishment of chromosome-wide silencing may be relatively slow.
As demonstrated herein, LNA molecules can be used as a valuable tool to manipulate and aid analysis of long nuclear ncRNAs. Advantages offered by an LNA molecule-based system are the relatively low costs, easy delivery, and rapid action. While other inhibitory nucleic acids may exhibit effects after longer periods of time, LNA molecules exhibit effects that are more rapid, e.g., a comparatively early onset of activity, are fully reversible after a recovery period following the synthesis of new IncRNA, and occur without causing substantial or substantially complete RNA cleavage or degradation. One or more of these design properties may be desired properties of the inhibitory nucleic acids of the invention. Additionally, LNA molecules make possible the systematic targeting of domains within much longer nuclear transcripts. Although a PNA -based system has been described earlier, the effects on Xi were apparent only after 24 hours (13). The LNA technology enables high-throughput screens for functional analysis of long non-coding RNAs and also provides a novel tool to manipulate chromatin states in vivo for therapeutic applications.
In various related aspects, the methods described herein include using LNA molecules to target lncRNAs for a number of uses, including as a research tool to probe the function of a specific IncRNA, e.g., in vitro or in vivo. The methods include selecting one or more desired lncRNAs, designing one or more LNA molecules that target the IncRNA, providing the designed LNA molecule, and administering the LNA molecule to a cell or animal. The methods can optionally include selecting a region of the IncRNA and designing one or more LNA molecules that target that region of the IncRNA.
Aberrant imprinted gene expression is implicated in several diseases including Long QT syndrome, Beckwith-Wiedemann, Prader-Willi, and Angelman syndromes, as well as behavioral disorders and carcinogenesis (see, e.g., Falls et al, Am. J. Pathol. 154:635-647 (1999); Lalande, Annu Rev Genet 30: 173-195 (1996); Hall Annu Rev Med. 48:35-44 (1997)). LNA molecules can be created to treat such imprinted diseases. As one example, the long QT Syndrome can be caused by a K+ gated Calcium-channel encoded by Kcnql. This gene is regulated by its antisense counterpart, the long noncoding RNA, Kcnql otl (Pandey et al, Mol Cell. 2008 Oct 24;32(2):232-46). Disease arises when Kcnql otl is aberrantly expressed. LNA molecules can be created to downregulate Kcnqlotl, thereby restoring expression of Kcnql. As another example, LNA molecules could inhibit LncRNA cofactors for polycomb complex chromatin modifiers to reverse the imprinted defect.
From a commercial and clinical perspective, the timepoints between about 1 to 24 hours potentially define a window for epigenetic reprogramming. The advantage of the LNA system is that it works quickly, with a defined half-life, and is therefore reversible upon degradation of LNAs, at the same time that it provides a discrete timeframe during which epigenetic manipulations can be made. By targeting nuclear long ncRNAs, LNA molecules or similar polymers, e.g., xylo-LNAs, might be utilized to manipulate the chromatin state of cells in culture or in vivo, by transiently eliminating the regulatory RNA and associated proteins long enough to alter the underlying locus for therapeutic purposes. In particular, LNA molecules or similar polymers that specifically bind to, or are complementary to, PRC2 -binding lncRNA can prevent recruitment of PRC2 to a specific chromosomal locus, in a gene-specific fashion.
LNA molecules might also be administered in vivo to treat other human diseases, such as but not limited to cancer, neurological disorders, infections, inflammation, and myotonic dystrophy. For example, LNA molecules might be delivered to tumor cells to downregulate the biologic activity of a growth-promoting or oncogenic long nuclear ncRNA (e.g., Gtl2 or MALAT1 (Luo et al, Hepatology. 44(4): 1012-24 (2006)), a lncRNA associated with metastasis and is frequently upregulated in cancers). Repressive lncRNAs downregulating tumor suppressors can also be targeted by LNA molecules to promote reexpression. For example, expression of the INK4b/ARF/INK4a tumor suppressor locus is controlled by Polycomb group proteins including PRC 1 and PRC2 and repressed by the antisense noncoding RNA ANRIL (Yap et al, Mol Cell. 2010 Jun 1 1;38(5):662-74). ANRIL can be targeted by LNA molecules to promote reexpression of the INK4b/ARF/INK4a tumor suppressor. Some lncRNA may be positive regulators of oncogenes. Such "activating lncRNAs" have been described recently (e.g., Jpx (Tian et al, Cell. 143(3):390-403 (2010) and others (0rom et al., Cell. 143(l):46-58 (2010)). Therefore, LNA molecules could be directed at these activating IncRNAs to downregulate oncogenes. LNA molecules could also be delivered to inflammatory cells to downregulate regulatory lncRNA that modulate the inflammatory or immune response, (e.g., LincRNA-Cox2, see Guttman et al, Nature. 458(7235):223-7. Epub 2009 Feb 1 (2009)).
In still other related aspects, the LNA molecules targeting IncRNAs described herein can be used to create animal or cell models of conditions associated with altered gene expression (e.g., as a result of altered epigenetics).
For example, it was first noticed about half a century ago that X-chromosome changes are often seen in female reproductive cancers. Some 70% of breast carcinomas lack a 'Barr body', the cytologic hallmark of the inactive X chromosome (Xi), and instead harbor two or more active Xs (Xa). Additional X's are also a risk factor for men, as XXY men (Klinefelter Syndrome) have a 20- to 50-fold increased risk of breast cancer in a BRCA1 background. The X is also known to harbor a number of oncogenes. Supernumerary Xa's correlate with a poor prognosis and stand as one of the most common cytogenetic abnormalities not only in reproductive cancers but also in leukemias, lymphomas, and germ cell tumors of both sexes. See, e.g., Liao et al, Cancer Invest 21, 641-58 (2003); Spatz et al., Nat Rev Cancer 4, 617- 29 (2004); Barr et al, Proc Can Cancer Conf 2, 3-16 (1957); Borah et al., J Surg Oncol 13, 1-7 (1980); Camargo and Wang, Hum Genet 55, 81-5 (1980); Dutrillaux et al, Int J Cancer 38, 475-9 (1986); Ghosh and ShahCancer Genet Cytogenet 4, 269-74 (1981); Ghosh and Shah, Med Hypotheses 7, 1099-104 (1981); Ghosh et al., Acta Cytol 27, 202-3 (1983); Huang et al, Mol Cancer Ther 1, 769-76 (2002); Kawakami et al, Lancet 363, 40-2 (2004); Kawakami et al., J Urol 169, 1546-52 (2003);
Kawakami et al, Oncogene 23, 6163-9 (2004); Moore and Barr, Br J Cancer 9, 246- 52 (1955); Moore and Barr, Br J Cancer 11, 384-90 (1957); Moore et al, J Exp Zool 135, 101-25 (1957); Rosen et al, Ann Clin Lab Sci 7, 491-9 (1977); Sirchia et al, Cancer Res 65, 2139-46 (2005); Tavares, Lancet 268, 948-9 (1955); Tavares, Medico (Porto) 12, 97-100 (1961); Tavares, Acta Cytol 6, 90-4 (1962); Wang et al, Cancer Genet Cytogenet 46, 271-80 (1990); and Ganesan et al., Cold Spring Harb Symp Quant Biol 70, 93-7 (2005).
Some 60% of childhood acute lymphoblastic leukemias (ALL) also display extra X's; in chronic neutrophilic leukemia, the gain of X is sometimes the only obvious abnormality and is associated with progression to blast crisis (see, e.g., Heinonen and Mahlamaki, Cancer Genet Cytogenet 87, 123-6 (1996); Heinonen et al., Med Pediatr Oncol 32, 360-5 (1999); and Yamamoto et al, Cancer Genet Cytogenet 134, 84-7 (2002)). These observations are so far only correlative but together hint that the X may be an accomplice in carcinogenesis. Xist, therefore may be a tumor suppressor. Preliminary data obtained after deleting Xist in specific lineages in male and female mice shows that increased B cell proliferation occurs in a subset of mice (but not in controls; n=9). Without wishing to be bound by theory, one potential mechanism is that loss of Xist in cells leads X-reactivation or Xa duplication, resulting in an XaXa state in the cell. The consequent increased expression of X- oncogenes induces a pre-cancerous state, and an accumulation of additional epigenetic/genetic changes (e.g., genome-wide changes then results in cancer. Thus, Xist may be a tumor suppressor.
An animal model of specific cancers (e.g., those cancers known in the art and described above that are associated with X-chromosome changes) could be created by using an XIST-LNA, e.g., the XIST LNAs described herein, to remove XIST in a cell or tissue and developmentally specific way.
The methods described herein may also be useful for creating animal or cell models of other conditions associated with aberrant imprinted gene expression, e.g., as noted above.
In various related aspects, the results described herein demonstrate the utility of LNA molecules for targeting long ncRNA, for example, to transiently disrupt chromatin for purposes of reprogramming chromatin states ex vivo. Because LNA molecules stably displace RNA for hours and chromatin does not rebuild for hours thereafter, LNA molecules create a window of opportunity to manipulate the epigenetic state of specific loci ex vivo, e.g., for reprogramming of hiPS and hESC prior to stem cell therapy. For example, Gtl2 controls expression of DLK1, which modulates the pluripotency of iPS cells. Low Gtl2 and high DLK1 is correlated with increased pluripotency and stability in human iPS cells. Thus, LNA molecules targeting Gtl2 can be used to inhibit differentiation and increase pluripotency and stability of iPS cells.
See also USSN 61/412,862, which is incorporated by reference herein in its entirety. Antagomirs
In some embodiments, the inhibitory nucleic acid is an antagomir.
Antagomirs are chemically modified antisense oligonucleotides that can target an IncRNA. For example, an antagomir for use in the methods described herein can include a nucleotide sequence sufficiently complementary to hybridize to an IncRNA target sequence of about 12 to 25 nucleotides, preferably about 15 to 23 nucleotides.
In some embodiments, antagomirs include a cholesterol moiety, e.g., at the 3'- end. In some embodiments, antagomirs have various modifications for RNase protection and pharmacologic properties such as enhanced tissue and cellular uptake. For example, in addition to the modifications discussed above for antisense oligos, an antagomir can have one or more of complete or partial 2'-0-methylation of sugar and/or a phosphorothioate backbone. Phosphorothioate modifications provide protection against RNase or other nuclease activity and their lipophilicity contributes to enhanced tissue uptake. In some embodiments, the antagomir cam include six phosphorothioate backbone modifications; two phosphorothioates are located at the 5'-end and four at the 3'-end, but other patterns of phosphorothioate modification are also commonly employed and effective. See, e.g., Krutzfeldt et al., Nature 438, 685- 689 (2005); Czech, N Engl J Med 2006; 354: 1 194-1195 (2006); Robertson et al, Silence. 1 : 10 (2010); Marquez and McCaffrey, Hum Gene Ther. 19(l):27-38 (2008); van Rooij et al, Circ Res. 103(9):919-928 (2008); and Liu et al, Int. J. Mol. Sci. 9:978-999 (2008). Krutzfeld et al. (2005) describe chemically engineered oligonucleotides, termed 'antagomirs', that are reported to be efficient and specific silencers of endogenous miRNAs in mice.
In general, the design of an antagomir avoids target RNA degradation due to the modified sugars present in the molecule. The presence of an unbroken string of unmodified sugars supports RNAseH recruitment and enzymatic activity. Thus, typically the design of an antagomir will include bases that contain modified sugar (e.g., LNA), at the ends or interspersed with natural ribose or deoxyribose nucleobases.
Antagomirs useful in the present methods can also be modified with respect to their length or otherwise the number of nucleotides making up the antagomir. In some embodiments, the antagomirs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target. In some embodiments, antagomirs may exhibit nonspecific binding that does not produce significant undesired biologic effect, e.g., the antagomirs do not affect expression levels of non-target transcripts or their association with regulatory proteins or regulatory RNAs..
Interfering RNA, including siRNA/shRNA
In some embodiments, the inhibitory nucleic acid sequence that is complementary to an IncRNA can be an interfering RNA, including but not limited to a small interfering RNA ("siRNA") or a small hairpin RNA ("shRNA"). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self- complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference. In some embodiments, the interfering RNA coding region encodes a self- complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a "hairpin" structure, and is referred to herein as an "shRNA." The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length.
Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp et al, Science 296:550-553, (2002); Lee et al, Nature Biotechnol, 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); Yu et al. Proc NatlAcadSci USA 99:6047- 6052, (2002).
The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequences identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly
significantly affect expression levels of, transcripts other than the intended target.
Ribozymes
In some embodiments, the inhibitory nucleic acids are ribozymes. Trans- cleaving enzymatic nucleic acid molecules can also be used; they have shown promise as therapeutic agents for human disease (Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific IncRNA targets within the background of cellular RNA. Such a cleavage event renders the IncRNA non- functional.
In general, enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
Several approaches such as in vitro selection (evolution) strategies (Orgel, 1979, Proc. R. Soc. London, B 205, 435) have been used to evolve new nucleic acid catalysts capable of catalyzing a variety of reactions, such as cleavage and ligation of phosphodiester linkages and amide linkages, (Joyce, 1989, Gene, 82, 83-87; Beaudry et al, 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al, 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261 : 1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al, 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 1, 442). The development of ribozymes that are optimal for catalytic activity would contribute significantly to any strategy that employs RNA- cleaving ribozymes for the purpose of regulating gene expression. The hammerhead ribozyme, for example, functions with a catalytic rate (kcat) of about 1 min 1 in the presence of saturating (10 MM) concentrations of Mg 2+ cofactor. An artificial "RNA ligase" ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min "1 . In addition, it is known that certain modified hammerhead ribozymes that have substrate binding arms made of DNA catalyze RNA cleavage with multiple turn-over rates that approach 100 min "1 .
Making and Using Inhibitory Nucleic Acids
The nucleic acid sequences used to practice the methods described herein, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/ generated recombinantly. If desired, nucleic acid sequences of the invention can be inserted into delivery vectors and expressed from transcription units within the vectors. The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and "RNA Viruses: A Practical
Approach" (Alan J. Cann, Ed., Oxford University Press, (2000)).
Preferably, inhibitory nucleic acids of the invention are synthesized chemically ._Nucleic acid sequences used to practice this invention can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440- 3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994)
Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; U.S. Patent No. 4,458,066; WO/2008/043753 and WO/2008/049085, and the refences cited therein.
Nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences of the invention includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5' or 3' end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2'-modified nucleotide, e.g., a 2'-deoxy, 2'-deoxy-2'-fluoro, 2'-0-methyl, 2'- O-methoxyethyl (2'-0-MOE), 2'-0-aminopropyl (2'-0-AP), 2'-0-dimethylaminoethyl (2'-0-DMAOE), 2'-0-dimethylaminopropyl (2'-0-DMAP), 2'-0- dimethylaminoethyloxyethyl (2'-0-DMAEOE), or 2'-0-N-methylacetamido (2'-0- NMA). As another example, the nucleic acid sequence can include at least one 2'-0- methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2'-0-methyl modification. In some embodiments, the nucleic acids are "locked," i.e., comprise nucleic acid analogues in which the ribose ring is "locked" by a methylene bridge connecting the 2'-0 atom and the 4'-C atom (see, e.g., Kaupinnen et al, Drug Disc. Today 2(3):287-290 (2005); Koshkin et al, J. Am. Chem. Soc, 120(50): 13252-13253 (1998)). For additional modifications see US 20100004320, US 20090298916, and US 20090143326.
It is understood that any of the modified chemistries or formats of inhibitory nucleic acids described herein can be combined with each other, and that one, two, three, four, five, or more different types of modifications can be included within the same molecule.
Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al, Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al, eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
Pharmaceutical Compositions
The methods described herein can include the administration of
pharmaceutical compositions and formulations comprising inhibitory nucleic acid sequences designed to target an IncRNA.
In some embodiments, the compositions are formulated with a
pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/ nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response.
Pharmaceutical formulations of this invention can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolarity.
In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Patent No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Patent No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281 :93-102.
Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.
The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35: 1 187-1 193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75: 107- 111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.
In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.
In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3- butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).
In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/niL protein, about 15 mg/niL sucrose, about 19 mg/niL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.
The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Patent Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46: 1576-1587. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered.
Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
Liposomes can also include "sterically stabilized" liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.
The formulations of the invention can be administered for prophylactic and/or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is need of reduced triglyceride levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount. For example, in some embodiments, pharmaceutical compositions of the invention are administered in an amount sufficient to decrease serum levels of triglycerides in the subject. The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.
The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51 :337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84: 1144-1 146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24: 103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, administered practicing the methods of the invention are correct and appropriate.
Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., effect on tumor size or growth), and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.
In alternative embodiments, pharmaceutical formulations for oral
administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day. Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005. Various studies have reported successful mammalian dosing using
complementary nucleic acid sequences. For example, Esau C, et al, (2006) Cell Metabolism, 3(2):87-98 reported dosing of normal mice with intraperitoneal doses of miR-122 antisense oligonucleotide ranging from 12.5 to 75 mg/kg twice weekly for 4 weeks. The mice appeared healthy and normal at the end of treatment, with no loss of body weight or reduced food intake. Plasma transaminase levels were in the normal range (AST ¾ 45, ALT ¾ 35) for all doses with the exception of the 75 mg/kg dose of miR-122 ASO, which showed a very mild increase in ALT and AST levels. They concluded that 50mg/kg was an effective, non-toxic dose. Another study by
Krutzfeldt J., et al, (2005) Nature 438, 685-689, injected anatgomirs to silence miR- 122 in mice using a total dose of 80, 160 or 240 mg per kg body weight. The highest dose resulted in a complete loss of miR-122 signal. In yet another study, locked nucleic acid molecules ("LNA molecules") were successfully applied in primates to silence miR-122. Elmen J., et al, (2008) Nature 452, 896-899, report that efficient silencing of miR-122 was achieved in primates by three doses of 10 mg kg-1 LNA- antimiR, leading to a long-lasting and reversible decrease in total plasma cholesterol without any evidence for LNA-associated toxicities or histopathological changes in the study animals.
In some embodiments, the methods described herein can include coadministration with other drugs or pharmaceuticals, e.g., compositions for providing cholesterol homeostasis. For example, the inhibitory nucleic acids can be coadministered with drugs for treating or reducing risk of a disorder described herein.
EXAMPLES
The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Materials and Methods
The following materials and methods were used in the Examples 1-7 set forth below.
RIP-seq
RNA immunoprecipitation was performed (Zhao et al, 2008) using 10 7 wildtype 16.7 (Lee and Lu, 1999) and Ezh2-/- (Shen et al., 2008) ES cells. To construct RIP-seq libraries, cell nuclei were isolated, nuclear lysates were prepared, treated with 400 U/ml DNAse, and incubated with anti-Ezh2 antibodies (Active Motif) or control IgG (Cell Signaling Technology). RNA-protein complexes were immunoprecipitated with protein A agarose beads and RNA extracted using Trizol (Invitrogen). To preserve strand information, template switching was used for the library construction (Cloonan et al, 2008). 20-150 ng RNA and Adaptorl (5'- CTTTCCCTACACGACGCTCTTCCGATCTNNNNNN-3'; SEQ ID NO: 934970) were used for first-strand cDNA synthesis using Superscript II Reverse Transcription Kit (Invitrogen). Superscript II adds non-template CCC 3' overhangs, which were used to hybridize to Adaptor2-GGG template-switch primer (5'- CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGGG-3 ' ; SEQ ID NO: 934971). During l st -strand cDNA synthesis, samples were incubated with adaptorl at 20 °C for 10 min, followed by 37 °C for 10 min and 42 °C for 45 min. Denatured template switch primer was then added and each tube incubated for 30 min at 42 °C, followed by 75 °C for 15 min. Resulting cDNAs were amplified by forward (5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT CCGATCT-3'; SEQ ID NO: 934972) and reverse (5'-
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT-3 ' ; SEQ ID NO: 934973) Illumina primers. PCR was performed by Phusion polymerase (BioRad) as follows: 98 °C for 30s, 20 - 24 cycles of [98°C 10s, 65°C 30s, 72°C 30s], and 72°C for 5 min. PCR products were loaded on 3% NuSieve gel for size-selection and 200-1,200 bp products were excised and extracted by QIAEX II Agarose Gel Extraction Kit (Qiagen). Minus-RT samples generally yielded no products. DNA concentrations were quantitated by PicoGreen. 5-10 ml of 2 - 20 nM cDNA samples were sequenced by the Sequencing Core Facility of the Dept. of Molecular Biology, MGH, on the Illumina GAIL
Bioinformatic analysis
Complete RIP-seq datasets can be accessed through GEO via series
GSE 17064. Except as noted below, all analyses were performed using custom C++ programs. Image processing and base calling were performed using the Illumina pipeline. 3' adaptor sequences were detected by crossmatch and matches of >5 bases were trimmed, homopolymer reads filtered, and reads matching the mitochondrial genome and ribosomal RNAs excluded from all subsequent analyses. Remaining sequences were then aligned to the mm9 mouse reference genome using shortQueryLookup (Batzoglou et al, 2002). Alignments with <1 error were retained. Because library construction and sequencing generate sequence from the opposite strand of the PRC2-bound RNA, in all further analysis, we treated each read as if it were reverse-complemented. To determine the correlation coefficients comparing the original a-Ezh2 RIP-seq library to its technical and biological replicates and also to RIP-seq of the Ezh2-/- control line, we compared the number of reads per gene between two samples and, for each pair, we computed the Pearson correlation between the number of reads mapped to each refGene. That is, for each sample, we created a vector of counts of reads mapped to each refGene and computed the Pearson correlation between all pairs of vectors.
Locations of repetitive sequences in mm9 (RepeatMasker) were obtained from the UCSC Genome Browser database (Kent et al, The human genome browser at UCSC. Genome Res. 2002 Jun; 12(6):996-1006; Fujita et al, "The UCSC Genome Browser database: update 2011." Nucleic Acids Res. 2010 Oct 18) The overlap of expanded PRC2 transcriptome reads with these repeats was obtained by intersecting coordinates of RepeatMasker data with coordinates of read alignments. The UCSC transcriptome was used as general reference (available online at
hgdownload.cse.ucsc.edu/goldenPath/mm9/database/transcrip tome.txt.gz). To obtain a set of non-overlapping distinct transcribed regions, we sorted the UCSC
transcriptome transcripts by start coordinate and merged overlapping transcripts on the same strand (joined UCSC transcriptome: 39,003 transcripts total). We then intersected read alignment coordinates with those of the merged UCSC transcripts to determine the number of UCSC transcripts present in the expanded PRC2 transcriptome. Hits to the transcripts were converted to RPKM units, where the read count is l/(n*K*M), and n is the number of alignments in the genome, K is the transcript length divided by 1,000, and M is the sequencing depth including only reads mapping to mm9 divided by 1,000,000 (Mortazavi et al, 2008). This normalization allows for comparisons between transcripts of differing lengths and between samples of differing sequencing depths. To generate promoter maps, promoter regions were defined as -10,000 to +2000 bases relative to TSS (obtained from refGene catalog, UCSC Genome Browser, ). We plotted read counts overlapping promoter regions, except that the limit of 10 alignments was relaxed. Reads were normalized such that those mapping to n locations were counted as 1/η Λ of a read at each location. Graphs were plotted using custom scripts written in R. A list of all enriched transcripts were found by comparing the RPKM scores on each strand for all transcripts in the WT and Ezh2-/- samples. Then their coordinates were intersected with coordinates of the feature of interest. Features not in NCBI37/mm9 mouse assembly coordinates were converted to those coordinates using UCSC's LiftOver utility (The liftOver utility effectively maps one genome to another, allowing rapid identification of regions of interest between successive assemblies of the same species or between two distinct species; available online at genome.ucsc.edu/cgi- bin/hgLiftOver). Only features whose coordinates were convertible are shown.
RIP/qRT-PCR
Validation RIPs were performed as described (Zhao et al, 2008) using 5 ul of rabbit anti-mouse-Ezh2 antibodies (Active Motif) or normal rabbit IgG (Millipore). RIP was followed by quantitative, strand-specific RT-PCR using the ICYCLER IQ™ Real-time detection system (BioRad). Gene-specific PCR primer pairs are:
Malat- 1 : Forward 5 ' -GCCTTTTGTCACCTCACT-3 ' ; SEQ ID NO :
934974
Reverse 5 ' -CAAACTCACTGCAAGGTCTC-3 ' ; SEQ ID NO: 934975 Malatl-as: Forward 5 ' -TACTGGGTCTGGATTCTCTG-3 ' ; SEQ ID NO:
934976
Reverse 5 ' -CAGTTCCGTGGTCTTTAGTG-3 ' ; SEQ ID NO: 934977
Foxn2-as: Forward5 '-GGCTATGCTCATGCTGTAAC; SEQ ID NO: 934978 Reverse 5 ' -GTTACTGGCATCTTTCTCACA-3 ' ; SEQ ID NO: 934979
Ly6e-as: Forward 5 ' -CCACACCGAGATTGAGATTG-3 ' ; SEQ ID NO: 934980 Reverse 5 ' -GCCAGGAGAAAGACCATTAC-3 ' ; SEQ ID NO: 934981
Bgn-as: Forward 5 ' -TGTGAACCCTTTCCTGGA-3 ' ; SEQ ID
NO: 934982Reverse 5'-CTTCACAGGTCTCTAGCCA-3'; SEQ ID NO: 934983
Gtl2 : Forward 5 ' - CGAGGACTTCACGCACAAC -3 ' ; SEQ ID NO :
934984Reverse 5'- TTACAGTTGGAGGGTCCTGG -3'; SEQ ID NO: 934985
Gtl2-as: Forward 5'-CACCCTGAACATCCAACA-3'; SEQ ID
NO: 934986
Reverse 5 ' -CATCTGCTTTTCCTACCTGG-3 ' ; SEQ ID NO: 934987 Hapal-upstream: Forward 5 ' -GGTCC AAAATCGGCAGT-3 ' ; SEQ ID NO: 934988 Reverse 5'-GTCCTCAAATCCCTACCAGA-3'; SEQ ID NO: 934989 Htr6-downstream: Forward 5 ' -ACACGGTCGTGAAGCTAGGTA-3 ' ;
SEQ ID NO: 934990
Reverse 5 ' -CAGTTGGAGTAGGCCATTCCC-3 ' ; SEQ ID NO: 934991 Nespas/TR019501 : Forward 5 ' -AGATGAGTCCAGGTGCTT-3 ' ; SEQ ID
NO: 934992
Reverse 5 '-CAAGTCCAGAGTAGCCAAC-3 ' ; SEQ ID NO: 934993
Xist-Forward 3F5 and -Reverse 2R primers have been described (Zhao et al, 2008). For strand-specific cDNA synthesis, the reverse primer was used, qPCR carried out with SYBR green (BioRad), and threshold crossings (Ct) recorded. Each value was normalized to input RNA levels.
Northern blot analysis
5 μg of poly(A+) RNA were isolated from 16.7 ES cells, separated by 0.8% agarose gel containing formaldehyde, blotted onto Hybond-XL (GE Healthcare), and hybridized to probe using Ultrahyb (Ambion) at 42°C. Probes were generated using STRIP-EZ PCR kit (Ambion) and amplified from genomic DNA with:
Malatl-AS-F, 5 ' -TGGGCTATTTTTCCTTACTGG-3 ' ; SEQ ID NO: 934994 Malatl-AS-R, 5 ' -GAGTCCCTTTGCTGTGCTG-3 ' ; SEQ ID NO: 934995 (Gtl2) Meg3-F, 5 ' -GCGATAAAGGAAGACACATGC-3 ' ; SEQ ID NO:
934996
Meg3-R, 5'-CCACTCCTTACTGGCTGCTC-3'; SEQ ID NO: 934997 Meg3 ds-F3, 5'- ATGAAGTCCATGGTGACAGAC-3 ' ; SEQ ID NO: 934998 Meg3 ds-R2, 5 ' -ACGCTCTCGCATACACAATG-3 ' ; SEQ ID NO: 934999 Rtll-F, 5 ' -GTTGGGGATGAAGATGTCGT-3 ' ; SEQ ID NO: 935000 Rtll-R, 5 ' -GAGGCACAAGGGAAAATGAC-3 ' ; SEQ ID NO: 935001 Nespas ds-F, 5 '-TGGACTTGCTACCCAAAAGG-3 ' ; SEQ ID NO: 935002 Nespas ds-R, 5 '-CGATGTTGCCCAGTTATCAG-3 ' ; SEQ ID NO: 935003 Bgn-AS-F, 5 '-CAACTGACCTCATAAGCAGCAC-3 ' ; SEQ ID NO: 935004 Bgn-AS-R, 5 ' -AGGCTGCTTTCTGCTTCACA-3 ' ; SEQ ID NO: 935005 Htr6 up-F, 5 ' -ATACTGAAGTGCCCGGAGTG-3 ' ; SEQ ID NO: 935006 Htr6 up-R, 5 ' -CAGGGGACAGACATCAGTGAG-3 ' ; SEQ ID NO: 935007. UV-crosslink RIP
UV-crosslink IP was performed as described (Ule et al, 2005), except that transcripts in the RNA-protein complexes were not trimmed by RNAse treatment prior to RNA isolation in order to preserve full-length RNA for RT-PCR. Mouse ES cells were UV-irradiated at 254 nm, 400 mJ/cm 2 (using a Stratagene
STRATALINKER), cell nuclei were lysed in RSB-TRITON buffer (lOmM Tris-HCl, lOOmM NaCl, 2.5 mM MgCl 2 , 35 μg/mL digitonin, 0.5% triton X-100) with disruptive sonication. Nuclear lysates were pre-cleared with salmon sperm
DNA/protein agarose beads for 1 hr at 4°C and incubated with antibodies overnight. RNA/antibody complexes were then precipitated with Protein A DY ABEADS (Invitrogen), washed first in a low-stringency buffer (1XPBS [150 mM NaCl], 0.1% SDS, 0.5% deoxycholate, 0.5% NP-40), then washed twice in a high-stringency, high- salt buffer (5XPBS [750 mM NaCl], 0.1% SDS, 0.5% deoxycholate, 0.5% NP-40), and treated with proteinase K. RNA was extracted using TRIZOL (Invitrogen) and RT-qPCR was performed as described above.
Expression and purification of human PRC2 components
For expression of human PRC2 subunits, N-terminal flagged-tagged EZH2 and SUZ12 in pFastBacl were expressed in Sf9 cells (Francis et al, 2001). For expression of the whole PRC2 complex, flag-tagged EZH2 was coexpressed with untagged SUZ12, EED, and RBAP48. Extracts were made by four freeze-thaw cycles in BC300 buffer (20mM HEPES pH 7.9, 300mM KC1, 0.2mM EDTA, 10% glycerol, ImM DTT, 0.2mM PMSF, and complete protease inhibitors (Roche)) and bound to M2 beads for 4 h and washed with BC2000 before eluting in BC300 with 0.4mg/ml flag peptide. EZH2 and PRC2 were adjusted to lOOmM KC1 and loaded onto a HiTrap Heparin FF 1ml column and eluted with a 100-lOOOmM KC1 gradient. Peak fractions were concentrated using Amicon ultra lOkDa MWCO concentrators (Millipore) and loaded onto a Superose 6 column equilibrated with BC300. Peak fractions were collected and concentrated. For SUZ12, the flag elution was concentrated and loaded onto a Superdex 200 column equilibrated with BC300. Electrophoretic mobility shifting assays (EMSA)
RNA-EMSA is performed as previously described (Zhao et al, 2008). The 30 nt Hes-1 probe (-270 bp downstream of TSS in an antisense direction) was used for gel shifts. RNA probes were radiolabeled with [γ-33ρ]ΑΤΡ using T4 polynucleotide kinase (Ambion). Purified PRC2 proteins (1 μg) were incubated with labeled probe for lhr at 4 C. RNA-protein complexes were separated on a 4% non-denaturing polyacrylamide gel in 0.5xTBE at 250 V at 4 °C for 1 h. Gels were dried and exposed to Kodak BioMax film.
RNA pulldown assays
We incorporated T7 promoter sequence into forward primers for PCR products of RepA, Xist exon 1, and truncated Gtl2. Full-length Gtl2 was cloned into pYX-ASC and XistEl into pEFl/V5/HisB (Invitrogen). Specific primer sequences were:
RepA-F:
TAATACGACTCACTATAGGGAGAcccatcggggccacggatacctgtgtgtcc; SEQ ID NO: 935008
RepA-R: taataggtgaggtttcaatgatttacatcg; SEQ ID NO: 935009
Truncated-Gtl2-F:
TAATACGACTCACTATAGGGAGATTCTGAGACACTGACCATGTGCCCAGT GCACC; SEQ ID NO: 935010
Truncated-Gtl2-R: CGTCGTGGGTGGAGTCCTCGCGCTGGGCTTCC; SEQ ID NO: 93501 1
Xist El-F: atgctctgtgtcctctatcaga; SEQ ID NO: 935012
Xist El-R: gaagtcagtatggagggggt; SEQ ID NO: 935013
RNAs were then transcribed using the Mega Script T7 (Ambion), purified using Trizol, and slow-cooled to facilitate secondary structure formation. For pulldown assays, 3μg of Flag-PRC2 or Flag-GFP and 5 pmol of RNA supplemented with 20U RNAsin were incubated for 30 min on ice. ΙΟμΙ of flag beads were added and incubated on a rotating wheel at 4°C for 1 hr. Beads were washed 3 times with 200 μΐ buffer containing 150mM KCl, 25mM Tris pH 7.4, 5mM EDTA, 0.5mM DTT, 0.5% NP40 and ImM PMSF. RNA-protein complexes were eluted from flag beads by addition of 35μ1 of 0.2M-glycine pH2.5. Eluates were neutralized by addition of 1/10 th volume of 1M Tris pH 8.0 and analyzed by gel electrophoresis.
Knockdown analysis and qRT-PCR
shRNA oligos were cloned into MISSION pLKO.1-puro (Sigma-Aldrich) vector and transfected into wild-type mouse ES cells by Lipofectamine 2000
(Invitrogen). After 10 days of puromycin selection, cells were collected and qRT-PCR was performed to confirm RNA knockdown. The corresponding scrambled sequence (MISSION Non-target shRNA) was used as a control (Scr). The shRNA oligos for Gtl2: (Top strand) 5' - CCG GGC AAG TGA GAG GAC ACA TAG GCT CGA GCC TAT GTG TCC TCT CAC TTG CTT TTT G - 3'; SEQ ID NO: 935014(Bottom strand) 5' - AAT TCA AAA AGC AAG TGA GAG GAC ACA TAG GCT CGA GCC TAT GTG TCC TCT CAC TTG C - 3'; SEQ ID NO: 935015. qPCR primers for Gtl2 and Gtl2-as RNAs are as described above. Primers for Dlkl RNAs:
(Forward) 5' - ACG GGA AAT TCT GCG AAA TA -3'; SEQ ID NO:
935016(Reverse) 5' - CTT TCC AGA GAA CCC AGG TG -3'; SEQ ID NO: 935017. Another Gtl2 shRNA was purchased from Open Biosystems (V2MM_97929). Ezh2 levels after knockdown with this shRNA were tested by qPCR (Zhao et al, 2008). After testing multiple clones, we concluded that Gtl2 could be knocked down in early passage clones (50-70%), but knockdown clones were difficult to maintain in culture long-term.
DNA ChIP and real-time PCR
ChIP was performed as described (Zhao et al., 2008). 5 μΐ of a-Ezh2 antibodies (Active Motif 39103), normal rabbit IgG (Upstate 12-370), and a- H3K27me3 (Upstate) were used per IP. Real-time PCR for ChIP DNA was performed at the Gi/2-proximal DMR with prGtl2F/prGtl2R, at the Gtl2-distal DMR with DMR- F/DMR-R, at the Dlkl promoter with prDlklF/prDlklR, and at the Gapdh promoter with prGAPDH-F/prGAPDH-R. Primer sequences are as follows:
proximal-DMR 5' - CATTACCACAGGGACCCCATTTT; SEQ ID NO: 935018
proximal-DMR 5' - GATACGGGGAATTTGGCATTGTT; SEQ ID NO: 935019 prDlklF 5' CTGTCTGCATTTGACGGTGAAC; SEQ ID NO: 935020 prDlklR 5' CTCCTCTCGCAGGTACCACAGT; SEQ ID NO: 935021 distal-DMR-F 5' GCCGTAAAGATGACCACA; SEQ ID NO: 935022
distal-DMR-R 5' GGAGAAACCCCTAAGCTGTA; SEQ ID NO: 935023 prGAPDH-F 5' AGCATCCCTAGACCCGTACAGT; SEQ ID NO: 935024 prGAPDH-R 5' - GGGTTCCTATAAATACGGACTGC; SEQ ID NO: 935025 prActin-F 5' - GCA GGC CTA GTA ACC GAG ACA; SEQ ID NO: 935026 prActin-R 5' - AGT TTT GGC GAT GGG TGC T; SEQ ID NO: 935027 The following materials and methods were used in Examples 6-10 set forth below.
LNA Nucleofection - 2 X 10 6 SV40T transformed MEFs were resuspended in ΙΟΟμΙ of Mef nucleofector solution (Lonza). Cy3-labeled LNA molecules were added to a final concentration of 2μΜ. The cells were transfected using the T-20 program. 2 ml of culture medium was added to the cells and ΙΟΟμΙ of this suspension was plated on one gelatinized 10 well slide per timepoint. LNA sequences were designed using Exiqon software (available at exiqon.com). Modified LNA bases were strategically introduced to maximize target affinity (Tm) while minimizing self-hybridization score. The LNA molecule sequences (from 5' to 3') were as follows:
LNA-Scr, GTGTAACACGTCTATACGCCCA; SEQ ID NO: 935028
LNA-C1, CACTGCATTTTAGCA; SEQ ID NO: 935029
LNA-C2, AAGTCAGTATGGAG; SEQ ID NO: 935030
LNA-B, AGGGGCTGGGGCTGG; SEQ ID NO: 935031
LNA-E, ATAGACACACAAAGCA; SEQ ID NO: 935032
LNA-F, AAAGCCCGCCAA; SEQ ID NO: 935033
LNA-4978, GCTAAATGCACACAGGG; SEQ ID NO: 935034LNA- 5205, CAGTGC AGAGGTTTTT; SEQ ID NO: 935035
LNA-726,TGCAATAACTCACAAAACCA ; SEQ ID NO: 935036
LNA-3', ACCCACCCATCCACCCACCC; SEQ ID NO: 935037
Real Time PCR - Total RNA was extracted after nucleofection using Trizol (Invitrogen). Reverse transcriptase reaction was performed using the Superscript II kit and real time PCR performed on cDNA samples using icycler SYBR green chemistry (Biorad).
ChIP - Cells were fixed at various time points after nucleofection in 1% formaldehyde solution. Fixation was stopped by addition of glycine to 0.125M and ChIP was performed as described earlier (28) and quantitated by qPCR.
Antibodies- The antibodies for various epitopes were purchased as follows: H3K27me3, Active Motif 39535. Ezh2, Active Motif 39639 and BD Pharmingen 612666. For Immunostaining, H3K27me3 antibodies were used at 1 : 100 dilution and Ezh2 antibodies (BD Pharmingen) at 1 :500. Alexa-Fluor secondary antibodies were from Invitrogen. For Western blots, Ezh2 antibodies (BD Pharmingen) were used at 1 :2000 dilution. Actin antibody (Sigma A2066) was used at 1 :5000 dilution.
DNA FISH, RNA FISH, and Immunostaining- Cells were grown on gelatinized glass slides or cytospun. RNA FISH, DNA FISH, serial RNA-DNA FISH, immunostaining, and immunoFISH were performed as described (24). Xist RNA FISH was performed using nick-translated pSx9-3 probe or an Xist riboprobe cocktail. pSx9-3 was used as probe ioxXist DNA FISH. For metaphase spreads, colchicine was added to cells for 1 hr. Cells were trypsinized and resuspended in 3 ml of 0.056M KC1 for 30 minutes at room temperature, centrifuged and resuspended in methanokacetic acid (3: 1) fixative. After several changes of fixative, cells were dropped on a chilled slide and processed for RNA or DNA FISH.
Example 1. Capturing the Expanded PRC2 Transcriptome by RIP-seq
Native RNA immunoprecipitations (RIP) previously identified RepA, Xist, and Tsix as PRC2-interacting RNAs (Zhao et al, 2008). Here, we developed a method of capturing the genome-wide pool bound to PRC2 by combining native RIP (Zhao et al, 2008) and R A-seq (Cloonan et al, 2008) (this method is referred to herein as "RIP-seq;" see an exemplary Fig. 1). Nuclear RNAs immunoprecipitated by a-Ezh2 antibodies were isolated from mouse ES cells (Lee and Lu, 1999) and an Ezh2-/- control (Shen et al, 2008), cDNAs created using strand-specific adaptors, and those from 200-1,200 nt were purified and subjected to Illumina sequencing. In pilot experiments, we performed RIP on 10 7 ES cells and included several control RIPs to assess the specificity of a-Ezh2 pulldowns. In the wildtype pulldown and its technical and biological replicates, a-Ezh2 antibodies precipitated 70-170 ng of RNA from 107 ES cells and yielded a cDNA smear of >200 nt. Treatment with RNAses eliminated products in this size range and -RT samples yielded no products, suggesting that the immunoprecipitated material was indeed RNA. There was -10- fold less RNA in the Ezh2-/- pulldown (~14 ng) and when wildtype cells were immunoprecipitated by IgG (~24 ng). A 500-fold enrichment over a mock RIP control (no cells) was also observed. In the >200 nt size range, control RIPs (null cells, IgG pulldowns, mock) were even further depleted of RNA, as these samples were dominated by adaptor and primer dimers. We computationally filtered out adaptor/primer dimers, rRNA, mitochondrial RNA, reads with <18 nt or
indeterminate nucleotides, and homopolymer runs in excess of 15 bases. From an equivalent number of cells, control RIPs were significantly depleted of reads. In wildtype libraries, 231,880-1.2 million reads remained after filtering. By contrast, only 4,888 to 73,691 reads remained in controls. The overwhelming majority of transcripts in the controls were of spurious nature (adaptor/primer dimers, homopolymers, etc.). Therefore, wildtype RIPs exhibited substantial RNA enrichment and greater degrees of RNA complexity in comparison to control RIPs.
Approximately half of all reads in the wildtype libraries was represented three times or more. Even after removing duplicates to avoid potential PCR artifacts, the wildtype library contained 301,427 distinct reads (technical and biological replicates with 98,704 and 87, 128, respectively), whereas control samples yielded only 1,050 (IgG) and 17,424 (null). The wildtype libraries were highly similar among each other, with correlation coefficients (CC) of 0.71-0.90, as compared to 0.27-0.01 when compared against Ezh2-/- and IgG controls, respectively. Reads mapping to repetitive elements of >10 copies/genome accounted for <20% of total wildtype reads, with simple repeats being most common and accounting for 85.714%, whereas LINEs, SINEs, and LTRs were relatively under-represented. Because reads with <10 alignments have greatest representation, we hereafter focus analysis on these reads (a cutoff of <10 retains genes with low-copy genomic duplications).
We next examined their genome distribution by plotting distinct reads as a function of chromosome position. The alignments showed that PRC2-associated RNAs occurred on every chromosome in the wildtype libraries. Alignments for IgG and Ezh2-/- controls demonstrated few and sporadic reads. Therefore, our RIP-seq produced a specific and reproducible profile for the expanded PRC2 transcriptome. A large number of wildtype reads hits the X-chromosome, and a zoom of the X- inactivation center showed that our positive controls - Tsix, RepA, and Xist RNAs - were each represented dozens of times. The high sensitivity of our RIP-seq detection was suggested by representation of RepA and Xist, which are in aggregate expressed at <10 copies/ES cell (Zhao et al, 2008). On the other hand, no hits occurred within other noncoding RNAs of the X-inactivation center. Thus, the RIP-seq technique was both sensitive and specific.
Example 2. The Expanded PRC2 Transcriptome
To obtain saturating coverage, sequencing was scaled up, resulting in 31.9 million reads for the original wildtype sample and 36.4 million for its biological replicate. After removing duplicates and filtering, 1,030,708 and 852,635 distinct reads of alignment <10 remained for each library, respectively. These reads were then combined with pilot wildtype reads for subsequent analyses (henceforth, WT library) and all analyses were performed using the Ezh2-/- library as control.
A strategy was designed based on the relative representation in the WT versus null libraries, reasoning that bona fide positives should be enriched in the WT. Genie representations were calculated using "reads per kilobase per million reads" (RPKM) as a means of normalizing for gene length and depth of sequencing (Mortazavi et al, 2008), and then all 39,003 transcripts in the UCSC joined transcriptome were mapped to a scatterplot by their WT RPKM (x-axis) and their null RPKM (y-axis) values. Transcripts with zero or near-zero representation in both libraries accounted for the vast majority of datapoints [blue cloud at (0,0)]. Transcripts with nonzero x- values and a zero y-value indicated a population represented only in WT pulldowns. In the original 9,788 transcriptome, to determine an appropriate enrichment threshold, we performed an in silico subtraction. WT/null RPKM ratios were examined for the same calibrators. Xist/RepA scored 4.18/0, implying hundreds to thousands of representations in the WT library but none in the null. Tsix scored 10.35/3.27, Bsn- pasr 0.95/0, and Kcnqlotl 1.17/0. The negative controls scored low ratios, with Pax3- pasr at 0.11/0.26, Heyl-pasr 0.28/0, Hotair 0.25/0, Insl6 0.27/3.09, and Ccdc8 0.22/5.04. On this basis, a 3: 1 enrichment ratio for RPKM(WT)/RPKM(null) and a minimum RPKM of 0.4 were called, as published in Zhao et al., 2010. To generate the "expanded PRC2 transcriptome", we dropped the criteria for enrichment based on minimum RPKM values and WT/null ratios. Instead, we based the transcript identification for the "expanded PRC2 transcriptome" on the fact that there are ~10-times more RNAs pulled down by EZH2 antibodies in the wildtype cell line than in the Ezh2-null line, indicating that the wildtype library is already highly enriched for PRC2-associated transcripts and that no further in silico subtraction is necessary. Using this criterion, the size of the expanded PRC2 transcriptome is estimated at ~57K RNAs. Table 2 includes transcripts that are unique compared to the approximately 9,788 PRC2 transcriptome published in Zhao et al., Molecular Cell, 40:939-953 (2010).
Example 3. Identification of PRC2-binding Peaks from Appendix I
In some or any embodiments, the region of an RNA to which a protein binding partner (e.g., PRC2) binds is one of the exemplary locations on a target lncRNA to which an inhibitory nucleic acid is designed to hybridize. For example, these regions can be identified by reviewing the data in Appendix I and identifying regions that are enriched in the dataset; these regions are likely to include PRC2-binding sequences.
The sequence reads in Appendix I come directly off the Illumina GA-II genome analyzer and are in an orientation that is the reverse complement of the PRC2-associated binding transcript. Appendix I is a filtered subset of all of the reads after bioinformatic filtering removed adaptor/primer dimers, mitochondrial RNA, rRNA, homopolymers, reads with indeterminate nucleotides, and truncated reads (<15nt). They are likely to represent regions best protected from endogenous nucleases during RIP and subsequent RNA purification steps described in Example 1 above (a RIP-seq method) and thus represent candidate regions of RNA that bind to PRC2 or associated proteins or complexes. Regions of the PRC2-associated transcripts were then identified with an uninterrupted pile-up of reads (peaks) and considered candidate PRC2 contact regions within the RNA.
The sequence reads in Appendix I were used to generate sequence coverage on the reference genome using the Broad Institute's Arachne aligner, ShortQueryLookup, which is based on making a k-mer (K=12) dictionary of the reference genome and performing a local Smith-Waterman alignment on a read's candidate locations based on matching k-mer locations in the genome. The aligner does multiple placements. The best alignment is allowed to have at most one error and alignments that differ from the best alignment's number of errors by one are also accepted. The coverage is normalized by dividing by the number of places the read aligns (e.g. if a reads aligns to four places, 0.25 is added to each of the bases in the four places).
To obtain the target Peaks, the following methodology was used. Appendix I wild-type sequence coverage of the transcriptome serves as the starting point. The coverage is strand-specific. Next, in non-overlapping consecutive windows of 100 bps in length, peak values and their locations are determined. Peak positions were then corrected for those peaks that are on the edge of a window that are determined to be on a side of a larger peak. Those peaks are moved to the top of the larger peak. Duplicate peak locations are then removed. Peaks positions that were on a plateau are moved to the center of the plateau. The coverage was then smoothed using a
Gaussian kernel, (l/sqrt(2*sigma*pi))*exp(-t A 2/(2*sigma)), where sigma = 5.0. Peak widths were then determined by locating the nearest position to the peak such that the smoothed coverage is less than or equal to one -third the maximum coverage. Adjacent peaks that overlap each other are resolved by placing a boundary between them at the midpoint between the peaks.
Peaks are then output into a table with the position, width, the maximum amplitude, and the sum of unsmoothed coverage underneath the width of the peak. The corresponding nucleotide sequences of the mouse Peaks in mm9 (converted to RNA by replacing T with U) appear in the sequence listing as SEQ ID NOS: 47,408 to 616,428 [mouse Peaks]. Mouse-to-human LiftOver of the mouse chromosome coordinates and strand of these mouse Peaks was performed in the UCSC genome browser as described herein, to generate orthologous human chromosome coordinates. This process and LiftOver chains are generally described in Kent et al, Proc. Natl Acad. Sci., 100(20) 11484-1 1489 (2003). When the mouse coordinates (mm9) of each mouse Peak were converted to the corresponding human (hgl9) coordinates, mapping percentages of 50, 65, 75, and 95 yielded essentially identical location and length results whenever a match occurred. Consequently, the 50% mapping parameter was used.
Each corresponding human Peak RNA sequence (i.e., the nucleotide sequence of the human chromosomal coordinates and strand, converted to RNA by replacing T with U) appear in the sequence listing as SEQ ID NOS: 652,256 to 916,209 [human Peaks]. Table 1 displays the mouse sequences and the corresponding human sequences. These human Peaks and the human PRC2 transcriptome (i.e. human sequences of PRC2-binding transcripts referenced in Tables 1-4) were intersected with known genes from the NCBI database to identify genes targeted by the PRC2- associated RNA (i.e. an intersecting or nearby gene).
Table 2 shows the annotation of the mouse and human Peaks with the names of genes that were near or intersected with each Peak. The unique NCBI gene ID associated with the human gene (listed first) or mouse gene (listed second) appears in parentheses adjacent to the gene name. The degree of overlap between the Peak coordinates and the gene coordinates appears in square brackets. A positive number indicates the number of overlapping nucleotides between the two, and a negative number represents the size of the gap between the two (i.e. the number of nucleotides of distance between the two). For Peaks, an "F" within the square brackets indicates that the Peak coordinates fully overlap the gene coordinates. For transcripts, an "F" within the square brackets indicates that the transcript coordinates fully overlap the gene coordinates, or vice versa. The RNA transcript or Peak is "antisense" to the reference genes in the "Opposite Strand" column, while the RNA transcript or Peak is in the same "sense" orientation as the reference gene in the "Same Strand" column.
Bioinformatic analysis indicates that the average Peak is about 40-60 bases, which is an excellent size for initial design of inhibitory nucleic acids. Each of these Peaks is fully represented by the reverse-complement reads in Appendix I since it corresponds to a segment of overlapping reverse-complement reads from Appendix I. The Peaks can be found anywhere within the coding gene, and in either sense or antisense orientations. Peaks can also be found in the promoter/5 'UTR regions, introns, internal exons, and 3 'UTR and beyond. The analysis strongly suggests that the PRC2 -interacting transcripts are not the protein-coding mRNA, but a distinct transcript or transcripts that overlap with the mRNA sequence. Many are novel RNAs not previously described.
Routine methods can be used to design an inhibitory nucleic acid that binds to target locations or segments with sufficient specificity, or are sufficiently
complementary to the target RNA to give the desired effect. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid.
Additional target segments 5-500 nucleotides in length, or about 5 to about 100 nucleotides in length, or about 2kb in length, comprising a stretch of at least five (5) consecutive nucleotides within the Peak, or immediately adjacent thereto, are considered to be suitable for targeting as well. For each of the human Peaks that did not match a longer human transcript sequence, a longer 2kb fragment of surrounding human chromosomal sequence was identified, and appears in the sequence listing as SEQ ID NOs 916,626-934,761 [larger region surrounding human Peaks].
Example 4. Evidence Supporting Direct Binding of RNA to PRC2 in or around the Peak regions
Experiments were carried out to test the idea that RNA identified using the criteria in Example 2 directly bind PRC2. In vitro biochemical analyses were performed using purified recombinant human PRC2 subunits, EED, EZH2, SUZ12, and RBAP48. The newly identified antisense RNA for Hesl (a transcription factor in the Notch signaling pathway (Axelson, 2004)) contains a double stem-loop structure, a motif also found in RepA (Zhao et al, 2008). In an RNA electrophoretic mobility shift assay (EMSA), both the 28-nt RepA and 30-nt Hesl-as probes were shifted by PRC2, whereas RNAs derived from other regions of Xist (Dsl, DsII) were not.
Mutating the stem-loop structures reduced PRC2 binding. To determine which subunit of PRC2 binds Hesl-as, we performed EMSA using specific subunits. EZH2 strongly shifted wildtype but not mutated Hesl-as RNA, whereas neither SUZ12 nor EED shifted Hesl-as. The RNA-protein shift was always more discrete when whole PRC2 was used, suggesting that other subunits stabilize the interaction. These results show that Hesl-as RNA directly and specifically interacts with PRC2 and Ezh2 is the RNA- binding subunit. Further evidence comes from the observation that the two of the greatest peaks within the Xist/Tsix locus localize to the Repeat A region, the 28-nt repeated motif known to directly interact with EZH2 on both the forward and reverse strands (Zhao et al, 2010). Other examples from the original 9,788 transcriptome have also been tested in vitro by RNA EMSA using purified PRC2 complexes. RNA fragments derived from "Peaks" showed robust shifts with PRC2, whereas those mapping outside the "Peaks" shifted poorly. We therefore believe that many, if not all, of the identified "Peaks" of Table 2 represent bona fide PRC2-interacting domains of the RNA. These results show that the Peaks, and likely adjacent regions, directly and specifically interact with PRC2 complex. Example 5. In vitro effect of inhibitory oligonucleotides on upregulation of mRNA expression
A. ApoE
Inhibitory oligonucleotides were designed to target lncRNA in order to upregulate ApoE. The oligonucleotides were less than 16 bases in length and comprised unmodified DNA and multiple locked nucleic acid modified bases, all linked by phosphorothioate bonds. Transfection and data analysis were carried out briefly as follows.
RNA was harvested from the Hep 3B cells using Promega SV 96 Total RNA Isolation system omitting the DNAse step. In separate pilot experiments, 50 ng of RNA was determined to be sufficient template for the reverse transcriptase reaction. RNA harvested from the Hep3B cells was normalized so that 50ng of RNA was input to each reverse transcription reaction. For the few samples that were too dilute to reach this limit, the maximum input volume was added. Quantitative PCR evaluation was then completed.
A baseline level of ApoE mRNA expression was determined through quantitative PCR as outlined above. Baseline levels were also determined for mRNA of various housekeeping genes which are constitutive ly expressed. A "control" housekeeping gene with approximately the same level of baseline expression as ApoE mRNA was chosen for comparison purposes to ApoE.
Hep3B cells were seeded into each well of 24-well plates at a density of 25,000 cells per 500uL and transfections were performed with Lipofectamine and the inhibitory oligonucleotides. Control wells contained Lipofectamine alone. At 48 hours post-transfection, approximately 200 uL of cell culture supematants were stored at -80 C for ELISA. At 48 hours post-transfection, RNA was harvested from the Hep 3B cells and quantitative PCR was carried out as outlined above. The percent induction of ApoE mRNA expression by each inhibitory oligonucleotide was determined by normalizing mRNA levels in the presence of the inhibitory oligonucleotide to the mRNA levels in the presence of control (Lipofectamine alone). This was compared side -by-side with the increase in mRNA expression of the "control" housekeeping gene.
A total of 26 oligonucleotides tested were complementary to PRC2 -binding RNA sequences identified according to Example 2 above. Of these 26 oligonucleotides, 7 upregulated apoE expression in human Hep3B cells, as indicated by increased ApoE mRNA levels relative to the "control" housekeeping gene.
The above procedure was repeated using human renal proximal tubule epithelial cells (RPTEC). Of the 26 oligonucleotides complementary to PRC2- binding RNA sequences identified according to Example 2 above, 5 increased ApoE mRNA levels in renal cells, relative to the "control" housekeeping gene. Levels increased by about 1.5 to about 5-fold over baseline expression.
In addition, of 1 1 oligonucleotides that are complementary to Peaks associated with apoE identified according to Example 3 above, 3 upregulated apoE expression.
Inhibitory oligonucleotides as short as 8 nucleobases in length were demonstrated to upregulate gene expression.
B. Nkx2-1
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target lncRNA in order to upregulate Nkx2- 1. A total of 13 oligonucleotides tested were complementary to a PRC2-binding RNA sequence identified according to Example 2 above . Of these 13 oligonucleotides, 3 upregulated Nkx2-1 expression as indicated by increased NKX2-1 mRNA expression relative to baseline, although no "control" housekeeping gene could be matched with Nkx2-1 due to low levels of intrinsic expression. In addition, of 9 oligonucleotides that are complementary to Peaks associated with Nkx2-l identified according to Example 3 above, 3 upregulated Nkx-21 expression.
C. Brcal
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target lncRNA in order to upregulate Brcal . A total of 30 oligonucleotides tested were complementary to two PRC2-binding RNA sequences identified according to Example 2 above. Of these 30 oligonucleotides, 5 oligonucleotides upregulated Brcal expression. Of these 30 oligonucleotides, 13 oligonucleotides were also complementary to Peaks associated with Brcal identified according to Example 3 above. Of these 13 oligonucleotides complementary to Peaks, 2 oligonucleotides upregulated Brcal expression. Levels increased by about 2 to about 3 fold over baseline expression. D. Smad7
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target lncRNA as set forth in the sequence listing in order to upregulate Smad7, with the following exception: the kidney cell line RPTEC was used instead of HepB3. A total of 28 oligonucleotides tested were complementary to SEQ ID NO. 18602. Of these 28 oligonucleotides, 4 upregulated Smad7 expression. In addition, of 28 oligonucleotides that are complementary to Peaks in Table 2 associated with Smad7, 4 upregulated Smad7 expression.
E. SirT6
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target lncRNA in order to upregulate SirT6. A total of 25 oligonucleotides tested were complementary to a PRC2 -binding RNA sequence identified according to Example 2 above. Of these 25 oligonucleotides, 3 upregulated SirT6 expression. A total of 2 oligonucleotides tested were
complementary to another PRC2 -binding RNA sequence identified according to Example 2 above. Of these 2 oligonucleotides, 1 upregulated SirT6 expression. A total of 2 oligonucleotides tested were complementary to yet another PRC2-binding RNA sequence identified according to Example 2 above. Of these 2 oligonucleotides, neither upregulated SirT6 expression. Levels increased by 2 to 6 fold over baseline expression. In addition, of 6 oligonucleotides that are complementary to Peaks associated with SirT6 identified according to Example 3 above, 1 upregulated SirT6 expression.
F. Serpinfl
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target lncRNA in order to upregulate Serpinfl . A total of 38 oligonucleotides tested were complementary to two PRC2-binding RNA sequences identified according to Example 2 above. Of these 38 oligonucleotides, 3 upregulated SerpinFl expression. Levels increased by 1.2 to 2 fold over baseline expression. In addition, of 32 oligonucleotides that are complementary to Peaks associated with Serpinfl identified according to Example 3 above, 3 upregulated SerpinFl expression. G. KLF l
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate KLFl . A total of 30 oligonucleotides tested were complementary to SEQ ID NO: 15688 and 15689 in Table 2. Of these 30 oligonucleotides, 15 upregulated KLFl expression in human Hep3B cells, as indicated by increased KLFl mRNA levels relative to the "control" housekeeping gene. In addition, of 2 oligonucleotides that are complementary to Peaks in Table 2 associated with KLFl, 1 upregulated KLFl expression. Levels increased by 2 to 50 fold over baseline expression.
H. Rpsl9
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate rpsl9. A total of 30 oligonucleotides tested were complementary to SEQ ID NO. 630259 and 630260 in Table 2. Of these 30 oligonucleotides, 7 upregulated rpsl9 expression as indicated by increased rpsl9 mRNA expression relative to the "control" housekeeping gene. In addition, of 25 oligonucleotides that are complementary to Peaks in Table 2 associated with rpsl9, 7 upregulated rpsl9 expression. Levels increased by 1.2 to 1.6 fold over baseline expression.
I. PTEN
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate PTEN. A total of 40 oligonucleotides tested were complementary to SEQ ID NOs: 650,560 and 650,559 in Table 2. Of these 40 oligonucleotides, 18 oligonucleotides upregulated PTEN expression. Of these 40 oligonucleotides, 31 were also complementary to Peaks in Table 2 associated with PTEN. Of these 31 oligonucleotides complementary to Peaks, 1 1 oligonucleotides upregulated PTEN expression. Levels increased by about 1.5 to about 5 fold over baseline expression.
J. EPO
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate erythropoietin (EPO). A total of 13 tested oligonucleotides were complementary to SEQ ID NOs. 932, 189 or 932, 190 in Table 2. Of these 13 oligonucleotides, 5 upregulated EPO expression. In addition, of 2 oligonucleotides that are complementary to Peaks in Table 2 associated with EPO, 1 upregulated EPO expression. Levels increased by 4 fold over baseline expression.
An ELISA assay using a commercially available kit [DEP00, RnD Systems] was used according to the manufacturer's instructions to determine secreted protein present in cellular supernatant. Fold induction of protein was determined by normalizing protein levels induced by oligonucleotides to the protein levels induced by control (Lipofectamine alone). The data showed that of the 1 oligonucleotides tested that increased EPO mRNA expression, it demonstrated a corresponding EPO protein expression increase.
3 oligonucleotides complementary to SEQ ID NOs. 14486 and 14487
(transcripts that overlap the mouse EPO gene) were tested in vivo for ability to upregulate mouse EPO expression. In addition, two other oligos targeting
downstream peak regions were tested as well. Of these, 4 oligonucleotides were complementary to Peak regions in Table 2 associated with EPO. Male C57B16/J mice [6-8wks old and 20-25g] were administered subcutaneously a single injection of oligonucleotide, at a dose of either 10 mg/kg or 25 mg/kg in ΙΟΟμΙ of sterile phosphate buffered saline. At a time point 48 hours after injection, terminal blood samples were taken via cardiac puncture and assayed for levels of EPO protein using an ELISA assay [MEPOO, RnD Systems] according to the manufacturer's instructions. Of the oligos tested that were complementary to SEQ ID NO. 14486 or 14487 or Peaks, one demonstrated a 5-fold induction and another demonstrated a 7-fold induction of EPO protein at a dose of 25 mg/kg. Of these two oligonucleotides that induced EPO protein expression in vivo, one is within 150 bases of (and the other is within 1500 bases of) and both are on the opposite strand as the mouse Peak that is SEQ ID NO: 461812. This mouse Peak corresponds to the human Peak of SEQ ID NO: 845472.
K. BDNF
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate BDNF. A total of 21 oligonucleotides tested were complementary to SEQ ID NO: 620236 and 620237 in Table 2. Of these 21 oligonucleotides, 9 upregulated BDNF expression. A total of 2 oligonucleotides tested were
complementary to SEQ ID NO: 130,694 in Table 2. Of these 2 oligonucleotides, 1 upregulated BDNF expression. . Levels increased by 1.5 to 6 fold over baseline expression. In addition, of 14 oligonucleotides that are complementary to Peaks in Table 2 associated with BDNF, 6 upregulated BDNF expression. Levels increased by 2 to 7 fold over baseline expression.
L. Granulin
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate Granulin. A total of 30 oligonucleotides tested were complementary to SEQ ID NO. 640164 and 192311 in Table 2. Of these 30 oligonucleotides, 6 upregulated Granulin expression as indicated by increased Granulin mRNA expression relative to the "control" housekeeping gene. In addition, of 22
oligonucleotides that are complementary to Peaks in Table 2 associated with
Granulin, 4 upregulated Granulin expression. Levels increased by 1.5 to 2 fold over baseline expression.
M. KLF4
A total of 30 oligonucleotides tested were complementary to SEQ ID NO: 624099 in Table 2. Of these 30 oligonucleotides, 13 upregulated KLF1 expression in human Hep3B cells, as indicated by increased KLF4 mRNA levels relative to the "control" housekeeping gene. In addition, of 20 oligonucleotides that are
complementary to Peaks in Table 2 associated with KLF4, 10 upregulated KLF4 expression. Levels increased by 2 to 15 fold over baseline expression.
N. Fvii (Factor VII)
The experiments as described in Example 5A above were repeated for inhibitory oligonucleotides designed to target IncRNA as set forth in Table 2 in order to upregulate Fvii. The oligonucleotides designed to target Fvii were about 20 bases in length and comprised modified DNA with a 2'-0- Me with full phosphorothioate linkage backbone. A total of 25 oligonucleotides tested were complementary to SEQ ID NOs: 632564 and 632565 in Table 2. Of these 25 oligonucleotides, 12 upregulated Fvii expression. Levels increased by 2- to 25 fold over baseline expression. In addition, of 25 oligonucleotides that are complementary to Peaks in Table 2 associated with Fvii, 12 upregulated Fvii expression.
Example 6. LNA molecules Targeting Xist Repeat C rapidly displace Xist RNA from Xi
Repeat C was aligned using Geneious (Drummond et al., (2010) Geneious v5.1, Available on the internet at geneious.com) and LNA molecules complementary to two regions with a high degree of inter-repeat conservation were synthesized. The first LNA molecule showed conservation in all 14 repeats (LNA-C1) and the second in 13 of 14 (LNA-C2). LNA molecules were nucleofected separately into transformed mouse embryonic fibroblasts (MEFs), and the cells were adhered onto slides and fixed in situ at various timepoints between 0 minutes (immediately after nucleofection) and 8 hours post-nucleofection. To examine effects on Xist RNA, RNA fluorescence in situ hybridization (FISH) was performed using Xist-specific probes. (MEF cells are tetraploid due to transformation; each tetraploid cell has two Xa and two Xi). In controls transfected with scrambled LNA molecules (LNA-Scr), robust Xist clouds were seen in 80-90% of cells at all timepoints. Intriguingly, introduction of either LNA-C 1 or -C2 resulted in immediate loss of Xist RNA from Xi. Even at t=0 (cells fixed immediately, within seconds to minutes, after LNA introduction), -10% of nuclei displayed a loosening of the Xist RNA clusters, with the clusters appearing faint and diffuse (n=149). The percentage of nuclei with full Xist clouds continued to drop during the first hour and reached a minimum at t=60 minutes (21%, n=190). These findings indicate that LNA molecules disrupted Xist binding to chromatin as soon as they were introduced. However, the loss of Xist from Xi was transient, as pinpoints of Xist RNA typical of nascent transcripts seen in undifferentiated embryonic stem (ES) cells, became visible at t=3 hr (18%, n=190 at 1 hr; 36%, n=123 at 3 hr). Full recovery of Xist clouds was not seen until 8-24 hr post- nucleofection (81% at 8 hr, n=l 17).
The next experiment addressed whether LNA molecules had similar effects in mouse ES cells an established ex vivo model which recapitulates XCI as the cells differentiate in culture. In the undifferentiated state, wildtype female ES cells express low levels of Xist RNA, visible as pinpoint signals by RNA FISH. By day 6 of differentiation, -40% of cells would normally have upregulated Xist RNA. When ES cells were nucleofected with LNA-C 1 on day 6, Xist displacement occurred rapidly, reaching a maximum at 1 hr and recovering by 8 hr. Thus, LNA molecules were effective in ES cells as well as in somatic cells. These results contracted sharply with those obtained from MEFs nucleofected with siRNAs or shRNAs toward the same region of Xist. Neither siRNAs nor shRNAs led to loss of Xist at the 1,3 or 24 hour timepoints, and partial decreases in Xist clouds occurred only at 48 hours (83%, n=84 at lhr; 80%, n=106 at 24 hr). Thus, LNA molecules can be used efficiently to target long nuclear ncRNAs such as Xist with extremely rapid kinetics, much more rapid than the action of siRNAs or shRNAs, in multiple cell types.
To test the specificity of the LNA molecules, human 293 cells were nucleofected with the Repeat C LNA molecules. Sequence comparison between the mouse and human Xist/XIST revealed that the region targeted by LNA-C1 is conserved in 10 of 15 nt and is conserved in 10 of 14 nt for LNA-C2. Nucleofection of scrambled LNA molecules followed by XIST RNA FISH in human cells showed two normal XIST clouds in nearly all cells (92%, n=108). Similarly, nucleofection with either LNA-C1 or LNAC-2 did not change the XIST clouds (LNA-C1, 89%, n=126; LNA-C2, 85%, n=139). Thus, mouse Repeat C LNA molecules do not affect human XIST localization, suggesting that they function in a species-specific manner. To determine whether human Repeat C could displace human XIST, we nucleofected LNA molecules complementary to the human Repeat C into 293 cells, but observed no loss of XIST clouds (91%, n=103 at 1 hr; 87%, n=95 at 3 hr and 92%, n=85 at 8 hr). This finding indicated that, although Repeat C may play a role in humans, additional human elements function in RNA localization. Whereas mouse Repeat C occurs 14 times, the human repeat is present only once (8, 9).
Example 7. Xist RNA is displaced without transcript destabilization
Several mechanisms could explain the disappearance of Xist. LNA molecules could anneal to the complementary region and target Xist for degradation.
Alternatively, hybridization to LNA molecules could displace Xist RNA from Xi without affecting the transcript stability. To distinguish between these possibilities, Xist levels were quantitated relative to Gadph levels (control) by qRT-PCR at different timepoints. At 1 hr when Xist clouds were no longer visible, Xist levels remained comparable to that seen in the scrambled control. Even at 3 and 8 hr, Xist levels did not change significantly. These results showed that displacement of Xist occurred without complete RNA degradation. Thus, LNA molecules function by blocking Xist interaction with chromatin rather than altering the RNA's stability.
The rapid displacement of Xist and the slow kinetics of recovery provided the opportunity to investigate several unanswered questions regarding Xist's mechanism of localization. To ask whether reappearance of Xist on Xi is due to relocalization of displaced Xist molecules or to coating by newly synthesized RNA, we performed time-course analysis in the presence of actinomycin D (ActD), an inhibitor of RNA polymerase II. Previous studies have shown that the half-life of Xist in the cell is approximately 4-6 hr (14-16). It was reasoned that treating cells with ActD for 0-8 hr would prevent new synthesis of Xist RNA during this timeframe and that, therefore, reappearance of Xist clouds would imply relocalization of displaced RNA back onto Xi. LNA molecules were introduced into cells and then the cells were allowed to recover in medium containing ActD. In the scrambled controls, Xist clouds were clearly visible at all time points without ActD. With ActD, Xist clouds were apparent in the 1 and 3 hr timepoints and were lost by 8 hr, consistent with a 4-6 hr half-life. In LNA-C1- or LNA-C2-treated samples allowed to recover without ActD, pinpoints of Xist were visible at 3 hr and Xist clouds were restored by the 8 hr timepoint.
However, with ActD, Xist clouds were never restored, neither fully nor partially. Thus, Xist recovery after LNA molecule -mediated displacement from Xi is due to new RNA synthesis and not relocalization of the displaced transcript.
Example 8. Xist RNA localizes near the X-inactivation center first
Taking further advantage of the rapid displacement and slow recovery, the long-standing question of whether Xist spreads in a piecemeal fashion or localizes simultaneously throughout Xi was asked. One hypothesis is that coating initiates near the Xist locus and proceeds to both ends of the chromosome through booster elements located along the X (17). Alternatively, coating can occur all at once through multiple X-linked seeding points which would promote local spreading. Xist localization on metaphase chromosomes was analyzed during the 3-8 hr period of recovery. In cells treated with scrambled LNA molecules, all metaphase chromosomes coated with Xist RNA showed a banded pattern similar to the heterogeneous patterns described in earlier works (18-20). By contrast, LNA-C1 treated cells gave intermediate patterns. At 1 hr, no metaphase chromosomes showed a coat of Xist RNA (0%, n= 41). At 3 hr when Xist RNA could be seen as a pinpoint in interphase cells, the predominant pattern was a combination of a single bright band in the middle of the metaphase chromosome together with a small number of very faint bands elsewhere on the X (52%, n=46). This result suggested that Xist RNA initially bound locally. To determine whether the strong RNA band was localized to the Xist region, Xist RNA FISH was carried out on non-denatured nuclei and followed with denaturation and hybridization to an Xist probe. Indeed, the focal RNA band observed at the 3-hr mark colocalized with the Xist region. At 5 hr, intermediate degrees of coating and intensities could be seen, 68%, n= 38). At 8 hr, the predominant pattern was the whole-chromosome painting pattern typical of control cells (78%, n=38). In controls, intermediate patterns were not observed at any time. These findings argue that Xist RNA initially binds nearby, but seems to spread to the rest of Xi at the same time, within the temporal and spatial resolution of the FISH technique.
Example 9. Xist RNA displacement is accompanied by loss of PRC2 localization
The pattern of Polycomb repressive complex 2 (PRC2) binding to Xi has been of considerable interest, as its Ezh2 subunit catalyzes trimethylation of Histone H3 at lysine 27 (H3K27me3). Several studies have shown that PRC2 localizes to Xi in an Xist-dependent manner, as deleting Xist in ES cells precludes PRC2 recruitment during differentiation and conditionally deleting Xist in MEF cells results in loss of PRC2 on Xi (21 -24). However, the kinetics with which PRC2 is recruited to and lost from X are not known. Because Xist RNA directly recruits PRC2 (12), it was asked whether LNA molecule-mediated displacement of Xist results in immediate loss of PRC2 by immunostaining for Ezh2 in MEFs after LNA molecule delivery. Upon treatment with the Repeat C LNA molecules, Ezh2 was rapidly lost. There was nearly perfect concordance between Xist and PRC2 loss. At 1 and 3 hr, Ezh2 foci were never observed in nuclei that had lost Xist and, conversely, were always observed in nuclei with restored Xist clouds. The loss of Ezh2 on Xi was due to Ezh2 protein turnover (see Western analysis below). Transient displacement of PRC2, however, does not lead to appreciable H3K27me3 loss within the 1-8 hr timeframe. Thus, PRC2's localization onto Xi absolutely depends on Xist RNA for both initial targeting and for stable association after XCI is established, but the H3K27me3 mark is stable in the short term when Xist and PRC2 are displaced.
Given this, it was asked whether LNA molecules affected gene silencing. At 3 hr when Xist was maximally displaced, RNA FISH was performed for Xist and either Pgkl or Hprt, two X-linked genes subject to XCI. In control-nucleofected (LNA-Scr) cells, Xist clouds were observed from Xi and nascent Pgkl or Hprt transcripts from Xa. Nucleofection with LNA-C1 and LNA-4978 did not change the expression pattern, as two foci of Pgkl transcripts were still seen in 79% (n=39) of controls and 80% (n=36) of LNA-C1 -treated cells, and two foci of Hprt RNA were seen in 84% ( n =44) of controls and 79% (n=35) of LNA-C1 -treated cells. Four foci of Pgkl or Hprt transcripts were never seen. Thus, consistent with retention of H3K27me3, silencing was not disrupted by transient loss of Xist and PRC2.
Example 10. A broader domain around Repeat C is required for Xist localization
The next experiments investigated other conserved repeats within Xist. As Repeat A has already been shown to be essential for targeting PRC2, the experiments focused on Repeats B, E, and F, and found tht Xist localization was not affected by targeting any repeat individually or in combination. Conserved unique regions of Xist were also tested, including LNA-726 (between Repeats A and F), LNA-4978 and LNA-5205 (between Repeats C and D), and LNA-3' (distal terminus of Xist). None affected Xist localization except for LNA-4978, which corresponds to a 15-nt element located 280 bp downstream of Repeat C. LNA-4978 induced effects similar to LNA- C1/C2 but differed by its slower kinetics. At 1 hr, Xist clouds were still visible but appeared faint and dispersed (78%, n=125). The number of clouds reached a minimum at 3 hr (25%, n=158). At 8 hr, Xist was visible as small pinpoints (39%, n=123). Recovery was not complete until the 24-hr timepoint. As for Repeat C LNA molecules, loss of Xist was not due to RNA turnover, as determined by qRT-PCR, and Ezh2 was displaced without affecting H3K27me3 or change in Ezh2 protein level. Therefore, Xist localization to chromatin involves a broader region encompass both Repeat C and a unique region directly downstream of the repeat.
To determine if the two motifs cooperate, LNA-4978 and LNA-C1 were nucleofected separately or together into MEFs. As expected, treating with LNA-C1 alone resulted in loss of Xist RNA clouds by 1 hr and recovery beginning at 3 hr, and treating with LNA-4978 showed loss and recovery at 3 hr and 8 hr, respectively. Treating with both LNA molecules expanded the window of Xist depletion: Loss of Xist RNA and Ezh2 was observed by 1 hr (as was the case for LNA-C 1 alone) and recovery did not begin until the 8 hr timepoint (as was the case for LNA-4978 alone). Thus, the LNA molecule effects were additive, not synergistic, as the effects were not enhanced beyond the widening of the Xist-depleted time window.
Example 11. Ezh2 recovery after LNA molecule nucleofection is slow but uniform along Xi
Finally, it was asked whether Ezh2 retargeting to Xi closely follows the piecemeal relocalization of Xist RNA during the recovery phase. Because PRC2 generally binds near promoters (25, 26), Ezh2 localization at X-gene promoters was analyzed by quantitative chromatin immunoprecipitation (qChIP). Although female cells have two Xs and Ezh2 epitopes pulled down by the antibody could theoretically come from either Xa or Xi, evidence indicates that the vast bulk of Ezh2 and
H3K27me3 is bound to Xi (21-24). Ezh2 was indeed enriched at promoters of genes that are silenced on Xi (e.g., Xmr, Pgkl), but not at promoters of genes (e.g., Jaridlc) that escape XCI. Then, MEF cells were nucleofected with LNA-C1 and performed qChIP using anti-Ezh2 antibodies between 1 and 24 hr. At t=lhr, Ezh2 levels decreased dramatically at all tested target gene promoters to background levels, indicating that depletion of promoter-bound Ezh2 closely followed Xist displacement along Xi. At the 3- and 8-hr points, there was a gradual, uniform increase in Ezh2 levels across all genes, with many genes appearing to have reached saturating amounts of Ezh2 by t=8hr. On promoters with the highest levels of Ezh2 at t=0hr, Ezh2 levels did not fully recover until 24 hr. Thus, ChIP pulldowns were expected to originate predominantly, if not nearly exclusively, from Xi. In contrast, Ezh2 levels at the Enl control, a known autosomal PRC2 target (27), did not change significantly. Thus, Ezh2 levels fall and rise with similar kinetics throughout Xi. The loss of Xist RNA and Ezh2 binding between 1 and 8 hrs presents a window of opportunity during which cells could be reprogrammed to achieve novel epigenetic states.
References
1. Kapranov P, Willingham AT, & Gingeras TR (2007) Genome -wide transcription and the implications for genomic organization. Nat Rev Genet 8(6):413- 423. 2. Mercer TR, Dinger ME, & Mattick JS (2009) Long non-coding RNAs: insights into functions. Nat Rev Genet 10(3): 155-159.
3. Krutzfeldt J, et al. (2005) Silencing of microRNAs in vivo with 'antagomirs'. Nature 438(7068):685-689.
4. Orom UA, Kauppinen S, & Lund AH (2006) LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene 372: 137- 141.
5. Morris KV (2008) RNA-mediated transcriptional gene silencing in human cells. Curr Top Microbiol Immunol 320:211-224.
6. Petersen M & Wengel J (2003) LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol 21(2):74-81.
7. Penny GD, Kay GF, Sheardown SA, Rastan S, & Brockdorff N (1996) Requirement for Xist in X chromosome inactivation. Nature 379(6561): 131-137.
8. Brockdorff N, et al. (1992) The product of the mouse Xist gene is a 15 kb inactive X-specific transcript containing no conserved ORF and located in the nucleus. Cell 71 (3):515-526.
9. Brown CJ, et al. (1992) The human XIST gene: analysis of a 17 kb inactive X-specific RNA that contains conserved repeats and is highly localized within the nucleus. Cell 71(3):527-542.
10. Clemson CM, McNeil JA, Willard HF, & Lawrence JB (1996) XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure. J Cell Biol 132(3):259-275.
11. Wutz A, Rasmussen TP, & Jaenisch R (2002) Chromosomal silencing and localization are mediated by different domains of Xist RNA. Nat Genet
30(2): 167-174.
12. Zhao J, Sun BK, Erwin JA, Song JJ, & Lee JT (2008) Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 322(5902):750-756.
13. Beletskii A, Hong YK, Pehrson J, Egholm M, & Strauss WM (2001) PNA interference mapping demonstrates functional domains in the noncoding RNA Xist. Proc Natl Acad Sci USA 98(16):9215-9220.
14. Sheardown SA, et al. (1997) Stabilization of Xist RNA mediates initiation ofX chromosome inactivation. Cell 91(1):99-107. 15. Sun BK, Deaton AM, & Lee JT (2006) A transient heterochromatic state in Xist preempts X inactivation choice without RNA stabilization. Mol Cell 21(5):617-628.
16. Panning B, Dausman J, & Jaenisch R (1997) X chromosome inactivation is mediated by Xist RNA stabilization. Cell 90(5):907-916.
17. Gartler SM & Riggs AD (1983) Mammalian X-chromosome inactivation. Annu Rev Genet 17: 155-190.
18. Duthie SM, et al. (1999) Xist RNA exhibits a banded localization on the inactive X chromosome and is excluded from autosomal material in cis. Hum Mol Genet 8(2): 195-204.
19. Chadwick BP & Willard HF (2004) Multiple spatially distinct types of facultative heterochromatin on the human inactive X chromosome. Proc Natl Acad Sci USA 101(50): 17450-17455.
20. Clemson CM, Hall LL, Byron M, McNeil J, & Lawrence JB (2006) The X chromosome is organized into a gene -rich outer rim and an internal core containing silenced nongenic sequences. Proc Natl Acad Sci USA 103(20): 7688- 7693.
21. Plath K, et al. (2003) Role of histone H3 lysine 27 methylation in X inactivation. Science 300(5616): 131-135.
22. Kohlmaier A, et al. (2004) A chromosomal memory triggered by Xist regulates histone methylation in X inactivation. PLoS Biol 2(7):E171.
23. Silva J, et al. (2003) Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enxl polycomb group complexes. Dev Ce// 4(4):481-495.
24. Zhang LF, Huynh KD, & Lee JT (2007) Perinucleolar targeting of the inactive X during S phase: evidence for a role in the maintenance of silencing. Cell 129(4):693-706.
25. Boyer LA, et al. (2006) Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441(7091):349-353.
26. Ku M, et al. (2008) Genomewide analysis of PRC 1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 4(10):el000242.
27. Bracken AP, Dietrich N, Pasini D, Hansen KH, & Helin K (2006) Genome-wide mapping of Polycomb target genes unravels their roles in cell fate transitions. Genes Dev 20(9): 1 123-1136. 28. Blais A, et al. (2005) An initial blueprint for myogenic differentiation. Genes Dev 19(5):553-569.
Axelson, H. (2004). The Notch signaling cascade in neuroblastoma: role of the basic helix-loop-helix proteins HASH- 1 and HES-1. Cancer Lett 204, 171-178
Batzoglou, S., Jaffe, D.B., Stanley, K., Butler, J., Gnerre, S., Mauceli, E., Berger, B., Mesirov, J.P., and Lander, E.S. (2002). ARACHNE: a whole-genome shotgun assembler. Genome Res 12, 177-189
Bernardi, R., and Pandolfi, P.P. (2007). Structure, dynamics and functions of promyelocytic leukaemia nuclear bodies. Nat Rev Mol Cell Biol 8, 1006-1016
Bernstein, B.E., Mikkelsen, T.S., Xie, X., Kamal, M., Huebert, D.J., Cuff, J., Fry, B., Meissner, A., Wernig, M., Plath, K., et al. (2006a). A bivalent chromatin structure marks key developmental genes in embryonic stem cells. Cell 125, 315-326
Bernstein, E., and Allis, CD. (2005). RNA meets chromatin. Genes Dev 19, 1635-1655
Bernstein, E., Duncan, E.M., Masui, O., Gil, J., Heard, E., and Allis, CD. (2006b). Mouse polycomb proteins bind differentially to methylated histone H3 and RNA and are enriched in facultative heterochromatin. Mol Cell Biol 26, 2560-2569
Boyer, L.A., Plath, K., Zeitlinger, J., Brambrink, T., Medeiros, L.A., Lee, T.I., Levine, S.S., Wernig, M., Tajonar, A., Ray, M.K., et al. (2006). Polycomb complexes repress developmental regulators in murine embryonic stem cells. Nature 441, 349- 353
Carninci, P., Kasukawa, T, Katayama, S., Gough, J., Frith, M.C, Maeda, N., Oyama, R., Ravasi, T, Lenhard, B., Wells, C, et al. (2005). The transcriptional landscape of the mammalian genome. Science 309, 1559-1563
Cloonan, N., Forrest, A.R., Kolle, G, Gardiner, B.B., Faulkner, G.J., Brown, M.K., Taylor, D.F., Steptoe, A.L., Wani, S., Bethel, G, et al. (2008). Stem cell transcriptome profiling via massive-scale mRNA sequencing. Nat Methods 5, 613- 619
Coombes, C, Arnaud, P., Gordon, E., Dean, W, Coar, E.A., Williamson, CM., Feil, R., Peters, J., and Kelsey, G. (2003). Epigenetic properties and identification of an imprint mark in the Nesp-Gnasxl domain of the mouse Gnas imprinted locus. Mol Cell Biol 23, 5475-5488 Core, L.J., Waterfall, J.J., and Lis, J.T. (2008). Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters. Science 322, 1845-1848
Denisenko, O., Shnyreva, M., Suzuki, H., and Bomsztyk, K. (1998). Point mutations in the WD40 domain of Eed block its interaction with Ezh2. Mol Cell Biol 18, 5634-5642
Edwards, C.A., and Ferguson-Smith, A.C. (2007). Mechanisms regulating imprinted genes in clusters. Curr Opin Cell Biol 19, 281-289
Edwards, C.A., Mungall, A.J., Matthews, L., Ryder, E., Gray, D.J., Pask, A.J., Shaw, G, Graves, J.A., Rogers, J., Dunham, I., et al. (2008). The evolution of the DLK1-DI03 imprinted domain in mammals. PLoS Biol 6, e l35
Francis, N.J., Saurin, A.J., Shao, Z., and Kingston, R.E. (2001). Reconstitution of a functional core polycomb repressive complex. Mol Cell 8, 545-556
Gupta, R.A., Shah, N., Wang, K.C., Kim, J., Horlings, H.M., Wong, D.J., Tsai, M.C., Hung, T, Argani, P., Rinn, J.L., et al. (2010). Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature 464, 1071-1076
Guttman, M., Amit, I., Garber, M., French, C, Lin, M.F., Feldser, D., Huarte, M., Zuk, O., Carey, B.W., Cassady, J.P., et al. (2009). Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature
Kanhere, A., Viiri, K., Araujo, C.C., Rasaiyaah, J., Bouwman, R.D., Whyte, W.A., Pereira, C.F., Brookes, E., Walker, K., Bell, GW, et al. (2010). Short RNAs Are Transcribed from Repressed Polycomb Target Genes and Interact with Polycomb Repressive Complex-2. Mol Cell 38, 675-688
Kapranov, P., Cheng, J., Dike, S., Nix, D.A., Duttagupta, R., Willingham, A.T., Stadler, P.F., Hertel, J., Hackermuller, J., Hofacker, I.L., et al. (2007). RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science 316, 1484-1488
Khalil, A.M., Guttman, M., Huarte, M., Garber, M., Raj, A., Rivea Morales, D., Thomas, K., Presser, A., Bernstein, B.E., van Oudenaarden, A., et al. (2009). Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci U S A
Ku, M., Koche, R.P, Rheinbay, E., Mendenhall, E.M., Endoh, M., Mikkelsen, T.S., Presser, A., Nusbaum, C, Xie, X., Chi, A.S., et al. (2008). Genomewide analysis of PRC 1 and PRC2 occupancy identifies two classes of bivalent domains. PLoS Genet 4, el 000242
Lee, J.T. (2009). Lessons from X-chromosome inactivation: long ncR A as guides and tethers to the epigenome. Genes Dev 23, 1831-1842
Lee, J.T. (2010). The X as model for RNA's niche in epigenomic regulation. Cold Spring Harb Perspect Biol 2, a003749
Lee, J.T, and Lu, N. (1999). Targeted mutagenesis of Tsix leads to nonrandom X inactivation. Cell 99, 47-57
Lee, T.I., Jenner, R.G, Boyer, L.A., Guenther, M.G, Levine, S.S., Kumar, R.M., Chevalier, B., Johnstone, S.E., Cole, M.F., Isono, K., et al. (2006). Control of developmental regulators by Polycomb in human embryonic stem cells. Cell 125, 301 -313
Li, G, Margueron, R., Ku, M., Chambon, P., Bernstein, B.E., and Reinberg, D. Jarid2 and PRC2, partners in regulating gene expression. Genes Dev 24, 368-380
Li, G, Margueron, R., Ku, M., Chambon, P., Bernstein, B.E., and Reinberg, D. (2010). Jarid2 and PRC2, partners in regulating gene expression. Genes Dev 24, 368- 380
Lin, S.P., Youngson, N., Takada, S., Seitz, H., Reik, W., Paulsen, M., Cavaille, J., and Ferguson-Smith, A.C. (2003). Asymmetric regulation of imprinting on the maternal and paternal chromosomes at the Dlkl-Gtl2 imprinted cluster on mouse chromosome 12. Nat Genet 35, 97-102
Mercer, T.R., Dinger, M.E., and Mattick, J.S. (2009). Long non-coding RNAs: insights into functions. Nat Rev Genet 10, 155-159
Mikkelsen, T.S., Ku, M., Jaffe, D.B., Issac, B., Lieberman, E., Giannoukos, G, Alvarez, P., Brockman, W., Kim, T.K., Koche, R.P., et al. (2007). Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature 448, 553-560
Miremadi, A., Oestergaard, M.Z., Pharoah, P.D., and Caldas, C. (2007).
Cancer genetics of epigenetic genes. Hum Mol Genet 16 Spec No 1, R28-49
Montgomery, N.D., Yee, D., Chen, A., Kalantry, S., Chamberlain, S.J., Otte, A.P., and Magnuson, T. (2005). The murine polycomb group protein Eed is required for global histone H3 lysine-27 methylation. Curr Biol 15, 942-947
Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., and Wold, B. (2008). Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5, 621-628 Pandey, R.R., Mondal, T., Mohammad, R, Enroth, S., Redrup, L.,
Komorowski, J., Nagano, T., Mancini-Dinardo, D., and Kanduri, C. (2008). Kcnqlotl antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Mol Cell 32, 232-246
Pasini, D., Bracken, A.P., Jensen, M.R., Lazzerini Denchi, E., and Helin, K. (2004). Suzl2 is essential for mouse development and for EZH2 histone
methyltransferase activity. EMBO J 23, 4061-4071
Pasini, D., Cloos, P.A., Walfridsson, J., Olsson, L., Bukowski, J.P., Johansen, J. V., Bak, M., Tommerup, N., Rappsilber, J., and Helin, K. JARID2 regulates binding of the Polycomb repressive complex 2 to target genes in ES cells. Nature 464, 306- 310
Peng, J.C., Valouev, A., Swigut, T., Zhang, J., Zhao, Y., Sidow, A., and Wysocka, J. (2009). Jarid2/Jumonji Coordinates Control of PRC2 Enzymatic Activity and Target Gene Occupancy in Pluripotent Cells. Cell 139, 1290-1302
Pietersen, A.M., and van Lohuizen, M. (2008). Stem cell regulation by polycomb repressors: postponing commitment. Curr Opin Cell Biol 20, 201-207
Rajasekhar, V.K., and Begemann, M. (2007). Concise review: roles of polycomb group proteins in development and disease: a stem cell perspective. Stem Cells 25, 2498-2510
Ringrose, L., and Paro, R. (2004). Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu Rev Genet 38, 413-443
Rinn, J.L., Kertesz, M., Wang, J.K, Squazzo, S.L., Xu, X., Brugmann, S.A., Goodnough, L.H., Helms, J.A., Farnham, P.J., Segal, E., et al. (2007). Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell 129, 1311-1323
Schoeftner, S., Sengupta, A.K., Kubicek, S., Mechtler, K., Spahn, L., Koseki, H., Jenuwein, T., and Wutz, A. (2006). Recruitment of PRC1 function at the initiation of X inactivation independent of PRC2 and silencing. Embo J 25, 3110-3122
Schuettengruber, B., Chourrout, D., Vervoort, M., Leblanc, B., and Cavalli, G. (2007). Genome regulation by polycomb and trithorax proteins. Cell 128, 735-745
Schwartz, Y.B., Kahn, T.G, Nix, D.A., Li, X.Y., Bourgon, R., Biggin, M., and Pirrotta, V. (2006). Genome-wide analysis of Polycomb targets in Drosophila melanogaster. Nat Genet 38, 700-705 Schwartz, Y.B., and Pirrotta, V. (2008). Polycomb complexes and epigenetic states. Curr Opin Cell Biol 20, 266-273
Seila, A.C., Calabrese, J.M., Levine, S.S., Yeo, G.W., Rahl, P.B., Flynn, R.A., Young, R.A., and Sharp, P. A. (2008). Divergent transcription from active promoters. Science 322, 1849-1851
Shen, X., Liu, Y, Hsu, Y.J., Fujiwara, Y, Kim, J., Mao, X., Yuan, G.C., and Orkin, S.H. (2008). EZH1 mediates methylation on histone H3 lysine 27 and complements EZH2 in maintaining stem cell identity and executing pluripotency. Mol Cell 32, 491-502
Shen, X., Woojin, K., Fujiwara, Y, Simon, M.D., Liu, Y, Mysliwiec, M.R., Yuan, G.C., Lee, Y, and Orkin, S.H. (2009). Jumonji Modulates Polycomb Activity and Self-Renewal versus Differentiation of Stem Cells. Cell 139, 1303-1314
Simon, J.A., and Lange, C.A. (2008). Roles of the EZH2 histone
methyltransferase in cancer epigenetics. Mutat Res 647, 21-29
Sing, A., Pannell, D., Karaiskakis, A., Sturgeon, K., Djabali, M., Ellis, J., Lipshitz, H.D., and Cordes, S.P. (2009). A vertebrate Polycomb response element governs segmentation of the posterior hindbrain. Cell 138, 885-897
Sparmann, A., and van Lohuizen, M. (2006). Polycomb silencers control cell fate, development and cancer. Nat Rev Cancer 6, 846-856
Taft, R.J., Glazov, E.A., Cloonan, N., Simons, C, Stephen, S., Faulkner, G.J., Lassmann, T., Forrest, A.R., Grimmond, S.M., Schroder, K., et al. (2009). Tiny RNAs associated with transcription start sites in animals. Nat Genet 41, 572-578
Takahashi, N., Okamoto, A., Kobayashi, R., Shirai, M., Obata, Y, Ogawa, H., Sotomaru, Y, and Kono, T. (2009). Deletion of Gtl2, imprinted non-coding RNA, with its differentially methylated region induces lethal parent-origin-dependent defects in mice. Hum Mol Genet 18, 1879-1888
Thorvaldsen, J.L., and Bartolomei, M.S. (2007). Snapshot: imprinted gene clusters. Cell 130, 958
Ule, J., Jensen, K., Mele, A., and Darnell, R.B. (2005). CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods 37, 376-386
Wan, L.B., and Bartolomei, M.S. (2008). Regulation of imprinting in clusters: noncoding RNAs versus insulators. Adv Genet 61, 207-223
Williamson, CM., Turner, M.D., Ball, S.T., Nottingham, W.T., Glenister, P., Fray, M., Tymowska-Lalanne, Z., Plagge, A., Powles-Glover, N., Kelsey, G, et al. (2006). Identification of an imprinting control region affecting the expression of all transcripts in the Gnas cluster. Nat Genet 38, 350-355
Woo, C.J., Kharchenko, P.V., Daheron, L., Park, P.J., and Kingston, R.E. (2010). A region of the human HOXD cluster that confers Polycomb-group responsiveness. Cell 140, 99-110
Yap, K.L., Li, S., Munoz-Cabello, A.M., Raguz, S., Zeng, L., Mujtaba, S., Gil, J., Walsh, M.J., and Zhou, M.M. (2010). Molecular interplay of the noncoding RNA ANRIL and methylated histone H3 lysine 27 by polycomb CBX7 in transcriptional silencing of INK4a. Mol Cell 38, 662-674
Zhao, J., Sun, B.K., Erwin, J.A., Song, J.J., and Lee, J.T. (2008). Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome. Science 322, 750-756
Prasanth et al, Cell, 123:249-263, 2005
Khalil et al, Proc. Natl. Acad. Sci. USA, 106: 11667-1672, 2009
Bernard et al., EMBO J, 29:3082-3093, 2010
Mariner et al., Molec. Cell, 29:499-509, 2008
Shamovsky et al, Nature, 440:556-560, 2006
Sunwoo et al, Genome Res., 19:347-359, 2009
Kanhere et al., Molec. Cell, 38:675-388, 2010
Sarma et al, Proc. Natl. Acad. Sci., USA 107:22196-22201, 2010
EXAMPLES OF EMBODIMENTS
Examples of embodiments described herein include, but are not limited to:
1. A method of preparing a plurality of validated cDNAs complementary to a pool of nuclear ribonucleic acids (nRNAs), the method comprising:
providing a sample comprising nuclear ribonucleic acids, e.g., a sample comprising nuclear lysate, e.g., comprising nRNAs bound to nuclear proteins;
contacting the sample with an agent, e.g., an antibody, that binds specifically to a nuclear protein that is known or suspected to bind to nuclear ribonucleic acids, e.g., Ezh2, G9a, or Cbx7, under conditions sufficient to form complexes between the agent and the protein, e.g., such that the nRNAs remain bound to the proteins;
isolating the complexes; synthesizing DNA complementary to the nRNAs to provide an initial population of cDNAs;
optionally PCR-amplifying the cDNAs using strand-specific primers;
purifying the initial population of cDNAs to obtain a purified population of cDNAs that are at least about 20 nucleotides (nt) in length, e.g., at least 25, 50, 100, 150 or 200 nt in length;
sequencing at least part or substantially all of the purified population of cDNAs; comparing the high-confidence sequences to a reference genome, and selecting those sequences that have a high degree of identity to sequences in the reference genome, e.g., at least 95%, 98%, or 99% identity, or that have fewer than 10, 5, 2, or 1 mismatches; and
selecting those cDNAs that have (i) reads per kilobase per million reads (RPKM) above a desired threshold, and (ii) are enriched as compared to a control library (e.g., a protein-null library or library made from an IgG pulldown done in parallel);
thereby preparing the library of cDNAs.
2. The method of embodiment 1, wherein the agent is an antibody and isolating the complexes comprises immunoprecipitating the complexes.
3. The method of embodiment 1, wherein the cDNAs are synthesized using strand-specific adaptors.
4. The method of embodiment 1 , further comprising sequencing substantially all of the cDNAs.
5. A library of cDNAs complementary to a pool of nuclear ribonucleic acids (nRNAs) prepared by the method of embodiments 1-4.
6. The library of embodiment 5, wherein each of the cDNAs is linked to an individually addressable bead or area on a substrate.
7. An isolated nucleic acid comprising a sequence referred to in the sequence listing, or a fragment comprising at least 20 nt thereof.
8. A method of decreasing expression of an oncogene in a cell, the method comprising contacting the cell with a long non-coding RNA, or PRC2-binding fragment thereof, as referred to in Table 2, or a nucleic acid sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to a IncRNA sequence, or PRC2 -binding fragment thereof, as referred to in Table 2. 11. A method of increasing expression of a tumor suppressor in a mammal, e.g. human, in need thereof comprising administering to said mammal an inhibitory nucleic acid that specifically binds to a human IncRNA corresponding to a tumor suppressor locus of Table 2, or a human IncRNA corresponding to an imprinted gene of Table 4 and/or a IncRNA corresponding to a growth-suppressing gene of Table 2, or a related naturally occurring IncRNA that is orthologous or at least 90%, (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 100) nucleobases thereof, in an amount effective to increase expression of the tumor suppressor.
12. A method of inhibiting or suppressing tumor growth in a mammal, e.g. human, with cancer comprising administering to said mammal an inhibitory nucleic acid that specifically binds to a human IncRNA corresponding to a tumor suppressor locus of Table 2, or a human IncRNA corresponding to an imprinted gene of Table 4 and/or a human IncRNA corresponding to a growth-suppressing gene of Table 2, or a related naturally occurring IncRNA that is orthologous or at least 90%, (e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof, in an amount effective to suppress or inhibit tumor growth.
13. A method of treating a mammal, e.g., a human, with cancer comprising administering to said mammal an inhibitory nucleic acid that specifically binds to a human IncRNA corresponding to a tumor suppressor locus of Table 2, or aa human lcnRNA corresponding to an imprinted gene of Table 4, and/or a human IncRNS corresponding to a growth-suppressing gene of Table 2, or a related naturally occurring IncRNA that is orthologous or at least 90% (e.g.,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical over at least 15 (e.g., at least 20, 21, 25, 30, 50, 70, 100) nucleobases thereof, in a therapeutically effective amount.
14. The method of any of embodiments 1 1-13 wherein the inhibitory nucleic acid is single stranded or double stranded.
15. The method of any of embodiments 1 1-14 wherein the inhibitory nucleic acid is an antisense oligonucleotide, LNA, PNA, ribozyme or siRNA.
16. The method of any of embodiments 1 1-15 wherein the inhibitory nucleic acid is 5-40 bases in length (e.g., 12-30, 12-28, 12-25). 17. The method of embodiment 14 wherein the inhibitory nucleic acid is double stranded and comprises an overhang (optionally 2-6 bases in length) at one or both termini.
18. The method of any of embodiments 1-17 wherein the inhibitory nucleic acid comprises a sequence of bases at least 80% or 90% complementary to (e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of), or comprises a sequence of bases with up to 3 mismatches (e.g., up to 1, or up to 2 mismatches) over 10, 15, 20, 25 or 30 bases.
19. The method of embodiments 8-18, wherein the cell is a cancer cell, e.g., a tumor cell, in vitro or in vivo, e.g., in a subject.
20. A method of enhancing pluripotency of a stem cell, the method comprising contacting the cell with a long non-coding RNA, or PRC2 -binding fragment thereof, as referred to in Table 2 or 4 or a nucleic acid sequence that is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to a IncRNA sequence, or PRC2 -binding fragment thereof, as referred to in Table 2 or 4.
21. A method of enhancing differentiation of a stem cell, the method comprising contacting the cell with an inhibitory nucleic acid that specifically binds to a long non-coding RNA as referred to in the sequence listing.
22. The method of embodiments 20 or 21, wherein the stem cell is an embryonic stem cell.
23. The method of embodiments 20 or 21, wherein the stem cell is an iPS cell.
24. A sterile composition comprising an inhibitory nucleic acid that specifically binds to or is at least 90% complementary to (e.g., at least 5, 10, 15, 20, 25 or 30 bases of, or up to 30 or 40 bases of) a IncRNA of Table 2 or in the sequence listing, or a related naturally occurring IncRNA at least 90%,91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to at least 15 (e.g., at least 20, 21, 25, 30, 100) nucleobases of an IncRNA of Table 2 or in the sequence listing, for parenteral administration.
25. The composition of embodiment 24, wherein the inhibitory nucleic acid is selected from the group consisting of antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, micro RNAs (miRNAs); small, temporal RNAs (stRNA), and single- or double-stranded RNA interference (RNAi) compounds. 26. The composition of embodiment 24, wherein the RNAi) compound is selected from the group consisting of short interfering RNA (siRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); and small activating RNAs (saRNAs).
27. The composition of embodiment 24, wherein the antisense oligonucleotide is selected from the group consisting of antisense RNAs, antisense DNAs, chimeric antisense oligonucleotides, and antisense oligonucleotides
28. The composition of any of embodiments 24-27, wherein the inhibitory nucleic acid comprises one or more modifications comprising: a modified sugar moiety, a modified internucleoside linkage, a modified nucleotide and/or
combinations thereof.
29. The composition of embodiment 28, wherein the modified
internucleoside linkage comprises at least one of: alkylphosphonate,
phosphorothioate, phosphorodithioate, alkylphosphonothioate, phosphoramidate, carbamate, carbonate, phosphate triester, acetamidate, carboxymethyl ester, or combinations thereof.
30. The composition of embodiment 28, wherein the modified sugar moiety comprises a 2'-0-methoxyethyl modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-0-alkyl modified sugar moiety, or a bicyclic sugar moiety.
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
TABLE 2 - Page 1 of 1873
NCBI
SEQ ID NO. of PRC2-binding Transcripts and Peaks that target SEQ ID NO. of PRC2-binding Transcripts and Peaks that target
Gene Gene (Same Strand as Gene) Gene (Opposite or Antisense Strand to Gene)
Name
A1BG (1) &
645371[F], 645375[F], 736743[F], 630019[-4459], 38169[F],
645376[F], 630020[- 44 59], 38170[F], 38172[F], 231203[-3202] A1bg
38171 [F], 231204[F]
(117586) A1BG-AS1
736743[F], 645375(1530], 645371 [-552] 645376(1530]
(503538)
776399[F], 776402[F], 650544[80893], 44867[F], 313561 [F], 776400[F], 776401[F], 776403[F], 650545(80893], 44868[F], A1CF 313563[F], 313564[F], 313565[F], 313567[F], 313568[F], 313569[F], 313562[F], 313566[F], 313570[F], 313571 [F], 313573[F], 313574[F], (29974) & 313572[F], 313575[F], 313576[F 313577[F], 313578[F], 313579[F A1cf
629811 [F], 732828[F], 732829[F] 732831 [F], 863318[F], 863319[F],
629810[F], 732827[F], 732830[F], 732832]F], 863321 [F], 923036[F], A2LD1 863320[F], 923037[F], 923038[F] 923040[F], 644905(274], 37508[F],
923039[F], 923036(3987], 923041 (2159], 644904(274], 644906(157] (87769) & 222168[F], 222169[F], 222170[F] 222172[F], 222173[F], 222174[F],
37507[F], 222166[F], 222167[F], 222171 [F], 222178[F], 222184[F], A2ld1 222175[F], 222176[F], 222177[F] 222179[F], 222180[F], 222181 [F],
222186[F], 37505(1314], 37509(137] (223267) 222182[F], 222183[F], 222185[F] 37506(1314]
629388[F], 860302[F], 860303[F], 860304[F], 860305[F], 860306[F], 860307[F], 860308[F], 860309[F], 860310[F], 860318[F], 860323[F], 860331[F], 860301[-466], 629392[-2637], 16707[F], 493353[F], A2M (2) &
860325[F], 860332[F], 923809[F], 923810[F], 629391 [-2637] 493354[F], 493355[F], 493356[F], 493357[F], 493358[F], 493359[F], A2m
493360[F], 493361[F], 493362[F], 493363[F], 493364[F], 493365[F], (232345) 493366[F], 493367[F], 493368[F], 493369[F], 493370[F], 493371 [F], 493372[F], 493352[-403]
A2ML1 629389[F] 629390[F]
(144568) A3GALT2P
624994[F], 931023(1991], 825565[-9] 624995[F]
(127550) A4GALT
645830[F], 740013[F], 38764[F], 237580[F], 237581 [F], 237582[F], (53947) & 237583[F], 237584[F], 237585[F], 237586[F] A4galt
(239559) A4GNT
635745[F], 904011[F], 586904[F], 586906[F], 586907[F], (51146) &
635744[F], 904010[F], 904012[F], 586903[F], 586905[F], 25362(9865],
'25363[9865] A4gnt
(333424)
634505[F], 634507[F], 634508[F], 894708[F], 894711 [F], 894714[F], 634504[F], 634506[F], 894709[F], 894710[F], 894712[F], 894713[F], AAA1 894715[F], 634505(99988] , 634507(17137 894716[F], 634504(99988], 634506(17137 (404744)
646255[F], 742806[F], 742807[F], 742808[F], 742809[F], 742810[F],
AAAS
742811 [F], 742812[F], 742813[F], 646254[-274], 742805[-1849],
916549[F], 646253[-274], 742804[-4262], 646256[-4945], 39273[- (8086) & 646257[-4945], 39272[F], 243337[F], 243338[F], 243339[F],
66], 39270[-104], 243345[-2497], 243334[-3885] Aaas 243340[F], 243341[F], 243342[F], 243343[F], 243344[F], 39271 ]- (223921 ) 1041, 243336[-139l, 243335[-2276
627464[F], 844030[F], 844032[F], 844033[F], 844034[F], 844035[F], AACS 844036[F], 844038[F], 844039[F], 14231 [F], 458023[F], 458025[F], 627465[F], 844029[F], 844031 [F], 844037[F], 14232[F], 458022[F], (65985) & 458027[F], 458028[F], 458029[F], 458031 [F], 458032[F], 458034[F], 458024[F], 458026[F], 458030[F], 458033[F], 458036[F], 458039[F] Aacs 458035[F], 458037[F], 458038[F], 458040[F], 458041 [F] (78894)
AADAC
622083[F], 7179[F], 372135[-115] 622084[F], 7180[F], 372134[-3817] (13) &
Aadac AADACL2
622082[F], 7178[F], 372130[F], 372132[F], 7180[-295], 372134]- (344752) &
622081 [F], 7177[F], 372131 [F], 7179[-295], 372133[-343]
2504] Aadacl2
(639634) AADACL3 (126767) &
625506[F], 829335[F], 11535[F], 422320[F], 422321 [F] 625505[F], 11534[-128], 422319[-1559]
Aadacl3 (230883) AADACL4
625509[F], 829336[F], 829343[F], 829344[F], 829345[F], 11542[F], (343066) &
829342[F], 927236(2789]
422335[F], 422336[F], 422337[F] Gm13177
(435815) AADAT
633065[F], 884004[F], 884005[F], 884006[F], 21976[F], 545712[F], 633066[F], 884003[F], 884007[F], 884008[F], 884009[F], 21977[F],
(51166) & 545716[F], 545719[F], 545720[F], 545721 [F], 545723[F], 545724[F], 545711[F], 545713[F], 545714[F], 545715[F], 545717[F], 545718[F],
Aadat 545727[F], 545728[F], 21974[-2893] 545722[F], 545725[F], 545726[F], 21975[-2893]
(23923)
900047[F], 900048[F], 900049[F], 635283(53659], 635282[-86], AAGAB 900046[-329], 24751 [F], 579034[F], 579035[F], 579036[F], (79719) &
635281 [-86], 24749[-160], 579032[-2685], 24752[-4875]
579037[F], 579038[F], 579039[F], 24750[-160], 579033[-340], Aagab 5790311-2790], 579030[-4669], 24753[-4875], 579040[-4961] (66939) TABLE 2 - Page 2 of 1873
628962[F] 855726[F] 855727[F] 855729[F], 855730[F] 855731 [F
855732[F] 855733[F] 855734[F] 855735[F], 855737[F] 855738[F
855740[F] 855741 [F] 855742[F] 855743[F], 855744[F] 855746[F
855747[F] 855748[F] 855749[F] 855750[F], 855751 [F] 855752[F
855753[F] 855754[F] 855761 [F] 855762[F], 855763[F] 855766[F 628960[F], 628963[F], 855725[F], 855728[F], 855736[F], 855739[F], 855767[F] 855769[F] 855770[F] 855771 [F], 855772[F] 855773[F 855745[F], 855756[F], 855757[F], 855758[F], 855759[F], 855760[F], 855774[F] 855776[F] 855778[F] 855779[F], 855782[F] 855787[F 855764[F], 855765[F], 855768[F], 855775[F], 855777[F], 855780[F], 855789[F] 855791 [F] 855793[F] 855794[F], 855800[F] 855802[F 855781[F], 855783[F], 855784[F], 855785[F], 855786[F], 855788[F], 855803[F] 855805[F] 855806[F] 855807[F], 855810[F] 855812[F 855790[F], 855792[F], 855795[F], 855796[F], 855797[F], 855798[F], 855813[F] 855815[F], 855816[F], 855817[F], 16195[F], 484286[F] 855799[F], 855801[F], 855804[F], 855808[F], 855809[F], 855811[F], 484287[F] 484289[F] 484290[F] 484291 [F], 484292[F] 484293[F; 855814[F], 628961[269], 855724[-961], 16196[F], 484285[F],
484294[F] 484296[F] 484298[F] 484299[F], 484301 [F] 484302[F; 484288[F], 484295[F], 484297[F], 484300[F], 484304[F], 484308[F], AAK1 484303[F] 484305[F] 484306[F] 484307[F], 484310[F] 484311[F; 484309[F], 484316[F], 484324[F], 484326[F], 484335[F], 484337[F], (22848) & 484312[F] 484313[F] 484314[F] 484315[F], 484317[F] 484318[F 484338[F], 484339[F], 484340[F], 484344[F], 484346[F], 484347[F], Aak1 484319[F] 484320[F] 484321 [F] 484322[F], 484323[F] 484325[F 484350[F], 484352[F], 484353[F], 484354[F], 484356[F], 484358[F], (269774) 484327[F] 484328[F] 484329[F] 484330[F], 484331 [F] 484332[F; 484361[F], 484365[F], 484368[F], 484373[F], 484376[F], 484380[F], 484333[F] 484334[F] 484336[F] 484341 [F], 484342[F] 484343[F 484382[F], 484385[F], 484386[F], 484388[F], 484389[F], 484391 [F], 484345[F] 484348[F] 484349[F] 484351 [F], 484355[F] 484357[F; 484392[F], 484393[F], 484395[F], 484397[F], 484399[F], 484401 [F], 484359[F] 484360[F] 484362[F] 484363[F], 484364[F] 484366[F 484403[F], 484404[F], 484406[F], 484407[F], 484409[F], 484411[F], 484367[F] 484369[F] 484370[F] 484371 [F], 484372[F] 484374[F; 484415[F], 484419[F], 484420[F], 484422[F], 484425[F],
484375[F] 484377[F] 484378[F] 484379[F], 484381 [F] 484383[F 16194[133], 484284[-901], 484433[-2034], 16193[-2392], 484283[- 484384[F] 484387[F] 484390[F] 484394[F], 484396[F] 484398[F; 3506], 484282[-4623]
484400[F] 484402[F] 484405[F] 484408[F], 484410[F] 484412[F
484413[F] 484414[F] 484416[F] 484417[F], 484418[F] 484421 [F;
484423[F] 484424[F] 484426[F] 484427[F], 484428[F] 484429[F;
484430[F], 484431 [F], 4844321-1690], 484434[-4170], 484435[-4559]
617194[F], 658188[F], 658189[F], 658190[F], 658191 [F], 658192[F],
AAMP (14) 658193[F], 658194[F], 931074(2037], 658187[37], 658195[-95],
6171961-4026], 1002[-3507] & Aamp 1000[F], 60221 [F], 60222[F], 60223[F], 60224[F], 60225[F], 60226[F],
(227290) 60227[F], 60220[41], 60228[-63], 1001[-190], 60229[-1856]
AANAT
640549[F], 700027[F], 922861 [930], 700024[-1070], 700027[-1527],
640548[F], 700025[F], 700026[F], 928222[-2925], 700026[-4520], (15) &
922860[-3130], 31307[F], 31319[F], 144367[F], 144365[-1605],
700028[-4925], 31306[F], 31318[F], 144366[F], 144368[-4521] Aanat
144364[-1971], 144363[-2325], 144362[-2605], 144361[-4650]
(11298)
633929[F], 890561[F], 890562[F], 890563[F], 890564[F], 890565[F],
890566[F], 890567[F], 890568[F], 890569[F], 890570[F], 890571 [F],
890572[F], 890573[F], 890574[F], 890575[F], 890576[F], 890577[F],
890578[F], 890579[F], 890580[F], 890581 [F], 890582[F], 890583[F],
633930(2471], 924965(2030], 932947(715], 890560(30], 890584[- 1285], 925246[-3450], 23042[F], 559498[F], 559499[F], 559500[F],
AARS (16) 559501 [F], 559502[F], 559503[F], 559504[F], 559505[F], 559506[F],
23045[-2048], 559535[-4583] & Aars 559507[F], 559508[F], 559509[F], 559510[F], 559511 [F], 559512[F],
(234734) 559513[F], 559514[F], 559515[F], 559516[F], 559517[F], 559518[F],
559519[F], 559520[F], 559521[F], 559522[F], 559523[F], 559524[F],
559525[F], 559526[F], 559527[F], 559528[F], 559529[F], 559530[F],
23043(3727], 559497[-18], 559531 [-295], 559532[-455], 559533[- 547], 23044[-2048], 559534[-2199], 23041[-2214], 559496[-2379],
5594951-4012], 559494[-4174]
758761 [F], 758762[F], 758763[F], 758765[F], 758766[F], 758767[F],
758771[F], 758772[F], 758774[F], 758776[F], 648294(13023], AARS2
758764[F], 758768[F], 758769[F], 758770[F], 758773[F], 758775[F], 648296[-1004], 758777[-3377], 758778[-3618], 42029[F], 277680[F], (57505) &
648295[13023], 42030[F], 277683[F], 277685[F], 277687[F],
277681 [F], 277682[F], 277684[F], 277686[F], 277688[F], 277689[F], Aars2
277690[F], 277691[F], 277692[F], 277695[F], 277697[F]
277693[F], 277694[F], 277696[F], 277698[F], 42031 [-2576], 277699[- (224805) 4653], 277700[-4866]
640109[F], 697294[F], 697295[F], 697296[F], 697297[F], 697298[F],
640108[F], 697301[F], 697303[F], 640106(14186], 640108[11916], AARSD1 697299[F], 697300[F], 697302[F], 640107[14186], 640109[11916],
640110[-29], 697306[-513], 697307[-862], 30813[F], 139187[F], (80755) & 640111 [-29], 697304[-86], 697305[-322], 697300[-3882], 30814[F],
139188[F], 139193[F], 139194[F], 139195[F], 30815[-1045], 139199| Aarsdl 139185[F], 139186[F], 139189[F], 139190[F], 139191 [F], 139192[F],
1314], 139201 [-4492] (69684) 139196[F], 139197[F], 30816[-1045], 139198[-1172], 139200[-1406]
AASDH
626620[F], 838368[F], 13053[F], 445299[F], 445300[F], 445301[F],
(132949) &
13052[-2379] 445302[F], 445303[F], 445304[F], 445305[F], 445306[F], 13051 [-
Aasdh 2379]
(231326) TABLE 2 - Page 3 of 1873
893329[F], 893330[F], 893331[F], 893332[F], 893333[F], 893334[F],
AASDHPP
893335[F], 893336[F], 893337[F], 634256(21114], 634257[174],
634255(21114], 23478[F], 566228[F], 566229[F], 566233[F], T (60 4 96) 23479[F], 566226[F], 566227[F], 566230[F], 566231 [F], 566232[F],
566239[F], 566240[F] & Aasdhppt 566234[F], 566235[F], 566236[F], 566237[F], 566238[F], 566241 [F],
(67618) 566242[F], 23480[-44], 566243[-3782]
628161 [F], 848955[F], 848956[F], 848957[F], 848958[F], 848959[F],
848960[F], 848963[F], 848964[F], 848965[F], 848966[F], 848967[F], AASS
628160[F], 848954[F], 848961 [F], 848962[F], 15154[F], 469672[F], 15155[F], 469673[F], 469675[F], 469676[F], 469677[F], 469678[F], (10157) &
469674[F], 469681[F], 469682[F], 469683[F], 469685[F], 469689[F], 469679[F], 469680[F], 469684[F], 469686[F], 469687[F], 469688[F], Aass
469692[F], 469695[F], 469698[F], 469699[F], 469703[F]
469690[F], 469691[F], 469693[F], 469694[F], 469696[F], 469697[F], (30956) 469700[F], 469701[F], 469702[F], 469704[F]
639576[F] 693813[F] 693814[F] 693815[F] 693817[F] 693818[F]
693819[F] , 693820[F] 693821 [F] 693822[F] 693823[F] 693824[F]
693826[F] , 693827[F] 693828[F] 693829[F] 693831 [F] 693832[F]
693833[F] 693835[F] 693836[F] 693837[F] 693838[F] 693839[F]
693840[F] 693841 [F] 693842[F] 6938 4 3[F] 6938 4 4[F] 693845[F]
693846[F] , 693847[F] 6938 4 8[F] 693850[F] 693851 [F] 693852[F]
693853[F] 693854[F] 693856[F] 693858[F] 693859[F] 693860 [F]
30223[F] 133347[F], 33348[F], 33349[F] 133350[F], 33351 [F], 639575[F], 693816[F] 693825[F], 693830[F], 693834[F], 693849[F], 133353[F] , 133354[F] 133355[F] 133356[F] 133357[F] 133358[F] 693855[F], 693857[F] 693861 [F], 639577[-4258], 30222[F],
AATF
133359[F] 133360[F] 133361 [F] 133363[F] 133364[F] 133365[F] 133352[F], 133362[F] 133374[F], 133381 [F], 133386[F], 133392[F],
(26574) & 133366[F] 133367[F] 133368[F] 133369[F] 133370[F] 133371 [F] 133394[F], 133400[F] 133401 [F], 133403[F], 133408[F], 133409[F],
Aatf 133372[F] , 133373[F] 133375[F] 133376[F] 133377[F] 133378[F] 133417[F], 133420[F] 133423[F], 133427[F], 133430[F], 133432[F],
(56321) 133379[F] , 133380[F] 133382[F] 133383[F] 133384[F] 133385[F] 133435[F], 133439[F] 133441 [F], 133443[F], 133444[F], 133445[F], 133387[F] 133388[F] 133389[F] 133390[F] 133391 [F] 133393[F] 133448[F], 133451 [F] 30224[-4470]
133395[F] 133396[F] 133397[F] 133398[F] 133399[F] 133402[F]
133404[F] , 133405[F] 133406[F] 133407[F] 133410[F] 133411 [F]
133412[F] , 133413[F] 133414[F] 133415[F] 133416[F] 133418[F]
133419[F] 133421 [F] 133422[F] 133424[F] 133425[F] 133426[F]
133428[F] 133429[F] 133431 [F] 133433[F] 133434[F] 133436[F]
133437[F] , 133438[F] 133440[F] 133 44 2[F] 133 44 6[F] 133447[F]
133449[F] 133450[F]
700735[F], 700736[F], 923728[F], 923729[F], 640649[-1064], 923728 700734[F], 923727[F], 928145[-481 ], 640648[-1064], 700737[-2481].
AATK
1383], 700733[-1459], 700735[-3383], 31432[F], 145875[F], 700732[-2589], 31431[F], 145874[F], 145876[F], 145879[F],
(9625) &
145877[F], 145878[F], 145880[F], 145881 [F], 145882[F], 145883[F], 145884[F], 145885[F], 145888[F], 145889[-519], 31443[-534],
Aatk 145886[F], 145887[F], 31444[-534], 145891 [-713], 145873[-892], 145890[-599], 145892[-805], 145888[-1298], 145893[-1796],
(11302) 145870[-2795], 145894[-4014], 145869[-4763] 145872[-1908], 145871 [-2665]
646392[F], 743751[F], 743752[F], 743753[F], 743756[F], 743757[F], 743763[F], 743753[-593], 39437[F], 245100[F], 245101 [F],
646391 [F], 743750[F], 743754[F] 743755[F], 743758[F], 743759[F],
245102[F], 245103[F], 245105[F], 245107[F], 245110[F], 245111 [F], 743760[F], 743761[F], 743762[F] 39436[F], 245099[F], 245104[F],
245112[F], 245114[F], 245115[F], 245116[F], 245118[F], 245119[F], ABAT (18) 245106[F], 245108[F], 245109[F] 245113[F], 245117[F], 245125[F],
245120[F], 245121[F], 245122[F], 245123[F], 245124[F], 245126[F], & Abat 245141 [F], 245142[F], 245143[F] 245144[F], 245145[F], 245147[F],
245127[F], 245128[F], 245129[F], 245130[F], 245131 [F], 245132[F], (268860) 245149[F], 245150[F], 245151[F] 245152[F], 245155[F], 245156[F],
245133[F], 245134[F], 245135[F], 245136[F], 245137[F], 245138[F], 245158[F], 245159[F], 245160[F] 245162[F], 245163[F], 245164[F]
245139[F], 245140[F], 245146[F], 245148[F], 245153[F], 245154[F], 245157[F], 245161[F], 245165[F]
624072[F], 817555[F], 817556[F], 817557[F], 817558[F], 817559[F], 817560[F], 817561[F], 817562[F], 817563[F], 817564[F], 817565[F], 817566[F], 817567[F], 817568[F], 817569[F], 817570[F], 817571 [F], ABCA1 9685[F], 399612[F], 399613[F], 399614[F], 399615[F], 399616[F], (19) & 399617[F], 399618[F], 399619[F], 399620[F], 399621 [F], 399622[F], Abcal 399623[F], 399624[F], 399625[F], 399626[F], 399627[F], 399628[F], (11303) 399629[F], 399630[F], 399631 [F], 399632[F], 399633[F], 399634[F], 399635[F], 399636[F], 399637[F]
ABCA10
699155[F], 921225[F], 640383[401], 699165[-3753] 640382[401]
(10349)
ABCA11 P 717375[F], 923730[F]
(79963)
657714[F], 657715[F], 657719[F], 657722[F], 657723[F],
657716[F], 657717[F], 657718[F], 657720[F], 657721 [F], 657724[F], ABCA12
617140[206043], 939[F], 59395[F], 59396[F], 59399[F], 59401 [F],
617141 (206043], 940[F], 59397[F], 59398[F], 59400[F], 59402[F], (26154) &
59405[F], 59406[F], 59407[F], 59409[F], 59410[F], 59411[F],
59403[F], 59404[F], 59408[F], 59413[F], 59416[F], 59418[F], Abcal 2
59412[F], 59414[F], 59415[F], 59417[F], 59419[F], 59420[F],
59421 [F], 59422[F] (74591)
59423[Fl TABLE 2 - Page 4 of 1873
638207[F], 683680[F], 683682[F] 683684[F], 683685[F], 683688[F], 638208[F], 683679[F], 683681 [F], 683683]F] 683686 [F] „ 683687[F], 683689[F], 683690[F], 683691 [F] 683692[F], 683694[F], 683695[F], 683697[F], 683701 [F], 683702[F], 28545[F] 28547[F], 114279]F], 683696[F], 683698[F], 683699[F] 683700[F], 28544[F], 28546[F], 114281[F], 114283[F], 114285[F], 114287[F] 114289[F] ' 114290[F], 114278[F], 114280[F], 114282[F] 114284[F], 114286[F], 114288[F], 114291[F], 114292[F], 114294[F], 114295[F] , 114296[F] 114297[F], 114293[F], 114300[F], 114301[F] 114302[F], 114303[F], 114304[F], 114298[F], 114299[F], 114305[F], 114306[F] , 114307[F] 114310[F], 114308[F], 114309[F], 114314[F] 114315[F], 114316[F], 114318[F], 114311[F], 114312[F], 114313[F], 114317[F] 114319[F] 114320[F],™ί 3 114323[F], 114324[F], 114325[F] 114327[F], 114329[F], 114330[F], 114321[F], 114322[F], 114326[F], 114328[F] 114331 [F]„ 114333[F], 114332[F], 114334[F], 114337[F] 114338[F], 114339[F], 114340[F], 114335[F], 114336[F], 114342[F], 114344[F] , 114346[F] |, 114349[F], (268379) 114341 [F], 114343[F], 114345[F] 114347[F], 114348[F], 114354[F], 114350[F], 114351[F], 114352[F], 114353[F] , 114358[F] I, 114360[F], 114355[F], 114356[F], 114357[F] 114359[F], 114361 [F], 114362[F], 114363[F], 114365[F], 114366[F], 114367[F] 114368[F] 114371 [F] 114364[F], 114369[F], 114370[F] 114372[F], 114375[F] 114373[F], 114374[F]
647736[F], 754923[F], 754924[F], 754925[F], 754927[F], 647738[
647735[F], 754922[F], 875923[F], 647737[-175], 925994[-695],
175], 925993[-796], 925992[-1407], 925991[-1489], 925990[-2443], ABCA17P
7549281-1381], 754921 [-2695], 754929[-3026], 925987[-4598],
754920[-2796], 754919 [-3407], 754918[-3489], 925989[-4053], (650655)
925986[-4750]
7549171-4443], 925988[-4519;
619076[F], 783075[F], 783077[F], 783078[F], 783079[F], 783080[F], 619077[F], 783074[F], 783076[F], 783081 [F], 783082[F], 783083[F], ABCA2 783086[F], 783087[F], 783088[F], 783089[F], 619076(21054], 783084[F], 783085[F], 619077(21054], 619075[-1230], 3356[F], (20) & 3355[F], 326857[F], 326859[F], 326861[F], 326862[F], 326863[F], 326858[F], 326860[F], 326865[F], 326866[F], 326867[F], 326868[F], Abca2 326864[F], 326870[F], 326871[F], 326872[F], 326873[F] 326869[F], 3354[-2298] (11305)
647737[F], 754926[F], 754928[F], 754929[F], 754930[F], 754932[F],
754933[F], 754934[F], 754935[F], 754938[F], 754941 [F], 754942[F],
647738[F], 754931[F], 754936[F], 754937[F], 754939[F], 754940[F], 754943[F], 754944[F], 922801[1840], 754945[-160], 647735[-175],
875920[F], 875922[F], 647736[-175], 41345[F], 270112[F], ABCA3 41344[F], 270106[F], 270107[F], 270108[F], 270109[F], 270110[F],
270116[F], 270119[F], 270121[F], 270125[F], 270129[F], 270131[F], (21) & 270111[F], 270113[F], 270114[F], 270115[F], 270117[F], 270118[F],
270132[F], 270133[F], 41347[12395], 41343[-976], 270139[-2911], Abca3 270120[F], 270122[F], 270123[F], 270124[F], 270126[F], 270127[F],
270105[-3140], 270104[-3920], 270141 [-3924], 41349[-4362], (27410) 270128[F], 270130[F], 270134[F], 270135[F], 270136[F], 270137[F],
270145[-4853]
41346[12395], 270138[-385], 41342[-976], 270140[-3600], 41348[- 4362], 270142[-4579], 270143[-4710], 270144[-4842]
623079[F], 811140[F], 811141[F], 811142[F], 811143[F], 811146[F],
623080[F], 811144[F], 811145[F], 811147[F], 811148[F], 811149[F], 811151[F], 811155[F], 811157[F], 811158[F], 811161 [F], 811162[F],
811150[F], 811152[F], 811153[F], 811154[F], 811156[F], 811159[F], 811163[F], 811164[F], 811167[F], 811169[F], 8394[F], 384453[F], ABCA4
811160[F], 811165[F], 811166[F], 811168[F], 8395[F], 384454[F], 384455[F], 384456[F], 384457[F], 384459[F], 384461 [F], 384462[F], (24) &
384458[F], 384460[F], 384463[F], 384464[F], 384465[F], 384466[F], 384467[F], 384469[F], 384471 [F], 384472[F], 384476[F], 384481 [F], Abca4
384468[F], 384470[F], 384473[F], 384474[F], 384475[F], 384477[F], 384483[F], 384484[F], 384486[F], 384487[F], 384490[F], 384491 [F], (11304)
384478[F], 384479[F], 384480[F], 384482[F], 384485[F], 384488[F], 384492[F], 384493[F], 384494[F], 384495[F], 384497[F], 384498[F],
384489[F], 384496[F], 384499[F], 384502[F]
384500[F], 384501 [F], 384503[F]
640383[F], 699165[F], 699166[F], 699168[F], 699171[F], 699173[F],
640382[F], 699167[F], 699169[F], 699170[F], 699172[F], 699174[F], ABCA5 699175[F], 699176[F], 699177[F], 699180[F], 699176[-3941], 699177
699178[F], 699179[F], 699181[F], 31119[F], 142667[F], 142670[F], (23461 ) & 4403], 31120[F], 142664[F], 142665[F], 142666[F], 142668[F],
142671 [F], 142673[F], 142677[F], 142679[F], 142680[F], 142681 [F], Abca5 142669[F], 142672[F], 142674[F], 142675[F], 142676[F], 142678[F],
142682[F], 142683[F], 142688[F], 142689[F], 142691 [F] (217265) 142684[F], 142685[F], 142686[F], 142687[F], 142690[F]
640381 [F], 699162[F], 699163[F], 699164[F], 31118[F], 142647[F], ABCA6
640380[F], 699161[F], 31117[F], 142648[F], 142649[F], 142650[F], 142651 [F], 142652[F], 142653[F], 142654[F], 142655[F], 142657[F], (23460) &
142656[F], 142659[F], 142661[F], 142663[F], 142663[-942], 142661 | 142658[F], 142660[F], 142662[F], 142660[-292], 142662[-1035], Abca6
1495], 142659[-1951]
142658[-2616], 142657[-4324; (76184)
637229[F], 677019[F], 677020[F], 677021[F], 677022[F], 677023[F],
677024[F], 677027[F], 677028[F], 677029[F], 677030[F], 637228[- 359], 677017[-861], 677016[-1565], 637231 [-1659], 677015[-1823], ABCA7
637230[F], 677018[F], 677025[F], 677026[F], 677031 [F], 637232[- 677014[-2389], 677013[-3919], 27299[F], 100478[F], 100479[F], (10347) &
1659], 27300[F], 100484[F], 100485[F], 100490[F], 100476[-851], 100480[F], 100481[F], 100482[F], 100483[F], 100486[F], 100487[F], Abca7
27302[-1040]
100488[F], 100489[F], 100477[-724], 27301[-1040], 27298[-1551], (27403) 100475[-2100], 100474[-2461], 100473[-2637], 100472[-2802],
100471 [-2886], 100470[-3175], 100469[-4347], 100491[-4680]
640375[F], 699145[F], 699146[F], 699147[F], 699149[F], 699150[F], ABCA8
640374[F], 699148[F], 699151[F], 699153[F], 699156[F], 31111 [F], 699152[F], 699154[F], 31112[F], 142601[F], 142602[F], 142603[F], (10351 ) &
142604[F], 142607[F], 142608[F], 142609[F], 142610[F], 142611 [F], 142605[F], 142606[F], 142612[F], 142613[F], 142615[F], 142600[- Abca8b
142614[F], 142616[F], 142617[F], 142618[F], 142619[F], 142620[F] 385], 142599[-433], 142598[-771], 142597[-898] (27404)
ABCA9
640376[F], 640378[F], 699157[F], 699159[F], 31115[F], 142635[F],
640377[F], 640379[F], 699158[F], 699160[F], 31116[F], 142637[F], (10350) &
142636[F], 142638[F], 142640[F], 142642[F], 142643[F], 142645[F], 142639[F], 142641[F], 142644[F], 31114[-4842] Abca9
142646[F], 31113[-4842]
(217262)
625848[F], 832430[F] 832431 [F], 832436[F], 832437[F], 832438[F], 832439[F], 832440[F] 832443[F], 832445[F], 832447[F], 832448[F],
832432[F], 832433[F], 832434[F], 832435[F], 832441 [F], 832442[F],
832449[F], 832451 [F] 832452[F], 832453[F], 832454[F], 832455[F], ABCB1 832444[F], 832446[F], 832450[F], 916290[F], 625846(84911],
832456[F], 832457[F] 832458[F], 832459[F], 832460[F], (5243) & 11970[F], 431781[F], 431782[F], 431783[F], 431786[F], 431790[F],
625847[84911], 11971 [F], 11972[F], 431784[F], 431785[F], Abcbla 431791[F], 431792[F], 431793[F], 431795[F], 431796[F], 431798[F],
431787[F], 431788[F] 431789[F], 431794[F], 431797[F], 431799[F], (18671) 431800[F], 431801[F], 431803[F], 431804[F], 431805[F], 431812[F]
431802[F], 431806[F] 431807[F], 431808[F], 431809[F], 431810[F], 431811[F] TABLE 2 - Page 5 of 1873
634174[F], 892620[F], 892622[F], 892623[F], 892624[F], 892625[F],
ABCB10 23358[F], 56 4 212[F], 564213[F], 564214[F], 564215[F], 564216[F],
(23456) & 564217[F], 564218[F], 564219[F], 564220[F], 564221 [F], 564222[F], 23356[-3173]
AbcMO 564223[F], 564224[F], 564225[F], 564226[F], 23357[6478], 564211]- (56199) 2029], 5642101-2291]
619702[F], 619704[F], 788376[F], 788377[F], 788378[F], 788379[F],
619703[F], 619705[F], 788380[F], 788382[F], 788384[F], 788388[F], 788381[F], 788383[F], 788385[F], 788386[F], 788387[F], 788390[F], ABCB11 788392[F], 4097[F], 4099[F], 336756[F], 336759[F], 336763[F], 788391[F], 4096[F], 4098[F], 336757[F], 336758[F], 336760[F], (8647) & 336765[F], 336767[F], 336768[F], 336769[F], 336771 [F], 336772[F], 336761[F], 336762[F], 336764[F], 336766[F], 336770[F], 336774[F], Abcb11 336773[F], 336775[F], 336779[F], 336783[F], 336784[F], 336787[F] 336776[F], 336777[F], 336778[F], 336780[F], 336781 [F], 336782[F], (27413)
336785[F], 336786[F]
625849[F], 832463[F], 832465[F], 832466[F], 832477[F], 832478[F],
832479[F], 832481[F], 625852[-2248], 11976[F], 1 1978[F],
625850[F], 832461[F], 832462[F], 832464[F], 832467[F], 832468[F], ABCB4 431840[F], 431842[F], 431843[F], 431845[F], 431847[F], 431848[F],
832480[F], 625853[-2248], 832482[-3129], 832483[-3331], 11977[F], (5244) & 431849[F], 431850[F], 431851[F], 431852[F], 431853[F], 431854[F],
431838[F], 431839[F], 431841 [F], 431844[F], 431846[F], 431861 [F], Abcb4 431855[F], 431856[F], 431857[F], 431858[F], 431859[F], 431860[F],
431863[F], 431868[F], 431869[F], 431870[F] (18670) 431862[F], 431864[F], 431865[F], 431866[F], 431867[F], 431871 [F],
431872[F]
ABCB5
642067[F], 712051[F], 712052[F], 33352[F], 172247[F], 172248[F], 642066[F], 712053[F], 712054[F], 919770[F], 33351 [F], 172250[F],
(340273) & 172249[F], 172252[F], 172253[F], 172257[F], 172258[F], 172260[F], 172251[F], 172254[F], 172255[F], 172256[F], 172259[F], 172262[F],
Abcb5 172261 [F], 172264[F], 172265[F], 172266[F] 172263[F]
(77706)
658433[F], 658434[F], 658435[F], 658436[F], 658437[F], 658438[F],
ABCB6 658440[F], 658441[F], 658443[F], 658445[F], 658446[F], 658448[F], 658439[F], 658442[F], 658444[F], 658447[F], 617242(9220],
(10058) & 617243(9220], 1051[F], 60632[F], 60633[F], 60634[F], 60635[F], 617241[-117], 658432[-2357], 1050[F], 60638[F], 60641[F],
Abcb6 60636[F], 60637[F], 60639[F], 60640[F], 60642[F], 60644[F], 60643[F], 60646[F], 60647[F], 60648[F], 1049[-10], 60631 [-2374]
(74104) 60645[Fl, 60649[Fl, 60650[F "
651804[F], 912709[F], 912711[F], 912713[F] , 912715[F], 912716[F],
912717[F], 912718[F], 912719[F], 912720[F] , 912721 [F], 912722[F],
912724[F], 912736[F], 912737[F], 912738[F] , 921061 (142], 921060]- 382], 921059[-622], 912708[-1858], 912707]- 2382], 912706[-2622],
46741 [F], 607465[F], 607466[F], 607467[F] 607468[F], 607470[F],
607471 [F], 607472[F], 607473[F], 607474[F] 607475[F], 607477[F],
607478[F], 607480[F], 607482[F], 607484[F] 607485[F], 607486[F],
651803[F], 912710[F], 912712[F], 912714[F], 912723[F], 912735[F], 607490[F], 607491[F], 607492[F], 607494[F] 607495[F], 607497[F],
46740[F], 607469[F], 607476[F], 607479[F], 607481 [F], 607483[F], 607498[F], 607499[F], 607500[F], 607502[F] 607503[F], 607506[F], ABCB7
607487[F], 607488[F], 607489[F], 607493[F], 607496[F], 607501 [F], 607507[F], 607508[F], 607509[F], 607510[F] 607512[F], 607513[F], (22) &
607504[F], 607505[F], 607511 [F], 607516[F], 607523[F], 607530[F], 607514[F], 607515[F], 607517[F], 607518[F] 607519]F], 607520[F], Abcb7
607532[F], 607534[F], 607543[F], 607544[F], 607545[F], 607551 [F], 607521 [F], 607522[F], 607524[F], 607525[F] 607526]F], 607527[F], (11306)
607553[F], 607555[F], 607562[F], 607563[F], 607571 [F], 607575[F], 607528[F], 607529[F], 607531[F], 607533[F] 607535[F], 607536[F],
607577[F], 607581 [F], 607582[F]
607537[F], 607538[F], 607539[F], 607540[F] 607541 [F], 607542[F],
607546[F], 607547[F], 607548[F], 607549[F] 607550[F], 607552[F],
607554[F], 607556[F], 607557[F], 607558[F] 607559[F], 607560[F],
607561 [F], 607564[F], 607565[F], 607566[F] 607567[F], 607568[F],
607569[F], 607570[F], 607572[F], 607573[F] 607574[F], 607576[F],
607578[F], 607579[F], 607580[F], 607583[F] 607584[F], 607585[F],
607586[F], 607587[F]
ABCB8
833477[F], 833478[F], 625970(17258], 833476[-37], 625971[-767],
931677(1595], 833479[-405], 12229[F], 434917[-374], 434918[-3080] (11194) &
833480[-1064], 12230[F], 12235[F], 434913[F], 434914[F],
434912[-4224] Abcb8
434915[F], 434916[F], 12236[-3443], 434919[-3712]
(74610)
627420[F], 843660[F], 843661 [F], 843662[F], 843663[F], 843664[F], ABCB9
627421 [F], 843659[F], 843665[F], 843659[-284], 14176[F],
14175[F], 457273[F], 457275[F], 457276[F], 457277[F], 457281 [F], (23457) & 457274[F], 457278[F], 457279[F], 457280[F], 457286[F],
457282[F], 457283[F], 457284[F], 457285[F], 457287[F], Abcb9 14174(14429], 457272[-193]
14173(14429], 457271 [-1140], 457270[-3796], 457269[-4520] (56325)
646484[F], 744591[F], 744592[F], 744593[F], 744594[F], 744595[F], 744596[F], 744597[F], 744598[F], 744599[F], 744600[F], 744601 [F], 744602[F], 744603[F], 744604[F], 744605[F], 744606[F], 868780[F], 39569[F], 247209[F], 247210[F], 247211 [F], 247212[F], 247213[F], ABCC1 247214[F], 247215[F], 247216[F], 247217[F], 247218[F], 247219[F], (4363) & 247220[F], 247221[F], 247222[F], 247223[F], 247224[F], 247225[F], Abed 247226[F], 247227[F], 247228[F], 247229[F], 247230[F], 247231 [F], (17250) 247232[F], 247233[F], 247234[F], 247235[F], 247236[F], 247237[F], 247238[F], 247239[F], 247240[F], 247241 [F], 247242[F], 247243[F], 247244[F]
648330[F], 758980[F], 758981[F], 758983[F], 758985[F], 758987[F], 648329[F], 758982[F], 758984[F], 758986[F], 758989[F], 758991 [F], ABCC10 758988[F], 758990[F], 758992[F], 758993[F], 758994[F], 758998[F], 758995[F], 758996[F], 758997[F], 648328(506], 42064[F], (89845) & 42065[F], 277995[F], 277996[F], 277998[F], 278000[F], 278002[F], 277997[F], 277999[F], 278001 [F], 278004[F], 278006[F], 278007[F], Abed 0 278003[F], 278005[F], 278008[F], 278009[F], 278010[F], 278014[F] 278011[F], 278012[F], 278013[F], 42063[432], 277994[-3008] (224814) TABLE 2 - Page 6 of 1873
633520[F], 887242[F], 8872 4 3[F], 8872 44 [F], 8872 4 5[F], 887246[F], 633519[F], 887247[F], 887248[F], 887249[F], 887250[F], 887253[F],
ABCC12 887251 [F], 887252[F], 88725 4 [F], 887256[F], 887259[F], 22538[F], 887255[F], 887257[F], 887258[F], 887241[-1251], 22537[F],
(94160) & 553158[F], 553159[F], 553160[F], 553161[F], 553162[F], 553163[F], 553164[F], 553166[F], 553167[F], 553168[F], 553171 [F], 553172[F],
Abed 2 553165[F], 553169[F], 553170[F], 553173[F], 553175[F], 553177[F], 553174[F], 553176[F], 553178[F], 553179[F], 553180[F], 553181[F],
(244562) 553184[F], 553185[-2522], 553155[- 4 313] 553182[F], 553183[F], 553157[-1220], 553156[-3329]
650764[F], 778313[F], 778314[F], 778315[F], 778317[F], 778318[F],
650765[F], 778312[F], 778316[F], 778319[F], 778321 [F], 778323[F], ABCC2 778320[F], 778322[F], 45148[F], 317282[F], 317283[F], 317284[F],
45149[F], 317286[F], 317287[F], 317288[F], 317289[F], 317291[F], (1244) & 317285[F], 317290[F], 317297[F], 317298[F], 317299[F], 317301[F],
317292[F], 317293[F], 317294[F], 317295[F], 317296[F], 317300[F], Abcc2 317302[F], 317303[F], 317305[F], 317306[F], 317307[F], 317308[F],
317304[F], 317310[F], 317312[F] (12780) 317309[F], 317311[F]
695304[F], 695306[F], 695307[F], 695309[F], 695310[F], 695312[F], 639749[F], 695305[F], 695308[F], 695311[F], 695313[F], 695315[F], 695314[F], 695316[F], 695317[F], 639748(56845], 639746[-1488], 639747(56845], 695313[-1308], 639745[-1488], 695302[-1698], ABCC3
6953031-1672], 695300[-4305], 695299[-4379], 30422[F], 136137[F], 695301 [-3856], 30421[F], 30423[F], 136138[F], 136139[F], (8714) & 136140[F], 136142[F], 136144[F], 136146[F], 136147[F], 136150[F], 136141[F], 136143[F], 136145[F], 136148[F], 136149[F], 136151[F], Abcc3 136154[F], 136156[F], 136157[F], 136158[F], 30420[-1446], 136136]- 136152[F], 136153[F], 136155[F], 30419[-1446], 136135[-1652], (76408) 1626], 136133[-3606], 136132[-3680] 136134[-3167], 136131[-4814]
644845[F] 732013[F], 732015[F] 732016[F], 732017[F], 732018[F],
732019[F] 732021 [F], 732022[F] 732023[F], 732025[F], 732026[F],
732029[F] 732030[F], 732031[F] 732032[F], 732034[F], 732035[F],
732037[F] 732038[F], 732040[F] 732042[F], 732043[F], 732046[F],
732047[F] 732048[F], 732049[F] 732050[F], 732052[F], 732054[F],
732056[F] 732059[F], 732061[F] 732062[F], 732063[F], 732065[F],
644844[F], 644846[F], 732014[F], 732020[F], 732024[F] 732027[F], 732066[F] 732069[F], 732070[F] 732074[F], 732075[F], 732076[F],
732028[F], 732033[F], 732036[F], 732039[F], 732041 [F] 732044[F], 732079[F] 732080[F], 732082[F] 732083[F], 732086[F], 732087[F],
732045[F], 732051[F], 732053[F], 732055[F], 732057[F] 732058[F], 732088[F] 732089[F], 732091[F] 732092[F], 732093[F], 732095[F],
732060[F], 732064[F], 732067[F], 732068[F], 732071 [F] 732072[F], 732096[F] 732097[F], 732100[F] 732101[F], 732102[F], 732104[F],
732073[F], 732077[F], 732078[F], 732081 [F], 732084[F] 732085[F], 732106[F] 732107[F], 732108[F] 732109[F], 732110[F], 732111[F],
732090[F], 732094[F], 732098[F], 732099[F], 732103[F] 732105[F], 732112[F] 732113[F], 732115[F] 644848(650], 732117[-406],
732114[F], 732116[F], 644847[650], 37430[F], 37432[F 220568[F],
37431 [F], 220567[F], 220569[F], 220570[F], 220571 [F], 220572[F]
220575[F], 220580[F], 220583[F], 220584[F], 220585[F] 220588[F],
220573[F] 220574[F], 220576[F] 220577[F] 220578[F], 220579[F] ABCC4
220592[F], 220595[F], 220598[F], 220600[F], 220603[F] 220604[F], 220581 [F] 220582[F], 220586[F] 220587[F] 220589[F], 220590[F] (10257) &
220610[F], 220611[F], 220613[F], 220615[F], 220618[F] 220620[F], 220591 [F] 220593[F], 220594[F] 220596[F] 220597[F], 220599[F] Abcc4
220622[F], 220623[F], 220624[F], 220626[F], 220631 [F] 220632[F], 220601 [F] 220602[F], 220605[F] 220606[F] 220607[F], 220608[F] (239273)
220639[F], 220640[F], 220643[F], 220644[F], 220645[F] 220649[F], 220609[F] 220612[F], 220614[F] 220616[F] 220617[F], 220619[F]
220650[F], 220653[F], 220656[F], 220657[F], 220658[F] 220660[F], 220621 [F] 220625[F], 220627[F] 220628[F] 220629[F], 220630[F]
220661[F], 220663[F], 220664[F], 220665[F], 220672[F] 220680[F], 220633[F] 220634[F], 220635[F] 220636[F] 220637[F], 220638[F]
220683[F], 220685[F], 220687[F], 220688[F], 220690[F] 220691 [F], 220641 [F] 220642[F], 220646[F] 220647[F] 220648[F], 220651 [F]
220696[F], 220698[F], 220701 [F], 220704[F], 220706[F] 220709[F], 220652[F] 220654[F], 220655[F] 220659[F] 220662[F], 220666[F]
220714[F], 220717[F], 220718[F], 220723[F], 220724[F] 220726[F], 220667[F] 220668[F], 220669[F] 220670[F] 220671 [F], 220673[F]
220729[F], 220730[F], 220731 [F], 220732[F], 220733[F] 220734[F], 220674[F] 220675[F], 220676[F] 220677[F] 220678[F], 220679[F]
37433[568], 220736[-1152]
220681 [F] 220682[F], 220684[F] 220686[F] 220689[F], 220692[F]
220693[F] 220694[F], 220695[F] 220697[F] 220699[F], 220700[F]
220702[F] 220703[F], 220705[F] 220707[F] 220708[F], 220710[F]
220711[F] 220712[F], 220713] F] 220715[F] 220716[F], 220719[F]
220720[F] 220721 [F], 220722[F] 220725[F] 220727[F], 220728[F]
37434(568], 220710[-144], 220735[-293]
646617[F], 745427[F], 745428[F], 745429[F], 745430[F], 745431 [F], 745432[F], 745433[F], 745434[F], 745435[F], 745436[F], 745437[F],
ABCC5 745438[F], 39724[F], 249143[F], 249144[F], 249145[F], 249146[F],
(10057) & 249147[F], 249148[F], 249149[F], 249150[F], 249151 [F], 249152[F],
Abcc5 249153[F], 249154[F], 249155[F], 249156[F], 249157[F], 249158[F],
(27416) 249159[F], 249160[F], 249161[F], 249162[F], 249163[F], 249164[F], 249165[F], 249166[F], 249159[-4283]
ABCC6
630880[F], 868781[F], 868783[F], 868784[F], 868785[F], 19053[F], 630879[F], 868782[F], 868786[F], 868787[F], 19052[F], 512770[F],
(368) & 512769[F], 512771[F], 512773[F], 512774[F], 512775[F], 512776[F], 512772[F], 512777[F], 512779[F], 512780[F], 512781 [F], 512782[F],
Abcc6 512778[F], 512785[F], 19054[-3410], 512788[-3801], 512767[-4386] 512783[F], 512784[F], 512786[F], 512787[F], 512768[-1974]
(27421)
630887[F], 868805[F], 868806[F], 868807[F], 868810[F], 868811[F], 630886[F], 868802[F], 868803[F], 868804[F], 868808[F], 868809[F], 868812[F], 868813[F], 868815[F], 868817[F], 868821 [F], 868822[F], 868814[F], 868816[F], 868824[F], 868826[F], 630884(84017],
ABCC8 868823[F], 868825[F], 630885(84017], 630883[-3569], 868801]- 6308821-3569], 19057[F], 19059[F], 512810[F], 512811 [F],
(6833) & 3886], 19058[F], 19060[F], 512813[F], 512814[F], 512815[F], 512812[F], 512816[F], 512817[F], 512819[F], 512823[F], 512824[F],
Abcc8 512818[F], 512820[F], 512821[F], 512822[F], 512825[F], 512829[F], 512826[F], 512827[F], 512828[F], 512830[F], 512831 [F], 512832[F],
(20927) 512833[F], 512835[F], 512836[F], 512837[F], 512841 [F], 19056]- 512834[F], 512838[F], 512839[F], 512840[F], 512842[F], 19055]- 3757], 512809[-4061] 3757] TABLE 2 - Page 7 of 1873
629755[F], 629757[F], 862745[F], 862747[F], 862748[F], 862749[F],
862750[F], 862751[F], 862753[F], 862756[F], 862758[F], 862759[F], 629754[F], 629756[F], 862746[F], 862752[F], 862754[F], 862755[F], 862760[F], 862764[-29], 17241 [F], 17243[F], 498736[F], 498738[F], 862757[F], 862761[F], 862762[F], 862763[F], 862765[-2631 ], ABCC9 498741 [F], 498742[F], 498743[F], 498744[F], 498745[F], 498747[F], 17240[F], 17242[F], 498732[F], 498733[F], 498734[F], 498735[F], (10060) & 498748[F], 498750[F], 498752[F], 498753[F], 498754[F], 498755[F], 498737[F], 498739[F], 498740[F], 498746[F], 498749[F], 498751 [F], Abcc9 498758[F], 498759[F], 498760[F], 498762[F], 498764[F], 498766[F], 498756[F], 498757[F], 498761 [F], 498763[F], 498765[F], 498767[F], (20928) 498768[F], 498770[F], 498771[F], 498772[F], 498775[F], 498776[F], 498769[F], 498773[F], 498774[F], 498778[F]
498777[F]
910874[F], 910875[F], 910877[F], 910878[F], 910879[F], 910880[F],
ABCD1 651533[19881], 651531 [-121], 910870[-200], 910869[-651], 910867]- 910871[F], 910872[F], 910873[F], 910876[F], 651534(19881],
(215) & 1658], 46358[F], 602993[F], 602994[F], 602996[F], 602997[F], 651532[-121], 910868[-1583], 46359[F], 602990[F], 602991 [F],
Abcdl 602998[F], 603000[F], 603001[F], 46356(1243], 602989[-144], 602992[F], 602995[F], 602999[F], 46357(1243], 602987[-1672]
(11666) 602988[-598l, 602986[-1747 "
740996[F], 740997[F], 740998[F], 740999[F], 645975(68760], ABCD2
645974(68760], 38951 [F], 239681 [F], 239685[F], 239686[F],
38952[F], 239679[F], 239680[F], 239682[F], 239683[F], 239684[F], (225) &
239688[F]
239687[F], 239689[F] Abcd2
623076[F], 811082[F], 811083[F], 811084[F], 811085[F], 811086[F],
811087[F], 811088[F], 811089[F], 811090[F], 811091 [F], 811092[F],
811093[F], 811094[F], 811095[F], 811097[F], 811098[F], 811099[F],
811 100[F], 811 101[F], 811102[F], 811103[F], 811105]F], 811106[F],
811 107[F], 811 108[F], 811109[F], 811111 [F], 811112[F], 811113[F],
811 116[F], 811 117[F], 811118[F], 811119[F], 811120[F], 623075[F], 811096[F], 811104[F], 811110[F], 811114[F], 811115[F], ABCD3 623076(100157], 8111 061-1417], 8111051-4446], 8391 [F], 384377[F], 623075(100157], 8390[F], 384383[F], 384384[F], 384395[F], (5825) & 384378[F], 384379[F], 384380[F], 384381 [F], 384382[F], 384385[F], 384397[F], 384404[F], 384411 [F], 384416[F], 384417[F], 384418[F], Abcd3 384386[F], 384387[F], 384388[F], 384389[F], 384390[F], 384391 [F], 384420[F], 384421[F], 384425[F] (19299) 384392[F], 384393[F], 384394[F], 384396[F], 384398[F], 384399[F],
384400[F], 384401[F], 384402[F], 384403[F], 384405[F], 384406[F],
384407[F], 384408[F], 384409[F], 384410[F], 384412[F], 384413[F],
384414[F], 384415[F], 384419[F], 384422[F], 384423[F], 384424[F],
384426[F], 384427[F]
641586[F], 707888[F], 707889[F], 707891 [F], 707892[F], 707895[F], ABCD4
641585[F], 707890[F], 707893[F], 707894[F], 163305[F], 163306[F], 163302[F], 163303[F], 163304[F], 163307[F], 163308[F], 163311 [F], (5826) &
163309[F], 163310[F], 32720(14935], 163301[-22]
32721 (14935] Abcd4
ABCE1
633363(213], 886135[-1995], 633360[-4040], 22364[-21], 551000]-
633364(213], 633361 [-4040], 22365[-21], 551001 [-1580] (6059) &
1515], 22363[-2526], 550999[-2749], 551002[-4573]
Abcel
648186[F], 758149[F], 758150[F], 758151 [F], 758152[F], 758153[F],
758154[F], 758155[F], 758156[F], 758157[F], 758158[F], 758159[F],
ABCF1 758160[F], 758161[F], 758162[F], 758163[F], 758164[F], 758165[F],
(23) & 41868[F], 276276[F], 276277[F], 276278[F], 276279[F], 276280[F], 41861 (3614]
Abcfl 276281 [F], 276282[F], 276283[F], 276284[F], 276285[F], 276286[F],
(224742) 276287[F], 276288[F], 276289[F], 276290[F], 276291 [F], 276292[F],
276293[F], 276294[F], 41862(3614], 276275[-525]
625979[F], 625982[-2167], 833548[-4189], 833547[-4498], 12244[F], ABCF2
625980[F], 625983[-2167], 12245[F], 435016[-1591], 435017[-2359],
435015[-2221], 435014[-2545], 12249[-3920], 435018[-3994], (10061 ) & 435013[-4631]
435012[-4812] Abcf2
646623(7890], 646621 [-77], 745462[-93], 745465[-372], 777273]-
745463[F], 745464[F], 646622[7890], 930029[13], 930034[-76], 2030], 745459[-2032], 786590[-2032], 885446[-2124], 777274]- 9300331-330], 930032[-375], 930030[-393], 745466[-536], 930031 ]- 2128], 7454581-2130], 745457[-2308], 885445[-2314], 777275]- ABCF3 591 ], 7772721-1987], 786589[-2076], 786588[-2330], 786587[-2375], 2315], 885444I-2428], 745456[-3244], 786586[-3244], 885443]- (55324) & 777276[-2393], 777277[-2591], 650646[-2592], 786585[-3273], 3284], 745455[-3851], 786584[-3870], 745454[-4094], 786583]- Abcf3 786582[-4861], 786580[-4950], 39731[F], 249204[F], 249205[F], 4094], 786581 [-4891], 745453[-4895], 786579[-4958], 39732[F], (27406) 249206[F], 249209[F], 249210[F] 249207[F], 249208[F], 39730[-145], 249203[-161], 249202[-3176],
249201 [-3263], 249200[-4742], 249199[-4841]
648023[F], 756704[F], 756705[F], 756707[F], 756709[F], 756710[F],
756711 [F], 756712[F], 756713[F], 756716[F], 756719[F], 756720[F],
648024[F], 756706[F], 756708[F], 756714[F], 756715[F], 756717[F], ABCG1 756721 [F], 756722[F], 756723[F], 756724[F], 648023(78110],
756718[F], 648024(78110], 41660[F], 273377[F], 273379[F], (9619) & 756725[-825], 41659[F], 273375[F], 273376[F], 273378[F],
273385[F], 273387[F], 273389[F], 273391 [F], 273393[F], 273394[F], Abcgl 273380[F], 273381[F], 273382[F], 273383[F], 273384[F], 273386[F],
273395[F] (11307) 273388[F], 273390[F], 273392[F], 273396[F], 273397[F], 273398[F],
273399[F], 273400[F], 273401[F], 273402[F] TABLE 2 - Page 8 of 1873
628680[F], 840289[F] 853513[F; 853514[F] 853515[F], 853516[F]
853517[F], 853518[F] 853520[F; 853521 [F] 853523[F], 853524[F]
853525[F], 853526[F] 853527[F 853528[F] 853530[F], 853531 [F]
853532[F], 853534[F] 853535[F; 853536[F] 853537[F], 853538[F]
853540[F], 853542[F] 853543[F 853544[F] 15787[F], 478645[F],
478646[F], 478649[F] 478650[F; 478651 [F] 478652[F], 478653[F]
478654[F], 478656[F] 478657[F 478658[F] 478659[F], 478662[F]
478664[F], 478665[F] 478666[F; 478667[F] 478668[F], 478669[F]
478670[F], 478671[F] 478673[F 478675[F] 478676[F], 4 78677[F] 628681[F], 840288[F], 840290[F], 853512[F], 853519[F], 853522[F], 478678[F], 478679[F] 478680[F; 478681 [F] 478682[F], 4 78683[F] 853529[F], 853533[F], 853539[F], 853541 [F], 922501 (1890],
478684[F], 478685[F] 478686[F; 478687[F] 478688[F], 4 78689[F] 840240[-110], 15788[F], 478644[F], 478647[F], 478648[F], ABCG2 478690[F], 478691[F] 478692[F; 478693[F] 478694[F], 478695[F] 478655[F], 478660[F], 478661 [F], 478663[F], 478672[F], 478674[F], (9429) & 478697[F], 478698[F] 478700[F; 478702[F] 478703[F], 478704[F] 478696[F], 478699[F], 478701 [F], 478705[F], 478708[F], 478718[F], Abcg2 478706[F], 478707[F] 478709[F; 478710[F] 478711 [F], 478712[F] 478724[F], 478729[F], 478731 [F], 478732[F], 478735[F], 478740[F], (26357) 478713[F], 478714[F] 478715[F; 478716[F] 478717[F], 478719[F] 478749[F], 478754[F], 478760[F], 478764[F], 478768[F], 15790]- 478720[F], 478721[F] 478722[F; 478723[F] 478725[F], 478726[F] 1016], 4786421-1364], 478774[-1381], 478639[-3819]
478727[F], 478728[F] 478730[F 478733[F] 478734[F], 478736[F]
478737[F], 478738[F] 478739[F; 478741 [F] 478742[F], 478743[F]
478744[F], 478745[F] 478746[F 478747[F] 478748[F], 478750[F]
478751 [F], 478752[F] 478753[F; 478755[F] 478756[F], 478757[F]
478758[F], 478759[F] 478761 [F 478762[F] 478763[F], 478765[F]
478766[F], 478767[F] 478769[F 478770[F] 478771 [F], 478772[F]
478773[F], 15789[-101 6], 478643[-1285], 478641[-1681], 478775[- 1989], 478640[-3530]
896888[F], 896889[F], 896890[F], 896892[F], 896894[F], ABCG4
896891 [F], 896893[F], 634789(13615], 896895[-462], 24183[F], 634788[13615], 24182[F], 573576[F], 573578[F], 573579[F], (64137) & 573577[F], 573580[F], 573582[F], 573586[-537], 24180[-4589] 573581[F], 573583[F], 573584[F], 573585[F], 24184[-1804], 24179]- Abcg4
4589] (192663)
648840[F], 762979[F], 648842(6777], 648838[-2460], 42738[F], ABCG5
648841 [F], 6488391-2460], 42739[F], 286492[F], 286502[F], 42737[- 286493[F], 286494[F], 286495[F], 286496[F], 286497[F], 286498[F], (64240) & 2642] 286499[F], 286500[F], 286501 [F], 286503[F], 42740(6623], 42736]- Abcg5
2642] (27409)
ABCG8
648842[F], 762980[F], 648840[-144], 42740[F], 286504[F], (64241 ) &
648841[-144], 42739[-118], 42742[-4912]
286505[F], 42738[-118], 42741 [-4912] Abcg8
(67470) ABHD1
834235[F], 834236[F], 626087[6926], 626089[6139], 834238[-2], 834234[F], 834237[F], 626088(6926], 626090(6139], 834239[-2060],
(84696) & 8342411-3489], 626085[-4661], 12397[F], 436868[F], 436869[F], 8342401-2471], 626086[-4661], 12398[F], 436867[F], 436870[F],
AbhcM 12399(4244], 436871 [2], 12395[-4473], 436874[-4890] 12400(4244], 436872[-3405], 436873[-3787], 12396[-4473]
(57742)
749270[F], 749271[F], 749272[F], 749273[F], 749274[F], ABHD10
647056(14376], 647058[-2716], 749276[-3752], 40240[F], 256432[F], 749275[F], 647055[14376], 647057[-2716], 40239[F], 256433[F], (55347) & 256434[F], 256435[F], 256436[F], 256437[F], 256438[F], 256439[F], 256441[F], 40241[-3322] AbhdI O 256440[F], 256442[F], 256431[-546], 40242[-3322], 256443[-4314] (213012)
ABHD11
627570[F], 627570(2758], 14387(958], 460627[-667], 460626[-734], (83451 ) &
627571 [F], 627571 [2758], 14388[958]
460625[-1044] Abhd11
(68758)
620883[F], 620885[F], 796866[F] 796867[F], 796868[F], 796870[F],
796872[F], 796873[F], 796874[F] 796875[F], 796876[F], 796877[F], 620882[F], 620884[F], 774255[F], 774256[F], 796862[F], 796863[F], 796880[F], 796881[F], 796882[F] 796884[F], 796885[F], 796886[F], 796864[F], 796865[F], 796869[F], 796871 [F], 796878[F], 796879[F], 796887[F], 796888[F], 796889[F] 796891 [F], 620880(3270], 796861]- 796883[F], 796890[F], 620879(3270], 774256[-2996], 796863]-
ABHD12
1053], 5556[F], 5558[F], 353668[F], 353669[F], 353670[F] 3427], 774255[-4545], 796862[-4545], 5555[F], 5557[F], 353666[F],
(26090) &
353672[F], 353674[F], 353675[F] 353676[F], 353678[F], 353679[F], 353667[F], 353671[F], 353673[F], 353677[F], 353681 [F], 353682[F],
Abhd12 353680[F], 353683[F], 353689[F] 353690[F], 353691 [F], 353699[F], 353684[F], 353685[F], 353686[F], 353687[F], 353688[F], 353692[F],
(76192) 353700[F], 353701[F], 353702[F] 353703[F], 353704[F], 353705[F], 353693[F], 353694[F], 353695[F], 353696[F], 353697[F], 353698[F], 353706[F], 353707[F], 353708[F] 353710[F], 353712[F], 353713[F], 353709[F], 353711[F], 353716[F], 353721 [F], 5559[-667], 5552]- 353714[F], 353715[F], 353717[F] 353718[F], 353719[F], 353720[F], 755], 353665[-1393], 353664[-1766], 353663[-2838]
353722[F], 5560[-667], 5553[-755], 353723[-2873], 353662[-4503]
ABHD12B
641300[F], 641302[-177], 641304[-246], 705552[-299], 32388[F],
641299[F], 705551[F], 641301[-177], 641303[-246], 705553[-433], (145447) &
158696[F], 158697[F], 158698[F], 158700[F], 158701 [F], 158704[F], 32387[F], 158699[F], 158702[F], 158703[F], 158705[F], 32389[-658] Abhd12b
158706[F], 158695[-4801]
(328121 ) ABHD13
632525[F], 879982[F], 879983[F], 879984[F], 879985[F], 879986[F],
(84945) &
632523[-74], 21172[-29], 535753[-1732] 632524[-74], 21174[F], 535754[F], 535755[F], 535756[F], 535757[F]
Ab d13 535758[F], 535759[F], 21173[-29], 535752[-3969], 535751 [-4315]
(68904)
904919[F], 904920[F], 904921[F], 904922[F], 904923[F], ABHD14A 635866(6172], 635867[-90], 904924[-160], 25506[F], 588771 [F], (25864) & 588772[F], 588773[F], 588774[F], 588775[F], 588776[F], 588777[F], Abhd14a 588778[F], 588779[F], 588780[F], 25507[-108], 588781 [-157] (68644) TABLE 2 - Page 9 of 1873
ABHD14B
635868[-3 4 5], 904926[-2275], 904927[-2436], 904928[-3122], 635866[F], 635867[F], 904925[-133], 904924[-188], 635869[-345],
(84836) &
904929[-4035], 904930 [-4960], 25508[-371], 588783[-2184], 588784[-904923[-3666], 25506[F], 25507[F], 588782[-141], 25509[-371],
Abhd14b 2328], 588785[-2939], 588786[-3813], 588787[-4725] 588781[-759], 588780[-1513], 588779[-2535], 588778[-4735]
(76491) ABHD15
639396[F], 639398[F], 692157[F], 639395[868], 692156[-3793],
(116236) &
30015[F], 30017[F], 130544[F], 30014(865], 130543[-4085], 130547]- 639397[F], 692158[-1258], 30016[F], 130545[F], 130546[-1931]
Abhd15 4135], 130542[-4418]
(67477) ABHD16A
648144[F], 757763[F], 757764[F], 757765[F], 757766[F], 757762]- 648145[F], 41815[F], 41817[F], 275614[F], 275619[-2297], 275610[
(7920) & 3946], 757761 [-4076], 41814[F], 41816[F], 275611[F], 275612[F], 2968], 275609[-3067], 275620[-3331], 275608[-4635], 275607[- Abhd16a 275613[F], 275615[F], 275616[F], 275617[F], 275618[F] 4743]
(193742) ABHD16B
621575[-2239], 6455[-2160], 364559[-3985], 364560[-4311], 364561 [-801699[F], 621574(1487], 621576[-2239], 364557[F], 6454[1773], (140701) & 4942] 6456[-2160], 364558[-3424] Abhd16b
(241850)
631164[F], 870985[F], 870988[F], 870989[F], 870990[F], 870994[F],
870995[F], 870997[F], 871001[F], 871002[F], 871005[F], 871006[F],
871007[F], 871008[F], 871010[F], 871011[F], 871013[F], 871014[F],
871015[F], 871016[F], 871017[F], 871018[F], 871019[F], 871020[F],
871021 [F], 871022[F], 871023[F], 871025[F], 871026[F], 871027[F],
631165[F], 870986[F] 870987[F], 870991 [F], 870992[F], 870993[F], 871028[F], 871030[F], 871031[F], 871032[F], 871033[F], 871034[F],
870996[F], 870998[F] 870999[F], 871000[F], 871003[F], 871004[F], 871035[F], 871036[F], 871037[F], 871039[F], 871041 [F], 871043[F],
871009[F], 871012[F] 871024[F], 871029[F], 871038[F], 871040[F], 871045[F], 920579[2035], 871046[35], 19481[F], 517945[F], ABHD2
871042[F], 871044[F] 19482[F], 517943[F], 517944[F], 517947[F], 517946[F], 517948[F], 517949[F], 517953[F], 517954[F], 517956[F], (11057) &
517950[F], 517951[F] 517952[F], 517955[F], 517957[F], 517958[F], 517961[F], 517962[F], 517966[F], 517967[F], 517968[F], 517969[F], Abhd2
517959[F], 517960[F] 517963[F], 517964[F], 517965[F], 517971[F], 517970[F], 517972[F], 517973[F], 517974[F], 517975[F], 517977[F], (54608)
517976[F], 517982[F] 517991 [F], 517993[F], 517995[F], 517996[F], 517978[F], 517979[F], 517980[F], 517981[F], 517983[F], 517984[F],
518001[F], 518010[-1682], 518012[-2085], 518014[-2404], 518016[- 517985[F], 517986[F], 517987[F], 517988[F], 517989[F], 517990[F],
2669]
517992[F], 517994[F], 517997[F], 517998[F], 517999[F], 518000[F],
518002[F], 517942[29], 518003[-313], 518004[-435], 518005[-807],
518006[-910], 518007[-1000], 518008[-1152], 518009[-1574],
518011[-1923], 518013 [-2378], 518015[-2616], 518017[-2729],
518018[-2811], 518019[-2951], 518020[-3872]
ABHD3
648993[F], 764326[F], 764327[F], 764328[F], 42951 [F], 289443[F], 648992[F], 764329[F], 764330[F], 42950[F], 289444[F], 289449[F],
(171586) & 289445[F], 289446[F], 289447[F], 289448[F], 289452[F], 289453[F], 289450[F], 289451[F], 289454[F], 289456[F], 289458[F], 289459[F],
Abhd3 289455[F], 289457[F], 289460[F], 42949[-2330] 289461[F], 289462[F], 289463[F], 289464[F], 42948[-2330]
(106861 )
644120[F], 726870[F], 726871[F], 726874[F], 726875[F], 726876[F],
726877[F], 726878[F], 726879[F], 726880[F], 726881 [F], 726882[F], ABHD4 726884[F], 726869[-2914], 36521[F], 209920[F], 209921 [F], 644121[F], 726872[F], 726873[F], 726883[F], 36522[F], 209919[F], (63874) & 209922[F], 209925[F], 209926[F], 209927[F], 209928[F], 209929[F], 209923[F], 209924[F], 209934[F], 209919[-4749] Abhd4 209930[F], 209931[F], 209932[F], 209933[F], 209935[F], 36520[-23], (105501) 209936[-881], 209920[-1947], 209918[-4421]
636245[F], 907599[F], 907601[F], 907602[F], 907603[F], 907604[F], ABHD5
636246[F], 907600[F], 907605[F], 636244(29811], 25988[F],
636243[29811], 925624[-2567], 907606[-4567], 25987[F], 594539[F], (51099) &
594542[F], 594543[F], 594545[F], 594550[F], 25990(950], 594551[- 594540[F], 594541[F], 594544[F], 594546[F], 594547[F], 594548[F], Abhd5
779]
594549[F], 25989[950], 594552[-3167] (67469)
643531[F], 722113[F], 722115[F], 722116[F], 722117[F], 722118[F],
ABHD6
643530[F], 661174[F], 722112[F], 722114[F], 722119[F], 722120[F], 923094[-2405], 722121[-4405], 35599[F], 198827[F], 198828[F],
(57406) & 35598[F], 198832[F], 198837[F], 198839[F], 198841[F], 198842[F], 198829[F], 198830[F], 198831 [F], 198833[F], 198834[F], 198835[F],
Abhd6 198845[F], 198846[F], 198852[F], 198853[F], 198854[F], 198855[F] 198836[F], 198838[F], 198840[F], 198843[F], 198844[F], 198847[F],
(66082) 198848[F], 198849[F], 198850[F], 198851 [F]
ABHD8
633241 [-4485] 633240[-4485]
(79575)
618998[F], 782736[F], 782737[F], 782738[F], 3265[F], 3266[F],
ABI1 326126[F], 326127[F], 326128[F], 326129[F], 326130[F], 326131[F],
(10006) &
916233[F], 618997[202], 3267[F], 3264[279], 326125[-4498] 326132[F], 326133[F], 326134[F], 326135[F], 326136[F], 326137[F],
Abi1 326138[F], 326139[F], 326140[F], 326141[F], 326142[F], 326143[F],
(11308) 326144[F], 326145[F], 326146[F], 326147[F]
617020[F], 656711[F], 656712[F], 656713[F], 656714[F], 656715[F], 617021[F], 656718[F], 656720[F], 656722[F], 656723[F], 656726[F], 656716[F], 656717[F], 656721[F], 656724[F], 656725[F], 656729[F], 656727[F], 656728[F], 656731 [F], 656736[F], 656737[F], 656738[F], 656730[F], 656732[F], 656733[F], 656734[F], 656735[F], 617022[- 656739[F], 617023[-1646], 656740[-2308], 656741 [-2505], 656742[-
ABI2 1646], 656743[-3665], 793[F], 57457[F], 57458[F], 57460[F], 2740], 656744[-4163], 794[F], 57459[F], 57465[F], 57469[F],
(10152) & 57461 [F], 57462[F], 57463[F], 57464[F], 57466[F], 57467[F], 57470[F], 57471 [F], 57474[F], 57475[F], 57477[F], 57478[F],
Abi2 57468[F], 57472[F], 57473[F], 57476[F], 57479[F], 57480[F], 57484[F], 57485[F], 57486[F], 57488[F], 57489[F], 57494[F],
(329165) 57481 [F], 57482[F], 57483[F], 57487[F], 57490[F], 57491 [F], 57497[F], 57500[F], 57501[F], 57502[F], 57503[F], 796[-1127],
57492[F], 57493[F], 57495[F], 57496[F], 57498[F], 57499[F], 795[- 57504[-2071], 57505[-2910], 57506[-3084], 57507[-3284], 57509[- 1127], 57508[-4010] 4367] TABLE 2 - Page 10 of 1873
695668[F], 695669[F], 695670[F], 695672[F], 639812 [12833],
695671 [F], 639813[12833], 639815[6327], 639811 [-144], 695667[- ABI3
639814[6327], 695673[-623], 695674[-1214], 695675[-3347],
550], 695666[- 4 855], 136727[F], 136731 [F], 30500[12404], (51225) &
136728[F], 136729[F], 136730[F], 136732[F], 30499[12404],
30502[5262], 30497[5045], 136726[-2805], 136725[-3905], 136724[- Abi3
30501 (5262], 30496[5045], 136733[-719], 136734[-1257], 136735[- 392] (66610)
30091
749915[F], 749918[F], 749922[F], 749923[F], 749924[F], 749925[F],
749927[F], 749929[F], 749931[F], 749932[F], 749934[F], 749936[F], 749916[F], 749917[F], 749919[F]. 749920[F], 749921 [F], 749926[F], 749937[F], 749938[F], 749942[F], 749944[F], 749947[F], 749949[F], 749928[F], 749930[F], 749933[F]. 749935[F], 749939[F], 749940[F], 749950[F], 749951[F], 647130(244139], 647132[-365], 749952[-961], 749941 [F], 749943[F], 749945[F]. 749946[F], 749948[F], ABI3BP 40342[F], 257709[F], 257711[F], 257714[F], 257719[F], 257721 [F], 647131(244139], 40343[F], 257710[F], 257712[F], 257713[F], (25890) & 257723[F], 257725[F], 257726[F], 257727[F], 257729[F], 257730[F], 257715[F], 257716[F], 257717[F]. 257718[F], 257720[F], 257722[F], Abi3bp 257731 [F], 257732[F], 257734[F], 257736[F], 257738[F], 257739[F], 257724[F], 257728[F], 257733[F]. 257735[F], 257737[F], 257740[F], (320712) 257741 [F], 257742[F], 257746[F], 257747[F], 257748[F], 257752[F], 257743[F], 257744[F], 257745[F] 257749[F], 257750[F], 257751 [F], 257754[F], 257757[F], 257760[F], 257761 [F], 257762[F], 257763[F], 257753[F], 257755[F], 257756[F]. 257758[F], 257759[F]
403441-192], 257764[-793]
619292[F], 784444[F], 784445[F], 784446[F], 784447[F], 784448[F],
784451 [F], 784452[F], 784453[F], 784454[F], 784455[F], 784459[F],
784460[F], 784463[F], 784465[F], 784466[F], 784467[F], 784469[F],
784470[F], 784472[F], 784473[F], 784476[F], 784477[F], 784479[F],
619293[F], 784449[F], 784450[F], 784456[F], 784457[F], 784458[F], 784480[F], 784482[F], 919338(1976], 919337(1779], 919336(1535],
784461[F], 784462[F], 784464[F], 784468[F], 784471 [F], 784474[F], 7844431-24], 784442] 221], 7844411-465], 3599[F], 329308[F],
784475[F], 784478[F], 784481 [F], 919335(1160], 784440[-840],
329309[F], 329310[F], 329311[F], 329314[F], 329315[F], 329316[F],
619294[-2702], 784464[-4041], 3600[F], 329312[F], 329313[F],
329317[F], 329318[F], 329320[F], 329321 [F], 329322[F], 329324[F],
329319[F], 329323[F], 329327[F], 329336[F], 329337[F], 329339[F], ABL1 (25) 329325[F], 329326[F], 329328[F], 329329[F], 329330[F], 329331 [F],
329344[F], 329351[F], 329352[F], 329353[F], 329355[F], 329357[F], & Abl1 329332[F], 329333[F], 329334[F], 329335[F], 329338[F], 329340[F],
329360[F], 329366[F], 329367[F], 329369[F], 329370[F], 329371 [F], (1 1350) 329341 [F], 329342[F], 329343[F], 329345[F], 329346[F], 329347[F],
329377[F], 329380[F], 329386[F], 329388[F], 329389[F], 329390[F], 329348[F], 329349[F], 329350[F], 329354[F], 329356[F], 329358[F],
329391[F], 329393[F], 329395[F], 329397[F], 329401 [F], 329307[-7] 329359[F], 329361[F], 329362[F], 329363[F], 329364[F], 329365[F],
3598[-85], 3601 [-1078], 329371 [-2481], 329370[-2704], 329369[- 329368[F], 329372[F], 329373[F], 329374[F], 329375[F], 329376[F],
3061], 329 4 07[-3955]
329378[F], 329379[F], 329381[F], 329382[F], 329383[F], 329384[F],
329385[F], 329387[F], 329392[F], 329394[F], 329396[F], 329398[F],
329399[F], 329400[F], 329402[F], 3597[-85], 329403[-135], 329404]-
204], 3294051-512], 329406[-813], 329306[-1712]
618110[F], 665633[F], 665634[F] 665636[F], 665637[F], 665638[F],
665639[F], 665640[F], 665641[F] 665642[F], 665645[F], 665646[F],
665647[F], 665648[F], 665649[F] 665650[F], 665652[F], 665653[F],
665654[F], 665655[F], 665656[F] 665657[F], 665658[F], 665659[F],
665661 [F], 665662[F], 665664[F] 665666[F], 665667[F], 665668[F],
665670[F], 665671[F], 665672[F] 665674[F], 665675[F], 665677[F], 618111[F], 665635[F], 665643[F], 665651 [F], 665660[F], 665663[F],
841058[F], 665646[-64], 665662[-202], 665645[-295], 665664[-1985]. 665665[F], 665669[F], 665673[F], 665676[F], 697549[F], 665663[- 665666[-2994], 665667[-3224], 618112[-3332], 665668[-3637], 1675], 665665[-2126], 618113[-3332], 665678[-3421], 665679[-
ABL2 (27) 665670[-3819], 2183[F], 75939[F], 75940[F], 75942[F], 75943[F], 3614], 665669[-3702], 665680[-4181], 2184[F], 75941 [F], 75945[F],
& Abl2 75944[F], 75946[F], 75947[F], 75948[F], 75949[F], 75950[F], 75951 [F], 75953[F], 75960[F], 75961[F], 75962[F], 75966[F],
(1 1352) 75952[F], 75954[F], 75955[F], 75956[F], 75957[F], 75958[F], 75968[F], 75970[F], 75972[F], 75975[F], 75977[F], 75985[F],
75959[F], 75963[F], 75964[F], 75965[F], 75967[F], 75969[F], 75987[F], 75998[F], 76002[F], 76004[F], 76008[F], 76012[F],
75971 [F], 75973[F], 75974[F], 75976[F], 75978[F], 75979[F], 76015[F], 2186[-3996], 76017[-4566]
75980[F], 75981 [F], 75982[F], 75983[F], 75984[F], 75986[F],
75988[F], 75989[F], 75990[F], 75991 [F], 75992[F], 75993[F],
75994[F], 75995[F], 75996[F], 75997[F], 75999[F], 76000[F],
76001 [F], 76003[F], 76005[F], 76006[F], 76007[F], 76009[F],
76010[F], 7601 1 [F], 76013[F], 76014[F], 76016[F], 2185[-3996]
651016[F], 780246[F], 780247[F], 780251 [F], 780252[F], 780253[F],
651017[F], 780248[F], 780249[F], 780250[F], 780254[F], 780255[F],
780258[F], 780259[F], 780260[F], 780261 [F], 780263[F], 780267[F], 780262[F], 780264[F], 780265[F], 780266[F], 780270[F], 780272[F],
780268[F], 780269[F], 780271 [F], 780276[F], 651014(252949],
780273[F], 780274[F], 780275[F], 651015(252949], 780277[-12],
651016[-240], 780260[-3491], 45428[F], 320622[F], 320623[F], ABLIM1 6510171-240], 780272[ 591], 45429[F], 320625[F], 320627[F],
320624[F], 320626[F], 320635[F], 320636[F], 320637[F], 320639[F], (3983) & 320628[F], 320629[F], 320630[F], 320631 [F], 320632[F], 320633[F],
320640[F], 320641[F], 320642[F], 320644[F], 320645[F], 320650[F], Abliml 320634[F], 320638[F], 320643[F], 320646[F], 320647[F], 320648[F],
320651[F], 320653[F], 320654[F], 320656[F], 320658[F], 320659[F], (226251 ) 320649[F], 320652[F], 320655[F], 320657[F], 320660[F], 320661 [F],
320662[F], 320663[F], 320664[F], 320665[F], 320667[F], 320668[F], 320666[F], 320669[F], 320670[F], 320671 [F], 320674[F], 320678[F],
320672[F], 320673[F], 320675[F], 320676[F], 320677[F], 320680[F], 320679[F], 320681[F], 320682[F], 45431 [-229], 320683[-565]
45430[-229], 320680[-1308], 320653[-1696], 320654[-3624] TABLE 2 - Page 11 of 1873
626233[F], 835277[F], 835278[F], 835279[F], 835280[F], 835282[F],
835283[F], 835284[F], 835287[F], 835288[F], 835289[F], 835291 [F],
626234[F], 835281[F], 835285[F], 835286[F], 835290[F], 835293[F], 835292[F], 835294[F], 835295[F], 835297[F], 835298[F], 835299[F],
835296[F], 835300[F], 835301 [F], 835306[F], 835307[F], 835308[F], 835302[F], 835303[F], 835304[F], 835305[F], 835313[F],
835309[F], 835310[F], 835311[F], 835312[F], 835314[F],
626233[193511], 835305[-129], 438856[F], 438857[F], 438858[F], ABLIM2
626234(193511], 438860[F], 438861 [F], 438862[F], 438863[F],
438859[F], 438865[F], 438866[F], 438867[F], 438869[F], 438870[F], (84448) &
438864[F], 438868[F], 438874[F], 438875[F], 438876[F], 438880[F], 438871 [F], 438872[F], 438873[F], 438877[F], 438878[F], 438879[F], Ablim2
438884[F], 438887[F], 438888[F], 438889[F], 438892[F], 438896[F], 438881 [F], 438882[F], 438883[F], 438885[F], 438886[F], 438890[F], (231148)
438899[F], 438901[F], 438906[F], 438907[F], 438912[F], 438913[F], 438891 [F], 438893[F], 438894[F], 438895[F], 438897[F], 438898[F],
438914[F], 438915[F], 438916[F], 438917[F], 438918[F], 438919[F], 438900[F], 438902[F], 438903[F], 438904[F], 438905[F], 438908[F],
438923[F], 12570(127099]
438909[F], 438910[F], 438911[F], 438920[F], 438921 [F], 438922[F],
12569[127099]
649604[F], 769178[F], 769180[F], 769181[F] 769183[F], 769184[F], 649603[F], 769172[F], 769173[F], 769174[F], 769175[F], 769176[F], 769185[F], 769189[F], 769190[F], 769193[F] 769194[F], 769195[F], 769177[F], 769179[F], 769182[F], 769186[F], 769187[F], 769188[F],
ABLIM3 769196[F], 769198[F], 43710[F], 299506[F] 299507[F], 299509[F], 769191[F], 769192[F], 769197[F], 43709[F], 299499[F], 299500[F],
(22885) & 299510[F], 299514[F], 299515[F], 299517[F] 299518[F], 299519[F], 299501 [F], 299502[F], 299503[F], 299504[F], 299505[F], 299508[F],
Ablim3 299525[F], 299526[F], 299528[F], 299529[F] 299530[F], 299532[F], 299511[F], 299512[F], 299513[F], 299516[F], 299520[F], 299521 [F],
(319713) 299533[F], 299534[F], 299535[F], 299536[F] 299537[F], 299540[F], 299522[F], 299523[F], 299524[F], 299527[F], 299531 [F], 299538[F], 299541 [F] 299539[F]
619138[F], 783302[F], 783303[F], 3427[F], 3428[F], 327253[F], ABO (28) & 327254[F], 327255[F], 327256[F], 327257[F Abo
628521 [F], 833443[F], 852220[F], 15589[F], 476092[F], 476093[F], 628522[F], 833442[F], 852221 [F], 852222[F], 930139[-2337], ABP1 (26) 15587(7782], 476093[-19], 476089[-338], 476092[-356], 476087[- 8522191-4337], 15590[F], 476090[F], 476091 [F], 15588(7782], & Abp1 3122] 4760881-1861], 476091[-2910], 476090[-3135], 476086[-3975] (76507)
639368[F], 691862[F], 691863[F], 691864[F], 691865[F], 691868[F],
691869[F], 691870[F], 691871[F], 691872[F], 691874[F], 691875[F],
691876[F], 691879[F], 691880[F], 691881[F], 691884]F], 691886[F],
691890[F], 691892[F], 691893[F], 691894[F], 691895[F], 691896[F], 639367[F], 691866[F], 691867[F], 691873[F], 691877[F], 691878[F], 691898[F], 691899[F], 691900[F], 691901 [F], 639366[-1368], 691860 691882[F], 691883[F], 691885[F], 691891[F], 691897[F], 691902[F], 2138], 6918591-2718], 691858[-4356], 29987[F], 130039[F], 691903[F], 691904[F], 709023[F], 709024[F], 691902[45], 639365]- 130040[F], 130041[F], 130042[F], 130045[F], 130046[F], 130047[F], 1368], 6919031-1798], 691861 [-2107], 691882[-3745], 29986[F],
130048[F], 130050[F], 130051[F], 130052[F], 130053[F], 130056[F], 130043[F], 130044[F], 130049[F], 130054[F], 130055[F], 130059[F], ABR (29) & 130057[F], 130058[F], 130060[F], 130062[F], 130064[F], 130065[F], 130061[F], 130063[F], 130071 [F], 130075[F], 130077[F], 130080[F], Abr 130066[F], 130067[F], 130068[F], 130069[F], 130070[F], 130072[F], 130084[F], 130086[F], 130090[F], 130091 [F], 130092[F], 130094[F], (109934) 130073[F], 130074[F], 130076[F], 130078[F], 130079[F], 130081[F], 130096[F], 130104[F], 130105[F], 130107[F], 130108[F], 130113[F], 130082[F], 130083[F], 130085[F], 130087[F], 130088[F], 130089[F], 130114[F], 130116[F], 29984[-419], 130114[-1460], 130038[-1976], 130093[F], 130095[F], 130097[F], 130098[F], 130099[F], 130100[F], 130037[-2287], 130034[-4188], 130090[-4685], 130032[-4801],
130101[F], 130102[F], 130103[F], 130106[F], 130109[F], 130110[F], 130091 [-4931]
130111[F], 130112[F], 130115[F], 29985[-419], 130115[-2253],
130036[-2317], 130088[-2515], 130035[-3100], 130089[-3192],
130033[-4804]
ABRA
645227[F], 735720[F], 37978[F], 228945[F], 37973[-4243] 37972[-4243], 228944[-4282] (137735) &
Abra ABT1
916518[F], 33684[-3659], 175769[-4872], 175770[-4939] 642283[F], 713456[F], 33683[F], 175768[F] (29777) &
Abt1 ABTB1
6290101-128], 629012[-543], 856205[-3743], 16246[-620], 16248]- 629009[-128], 629011[-543], 856206[-4443], 16245[-620], 16247[- (80325) & 917], 4851521-3138] 917], 485151 [-2442], 485153[-3700]
Abtbl
620161[F], 791620[F], 791621[F] 791623[F], 791624[F], 791625[F],
791626[F], 791627[F], 791628[F] 791631[F], 791632[F], 791634[F],
791636[F], 791637[F], 791639[F] 791640[F], 791641 [F], 791647[F],
791648[F], 791649[F], 791650[F] 791651[F], 791653[F], 791654[F], 620162[F], 791622[F], 791629[F], 791630[F], 791633[F], 791635[F], 791655[F], 791656[F], 791661[F] 791662[F], 791664[F], 791666[F], 791638[F], 791642[F], 791643[F], 791644[F], 791645[F], 791646[F], 620163[-4075], 4691 [F], 343053[F], 343054[F], 343056[F] 791652[F], 791657[F], 791658[F], 791659[F], 791660[F], 791663[F], ABTB2
343058[F], 343059[F], 343060[F] 343061 [F], 343062[F], 343063[F], 791665[F], 4692[F], 343055[F], 343057[F], 343065[F], 343067[F], (25841) & 343064[F], 343066[F], 343068[F] 343069[F], 343071 [F], 343073[F], 343070[F], 343072[F], 343075[F], 343079[F], 343080[F], 343081 [F], Abtb2 343074[F], 343076[F], 343077[F] 343078[F], 343084[F], 343086[F], 343082[F], 343083[F], 343085[F], 343092[F], 343100[F], 343101[F], (99382) 343087[F], 343088[F], 343089[F] 343090[F], 343091 [F], 343093[F], 343110[F], 343111[F], 343113[F], 343114[F], 343117[F], 343120[F], 343094[F], 343095[F], 343096[F] 343097[F], 343098[F], 343099[F], 343122[F]
343102[F], 343103[F], 343104[F] 343105[F], 343106[F], 343107[F],
343108[F], 343109[F], 343112[F] 343115[F], 343116[F], 343118[F],
343119[F], 343121[F], 4693[-2832], 343123[-3752]
636164[F], 907045[F], 907108[F], 907111[F], 636158(14424], 636165[F], 907043[F], 907044[F], 907109[F], 907110[F], 907112[F], ACAA1 636156[-296], 907042[-2524], 25891 [F], 593370[F], 593371 [F], 636157(14424], 636155[-296], 25892[F], 593369[F], 593373[F], (30) & 593372[F], 593376[F] 593374[F], 593375[F], 593377[F Acaal a
ACAA2
649783[F], 770556[F], 770557[F], 770558[F], 43927[F], 302397[F],
649782[F], 770559[F], 770560[F], 770561 [F], 770562[F], 43926[F], (10449) &
302399[F], 302400[F], 302401 [F], 302402[F], 302406[F], 302407[F], 302398[F], 302403[F], 302404[F], 302405[F], 302408[F], 302410[F] Acaa2
302409[F]
(52538) TABLE 2 - Page 12 of 1873
639571 [F], 639573[F], 693716[F; 693717[F] 693719[F] 693720[F],
693721 [F], 693723[F], 693725[F; 693726[F] 693727[F] 693728[F],
693730[F], 693731[F], 693733[F; 693734[F] 693735[F] 693736[F],
693738[F], 693739[F], 693740[F 693741 [F] 693743[F] 693748[F],
693749[F], 693750[F], 693751 [F 693752[F] 693753[F] 693754[F],
693755[F], 693756[F], 693757[F 693758[F] 693759[F] 693761 [F],
693762[F], 693764[F], 693765[F; 693766[F] 693767[F] 693768[F],
693770[F], 693771[F], 693772[F 693773[F] 693774[F] 693775[F],
693776[F], 693777[F], 693780[F; 693781 [F] 693784[F] 693785[F],
639572[F], 639574[F], 693718[F], 693722[F], 693729[F], 693732[F], 693787[F], 693789[F], 693790[F 693791 [F] 693792[F] 693793[F],
693737[F], 693742[F], 693744[F], 693745[F], 693746[F], 693747[F], 693794[F], 693795[F], 693798[F; 693799[F] 693800[F] 693801 [F],
693760[F], 693763[F], 693769[F], 693778[F], 693779[F], 693782[F], 693803[F], 693804[F], 693805[F; 693806[F] 693808[F] 693810[F],
693783[F], 693786[F], 693788[F], 693796[F], 693797[F], 693802[F], 693811[F], 693812[F], 701886[F; 701887[F] 701888[F]
693807[F], 693809[F], 701889[F], 639572(324956], 639570[-409], ACACA
639571(324956], 639569[-409], 30218[F], 133226[F], 133228[F],
6937181-2694], 30219[F], 133224[F], 133225[F], 133227[F], (31) &
133229[F], 133230[F], 133231 [F; 133232[F] 133233[F] 133234[F]
133235[F], 133237[F], 133241 [F], 133246[F], 133253[F], 133254[F], Acaca 133236[F], 133238[F], 133239[F; 133240[F] 133242[F] 133243[F]
133256[F], 133260[F], 133263[F], 133264[F], 133265[F], 133266[F], (107476) 133244[F], 133245[F], 133247[F 133248[F] 133249[F] 133250[F]
133280[F], 133281[F], 133284[F], 133289[F], 133291 [F], 133302[F], 133251[F], 133252[F], 133255[F 133257[F] 133258[F] 133259[F]
133303[F], 133304[F], 133305[F], 133308[F], 133310[F], 133311[F], 133261[F], 133262[F], 133267[F 133268[F] 133269[F] 133270[F]
133312[F], 133316[F], 133318[F], 133328[F], 133329[F], 133330[F], 133271[F], 133272[F], 133273[F 133274[F] 133275[F] 133276[F]
133336[F], 133341 [F], 133343[F]
133277[F], 133278[F], 133279[F 133282[F] 133283[F] 133285[F]
133286[F], 133287[F], 133288[F 133290[F] 133292[F] 133293[F]
133294[F], 133295[F], 133296[F 133297[F] 133298[F] 133299[F]
133300[F], 133301[F], 133306[F 133307[F] 133309[F] 133313[F]
133314[F], 133315[F], 133317[F 133319[F] 133320[F] 133321 [F]
133322[F], 133323[F], 133324[F 133325[F] 133326[F] 133327[F]
133331[F], 133332[F], 133333[F; 133334[F] 133335[F] 133337[F]
133338[F], 133339[F], 133340[F; 133342[F] 133344[F] 133345[F]
133346[F], 1332231-3823], 133222[-4074]
841637[F], 841638[F], 841639[F], 841642]F], 841644[F], 841645[F],
841640[F], 841641[F], 841643[F], 841646[F], 841648[F], 841653[F],
841647[F], 841649[F], 841650[F], 841652[F], 841655[F], 841656[F], 841654[F], 841657[F], 916305[F], 13842[F], 453092[F], 453093[F], ACACB
916306[F], 13843[F], 453097[F], 453098[F], 453099[F], 453100[F], 453094[F], 453095[F], 453096[F], 453101[F], 453104[F], 453105[F], (32) &
453102[F], 453103[F], 453106[F], 453107[F], 453108[F], 453110[F], 453109[F], 453111[F], 453112[F], 453113[F], 453117[F], 453119[F], Acacb
453114[F], 453115[F], 453116[F], 453118[F], 453120[F], 453121[F], 453122[F], 453124[F], 453126[F], 453127[F], 453131 [F], 453133[F], (100705)
453123[F], 453125[F], 453128[F], 453129[F], 453130[F], 453132[F], 453135[F], 453137[F], 453139[F], 13844[-3404]
453134[F], 453136[F], 453138[F], 13845[-3404], 453140[-3914]
627339[F], 843028[F], 843030[F], 843031 [F], 843032[F], 843033[F],
627338[F], 843029[F], 627340[-66], 843035[-2865], 843036[-3956], ACAD 10 843034[F], 627341[-66], 843038^4290], 14086[F], 14088[F],
843037[-4274], 843039[-4584], 14085[F], 14087[F], 455950[F], (80724) & 455948[F], 455949[F], 455951[F], 455953[F], 455954[F], 455955[F],
455952[F], 455958[F], 455947[-27], 14076[-46], 14089[-51], 455960| Acad 10 455956[F], 455957[F], 455959[F], 14077[-46], 14090[-51], 455946]- 1609], 4559611-2319], 455962[-2842], 455964[-3139] (71985) 1383], 455963[-2858], 455945[-3882], 455965[-4646]
635818[F], 904583[F], 904584[F], 904585[F], 904587[F], 904588[F],
904589[F], 904590[F], 904591[F], 904592[F], 904595[F], 904596[F], 635819[F], 904582[F], 904586[F], 904593[F], 904594[F],
904597[F], 904598[F], 635814[101393], 635816[-217], 904581[-388], 635815(101393], 635817( 217], 904580( 403], 904578( 488], ACAD 11 904579[-460], 25451 [F], 25455[F], 588142[F], 588143[F], 588144[F], 904577[-929], 25452[F], 25456[F], 588145[F], 588155[F], 588158[F] (84129) &
588146[F], 588147[F], 588148[F], 588149[F], 588150[F], 588151[F], 588141[-75], 25454[-567], 588139[-753], 588137[-837], 588136]- Acadl 1 588152[F], 588153[F], 588154[F], 588156[F], 588157[F], 588159[F], 1037], 588135[-1392], 588134[-2970], 588133[-3395], 588132]- (102632) 588160[F], 588161[F], 588162[F], 25453[-567], 588140[-738], 3507], 588131[-4514]
588138[-810]
ACAD8
634540[F], 894889[F], 894890[F], 894891 [F], 894892[F], 634542]- (27034) &
634541[-173], 894893[-2223], 23877[-123], 569886[-4039] 2703], 23876[F], 569880[F], 569881 [F], 569882[F], 569883[F],
Acad 8 569884[F], 569885[F], 23878[-4951]
(66948)
803470[F], 803471[F], 803472[F], 803473[F], 803474[F], 803475[F], ACAD9 855949[F], 925354[F], 925355[F], 925356[F], 925357[F], 925358[F], (28976) &
803469[F], 925353[F], 6839[F], 369157[F], 369164[F]
628978[4191], 6838[F], 369158[F], 369159[F], 369160[F], 369161 [F], Acad 9 369162[F], 369163[F], 369165[F], 369166[-2757], 369167]-4286] (229211 )
617115[F], 657485[F], 657486[F], 657487[F], 657488[F], 657489[F],
657490[F], 657491[F], 657492[F], 657493[F], 657494[F], 657500[F],
657501 [F], 657504[F], 657505[F], 657506[F], 657507[F], 657508[F], ACADL
909[F], 58812[F], 58813[F], 58814[F], 58817[F], 58819[F], 58820[F], 617114[F], 657502[F], 657503[F], 908[F], 58815[F], 58816[F], (33) & 58821 [F], 58822[F], 58823[F], 58824[F], 58825[F], 58826[F], 58818[F], 58832[F], 58833[F], 58838[F], 58839[F], 58842[F] Acadl 58827[F], 58828[F], 58829[F], 58830[F], 58831 [F], 58834[F], (11363) 58835[F], 58836[F], 58837[F], 58840[F], 58841 [F], 58843[F],
58844[F], 58845[F], 58846[F], 907[-4937]
623482[F], 813827[F], 813828[F], 813829[F], 813830[F], 813831[F], ACADM
888732[F], 888735[F], 888737[F], 888738[F], 924758[F], 924759[F], 813832[F], 888733[F], 888734[F], 888736[F], 8886[F], 390241 [F], (34) & 924760[F], 924761[F] 390242[F], 390243[F], 390244[F], 390245[F], 390246[F], 390247[F], Acadm
390248[F], 390249[F], 390250[F], 390251 [F], 390252[F] (11364) TABLE 2 - Page 13 of 1873
ACADS
627196[-2114], 841870 [-4833], 13893[-36], 13895[-3235], 453568[- 627195[F], 13894[F], 453567[F], 13892[-36], 453566[-1006],
(35) & 3712], 4 53569[-3872] 453565[-3896]
Acads
632145[F], 877918[F], 877919[F], 877920[F], 877921 [F], 877922[F],
632144[F], 877917[F], 877923[F], 877924[F], 877926[F], 877927[F], 877925[F], 877928[F], 632142[-87], 632143[-117], 877916[-119], ACADS B 877929[F], 632141[-87], 20681 [F], 531521[F], 531523[F], 531526[F], 8779151-232], 877914[-604], 20682[F], 531522[F], 531524[F], (36) & 531530[F], 531531[F], 531533[F], 531534[F], 531538[F], 531540[F], 531525[F], 531527[F], 531528[F], 531529[F], 531532[F], 531535[F], Acadsb 20678[-71] 531536[F], 531537[F], 531539[F], 20679[-71], 531520[-105], (66885)
531519[-230], 531518[-568], 531541[-1149]
690439[F], 690440[F], 690441[F], 690442[F], 639138(5390],
ACADVL
639137(3031], 639140[-1009], 690443[-2212], 690444[-2669],
639139[-1009], 690446[-3110], 690447[-3245], 690448[-4180], (37) & 690445[-3089], 29729[F], 127614[F], 127615[F], 127616[F],
29730[-1832], 127621 [-3949], 127622[-4081], 127623[-4960] Acadvl 29728(2833], 127617(38], 29731[-1832], 127618[-3041], 127619[- (11370) 34951, 127620[-39281
631158[F], 870957[F], 870958[F], 870966[F], 870968[F], 870970[F],
870959[F], 870960[F], 870961 [F], 870962[F], 870963[F], 870964[F], 870971 [F], 870972[F], 870976[F], 870977[F], 870978[F], 870979[F],
870965[F], 870967[F], 870969[F], 870973[F], 870974[F], 870975[F], ACAN 870980[F], 631159[71670], 631161[-1933], 19476[F], 517900[F],
631160(71670], 922288(1959], 870981[-41], 631162[-1933], (176) & 517901[F], 517906[F], 517911[F], 517914[F], 517915[F], 517917[F],
19477[F], 517902[F], 517903[F], 517904[F], 517905[F], 517907[F], Acan 517919[F], 517920[F], 517921[F], 517923[F], 517924[F], 517927[F],
517908[F], 517909[F], 517910[F], 517912[F], 517913[F], 517916[F], (11595) 517928[F], 517929[F], 517930[F], 517931[F], 517932[F], 19478[-1],
517918[F], 517922[F], 517925[F], 517926[F], 19479[-1], 517933[-75] 19475[-158]
ACAP1
639123[F], 690366[F], 690367[F], 639124[-803], 690365[-905],
(9744) &
9289141-4342] 690368[-2589], 928915[-4375], 29714[F], 127532[F], 127533[F],
Acapl 127534[F], 1275311-801], 29715[-1811], 127535[-3247]
(216859)
646790[F], 746870[F], 746871[F], 746872[F], 746873[F], 746874[F],
746875[F], 746877[F], 746878[F], 746879[F], 746883[F], 746885[F],
746887[F], 746889[F], 746890[F], 746891 [F], 746892]F], 746893[F],
646789[F], 746876[F], 746880[F], 746881 [F], 746882[F], 746884[F], 746894[F], 746895[F], 746896[F], 746897[F], 746899[F], 746900[F],
746886[F], 746888[F], 746898[F], 746904[F], 646785[-3569],
746901 [F], 746902[F], 746903[F], 746906[F], 646786[-3569], 746869 ACAP2
39926[F], 251909[F], 251914[F], 251915[F], 251916[F], 251917[F], 4726], 7468681-4920], 39927[F], 251903[F], 251904[F], 251905[F], (23527) &
251919[F], 251921[F], 251922[F], 251926[F], 251931 [F], 251934[F], 251906[F], 251907[F], 251908[F], 251910[F], 251911 [F], 251912[F], Acap2
251939[F], 251942[F], 251943[F], 251949[F], 251950[F], 251951[F], 251913[F], 251918[F], 251920[F], 251923[F], 251924[F], 251925[F], (78618)
251952[F], 251955[F], 251956[F], 251958[F], 251959[F], 251960[F], 251927[F], 251928[F], 251929[F], 251930[F], 251932[F], 251933[F],
251962[F], 251964[F], 251965[F]
251935[F], 251936[F], 251937[F], 251938[F], 251940[F], 251941[F],
251944[F], 251945[F], 251946[F], 251947[F], 251948[F], 251953[F],
251954[F], 251957[F], 251961[F], 251963[F], 251966[F], 251967[F]
831801[F], 831804[F], 831805[F], 928569[F], 928570[F],
928568(2611], 625766[-201], 625763[-3695], 831800[-3805], 831799| ACAP3
4177], 8317981-4913], 11859[F], 430490[F], 430491 [F], 430492[F], 831806[F], 928571[F], 916288[-3695], 11860[F], 430494[F], (116983) &
430493[F], 430495[F], 430496[F], 430497[F], 430498[F], 11864(262], 430499[F] Acap3
430489[-3035], 430488[-3398], 430487[-4123], 430486[-4367], (140500) 4304851-4715], 430484[-4977;
635026[F], 897993[F], 897995[F], 897996[F], 897997[F], 24444[F], ACAT1 575471 [F], 575473[F], 575474[F], 575475[F], 575478[F], 575479[F], 635025[F], 897994[F], 24443[F], 575472[F], 575476[F], 575477[F], (38) &
575480[F], 575481[F], 575482[F], 575484[F], 575486[F], 575488[F], 575483[F], 575485[F], 575487[F], 24445[-4230] Acatl
575489[F], 24441[-3191], 575470[-3763], 24446[-4230] (110446)
754162[F], 754163[F], 916576[F], 929510(1966], 929509(1868],
929508(1413], 929507(1043], 929506(606], 929505(554],
ACAT2
647608[F], 929497[-4419], 41025[F], 267326[F], 267327[F], 929504(99], 929503[-21], 754161[-34], 754160[-132], 754159[-587],
(39) & 267328[F], 267329[F], 267330[F], 267331 [F], 267332[F], 267333[F], 754158[-957], 754157[-1394], 754156[-1446], 754155[-1901],
Acat2 267334[F], 41024( 2638] 754154( 2021], 929502( 2940], 929501 [-3675], 929500( 4364],
(110460) 934652[-4538], 934653( 4545], 754153[-4940], 41022[718], 41023[- 2638], 267325[-3319], 41026[-3610]
618549[F], 668622[F], 668623[F], 668624[F], 668625[F], 668626[F],
668627[F], 668628[F], 668631[F], 668632[F], 668633[F], 668634[F],
ACBD3 668635[F], 668636[F], 2693[F], 81613[F], 81614[F], 81615[F], 618550[F], 668629[F], 668630[F], 2694[F], 81622[F], 81624[F],
(64746) & 81616[F], 81617[F], 81618[F], 81619[F], 81620[F], 81621[F], 81625[F], 81627[F], 81636[F], 2696[10996], 2697[-342], 81639[-
Acbd3 81623[F], 81626[F], 81628[F], 81629[F], 81630[F], 81631[F], 4170]
(170760) 81632[F], 81633[F], 81634[F], 81635[F], 81637[F], 81638[F],
2695[10996], 2692[-3910], 81612[-4093]
640203[F], 697742[F], 697744[F], 697746[F], 640201 [-75], 697746[- 640204[F], 697739[F], 697740[F], 697741 [F], 697743[F], 697745[F],
1018], 697738[-1674], 697736[-1831], 697734[-2891], 640205[-3140].640202[-75], 697745[-545], 697737[-1715], 697735[-2679], 640206[- ACBD4
640207[-4390], 697747[-4573], 697733[-4780], 697748[-4811], 3140], 30917[F], 139890[F], 139891 [F], 139892[F], 139894[F], (79777) &
30916[F], 139893[F], 139895[F], 139901[F], 139903[F], 30914(1044], 139896[F], 139897[F], 139898[F], 139899[F], 139900[F], 139902[F], Acbd4
1398881-1705], 139886[-1847], 139884[-2793], 30918[-3646], 30920[-30915[1044], 139889[-754], 139887[-1751], 139885[-2614], 30919[- (67131) 4124], 1399041-4302], 139905[-4546], 139883[-4604] 3646], 139882[-4905] TABLE 2 - Page 14 of 1873
618999[F], 672741[F], 782740[F], 782741[F], 782742[F], 782743[F],
782744[F], 782745[F], 782747[F], 782748[F], 782749[F], 782751 [F], ACBD5
619000[F], 782739[F], 782746[F], 782750[F], 3269[F], 326148[F], 911121 [F], 3268[F], 326149[F], 326150[F], 326151[F], 326153[F], (91452) &
326152[F], 326154[F], 326155[F], 326164[F], 326167[F], 326172[F], 326156[F], 326157[F], 326158[F], 326159[F], 326160[F], 326161[F], Acbd5
3271[-1063], 326174[-3433], 326175[-3964], 326176[-4390]
326162[F], 326163[F], 326165[F], 326166[F], 326168[F], 326169[F], (74159) 326170[F], 326171[F], 326173[F], 3270[-1063]
618087[F], 665435[F], 665436[F], 665437[F], 665438[F], 665439[F], 665440[F], 665441[F], 665442[F], 665443[F], 665444[F], 2156[F], 75560[F], 75561 [F], 75562[F], 75563[F], 75564[F], 75565[F],
ACBD6 75566[F], 75567[F], 75568[F], 75569[F], 75570[F], 75571 [F],
(84320) & 75572[F], 75573[F], 75574[F], 75575[F], 75576[F], 75577[F],
Acbd6 75578[F], 75579[F], 75580[F], 75581[F], 75582[F], 75583[F],
(72482) 75584[F], 75585[F], 75586[F], 75587[F], 75588[F], 75589[F],
75590[F], 75559[13], 75591 [-228], 75562[-386], 75568[-1107],
75563[-1226], 75564[-1603], 75592[-2460], 75569[-2690]
ACBD7
618788[F], 780850[F], 618790[-1622], 2984[F], 321885[F], 2986[- 618789[F], 618791[-1622], 2985[F], 321884[F], 2987[-579], 2983[- (414149) S 579] 3538], 321883[-4614] Acbd7
(78245)
639498[F; 639501 [F], 639503[F; 639505[F] 693120[F], 693123[F] 639497[F] 639499[F; 639500[F] 639502[F] 639504[F], 693119[F] 693124[F 693125[F], 693128[F 693129[F] 693132[F], 693134[F] 693121[F] 693122[F 693126[F] 693127[F] 693130[F], 693131 [F] 693136[F 693139[F], 693140[F 693141 [F] 693142[F], 693144[F] 693133[F] 693135[F 693137[F] 693138[F] 693143[F], 693145[F] 693147[F 693148[F], 693150[F 693152[F] 693160[F], 693161 [F] 693146[F] 693149[F 693151 [F] 693153[F] 693154[F], 693155[F] 693162[F 693163[F], 693165[F 693168[F] 693169[F], 693170[F] 693156[F] 693157[F 693158[F] 693159[F] 693164[F], 693166[F] 693174[F 693176[F], 693177[F 693178[F] 693180[F], 693182[F] 693167[F] 693171[F 693172[F] 693173[F] 693175[F], 693179[F] 693186[F 693187[F], 693188[F 693189[F] 693190[F], 693191 [F] 693181[F] 693183[F 693184[F] 693185[F] 693197[F], 693198[F] 693192[F 693193[F], 693194[F 693195[F] 693196[F], 693201[F] 693199[F] 693200[F 693205[F] 693207[F] 693209[F], 693212[F] 693202[F; 693203[F], 69320 4 [F; 693206[F] 693208[F], 693210[F] 693213[F] 693214[F 693216[F] 693221 [F] 693222[F], 693224[F] 693211[F; 693215[F], 693217[F; 693218[F] 693219[F], 693220[F] 693225[F] 693227[F; 693228[F] 693229[F] 693230[F], 693234[F] 693223[F; 693226[F], 693231 [F; 693232[F] 693233[F], 693235[F] 693236[F] 693237[F; 693238[F] 693239[F] 693241 [F], 693242[F] 693240[F; 693243[F], 693244[F; 693246[F] 693248[F], 693253[F] 693245[F] 693247[F; 693249[F] 693250[F] 693251 [F], 693252[F] 693254[F; 693259[F], 693260[F; 693262[F] 693264[F], 693265[F] 693255[F] 693256[F; 693257[F] 693258[F] 693261 [F], 693263[F] 693267[F; 693268[F], 693270[F; 693271 [F] 693273[F], 693274[F] 693266[F] 693269[F; 693272[F] 693275[F] 693276[F], 693279[F] 693277[F; 693278[F], 693281 [F 693283[F] 693284[F], 693285[F] 693280[F] 693282[F; 693286[F] 693287[F] 693288[F], 693293[F] ACCN1 693294[F 693296[F], 693297[F 693298[F] 693299[F], 693301 [F] 693295[F] 693300[F 693302[F] 693303[F] 693312[F], 693313[F] (40) & 693304[F; 693305[F], 693306[F; 693307[F] 693308[F], 693309[F] 693314[F] 693319[F 693322[F] 693324[F] 693329[F], 693331 [F] Accnl 693310[F 693311[F], 693315[F 693316[F] 693317[F], 693318[F] 693332[F] 693337[F 693339[F] 693341 [F] 693342[F], 693344[F] (11418) 693320[F; 693321 [F], 693323[F 693325[F] 693326[F], 693327[F] 693345[F] 693350[F; 693351 [F] 693352[F] 693354[F], 693356[F] 693328[F 693330[F], 693333[F 693334[F] 693335[F], 693336[F] 693357[F] 693358[F 693359[F] 829610[F] 829611 [F], 829613[F] 693338[F; 693340[F], 693343[F; 693346[F] 693347[F], 693348[F] 829617[F] 829649[F; 829653[F] 829655[F] 829656[F], 829753[F] 693349[F 693353[F], 693355[F 693360[F] 693361 [F], 693362[F] 829797[F] 829798[F 829883[F] 829886[F] 639497[1143714],
829612[F 829614[F], 829615[F 829616[F] 829650[F], 829651 [F] 693207[- 622] 30131 F], 30133[F], 30134[F], 30136[F], 30138[F],
829652[F; 829654[F], 82975 4 [F; 829755[F] 829756[F], 829757[F] 132144[F] 132146[F 132147[F] 132152[F], 132153[F], 132156[F], 829799[F; 829800[F], 82988 4 [F; 829885[F] 639498(1143714], 132157[F] 132163[F; 132165[F] 132166[F], 132167[F], 132169[F],
693208[-862], 30132[F], 30135[F] , 30137[F], 30139[F], 132145[F], 132172[F] 13217 4 [F; 132175[F] 132177[F], 132178[F], 132183[F],
132148[F; 132149[F], 132150[F; 132151 [F] 132154[F], 132155[F] 132185[F] 132186[F; 132189[F] 132191[F], 132193[F], 132194[F], 132158[F; 132159[F], 132160[F; 132161 [F] 132162[F], 132164[F] 132195[F] 132196[F; 132197[F] 132198[F], 132199[F], 132200[F], 132168[F 132170[F], 132171[F 132173[F] 132176[F], 132179[F] 132201 [F] 132209[F 132211[F] 132212[F], 132213[F], 132218[F], 132180[F 132181[F], 132182[F 132184[F] 132187[F], 132188[F] 132219[F] 132220[F 132222[F] 132227[F], 132229[F], 132231 [F], 132190[F 132192[F], 132202[F 132203[F] 132204[F], 132205[F] 132233[F] 132234[F 132235[F] 132236[F], 132237[F], 132255[F],
13??0fiiFl 13??07iFl 13??nfiiFl 13??10 1 13??14[F1 13??15iFl 13??5RiFl 13??57iFl 13?? firFl 13??R3[F1 13??R5iFl 13??R7iFl
646148[F], 742184[F 742185[F], 742186[F], 742187[F], 742188[F],
646149[-104], 646147[-1734], 742190[-1956], 742192[-2648],
742189[F], 646150[ 04], 742191[-2611], 742193[-2697], 742195[- ACCN2 742194[-2969], 742196[-3219], 742198[-3755], 742183[-4569],
3151], 742197[-3393 , 742199[-3791], 39150[F], 242166[F], (41) & 742200[-4963], 39151 [-325], 242176[-1391], 39149[-1818], 242178[- 242167[F], 242168[F 242169[F], 242170[F], 242171 [F], 242172[F], Accn2 2076], 242180[-2421], 242182[-2684], 242184[-3206], 242165[-4119]
242173[F], 242174[F 242175[F], 39152[-325], 242177[-2039], (11419) 242186[-4552], 242187[-4728], 242188[-4922]
242179[-2125], 242181[-2616], 242183[-2854], 242185[-3242]
ACCN3
833480[F], 625971[4207], 931701[-1977], 931702[-2357], 625970[-
931677[1712], 833479[-288], 931700[-1035], 833481 [-3035], (9311) &
2837], 833482[-3977], 833483[-4357], 12230[F], 12236[F],
12229[F], 434918[-381], 43491 [-3083], 434921[-3159] Accn3
434919[F], 434920[F], 434922[-3315], 12235[-3397], 434923[-4661]
(171209)
658545[F], 658546[F], 658547[F], 658548[F], 658549[F],
658550[F], 617268[24370], 617270[-182], 658552[-257], 658553[- ACCN4 617267[24370], 926725[2022], 658551 [22], 617269[-182], 658554[-
773], 658555[-2399], 617271[-4718], 1076[F], 60772[F], 60775[F], (55515) & 823], 658556[-3050], 658557[-3146], 1075[F], 60773[F], 60774[F],
60778[F], 60780[F], 60783[F], 1078[-227], 60785[-315], 60786[-792] Accn4 60776[F], 60777[F], 60779[F], 60781 [F], 60782[F], 60784[22], 1077[-
60788[-2458], 1079[-4717] (241118) 227], 60787[-842], 60789[-3111], 60790[-3207]
ACCN5 (51802) &
805874[F], 622241[36544], 7389[F], 374658[F] 622242(36544] , 7390[F], 374659[F]
Accn5 (58170) ACCS
791194[F], 791195[F], 791197[F], 620091 [17360], 4604[F], 791193[F], 791196[F], 620090(17360], 4603[F], 342089[F],
(84680) & 342090[F], 342091[F], 342094[F], 342095[F] 342092[F], 342093[F]
Aces TABLE 2 - Page 15 of 1873
ACCSL
620093[F], 791199[F], 791200[F], 791201[F], 791202[F], 4606[F],
620092[F], 791198[F], 929352(1907], 791203[-93], 4605[F], (390110) & 342096[F], 342099[F], 342100[F], 342101 [F], 342102[F], 342104[- 342097[F], 342098[F], 342103[F], 342105[-1566], 342106[-1769] Aces I 1188], 342107[-4057]
(381411 )
889360[F], 889361[F], 889362[F], 889363[F], 889364[F], 889365[F],
ACD
889366[F], 889367[F], 889368[F], 633796(3196], 633797(463],
633795(496], 633798[-2130], 889370[-3641], 22888(477], 22891[- (65057) & 8893691-341], 22889[F], 557167[F], 557168[F], 557169[F],
2554], 557177[-4025] Acd 557170[F], 557171[F], 557172[F], 557173[F], 557174[F], 557175[F],
(497652) 22890f-51l, 557176]-773 "
640280[F], 698243[F], 698245[F], 698246[F], 698247[F], ACE
640279[F], 698244[F], 698248[F], 698249[F], 640277(16973],
640278(16973], 698246[-4362], 31004[F], 140931[F], 140933[F], (1636) & 31003[F], 140932[F], 140936[F], 140937[F], 140938[F], 140939[F],
140934[F], 140935[F], 140940[F], 31002(17740], 140934[-3798], Ace 31001(17740], 31005[-4765]
310061-4765] (11421)
ACE2
652209[F], 915929[F], 915933[F], 915935[F], 652211 [-4503], 652210[F], 915930[F], 915931 [F], 915932[F], 915934[F], 652212]- (59272) & 47350[F], 615597[F], 615598[F], 615603[F], 615604[F], 615606[F], 4503], 9159361-4728], 47351 [F], 615595[F], 615596[F], 615599[F],
Ace2 47352[-4422] 615600[F], 615601[F], 615602[F], 615605[F], 47353[-4422]
(70008) ACER1
648533[F], 926360[845], 760306[-1155], 42346[F], 280857[F],
(125981) &
648534[F], 760307[F], 42347[F], 280864[F], 280865[F], 280867[F] 280858[F], 280859[F], 280860[F], 280861 [F], 280862[F], 280863[F],
Acerl 280866[F], 280868[F]
(171168)
624330[F], 819842[F], 819845[F], 819848[F], 10059[F], 404622[F], 624331[F], 819843[F], 819844[F], 819846]F], 819847[F], 819849[F], ACER2 404623[F], 404625[F], 404628[F], 404629[F], 404634[F], 404635[F], 924431(331], 924432(66], 819850[-1669], 819851 [-1934], 10060[F], (340485) & 404636[F], 404637[F], 404638[F], 404642[F], 404643[F], 404644[F], 404624[F], 404626[F], 404627[F], 404630[F], 404631 [F], 404632[F], Acer2 404647[-3540] 404633[F], 404639[F], 404640[F], 404641 [F], 404645[F], 404646[F] (230379)
631427[F], 872828[F], 872829[F], 872830[F], 872831 [F], 872832[F],
872834[F], 872835[F], 872836[F], 872837[F], 872838[F], 872839[F],
872840[F], 19809[F], 521764[F], 521766[F], 521767[F], 521768[F],
631426[F], 872833[F], 19808[F], 521765[F], 521769[F], 521773[F], 521770[F], 521771[F], 521772[F], 521774[F], 521775[F], 521776[F], ACER3
521779[F], 521781[F], 521784[F], 521787[F], 521788[F], 521789[F], 521777[F], 521778[F], 521780[F], 521782[F], 521783[F], 521785[F], (55331) &
521790[F], 521794[F], 521799[F], 521800[F], 521807[F], 521810[F], 521786[F], 521791[F], 521792[F], 521793[F], 521795[F], 521796[F], Acer3
521812[F], 521814[F], 521816[F], 521817[F], 521818[F], 19806[- 521797[F], 521798[F], 521801[F], 521802[F], 521803[F], 521804[F], (66190)
3281]
521805[F], 521806[F], 521808[F], 521809[F], 521811 [F], 521813[F],
521815[F], 521819[F], 521820[F], 521821 [F], 521822[F], 521823[F],
198071-3281]
627647[F], 931108[89], 627650[-1313], 845418[-1653], 845414[- 1911], 845419[-2133], 845421 [-2241], 845423[-2879], 845424[- 627646[F], 627648[F], 845416[F], 845417[F], 845415[-360], 627649[- 3057], 845425[-3608], 845426[-3702], 845427[-4069], 845428[- 1313], 845420[-2226], 845422[-2483], 845429]-4655], 845432[-4950] 4362], 845430[-4631], 845431 [-4740], 845433[-4963], 14472[387], ACHE (43)
14473[F], 461733[F], 461734[F], 461735[F], 14471[387], 461732[- 14475[-1239], 461736[-1566], 461731[-1628], 461730 [-1987], & Ache 346], 14474[-1239], 461738[-2095], 461740[-2314], 461727[-3522], 461737[-2002], 461739[-2110], 461729[-2481], 461741[-2701], (11423) 461747[-4294], 461725[-4804] 461742[-2908], 461728[-3129], 461743[-3385], 461744[-3479],
461745[-3781], 461746[-4064], 461748[-4270], 461749[-4379],
461726[-4411], 461724[-4807]
644138[F], 726956[F], 726957[F], 726958[F], 726959[F], 726960[F],
726961 [F], 726962[F], 726963[F], 726964[F], 726965[F], 726966[F],
726967[F], 726968[F], 726969[F], 726970[F], 726971 [F], 726972[F],
726973[F], 726974[F], 726975[F], 726976[F], 726977[F], 726978[F],
726979[F], 726980[F], 726981[F], 726982[F], 726983[F], 726984[F],
726985[F], 726986[F], 644138(36908], 644140(905], 644137[-1016], ACIN1 644142[-4882], 726955[-4934], 36541[F], 210059[F], 210060[F], (22985) &
644139[905], 644141 [-4882], 36542(729]
210061[F], 210062[F], 210063[F], 210064[F], 210065[F], 210066[F], Acini 210067[F], 210068[F], 210069[F], 210070[F], 210071 [F], 210072[F], (56215) 210073[F], 210074[F], 210075[F], 210076[F], 210077[F], 210078[F],
210079[F], 210080[F], 210081[F], 210082[F], 210083[F], 210084[F],
210085[F], 210086[F], 210087[F], 210088[F], 210089[F], 210090[F],
210091 [F], 210092[F], 210093[F], 210094[F], 210095[F], 36543(729],
210096[34], 36540[-795], 210072[-3070], 210058[-4705] TABLE 2 - Page 16 of 1873
640050[F], 696943[F], 696944[F], 696945[F], 696947[F], 696949[F],
696951 [F], 696952[F], 696953[F], 696954[F], 696955[F], 696956[F],
696957[F], 696958[F], 696959[F], 696961 [F], 696962[F], 696964[F],
696965[F], 696966[F], 696967[F], 696970[F], 696971 [F], 696972[F],
696973[F], 696974[F], 696975[F], 696976[F], 696977[F], 696979[F],
696980[F], 696983[F], 696984[F], 696985[F], 696987[F], 696988[F],
696989[F], 923356[1895], 923357[1458], 923358[1288], 696991[-
640049[F], 696946[F], 696948[F], 696950[F], 696960[F], 696963[F], 105], 696992[-542], 696993[-712], 640048[-1483], 696942[-2375],
696968[F], 696969[F], 696978[F], 696981 [F], 696982[F], 696986[F], 696941 [-4152], 30755[F], 138682[F], 138683[F], 138684[F], ACLY (47)
696990[F], 30754[F], 138685[F], 138688[F], 138691[F], 138694[F], 138686[F], 138687[F], 138689[F], 138690[F], 138692[F], 138693[F], & Acly
138696[F], 138701[F], 138702[F], 138703[F], 138706[F], 138707[F], 138695[F], 138697[F], 138698[F], 138699[F], 138700[F], 138704[F], (104112)
138718[F], 138721[F], 138725[F], 138727[F], 138732[F], 138733[F], 138705[F], 138708[F], 138709[F], 138710[F], 138711 [F], 138712[F],
138744[F], 138747[F], 138748[F], 138752[F], 138756[F], 30756[768] 138713[F], 138714[F], 138715[F], 138716[F], 138717[F], 138719[F],
138720[F], 138722[F], 138723[F], 138724[F], 138726[F], 138728[F],
138729[F], 138730[F], 138731[F], 138734[F], 138735[F], 138736[F],
138737[F], 138738[F], 138739[F], 138740[F], 138741 [F], 138742[F],
138743[F], 138745[F], 138746[F], 138749[F], 138750[F], 138751[F],
138753[F], 138754[F], 138755[F], 30757[768], 138757[-36], 138758[- 462], 138759[-634], 30753[-3550], 138681[-4388]
617706[F], 662267[F], 662269[F], 923362(1106], 923363(1014],
ACMSD
617705[F], 662268[F], 923361(1446], 662270[-554], 923365[-3175], 923364(770], 662271[-894], 662272[-986], 662273[-1230], 1689[F],
(130013) & 1688[F], 69705[F], 69708[F], 69710[F], 69711[F], 69712[F], 69714[F], 69706[F], 69707[F], 69709[F], 69713[F], 69717[F], 69718[F],
Acmsd
69715[F], 69716[F], 1690(13950], 69721(40], 69727[-4064] 69719[F], 69720[F], 1691(13950], 69722[-284], 69723[-367], 69724[- (266645) 1217], 69725[-3119], 69726[-3566]
628047[F], 848108[F], 848109[F], 848112[F], 848113[F], 15016[F], ACN9
628048[F], 848110[F], 848111[F], 15017[F], 467913[F], 467915[F], 467911[F], 467912[F], 467914[F], 467917[F], 467919[F], 467920[F], (57001) &
467916[F], 467918[F], 467921[F], 467922[F], 467926[F], 467927[F], 467923[F], 467924[F], 467925[F], 467928[F], 467929[F], 467930[F], Acn9
467932[F], 467934[F], 467937[F]
467931 [F], 467933[F], 467935[F], 467936[F], 467938]F], 467939[F] (71238)
623788[F], 815926[F], 815928[F], 815929[F], 815930[F], 815934[F],
815935[F], 815937[F], 815938[F], 815939[F], 815940[F], 815941[F], 623789[F], 815927[F], 815931[F], 815932[F], 815933[F], 815936[F], 815943[F], 815946[F], 815947[F], 815949[F], 623790[-4467], 815942[F], 815944[F], 815945[F], 815948[F], 9314[F], 395822[F], AC01 (48) 9313[F], 395821 [F], 395824[F], 395825[F], 395827[F], 395830[F], 395823[F], 395826[F], 395828[F], 395829[F], 395831 [F], 395832[F], & Aco1 395833[F], 395834[F], 395835[F], 395838[F], 395839[F], 395840[F], 395836[F], 395837[F], 395844[F], 395845[F], 395847[F], 395848[F], (11428) 395841 [F], 395842[F], 395843[F], 395846[F], 395849[F], 395850[F], 395851 [F]
395852[F], 395820[-3], 9315[-4760]
739638[F], 739640[F], 739641 [F], 739645[F], 739646[F], 739650[F], 739651[F], 739655[F], 739656[F], 739658[F], 739661 [F], 739663[F],
739639[F], 739642[F], 739643[F], 739644[F], 739647[F], 739648[F],
739664[F], 739668[F], 739671 [F], 739672[F], 739674[F],
739649[F], 739652[F], 739653[F], 739654[F], 739657[F], 739659[F],
645763(59861 ], 645765(30648], 645761( 420], 739636( 516],
739660[F], 739662[F], 739665[F], 739666[F], 739667[F], 739669[F],
739635[-932], 739634[-1248], 739633[-1390], 739632[-1609],
739670[F], 739673[F], 739675[F], 739676[F], 739677[F],
739631 [-1762], 739678[-1815], 739630[-1828], 739629[-4190],
645762(59861], 645764(30648], 645760[-420], 739637[-462],
38681[F], 236910[F], 236911[F], 236915[F], 236920[F], 236922[F], 38680[F], 236909[F], 236912[F], 236913[F], 236914[F], 236916[F], AC02 (50)
236924[F], 236927[F], 236930[F], 236932[F], 236935[F], 236936[F], 236917[F], 236918[F], 236919[F], 236921[F], 236923[F], 236925[F], & Aco2
236939[F], 236943[F], 236944[F], 236947[F], 236948[F], 236955[F], 236926[F], 236928[F], 236929[F], 236931 [F], 236933]F], 236934[F], (11429)
236956[F], 236958[F], 236959[F], 236962[F], 236964[F], 236965[F], 236937[F], 236938[F], 236940[F], 236941 [F], 236942[F], 236945[F],
236969[F], 236972[F], 236973[F], 236975[F], 38683(26911], 38679[- 236946[F], 236949[F], 236950[F], 236951 [F], 236952[F], 236953[F],
550], 2369071-643], 236979[-796], 236906[-1230], 236905[-1731],
236954[F], 236957[F], 236960[F], 236961 [F], 236963[F], 236966[F],
236904[-1857], 236903[-2063], 236980[-2180], 236902[-2226],
236967[F], 236968[F], 236970[F], 236971 [F], 236974[F], 236976[F],
236901 [-2288], 236900[-2488], 236899[-2564], 236898[-2761],
236977[F], 236978[F], 38682(26911], 38678[-550], 236908[-588]
236897[-3014], 236896[-3144], 236895[-3249], 236894[-3375],
236893[-3493], 236892[-4042], 236891 [-4742]
ACOT1
641561[F], 707746[F], 707747[F], 921928[-4134], 32695[F],
641560[F], 707744[F], 707745[F], 32694[F], 163018[F], 32696(2105], (641371) &
163019[F], 163020[F], 163021[F], 32697(2105], 163016[-3360],
163022[-57], 163017[-1855], 163023[-3132] Acot3
1630241-4602]
(171281 )
624519[F], 624521[F], 821707[F], 821708[F], 821709[F], 821710[F],
624518[F], 624520[F], 821712[F], 821713[F], 821717[F], 821718[F], 821711[F], 821714[F], 821715[F], 821716[F], 624521 (65938], ACOT11
624520[65938], 624518[5461], 10333[F], 408394[F], 408396[F],
624519[5461], 821709[-2344], 821708[-2460], 821707[-4533], (26027) &
408397[F], 408398[F], 408399[F], 408400[F], 408401 [F], 408408[F], 10334[F], 408390[F], 408391[F], 408392[F], 408393[F], 408395[F], Acotl 1
408409[F], 408410[F], 408411[F], 408412[F], 10331(8825], 408413[- 408402[F], 408403[F], 408404[F], 408405[F], 408406[F], 408407[F], (329910)
1707]
10332[88251, 408389[-1369 "
ACOT12
643145[F], 718941[F], 718942[F], 643144(64004], 34994[F],
(134526) & 34995[F], 190948[F], 190949[F], 190950[F], 190951[F], 190952[F], 34992(353]
Acotl 2 190953[F], 34991 [353]
(74156) TABLE 2 - Page 17 of 1873
642346[F], 713661[F], 713662[F], 642344(206], 642347[-108],
713660[-113], 713663[-205], 713664[-415], 713658[-475], 713657]- 610], 7136561-674], 713655[-809], 713654[-900], 713653[-1026],
ACOT13 7136651-4166], 33757[F], 176191[F], 176192[F], 176193[F],
(55856) &
642345(206], 713659[-320], 33756[-458], 176188[-4447] 176194[F], 176195[F], 33758[-163], 176196[-302], 33755(^58],
Acot13 1761971-512], 176198[-2083], 176199[-2244], 176200[-2425],
(66834) 176201 [-2502], 176202[-2726], 176203[-2792], 176204[-3384],
176205[-3874], 176190[-4024], 176189[-4283], 176187[-4605],
176186[-4738], 176185[-4801], 176206[-4918], 176184[-4928]
ACOT2
641558[F], 707748[F], 707749[F], 32692[F], 162990[F], 162991[F], 641559[F], 707750[F], 707751 [F], 707753[F], 32693[F], 162994[F], (10965) & 162992[F], 162993[F], 162996[F], 32690[-3007], 162987[-4493] 162995[F], 326911-3007], 162989[-3108], 162988[-3379] Acot2
(171210) ACOT4
641563[F], 32695[F], 32697[F], 163012[F], 163010[-757], 163013[- (122970) & 641562[F], 707752[F], 32694[F], 32696[F], 163011[F], 163009[-1082] 1699], 163014[-1782], 163015[-1980], 163008[-3000], 163016]-
Acot4
4042]
(171282) ACOT6
641564[F], 932085[-2047], 707754[-4047], 32698[F], 163031[F], 641565[F], 707755[F], 707756[F], 32699[F], 163033[F], 163034[F], (641372) & 163032[F], 32700[-4543] 32701 [-4543] Acot6
(217700)
625669[F], 680388[F], 831152[F], 831153[F], 831155[F], 831156[F],
831157[F], 831159[F], 831160[F], 831161[F], 831164[F], 831165[F],
625670[F], 831150[F], 831151[F], 831154[F], 831158[F], 831162[F], 831167[F], 831169[F], 625671[-2936], 11749[F], 429201[F],
831163[F], 831166[F], 831168[F], 920095[F], 920094[2537],
429202[F], 429206[F], 429209[F], 429211[F], 429212[F], 429214[F], ACOT7
920095[6], 831151 [-1994], 625672[-2936], 11750[F], 429200[F],
429215[F], 429217[F], 429218[F], 429219[F], 429220[F], 429222[F], (11332) &
429203[F], 429204[F], 429205[F], 429207[F], 429208[F], 429210[F], 429223[F], 429224[F], 429225[F], 429226[F], 429228[F], 429229[F], Acot7
429213[F], 429216[F], 429221[F], 429227[F], 429231 [F], 429234[F], 429230[F], 429232[F], 429233[F], 429235[F], 429238[F], 429239[F], (70025)
429236[F], 429237[F], 429246[F], 429249[F], 429251 [F], 429208]- 429240[F], 429241[F], 429242[F], 429243[F], 429244[F], 429245[F],
1343], 11752[-2076], 429207[-2946], 429205[-4691]
429247[F], 429248[F], 429250[F], 429252[F], 429209[-244], 11751[- 2076], 429202[-2592], 429206[-4538]
ACOT8
621277[F], 799752[F], 799753[F], 621275[1350], 799750[39], 621276[F], 799751[F], 621274[1350], 799749[-4937], 6011[F],
(10005) & 621278[-171], 6012[F], 358824[F], 358825[F], 358826[F], 358830[F], 358823[F], 358827[F], 358828[F], 358829[F], 6009[1463], 358821]-
Acot8 358831[F], 358832[F], 6010[1463], 358822[39], 6013[-215] 1877], 358820[-3821], 358819[-4843]
(170789)
645062[F], 915083[F], 915084[F], 915085[F], 915086[F], 915087[F],
915090[F], 915091[F], 47250[F], 613715[F], 613716[F], 613717]F], ACOT9 613718[F], 613719[F], 613720[F], 613721[F], 613722[F], 613725[F], 645061[F], 47251[F], 613723[F], 613724[F], 613728[F], 613731[F], (23597) & 613726[F], 613727[F], 613729[F], 613730[F], 613732[F], 613733[F], 613734[F], 613735[F], 613737[F], 613742[F] Acot9 613736[F], 613738[F], 613739[F], 613740[F], 613741 [F], 613743]- (56360) 17], 47252[-3203], 613744[-4267]
640530[F], 699914[F], 699916[F], 699917[F], 699918[F], 699920[F], 640529[F], 699915[F], 699919[F], 699923[F], 699924[F],
699921 [F], 699922[F], 699925[F], 640532[218], 640528[-449], 640531[218], 699926[-289], 640527[-449], 699913[-546], 31297[F], ACOX1 699912[-832], 699911[-937], 31298[F], 144124[F], 144126[F], 144125[F], 144129[F], 144130[F], 144131[F], 144132[F], 144133[F], (51) & 144127[F], 144128[F], 144136[F], 144137[F], 144138[F], 144140[F], 144134[F], 144135[F], 144139[F], 144141[F], 144142[F], 144146[F], Acoxl 144143[F], 144144[F], 144145[F], 144147[F], 144148[F], 31300(192], 31299[192], 144149[-255], 144150[-1251], 144151[-1422], 144152]- (11430) 31296[-3708(, 144122[-4094], 144121[-4211] 2836], 31295[-3708], 144123[-3807], 144153]-4356]
643539[F], 722158[F], 722159[F], 722161[F], 722162[F], 643537]-
ACOX2 2774], 722156[-3041], 722155[-3770], 722154[-3857], 35607[F],
643538[F], 722157[F], 722160[F], 35606[F], 198918[F], 198920[F], (8309) & 198915[F], 198916[F], 198917[F], 198919[F], 198921 [F], 198922[F],
198925[F] Acox2 198923[F], 198924[F], 198926[F], 198927[F], 35605[-1939], 198914]- (93732) 2195], 198913[-2904], 198912[-2991]
626227[F], 835238[F], 835239[F], 835240[F], 835241 [F], 835243[F],
ACOX3 835244[F], 835245[F], 835246[F], 835248[F], 835249[F], 835250[F], 626228[F], 835242[F], 835247[F], 626226[-79], 12564[F], 438795[F]
(8310) &
835251[F], 6262251-79], 12563[F], 438791[F], 438792[F], 438793[F], 438796[F], 438797[F], 438799[F], 438800[F], 438804[F], 438809[F],
Acox3
438794[F], 438798[F], 438801[F], 438802[F], 438803[F], 438805[F], 438810[F], 12562(5705], 438790[-213]
(80911) 438806[F], 438807[F], 438808[F], 12561(5705]
620580[F], 794568[F], 794569[F], 794570[F], 794571 [F], 794572[F],
620581[F], 794573[F], 794575[F], 794578[F], 794582[F], 794583[F], 794574[F], 794576[F], 794577[F], 794579[F], 794580[F], 794581 [F],
794584[F], 794585[F], 794592[F], 794593[F], 794595[F], 794598[F], 794586[F], 794587[F], 794588[F], 794589[F], 794590[F], 794591 [F],
794599[F], 794602[F], 620582(1457], 620584[-2689], 794603]- 794594[F], 794596[F], 794597[F], 794600[F], 794601 [F], 620583]- 2910], 5181[F], 348704[F], 348709[F], 348710]F], 348711[F],
2689], 5180[F], 348705[F], 348706[F], 348707[F], 348708[F], ACOXL
348714[F], 348718[F], 348722[F], 348723[F], 348725[F], 348726[F], 348712[F], 348713[F], 348715[F], 348716[F], 348717[F], 348719[F], (55289) &
348727[F], 348728[F], 348729[F], 348731 [F], 348733[F], 348735[F], 348720[F], 348721[F], 348724[F], 348730[F], 348732[F], 348734[F], A∞xl
348741[F], 348742[F], 348743[F], 348744[F], 348745[F], 348747[F], 348736[F], 348737[F], 348738[F], 348739[F], 348740[F], 348746[F], (74121)
348755[F], 348756[F], 348759[F], 348761 [F], 348762[F], 348764[F], 348748[F], 348749[F], 348750[F], 348751 [F], 348752[F], 348753[F],
348766[F], 348767[F], 348769[F], 348771 [F], 348774[F], 348775[F], 348754[F], 348757[F], 348758[F], 348760[F], 348763[F], 348765[F],
348779[F], 348780[F], 348782[F], 348783[F], 348785[F], 348786[F], 348768[F], 348770[F], 348772[F], 348773[F], 348776[F], 348777[F],
348787[F], 5182[1663], 5184[-2143], 348788[-2304], 348703[-3420] 348778[F], 348781[F], 348784[F], 5183[-2143] TABLE 2 - Page 18 of 1873
621921[F], 640979[F], 703167[F], 703168[F], 703169[F], 703170[F], 640978[F], 703171[F], 703176[F], 703177[F], 703178[F], 802463[F], 703172[F], 703173[F], 703174[F], 703175[F], 802462[F], 802464[F], 802465[F], 876271[F], 928956(1917], 703166[-83], 640980[-800],
802466[F], 802467[F], 802468[F], 802469[F], 876269[F], 876270[F], 7031791-851], 640977[-1275], 703180[-2516], 703165[-2651],
ACP1 (52) 876272[F], 621921[617], 802462(197], 640981[-800], 703174H410], 7031641-3467], 802463[-4566], 876271 [-4896], 703171 [-4898],
& Acp1 8762701-4547], 703173[-4549], 802464[-4879], 703172[-4881], 802465[-4902], 31963[F], 153290[F], 153296[F], 153306[F],
(11431) 31964[F], 153291[F], 153292[F], 153293[F], 153294[F], 153295[F], 153307[F], 153308[F], 153309[F], 153311[F], 31962(530], 31965[- 153297[F], 153298[F], 153299[F], 153300[F], 153301 [F], 153302[F], 54], 153312[-586], 153289[-749], 153313[-988], 153288[-1497],
153303[F], 153304[F], 153305[F], 153310[F], 31966[-54] 153314[-2114]
790656[F], 790657[F], 790658[F], 790659[F], 790660[F], 790661 [F],
790662[F], 620027(9516], 620025[16], 620028[-83], 790658[-714],
790659[-832], 790663[-1439], 790660[-2689], 790661 [-2846], 620026(16], 916239[-83], 790664[-4455], 790666[-4639], ACP2 (53) 790665[-4434], 4527[F], 341132[F], 341133[F], 341134[F], 4529(2521], 4526[-76], 341131[-1568], 341144[-3042], 341146[- & Acp2 341135[F], 341136[F], 341137[F], 341138[F], 341139[F], 341140[F], 3218], 341147[-4732] (11432) 341141[F], 4528(2521], 4525[-76], 341142[-933], 341143[-1512],
341145Γ-30211
634490[F], 894576[F], 894577[F], 894578[F], 931716[2501],
ACP5 (54) 894578[-747], 23802[F], 23803[F], 569127[F], 569128[F], 569129[F]
& Acp5 569130[F], 569126[-122], 569129[-755], 569130[-2081], 569125[- (11433) 4076]
622717[F], 808702[F], 808703[F], 808704[F], 808705[F], 808706[F],
808707[F], 808708[F], 808709[F], 808710[F], 808711 [F], 808712[F],
808713[F], 808714[F], 808715[F], 808716[F], 808717[F], 808718[F],
ACP6 808719[F], 808720[F], 808721[F], 808722[33], 7968[F], 379803[F],
(51205) & 379804[F], 379805[F], 379806[F], 379807[F], 379808[F], 379809[F],
Acp6 379810[F], 379811[F], 379812[F], 379813[F], 379814[F], 379815[F],
(66659) 379816[F], 379817[F], 379818[F], 379819[F], 379820[F], 379821[F],
379822[F], 379823[F], 379824[F], 379825[F], 379826[F], 379827[F],
379828[F], 379829[F], 379830[-57]
635701 [F], 903664[F], 903667[F], 903668[F], 903671 [F], 903672[F],
903673[F], 903674[F], 903675[F], 903676[F], 903679[F], 903680[-
635700[F], 903665[F], 903666[F], 903669[F], 903670[F], 903677[F], ACPL2 1469], 903681 [-1583], 25307[F], 586277[F], 586282[F], 586283[F],
903678[F], 25306[F], 586278[F], 586279[F], 586280[F], 586281 [F], (92370) & 586287[F], 586289[F], 586291[F], 586292[F], 586293[F], 586294[F],
586284[F], 586285[F], 586286[F], 586288[F], 586290[F], 586295[F], Acpl2 586297[F], 586298[F], 586299[F], 586302[F], 586303[F], 586304[F],
586296[F], 586300[F], 586301[F], 586308[F], 586310[F] (235534) 586305[F], 586306[F], 586307[F], 586309[F], 586311 [F], 586276[- 585], 586312[-1222], 586313[-1317]
904655[F], 904656[F], 904658[F], 904659[F], 904661 [F], 904665[F], 904654[F], 904657[F], 904660[F], 904662[F], 904663[F], 904664[F],
ACPP (55) 635823(50916], 904653[-5], 904656[-874], 904655[-3886], 25460[F], 635822(50916], 904657[-819], 25459[F], 588246[F], 588248[F],
& Acpp 588245[F], 588247[F], 588250[F], 588251 [F], 588253[F], 588254[F], 588249[F], 588252[F], 588255[F], 588256[F], 588258[F], 588259[F],
(56318) 588257[F], 588263[F], 588251[-193], 588250[-1824] 588260[F], 588261[F], 588262[F], 588252[-131], 588249[-2755]
630729[-2479], 868122[-3331], 868121 [-3470], 868120[-3717],
ACPT
868119[-4136], 18889[F], 511668[-1166], 511666[-2057], 511665[-
630731[F], 868125[F], 630730[-2479], 868123[-3244], 18890[F], (93650) &
2199], 511664[-2445], 511663[-3069], 511670[-3463], 511661 [- 18891[F], 511669[F], 511667[-1945], 511662[-3438], 511671[-3648] Acpt
3478], 511660[-3785], 511659[-3930], 511658[-4265], 511657[- (546967) 49191
645961[F], 740900[F], 923059[-2514], 740899[-4514], 38918[F], ACR (49) &
645960[F], 740901[F], 38917[F], 38928[F], 239456[F], 239454[-2824]
38929[F], 239455[F], 239453[-4989; Acr
629481[F], 860818[F], 860821[F], 860822[F], 860824[F], 860826[F], 629483[-1944], 860827[-2551], 860817[-3351], 860816[-3793], ACRBP
629480[F], 860819[F], 860820[F], 860823[F], 860825[F], 629482[- 860815[-4892], 16850[F], 494455[F], 494458[F], 494460[F], (84519) & 1944], 16849[F], 494456[F], 494457[F], 494459[F], 494463[F],
494461[F], 494462[F], 494465[F], 494467[F], 16848[-72], 494454[- Acrbp 494464[F], 494466[F], 494459[-1528], 16851[-4653]
1105], 494453[-1532], 494452[-2022], 494460[-3292], 494451 [- (54137) 4474], 16852[-4653], 494468[-4995]
651750[-2130], 912330 [-2180], 912329[-2288], 912328[-3029],
ACRC
912326[-3321], 912324 [-3547], 912323[-3823], 912322[-3926], 651751 [-2130], 912327[-3266], 912325[-3423], 912321[-3968]
(93953) 912320[-4121], 912319[-432r
ACRV1
634650[F], 24012[-29] 634651 [F], 24013[-29]
(56) &
635051[F], 898138[F], 898140[F], 898142[F], 898145[F], 635049[-
635052[F], 760290[F], 898136[F], 898137[F], 898139[F], 898141[F]
302], 898134[-1239], 898133[-1398], 898132[-1487], 898131[-1609], 898143[F], 898144[F], 898146[F], 898147[20], 635050[-302], 898135| ACSBG1
898130[-1732], 898129[-1803], 898128[-4551], 24476[F], 575754[F], 818], 24477[F], 575751[F], 575752[F], 575753[F], 575756[F], (23205) &
575755[F], 575757[F], 575758[F], 575761 [F], 575764[F], 575768[F], 575759[F], 575760[F], 575762[F], 575763[F], 575765[F], 575766[F] Acsbg 1
575769[F], 575770[F], 24474[-332], 575749[-1057], 575748[-1200], 575767[F], 575771[F], 575772[F], 24475[-332], 575750[-758], (94180)
575747[-1286], 575746[-1407], 575745[-1527], 575744[-1588],
575742[-2298]
575743[-2195], 575741 [-3791]
ACSBG2
648530[F], 929870[-4279], 42341[F], 280791[F], 280793[F], 648529[F], 760287[F], 760288[F], 42340[F], 280790[F], 280792[F],
(81616) & 280794[F], 280797[F], 280800[F], 280802[F], 280805[F], 42343[- 280795[F], 280796[F], 280798[F], 280799[F], 280801 [F], 280803[F],
Acsbg2 1028] 280804[F], 280806[F], 42342[-1028], 280807[-2986]
(328845) TABLE 2 - Page 19 of 1873
639762[F], 695365[F], 695366[F], 695367[F], 695368[F], 695372[F], 639761[F], 639763[F], 695369[F], 695370[F], 695371 [F], 695373[F], 695374[F], 695375[F], 695376[F], 738308[F], 805066[F], 622122[14166], 639764[440], 695378[-1232], 639759[-3989], ACSF2 622121[14166], 639765[440], 695377[-671], 639760[-3989], 30435[F], 30437[F], 136222[F], 136223[F], 136228[F], 136229[F], (80221) & 30436[F], 136224[F], 136225[F], 136226[F], 136227[F], 136232[F], 136230[F], 136231[F], 136233[F], 136237[F], 136238[F], 136240[F], Acsf2 136234[F], 136235[F], 136236[F], 136239[F], 136244[F], 136245[F], 136241[F], 136242[F], 136243[F], 136247[F], 30438(323], 136249[- (264895) 136246[F], 30439[323], 136248[-743] 1257]
634126[F], 892367[F], 892370[F], 23290[F], 563553[F], 563554[F],
ACSF3 563555[F], 563558[F], 563559[F], 563561 [F], 563562[F], 563563[F], 634127[F], 892368[F], 892369[F], 892371[F], 892372[F], 23291[F],
(197322) & 563564[F], 563566[F], 563567[F], 563568[F], 563569[F], 563570[F], 563556[F], 563557[F], 563560[F], 563565[F], 563572[F], 563577[F],
Acsf3 563571 [F], 563573[F], 563574[F], 563575[F], 563576[F], 563580[F], 563578[F], 563579[F], 563582[F]
(257633) 563581 [F]
632961[F], 883162[F], 883163[F] 883164[F], 883165[F], 883167[F],
883168[F], 883169[F], 883170[F] 883171[F], 883172[F], 883174[F],
883176[F], 883178[F], 883179[F] 883182[F], 883184[F], 883185[F],
883186[F], 883187[F], 883188[F] 883189[F], 883190[F], 883192[F],
883193[F], 883194[F], 883195[F] 883196[F], 883197[F], 883199[F],
883200[F], 883201[F], 883202[F] 883203[F], 883204[F], 883205[F], 632962[F], 883166[F], 883173[F], 883175[F], 883177[F], 883180[F], ACSL1 21818[F], 544034[F], 544035[F], 544036[F], 544037[F], 544038[F], 883181[F], 883183[F], 883191[F], 883198[F], 21819[F], 544044[F], (2180) & 544039[F], 544040[F], 544041[F] 544042[F], 544043[F], 544045[F], 544050[F], 544053[F], 544055[F], 544057[F], 544060[F], 544061 [F], Acsl1 544046[F], 544047[F], 544048[F] 544049[F], 544051 [F], 544052[F], 544063[F], 544065[F], 544077[F], 544078[F], 544085[F] (14081) 544054[F], 544056[F], 544058[F] 544059[F], 544062[F], 544064[F],
544066[F], 544067[F], 544068[F] 544069[F], 544070[F], 544071 [F],
544072[F], 544073[F], 544074[F] 544075[F], 544076[F], 544079[F],
544080[F], 544081[F], 544082[F] 544083[F], 544084[F], 544086[F],
544087[F], 544088[F], 544089[F] 544090[F], 544091 [F], 544092[F]
617295[F], 658740[F], 658742[F], 658743[F], 658744[F], 658745[F],
658746[F], 658747[F], 658748[F], 658749[F], 658757[F], 658758[F],
658760[F], 658761[F], 658762[F], 658763[F], 658764[F], 658765[F],
658766[F], 658767[F], 658768[F], 658769[F], 658770[F], 658771 [F],
658772[F], 658773[F], 658775[F], 658778[F], 658779[F], 658780[F],
1108[F], 61112[F], 611 14[F], 61115[F], 61116[F], 61117[F], 61118[F], 617296[F], 658741[F], 658759[F], 658774[F], 658776[F], 658777[F],
ACSL3 61119[F], 61120[F], 61 122[F], 61124[F], 61125[F], 61126[F], 1109[F], 61113[F], 61121[F], 61123[F], 61127[F], 61133[F],
(2181) & 61128[F], 61129[F], 61130[F], 61131[F], 61132[F], 61134[F], 61135[F], 61137[F], 61142[F], 61143[F], 61144[F], 61150[F],
Acsl3 61136[F], 61138[F], 61139[F], 61140[F], 61141[F], 61145[F], 61151[F], 61161[F], 61166[F], 61171[F], 61173[F], 61180[F],
(74205) 61146[F], 61147[F], 61148[F], 61149[F], 61152[F], 61153[F], 61182[F], 61183[F], 61185[F], 61186[F]
61154[F], 61155[F], 61156[F], 61157[F], 61158[F], 61159[F],
61160[F], 61162[F], 61163[F], 61164[F], 61165[F], 61167[F],
61168[F], 61169[F], 61170[F], 61172[F], 61174[F], 61175[F],
61176[F], 61177[F], 61178[F], 61179[F], 61181[F], 61184[F],
61187[F], 61188[F], 61189[F], 61190[F]
914292[F], 914293[F], 914295[F], 914296[F] 914297[F], 914298[F],
914299[F], 914300[F], 914301[F], 914302[F] 914303[F], 914304[F],
914305[F], 914306[F], 914307[F], 914308[F] 914309[F], 914311[F],
914312[F], 914313[F], 914314[F], 914315[F] 914316[F], 914317[F],
914318[F], 914319[F], 914320[F], 914321[F] 652034(92000],
ACSL4 47079[F], 611821[F], 611822[F], 611824[F], 611825[F], 611826(F], 914294[F], 914310[F], 652033(92000], 47078[F], 611823[F],
(2182) & 611827[F], 611828[F], 611829[F], 611830[F] 611832[F], 611833[F], 611831[F], 611838[F], 611841[F], 611846[F], 611849[F], 611858[F],
Acsl4 611834[F], 611835[F], 611836[F], 611837[F] 611839[F], 611840[F], 611860[F], 611862[F], 611866[F], 611871[F], 611872[F]
(50790) 611842[F], 611843[F], 611844[F], 611845[F] 611847[F], 611848[F],
611850[F], 611851[F], 611852[F], 611853[F] 611854[F], 611855[F],
611856[F], 611857[F], 611859[F], 611861[F] 611863[F], 611864[F],
611865[F], 611867[F], 611868[F], 611869[F] 611870[F], 611873[F],
611874[F]
650974[F], 779949[F], 779950[F], 779951 [F], 779952[F], 779953[F],
650975[F], 779957[F], 779958[F], 779959[F], 779960[F], 779961 [F], 779954[F], 779955[F], 779956[F], 779962[F], 779963[F], 779964[F],
779966[F], 779967[F], 779969[F], 779971 [F], 779974[F],
779965[F], 779968[F], 779970[F], 779972[F], 779973[F], 779975[F],
650977(29612], 779977[-2005], 779978[-2554], 779979[-2784],
779976[F], 650976(29612], 779953[-170], 779952[-331], 779951]- ACSL5
779980[-3691], 45385[F], 320118[F], 320120[F], 320121 [F],
466], 779950[-552], 779949[-930], 45384[F], 320113[F], 320114[F], (51703) &
320122[F], 320123[F], 320124[F], 320131[F], 320132[F], 320134[F], 320115[F], 320116[F], 320117[F], 320119[F], 320125[F], 320126[F], Acsl5
320137[F], 320139[F], 320142[F], 45387(25339], 320145[-745],
320127[F], 320128[F], 320129[F], 320130[F], 320133[F], 320135[F], (433256)
320146[-1769], 320147[-2287], 320148[-2499], 320149[-3138],
320136[F], 320138[F], 320140[F], 320141[F], 320143[F], 320144[F],
320150[-3487], 320151[-3692], 320152[-3821], 320153[-4348],
45386(25339], 320112(36], 320111( 60], 320110( 1249], 320155]- 320154[-4541]
4829] TABLE 2 - Page 20 of 1873
638721 [F], 638723[F], 687762[F], 687763[F] 687764[F], 687765[F],
687766[F], 687767[F], 687768[F], 687770[F] 687772[F], 687777[F],
638722[F], 638724[F], 687759[F], 687760[F], 687761 [F], 687769[F], 687779[F], 687781[F], 687782[F], 687784[F] 687785[F], 687786[F],
687771 [F], 687773[F], 687774[F], 687775[F], 687776[F], 687778[F], 687788[F], 687789[F], 29211[F], 29213[F], 122585[F], 122586[F], ACSL6
687780[F], 687783[F], 687787[F], 29212[F], 29214[F], 122582[F], 122587[F], 122588[F], 122589[F], 122590[F] 122591 [F], 122592[F], (23305) &
122583[F], 122584[F], 122594[F], 122596[F], 122597[F], 122599[F], 122593[F], 122595[F], 122598[F], 122605[F] 122606[F], 122608[F], Acsl6
122600[F], 122601[F], 122602[F], 122603[F], 122604[F], 122607[F], 122609[F], 122610[F], 122611[F], 122614[F] 122615[F], 122616[F], (216739)
122612[F], 122613[F], 122617[F], 122618[F], 122619[F], 122628[F], 122620[F], 122621[F], 122622[F], 122623[F] 122624[F], 122625[F],
122629[F]
122626[F], 122627[F], 122630[F], 122631 [-121], 122590[-1366],
122632[-2541], 122589[-4487]
631825[F], 875834[F], 875835[F], 875836[F], 922559(1975], 875830[-631826[F], 875831[F], 875832[F], 875833[F], 875837[F] ACSM1 25], 20302[F], 527585[F], 527586[F], 527589[F], 527594[F], 922560(2008], 875838(8], 20303[F], 527587[F], 527588[F], (116285) & 527595[F], 527596[F], 527598[F], 527599[F], 527600[F], 527601 [F] 527590[F], 527591[F], 527592[F], 527593[F], 527597[F], 527602[F], Acsml 20304(24635] 20305(24635], 527603[12], 527584[-486] (1 17147)
631824[F], 875825[F], 875826[F], 875827[F], 925065[-568], 925066|
ACSM2A 836], 875828[-2568], 875829[-2836], 20301 [F], 527568[F],
631823[F], 875824[F], 20300[F], 527569[F], 527571 [F], 527573[F], (123876) &
527570[F], 527572[F], 527574[F], 527575[F], 527576[F], 527577[F], 527583[0], 527569[-4430] Acsm2
527578[F], 527579[F], 527580[F], 527581 [F], 527582[F], 527570[- (233799) 3357]
631835[F], 875862[F], 875865[F], 631837(21407], 875867[-835],
631834[F], 875861[F], 875863[F], 875864[F], 875866[F], ACSM3
8758691-1710], 875870[-2056], 875871 [-3239], 875865[-4679],
631836(21407], 875868[-1469], 20314[F], 527644[F], 527645[F], (6296) &
20315[F], 527646[F], 527648[F], 527650[F], 527651 [F], 527654[F], 527647[F], 527649[F], 527652[F], 527653[F], 527655[F], 527657[F], Acsm3
527656[F], 20317(16219], 527658[-582], 527660[-1454], 527661[- 20316(16219], 527659[-1213] (20216)
1791], 527662[-2932]
20308[-525], 527608[-949], 527609[-1127], 527610[-1190], 527611[
ACSM4
631827[F], 926816(1465], 875839[-535], 20306[F], 527604[F], 1441], 527613[-1632], 527614[-1853], 527615[-1994], 527616[- (341392) & 527605[F], 527606[F], 527607[F], 20307[-525], 527612[-1523], 2132], 527617[-2236], 527618[-2382], 527619[-2939], 527620[- Acsm4 527621 [-3629] 3533], 527622[-4224], 527623[-4383], 527624[-4547], 527625[- (233801 ) 4959]
ACSM5
631822[F], 875818[F], 875819[F], 875821 [F], 875823[F], 631820[-
631821 [F], 875820[F], 875822[F], 631819[-4743], 20298[F], (54988) &
4743], 20299[F], 527557[F], 527558[F], 527559[F], 527560[F],
527562[F], 527563[F], 527565[F], 527567[F], 20296[-2728] Acsm5
527561[F], 527564[F], 527566[F], 20297[-2728], 527556[-4916]
(272428)
620872[F], 796819[F], 796820[F], 796821 [F], 796822[F], 796823[F],
796824[F], 796825[F], 796826[F], 796827[F], 796829[F], 796830[F],
796831 [F], 796832[F], 5544[F], 353581[F], 353582[F], 353583[F], 620871[F], 796828[F], 796833[F], 796834[F], 620873[1629], ACSS1 353584[F], 353585[F], 353587[F], 353589[F], 353590[F], 353591 [F], 5543[F], 353579[F], 353580[F], 353586[F], 353588[F], 353594[F], (84532) & 353592[F], 353593[F], 353595[F], 353596[F], 353597[F], 353598[F], 353599[F], 353603[F], 353605[F], 353609[F], 353616[F], 353617[F], Acssl 353600[F], 353601[F], 353602[F], 353604[F], 353606[F], 353607[F], 353619[F], 5545[748] (68738) 353608[F], 353610[F], 353611[F], 353612[F], 353613[F], 353614[F],
353615[F], 353618[F]
621045[F], 621047[F], 797874[F], 797875[F], 797876[F], 797877[F],
797879[F], 797880[F], 797881[F], 797882[F], 797883[F], 797885[F],
621046[F], 621048[F], 797878[F], 79788 4 [F], 797887[F], 797888[F], 797886[F], 797889[F], 797890[F], 797891 [F], 621045(51501],
621046[51501], 621044[1815], 621050[-457], 797873[-2793], ACSS2 621043(1815], 797892[-10], 621049[-457], 9162 4 7[-466], 797874[-
797894[- 4 755], 5751 [F], 5753[F], 355617[F], 355618[F], 355619[F], (55902) & 551], 797893[-3377], 5750[F], 5752[F], 355615[F], 355616[F],
355620[F], 355622[F], 355626[F], 355627[F], 355629[F], 355630[F], Acss2 355621 [F], 355623[F], 355624[F], 355625[F], 355628[F], 355633[F],
355631[F], 355632[F], 355637[F], 355638[F], 355642[F], 355643[F], (60525) 355634[F], 355635[F], 355636[F], 355639[F], 355640[F], 355641 [F],
5749[196], 5755[-432], 355649[-2734], 355613[-3911]
355644[F], 355645[F], 355646[F], 5748[196], 355647[-10], 5754[- 432], 355614[-575], 355648[-2486], 355650[-2740], 355651 [-4067]
637658[F], 679697[F], 679698[F], 679704[F], 637655[-2462], 637656[F], 637657[F], 679705[F], 637654[-2462], 27866[F],
27868[F], 106441 [F], 106444[F], 106445[F], 106447[F], 106448[F], 27867[F], 106437[F], 106438[F], 106439[F], 106440[F], 106442[F], ACSS3 106449[F], 106451[F], 106452[F], 106455[F], 106456[F], 106457[F], 106443[F], 106446[F], 106450[F], 106453[F], 106454[F], 106458[F], (79611 ) & 106459[F], 106462[F], 106464[F], 106465[F], 106466[F], 106467[F], 106460[F], 106461[F], 106463[F], 106468[F], 106469[F], 106470[F], Acss3 106475[F], 106476[F], 106477[F], 106478[F], 106479[F], 106471[F], 106472[F], 106473[F], 106474[F], 106480[F], (380660) 27868(158584], 27861 [-2694] 27867(158584], 27860[-2694]
634171 [F], 892614[F], 892615[F], 23354[F], 564197[F], 564198[F], ACTA1
634172[F], 892613[F], 892616[F], 23355[F], 564196[F], 564199[F]
564200[F], 23356[-2385] (58) &
650582[F], 650582[17956], 650584[860], 44919[F], 314183[F], ACTA2
650583[860], 44917[-756], 314181 [-4568]
44918[-756], 314182[-3493 (59) & TABLE 2 - Page 21 of 1873
627808[F], 734070[F], 734071[F], 734072[F], 734073[F], 734074[F],
748305[F], 748307[F], 748310[F], 748311[F], 748312[F], 748313[F],
748314[F], 748316[F], 802770[F], 802771 [F], 803061 [F], 803062[F],
627807[F], 748303[F], 748304[F], 748306[F], 748308[F], 748309[F], 846172[F], 846173[F], 846176[F], 846178[F], 846179[F], 846180[F],
748315[F], 846174[F], 846175[F], 846177[F], 846183[F], 846185[F], ACTB (60) 846181[F], 846182[F], 846184[F], 846186[F], 846188[F], 846190[F],
846187[F], 846189[F], 846191 [F], 846193[F], 846194[F], 915025[F], & Actb 846192[F], 846195[F], 846196[F], 915020[F], 915021 [F], 915022[F],
915030[F], 14685[F], 463647[F], 463648[F], 463650[F], 463656[F], (11461) 915023[F], 915024[F], 915026[F], 915027[F], 915028[F], 915029[F],
463658[F], 463660[F], 463662[F], 463664[F], 463666[F], 463667[F] 14686[F], 463645[F], 463646[F], 463649[F], 463651 [F], 463652[F],
463653[F], 463654[F], 463655[F], 463657[F], 463659[F], 463661 [F],
463663[F], 463665[F], 463668[F], 463669[F]
ACTC1
620290[F], 792650[F], 792651[F], 620292(5503], 4851 [F], 4853[F], 620289[F], 792652[F], 620291(5503], 792653[-1040], 792654[- (70) & 345082[F], 3450841-407], 345081 [-1809], 345088[-3167], 345079[- 1869], 792655[-4382], 4850[F], 4852[F], 345083[F], 345085[-1227],
Add 4450] 3450861-2003], 345087[-2610], 345080[-3411]
(11464)
634694[F], 638234[F], 651372[F],, 683842[F], 683843[F], 683844[F],
683845[F], 683846[F], 683848[F],, 700839[F], 700840[F], 700842[F],
700843[F], 700844[F], 700845[F],, 700846[F], 700848[F], 700849[F],
700850[F], 700852[F], 700853[F],, 700854[F], 700856[F], 718499[F],
718500[F], 718502[F], 718503[F],, 718504[F], 718505[F], 718506[F],
718507[F], 718508[F], 718509[F],, 718510[F], 718511 [F], 750427[F],
750428[F], 750429[F], 750430[F],, 750431 [F], 750432[F], 750433[F],
750434[F], 750435[F], 750436[F],, 760584[F], 760586[F], 760587[F],
760588[F], 760589[F], 821181[F],, 821182[F], 821183[F], 821184[F], 634695[F], 638233[F], 683847[F], 683849[F], 700841 [F], 700847[F], 821185[F], 821186[F], 821187[F],, 821188[F], 821189[F], 821190[F], 700851[F], 700855[F], 700857[F], 700858[F], 718501 [F], 760585[F], ACTG1 861786[F], 861787[F], 861788[F],, 861789[F], 861790[F], 861791 [F], 864243[F], 864247[F], 896145[F], 896149[F], 629970(2372], (71) & 861792[F], 861793[F], 861794[F],, 861795[F], 861796[F], 864234[F], 31431[F], 146100[F], 146101[F], 146107[F], 146111[F], 146113[F], Actgl 864235[F], 864236[F], 864237[F],, 864238[F], 864239[F], 864240[F], 146116[F], 146118[F], 146119[F], 146097[-634], 146096[-702], (11465) 864241 [F], 864242[F], 864244[F],, 864245[F], 864246[F], 883149[F], 146121[-2812], 146095[-4484], 146094[-4554]
883150[F], 883151[F], 883152[F],, 883153[F], 883154[F], 883155[F],
883156[F], 883157[F], 896144[F],, 896146[F], 896147[F], 896148[F],
896150[F], 896151[F], 896152[F],, 896153[F], 909961 [F], 909962[F],
909963[F], 909964[F], 909965[F],, 629971(2372], 632956(2367],
6406541-120], 700859[-2010], 31' 432[F], 146098[F], 146099[F],
146102[F], 146103[F], 146104[F],, 146105[F], 146106[F], 146108[F],
146109[F], 146110[F], 146112[F],, 146114[F], 146115[F], 146117[F],
31449[-192], 146120[-1713], 146' 122[-3771]
ACTG2
628876[F], 855078[F], 855079[F], 855080[F], 855081 [F] 628875[F], 855082[F], 855083[F], 855084[F], 855085[F], 855086[F]
(72)
788199[F], 803171[F], 803172[F], 803174[F], 803175[F], 803176[F],
803177[F], 803178[F], 803179[F], 803181[F], 803182[F], 803183[F],
803173[F], 803180[F], 803184[F], 621797(25484], 621798(1731], ACTL6A 803185[F], 803186[F], 621796(25484], 803169[-2217], 6775[F],
803187[-487], 803188[-561], 803170[-1265], 6776[F], 368493[F], (86) & 368488[F], 368489[F], 368490[F], 368491 [F], 368492[F], 368494[F],
368501[F], 368505[F], 6777[1571], 368510[-643], 368511[-717], Actl6a 368495[F], 368496[F], 368497[F], 368498[F], 368499[F], 368500[F],
368487[-939], 368512[-3605] (56456) 368502[F], 368503[F], 368504[F], 368506[F], 368507[F], 368508[F],
368509[F], 368486[-1437]
ACTL6B
627661[F], 845507[F], 627663[-1552], 14492[F], 461858[F], 627662[F], 845506[F], 627664[-1552], 14493[F], 461857[F], (51412) & 461860[F], 144941-265], 461862[-4412] 461859[F], 144951-265], 461861[-3432] Actl6b
(83766) ACTL7A (10881 ) &
624105[-4549], 9735[-4753]
Actl7a (11470)
647206[F], 922291[-811], 922290[-2509], 828738[-2811], 828737[- ACTL8
828740[F], 922293[F], 922292[-586], 828739[-2586]
4509] (81569) TABLE 2 - Page 22 of 1873
706948[F] , 706949[F], 706950[F] 706951 [F] 706952[F], 706953[F],
706956[F] , 706957[F], 706958[F] 706959[F] 706961 [F], 706962[F],
706964[F] , 706965[F], 706966[F] 706968[F] 706969[F], 706970[F],
706971 [F] , 706972[F], 706973[F] 706974[F] 706975[F], 706977[F],
706979[F] , 706980[F], 706981 [F] 706984[F] 706985[F], 706987[F],
706988[F] , 706989[F], 706990[F] 706993[F] 706997[F], 707000[F],
641495[F], 706954[F], 706955[F], 706960[F], 706963[F], 706967[F], 707001 [F] , 707003[F], 707004[F] 707005[F] 707006[F], 707007[F],
706976[F], 706978[F], 706982[F], 706983[F], 706986[F], 706991 [F], 707008[F] , 707009[F], 707010[F] 903187[F] 641494(105219],
706992[F], 706994[F], 706995[F], 706996[F], 706998[F], 706999[F], ACTN1 32609[F], 161486[F], ■ 61487[F], 61488[F] 161489[F], 161490[F],
707002[F], 641493(105219], 32608[F], 32610[F], 161492[F], (87) & 161491 [F] , 161494[F], 161495[F] 161496[F] 161497[F], 161499[F],
161493[F], 161498[F], 161502[F], 161508[F], 161516[F], 161519[F], Actnl 161500[F] , 161501[F], 161503[F] 161504[F] 161505[F], 161506[F],
161521[F], 161525[F], 161529[F], 161530[F], 161534[F], 161540[F], (10971 1 ) 161507[F] , 161509[F], 161510[F] 161511 [F] 161512[F], 161513[F],
161541[F], 161543[F], 161544[F], 161546[F], 161547[F], 161548[F], 161514[F] , 161515[F], 161517[F] 161518[F] 161520[F], 161522[F],
161551[F], 161552[F], 161557[F], 161561 [F]
161523[F] , 161524[F], 161526[F] 161527[F] 161528[F], 161531 [F],
161532[F] , 161533[F], 161535[F] 161536[F] 161537[F], 161538[F],
161539[F] , 161542[F], 161545[F] 161549[F] 161550[F], 161553[F],
161554[F] , 161555[F], 161556[F] 161558[F] 161559[F], 161560[F],
161562[F] , 161563[F], 161564[F] 161565[F] 161566[F], 161567[F],
161568[F] 161485[-372], 161484[-1237]
642137[F], 712637[F], 712639[F], 712640[F], 712641 [F], 712644[F],
712645[F], 712646[F], 712649[F], 712650[F], 712651 [F], 712652[F], 642136[F], 712638[F] 712642[F], 712643[F], 712647[F], 712648[F],
ACTN2
712653[F], 33463[F], 173691[F], 173692[F], 173693[F], 173697[F], 712654[F], 712655[F] 33462[F], 173694[F], 173695[F], 173696[F],
(88) &
173698[F], 173699[F], 173700[F], 173702[F], 173703[F], 173707[F], 173701[F], 173704[F] 173705[F], 173706[F], 173712[F], 173714[F],
Actn2
173708[F], 173709[F], 173710[F], 173711 [F], 173713[F], 173715[F], 173716[F], 173717[F] 173720[F], 173721 [F], 173722[F], 173725[F],
(11472)
173718[F], 173719[F], 173723[F], 173724[F], 173728[F], 173729[F], 173726[F], 173727[F] 173730[F], 173733[F]
173731 [F], 173732[F]
650018[F], 772507[F], 772508[F], 772509[F], 772510[F], 772511 [F], 650019[-834], 772514[-1270], 772515[-1436], 772516[-1502], ACTN3 772512[F], 928396(1981], 772513[-19], 650017[-135], 44236[F], 772517[-2967], 772518[-3896], 44237[-782], 306464[-1229], (89) & 306455[F], 306456[F], 306457[F], 306458[F], 306459[F], 306460[F], 3064651-1363], 306466[-1455], 306467[-1537], 306468[-2324], Actn3 306461 [F], 306462[F], 306463[-12], 44235[-303] 3064691-3245], 306470[-4692], 306471 [-4782], 306472[-4925] (11474)
, 672268[F] 672269[F] 866618[F] 866620]F] 866621 [F]
, 866624[F] 866627[F] 866632[F] 866633[F] 866635[F]
, 866640[F] 866642[F] 866643[F] 866646[F] 866647[F]
, 866649[F] 866650[F] 866651 [F] 866652[F] 866653[F]
, 866655[F] 866656[F] 866657[F] 866658[F] 866659[F]
, 866663[F] 866664[F] 866666[F] 866667[F] 866668[F]
, 866670[F] 866672[F] 866674[F] 866675[F] 866676[F]
, 866678[F] 866679[F] 866680[F] 866681 [F] 866682[F]
, 866684[F] 866685[F] 866686[F] 866687[F] 866688[F] 630417[F], 630419[F], 866619[F], 866623[F], 866625[F], 866626[F], , 866690[F] 866691 [F] 866694[F] 866695[F] 866696[F] 866628[F], 866629[F], 866630[F], 866631 [F], 866634[F], 866636[F], , 866698[F] 866699[F] 866700[F] 866701 [F] 866702[F] 866638[F], 866639[F], 866641 [F], 866644[F], 866645[F], 866660[F], , 866704[F] 866705[F] 630416[341], 18405[F], 507701 [F], 866662[F], 866665[F], 866671 [F], 866673[F], 866692[F], 866693[F],
ACTN4 , 507704[F] 507705[F] 507707[F] 507710[F] 507716[F] 630415[341], 18404[F], 18406[F], 507702[F], 507706[F], 507708[F],
(81) & , 507719[F] 507721 [F] 507723[F] 507726[F] 507728[F] 507709[F], 507711[F], 507712[F], 507713[F], 507714[F], 507715[F],
Actn4 , 507733[F] 507734[F] 507735[F] 507736[F] 507737[F] 507718[F], 507720[F], 507722[F], 507724[F], 507725[F], 507727[F],
(60595) , 507739[F] 507741 [F] 507742[F] 507743[F] 507744[F] 507730[F], 507731[F], 507732[F], 507740[F], 507748[F], 507753[F], , 507746[F] 507747[F] 507749[F] 507750[F] 507751 [F] 507755[F], 507757[F], 507760[F], 507762[F], 507770[F], 507772[F], , 507754[F] 507756[F] 507758[F] 507759[F] 507761 [F] 507780[F], 507781[F], 507793[F], 507799[F], 507800[F], 507801 [F], , 507764[F] 507765[F] 507766[F] 507767[F] 507768[F] 18402(333], 507697[-4706]
, 507771 [F] 507773[F] 507774[F] 507775[F] 507776[F]
, 507778[F] 507779[F] 507782[F] 507783[F] 507784[F]
, 507786[F] 507787[F] 507788[F] 507789[F] 507790[F]
, 507792[F] 507794[F] 507795[F] 507796[F] 507797[F]
, 507802[F] 507803[F] 507804[F] 507805[F] 507806[F]
, 507808[F] 507809[F] 507810[F] 507811 [F] 507812[F]
, 18403[333] 507700[-1 347], 507699[-2489], 507698[-
ACTR10
641316[F], 705633[F], 705634[F], 705636[F], 705637[F], 705638[F],
641317[F], 705632[F], 705635[F], 158851 [F], 158855[F], 158856[F], (55860) & 158852[F], 158853[F], 158854[F], 158857[F], 158859[F], 158860[F],
158858[F], 32410(25197] ActrlO 158861 [F], 32409(25197]
(56444) TABLE 2 - Page 23 of 1873
650855[F], 778981[F], 778982[F], 778983[F], 778984[F], 778985[F], 778986[F], 778987[F], 650856[-1183], 650853[-2183], 778980]-
ACTR1A 2209], 778978[-3233], 778988[-4181], 778977[-4915], 45247[F],
650857[-1183], 650854[-2183], 778979[-2250], 45249[-1159], 45246] (10121 ) &
318338[F], 318339[F], 318340[F], 318341 [F], 318342[F], 318343[F], 1555], 3183361-1632], 318328[-4720] Actrla
318344[F], 452481-1159], 45245[-1555], 318337[-1577], 318335[- (54130) 2088], 318334[-3079], 318333[-3153], 318332[-3267], 318331 ]- 3375], 318345[-3573], 318330[-4175], 318329[-4380]
638271[F], 684082[F], 684083[F], 684084[F], 684085[F], 28629[F], ACTR2 115152[F], 115153[F], 115154[F], 1 15155[F], 115156[F], 115157[F], (10097) & 115158[F], 115159[F], 115160[F], 1 15161 [F], 115162[F], 115163[F], Actr2 115164[F], 115165[F] (66713)
617690[F], 662055[F], 662056[F] 662057[F], 662058[F], 662059[F],
662060[F], 662061[F], 662062[F] 662063[F], 662064[F], 662065[F],
662066[F], 662067[F], 662068[F] 662069[F], 662070[F], 662071 [F],
662072[F], 662073[F], 662074[F] 662075[F], 662076[F], 662077[F],
662078[F], 662079[F], 662080[F] 662081 [F], 662082[F], 662083[F],
662084[F], 662085[F], 1668[F], 69101[F], 69102[F], 69103[F],
ACTR3 69104[F], 69105[F], 69106[F], 69107[F], 69108[F], 69109[F],
(10096) & 691 10[F], 6911 1 [F], 69112[F], 69113[F], 69114[F], 691 15[F],
Actr3 691 16[F], 69117[F], 69118[F], 69119[F], 69120[F], 69121 [F],
(741 17) 69122[F], 69123[F], 69124[F], 69125[F], 69126[F], 69127[F],
69128[F], 69129[F], 69130[F], 69131 [F], 69132[F], 69133[F],
69134[F], 69135[F], 69136[F], 69137[F], 69138[F], 69139[F],
69140[F], 69141 [F], 69142[F], 69143[F], 69144[F], 69145[F],
69146[F], 69147[F], 69148[F], 69149[F], 69150[F], 69151 [F],
69152[F], 69153[F], 69154[F], 69155[F], 69156[F]
626008[F], 833684[F], 833686[F], 833687[F], 833688[F], 833690[F],
626009[F], 833685[F] 833689[F], 833692[F], 12286[F], 435333[F], 833691 [F], 833693[F], 12285[F], 435334[F], 435336[F], 435340[F], ACTR3B
435335[F], 435337[F] 435338[F], 435339[F], 435341 [F], 435343[F], 435342[F], 435344[F], 435345[F], 435350[F], 435351 [F], 435352[F], (57180) &
435346[F], 435347[F] 435348[F], 435349[F], 435357[F], 435361 [F], 435353[F], 435354[F], 435355[F], 435356[F], 435358[F], 435359[F], Actr3b
435362[F], 435363[F] 435365[F], 435366[F], 435367[F], 435369[F], 435360[F], 435364[F], 435368[F], 435370[F], 435372[F], 435373[F], (242894)
435371 [F], 435374[F] 435377[F], 435379[F], 435381 [F]
435375[F], 435376[F], 435378[F], 435380[F], 435382[-292]
ACTR3C
628505[463] 628504[463]
(653857)
637488[F], 678607[F], 678608[F], 678610[F], 678611 [F], 678612[F], ACTR6
637487[F], 678609[F], 27631[F], 103793[F], 103795[F], 27633]- 27632[F], 103791 [F], 103792[F], 103794[F], 103796[F], 103797[F], (64431 ) &
4474]
103798[F], 103799[F], 103800[F Actr6
ACTR8
643757[F], 724605[F], 643759[-1260], 643756[-2839], 35918[F],
6437581-1260], 35919[-2915] (93973) &
204266[F], 359201-2915], 35917[-3261]
Actr8
619584[F], 787207[F], 787210[F], 787211 [F], 787212[F], 787213[F],
787215[F], 787217[F], 787218[F], 787222[F], 787223[F], 787224[F],
619583[F], 787206[F], 787208[F], 787209[F], 787214[F], 787216[F], 787225[F], 787226[F], 787227[F], 787228[F], 787230[F], 787231 [F],
787219[F], 787220[F], 787221 [F], 787229[F], 787235[F], 787239[F], 787232[F], 787233[F], 787234[F], 787236[F], 787237[F], 787238[F],
787240[F], 787242[F], 787243[F], 787246[F], 919822[-1418],
787241 [F], 787244[F], 787245[F], 919821 [922], 787247[-1078], ACVR1
787248[-3418], 3958[F], 334638[F], 334640[F], 334641 [F],
3959[F], 334639[F], 334642[F], 334643[F], 334646[F], 334647[F], (90) &
334644[F], 334645[F], 334651 [F], 334654[F], 334657[F], 334658[F], 334648[F], 334649[F], 334650[F], 334652[F], 334653[F], 334655[F], Acvr1
334659[F], 334661[F], 334665[F], 334669]F], 334672[F], 334674[F], 334656[F], 334660[F], 334662[F], 334663[F], 334664[F], 334666[F], (11477)
334680[F], 334685[F], 334687[F], 334689[F], 334691 [F], 334692[F], 334667[F], 334668[F], 334670[F], 334671 [F], 334673[F], 334675[F],
334695[F], 3960[-488], 334697[-2038], 334698[-2567], 334699]- 334676[F], 334677[F], 334678[F], 334679[F], 334681 [F], 334682[F],
441 1], 334700[-4585], 334701 [-4794]
334683[F], 334684[F], 334686[F], 334688[F], 334690[F], 334693[F],
334694[F], 3961 [-488], 334696[-899], 334637[-1940]
646194[F], 742504[F], 742505[F], 742506[F], 742507[F], 742508[F], ACVR1B 39208[F], 242902[F], 242903[F], 242904[F], 242905[F], 242906[F], (91) &
242907[F], 242908[F], 242909[F], 242910[F], 242911 [F], 242912[F], Acvrl b
242913[F] (1 1479) 619579[F], 619581[F], 787192[F], 787193[F], 787195[F], 787196[F],
619580[F], 619582[F], 787191[F], 787194[F], 787197[F], 787202[F],
787198[F], 787199[F], 787200[F], 787201 [F], 619579[66975], ACVR1C 787203[F], 619580[66975], 3957[F], 334600[F], 334603[F],
787199[-3185], 3956[F], 334601[F], 334602[F], 334604[F], (130399) & 334607[F], 334610[F], 334611[F], 334612[F], 334614[F], 334615[F],
334605[F], 334606[F], 334608[F], 334609[F], 334613[F], 334616[F], Acvrlc 334618[F], 334620[F], 334621[F], 334624[F], 334625[F], 334626[F],
334617[F], 334619[F], 334622[F], 334623[F], 3954[85938], 334617]- (269275) 3955(85938], 334618[-3501]
2039]
619503[F], 786528[F], 786529[F], 786530[F], 786531 [F], 786532[F], ACVR2A 786533[F], 786534[F], 3864[F], 333211[F], 333212[F], 333213[F], (92) &
333214[F], 333215[F], 333216[F], 333217]F], 333218[F], 333219[F], Acvr2a
333220[F], 333221[F], 333222[F], 333223[F] (1 1480) TABLE 2 - Page 24 of 1873
636168[F], 907124[F], 907125[F], 907127[F], 907128[F], 907129[F],
907130[F], 907131[F], 907132[F], 907133[F], 907134[F], 907135[F],
907136[F], 907138[F], 907140[F], 907141[F], 907142[F], 907143[F],
907144[F], 907146[F], 907147[F], 924777[F], 924779[F], 924780[F],
924781 [F], 924782[F], 924783[F], 924784[F], 924785[F], 924786[F],
907123[F], 907126[F], 907137[F], 907139[F], 907145[F], 924778[F], 924787[F], 924788[F], 924790[F], 924792[F], 924793[F], 924794[F], ACVR2B
924789[F], 924791[F], 924797[F], 924776(3018], 931810(1656],
924795[F], 924796[F], 924798[F], 924799[3592], 636169[-3129], (93) &
907122[-344], 636170[-3129], 25894[F], 593403[F], 593413[F],
25893[F], 25895[F], 593404[F], 593405[F], 593406[F], 593407[F], Acvr2b
593415[F], 593420[F], 593424[F], 593402[-307], 593400[-2669],
593408[F], 593409[F], 593410[F], 593411[F], 593412[F], 593414[F], (11481)
593432[-2727], 593434[-3111]
593416[F], 593417[F], 593418[F], 593419[F], 593421 [F], 593422[F],
593423[F], 593425[F], 593426[-556], 593427[-1118], 593428[-1377],
593429[-1710], 593430[-1962], 593401 [-2088], 593431 [-2513],
593433[-2943], 593435[-4130], 593436[-4254], 593437[-4407],
593438[-4915]
646192[F], 742499[F], 742501[F], 742502[F], 742503[F], 742499]- ACVRL1 1356], 39206[F], 242896[F], 242897[F], 242899[F], 242900[F], 646193[F], 742500[F], 39207[F], 242895[F], 242898[F] (94) & 242901 [F] AcvrH
635866[-2086], 904919 [-2245], 904920[-2832], 904921 [-2944],
904922[-3034], 635865[-4399], 616808[-4418], 904923[-4941], ACY1 (95) 25505[-1408], 25506[-1813], 588771[-1971], 588772[-2561], 588773[- & Acy1 2672], 588774[-2754], 588770[-3408], 588775[-3424], 588776[-4515], (109652) 588777[-4577]
649961[F], 930325(1165], 930326(1049], 930327[-288], 704776[- ACY3
649962[F], 649964[-2750], 772221[-4151], 44181[-2745], 305953[- 835], 7047771-951], 704780[-2288], 649963[-2750], 44180[-2745], (91703) &
3573], 44179[-4994]
441781-4994] Acy3
641614[F], 929621(1202], 708061[-798], 641612[-1756], 930232[ ACYP1
641613[F], 708060[F], 641611[-1756], 32748[F], 163554[F],
2618], 708059[-4048], 708062[-4618], 32749[F], 163552[F], (97) &
163555[F], 163556[F], 163557[F], 32746[-1797], 163559[-2158],
163553[F], 163558[-367], 32747( 1797], 163551 [-3466], 163549[- Acypl
163560[-4200], 163550[-4671]
4722] (66204)
638396[F], 685096[F], 685101[F], 685102[F], 685103[F], 685104[F],
685130[F], 28787[F], 117283[F], 117285[F], 117286[F], 117288[F], 638395[F], 685097[F] 685105[F], 685106[F], 685110[F], 28786[F], 117291[F], 117295[F], 117296[F], 117297[F], 117301 [F], 117302[F], 117284[F], 117287[F] 117289[F], 117290[F], 117292[F], 117293[F], 117303[F], 117304[F], 117305[F], 117309[F], 117310[F], 117311[F], 117294[F], 117298[F] 117299[F], 117300[F], 117306[F], 117307[F], ACYP2 117313[F], 117316[F], 117318[F], 117319[F], 117320[F], 117321[F], 117308[F], 117312[F] 117314[F], 117315[F], 117317[F], 117329[F], (98) & 117322[F], 117323[F], 117324[F], 117325[F], 117326[F], 117327[F], 117334[F], 117336[F] 117338[F], 117340[F], 117345[F], 117346[F], Acyp2 117328[F], 117330[F], 117331[F], 117332[F], 117333[F], 117335[F], 117348[F], 117349[F] 117351[F], 117353[F], 117358[F], 117360[F], (75572) 117337[F], 117339[F], 117341[F], 117342[F], 117343[F], 117344[F], 117361[F], 117365[F] 117366[F], 117367[F], 28785[-566], 117282[- 117347[F], 117350[F], 117352[F], 117354[F], 117355[F], 117356[F], 2001]
117357[F], 117359[F], 117362[F], 117363[F], 117364[F]
621224[F], 799533[F], 799534[F], 799536[F], 925558(1940], 799537[- ADA (100)
621223[F], 799535[F], 621220[-484], 799532[-907], 5946[F],
60], 6212211-484], 799531 [-4220], 5947[F], 5951 [F], 358397[F], & Ada
5950[F], 358399[F], 358396[-848]
358398[F], 358400[F], 358401[-115], 358395[-4718 (11486)
ADAD1
621858[F], 803554[F], 6860[F], 369344[F], 369345[F], 369346[F], 621859[F], 803555[F], 6861 [F], 369343[F], 369347[F], 369349[F],
(132612) & 369348[F], 369354[F], 369356[F], 369358[F], 369359[F], 369362[- 369350[F], 369351[F], 369352[F], 369353[F], 369355[F], 369357[F],
Adadl 2546], 6859[-3619], 369363[-4468], 369364[-4809] 369360[F], 369361 [-2544]
(21744) ADAD2
891971[F], 891972[F], 634047[6017], 23182[F], 562471[F], (161931) &
891973[F], 634048(6017], 23183[F], 562475[F]
562472[F], 562473[F], 562474[F] Adad2
(75773)
620431[F], 793700[F], 793701[F], 793702[F], 793703[F],
620431[22653], 620430[765], 620433[425], 793699[-396], 793698[- ADAL
620429[765], 620434[425], 620432[425], 5009[-737], 5012[-746], 561 ], 793697[-819], 793696[-941 ], 793695[-1212], 5011 [F], (161823) & 5014[-748], 347035[-3178] 347031[F], 347032[F], 347033[F], 347034[F], 5010[-737], 5013[- Adal
746], 347030[-1752], 347029[-1917], 347028[-2175], 347027[-2297], (75894)
347026[-2568]
635412[F], 901504[F], 901505[F], 901506[F], 901507[F], 901508[F], 901509[F], 901510[F], 901511[F], 919605(1863], 919606(1697], ADAM 10 901512[-137], 901513[-303], 24914[F], 581725[F], 581726[F], (102) &
581727[F], 581728[F], 581729[F], 581730[F], 581731 [F], 581732[F], AdamlO 581733[F], 581734[F], 581735[F], 581736[F], 581737[F], 581738[F], (11487) 581739[F], 581740[F], 581741 [F]
ADAM 11
640179[F], 697600[F], 697601[F], 697603[F], 697604[F], 697605[F],
640180[F], 697602[F], 697606[F], 697608[F], 697609[F], 697610[F], (4185) & 697607[F], 30892[F], 139684[F], 139685[F], 139687[F], 139688[F],
30893[F], 139686[F], 139691[F], 139693[F], 139694[F], 139695[F] Adam11 139689[F], 139690[F], 139692[F]
(11488) TABLE 2 - Page 25 of 1873
632201 [F], 878267[F], 878268[F], 878269[F], 878271 [F], 878273[F],
878274[F], 878275[F], 878277[F], 878279[F], 878280[F], 878281 [F], 632200[F], 878266[F], 878270[F], 878272[F], 878276[F], 878278[F],
878285[F], 878286[F], 878289[F], 878290[F], 878294[F], 878298[F], 878282[F], 878283[F], 878284[F], 878287[F], 878288[F], 878291 [F],
878300[F], 878306[F], 878309[F], 878310[F], 878311 [F], 878312[F], 878292[F], 878293[F], 878295[F], 878296[F], 878297[F], 878299[F], 878313[F], 878314[F], 878316[F], 878317[F], 878263[-376], 878262[- 878301 [F], 878302[F], 878303[F], 878304[F], 878305[F], 878307[F],
771], 632199[-4740], 20749[F], 532110[F], 532111[F], 532115[F], 878308[F], 878315[F], 878265[-106], 878264[-253], 878318[-962],
532116[F], 532117[F], 532119[F], 532120[F], 532123[F], 532124[F], 632198[-4740], 20748[F], 532112[F], 532113[F], 532114[F], ADAM 12
532125[F], 532126[F], 532128[F], 532130[F], 532131 [F], 532134[F], 532118[F], 532121[F], 532122[F], 532127[F], 532129[F], 532132[F], (8038) &
532135[F], 532136[F], 532142[F], 532143[F], 532146[F], 532148[F], 532133[F], 532137[F], 532138[F], 532139[F], 532140[F], 532141[F], Adam12
532149[F], 532150[F], 532151[F], 532152[F], 532154[F], 532156[F], 532144[F], 532145[F], 532147[F], 532153[F], 532155[F], 532157[F], (11489)
532161[F], 532162[F], 532166[F], 532168[F], 532173[F], 532174[F], 532158[F], 532159[F], 532160[F], 532163[F], 532164[F], 532165[F],
532176[F], 532179[F], 532182[F], 532184[F], 532186[F], 532188[F], 532167[F], 532169[F], 532170[F], 532171[F], 532172[F], 532175[F],
532189[F], 532191[F], 532193[F], 53219 4 [F], 532195[F], 532196[F], 532177[F], 532178[F], 532180[F], 532181[F], 532183[F], 532185[F],
532197[F], 532198[F], 532202[F], 532203[F], 532204[F], 532205[F], 532187[F], 532190[F], 532192[F], 532199[F], 532200[F], 532201[F],
532206[F], 532207[F], 532208[F], 532209[F], 532210[F], 532211[F], 532212[F], 532215[F], 532217[-1330], 20746[-1666]
532213[F], 532214[F], 532216[F], 20747[-1666]
622447[F], 807340[F], 8073 4 1[F], 8073 4 2[F], 807343[F], 807344[F],
807345[F], 807346[F], 622 44 6[92 4 0], 807347[30], 622 44 8[-145], ADAM 15
622449[-145], 622445[-967], 807349[-1356], 807339[-4616], 7627[- 807348[-668], 807350[-3230], 7625[F], 377382[F], 377383[F], (8751) & 55], 377391 [-1485], 7623[-1608], 377380[-4810] 377384[F], 377385[F], 377386[F], 377387[F], 377388[F], 377389[F], Adam15
7624(8193], 7626[-55], 377390[-503], 377381[-671], 377392[-1721], (11490) 3773931-2083], 377394[-2571]
640914[F], 702604[F], 702605[F], 702606[F], 702607[F], 702608[F], 702609[F], 702610[F], 702611[F], 928874(1445], 928873(1033],
928872(908], 922633(561 ], 702603[-555], 702602[-967], 702601 [- ADAM 17 1092], 702613[-1439], 31821[F], 31826[F], 150428[F], 150 4 29[F], (6868) &
922632(1762], 702612[-238], 31822[F], 150444[-233]
150430[F], 150431[F], 150432[F], 150 4 33[F], 150 4 34[F], 150435[F], Adam17 150436[F], 150437[F], 150438[F], 150 4 39[F], 150 4 40[F], 150441 [F], (11491) 150442[F], 150443[F], 150427[-52], 150426[-177], 150445[-1156], 1504461-2469], 150425[-3845], 150424[-4151], 150423[-4214]
632703[F], 21471[F], 540163[F], 540164[F], 540165[F], 540166[F], 632702[F], 881416[F], 881421[F], 21470[F], 540162[F], 540167[F], ADAM 18
540168[F], 540169[F], 540171[F], 540177[F], 540178[F], 540179[F], 540170[F], 540172[F], 540173[F], 540174[F], 540175[F], 540176[F], (8749) &
540180[F], 540186[F], 540189[F], 540191[F], 21473[-2468], 540193]- 540181 [F], 540182[F], 540183[F], 540184[F], 540185[F], 540187[F], Adam18
3763] 540188[F], 540190[F], 540192[F], 21472[-2468] (13524)
ADAM 19
6385551-2492], 686717[-4411] 289811-811], 1202701-996], 120272]- 638556[-2492], 686716[-2938], 120269[-789], 28982[-811] 120271] (8728) & 2871] 1485] Adam19
(11492)
644430[F], 728928[F], 728929[F], 728930[F], 728931 [F], 36908[F],
ADAM 2
644431 [F], 728924[F], 728925[F], 728926[F], 36909[F], 214024[F], 214028[F], 214029[F], 214030[F], 214031[F], 214032[F], 214034[F],
(2515) & 214025[F], 214026[F], 214027[F], 214033[F], 214039[F], 214042[F], 214035[F], 214036[F], 214037[F], 214038[F], 214040[F], 214041[F],
Adam2 214044[F], 214045[F], 214049[F], 214051 [F], 214054[F] 214043[F], 214046[F], 214047[F], 214048[F], 214050[F], 214052[F],
(11495) 214053[F], 214055[F]
832337[F], 832338[F], 832339[F]
832347[F], 832348[F], 832349[F]
832353[F], 832354[F], 832355[F]
832359[F], 832360[F], 832363[F]
832369[F], 832370[F], 832372[F]
832376[F], 832377[F], 832379[F] 625840[F], 832335[F], 832340[F], 8323 4 2[F], 832343[F], 832346[F], 625839[-2227], 11963[F], 832361[F], 832362[F], 832364[F], 832367[F], 832371 [F], 832378[F], 431546[F], 431547]F], 431548[F] 832380[F], 832383[F], 625838[-2227], 832333]-2503], 832332]- 431552[F], 431554[F], 431555[F] 4226], 832335[-4547], 11962[F], 431543[F], 431544[F], 431553[F],
ADAM 22 431564[F], 431565[F], 431566[F] 431556[F], 431558[F], 431559[F], 431560[F], 431563[F], 431569[F],
(53616) & 431572[F], 431574[F], 431575[F] 431570[F], 431573[F], 431578[F], 431580[F], 431581 [F], 431583[F],
Adam22 431582[F], 431585[F], 431588[F] 431584[F], 431586[F], 431587[F], 431590[F], 431591 [F], 431593[F],
(11496) 431595[F], 431596[F], 431597[F] 431600[F], 431608[F], 431609[F], 431617[F], 431618[F], 431620[F], 431602[F], 431603[F], 431604[F] 431621[F], 431623[F], 431631[F], 431635[F], 431638[F], 431639[F], 431610[F], 431611 [F], 431612[F] 431642[F], 431647[F], 431650[F], 431651[F], 431655[F], 431658[F], 431616[F], 431619[F], 431622[F] 11960[-2971], 431540[-3407], 431544[-4237]
431627[F], 431628[F], 431629[F]
431634[F], 431636[F], 431637[F]
431644[F], 431645[F], 431646[F]
431653[F], 431654[F], 431656[F]
11961[-2971] TABLE 2 - Page 26 of 1873
ADAM 23
617063[F], 919332[-1487], 657131 [-3487], 849[208], 58199[-2378], (8745) &
617062[F], 848[208], 58200[-1688], 58198[-2736]
58197[-2763], 58196[- 44 20] Adam23
(23792) ADAM 28
644484[F], 729211[F], 729212[F], 36968[F], 214620[F], 214621 [F], (10863) &
644483[F], 36967[F], 214622[F], 214623[F], 214624[F]
214625[F], 214626[F], 214620[-216] Adam28
(13522) ADAM 29 (11086) &
633034[F], 21936[F], 545303[F], 545305[F], 545307[F] 633033[F], 21935[F], 545304[F], 545306[F]
Adam29 (244 4 86) ADAM 30 (11085) &
808924[F], 622739(2329], 7990[F], 380143[F]
Adam30 (71078)
632708[F], 881427[F], 881428[F], 632710[-2270], 881431 [-3881],
632709[F], 881429[F], 881430[F], 21477[F], 540239[F], 540242[F],
21476[F], 540240[F], 540241[F], 540243[F], 540244[F], 540247[F], ADAM 32 540245[F], 540246[F], 540251[F], 540252[F], 540253[F], 540255[F],
540248[F], 540249[F], 540250[F], 540254[F], 540256[F], 540259[F], (203102) & 540257[F], 540258[F], 540260[F], 540262[F], 540266[F], 540268[F],
540261[F], 540263[F], 540264[F], 540265[F], 540267[F], 540271 [F], Adam32 540269[F], 540270[F], 540272[F], 540273[F], 540274[F], 540275[F],
5 4 0277[F], 540278[F], 540279[F], 540281 [F], 540285[F], 21 4 78[- (353188) 540276[F], 540280[F], 540282[F], 540283[F], 540284[F]
804], 540286[-2163], 540287[-4372], 540288[-4751]
795204[F], 795205[F], 795206[F], 795207[F], 795209[F], 795211 [F], ADAM 33
795208[F], 795210[F], 795214[F], 620667[13046], 5289[F], 795212[F], 795213[F], 795215[F], 620666(13046], 5288[F], (80332) & 349880[F], 349882[F], 349886[F] 349876[F], 349877[F], 349878[F], 349879[F], 349881 [F], 349883[F], Adam33
349884[F], 349885[F], 349887[F] (1 10751 )
ADAM 3 A
632705[F], 881422[F], 881423[F] 632704[F], 881424[F]
(1587)
ADAM3B
633545[F], 887399[-1404], 887400[-2022], 887401 [-4498] 633544[F]
(1596)
ADAM5P 632707[F], 881425[F], 881426[F] 632706[F], 901257[F]
(255926) ADAM 7
644478[F], 729209[F], 729210[F], 644480(68518], 36964[F],
644479[F], 644481(68518], 36965[F], 214613[F], 214614[F], (8756) &
214611[F], 214612[F], 214615[F], 214616[F], 214617[F], 36962]- 214618[F], 36963[-660] Adam7
660]
(11500)
632270[F], 632272[F], 878739[F], 878740[F], 878741 [F], 878742[F], ADAM 8 878743[F], 632273[-2730], 20835[F], 533136[F], 533137[F], (101 ) &
632271 [F], 632274[-2730], 20834[1456], 20837]- 3465]
533138[F], 533139[F], 533140[F], 20833[1456], 533135[-2280], Adam8 208361-3465] (11501)
632710[F], 881431[F], 881432[F], 881433[F], 881434[F], 881435[F], 881436[F], 881437[F], 881438[F], 63271 1 [-385], 632708[-2270],
ADAM 9 881440[-3366], 21478[F], 540286[F], 540287[F], 540288[F],
632712[-385], 632709[-2270], 881439[-3081], 21480[-287], 21477]- (8754) &
540289[F], 540290[F], 540291 [F], 540292[F], 540293[F], 540294[F], 805], 540305[-3319] Adam9
540295[F], 540296[F], 540297[F], 540298[F], 540299[F], 540300[F],
(11502) 540301[F], 540302[F], 540303[F], 540304[F], 21479[-287], 21476[- 805], 540285[-1989], 540306[-3557], 540307[-4667]
ADAMDEC
1 (27299)
644482[F], 36966[F], 214619[F]
&
Adamded ADAMTS1 (9510) &
647283[F], 751082[F], 751083[F], 40553[F], 260281 [F], 260282[F]
Adamtsl (1 1504)
648088[F], 757079[F], 757080[F], 757082[F], 757083[F], 757084[F], ADAMTS1 757086[F], 6480901-2794], 41755[F], 274356[F], 274357[F], 648089[F], 757081[F], 757085[F], 757087[F], 648091 [-2794], 0 (81794) 274359[F], 274360[F], 274361[F], 274362[F], 274364[F], 274365[F], 757088[-3325], 41756[F], 274358[F], 274363[F], 274366[F], & 274368[F], 274370[F], 274371[F], 274372[F], 41757[-1923], 274375]- 274367[F], 274369[F], 274373[F], 41758[-1923], 274374[-2409] Adamtsl 0 35881 (224697) TABLE 2 - Page 27 of 1873
645031[F], 733613[F], 733615[F], 733616[F], 733623[F], 733624[F],
733626[F], 733627[F], 733628[F], 733630[F], 733632[F], 733633[F],
733635[F], 733637[F], 733638[F], 733639[F], 733640[F], 733641 [F],
645032[F], 733614[F], 733617[F], 733618[F], 733619[F] 733620[F], 733642[F], 733645[F], 733647[F], 917995(1881], 917996(726],
733621[F], 733622[F], 733625[F], 733629[F], 733631 [F] 733634[F], 917997(35], 733650[-119], 733651 [-1274], 733652[-1965], 37676[F],
733636[F], 733643[F], 733644[F], 733646[F], 733648[F]„ 733649[F], ADAMTS1 224102[F], 224103[F], 224104[F], 224106[F], 224108[F], 224109[F],
37677[F], 224105[F], 224107[F], 224110[F], 224111[F] 224115[F], AUAM I b1 224112[F], 224113[F], 224114[F], 224117[F], 224118[F], 224122[F], 2 (81792)
224116[F], 224119[F], 224120[F], 224121[F], 224123[F] I, 224124[F], 224127[F], 224128[F], 224130[F], 224131[F], 224132[F], 224133[F], &
224125[F], 224126[F], 224129[F], 224135[F], 224137[F] 224140[F], 224134[F], 224136[F], 224138[F], 224139[F], 224142[F], 224145[F], Adarrrts12
224141[F], 224143[F], 224144[F], 224148[F], 224152[F] 224153[F], 224146[F], 224147[F], 224149[F], 224150[F], 224151 [F], 224154[F], (239337)
224155[F], 224156[F], 224157[F], 224158[F], 224160[F] 224163[F], 224159[F], 224161[F], 224162[F], 224164[F], 224166[F], 224167[F],
224165[F], 224172[F], 224177[F], 224187[F], 224188[F] 224189[F], 224168[F], 224169[F], 224170[F], 224171[F], 224173[F], 224174[F],
224191[F], 224192[F], 224194[F], 224195[F], 224196[F]
224175[F], 224176[F], 224178[F], 224179[F], 224180[F], 224181[F],
224182[F], 224183[F], 224184[F], 224185[F], 224186[F], 224190[F],
224193[F], 224197[F], 224198[-178], 224199[-818]
ADAMTS1
783343[F], 783345[F], 783348[F], 783349[F], 619148(37085], 783344[F], 783346[F], 783347[F], 783350[F], 619149(37085],
3 (11093) 619147(3726], 783343[-4318], 3438[F], 327313[F], 327314[F], 783351 [-4362], 3439[F], 327312[F], 327315[F], 327316[F],
& 327317[F], 327319[F] 327318[F], 327320[F], 327321 [-4612]
Adarrrts13
674813[F], 674814[F], 674818[F], 674819[F], 674820[F], 674821[F],
674815[F], 674816[F], 674817[F], 674824[F], 674829[F], 674832[F], 674822[F], 674823[F], 674825[F], 674826[F], 674827[F], 674828[F],
674835[F], 674836[F], 674838[F], 674839[F], 674840[F], 777905[F], ADAMTS1 674830[F], 674831[F], 674833[F], 674834[F], 674837[F], 674841[F],
777906[F], 636913[89619], 26875[F], 95080[F], 95081[F], 95082[F], 4 (140766) 636914(89619], 26876[F], 95078[F], 95079[F], 95084[F], 95085[F],
95083[F], 95091 [F], 95094[F], 95096[F], 95097[F], 95100[F], & 95086[F], 95087[F], 95088[F], 95089[F], 95090[F], 95092[F],
95104[F], 95105[F], 95106[F], 95107[F], 95112[F], 95114[F], Adamts14 95093[F], 95095[F], 95098[F], 95099[F], 95101[F], 95102[F],
95115[F], 95118[F], 95119[F], 95122[F], 95123[F], 95124[F], (237360) 95103[F], 95108[F], 95109[F], 95110[F], 95111[F], 95113[F],
95125[F], 95126[F], 95127[F]
95116[F], 95117[F], 95120[F], 95121[F], 95128[F]
ADAMTS1
634573[F], 895307[F], 895308[F], 895309[F], 895310[F], 23909[F], 634572[F], 895311[F], 895312[F], 895313[F], 23908[F], 570602[F], 5 (170689) 570597[F], 570598[F], 570599[F], 570600[F], 570601 [F] 570603[F], 570604[F], 570605[F] &
Adamts15
642970[F], 717959[F], 717960[F], 717965[F], 717966[F], 717967[F],
642969[F], 717961[F], 717962[F], 717963[F], 717964[F], ADAMTS1 717968[F], 717969[F], 642968[5750], 34757[F], 188269[F],
642967[5750], 919193[1853], 717970[-147], 34756[F], 188271 [F], 6 (170690) 188270[F], 188275[F], 188277[F], 188279[F], 188282[F], 188283[F],
188272[F], 188273[F], 188274[F], 188276[F], 188278[F], 188280[F], & 188284[F], 188285[F], 188286[F], 188287[F], 188288[F], 188289[F],
188281[F], 188293[F], 34754[5401], 34758[1362], 188294[-48], Adarrrts16 188290[F], 188291[F], 188292[F], 34755(5401], 34759(1362],
188296[-1856], 188297[-1981], 188268[-2983] (271127) 1882951-1615]
631057[F], 870196[F], 870197[F] 870198[F] 870199[F] , 870200[F], 631058[F], 870205[F] 870206[F], 870207[F], 870209[F], 870210[F], 870201 [F], 870202[F], 870203[F] 870204[F] 870208[F] , 870211[F], 870215[F], 870219[F] 870220[F], 870222[F], 870223[F], 870224[F], 870212[F], 870213[F], 870214[F] 870216[F] 870217[F] 870221 [F], 870225[F], 870231 [F] 870233[F], 870234[F], 870236[F], 19350[F], 870232[F], 870235[F], 870237[F] 19349[F] 516352[F] 516353[F], 516356[F], 516358[F] 516361[F], 516364[F], 516369[F], 516370[F], ADAMTS1 516354[F], 516355[F], 516357[F] 516359[F] 516360[F] , 516362[F], 516371[F], 516373[F] 516374[F], 516375[F], 516376[F], 516378[F], 7 (170691) 516363[F], 516365[F], 516366[F] 516367[F] 516368[F] , 516372[F], 516379[F], 516380[F] 516384[F], 516385[F], 516386[F], 516387[F], & 516377[F], 516381[F], 516382[F] 516383[F] 516389[F] 516391[F], 516388[F], 516390[F] 516394[F], 516395[F], 516398[F], 516400[F], Adamts17 516392[F], 516393[F], 516396[F] 516397[F] 516399[F] 516 4 03[F], 516401[F], 516402[F] 516405[F], 516407[F], 516 4 09[F], 516410[F], (233332) 516404[F], 516406[F], 516408[F] 516415[F] 516416[F] , 516417[F], 516411[F], 516412[F] 516413[F], 51641 4 [F], 516418[F], 516419[F], 516420[F], 516421 [F], 516424[F] 516426[F] 516 4 27[F] , 516431[F], 516422[F], 516423[F] 516425[F], 516428[F], 516 4 29[F], 516430[F], 516432[F], 516434[F], 516435[F] 516437[F] 516 4 38[F] 516439[F] 516433[F], 516436[F]
633974[F], 890914[F], 890920[F], 890921 [F], 890922[F], 890923[F], 890924[F], 890926[F], 890927[F], 890928[F], 890929[F], 890930[F],
ADAMTS1
633975[F], 890913[F], 890915[F], 890916[F], 890917[F], 890918[F], 23098[F], 560337[F], 560338[F], 560339[F], 560342[F], 560343[F],
8 (170692) 890919[F], 890925[F], 890931[F], 23099[F], 560340[F], 560341[F], 560349[F], 560350[F], 560351 [F], 560352[F], 560353[F], 560354[F],
& 560344[F], 560345[F], 560346[F], 560347[F], 5603 4 8[F], 560357[F], 560355[F], 560356[F], 560359[F], 560360[F], 560361 [F], 560362[F],
Adarrrts18 560358[F], 560375[F], 560377[F], 560336[-23] 560363[F], 560364[F], 560365[F], 560366[F], 560367[F], 560368[F],
(208936) 560369[F], 560370[F], 560371 [F], 560372[F], 560373[F], 560374[F], 560376[F]
649543[F], 768749[F], 768750[F], 768752[F], 768753[F], 768754[F],
768755[F], 768756[F], 768757[F], 768758[F], 768759[F], 768760[F], 649544[F], 768751[F], 43640[F], 298647[F], 298649[F], 298652[F], ADAMTS1 918206[1850], 768748[-150], 43639[F], 298645[F], 298646[F], 298653[F], 298655[F], 298658[F], 298659[F], 298660[F], 298661[F], 9 (171019) 298648[F], 298650[F], 298651[F], 298654[F], 298656[F], 298657[F], 298664[F], 298668[F], 298669[F], 298673[F], 298675[F], 298677[F], & 298662[F], 298663[F], 298665[F], 298666[F], 298667[F], 298670[F], 298679[F], 298680[F], 298683[F], 298686[F], 298687[F], 298688[F], Adamts19 298671 [F], 298672[F], 298674[F], 298676[F], 298678[F], 298681 [F], 298691 [F] (240322) 298682[F], 298684[F], 298685[F], 298689[F], 298690[F], 298644[-62] TABLE 2 - Page 28 of 1873
638629[F], 638631[F], 6871 9[F], 687151[F], 687153[F], 687154[F],
687155[F], 687156[F], 687160[F], 687162[F], 687165[F], 687167[F],
687168[F], 687171[F], 687172[F], 687173[F], 687176[F], 687177[F], 638630[F], 687150[F], 687152[F], 687157[F], 687158[F], 687159[F], 687180[F], 687181[F], 687182[F], 687183[F], 687184[F], 687161[F], 687163[F], 687164[F], 687166[F], 687169[F], 687170[F], 638629(231918], 638628(389], 687148[-571], 29094[F], 29096[F], 687174[F], 687175[F], 687178[F], 687179[F], 638630(231918],
ADAMTS2 121329[F], 121330[F], 121331[F], 121333[F], 121335[F], 121336[F], 29095[F], 121332[F], 121334[F], 121343[F], 121346[F], 121347[F],
(9509) & 121337[F], 121338[F], 121339[F], 121340[F], 121341 [F], 121342[F], 121349[F], 121350[F], 121351[F], 121352[F], 121355[F], 121356[F],
Adamts2 121344[F], 121345[F], 121348[F], 121353[F], 121354[F], 121358[F], 121357[F], 121359[F], 121362[F], 121364[F], 121366[F], 121369[F],
(216725) 121360[F], 121361[F], 121363[F], 121365[F], 121367[F], 121368[F], 121370[F], 121371[F], 121375[F], 121377[F], 121379[F], 121381[F], 121372[F], 121373[F], 121374[F], 121376[F], 121378[F], 121380[F], 121383[F], 121384[F], 121386[F], 121389[F], 121392[F], 121393[F], 121382[F], 121385[F], 121387[F], 121388[F], 121390[F], 121391[F], 121394[F]
121395[F], 121396[F], 121397[F], 121398[F], 121399[F], 29093(365],
121328[-551]
646016[F], 741191[F], 741193[F], 741195[F], 741197[F], 741200[F], 646015[F], 741189[F] 741190[F], 741192[F], 741194[F], 741196[F], ADAMTS2 741201 [-86], 646014[-4117], 38999[F], 240249[F], 240253[F], 741198[F], 741199[F] 646013[-4117], 38998[F], 240247[F], 0 (80070) 240254[F], 240256[F], 240259[F], 240261 [F], 240262[F], 240264[F], 240248[F], 240250[F] 240251 [F], 240252[F], 240255[F], 240257[F], & 240266[F], 240269[F], 240271[F], 240274[F], 240275[F], 38997[- 240258[F], 240260[F] 240263[F], 240265[F], 240267[F], 240268[F], Adamts20 3502] 240270[F], 240272[F] 240273[F], 240258[-3468], 38996[-3502] (223838)
626736[F], 838918[F], 838919[F], 838920[F], 838921 [F], 838922[F],
626735[F], 838906[F] 838916[F], 838917[F], 838925[F], 838927[F], 838923[F], 838924[F], 838926[F], 838928[F], 838930[F],
838929[F], 838931 [F] 838932[F], 626737(285978], 446538[F],
626738[285978], 446540[F], 446541 [F], 446542[F], 446544[F], ADAMTS3
446539[F], 446543[F] 446549[F], 446550[F], 446551 [F], 446552[F], 446545[F], 446546[F], 446547[F], 446548[F], 446553[F], 446555[F], (9508) &
446554[F], 446558[F] 446559[F], 446560[F], 446561 [F], 446562[F], 446556[F], 446557[F], 446567[F], 446568[F], 446569[F], 446570[F], Adamts3
446563[F], 446564[F] 446565[F], 446566[F], 446571 [F], 446573[F], 446572[F], 446574[F], 446575[F], 446579[F], 446580[F], 446582[F], (330119)
446576[F], 446577[F] 446578[F], 446581 [F], 446583[F], 446585[F], 446584[F], 446586[F], 446587[F], 446589[F], 446592[F],
446588[F], 446590[F] 446591 [F], 13197[206415], 13195[637]
13198[206415], 13196(637]
ADAMTS4
618361[F], 667520[F], 667521 [F], 667522[F], 618360[862], 2474[F], (9507) & 79313[F], 79314[F], 79315[F], 79316[F], 2473[849] Adamts4
(240913)
751084[F], 751086[F], 751087[F], 751088[F], 751089[F], 751090[F],
ADAMTS5 751091[F], 751092[F], 751094[F], 751095[F], 751097[F], 751098[F],
751085[F], 751093[F], 751096[F], 647284(47735], 40554[F], (11096) & 647285[47735], 40555[F], 260283[F], 260285[F], 260286[F],
260284[F], 260293[F], 260296[F] Adamts5 260287[F], 260288[F], 260289[F], 260290[F], 260291 [F], 260292[F],
(23794) 260294[F], 260295[F], 260297[F], 260298[F], 260299[F]
643369[F], 720597[F], 720598[F], 720599[F] 720600[F], 720601 [F],
720602[F], 720603[F], 720604[F], 720606[F] 720607[F], 720608[F],
720609[F], 35265[F], 35267[F], 194149[F], 194150[F], 194151 [F], ADAMTS6 194152[F], 194153[F], 194154[F], 194155[F] 194157[F], 194159[F], 643370[F], 720596[F], 35266[F], 194148[F], 194156[F], 194158[F], (11174) & 194160[F], 194161[F], 194163[F], 194164[F] 194165[F], 194167[F], 194162[F], 194166[F], 194168[F], 194177[F] Adamts6 194169[F], 194170[F], 194171[F], 194172[F] 194173[F], 194174[F], (108154) 194175[F], 194176[F], 194178[F], 194179[F] 194180[F], 194181[F],
194182[F], 194183[F], 194184[-1831]
635649[F], 903230[F], 903231 [F] 903234[F], 903235[F], 903236[F],
903237[F], 903238[F], 903239[F] 903242[F], 903243[F], 903244[F], 635650[F], 903232[F], 903233[F], 903240[F], 903241 [F], 903245[F], ADAMTS7 903247[F], 903248[F], 903249[F] 903250[F], 25233[F], 585429[F], 903246[F], 903251[F], 25234[F], 585431 [F], 585432[F], 585433[F], (11173) & 585430[F], 585434[F], 585435[F] 585436[F], 585439[F], 585440[F], 585437[F], 585438[F], 585442[F], 585445[F], 585446[F], 585450[F], Adamts7 585441 [F], 585443[F], 585444[F] 585447[F], 585448[F], 585449[F], 585451[F], 585456[F] (108153) 585452[F], 585453[F], 585454[F] 585455[F], 252351-1922]
634578[F], 895315[F], 895317[F], 895318[F], 895319[F], 895320[F],
634577[F], 895316[F], 634575[23658], 634574[2343], 895314[-225], 895321[F], 634576[23658], 926870[641], 895323[-1359], 23912[F], ,^α^ A 895322[-755], 23911[F], 570608[F], 570610[F], 23913[8773], 570607[F], 570609[F], 570611[F], 570612[F], 570613[F], 570614[F], 23910[2213], 570606[-287], 570617[-726] 570615[F], 570616[F], 23914[8773], 570618[-1272], 570619[-1842], Adamtsa
(30806) 570620[-3401], 570621 [-3556] TABLE 2 - Page 29 of 1873
629080[F], 856820[F], 856823[F], 856825[F], 856826[F], 856827[F],
856828[F], 856830[F], 856831[F], 856832[F], 856834[F], 856835[F],
856836[F], 856838[F], 856839[F], 856849[F], 856850[F], 856851 [F],
856853[F], 856854[F], 856855[F], 856856[F], 856857[F], 856858[F],
629079[F], 856821[F], 856822[F], 856824[F], 856829F], 856833[F], 856859[F], 856860[F], 856862[F], 856863[F], 856864[F], 856865[F],
856837[F], 856840[F], 856841 [F], 856842[F], 856843[F], 856844[F], 856866[F], 856867[F], 856868[F], 856869[F], 856870[F], 856871 [F],
856845[F], 856846[F], 856847[F], 856848[F], 856852[F], 856861 [F], 856872[F], 856874[F], 856876[F], 856877[F], 856879[F], 856880[F],
856873[F], 856875[F], 856878[F], 856881 [F], 856882[F], 856883[F], 919348[F], 629078(132353], 629083(2834], 856886[-871], 856889[- 856884[F], 629077(132353], 629081(18553], 629082(2834], 856885 ADAMTS9 4657], 16338[F], 16340[F], 486217[F], 486220[F], 486222[F],
583], 856887[-1790], 856888[-4216], 16337[F], 16339[F], 486218[F], (56999) & 486225[F], 486226[F], 486227[F], 486231 [F], 486232[F], 486233[F],
486219[F], 486221[F], 486223[F], 486224[F], 486228[F], 486229[F], Adamts9 486234[F], 486236[F], 486237[F], 486238[F], 486241 [F], 486242[F],
486230[F], 486235[F], 486239[F], 486240[F], 486243F], 486245[F], (101401) 486244[F], 486246[F], 486247[F], 486248[F], 486263[F], 486264[F],
486249[F], 486250[F], 486251 [F], 486252[F], 486253[F], 486254[F], 486265[F], 486266[F], 486267[F], 486268[F], 486270[F], 486271 [F],
486255[F], 486256[F], 486257[F], 486258[F], 486259[F], 486260[F], 486272[F], 486274[F], 486275[F], 486276[F], 486277[F], 486278[F],
486261[F], 486262[F], 486269[F], 486273[F], 486280[F], 486297[F], 486279[F], 486281[F], 486282[F], 486283[F], 486284[F], 486285[F],
486299[F], 486305[F]
486286[F], 486287[F], 486288[F], 486289[F], 486290[F], 486291 [F],
486292[F], 486293[F], 486294[F], 486295[F], 486296[F], 486298[F],
486300[F], 486301[F], 486302[F], 486303[F], 486304[F], 486306[F],
486307[F], 486308[42]
624315[F], 624317[F], 819725[F], 819727[F] 819729[F], 819730[F]
819733[F], 819734[F], 819736[F], 819737[F] 819738[F], 819739[F]
624316[F], 624318[F], 624319[F], 819726[F], 819728[F] 819731 [F], 819741[F], 819742[F], 819743[F], 819744[F] 819748[F], 819749[F]
819732[F], 819735[F], 819740[F], 819745[F], 819746[F] 819747[F], 819750[F], 819751[F], 819752[F], 819753[F] 819755[F], 819756[F]
819754[F], 819759[F], 819760[F], 819761[F], 819762[F] 819764[F], 819757[F], 819758[F], 819763[F], 819765[F] 819767[F], 819768[F]
819766[F], 819769[F], 819770[F], 819772[F], 819773[F] 819775[F], 819771[F], 819774[F], 819776[F], 404337[F] 404338[F], 404340[F]
10042[F], 404339[F], 404342[F], 404344[F], 404348[F] 404349[F], ADAMTSL 404341 [F], 404343[F], 404345[F], 404346[F] 404347[F], 404350[F]
404351[F], 404352[F], 404353[F], 404355[F], 404359[F] 404360[F], 1 (92949) 404354[F], 404356[F], 404357[F], 404358[F] 404361 [F], 404363[F]
404362[F], 404371[F], 404376[F], 404377[F], 404378[F] 404380[F], & AdamtsU 404364[F], 404365[F], 404366[F], 404367[F] 404368[F], 404369[F]
404381[F], 404382[F], 404384[F], 404391[F], 404395[F] 404399[F], (77739) 404370[F], 404372[F], 404373[F], 404374[F] 404375[F], 404379[F]
404400[F], 404401[F], 404403[F], 404404[F], 404407[F] 404408[F], 404383[F], 404385[F], 404386[F], 404387[F] 404388[F], 404389[F]
404409[F], 404410[F], 404411[F], 404412[F], 404414[F] 404417[F], 404390[F], 404392[F], 404393[F], 404394[F] 404396[F], 404397[F]
404419[F], 404421[F], 404423[F], 404424[F], 404427[F] 404428[F], 404398[F], 404402[F], 404405[F], 404406[F] 404413[F], 404415[F]
404429[F], 404431 [F], 10039(194216], 10041(151895]
404416[F], 404418[F], 404420[F], 404422[F] 404425[F], 404426[F]
404430[F], 404432[F], 10038(194216], 1004( '[151895]
619155[F], 783362[F], 783363[F], 783364[F], 783365[F], 783366[F],
ADAMTSL
783368[F], 619155[40817], 619157[-2895], 783369[-2968], 783370]-
619156[F], 783367[F], 619156(40817], 619158[-2895], 783371] 2 (9719) & 3127], 3446[F], 327341[F], 327342[F], 327343[F], 327344[F],
3617], 3447[F], 327348[F], 3449[-1764], 327354[-3981] Adamtsl2 327345[F], 327346[F], 327347[F], 327349[F], 3448[-1764], 327350]- (77794) 3050], 3273511-3148], 327352[-3298], 327353[-3493]
871721[F], 871722[F], 871724[F], 871727[F] 871728[F], 871729[F],
871730[F], 871731[F], 871732[F], 871733[F] 871734[F], 871735[F], 871723[F], 871725[F], 871726[F], 871737[F], 871738[F], 871741[F], 871736[F], 871739[F], 871740[F], 871742[F] 871744[F], 871747[F], 871743[F], 871745[F], 871746[F], 871750[F], 871751 [F], 871757[F], 871748[F], 871749[F], 871752[F], 871753[F] 871754[F], 871755[F], 871758[F], 631267[385748], 19594[F], 519321[F], 519324[F],
871756[F], 631266(385748], 19593[F], 519319[F], 519320[F], 519326[F], 519328[F], 519330[F], 519332[F], 519339[F], 519340[F], ADAMTSL 519322[F], 519323[F], 519325[F], 519327[F] 519329F], 519331[F], 519342[F], 519352[F], 519353[F], 519354[F], 519355[F], 519357[F], 3 (57188) 519333[F], 519334[F], 519335[F], 519336[F] 519337[F], 519338[F], 519358[F], 519359[F], 519360[F], 519362[F], 519365[F], 519367[F], & Adamtsl3 519341[F], 519343[F], 519344[F], 519345[F] 519346[F], 519347[F], 519368[F], 519373[F], 519374[F], 519375[F], 519376F], 519380[F], (269959) 519348[F], 519349[F], 519350[F], 519351[F] 519356[F], 519361[F], 519381[F], 519382[F], 519384[F], 519386[F], 519387[F], 519388[F], 519363[F], 519364[F], 519366[F], 519369[F] 519370[F], 519371[F], 519391[F], 519393[F], 519394[F], 519397[F], 519399[F], 519400[F], 519372[F], 519377[F], 519378[F], 519379[F] 519383[F], 519385[F], 519401[F], 519402[F], 519403[F], 519404[F], 519405[F]
519389[F], 519390[F], 519392[F], 519395[F] 519396[F], 519398[F]
ADAMTSL
637256(8039] 677118[F], 637255[8039]
5 (339366)
627737[F], 845763[F], 845764[F], 845766[F], 627735[-1465],
627736[F], 845762[F], 845765[F], 627734[-1465], 833181 [-2269],
14586[F], 462414[F], 462415[F], 462416[F], 462417[F], 462418[F], ADAP1
845761 [-2271], 14585[F], 462413[F], 462420[F], 462421 [F],
462419[F], 462422[F], 462423[F], 462425[F], 462426[F], 462429[F], (11033) &
462424[F], 462427[F], 462428[F], 462431 [F], 462432F], 462433[F], 462430[F], 462436[F], 462437[F], 462438[F], 462439[F], 462440[F], Adapl
462434[F], 462435[F], 462444[F], 462445[F], 462448[F], 14583[- 462441 [F], 462442[F], 462443[F], 462446[F], 462447[F], 462449[F], (231821)
706], 462412[-1602], 462411 [-2619], 462410[-3004], 462408[-4769] 14584[-706], 462409[-4701]
639477[F], 692933[F], 692934[F], 692935[F], 692936[F], 692937[F], ADAP2
692938[F], 692939[F], 692940[F], 692941[F], 30107[F], 30109[F], (55803) &
916485[F], 30108[F]
131823[F], 131824[F], 131825[F], 131826F], 131827[F], 131828[F], Adap2
131829[F], 131830[F], 131831[F], 131832[F], 131833[F], 131834[F] (216991) TABLE 2 - Page 30 of 1873
622463[F], 807450[F], 807451[F], 807452[F], 807455[F], 807457[F],
807458[F], 807459[F], 807460[F], 807462[F], 807463[F], 807465[F],
807466[F], 807467[F], 807468[F], 807469[F], 807470[F], 807471 [F], 622464[F], 807449[F], 807453[F], 807454[F], 807456[F], 807461 [F],
ADAR
807472[F], 622465(7593], 7641 [F], 377526[F], 377527[F], 377528[F], 807464[F], 622466(7593], 622467[-2180], 7642[F], 377525[F],
(103) & 377529[F], 377530[F], 377531[F], 377535[F], 377536[F], 377537[F], 377532[F], 377533[F], 377534[F], 377538[F], 377539[F], 377541 [F],
Adar 377540[F], 377543[F], 377545[F], 377546[F], 377547[F], 377548[F], 377542[F], 377544[F], 377549[F], 377552[F], 377555[F],
(56417) 377550[F], 377551[F], 377553[F], 377554[F], 377556[F], 377557[F], 7644(7262], 377564[-4038], 377565[-4108], 377532[-4474]
377558[F], 377559[F], 377560[F], 377561 [F], 377562[F], 377563[F],
7643[7262]
637141 [F], 676675[F], 676678[F], 676679[F], 676680]F], 676681 [F],
676682[F], 676683[F], 676684[F], 676687[F], 676688[F], 676692[F],
676697[F], 676698[F], 676700[F], 676701 [F], 676702[F], 676703[F],
676704[F], 676705[F], 676706[F], 676707[F], 676708[F], 676709[F],
676710[F], 676711[F], 676712[F], 676713[F], 676714[F], 27177[F],
637140[F], 676676[F], 676677[F], 676685[F], 676686[F], 676689[F], 99621 [F], 99624[F], 99626[F], 99627[F], 99628[F], 99629[F],
676690[F], 676691[F], 676693[F], 676694[F], 676695[F], 676696[F], ADARB1 99630[F], 99632[F], 99633[F], 99634[F], 99635[F], 99638[F],
676699[F], 27176[F], 99622[F], 99623[F], 99625[F], 99631 [F], (104) & 99639[F], 99640[F], 99641 [F], 99642[F], 99643[F], 99644[F],
99636[F], 99637[F], 99645[F], 99647[F], 99650[F], 99654[F], Adarbl 99646[F], 99648[F], 99649[F], 99651 [F], 99652[F], 99653[F],
99655[F], 99658[F], 99660[F], 99662[F], 99665[F], 99667[F], (110532) 99656[F], 99657[F], 99659[F], 99661 [F], 99663[F], 99664[F],
99673[F], 99676[F], 99682[F], 27178[-101], 99697[-2936]
99666[F], 99668[F], 99669[F], 99670[F], 99671 [F], 99672[F],
99674[F], 99675[F], 99677[F], 99678[F], 99679[F], 99680[F],
99681 [F], 99683[F], 99684[F], 99685[F], 99686[F], 99687[F],
99688[F], 99689[F], 99690[F], 99691 [F], 99692[F], 99693[F],
99694[F], 99695[F], 99696[F], 27179[-101], 99698[-4295]
642114[F 712306[F 712308[F] 712309[F] 712310[F] 712313[F]
642113[F], 712304[F], 712305[F] 712307[F] 712315[F], 712316[F]
712314[F 712317[F 712320[F] 712321 [F] 712322[F] 712323[F] 712318[F], 712319[F], 712326[F] 712327[F] 712329[F], 712330[F]
712324[F 712328[F; 712331 [F] 712334]F] 712335 [F] 712337[F] 712332[F], 712333[F], 712336[F] 712338[F] 712339]F], 712340[F]
712341[F 712342[F; 712343[F] 712346[F] 714509[F] 714510[F] 712344[F], 712345[F], 820897[F] 820898[F] 820899[F], 820900[F]
714511[F 714512[F; 33431[F], 72767[F], 72768[F], 172771 [F].
820901 [F], 33430[F], 72765[F], 72766[F], 72769[F], 172770[F],
172777[F 172779[F; 172780[F] 172781 [F] 172783[F] 172785[F] 172772[F], 172773[F], 172774[F] 172775[F] 172776[F], 172778[F]
172788[F 172791 [F; 172792[F] 172794[F] 172798[F] 172799[F] 172782[F], 172784[F], 172786[F] 172787[F] 172789[F], 172790[F]
172803[F 172804[F 172805[F] 172806[F] 172807[F] 172809[F] 172793[F], 172795[F], 172796[F] 172797[F] 172800[F], 172801[F] ADARB2
172811[F 172812[F 172815[F] 172816[F] 172818[F] 172819[F] 172802[F], 172808[F], 172810[F] 172813[F] 172814[F], 172817[F] (105) &
172826[F 172828[F 172829[F] 172830[F] 172831 [F] 172833[F] 172820[F], 172821[F], 172822[F] 172823[F] 172824[F], 172825[F] Adarb2
172835[F 172836[F 172839[F] 172840[F] 172841 [F] 172842[F] 172827[F], 172832[F], 172834[F] 172837[F] 172838[F], 172847[F] (94191)
172843[F 172844[F 172845[F] 172846[F] 172848[F] 172849[F] 172851[F], 172853[F], 172854[F] 172855[F] 172856[F], 172860[F]
172850[F 172852[F 172857[F] 172858[F] 172859[F] 172863[F] 172861[F], 172862[F], 172864[F] 172866[F] 172868[F], 172869[F]
172865[F 172867[F 172870[F] 172873[F] 172874[F] 172876[F] 172871[F], 172872[F], 172875[F] 172880[F] 172882[F], 172885[F]
172877[F 172878[F 172879[F] 172881 [F] 172883[F] 172884[F] 172886[F], 172890[F], 172891 [F] 172893[F] 172894[F], 172895[F]
172887[F 172888[F 172889[F] 172892[F] 172897[F] 172900[F] 172896[F], 172898[F], 172899[F] 172903[F] 172904[F], 172907[F]
172901 [F 172902[F 172905[F] 172906[F] 172909[F] 172912[F] 172908[F], 172910[F], 172911[F] 33432[-1647], 172914[-1859],
172913[F; 33433[-1647], 172915[-1943], 172916[-2112], 172918]- 1729171-2149]
3032]
ADARB2-
642114[F], 712317[F] 642113[F], 712318[F]
AS1
633956[F], 890807[F], 890808[F], 890809[F], 890810[F], 890811[F],
890812[F], 890813[F], 890814[F], 633957[-4374], 23072[F],
23073[F], 560042[F], 560043[F], 560044[F], 560045[F], 560046[F], ADAT1 560047[F], 560048[F], 560049[F], 560050[F], 560051 [F], 560052[F], (23536) & 560053[F], 560054[F], 560055[F], 560056[F], 560057[F], 560058[F], Adatl 560059[F], 560060[F], 560061[F], 560062[F], 560063[F], 560041]- (30947) 906], 560064[-984], 23074[-1135], 560040[-3273], 560039[-4104],
560065[-4224]
ADAT2
671275[F], 671276[F], 671277[F], 671279[F], 636414(22523], 671273[F], 671274[F], 671278[F], 671280[F], 636415(22523],
(134637) & 636411[-80], 26193[F], 86926[F], 86927[F], 86928[F], 86929[F], 636412[-80], 26194[F], 86924[F], 86925[F], 86933[F], 86935[F],
Adat2 86930[F], 86931[F], 86932[F], 86934[F], 26190(234] 86936[F], 26191(234], 26192[-3531]
(66757) ADAT3
637270[F], 677175[F], 27344[F], 100781[F], 100782[F], 100784[F], 637271[F], 27345[F], 100783[F], 100785[-472], 100786[-1480], (113179) & 100780[-1625], 100788[-3380] 100779[-2879], 100787[-3029], 100789[-3861] Adat3
(10011339
ADC
825583[F], 825584[F], 825585[F], 825586[F], 625000(39257],
(113451) & 10927[F], 415414[F], 415415[F], 415416[F], 415417[F], 415418[F],
Adc 415419[F], 415420[F], 415421[F], 415422[F], 415423[F]
(242669) TABLE 2 - Page 31 of 1873
641685[F], 641694[F], 641696[F], 708659[F], 708660[F], 708698[F],
641686[F], 641695[F], 641697[F], 708712[F], 708718[F], 708719[F], 708699[F], 708713[F], 708714[F], 708715[F], 708716[F], 708717[F],
708721[F], 708722[F], 708723[F], 708724[F], 708725[F], 32854[F], 708720[F], 708726[F], 708727[F], 708728[F], 708729[F], 708730[F], ADCK1
32856[F], 164973[F], 164976[F], 164977[F], 164980[F], 164981 [F], 32853[F], 32855[F], 164974[F], 164975[F], 164978[F], 164979[F], (57143) &
164984[F], 164985[F], 164986[F], 164993[F], 164994[F], 164995[F], 164982[F], 164983[F], 164987[F], 164988[F], 164989[F], 164990[F], Adckl
164996[F], 164999[F], 165000[F], 165001 [F], 165002[F], 165003[F], 164991 [F], 164992[F], 164997[F], 164998[F], 165004[F], 165007[F], (72113)
165005[F], 165006[F], 165011 [F], 165014[F], 165015[F],
165008[F], 165009[F], 165010[F], 165012[F], 165013[F], 165016[F],
32823(46159]
165017[F], 32822(46159]
628395[F], 628397[F], 851349[F], 851351 [F], 851352[F], 851355[F], 662288339966[[FF]],, 662288339988[[FF]],, 885511335500[[FF]],, 885511335533[[FF]],, 885511335544[[FF]],, 885511335566[[FF]],, ADCK2
851358[F], 15436[F], 474114[F], 474116[F], 474117[F], 474119[F], 885511335577[[FF]],, 885511334488[[--335588]],, 1155443377[[FF]],, 447744111133[[FF]],, 447744111155[[FF]],, (90956) &
474122[F], 474126[F], 15438(4679], 474127[-264], 474128[-338], 447744111188[[FF]],, 447744112200[[FF]],, 447744112211 [[FF]],, 447744112233[[FF]],, 447744112244[[FF]],, 447744112255[[FF]],, Adck2
474130[-4095] 1155443399((44667799]],, 447744112299[[--884444]] (57869)
618535[F], 668498[F], 668499[F], 668502[F], 668503[F], 668505[F],
ADCK3 668506[F], 668508[F], 618533[-2319], 668497[-4320], 2676[F],
618534[F], 668500[F], 668501 [F], 668504[F], 668507[F], 2675[F], (56997) & 81345[F], 81346[F], 81347[F], 81350[F], 81351 [F], 81353[F],
81348[F], 81349[F], 81352[F], 81355[F], 81357[-1929], 81355[-1983] Adck3 81354[F], 81356[F], 2674[532], 81344[-1422], 81354[-1658], 81356[-
(67426) 24731
630340[F], 866059[F], 866060[F], 866062[F], 866063[F], 866065[F],
866066[F], 926695[36], 926696[-133], 630338[-217], 866067[-1964], 630341[F], 866058[F], 866061 [F], 866064[F], 866058[15], 630339]- ADCK4
866068[-2133], 926698[-3022], 926700[-4698], 18309[F], 18311[F], 217], 866057[-1194], 926697[-2068], 866069[-4068], 926699[-4698], (79934) &
506622[F], 506623[F], 506625[F], 506627[F], 506630[F], 506631 [F], 18310[F], 18312[F], 506624[F], 506626[F], 506628[F], 506629[F], Adck4 506632[F], 506633[F], 506635[F], 506636[F], 506637[-1882], 506638 506634[F], 506621[24], 506639[-3798], 18308[-4340] (76889) 2047], 183071-4340], 506640[-4737]
738125[F], 738127[F], 916544[F], 927531 (923], 645558(280], 645557[F], 738126[F], 645559(280], 738128[-686], 738129[-1467], ADCK5 829221 [-1077], 738130[-3379], 38427[F], 234096[F], 234097[F], 738131[-3453], 38428[F], 234095[F], 234098[F], 234099[F], (203054) & 234100[F], 234101[F], 234102[F], 234103[F], 234106[F], 234108[F], 234104[F], 234105[F], 234107[F], 38430(281], 234109( 646], Adck5 38429(281], 234111 [-3242] 234110[-1439], 234112[-3316] (268822)
638191 [F], 683402[F], 683403[F], 683404[F], 683406[F], 683407[F],
683408[F], 683411[F], 683412[F], 683413[F], 683414[F], 683415[F],
683416[F], 683417[F], 683418[F], 683422[F], 683423[F], 683424[F], 638192[F], 683405[F], 683409[F], 683410[F], 683419[F], 683420[F],
ADCY1 683425[F], 683427[F], 683428[F], 683429[F], 28523[F], 113760[F], 683421 [F], 683426[F], 28524[F], 113763[F], 113766[F], 113770[F],
(107) & 113761 [F], 113762[F], 113764[F], 1 13765[F], 113767[F], 113768[F], 113771 [F], 113777[F], 113784[F], 1 13785[F], 113786[F], 113787[F],
Adcyl 113769[F], 113772[F], 113773[F], 1 13774[F], 113775[F], 113776[F], 113791 [F], 113792[F], 113794[F], 1 13795[F], 113799[F], 113800[F],
(432530) 113778[F], 113779[F], 113780[F], 1 13781 [F], 113782[F], 113783[F], 113801 [F], 113802[F], 113804[F], 1 13806[F]
113788[F], 113789[F], 113790[F], 1 13793[F], 113796[F], 113797[F],
113798[F], 113803[F], 113805[F], 1 13807[F], 113808[F], 113809[F]
618270[F], 666831[F], 666834[F], 666835[F], 666838[F], 666839[F],
618271[F], 666830[F], 666832[F], 666833[F], 666836[F], 666837[F], ADCY10 6182691-2459], 666829[-4007], 2366[F], 78156[F], 78157[F],
2367[F], 78158[F], 78163[F], 78165[F], 78167[F], 78168[F], (55811 ) & 78159[F], 78160[F], 78161 [F], 78162[F], 78164[F], 78166[F],
78171 [F], 78172[F], 78173[F], 78176[F], 78177[F], 78179[F], Adcyl 0 78169[F], 78170[F], 78174[F], 78175[F], 78178[F], 78181 [F],
78180[F] (271639) 78182[F], 78183[F], 78184[F], 78185[F], 2365[-3967], 78155[-4137]
717832[F], 717833[F], 717834[F], 717835[F], 717836[F], 717842[F],
717837[F], 717838[F], 717839[F], 717840[F], 717841 [F], 717843[F], 717844[F], 717845[F], 71 846[F], 71 849[F], 717851 [F],
717848[F], 71 850[F], 717852[F], 642943(431316], 642941 [-407], 642944(431316], 642946(1241], 717853(0], 642942[-407], 717854]- 34718[F], 187953[F], 187954[F], 187956[F], 187957[F], 187963[F], 1936], 34719[F], 34720[F], 187955[F], 187958[F], 187959[F], ADCY2
187966[F], 187967[F], 187968[F], 187969[F], 187970[F], 187972[F], 187960[F], 187961[F], 187962[F], 187964[F], 187965[F], 187971 [F], (108) &
187973[F], 187974[F], 187976[F], 187978[F], 187980[F], 187981 [F], 187975[F], 187977[F], 187979[F], 187982[F], 187983[F], 187986[F], Adcy2
187984[F], 187985[F], 187987[F], 187989[F], 187991 [F], 187994[F], 187988[F], 187990[F], 187992[F], 187993[F], 187999[F], 188001 [F], (210044)
187995[F], 187996[F], 187997[F], 187998[F], 188000[F], 188005[F], 188002[F], 188003[F], 188004[F], 188007[F], 188008[F], 188010[F],
188006[F], 188009[F], 188012[F], 188013[F], 188014[F], 188015[F], 188011 [F], 188016[F], 188017[F], 188019[F], 188022[F],
188018[F], 188020[F], 188021 [F]
34721 (1320], 188023[-1317]
640754[F], 701382[F], 701384[F], 701387[F], 701388[F], 701389[F],
640753[F], 701380[F], 701381[F], 701383[F], 701385(F], 701386(F),
701390[F], 701392[F], 701393[F], 701394[F], 701397[F], 701399[F], 701391 [F], 701395[F], 701396[F], 701398[F], 640755(3207],
640756(3207], 701400[-302], 31571 [F], 147301 [F], 147304[F], ADCY3 31570[F], 147299[F], 147300[F], 147302[F], 147303[F], 147306[F],
147305[F], 147308[F], 147312[F], 147313[F], 147314[F], 147315[F], (109) & 147307[F], 147309[F], 147310[F], 147311 [F], 147317[F], 147318[F],
147316[F], 147324[F], 147325[F], 147326[F], 147327[F], 147328[F], Adcy3 147319[F], 147320[F], 147321[F], 147322[F], 147323[F], 147334[F],
147329[F], 147330[F], 147331 [F], 147332[F], 147333[F], 147335[F], (104111 ) 147336[F], 147340[F], 147341[F], 147342[F], 147343[F], 147345[F],
147337[F], 147338[F], 147339[F], 147344[F], 147346[F],
31572(16723]
31573(16723], 147347[-193], 147348[-4433]
727300[F], 727303[F], 727305[F], 727307[F], 727308[F], 727309[F],
ADCY4 727310[F], 644221(16719], 644219[-1401], 727299[-2212], 644218]- 727301[F], 727302[F], 727304[F], 727306[F], 644220(16719],
(196883) & 4193], 36631[F], 210516[F], 210520[F], 210522[F], 210524[F], 644217[-4193], 36630[F], 210517[F], 210518[F], 210519[F],
Adcy4 210525[F], 210526[F], 210527[F], 36629[-596], 210515[-1362], 210521 [F], 210523[F], 36627[-3952]
(104110) 36628[-3952] TABLE 2 - Page 32 of 1873
646886[F], 646887[F], 646888[F], 747776[F], 747777[F], 7 4 7780[F], 747781[F], 747782[F], 747783[F], 747785[F], 747787[F], 7 4 7795[F],
646885[F], 747775[F], 747778[F], 747779[F], 747784[F], 747786[F],
747802[F], 747803[F], 747804[F], 747805[F], 747806[F], 747807[F], 747788[F], 747789[F], 747790[F], 747791 [F], 747792[F], 747793[F],
747808[F], 747810[F], 747812[F], 747813[F], 747814[F], 747815[F], 747794[F], 747796[F], 747797[F], 747798[F], 747799[F], 747800[F],
747816[F], 747819[F], 747820[F], 747821 [F], 747822[F], 747823[F], 747801 [F], 747809[F], 747811[F], 747817[F], 747818[F], 747824[F],
747825[F], 747826[F], 747774[-925], 747773[-1458], 40040[F], ADCY5 747789[-3142], 747788[-3920], 40039[F], 253667[F], 253670[F],
40041 [F], 40042[F], 253668[F], 253669[F], 253672[F], 253673[F], (111 ) & 253671 [F], 253676[F], 253677[F], 253679[F], 253680[F], 253681 [F],
253674[F], 253675[F], 253678[F], 253686[F], 253687[F], 253689[F], Adcy5 253682[F], 253683[F], 253684[F], 253685[F], 253688[F], 253690[F],
253691[F], 253695[F], 253703[F], 253705[F], 253707[F], 253708[F], (224129) 253692[F], 253693[F], 253694[F], 253696[F], 253697[F], 253698[F],
253710[F], 253711[F], 253712[F], 253713[F], 253716[F], 253718[F], 253699[F], 253700[F], 253701[F], 253702[F], 253704[F], 253706[F],
253720[F], 253721[F], 253722[F], 253723[F], 253724[F], 253725[F], 253709[F], 253714[F], 253715[F], 253717[F], 253719[F], 253726[F],
253729[F], 253730[F], 253731 [F], 253732[F], 253733[F], 253735[F], 253727[F], 253728[F], 253734[F], 253739[F], 253664[-3826]
253736[F], 253737[F], 253738[F], 253740[-184], 253666[-470],
253741[-842], 253665[-1022]
646089[F], 741823[F], 741824[F], 741825[F], 741826[F], 741827[F],
741828[F], 741830[F], 741831[F], 741832[F], 741833[F], 741834[F],
741835[F], 741836[F], 741837[F], 741839[F], 741842[F], 741843[F],
ADCY6 741844[F], 646087[-405], 7 4 1842[-1952], 741843[-2840], 741844[- 646088[F], 741829[F], 741838[F], 741840[F], 741841 [F], 646086[- (112) & 45 4 0], 39087[F], 241590[F], 241591 [F], 241592[F], 241593[F], 405], 39086[F], 241597[F], 241606[F], 241608[F], 241609[F], 39084|
Adcy6 241594[F], 241595[F], 241596[F], 241598[F], 241599[F], 241600[F], 400], 241588[-4943]
(11512) 241601 [F], 241602[F], 241603[F], 241604[F], 241605[F], 241607[F],
2 4 1610[F], 241611[F], 241612[F], 241613[F], 241614[-11], 39085[- 400], 241615[-1361], 241589[-2426]
633551 [F], 887604[F], 887605[F], 887607[F], 887609[F], 887611 [F], 633552[F], 887603[F], 887606[F], 887608[F], 887610[F],
887612[F], 887613[F], 887614[F], 633553[-885], 22576[F], 925914(1718], 887615[-282], 633554[-885], 887616[-1813], 887617]- ADCY7 553851 [F], 553852[F], 553853[F], 553855[F], 553856[F], 553857[F], 2640], 22577[F], 553854[F], 553858[F], 553859[F], 553861 [F], (113) & 553860[F], 553866[F], 553867[F], 553868[F], 553870[F], 553874[F], 553862[F], 553863[F], 553864[F], 553865[F], 553869[F], 553871 [F], Adcy7 553876[F], 553877[F], 553878[F], 553879[F], 553857[-609], 22578[- 553872[F], 553873[F], 553875[F], 553858[-457], 22579[-634], (11513) 634], 553856[-4752], 553855[-4885] 553880[-1012], 553881 [-2977], 553882[-4252]
645407[F], 645408[F], 737062[F], 737063[F], 737069[F], 737070[F], 645406[F], 737064[F], 737065[F], 737066[F], 737067[F], 737068[F], 737071 [F], 737072[F], 737073[F], 737074[F], 737077[F], 737078[F], 737075[F], 737076[F], 737079[F], 737080[F], 737082[F], 737083[F],
ADCY8 737081 [F], 737085[F], 737086[F], 38222[F], 38223[F], 231849[F], 737084[F], 38221[F], 231848[F], 231852[F], 231853[F], 231855[F],
(114) & 231850[F], 231851[F], 231854[F], 231859[F], 231861 [F], 231862[F], 231856[F], 231857[F], 231858[F], 231860[F], 231867[F], 231868[F],
Adcy8 231863[F], 231864[F], 231865[F], 231866[F], 231872[F], 231873[F], 231869[F], 231870[F], 231871 [F], 231879[F], 231881 [F], 231882[F],
(11514) 231874[F], 231875[F], 231876[F], 231877[F], 231878[F], 231880[F], 231883[F], 231884[F], 231885[F], 231889[F], 231890[F], 231891 [F], 231886[F], 231887[F], 231888[F], 231897[F], 231898[F] 231892[F], 231893[F], 231894[F], 231895[F], 231896[F]
646339[F], 743343[F], 743344[F], 743345[F], 743346[F], 743348[F],
743351 [F], 743356[F], 743357[F], 743361 [F], 743363[F], 743364[F],
743347[F], 743349[F], 743350[F], 743352[F], 743353[F], 743358[F], 743365[F], 743366[F], 743367[F], 743368[F], 743369[F], 743370[F],
743359[F], 743360[F], 743362[F], 743371 [F], 916550[F],
919610(1923], 743372[-77], 39376[F], 244173[F], 244174[F],
919609[1832], 919608[98], 743342[-168], 743341 [-1902], 39375[F], 244175[F], 244176[F], 244177[F], 244179[F], 244183[F], 244186[F], ADCY9
244178[F], 244180[F], 244181 [F], 244182[F], 244184[F], 244185[F], 244188[F], 244189[F], 244192[F], 244195[F], 244196[F], 244197[F], (115) &
244187[F], 244190[F], 244191 [F], 244193[F], 244194[F], 244199[F], 244198[F], 244200[F], 244202[F], 244203[F], 244207[F], 244208[F], Adcy9
244201[F], 244204[F], 244205[F], 244206[F], 244209[F], 244210[F], 244212[F], 244213[F], 244215[F], 244217[F], 244218[F], 244219[F], (11515)
244211[F], 244214[F], 244216[F], 244222[F], 244228[F], 244230[F], 244220[F], 244221[F], 244223[F], 244224[F], 244225]F], 244226[F],
244232[F], 244241[F], 39373[-1938], 244171 [-2832], 244170[-3017] 244227[F], 244229[F], 244231[F], 244233[F], 244234[F], 244235[F],
244169[-4337], 244168[-4806]
244236[F], 244237[F], 244238[F], 244239[F], 244240[F], 244242]- 660], 2441721-1544], 39374[-1938]
ADCYAP1 (116) &
763741 [F], 648925(7224], 42849[F], 288016[F]
Adcyapl (1 1516)
628652[F], 853297[F], 853298[F] 853301 [F], 853302[F], 853304[F],
628653[F], 853299[F], 853300[F], 853303[F], 853305[F], 853307[F], ADCYAP1 853306[F], 853308[F], 853309[F] 853310[F], 853314[F], 853315[F],
853311[F], 853312[F], 853313[F], 853319[F], 853320[F], 853321 [F], R1 (117) & 853316[F], 853317[F], 853318[F] 15746[F], 478055[F], 478056[F],
15747[F], 478057[F], 478058[F], 478061 [F], 478063[F], 478065[F], Adcyap1 r1 478059[F], 478060[F], 478062[F] 478064[F], 478066[F], 478067[F],
478069[F], 478070[F], 478071 [F], 478077[F], 478078[F], 478079[F] (11517) 478068[F], 478072[F], 478073[F] 478074[F], 478075[F], 478076[F] TABLE 2 - Page 33 of 1873
626203[F], 835094[F], 835095[F], 835096[F], 835097[F], 835100[F],
835101 [F], 835102[F], 835104[F], 835105[F], 835106[F], 835107[F],
835108[F], 835109[F], 835110[F], 835111[F], 835113[F], 835115[F],
835118[F], 835119[F], 835120[F], 835121 [F], 835123[F], 835124[F], 626204[F], 835093[F] 835098[F], 835099[F], 835103[F], 835112[F], 835125[F], 835126[F], 835127[F], 626205[-479], 835129[-1761], 835114[F], 835116[F] 835117[F], 835122[F], 835128[F], 12531[F], ADD1 835130[-2379], 12530[F], 438496[F], 438497[F], 438498[F], 438495[F], 438501 [F] 438502[F], 438506[F], 438507[F], 438509[F], (118) & 438499[F], 438500[F], 438503[F], 438504[F], 438505[F], 438508[F], 438511[F], 438513[F] 438517[F], 438518[F], 438521 [F], 438524[F], Add1 438510[F], 438512[F], 438514[F], 438515[F], 438516[F], 438519[F], 438529[F], 438531 [F] 438533[F], 438534[F], 438539[F], 438541[F], (11518) 438520[F], 438522[F], 438523[F], 438525[F], 438526[F], 438527[F], 438547[F]
438528[F], 438530[F], 438532[F], 438535[F], 438536[F], 438537[F],
438538[F], 438540[F], 438542[F], 438543[F], 438544[F], 438545[F],
438546[F], 12532[-1335], 438548[-2557], 438549[-3168]
628937[F], 628939[F], 855579[F], 855581 [F], 855584[F], 855585[F],
628936[F], 628938[F], 855578[F], 855580[F], 855582[F], 855583[F]. 855589[F], 855592[F], 855593[F], 855594[F], 855595[F], 855596[F],
ADD2 855586[F], 855587[F], 855588[F], 855590[F], 855591 [F], 855600]- 855597[F], 855598[F], 855599[F], 920960(2033], 855577[33],
(119) & 1505], 855601 [-4078], 16163[F], 16165[F], 484021 [F], 484023[F], 855595[-3393], 855602[-4372], 855596[-4542], 16164[F], 16166[F],
Add2 484025[F], 484026[F], 484028[F], 484029[F], 484032[F], 484043]- 484022[F], 484024[F], 484027[F], 484030[F], 484031 [F], 484033[F],
(11519) 1545], 484019[-2846], 484044[-3546], 484045[-3663], 484018[-4237] 484034[F], 484035[F], 484036[F], 484037[F], 484038[F], 484039[F],
484040[F], 484041[F], 484042[F], 484020[-1069], 484046[-3951]
650938[F], 779671[F], 779672[F], 779673[F], 779674[F], 779676[F],
779678[F], 779679[F], 779681[F], 779682[F], 779683[F], 779684[F],
779685[F], 779686[F], 779687[F], 779689[F], 779690[F], 779691 [F],
779692[F], 779693[F], 779695[F], 779696[F], 779699[F], 779700[F],
779701 [F], 779702[F], 779704[F], 779705[F], 779706[F], 779707[F],
650939[F], 779670[F] 779675[F], 779677[F], 779680[F], 779688[F], 779708[F], 779711[F], 779712[F], 779714[F], 779716[F], 779717[F],
779694[F], 779697[F] 779698[F], 779703[F], 779709[F], 779710[F], 779718[F], 779719[F], 779672[-358], 779671[-979], 650940[-2021],
779713[F], 779715[F] 779670[-1470], 650941 [-2021], 45342[F], ADD3 45341 [F], 319615[F], 319616[F], 319619[F], 319620[F], 319621 [F],
319614[F], 319617[F] 319618[F], 319623[F], 319625[F], 319628[F], (120) & 319622[F], 319624[F], 319626[F], 319627[F], 319629[F], 319630[F],
319636[F], 319637[F] 319642[F], 319645[F], 319647[F], 319653[F], Add3 319631[F], 319632[F], 319633[F], 319634[F], 319635[F], 319638[F],
319656[F], 319657[F] 319661[F], 319668[F], 319669[F], 319670[F], (27360) 319639[F], 319640[F], 319641[F], 319643[F], 319644[F], 319646[F],
319678[F], 319680[F] 319684[F], 319686[F], 45344[-1110], 319614| 319648[F], 319649[F], 319650[F], 319651[F], 319652[F], 319654[F],
1698], 319691 [-3863]
319655[F], 319658[F], 319659[F], 319660[F], 319662[F], 319663[F],
319664[F], 319665[F], 319666[F], 319667[F], 319671 [F], 319672[F],
319673[F], 319674[F], 319675[F], 319676[F], 319677[F], 319679[F],
319681[F], 319682[F], 319683[F], 319685[F], 319687[F], 319688[F],
319689[F], 319690[F], 319616[-556], 45343[-1110], 319615[-1168]
812630[F], 928743[F]
ADH1 C
623293[F], 812631[F], 8660[F], 387739[F], 387740[F], 8662[9285], 623294[F], 928413(1480], 812629[-520], 8661[F], 387738[F],
(126) & 3877411-1078], 387742[-1963], 387736[-2720], 38774 4 [-3209] 8663[9285], 387737[-463], 387743[-2976]
Ad 1 ADH4
623297[F], 8670[F], 387764[F], 387765[F] 623298[F], 8671 [F], 387763[F]
(127) &
623299[F], 812634[F], 812635[F], 812637[F], 812638[F], 812640[F],
ADH5 812641[F], 812644[F], 812645[F], 8672[F], 387767[F], 387769[F], 623300[F], 812636[F], 812639[F], 8673[F], 387768[F], 387773[F],
(128) & 387770[F], 387771[F], 387772[F], 387774[F], 387775[F], 387778[F], 387776[F], 387777[F], 387780[F], 387781 [F], 8675[-3450], 387785[- Adh5 387779[F], 387782[F], 387783[F], 387784[F], 8674[-3450], 387788[- 3474], 387786[-3571], 387787[-3915]
(11532) 4 235l
rt nc
623295[F], 812633[F] 623296[F], 811170[F], 812632[F] Qn\
623291[F], 623292[F], 623292(23105], 812627[-594], 8658[F], ADH7 8659[F], 387728[F], 387729[F], 387727[-836 (131) &
616462[F], 616465[F], 652486[F], 652487[F], 652488[F], 652491 [F],
6164641-1276], 652485[-1858], 652484[-1996], 652483[-2273],
833703[-2273], 833698[-2273], 652482[-2435], 833697[-2438], ADHFE1
616463[F], 616466[F], 652489[F], 652490[F], 930019[-1600],
833702[-2441], 802301 [-2478], 652481 [-2850], 652480[-3087], 59[F], (137872) &
652479[-3600], 60[F], 48222[F], 48223[F], 48225[F], 48227[F].
48220[F], 48221 [F], 48224[F], 48226[F], 48228[F], 48229[F], Adhfel
48230[F], 62(17138], 57[-1458], 48213[-2768], 48212[-3240]
48231 [F], 61[17138], 58[-587], 48219[-1110], 48218[-1218], 48217[- (76187) 1444], 56[-1458], 48216[-1606], 48215[-2021], 48214[-2258], 48211[- 41981
ADI1
640960[F], 31938[F], 152983[F], 152985[F], 152986[F], 152988[F] 640961[F], 31939[F], 152982[F], 152984[F], 152987[F] (55256) &
Adi1
621156[F], 6211521-2111], 621154[-2333], 798828[-2512], 798827[- 621157[F], 6211531-2111], 798829[-2280], 621155[-2333], 798826[- ADIG 4645], 5871 [F], 357184[F], 357185[F], 5867[-3129], 357182[-3535], 4691], 5872[F], 357186[F], 357187[F], 5868[-3129], 357183[-3287], (149685) & 5873[-4596], 357188[-4634 5874[-4596] Adig
ADIPOQ
(9370) &
646696[F], 746054[F], 746055[F], 39821 [F], 250229[F], 250232[F] 646697[F], 746056[F], 39822[F], 250230[F], 250231 [F], 250233[F]
Adipoq (11450) TABLE 2 - Page 34 of 1873
ADIPOR1
617870[F], 617868[-3298], 663649[-3315], 663648[-3422], 6636 4 7[- 617869[F], 617871[F], 663650[F], 663651 [F], 663652[F], 911835[F],
(51094) & 3650], 663646[-3711], 663645[-3919], 1883[F], 1881 [-3727], 72104[- 617869[17563], 1882[F], 72105[F], 72106[F], 72107[F], 72108[F],
Adiporl 3741], 72103[-3848], 72102[-4084], 72101[-4142], 72100[-4353] 72109[-870], 1884[-3285], 72110[-4648]
(72674)
629341 [F], 859869[F], 859870[F] 859871 [F], 859872[F], 859874[F],
859875[F], 859876[F], 859877[F] 859878[F], 859879[F], 859880[F],
859881 [F], 859882[F], 859883[F] 859884[F], 859885[F], 859886[F],
859887[F], 859888[F], 859889[F] 859890[F], 859891 [F], 859892[F],
859893[F], 859894[F], 859895[F] 859897[F], 859899[F], 859901 [F],
859902[F], 859903[F], 859904[F] 859906[F], 859907[F], 921201 [-
274], 921202[-2012], 859909[-2274], 629337[-3277], 859910[-4012],
629340[F], 859873[F], 859896[F], 859898[F], 859900[F], 859905[F], 16652[F], 492406[F], 492407[F], 492408[F], 492409[F], 492411[F],
921200(1706], 859908[-294], 629336[-3277], 16651[F], 492410[F],
492412[F], 492413[F], 492414[F] 492415[F], 492416[F], 492417[F], ADIPOR2
492429[F], 492438[F], 492439[F], 492441 [F], 492443[F], 492445[F], 492418[F], 492419[F], 492420[F] 492421 [F], 492422[F], 492423[F], (79602) &
492450[F], 492454[F], 492457[F], 492466[F], 492469[F], 492479[F], 492424[F], 492425[F], 492426[F] 492427[F], 492428[F], 492430[F], Adipor2
492481[F], 492484[F], 492485[F], 492487[F], 492489[F], 492490[F], 492431 [F], 492432[F], 492433[F] 492434[F], 492435[F], 492436[F], (68465)
492491[F], 492495[F], 16647[-741], 492405[-1499], 492403[-2741], 492437[F], 492440[F], 492442[F] 492444[F], 492446[F], 492447[F],
492402[-3791]
492448[F], 492449[F], 492451[F] 492452[F], 492453[F], 492455[F],
492456[F], 492458[F], 492459[F] 492460[F], 492461 [F], 492462[F],
492463[F], 492464[F], 492465[F] 492467[F], 492468[F], 492470[F],
492471 [F], 492472[F], 492473[F] 492474[F], 492475[F], 492476[F],
492477[F], 492478[F], 492480[F] 492482[F], 492483[F], 492486[F],
492488[F], 492492[F], 492493[F] 492494[F], 492496[F], 492497[F],
492498[F], 16648[-741], 492404[-1774]
643660[F], 643662[F; 723266[F] 723268[F] 723269[F] 723270 [F],
723271 [F], 723272[F; 723274[F] 723275[F; 723276[F] 723277[F],
723279[F], 723281[F 723282[F] 723283[F; 723285[F] 723286[F],
723287[F], 723288[F; 723289[F] 723290[F; 723291 [F] 723292[F],
723294[F], 723295[F 723296[F] 723297[F; 723298[F] 723301 [F],
723302[F], 723303[F " 723306[F] 723307[F 723310[F] 723311[F],
723313[F], 723314[F; 723315[F] 723316[F 723318[F] 723319[F],
723320[F], 723323[F " 723324[F] 723326[F 723327[F] 723328[F], 643661[F], 643663[F], 723267[F], 723273[F], 723278[F], 723280[F], 723329[F], 723330[F; 723331 [F] 723333[F; 723337[F] 723338[F], 723284[F], 723293[F], 723299[F], 723300[F], 723304[F], 723305[F], 723339[F], 723342[F " 723343[F] 723345[F 723346[F] 723347[F], 723308[F], 723309[F], 723312[F], 723317[F], 723321 [F], 723322[F], 723348[F], 723350[F; 723351 [F] 723352[F 723353[F] 643659[- 723325[F], 723332[F], 723334[F], 723335[F], 723336[F], 723344[F], 36], 35782[F], 35784 F], 201534[F], 201535 F], 201538[F] 723349[F], 723273[-921], 35783[F], 35785[F], 201536[F], 201537[F] 201539[F], 201540[F; 201541 [F] 201542[F 201543[F] 201544[F] 201545[F], 201546[F], 201547[F], 201548[F], 201555[F], 201558[F], 201549[F], 201550[F; 201551[F] 201552[F 201553[F] 201554[F] 201563[F], 201566[F], 201567[F], 201569[F], 201577[F], 201578[F], 201556[F], 201557[F; 201559[F] 201560[F; 201561 [F] 201562[F] 201581[F], 201584[F], 201587[F], 201589]F], 201595[F], 201599[F],
ADK (132) 201564[F], 201565[F; 201568[F] 201570[F; 201571 [F] 201572[F] 201607[F], 201609[F], 201615[F], 201622[F], 201630[F], 201632[F],
& Adk 201573[F], 201574[F; 201575[F] 201576[F 201579[F] 201580[F] 201633[F], 201642[F], 201643[F], 201646[F], 201647[F], 201648[F],
(11534) 201582[F], 201583[F; 201585[F] 201586[F 201588[F] 201590[F] 201652[F], 201655[F], 201657[F], 201658[F], 201660[F], 201661[F], 201591 [F], 201592[F; 201593[F] 201594[F 201596[F] 201597[F] 201668[F], 201669[F], 201673[F], 201674[F], 201676[F], 201677[F], 201598[F], 201600[F " 201601[F] 201602[F 201603[F] 201604[F] 201683[F], 201687[F], 201689[F], 201693[F], 201694[F], 201696[F], 201605[F], 201606[F; 201608[F] 201610[F 201611 [F] 201612[F] 201697[F], 201698[F], 201699[F], 201701[F], 201705[F], 201712[F], 201613[F], 201614[F " 201616[F] 201617[F 201618[F] 201619[F] 201716[F], 201717[F], 201718[F], 201725[F], 201726[F], 201729[F], 201620[F], 201621[F 201623[F] 201624[F 201625[F] 201626[F] 201731[F], 201732[F], 201548[-1026], 201736[-1048], 35787[-1378], 201627[F], 201628[F " 201629[F] 201631 [F 201634[F] 201635[F] 201737[-1518], 201738[-2367], 201740[-4049], 201547[-4074],
201636[F], 201637[F; 201638[F] 201639[F 201640[F] 201641 [F] 201741 [-4325], 201742[-4628], 201744[-4771]
201644[F], 201645[F " 201649[F] 201650[F 201651 [F] 201653[F]
201654[F], 201656[F; 201659[F] 201662[F 201663[F] 201664[F]
201665[F], 201666[F " 201667[F] 201670[F 201671 [F] 201672[F]
201675[F], 201678[F; 201679[F] 201680[F 201681 [F] 201682[F]
201684[F], 201685[F; 201686[F] 201688[F; 201690[F] 201691 [F]
201692[F], 201695[F; 201700[F] 201702[F 201703[F] 201704[F]
?ni7nfiiFl ?01707iFl ?oi7nsrFi ?oi7nsrFi ?oi7inrFi ?ni7i iiFi
631708[F], 874695[F], , 932564[1055], 932563[734], 874694[-945], ADM (133)
932562[-984], 874692[-2984], 20156[F], 525373[-2816], 525372[- 874693[-1266], 20155[F], 20157[F], 525376[F], 525375[-897], & Adm
3758], 525371 [-3903]
525374[-1166] (11535)
ADM2
740785[F], 645947(1754], 645948[-365], 740786[-2812], 38915[F],
(79924) & 239279[F]
Adm2 TABLE 2 - Page 35 of 1873
621368[F], 800475[F], 800476[F], 800477[F], 800478[F], 800480[F],
800481 [F], 800482[F], 800483[F], 800484[F], 800486[F], 800491 [F],
800492[F], 800493[F], 800494[F], 800495[F], 800496[F], 800497[F],
800498[F], 800499[F], 800500[F], 800501 [F], 800502[F], 800503[F],
800505[F], 800506[F], 800507[F], 800508[F], 800509[F], 800510[F],
924652[1664], 924654(1571], 926886[-109], 800512[-336], 800514[- 621367[F], 800479[F], 800485[F], 800487[F], 800488[F], 800489[F],
ADNP
429], 800515[-2109], 6139[F], 360258[F], 360259[F], 360260[F], 800490[F], 800504[F], 800511[F], 924653(1601], 926887[-210],
(23394) & 360261 [F], 360263[F], 360264[F], 360265[F], 360266[F], 360267[F], 800513[-399], 800516[-2210], 6138[F], 360262[F], 360268[F],
Adnp 360269[F], 360274[F], 360275[F], 360276[F], 360277[F], 360278[F], 360270[F], 360271[F], 360272[F], 360273[F], 360295[F], 360303[F],
(11538) 360279[F], 360280[F], 360281[F], 360282[F], 360283[F], 360284[F], 360310[F], 360312[-18], 360316[-1794]
360285[F], 360286[F], 360287[F], 360288[F], 360289[F], 360290[F],
360291 [F], 360292[F], 360293[F], 360294[F], 360296[F], 360297[F],
360298[F], 360299[F], 360300[F], 360301 [F], 360302[F], 360304[F],
360305[F], 360306[F], 360307[F], 360308[F], 360309[F], 360311[F],
3603131-48], 360314[-1505], 360315[-1691]
649855[F], 771509[F], 771510[F], 771511[F], 771512[F], 771513[F],
771514[F], 771515[F], 771516[F], 771517[F], 771518[F], 771519[F],
771520[F], 771521[F], 771522[F], 771523[F], 771524[F], 771525[F],
ADNP2 771526[F], 771527[F], 44014[F], 304165[F], 30416B[F], 3041B7[F],
(22850) & 304168[F], 304169[F], 304170[F], 304171 [F], 304172[F], 304173[F], 678275[F], 925706[F]
Adnp2 304174[F], 304175[F], 304176[F], 304177[F], 304178[F], 304179[F],
(240442) 304180[F], 304181[F], 304182[F], 304183[F], 304184[F], 304185[F],
304186[F], 304187[F], 304188[F], 304189[F], 304190[F], 304191 [F],
304192[F], 304193[F], 304194[F], 304164[-447]
ADO
637002[-3515], 675566[-4503], 26993[-2321], 96937[-3314], 96936[- (84890) & 4258], 96935[-4343], 96934[-4476], 96933[-4645], 96932[-4716]
Ado
617862[F], 663601[F], 663604[F], 663605[F], 663606[F], 663607[F], 617861[F], 663602[F], 663603[F], 663608[F], 663610[F], 663612[F], ADORA1 663609[F], 663611[F], 617860[-404], 663600[-707], 663599[-3150], 663613[F], 617859[-404], 663598[-4779], 1874[F], 72039[F], (134) & 1875[F], 72037[F], 72038[F], 72041 [F], 72042[F], 72043[F], 72044[F], 72040[F], 72046[F], 72048[F], 72049[F], 72051[F], 72052[F], Adoral 72045[F], 72047[F], 72050[F], 1873(2017], 72036[-924], 1866[-3260] 1872(2017], 72035[-2345], 1865[-3260], 72034[-3381] (11539)
676279[F], 676280[F], 676281[F], 676282[F], 637077(14793], ADORA2A 676277[-928], 676276( 3267], 27090[F], 98615[F], 98616[F], (135) &
676278[F], 637078[14793], 27091 [F], 98617[F], 27089[-41£
98618[F], 98619[F], 98620[F], 98621 [F], 98622[F], 27088[-4198], Adora2a 986141-4556] (11540)
ADORA2B
688962[F], 688963[F], 688966[F], 638914(30791], 638916[-1517],
688964[F], 688965[F], 688967[F], 638915(30791], 29488[F], (136) & 29487[F], 125173[F], 125174[F], 125178[F], 125179[F], 125180[F],
125175[F], 125176[F], 125177[F], 125181[F] Adora2b 29489[-770], 125182[-2750], 125183[-3335]
(11541)
622863[F], 809912[F], 809914[F], 809915[F], 809917[F], 809918[F],
809919[F], 921915[F], 921917[F], 921918[F], 809917[-1827], 809918 ADORA3
622864[F], 809913[F], 809916[F], 921916[F], 8140[F], 381968[F], 2392], 921918( 4079], 622865( 4387], 8139[F], 381969[F], 381970[F] (140) &
381971[F], 381972[F], 381977[F], 381979[F], 381980[F], 381984[F], 381973[F], 381974[F], 381975[F], 381976[F], 381978[F], 381981[F], Adora3
381985[F], 381977[-4258]
381982[F], 381983[F], 8141[-1847], 381978[-2294], 381981[-2628], (11542) 381986[-2669], 381982 [-2892], 381987[-2937]
899208[F], 899209[F], 899210[F], 899211[F], 899212[F], 899213[F],
899214[F], 899216[F], 899217[F], 899218[F], 899219[F], 899220[F],
899222[F], 899223[F], 899224[F], 899226[F], 899227[F], 899229[F],
899230[F], 899231[F], 899235[F], 899236[F], 899237[F], 899238[F],
899215[F], 899221[F], 899225[F], 899228[F], 899232[F], ADPGK 899239[F], 635200(32403], 899240( 797], 24640[F], 577532[F],
635201(32403], 24641(F), 577534[F], 577536[F], 577541[F], (83440) & 577533[F], 577535[F], 577537[F], 577538[F], 577539[F], 577540[F],
577545[F], 577550[F], 577556[F], 577560[F], 577563[F], 577567[F], Adpgk 577542[F], 577543[F], 577544[F], 577546[F], 577547[F], 577548[F],
577568[F], 577578[-4050] (72141) 577549[F], 577551[F], 577552[F], 577553[F], 577554[F], 577555[F],
577557[F], 577558[F], 577559[F], 577561 [F], 577562[F], 577564[F],
577565[F], 577566[F], 577569[F], 577570[F], 577571 [F], 577572[F],
577573[F], 577574[F], 577575[-786], 577576[-1104], 577577[-3574]
632575[F], 880321[F], 880322[F], 632575(26874], 925709(1502], ADPRHL1
632574[F], 762736[F], 762737[F], 632574(26874], 925710(1183],
653742[-498], 632577[-2294], 880323[-2650], 21254[F], 536637[F], (113622) &
653743[-817], 632576[-2294], 880324[-3726], 21253[F], 536636[F], 536639[F], 536640[F], 536642[F], 21256[-1796], 536643[-2337], AdprhH
536638[F], 536641 [F], 21255[-1796], 536644( 3046]
536645[-4334] (234072)
825119[F], 825121[F], 825123[F], 624945(5059], 624947(372], ADPRHL2
825120[F], 825122[F], 624946[5059], 624944[-586], 10868[F],
624948[-574], 624943[-586], 825124[-2978], 10867[F], 414591[F], (54936) & 414592[F], 414594[F], 414596[F], 414597[F], 414598[F], 10866]- 414593[F], 414595[F], 414599[F], 10869(542], 10870[-416], 10865[- Adprhl2 1207]
1207], 4146001-2694] (100206) TABLE 2 Page 36 of 1873
644443[F], 729006[F], 729008[F], 729009[F], 729010[F], 729013[F],
729014[F], 729016[F], 729018[F], 729019[F], 6 4444 5[16505], 644444[F], 729007[F], 729011[F], 729012[F], 729015[F], 729017[F],
ADRA1A 729021[-1161], 729019[-3052], 36921[F], 214177[F], 214180[F], 644446[16505], 729020[-949], 729017[-4088], 36922[F], 214176[F],
(148) & 214181[F], 214182[F], 214183[F], 214185[F], 214186[F], 214187[F] 214178[F], 214179[F], 214184[F], 214189[F], 214190[F], 214191 [F],
Adrala 214188[F], 214193[F], 214194[F], 214195[F], 214197[F], 214200[F] 214192[F], 214196[F], 214198[F], 214199[F], 214202[F], 214205[F],
(11549) 214201 [F], 214203[F], 214204[F], 214209[F], 36923[877], 214211[- 214206[F], 214207[F], 214208[F], 36924[877], 214210[-344]
38341
638531 [F], 686422[F], 686425[F], 686426[F], 686427[F], 686429[F],
638530[F], 686421[F], 686423[F], 686424[F], 686428[F], 686430[F], ADRA1B 686431[-1728], 686432[-2760], 28950[F], 119803[F], 119804[F],
28949[F], 119802[F], 119807[F], 119808[F], 119809[F], 119810[F], (147) & 119805[F], 119806[F], 119811[F], 119813[F], 119815[F], 119817[F],
119812[F], 119814[F], 119816[F], 119818[F], 119819[F], 119826[F], Adralb 119820[F], 119821[F], 119822[F], 119823[F], 119824[F], 119825[F],
119828[F] (11548) 119827[F], 119829[-2241], 119830[-3635], 119831 [-4687]
ADRA1D
795326[F], 795327[F], 795328[F], 795329[F], 795330[F], 795331 [F],
(146) & 795332[F], 620682(28270], 5306[F], 350099[F], 350100[F],
Adrald 350101[F], 350102[F], 350103[F], 350104[F], 350105[F]
(11550)
ADRA2A (150) &
779903[F], 650965(3782], 45371 [F], 320024[F]
Adra2a (11551)
ADRA2C
(152) &
626218[F], 835217[F], 12548[F], 438745[F]
Adra2c (11553) ADRB1
651003[F], 780195[F], 780196[F], 780197[F], 780198[-1602],
651004[F], 780199[-4285], 45416[F], 320537[-3921] (153) & 45415[F], 320533[F], 320534[F], 320535[F], 320536[-1823]
Adrbl
ADRB2
649609[-109], 769216[-371], 649611 [-2643], 769219[-4621], 43715[- 649608[-109], 769217[-697], 769218[-1056], 649610[-2643], 43714[-
(154) & 139], 299577[-392], 43717[-2577], 299580[-2984] 139], 299578[-672], 299579[-1277], 43716[-2577], 299581 [-4064]
Adrb2
632770[F], 881827[F], 881828[F], 632772[-180], 881832[-462],
9318451-1026], 931846 [-1422], 931847[-2259], 931844[-2870], 632769[F], 881825[F], 881826[F], 881829[F], 632771 [-180], 881830| ADRB3 8818241-3026], 881834 [-3422], 881835[-4259], 881823[-4870], 227], 8818311-384], 881833[-2162], 21552[F], 541087[F], 541088[F]. (155) & 21553[F], 541089[F], 541090[F], 541094[F], 21555[904], 541097[- 541091[F], 541092[F], 541093[F], 541095[F], 21554(904], 541096[- Adrb3 1793], 215511-1946], 541098[-2270], 541086[-2351], 541085[-3841], 520], 215501-1946], 541099[-2945], 54110O[-3971], 541103[-4975] (11556) 541101[-4136], 541102[-4305
649994[F], 772290[F], 772291[F], 772293[F], 772296[F], 772297[F],
649993[F], 772289[F], 772292[F], 772294[F], 772295[F], 772300[F], ADRBK1 772298[F], 772299[F], 772301[F], 772303[F], 649992[-2786], 772288
772302[F], 649991[-2786], 44211[F], 306048[F], 306051 [F], (156) & 4362], 44212[F], 306049[F], 306050[F], 306052[F], 306055[F],
306053[F], 306054[F], 306056[F], 306060[F], 306062[4], 44209[- Adrbkl 306057[F], 306058[F], 306059[F], 306061[F], 306063[-6], 44210[- 2862], 306047[-3332] (110355) 2862], 306046[-4547]
627114[F], 773478[F], 841397[F], 841399[F], 841400[F], 841401 [F],
841402[F], 841403[F], 841404[F], 841406[F], 841408[F], 13787[F], 627113[F], 841396[F], 841398[F], 841405[F], 841407[F], 841409[F],
ADRBK2 452571 [F], 452572[F], 452573[F], 452574[F], 452576[F], 452577[F], 13786[F], 452567[F], 452568[F], 452569[F], 452570[F], 452575[F],
(157) & 452579[F], 452580[F], 452582[F], 452584[F], 452585[F], 452586[F], 452578[F], 452581[F], 452583[F], 452591 [F], 452593[F], 452596[F],
Adrbk2 452587[F], 452588[F], 452589[F], 452590[F], 452592[F], 452594[F], 452597[F], 452598[F], 452601 [F], 452603[F], 452605[F], 452583[-
(320129) 452595[F], 452599[F], 452600[F], 452602[F], 452604[F], 452582[- 1130], 452581 [-4469]
3866]
621507[F], 622530[F], 801376[F], 801378[F], 801380[F], 801381[F], 621506[F], 621508[F], 801375[F], 801377[F], 801379[F], 801384[F],
ADRM1 801382[F], 801383[F], 801385[F], 801387[F], 807806[F], 807807[F], 801386[F], 6215101-201], 801388[-1912], 801389[-3341], 801390[- (11047) & 807808[F], 807809[F], 807810[F], 807811[F], 621509[-201], 6375[F], 4884], 6376[F], 363976[F], 363978[F], 363980[F], 363985[F],
Adrml 363977[F], 363979[F], 363981[F], 363982[F], 363983[F], 363984[F], 363987[F], 6374[285], 6378[-87], 363989[-1561], 363990[-2999],
(56436) 363986[F], 363988[F], 6377[-87], 363993[-4871] 363991 [-4423], 363992[-4872]
645733[F], 739398[F], 739400[F] 739401 [F], 739402[F], 739403[F],
739404[F], 739405[F], 739406[F] 739407[F], 38647[F], 236349[F],
ADSL
236351 [F], 236352[F], 236353[F] 236354[F], 236355[F], 236356[F],
645734[F], 645735[-4019], 38648[F], 236348[F], 236350[F], (158) & 236357[F], 236358[F], 236359[F] 236360[F], 236361 [F], 236362[F],
236365[F] Adsl 236363[F], 236364[F], 236366[F] 236367[F], 236368[F], 236369[F],
(11564) 236370[F], 236371 [F], 236372[F] 236373[F], 236374[F], 236375[F],
236376[F]
668156[F], 668157[F], 668158[F] 668159[F], 668160[F], 668161[F],
668162[F], 668164[F], 668166[F] 668167[F], 668168[F], 668169[F],
668170[F], 668171[F], 668172[F] 668175[F], 668176[F], 668177[F],
668178[F], 668179[F], 668181[F] 668182[F], 668183[F], ADSS
668163[F], 668165[F], 668180[F], 668184[F], 618496[43444],
618497[43444], 2633[F], 80619[F], 80620[F], 80621 [F], 80622[F], (159) &
2632[F], 2634[F], 80623[F], 80624[F], 80626[F], 80630[F], 80632[F], 80625[F], 80627[F], 80628[F], 80629[F], 80631 [F], 80633[F], Adss
80635[F], 80639[F], 80641 [F], 80646[F], 80654[F], 80659[F]
80634[F], 80636[F], 80637[F], 80638[F], 80640[F], 80642[F], (11566) 80643[F], 80644[F], 80645[F], 80647[F], 80648[F], 80649[F],
80650[F], 80651 [F], 80652[F], 80653[F], 80655[F], 80656[F],
80657[Fl, 80658[Fl
ADSSL1
642005[F], 711479[F], 711480[F], 711482[F], 642005(23113], 642006[F], 711478[F], 711481 [F], 642006(23113], 711478[-2420],
(122622) 8 642003[-4935], 711477[-4935], 33262[F], 170400[F], 170401 [F], 642004[-4935], 33263[F], 170399[F], 170402[F], 170405[F],
AdssM 170403[F], 170404[F], 170407[F], 33260[-4485], 170398[-4697] 170406[F], 33261 [-4485]
(11565) TABLE 2 - Page 37 of 1873
929766[549], 930112[391], 930114[-346], 930115[-573], 930116[- 1063], 930118[-1393], 683111 [-1451], 683112[-1609], 683114]-
AEBP1 2346], 930119[-2476], 683115]-2573], 683116[-3063], 683118]-
930113[-358], 930117[-1128], 683113[-2358], 683117[-3128], (165) &
3393], 6831191-4476], 638145[-4708], 28461 [F], 113268[-979],
28460[F], 113269[-849], 113271[-1900], 113275[-2605] Aebpl
1132701-1238], 113272[-1888], 113273[-2090], 113274[-2540],
(11568) 1132761-2839], 113277[-3283], 113267[-3626], 113278[-3646],
1132791-3729], 28464[-3904], 113280[-4482]
629726[F], 862601[F], 862603[F], 862604[F], 862605[F], 862606[F],
862607[F], 862608[F], 862609[F], 862610[F], 862611 [F], 862612[F],
862613[F], 862614[F], 862615[F], 862617[F], 862619[F], 862620[F],
921820(1995], 921821(1977], 921822(1661], 862599[-5], 862621[- 23], 8626221-339], 17198[F], 498300[F], 498302[F], 498306[F],
498307[F], 498308[F], 498309[F], 498310[F], 498311 [F], 498312[F],
629727[F], 862600[F], 862602[F], 862616[F], 862618[F], 17199[F],
498314[F], 498315[F], 498316[F] 498317[F], 498319[F], 498320[F], AEBP2
498301[F], 498303[F], 498304[F], 498305[F], 498313[F], 498318[F], 498321 [F], 498322[F], 498323[F] 498324[F], 498325[F], 498326[F], (121536) S
498343[F], 498345[F], 498352[F], 498353[F], 498356[F], 498362[F], 498327[F], 498328[F], 498329[F] 498330[F], 498331 [F], 498332[F], Aebp2
498370[37], 17197[-238], 498299[-305], 498301 [-514], 498352[- 498333[F], 498334[F], 498335[F] 498336[F], 498337[F], 498338[F], (11569)
1932], 498353[-2195]
498339[F], 498340[F], 498341[F] 498342[F], 498344[F], 498346[F],
498347[F], 498348[F], 498349[F] 498350[F], 498351 [F], 498354[F],
498355[F], 498357[F], 498358[F] 498359[F], 498360[F], 498361 [F],
498363[F], 498364[F], 498365[F] 498366[F], 498367[F], 498368[F],
498369[F], 498300[-24], 17196[-238], 498302[-279], 498298[-994],
498350[-1631], 498351[-1733]
631152[F], 870941[F], 870942[F], 870943[F], 870944[F], 870945[F],
870947[F], 870948[F], 870949[F], 870950[F], 870951 [F], 928250[-
AEN
2152], 870952[-4152], 19469[F], 517865[F], 517866[F], 517867[F],
631153[F], 870946[F], 19470[F], 517864[F], 517870[F], 517875[F], (64782) & 517868[F], 517869[F], 517871[F], 517872[F], 517873[F], 517874[F],
517885[-647], 19472[-4589] Aen 517876[F], 517877[F], 517878[F], 517879[F], 517880[F], 517881[F],
(68048) 517882[F], 517883[F], 517884[F], 517886[-758], 517887[-1413],
517888[-1864], 19471 [ -4589]
637339[F], 677492[F], 677494[F], 677496[F], 677497[F], 677498[F],
637340[F], 677491[F], 677493[F], 677495[F], 677501 [F], 677503[F], 677499[F], 677500[F], 677502[F], 677504[F], 677505[F], 677508[F], AES (166)
677506[F], 677507[F], 27428[F], 101457[F], 101459[F], 101460[F], 27427[F], 101456[F], 101458[F], 101461[F], 101462[F], 101463[F], & Aes
101464[F], 101466[F], 101468[F], 101475[F], 101477[F], 101480[F], 101465[F], 101467[F], 101469[F], 101470[F], 101471 [F], 101472[F], (14797)
101481[F], 101455[-10]
101473[F], 101474[F], 101476[F], 101478[F], 101479[F], 101482[F]
626235[F], 835318[F], 835320[F], 835321 [F], 835322[F], 835323[F],
835325[F], 835326[F], 835328[F], 835329[F], 835330[F], 835331 [F],
835332[F], 835333[F], 835334[F], 835336[F], 835337[F], 835338[F],
626236[F], 835315[F], 835316[F], 835317[F], 835319[F], 835324[F], 835339[F], 12571[F], 438925[F], 438926[F], 438927[F], 438930[F], AFAP1
835327[F], 835335[F], 12572[F], 438924[F], 438928[F], 438929[F], 438933[F], 438936[F], 438940[F], 438941 [F], 438942[F], 438943[F], (60312) &
438931 [F], 438932[F], 438934[F], 438935[F], 438937[F], 438938[F], 438944[F], 438945[F], 438946[F], 438948[F], 438950[F], 438951 [F], Afapl
438939[F], 438947[F], 438949[F], 438952[F], 438956[F], 438957[F], 438953[F], 438954[F], 438955[F], 438958[F], 438959[F], 438960[F], (70292)
438961 [F], 438968[F], 438971 [F], 438972[F], 438976[F]
438962[F], 438963[F], 438964[F], 438965[F], 438966[F], 438967[F],
438969[F], 438970[F], 438973[F], 438974[F], 438975[F], 438977[F],
438978[F], 438979[F], 438980[F], 438981 [F]
835332[F], 835333[F], 835334[F], 835336[F], 835337[F], 835338[F], AFAP1-
835335[F], 626236(20215]
835339[F], 626235(20215; AS1
649597[F], 649599[F], 769154[F], 769155[F], 769163[F], 769164[F],
649598[F], 649600[F], 769156[F], 769157[F], 769158[F], 769159[F], 769166[F], 769168[F], 769169[F], 769170[F], 649601 [30539],
769160[F], 769161[F], 769162[F], 769165[F], 769167[F], 769171[F], 649595(9136], 769153[-3368], 649593[-3609], 769151 [-3771],
AFAP1L1 649602(30539], 649596(9136], 649594[-3609], 769152[-3755], 43703[F], 43705[F], 299465[F], 299466[F], 299469[F], 299470[F],
(134265) & 43704[F], 43706[F], 299464[F], 299467[F], 299468[F], 299471 [F], 299476[F], 299477[F], 299480[F], 299481 [F], 299483[F], 299484[F],
Afapl 11 299472[F], 299473[F], 299474[F], 299475[F], 299478[F], 299479[F], 299485[F], 299486[F], 299487[F], 299488[F], 299489[F], 299490[F],
(106877) 299482[F], 299492[F], 299493[F], 299494[F], 299498[F], 299491[F], 299495[F], 299496[F], 299497[F], 43707(30925],
43708[30925], 43702(5657], 43700[-3904], 299461 [-3982] 43701(5657], 299463[-3476], 299462[-3693], 43699[-3904], 299460[- 3995]
780228[F], 780229[F], 780231[F], 780232[F], 780233[F], 780234[F],
780236[F], 780238[F], 780239[F], 780240[F], 780242[F], 780244[F], 780230[F], 780235[F], 780237[F], 780241 [F], 780243[F], 780245[F], 651013[109929], 651011 [-321], 780226[-4457], 320583[F], 651012[109929], 651010[-321], 780227[-2930], 320584[F], AFAP1L2 320585[F], 320587[F], 320589[F], 320590[F], 320592[F], 320594[F], 320586[F], 320588[F], 320591 [F], 320593[F], 320596[F], 320598[F], (84632) & 320595[F], 320597[F], 320599[F], 320602[F], 320603[F], 320604[F], 320600[F], 320601[F], 320605[F], 320607[F], 320609[F], 320610[F], Afapl I2 320606[F], 320608[F], 320611[F], 320612[F], 320613[F], 320616[F], 320614[F], 320615[F], 320618[F], 320619[F], 320621 [F], (226250) 320617[F], 320620[F], 45427[96219], 45425[-271], 320581 [-2537], 45426[96219], 45424]-271], 320582]-! 144]
320580[-2989] TABLE 2 - Page 38 of 1873
626931[F], 840161[F] 840162[F], 840163[F], 840164[F], 840165[F], 840166[F], 840168[F] 840169[F], 840170[F], 840171 [F], 840172[F], 840173[F], 840174[F] 840175[F], 840176[F], 840177[F], 840178[F], AFF1 918721 [F], 918722[F] 13509[F], 449577[F], 449578[F], 449579[F], (4299) & 449580[F], 449581 [F] 449582[F], 449583[F], 449584[F], 449585[F], Aff1 449586[F], 449587[F] 449588[F], 449589[F], 449590[F], 449591[F], (17355) 449592[F], 449593[F] 449594[F], 449595[F], 449596[F], 449597[F], 449598[F], 449599[F] 449600[F], 449601 [F], 449576[-3473]
910580[F], 910581[F], 910583[F] 910584[F], 910585]F], 910586[F 676473[F], 910582[F], 910587[F], 910589]F], 910601 [F], 910602[F], 910588[F], 910590[F], 910591[F] 910592[F], 910593[F], 910594[F 910603[F], 910604[F], 910607[F], 910609[F], 910611 [F], 910614[F], 910605[F], 910606[F], 910608[F] 910610[F], 910612[F], 910615[F 651470(493174], 46272[F], 46273[F], 602306[F], 602308[F],
651469(493174], 651468(986], 910579[-3022], 46271[F], 602304[F 602310[F], 602312[F], 602313[F], 602314[F], 602318[F], 602320[F],
AFF2
602305[F], 602307[F], 602309[F] 602311[F], 602315[F], 602316[F] 602322[F], 602323[F], 602327[F], 602328[F], 602330[F], 602333[F],
(2334) & 602317[F], 602319[F], 602321[F] 602324[F], 602325[F], 602326[F] 602338[F], 602343[F], 602344[F], 602345[F], 602346[F], 602347[F],
Aff2 602329[F], 602331[F], 602332[F] 602334[F], 602335[F], 602336[F] 602348[F], 602349[F], 602350[F], 602351 [F], 602352[F], 602353[F],
(14266) 602337[F], 602339[F], 602340[F] 602341 [F], 602342[F], 602358[F] 602354[F], 602355[F], 602356[F], 602357[F], 602359[F], 602362[F], 602360[F], 602361[F], 602364[F] 602365[F], 602366[F], 602368[F] 602363[F], 602367[F], 602369[F], 602370[F], 602371 [F], 602372[F], 602373[F], 602375[F], 602376[F] 602378[F], 602382[F], 602383[F] 602374[F], 602377[F], 602379[F], 602380[F], 602381 [F], 602384[F],
46270[940], 602387[-403], 602303[-2738] 602385[F], 602386[F]
616737[F], 616739[F] 616741 [F] 654661 [F] 654662]F], 654664[F]
654665[F], 654666[F] 654668[F] 654670[F] 654671 [F], 654673[F]
654674[F], 654676[F] 654677[F] 654678[F] 654679[F], 654680[F]
654682[F], 654683[F] 654684[F] 654685[F] 654686[F], 654688[F]
654690[F], 654691[F] 654694[F] 654695[F] 654696[F], 654699[F]
654700[F], 654701[F] 654702[F] 654703[F] 654704[F], 654709[F]
654710[F], 654712[F] 654713[F] 654715[F] 654716[F], 654718[F]
654719[F], 654720[F] 654721 [F] 654722[F] 654723[F], 654724[F] 616736[F], 616738[F], 616740[F], 654663]F], 654667[F], 654669[F], 654725[F], 654726[F] 654729[F] 654730[F] 654731 [F], 654734[F] 654672[F], 654675[F], 654681 [F], 654687[F], 654689[F], 654692[F], 654735[F], 654736[F] 654737[F] 654738[F] 654739[F], 654740[F] 654693[F], 654697[F], 654698[F], 654705[F], 654706[F], 654707[F], 654741 [F], 654742[F] 654743[F] 654744[F] 654746[F], 654748[F] 654708[F], 654711[F], 654714[F], 654717[F], 654732[F], 654745[F], 654749[F], 654751[F] 654752[F] 654753[F] 654754[F], 654756[F] 654747[F], 654750[F], 654755[F], 654760[F], 654771 [F], 654772[F], 654757[F], 654758[F] 654759[F] 654761 [F] 654762[F], 654763[F] 654777[F], 654780[F], 654784[F], 654788[F], 654792[F], 654794[F], 654764[F], 654765[F] 654766[F] 654767[F] 654768[F], 654769[F] 654795[F], 654797[F], 654794[-1254], 654795[-1799], 423[F],
654770[F], 654773[F] 654774[F] 654775[F] 654776[F], 654778[F] 425[F], 427[F], 53171[F], 53174[F], 53179[F], 53181[F], 53184[F], AFF3 654779[F], 654781[F] 654782[F] 654783[F] 654785[F], 654786[F] 53190[F], 53197[F], 53199[F], 53200[F], 53203[F], 53206[F], (3899) & 654787[F], 654789[F] 654790[F] 654791 [F] 654793[F], 654796[F] 53210[F], 53214[F], 53218[F], 53219[F], 53222[F], 53225[F], Aff3
654798[F], 654799[F], 654800[F] 654801 [F] 654796[-2776], 654660 53227[F], 53228[F], 53230[F], 53234[F], 53244[F], 53245[F], (16764) 4914], 424[F], 426[F], 428[F], 53170[F], 53172[F], 53173[F], 53246[F], 53247[F], 53249[F], 53250[F], 53253[F], 53254[F],
53175[F], 53176[F], 53177[F], 53178[F], 53180[F], 53182[F], 53256[F], 53258[F], 53260[F], 53263[F], 53265[F], 53281 [F],
53183[F], 53185[F], 53186[F], 53187[F], 53188[F], 53189[F], 53283[F], 53292[F], 53298[F], 53300[F], 53305[F], 53306[F],
53191[F], 53192[F], 53193[F], 53194[F], 53195[F], 53196[F], 53307[F], 53313[F], 53314[F], 53315[F], 53316[F], 53317[F],
53198[F], 53201 [F], 53202[F], 53204[F], 53205[F], 53207[F], 53321 [F], 53323[F], 53335[F], 53336[F], 53342[F], 53343[F],
53208[F], 53209[F], 53211[F], 53212[F], 53213[F], 53215[F], 53347[F], 53350[F], 53353[F], 53359[F], 53366[F], 53368[F],
53216[F], 53217[F], 53220[F], 53221[F], 53223[F], 53224[F], 53369[F], 53371 [F], 53373[F], 53374[F], 53375[F], 53379[F]
53226[F], 53229[F], 53231 [F], 53232[F], 53233[F], 53235[F],
53236[F], 53237[F], 53238[F], 53239[F], 53240[F], 53241 [F],
53242[F], 53243[F], 53248[F], 53251 [F], 53252[F], 53255[F],
53257[F], 53259[F], 53261 [F], 53262[F], 53264[F], 53266[F],
53267[F], 53268[F], 53269[F], 53270[F], 53271 [F], 53272[F],
53273[F], 53274[F], 53275[F], 53276[F], 53277[F], 53278[F],
53?79iFl 5 ?anrFl 53?fi?iFl 53?84iFl 53?8fiiFl 53?8fiiFl
638689[F], 687618[F], 687619[F], 687620[F], 687621 [F], 687622[F], 687623[F], 687624[F], 687625[F], 687626[F], 687627[F], 29173[F], AFF4 122280[F], 122281 [F], 122282[F], 122283[F], 122284[F], 122285[F], (27125) & 122286[F], 122287[F], 122288[F], 122289[F], 122290[F], 122291[F], Aff4 122292[F], 122293[F], 122294[F], 122295[F], 122296[F], 122297[F], (93736) 122298[F], 122299[F], 122300[F], 122301[F], 122302[F], 122303[F]
634161[F], 892573[F], 892574[F], 892575[F], 892576[F], 892577[F],
892578[F], 892579[F], 892580[F], 892581 [F], 892582[F], 892584[F], 634162[F], 892583[F], 892583[-3289], 634163[-3822], 634159]- AFG3L1P 892585[F], 892581[-2418], 892582[-2473], 892584[-3944], 892585]- 4519] (172) 4080], 6341581-4519]
649701[F], 769956[F], 769957[F], 769959[F], 769960[F], 769962[F],
649702[F], 769949[F], 769950[F], 769951 [F], 769952[F], 769953[F],
769963[F], 769968[F], 923804[1346], 769948[-654], 649700[-2364], 769954[F], 769955[F], 769958[F], 769961 [F], 769964[F], 769965[F],
649698[-2374], 769947[-2841], 769946[-3146], 769945[-3336],
769966[F], 769967[F], 649699[-2374], 43818[F], 301062[F], AFG3L2
769944[-3513], 769943[-3710], 43817[F], 301072[F], 301077[F],
301063[F], 301064[F], 301065[F], 301066[F], 301067[F], 301068[F], (10939) &
301078[F], 301080[F], 301082[F], 301084[F], 301085[F], 301086[F], 301069[F], 301070[F], 301071[F], 301073[F], 301074[F], 301075[F], Afg3l2
301089[F], 301093[F], 301095[F], 301097]F], 301098[F], 301099[F], 301076[F], 301079[F], 301081[F], 301083[F], 301087]F], 301088[F], (69597)
301102[F], 3010601-1124], 43816[-1754], 43814[-1756], 301059[- 301090[F], 301091[F], 301092[F], 301094[F], 301096[F], 301100[F],
2418], 3010581-2723], 301057[-2913], 301056[-3090], 301055]- 301101[F], 3010611-941], 43815[-1756], 301054[-4762]
3287] TABLE 2 - Page 39 of 1873
626750[F], 838966[F], 927261 [-1622], 838968[-3622], 13212[F], AFM (173)
626749[F], 838967[F], 13211[F], 446677[F], 446678[F], 13213[347],
446674[F], 446675[F], 446676[F], 13214[347], 446680[-2236], & Afm 446679[-678], 13209[-3016], 44 6673[- 4 06 4 ]
13210[-3016], 446672[-4092 " (280662)
AFMID
640584[F; 640586[-112], 634227[-303], 700299[-2187], 31369[F], 640585[F], 640587[-112], 31370[F], 144901 [F], 31372[175], 144899[
' (125061) & 144902[F; 144903[F], 144904[F], 31371 [175], 144900[-1173] 3277], 144898[-4010], 144897[-4436]
Afmid
626745[F; 626747[F], 838963[F] 838965[F], 13207[F], 446668[F], 626746[F], 626748[F], 838964[F], 13208[F], 446669[F], 446670[F], AFP (174) 446671 [F 13209[9821 13210(9821] & Afp
684158[F 684159[F] 684160[F], 684163[F], 684164[F], 684165[F]
684166[F 684167[F] 684168[F], 684170[F], 684171 [F], 684172[F]
AFTPH
684173[F 684174[F] 638280[68673], 28645[F], 115306[F], 684161[F], 684162[F], 684169[F], 638279(68673], 638281 [-152],
(54812) & 115307[F 115309[F] 115310[F] 1 15312[F], 115313[F], 115315[F] 28644[F], 115308[F], 1 15311[F], 115314[F], 115318[F], 115324[F],
Aftph 115316[F 115317[F] 115319[F] 1 15320[F], 115321 [F], 115322[F] 115331 [F], 28646[-280], 1 15335[-2355]
(216549) 115323[F; 115325[F] 115326[F] 1 15327[F], 115328[F], 115329[F]
115330[F; 115332[F] 115333[F] 1 15334[-31]
617447[F 617449[F] 660346[F] 660348[F], 660349[F], 660353[F]
660354[F; 660355[F] 660356[F] 660357[F], 660358[F], 660359[F]
660361 [F 660362[F] 660364[F] 660365[F], 660366[F], 660367[F]
660368[F; 660369[F] 660370[F] 660371 [F], 660374[F], 660375[F]
660376[F; 660377[F] 660378[F] 660380[F], 660381 [F], 660382[F]
660383[F; 660384[F] 660385[F] 660386[F], 660387[F], 660388[F]
660389[F; 660390[F] 660391 [F] 660392[F], 660394[F], 660395[F]
660396[F; 660397[F] 660399[F] 660400[F], 660401 [F], 660402[F]
617448[F], 617450[F], 660347[F], 660350[F], 660351 [F], 660352[F], 660405[F 660410[F] 660411[F] 660414[F], 660415[F], 660416[F]
660360[F], 660363[F], 660372[F], 660373[F], 660379[F], 660393[F], 660417[F 660419[F] 660420[F] 660421 [F], 660422[F], 660423[F]
660398[F], 660403[F], 660404[F], 660406[F], 660407[F], 660408[F], 660424[F 660425[F] 660426[F] 660427[F], 660429[F], 660430[F]
660409[F], 660412[F], 660413[F], 660418[F], 660428[F], 660431 [F], 660432[F; 660436[F] 660437[F] 660438[F], 660440[F], 660441 [F]
660433[F], 660434[F], 660435[F], 660439[F], 660442[F], 660444[F], 660443[F 660445[F] 660446[F] 660447[F], 660448[F], 660449[F]
660458[F], 660462[F], 660463[F], 660465[F], 660469[F], 660471 [F], 660450[F; 660451 [F] 660452[F] 660453[F], 660454[F], 660455[F]
660472[F], 660474[F], 660482[F], 660484[F], 660488[F], 660439[- 660456[F 660457[F] 660459[F] 660460[F], 660461 [F], 660464[F] AGAP1
4840], 1313[F], 1315[F], 64907[F], 64914[F], 64915[F], 64916[F],
660466[F; 660467[F] 660468[F] 660470[F], 660473[F], 660475[F] (116987) &
64928[F], 64935[F], 64955[F], 64956[F], 64962[F], 64963[F],
660476[F 660477[F] 660478[F] 660479[F], 660480[F], 660 4 81 [F] Agapl
64971 [F], 64973[F], 64983[F], 64991[F], 64993[F], 64998[F],
660483[F 660485[F] , 660486[F] 660487[F], 660489[F], 660438[- (347722)
65004[F], 65005[F], 65006[F], 65008[F], 65009[F], 65010[F],
646], 1312[F], 1314[F], 64906[F], 64908[F], 64909[F], 64910[F],
65011 [F], 65015[F], 65019[F], 65020[F], 65024[F], 65027[F],
64911 [F], 64912[F], 64913[F], 6491 [F], 64918[F], 64919[F],
65043[F], 65044[F], 65047[F], 65049[F], 65050[F], 65051 [F],
64920[F], 64921 [F], 64922[F], 64923[F], 64924[F], 64925[F],
65055[F], 65058[F], 65060[F], 65063[F], 65067[F], 65078[F],
64926[F], 64927[F], 64929[F], 64930[F], 64931 [F], 64932[F],
65085[F], 65087[F], 65092[F], 65096[F], 65097[F], 65098[F],
64933[F], 64934[F], 64936[F], 64937[F], 64938[F], 64939[F],
65104[F], 65109[F], 65111[F], 65112[F], 65115[F], 651 17[F],
64940[F], 64941 [F], 64942[F], 64943[F], 64944[F], 64945[F],
651 19[F], 65127[F], 65129[F], 65134[F], 65136[-468]
64946[F], 64947[F], 64948[F], 64949[F], 64950[F], 64951 [F],
64952[F], 64953[F], 64954[F], 64957[F], 64958[F], 64959[F],
64960[F], 64961 [F], 64964[F], 64965[F], 64966[F], 64967[F],
64968[F], 64969[F], 64970[F], 64972[F], 64974[F], 64975[F],
64976[F], 64977[F], 64978[F], 64979[F], 64980[F], 64981 [F],
64982[F], 64984[F], 64985[F], 64986[F], 64987[F], 64988[F],
64989[F], 64990[F], 64992[F], 64994[F], 64995[F], 64996[F],
R4997rFl. R4999 1. RROOOiFl. RROO TFl. RR002rFl. 65003rFl.
681490[F], 681495[F], 681498[F], 637909(17265], 637911 [-2735], 681491[F], 681492[F], 681493[F], 681494[F], 681496[F], 681497[F], AGAP2 681500[-2858], 681501 [-3094], 681490[-3726], 681502[-3814], 681499[F], 637910[17265], 681493[-10], 681492[-525], 681491 [- (116986) & 28196[F], 110305[F], 1 10306[F], 110309[F], 28198[-2479], 110311 [- 595], 28197[F], 110301 [F], 110302[F], 110303[F], 110304[F], Agap2 2606], 110312[-2816], 110299[-3376], 110313[-3500] 110307[F], 110308[F], 110310[F], 1 10300[-1653] (216439)
625975[F], 833506[F], 833507[F], 833509[F], 833511 [F], 833512[F],
833513[F], 833514[F], 833516[F], 833518[F], 833520[F], 833522[F],
625976[F], 833508[F], 833510[F], 833515[F], 833517[F], 833519[F], 833523[F], 833513[-1688], 833514[-3289], 625977[-3937], 833525[- AGAP3
833521[F], 625974[-2893], 625978[-3937], 931676[-3987], 931675[- 4846], 931674[-4854], 12240[F], 434947[F], 434949[F], 434950[F], (116988) &
4613], 833524[-4633], 12241 [F], 434948[F], 434958[F], 434960[F], 434951 [F], 434952[F], 434953[F], 434954[F], 434955[F], 434956[F], Agap3
434963[F], 434966[F], 434968[F], 434970[F], 434972[F], 12243[- 434957[F], 434959[F], 434961[F], 434962[F], 434964[F], 434965[F], (213990)
2377], 434975[-3019], 434977[-3730], 12239[-3999]
434967[F], 434969[F], 434971[F], 434973[F], 434974[F], 12242[- 2377], 434976[-3234]
AGAP8
643831 [F], 643833[F] 643832[F], 643834[F]
(728404)
631 145[F] 870818[F], 870819[F], 870821 [F], 870823[F], 870824[F],
631 144[F], 870820[F], 870822[F] 870826[F], 870828[F], 870831 [F], 870825[F] 870827[F], 870829[F], 870830[F], 870836[F], 870838[F], 870832[F], 870833[F], 870834[F] 870835[F], 870837[F], 19461 [F], 19460[F], 19462[F], 517623[F], 517624[F], 517625[F], 517626[F],
517640[F], 517643[F], 517644[F] 517646[F], 517647[F], 517648[F], 517627[F] 517628[F], 517629[F], 517630[F], 517631 [F], 517632[F], AGBL1 517649[F], 517652[F], 517654[F] 517659[F], 517661 [F], 517663[F], 517633[F] 517634[F], 517635[F], 517636[F], 517637[F], 517638[F], (123624) & 517666[F], 517667[F], 517668[F] 517671 [F], 517675[F], 517676[F], 517639[F] 517641[F], 517642[F], 517645[F], 517650[F], 517651 [F], Agbl1 517678[F], 517679[F], 517681[F] 517682[F], 517685[F], 517686[F], 517653[F] 517655[F], 517656[F], 517657[F], 517658[F], 517660[F], (244071 ) 517689[F], 517690[F], 517694[F] 517695[F], 517696[F], 517697[F], 517662[F] 517664[F], 517665[F], 517669[F], 517670[F], 517672[F], 517698[F] 517673[F] 517674[F], 517677[F], 517680[F], 517683[F], 517684[F],
517687[F] 517688[F], 517691 [F], 517692[F], 517693[F], 517699[F] TABLE 2 - Page 40 of 1873
620004[F], 790570[F], 790571[F 790578[F], 620002[-1140], 790568 620005[F], 790569[F], 620003[-1140], 4502[F], 4504[F], 340964[F], 4613], 4501 [F], 4503[F], 340966| F], 340967[F], 340969[F], 340965[F], 340968[F], 340970[F], 340975[F], 340976[F], 340977[F], AGBL2 , 340972[F], 340973[F , 340974[F], 340978[F], 340979[F], 340982[F], 340985[F], 340986[F], 340987[F], 340988[F], 340990[F], (79841) & , 340981 [F], 340983[F , 340984[F], 340989[F], 340991 [F], 340992[F], 3409941-1543], 4500[-1721], 340996[-3343], 340961[- Agbl2 , 44991-1721], 340995| -3151], 3409631-3448], 340962]- 4060], 3409601-4518], 340997[-4802], 340959[-4851], 340958]- (271813)
4917]
628309[F], 850415[F], 850413[-1058], 850412[-1161], 850411]- AGBL3
850414[F 850416[F 850418[F 15327[F], 472347[F],
2788], 15328[F], 472348[F], 472349[F], 472354[F], 472356[F], (340351) & 472351 [F 472352[F 472353[F 472355[F], 472357[F],
472358[F], 472359[F], 472361 [F], 472362[F], 472363[F], 472364[F], Agbl3 472365[F; 472367[F; 472368[F; 472343[-3453]
472366[F], 472346[-941], 472345[-1443], 472344[-2372] (76223)
624621 [F; 822390[F; 822403[F; 822404[F] 822405]F], 822406[F]
822407[F 822408[F " 822411[F 822413[F 822416[F], 822418[F] 624622[F] 822396[F], 822397[F 822399[F] 822400[F] 822401 [F] 822420[F; 822421 [F 822422[F; 822424[F; 822435[F], 822436[F] 822409[F] 822410[F], 822412[F 822414[F] 822415[F] 822417[F] 822437[F 822438[F " 822442[F 822443[F 822444[F], 822445[F] 822419[F] 822423[F], 822425[F 822426[F] 822434[F] 822439[F] 822449[F; 822451 [F 822452[F; 822454[F; 822456[F], 822457[F] 822440[F] 822441 [F], 822446[F 822447[F] 822448[F] 822450[F] 822458[F 822459[F " 822460[F 822464[F 822466[F], 822472[F] 822453[F] 822455[F], 822461 [F; 822462[F] 822463[F] 822465[F] 822474[F; 822475[F; 822476[F; 822478[F; 822479[F], 822480[F] 822467[F] 822468[F], 822469[F 822470[F] 822471 [F] 822473[F] 822481 [F 822482[F " 822483[F 822484[F 822485[F], 822486[F] 822477[F] 10453[F], 409757[F], 409758[F], 409762[F], 409766[F].
822487[F; 822488[F; 10452[F], 409755[F] 409756[F], 409759[F], 409767[F] 409768[F], 409769[F; 409773[F] 409776[F] 409777[F] 409760[F; 409761 [F 409763[F; 409764[F; 409765[F], 409770[F] 409778[F] 409779[F], 409780[F; 409781 [F] 409783 [F] 409784[F] 409771 IF; 409772[F; 409774[F; 409775[F; 409782[F], 409785[F] 409788[F] 409789[F], 409790[F; 409791 [F] 409792[F] 409793[F] 409786[F; 409787[F; 409794[F; 409796[F; 409797[F], 409798[F] 409795[F] 409799[F], 409800[F; 409801 [F] 409803[F] 409804[F] 409802[F; 409807[F; 409811[F; 409812[F; 409813[F], 409816[F] 409805[F] 409806[F], 409808[F; 409809[F] 409810[F] 409814[F] 409819[F; 409821 [F 409824[F; 409825[F; 409826[F], 409828[F] 409815[F] 409817[F], 409818[F; 409820[F] 409822[F] 409823[F] 409834[F; 409835[F; 409836[F; 409837[F; 409840[F], 409843[F] 409827[F] 409829[F], 409830[F " 409831 [F] 409832[F] 409833[F] AGBL4 409848[F 409850[F " 409851 [F 409852[F 409853[F], 409855[F] 409838[F] 409839[F], 409841 [F; 409842[F] 409844[F] 409845[F] (84871) & 409859[F; 409860[F; 409861 [F 409862[F; 409863[F], 409866[F] 409846[F] 409847[F], 409849[F " 409854[F] 409856[F] 409857[F] Agbl4 409867[F 409868[F " 409872[F 409877[F 409878[F], 409880[F] 409858[F] 409864[F], 409865[F; 409869[F] 409870[F] 409871 [F] (78933) 409882[F; 409883[F; 409884[F; 409885[F; 409887[F], 409888[F] 409873[F] 409874[F], 409875[F " 409876[F] 409879[F] 409881 [F] 409889[F 409892[F " 409893[F 409895[F 409896[F], 409897[F] 409886[F] 409890[F], 409891 [F; 409894[F] 409898[F] 409899[F] 409900[F; 409901 [F 409902[F; 409904[F; 409906[F], 409912[F] 409903[F] 409905[F], 409907[F " 409908[F] 409909[F] 409910[F] 409913[F 409915[F " 409916[F 409919[F 409920[F], 409921 [F] 409911[F] 409914[F], 409917[F; 409918[F] 409922[F] 409923[F] 409924[F; 409929[F; 409930[F; 409931 [F 409932[F], 409933[F] 409925[F] 409926[F], 409927[F " 409928[F] 409934[F] 409936[F] 409935[F; 409938[F; 409939[F; 409947[F; 409948[F], 409950[F] 409937[F] 409940[F], 409941 [F; 409942[F] 409943[F] 409944[F] 409952[F; 409953[F; 409954[F; 409955[F; 409956]F], 409959[F] 409945[F] 409946[F], 409949[F; 409951 [F] 409957 [F] 409958[F] 409962[F; 409963[F; 409964[F; 409965[F; 409966[F], 409968[F] 409960[F] 409961 [F], 409967[F; 409969[F] 409970[F] 409972[F] 409971 IF; 409973[F; 409974[F; 409977[F; 409979[F], 409980[F] 409975[F] 409976[F], 409978[F; 409981 [F] 409984[F] 409985[F] 409982[F; 409983[F; 409988[F; 409989[F; 409990[F], 409992[F] 409986[F] 409987[F], 409991 [F; 409993[F] 409997[F] 410008[F] 409994[F; 409995[F; 409996[F; 409998[F; 409999[F], 410000[F] 410017[F] 410018[F], 410019[F 410021 [F] 410023[F] 410027[F] 410001 [F 410002[F 410003[F 410004[F 410005[F], 410006[F] 410030[F] 410031 [F], 410032[F 410033[F] 410035[F] 410036[F] 410007[F 410009[F 410010[F 410011[F 410012[F], 410013[F] 410040[F] 410047[F], 410048[F 410049[F]
410ni4rFl 4innisrFi 4 nniRrFi 4inn??rFi 4inn?4rFi
626080[F], 834194[F], 834195[F], 834196[F], 834197[F], 834198[F], 834199[F], 834200[F], 834202[F], 834203[F], 834204[F], 834205[F], 834206[F], 834207[F], 834208[F], 834209[F], 834210[F], 834211[F], 834212[F], 626081[789], 649331 [128], 834213[-1], 767214[-3], AGBL5
626079[F], 768795[F], 834193[F], 834201[F], 12389[F], 436819[F], 767213[-73], 834199[-2137], 834200[-2891], 12390[F], 436820[F], (60509) & 436826[F], 436829[F], 436830[F], 436826[-1019] 436821[F], 436822[F], 436823[F], 436824[F], 436825[F], 436827[F], Agbl5
436828[F], 436831[F], 436832[F], 436833[F], 436834[F], 436835[F], (231093) 436836[F], 436837[F], 436838[F], 436839[F], 436840[F], 436841 [F], 12391[783], 436842[-3], 436825[-881], 436827[-1134], 436828[- 3226]
757465[F], 757467[F], 931951(3165], 931949[2245], 932483(1648],
757466[F], 931950[2370], 932482[1749], 932486(1408],
932484[1580], 931321(1533], 932485(1444], 931319(381],
932487[1308], 932488(1052], 932489(887], 932490(729],
932491[142], 932492(40], 757469( 352], 757470[-420], 932494[- 931320(501], 757468[-251], 932493[-375], 932495[-464], 757472[- 436], 757464[-467], 757471[-556], 930420[-1058], 930422[-1413], AGER 592], 757473[-692], 757474[-948], 757475[-1113], 930421[-1150],
757462[-1619], 757477[-1858], 757478[-1960], 931317[-2116], (177) & 757476[-1271], 757463[-1499], 931318[-1998], 757479[-2375],
757480[-2436], 757482[-3058], 757484[-3413], 931316[-3424], Ager 757481 [-2464], 757483[-3150], 757461 [-3998], 41809[F], 41814[F],
757460[-4116], 41810[F], 41815[F], 275118[F], 275120[F], 275122[- (11596) 275119[F], 275121[-273], 275125[-587], 275126[-687], 275127[-915]
355], 2751231-418], 275117[-526], 275124[-547], 275115[-1601 ],
2751281-1078], 275129[-1219], 275116[-1477], 275133[-2460],
275130[-1645], 275131[-1870], 275132[-1998], 275134[-2521],
275135[-2549], 275137[-3275], 275114[-3811]
2751361-3183], 275138[-3553], 275113[-3929] TABLE 2 - Page 41 of 1873
617340[F], 659118[F], 659120[F] 659121 [F], 659122[F], 659123[F],
659124[F], 659125[F], 659126[F] 659128[F], 659129[F], 659130[F],
659133[F], 659134[F], 659135[F] 659136[F], 659138[F], 659139[F],
659140[F], 659141[F], 659142[F] 659143[F], 659144[F], 659145[F],
659146[F], 659147[F], 659148[F] 659150[F], 659151 [F], 659153[F],
659154[F], 659155[F], 1157[F], 61896[F], 61899[F], 61900[F], 617341[F], 659131[F], 659132[F], 659137[F], 659149[F], 659152[F], AGFG1 61904[F], 61905[F], 61907[F], 61908[F], 61909[F], 61910[F], 1158[F], 61895[F], 61897[F], 61898[F], 61901[F], 61902[F], (3267) & 61911[F], 61912[F], 61913[F], 61914[F], 61916[F], 61918[F], 61903[F], 61906[F], 61915[F], 61917[F], 61922[F], 61923[F], Agfgl 61919[F], 61920[F], 61921[F], 61924[F], 61925[F], 61927[F], 61926[F], 61930[F], 61934[F], 61942[F], 61952[-659], 61955[-2678] (15463) 61928[F], 61929[F], 61931[F], 61932[F], 61933[F], 61935[F],
61936[F], 61937[F], 61938[F], 61939[F], 61940[F], 61941[F],
61943[F], 61944[F], 61945[F], 61946[F], 61947[F], 61948[F],
61949[F], 61950[-68], 61951[-635], 61953[-1289], 61954[-1386]
61956[-3272], 61957[-3491], 61958[-3857]
627676[F], 845536[F], 845537[F], 845539[F], 845540[F], 845542[F],
845544[F], 845545[F], 627674[-1616], 627671 [-4004], 14507[F], 627675[F], 845538[F], 845541 [F], 845543[F], 627670[-4004], AGFG2 461909[F], 461911[F], 461913[F], 461914[F], 461915[F], 461917[F], 845535[-4438], 14506[F], 461910[F], 461912[F], 461916[F], (3268) & 461918[F], 461921[F], 461922[F], 461923[F], 461924[F], 461925[F], 461919[F], 461920[F], 461927[F], 461929[F], 461916[-136], 14508[- Agfg2 461926[F], 461928[F], 461930[F], 461931[F], 461931 [38], 461908[- 461], 461932[-3826], 461912[-3979] (231801 ) 289], 461915[-1521], 461914[-2552], 461913[-3584]
643213[F], 719356[F], 719357[F], 719358[F], 719359[F], 719360[F], AGGF1 719361[F], 719362[F], 719363[F], 719364[F], 35069[F], 191792[F], (55109) &
643212[F], 719365[F], 35068[F], 191797[F], 191803[F]
191793[F], 191794[F], 191795[F], 191796[F], 191798[F], 191799[F], Aggfl 191800[F], 191801[F], 191802[F] (66549)
851458[F], 851459[F], 851460[F], 851461[F], 851462[F], 851463[F], 851464[F], 851465[F], 851466[F], 851467[F], 851468[F],
AGK
628407[102716], 15448[F], 474318[F], 474319[F], 474320[F],
(55750) &
628408[-1882], 15449[-4261] 474321[F], 474322[F], 474323[F], 474324[F], 474325[F], 474326[F],
Agk 474327[F], 474328[F], 474329[F], 474330[F], 474331 [F], 474332[F],
(69923) 474333[F], 474334[F], 474335[F], 474336[F], 474337[F], 474338[F], 474339[F], 474317[-530]
623032[F], 810773[F], 810774[F] 810775[F], 810776[F], 810777[F],
623031[F], 810781[F], 810782[F], 810783[F], 810784[F], 810786[F], 810778[F], 810779[F], 810780[F] 810785[F], 8340[F], 383654[F],
8339[F], 383656[F], 383657[F], 383658[F], 383666[F], 383671 [F], 383655[F], 383659[F], 383660[F] 383661 [F], 383662[F], 383663[F],
383674[F], 383675[F], 383676[F], 383678[F], 383681 [F], 383683[F], 383664[F], 383665[F], 383667[F] 383668[F], 383669[F], 383670[F], (77559)
383684[F], 383685[F]
383672[F], 383673[F], 383677[F] 383679[F], 383680[F], 383682[F]
625457[F], 829088[F], 625459[35], 829091[-1586], 829093[-3315],
625456[F], 829089[F], 829090[F], 625458[35], 829092[-2508], AGMAT
829094[-4399], 11449[F], 421605[F], 421609[F], 421610[F],
8290951-4599], 11448[F], 421606[F], 421607[F], 421608[F], (79814) &
421611[F], 421612[F], 421613[F], 421614[F], 421615[F], 421617[F], 421616[F], 421618[F], 11450[-912], 11446[-2765], 421622 [-3276], Agmat
421619[30], 11451[-912], 421620[-2335], 421621 [-2715], 11447]- 421604[-3801], 421624[-4816] (75986)
2765], 421623[-4107]
641063[F], 703687[F], 703688[F], 703689[F], 703690[F], 703691 [F],
641064[F], 703686[F], 703692[F], 703693[F], 703698[F], 32064[F], 703694[F], 703695[F], 703696[F], 703697[F], 703699[F], 32063[F],
154398[F], 154399[F], 154404[F], 154405[F], 154408[F], 154409[F], AGMO 154400[F], 154401 [F], 154402[F], 154403[F], 154406[F], 154407[F],
154411[F], 154415[F], 154417[F], 154418[F], 154419[F], 154420[F], (392636) & 154410[F], 154412[F], 154413[F], 154414[F], 154416[F], 154421 [F],
154422[F], 154423[F], 154425[F], 154427[F], 154428[F], 154430[F], Agmo 154424[F], 154426[F], 154429[F], 154432[F], 154433[F], 154436[F],
154431[F], 154434[F], 154435[F], 154439]F], 154443[F], 154444[F], (319660) 154437[F], 154438[F], 154440[F], 154441 [F], 154442[F], 154445[F],
154447[F], 154448[F], 154449[F], 154450[F]
154446[F], 154451 [F], 154452[F]
757483[F], 757485[F], 757487[F], 757488[F], 757490[F], 757492[F],
757494[F], 757495[F], 757496[F], 757498[F], 930423[F], 930425[F], 757482[F], 757484[F], 757486[F], 757489[F], 757491 [F], 757493[F], 930426[F], 930428(4001], 930430(2960], 930432[2784], 757497[F], 930424[F], 930427[F], 930429(3142], 930431 [2949],
930433(2695], 930434(2490], 930421(2333], 930436(2069], 930422[2611], 930420(2247], 930435[2192], 932494[1608],
932495(1643], 932493(1565], 932490(460], 932489(317], 932492(1143], 932491[1028], 932485[-255], 932484[-345], 757480[- 932488(140], 931841 [76], 932487[-114], 932486[-222], 757481 [-357], 392], 932483[-436], 757478[-857], 757477[-972], 757484[-1361], AG PAT 1 7574791-435], 932482[-556], 757476[-1540], 757483[-1639], 757475[- 9318421-1546], 757482[-1725], 757471 [-2255], 757470[-2345], (10554) & 1683], 757474[-1860], 757499[-1924], 757473[-2114], 757472[-2222], 757469[-2436], 931951[-3046], 757500[-3546], 929919[-3596], Agpatl 757468[-2556], 929918[-2953], 931950[-3841], 757501 [-4953], 931949[-3966], 931321[-4678], 41810[F], 41815[F], 275140[F], (55979) 41809[F], 41814[F], 275139[F], 275141[F], 275142[F], 275143[F], 275144[F], 275146[F], 275148[F], 275152[F], 275140[-347], 275138| 275145[F], 275147[F], 275149[F], 275150[F], 275151 [F], 275153[F], 1330], 275136[-1700], 275155[-2277], 275134[-2379], 275132[- 275141(4], 275139[-368], 275137[-1611], 275154[-1702], 275135[- 2886], 275131[-3032], 275130[-3237], 275157[-4227], 275124[- 2343], 275133[-2422], 275156[-3624], 275129[-3664], 275128[-3804], 4332], 275123[-4421], 275122[-4510]
275127[-3968], 275126[-4191], 275125[-4299], 275121[-4609]
AGPAT2
619134[F], 783290[F], 783291[F], 619132[-464], 783288[-470],
928802(1861], 783289[-139], 619133[-464], 783287[-1158], 3421 [F], (10555) &
783286[-3464], 3420[F], 3422[F], 327221[F], 327222[F], 327223[F], 3272191-659], 327217[-1410] Agpat2
3272201-123], 327218[-910], 327224[-1213], 327216[-3134]
(67512) TABLE 2 - Page 42 of 1873
637171[F], 676846[F], 676847[F], 676849[F], 676852[F], 676853[F],
676854[F], 676855[F], 676857[F], 676858[F], 676859[F], 676860[F],
676862[F], 676863[F], 676864[F], 676865[F], 676866[F], 676867[F],
676868[F], 676870[F], 676871[F], 676873[F], 676874[F], 676875[F],
637170[F], 676848[F], 676850[F], 676851[F], 676856[F], 676861[F], 27216[F], 99975[F], 99977[F], 99980[F], 99981[F], 99982[F],
676869[F], 676872[F], 27215[F], 99976[F], 99978[F], 99979[F], AGPAT3 99983[F], 99985[F], 99986[F], 99987[F], 99989[F], 99990[F],
99984[F], 99988[F], 99991 [F], 99993[F], 99996[F], 100002[F], (56894) & 99992[F], 99994[F], 99995[F], 99997[F], 99998[F], 99999[F],
100011[F], 100015[F], 100016[F], 100020[F], 100021 [F], 100023[F], Agpat3 100000[F], 100001[F], 100003[F], 100004[F], 100005[F], 100006[F],
100026[F], 100027[F], 100029[F], 100035[F], 100036[F], 100039[F], (28169) 100007[F], 100008[F], 100009[F], 100010[F], 100012[F], 100013[F],
100042[F]
100014[F], 100017[F], 100018[F], 100019[F], 100022[F], 100024[F],
100025[F], 100028[F], 100030[F], 100031[F], 100032[F], 100033[F],
100034[F], 100037[F], 100038[F], 100040[F], 100041 [F], 100043[F],
100044[F], 100045[-91], 99974[-864]
647587[F], 754033[F], 754036[F], 754037[F], 754038[F], 754040[F],
754041 [F], 754042[F], 754043[F], 754044[F], 754045[F], 754049[F],
754054[F], 754055[F], 40995[F], 267037[F], 267040[F], 267041 [F], 647588[F], 754034[F], 754035[F], 754039[F], 754046[F], 754047[F],
AGPAT4 267042[F], 267043[F], 267045[F], 267048[F], 267050[F], 267051 [F], 754048[F], 754053[F], 40996[F], 267038[F], 267039[F], 267044[F],
(56895) & 267052[F], 267053[F], 267054[F], 267055[F], 267056[F], 267057[F], 267046[F], 267047[F], 267049[F], 267058[F], 267060[F], 267061 [F],
Agpat4 267059[F], 267063[F], 267064[F], 267065[F], 267066[F], 267067[F], 267062[F], 267069[F], 267070[F], 267076[F], 267082[F], 267084[F],
(68262) 267068[F], 267071[F], 267072[F], 267073[F], 267074[F], 267075[F], 267085[F]
267077[F], 267078[F], 267079[F], 267080[F], 267081 [F], 267083[F],
267086[F], 267087[F], 267088[F]
AGPAT4-
647587[F] 647588[F], 754053[F]
IT1
632685[F], 881297[F], 881298[F], 881299[F], 881300[F], 881301[F],
881302[F], 881303[F], 881305[F], 881306[F], 881307[F], 881308[F],
881309[F], 881310[F], 881311[F], 881312[F], 881313[F], 881314[F],
AGPAT6 881315[F], 881316[F], 881317[F], 881318[F], 881319[F], 21451[F],
881304[F], 881320[F], 916374[F], 21450[F], 539881[F], 539887[F], (137964) & 539874[F], 539875[F], 539876[F], 539877[F], 539878[F], 539879[F],
539888[F], 539890[F], 539905[F], 539906[F], 539910[F], 539911[F] Agpat6 539880[F], 539882[F], 539883[F], 539884[F], 539885[F], 539886[F],
(102247) 539889[F], 539891[F], 539892[F], 539893[F], 539894[F], 539895[F],
539896[F], 539897[F], 539898[F], 539899[F], 539900[F], 539901 [F],
539902[F], 539903[F], 539904[F], 539907[F], 539908[F], 539909[F]
626908[F], 839928[F], 839929[F], 839930[F], 839931 [F], 839932[F],
839934[F], 839936[F], 839937[F], 839938[F], 922423(1159], 839927[- AGPAT9
626909[F], 839933[F], 839935[F], 13475[F], 448988]F], 448990[F], 841], 13474[F], 448989[F], 448991[F], 448993[F], 448996[F], (84803) &
448992[F], 448994[F], 448995[F], 448999[F], 449001 [F], 449002[F], 448997[F], 448998[F], 449000[F], 449003[F], 449005[F], 449008[F], Agpat9
449004[F], 449006[F], 449007[F]
449009[F], 449010[F], 449011[F], 449012[F], 13473(940], 448987[- (231510) 353], 4489861-1929]
635059[F], 898192[F], 898194[F], 635061 [-2752], 635063[-3029], 635060[F], 898193[F], 635062[-2752], 898195[-2876], 635064]- AGPHD1 766643[-3079], 24484[F], 575842[F], 575847[F], 575848[F], 3029], 898196[-3838], 24485[F], 575843[F], 575844[F], 575845[F], (123688) & 575849[F], 575850[F], 24486[-304], 24488[-856], 575853[-899], 575846[F], 575851[F], 24487[-304], 575852[-735], 24489[-856], Agphdl 2 44 82[-475 4 ], 575856[- 4 987], 575841[- 4 991] 575854[-1585], 575855[-4732], 24483[-4754] (235386)
619843[F], 789501 [F], 789502[F], 789503[F], 789504[F], 789505[F], 789506[F], 789507[F], 789508[F], 4260[F], 338862[F], 338863[F], AGPS 338864[F], 338865[F], 338866[F], 338867[F], 338868[F], 338869[F], (8540) &
42611-4497]
338870[F], 338871 [F], 338872[F], 338873[F], 338874[F], 338875[F], Agps 338876[F], 338877[F], 338878[F], 338879[F], 338880[F], 4262]- (228061 ) 4497]
AGR2
641047[F], 703594[F], 32047[F], 154174[F], 154175[F], 154176[F],
641046[F], 703595[F], 32046[F], 154178[F], 154179[F] (10551) &
154177[F]
Agr2 AGR3
641044[F], 703593[F], 32044[F], 154171[F], 154173[F] 641045[F], 9346291-4772], 934628[-4773], 32045[F], 154172[F] (155465) &
Agr3
831867[F], 831868[F], 831869[F] 831870[F], 831871 [F], 831873[F],
831874[F], 831876[F], 831877[F] 831878[F], 831879[F], 831880[F],
831881 [F], 831882[F], 831883[F] 831884[F], 831886[F], 831889[F], 831872[F], 831875[F], 831885[F], 831887[F], 831888[F], 831891[F],
AGRN
831890[F], 831892[F], 831893[F] 831894[F], 831895[F], 831896[F], 831904[F], 831905[F], 831911[F], 831912[F], 831913[F],
(375790) 831897[F], 831898[F], 831899[F] 831900[F], 831901 [F], 831902[F], 625776[35994], 625778[13940]
831903[F], 831906[F], 831907[F] 831908[F], 831909[F], 831910[F],
831914[F], 831915[F], 831916[F] 625777[35994], 625779(13940]
633788[F], 633786[-1298], 889287[-1538], 889286[-2022], 889285]
AGRP
2784], 889284[-2915], 889283[-3008], 22880[F], 22882[F], 22878[- (181) & 572], 557024[-839], 557023]- 1274], 557025[-1539], 557022[-1882], 633787[F], 22879[F], 22881 [F], 557027[-4658]
Agrp 557021 [-2269], 557020[-2372], 557019[-2456], 557026[-2660],
(11604) 557028[-4800] TABLE 2 - Page 43 of 1873
634186[F], 929329[1994], 892721[-6], 23373[F], 564439[F], 634185[F], 892720[F], 23372[F], 564437[F], 564438[F], 564444[- AGT (183) 564440[F], 564441[F], 564442[F], 564443[-417], 564447[-2983], 595], 564445[-2519], 564446[-2682], 564448[-3510], 23370[-3781], & Agt 23371[-3781], 564434[-4614], 564432[-4821] 564436[-4220], 564435[-4299], 564433[-4615] (11606)
623979[F], 642833[F], 717125[F] 717126[F], 717129[F], 717130[F],
717131[F], 717133[F], 717134[F] 717135[F], 717138[F], 717139[F],
717140[F], 717141[F], 717142[F] 717143[F], 717144[F], 717145[F],
717146[F], 717147[F], 717150[F] 717151[F], 7171241-3374], 623978[F], 642834[F], 717127[F], 717128[F], 717132[F], 717136[F], 34451 [F], 183344[F], 183345[F], 83347[F], 183351[F], 183352[F], 717137[F], 717148[F], 717149[F], 798173[F], 717152[-1459],
183353[F], 183354[F], 183355[F] 183356[F], 183357[F], 183358[F], 34450[F], 183346[F], 183348[F], 183349[F], 183350[F], 183359[F], AGTPBP1 183362[F], 183363[F], 183365[F] 183366[F], 183367[F], 183368[F], 183360[F], 183361[F], 183364[F], 183369[F], 183371 [F], 183372[F], (23287) & 183370[F], 183373[F], 183374[F] 183375[F], 183376[F], 183379[F], 183377[F], 183378[F], 183394[F], 183399[F], 183402[F], 183403[F], Agtpbpl 183380[F], 183381[F], 183382[F] 183383[F], 183384[F], 183385[F], 183405[F], 183406[F], 183407[F], 183409[F], 183414[F], 183415[F], (67269) 183386[F], 183387[F], 183388[F] 183389[F], 183390[F], 183391[F], 183416[F], 183418[F], 183420[-1257], 183372[-2890], 183371]- 183392[F], 183393[F], 183395[F] 183396[F], 183397[F], 183398[F], 3078], 1833691-3322]
183400[F], 183401[F], 183404[F] 183408[F], 183410[F], 183411[F],
183412[F], 183413[F], 183417[F] 183419[F], 344491-1797], 183343]- 1832], 183373[-2322], 183370[-3186], 183368[-4720]
642394[F], 713993[F], 713994[F], 713996]F], 802346[F], 802347[F]
AGTR1 642393[F], 713995[F], 802348[F], 924201[F], 924203[F], 802349[F], 924200[F], 924202[F], 924204(2781], 924199[2244],
(185) &
924201(699], 924203[-418], 713995[-1301], 802348[-2418], 33838[F], 924202(1564], 934615(188], 713996[-436], 825623[-1812],
Agtrl a 176979[F], 176982[F], 176983[F], 176988[F], 176989[F], 176992[F] 33839[F], 176977[F], 176978[F], 176980[F], 176981[F], 176984[F],
(11607)
176985[F], 176986[F], 176987[F], 176990[F], 176991 [F]
625551 [F], 625552[F], 830033[F], 830034[F], 830035[F], 830036[F],
830037[F], 830038[F], 830039[F], 830040[F], 830041 [F], 830042[F],
AGTRAP
830032[-1328], 830031 [-1459], 830030[-1826], 11614[F], 427214[F],
(57085) & 427215[F], 427216[F], 427217[F], 427218[F], 427219[F], 427220[F], 625550[F], 11612[-1639], 427211[-4926]
Agtrap 427221 [F], 427222[F], 427223[F], 427224[F], 427225[F], 427226[F],
(11610) 427227[F], 427228[F], 427229[F], 11613[-1639], 427213[-2163],
427212[-4145]
617525[F], 660890[F], 660891[F], 660892[F], 1408[F], 65882[F], AGXT 65883[F], 65884[F], 65885[F; (189) &
AGXT2
645009[F], 733490[F], 733491[F], 37653[F], 223868[F], 223871[F], 645010[F], 733487[F], 733488[F], 733489[F], 733486[-1357], (64902) & 223873[F], 223875[F], 223876[F] 37654[F], 223869[F], 223870[F], 223872[F], 223874[F], 223867[15] Agxt2
(268782) AGXT2L1
623187[F], 811964[F], 811965[F], 811966[F], 811967[F], 8528[F], (64850) & 386236[F], 386237[F], 386238[F], 386239[F], 386240[F] Agxt2l1
(71760)
687291[F], 687292[F], 687294[F], 687295[F], 687296[F], 687297[F], 687298[F], 687299[F], 687300[F], 687301 [F], 687302[F], 687303[F], 926753[F], 926755[F], 926756[F], 926757[F], 926758[F], 926759[F], 926760[F], 926761[F], 638651(11257], 926752(2875], 687304]- 1359], 687305[-1664], 638652]-2227], 687306[-2622], 687307]-
AGXT2L2 2955], 687308[-3001], 687309]-3212], 687310[-3310], 687311 ]-
687293[F], 926754[F], 918014[-2632], 687290[-4632], 638649[-4813] (85007) &
3506], 6873121-3650], 638650[-4813], 29122[F], 121625[F],
29121[F], 121627[F], 121629[F], 121624[-3490] Agxt2l2
121626[F], 121628[F], 121630[F], 121631[F], 121632[F], 121633[F],
(72947) 121634[F], 121635[F], 121636[F], 121637[F], 121638[F], 121639[F], 121640[F], 121641[F], 121642[F], 121643[F], 121644[F],
29123(7089], 121645[-1176], 121646[-1405], 29124[-1890], 121647]- 2285], 121648[-2591], 121649[-2640], 121650[-2835], 121651 ]- 2917], 121652[-3084], 121653[-3243], 121623[-3942]
618532[F], 668439[F], 668440[F] 668442[F], 668443[F], 668444[F],
668447[F], 668448[F], 668449[F], 668450[F], 668451 [F], 668453[F],
668454[F], 668455[F], 668456[F], 668459[F], 668461 [F], 668463[F],
668465[F], 668467[F], 668469[F], 668470[F], 668471 [F], 668472[F],
668473[F], 668474[F], 668475[F], 668477[F], 2673[F], 81246[F], 618531[F], 668441[F], 668445[F], 668446[F], 668452[F], 668457[F],
AHCTF1 81247[F], 81249[F], 81250[F], 81251[F], 81253[F], 81254[F], 668458[F], 668460[F], 668462[F], 668464[F], 668466[F], 668468[F],
(25909) & 81258[F], 81259[F], 81260[F], 81261[F], 81262[F], 81264[F], 668476[F], 2672[F], 81248[F], 81252[F], 81255[F], 81256[F],
Ahctfl 81265[F], 81266[F], 81267[F], 81268[F], 81269[F], 81270[F], 81257[F], 81263[F], 81272[F], 81274[F], 81275[F], 81277[F],
(226747) 81271[F], 81273[F], 81276[F], 81278[F], 81280[F], 81282[F], 81279[F], 81281[F], 81284[F], 81286[F], 81300[F]
81283[F], 81285[F], 81287[F], 81288[F], 81289[F], 81290[F],
81291[F], 81292[F], 81293[F], 81294[F], 81295[F], 81296[F],
81297[F], 81298[F], 81299[F], 81301[F], 81302[F], 81303[F], 81245]- 4812] TABLE 2 - Page 44 of 1873
622914[F], 810102[F], 810103[F], 810104[F], 810105[F], 810106[F],
810107[F], 810108[F], 810109[F], 810110[F], 810111 [F], 810112[F],
810115[F], 810116[F], 810117[F], 810118[F], 810119[F], 810120[F],
810121 [F], 810122[F], 810123[F], 810124[F], 810125[F], 810127[F],
810128[F], 810129[F], 810130[F], 810131[F], 810132[F], 810133[F], AHCYL1
622912[F], 622913[F], 810113[F], 810114[F], 810126[F],
810134[F], 622914[22814], 810129[-3727], 8201 [F], 382304[F], (10768) &
622913[22814], 8200[F], 382315[F], 382316[F], 382334[F],
382305[F], 382306[F], 382307[F], 382308[F], 382309[F], 382310[F], AhcyH
382337[F], 382338[F], 382339[F], 8199[-2586], 382303[-3922]
382311[F], 382312[F], 382313[F], 382314[F], 382317[F], 382318[F], (229709) 382319[F], 382320[F], 382321[F], 382322[F], 382323[F], 382324[F],
382325[F], 382326[F], 382327[F], 382328[F], 382329[F], 382330[F],
382331 [F], 382332[F], 382333[F], 382335[F], 382336[F], 382340[F],
382341 [F], 382342[F], 382343[F], 382344[F], 382345[F], 382346[F]
628232[F], 849516[F], 849517[F], 849518[F], 849519[F], 849520[F], 849521[F], 849522[F], 849523[F], 849522[-450], 849521 [-4113],
628234[-4220], 15237[F], 470798[F], 470799[F], 470800[F], AHCYL2 470801[F], 470802[F], 470803[F], 470804[F], 470805[F], 470806[F], (23382) &
729502[F], 918726[F], 628233[-4220], 15238[-4701]
470807[F], 470808[F], 470809[F], 470810[F], 470811 [F], 470812[F], Ahcyl2 470813[F], 470814[F], 470815[F], 470816[F], 470817[F], 470818[F], (74340) 470819[F], 470820[F], 470821 [F], 470822[F], 470823[F], 470819[- 667], 470818[-2766], 15239[-4701]
625142[F], 826560[F] 826562[F] 826563[F; , 826564[F] , 826565[F],
826566[F], 826567[F] 826576[F] 826577[F , 826579[F] , 826580[F],
826582[F], 826583[F] 826584[F] 826585[F; , 826586[F] , 826587[F],
826588[F], 826589[F] 826590[F] 826591 [F , 826592[F] , 826593[F],
826594[F], 826595[F] 826596[F] 826597[F; , 826599[F] , 826600[F],
826601 [F], 826602[F] 826603[F] 826604[F; , 826605[F] , 826606[F],
826607[F], 826608[F] 826609[F] 826610[F; , 826611 [F] , 826612[F],
826615[F], 826616[F] 826617[F] 826619[F; , 826620[F] , 826621 [F],
625143[F], 826561[F], 826568[F], 826569[F], 826570[F], 826571[F], 826622[F], 826624[F] 826625[F] 826626[F; , 826627[F] , 826628[F],
826572[F], 826573[F], 826574[F], 826575[F], 826578[F], 826581 [F], 826629[F], 826631[F] 826632[F] 826634[F , 826635[F] , 826559[- AHDC1
826598[F], 826613[F], 826614[F], 826618[F], 826623[F], 826630[F], 173], 826558[-305] 826556[- 444] 11089[F] 417247[F], 41 249[F], (27245) &
826633[F], 826557[-348], 11090[F], 41 248[F], 417252[F],
417250[F], 417251[F] 417253[F] 417254[F , 417255[F] , 417256[F], Ahdd
417259[F], 417260[F], 417261[F], 417262[F], 417263[F], 417264[F], 417257[F], 417258[F] 417267[F] 417268[F , 417270[F] , 417271[F], (230793)
417265[F], 417266[F], 417269[F], 417272[F], 417281 [F], 417293[F], 417273[F], 417274[F] 417275[F] 417276[F , 417277[F] , 417278[F],
417308[F], 417309[F], 417313[F], 417318[F], 417326[F], 417329[F] 417279[F], 417280[F] 417282[F] 417283[F , 417284[F] , 417285[F],
417286[F], 417287[F] 417288[F] 417289[F , 417290[F] , 417291 [F],
417292[F], 417294[F] 417295[F] 417296[F , 417297[F] , 417298[F],
417299[F], 417300[F] 417301[F] 417302[F , 417303[F] , 417304[F],
417305[F], 417306[F] 417307[F] 417310[F; , 417311 [F] , 417312[F],
417314[F], 417315[F] 417316[F] 417317[F; , 417319[F] , 417320[F],
417321[F], 417322[F] 417323[F] 417324[F; , 417325[F] , 417327[F],
417328[F], 417330[F] 417331[F] 417332[F;
636493[F], 636495[F], 636496[F], 671853[F], 671854[F], 671855[F],
671856[F], 671857[F], 671860[F], 671862[F], 671863[F], 671864[F],
671866[F], 671867[F], 671868[F], 671872[F], 671873[F], 671874[F], 636494[F], 636497[F], 671858[F], 671859[F], 671861 [F], 671865[F], 671875[F], 671876[F], 671877[F], 671880[F], 636493(213787], 671869[F], 671870[F], 671871 [F], 671878[F], 671879[F], 671881[F],
AHI1 26298[F], 26300[F], 26301 [F], 88065[F], 88067[F], 88068[F], 636494[213787], 26299[F], 26302[F], 88066[F], 88073[F], 88074[F],
(54806) & 88069[F], 88070[F], 88071 [F], 88072[F], 88075[F], 88077[F], 88076[F], 88078[F], 88081 [F], 88084[F], 88088[F], 88089[F],
Ahi1 88079[F], 88080[F], 88082[F], 88083[F], 88085[F], 88086[F], 88092[F], 88096[F], 88098[F], 88101[F], 88102[F], 88103[F],
(52906) 88087[F], 88090[F], 88091 [F], 88093[F], 88094[F], 88095[F], 88111[F], 88112[F], 88114[F], 26302[8081], 88098[-1377], 88096[- 88097[F], 88099[F], 88100[F], 88104[F], 88105[F], 88106[F], 4156]
88107[F], 88108[F], 88109[F], 88110[F], 88113[F], 26301 [8081],
88097[-1675], 88095[-4977] TABLE 2 - Page 45 of 1873
773729[F; , 773730[F] 773731 [F] 773732[F], 773733[F] 773734[F], 773735[F; , 773736[F] 773737[F] 773738[F], 773739[F] 773740[F], 773741 [F , 773742[F] 773743[F] 773744[F], 773745[F] 773746[F], 773747[F " , 773748[F] 773749[F] 773750[F], 773751 [F] 773752[F], 773753[F; , 773754[F] 773755[F] 773756[F], 773757[F] 773758[F], 773759[F " , 773760[F] 773761 [F] 773762[F], 773763[F] 773764[F], 773765[F; , 773766[F] 773767[F] 773768[F], 773769[F] 773770[F], 773771 [F , 773772[F] 773773[F] 773774[F], 773775[F] 773776[F], 773777[F; , 773778[F] 773779[F] 773780[F], 773781 [F] 773782[F], 773783[F " , 773784[F] 773785[F] 773786[F], 773787[F] 773788[F], 773789[F; , 773790[F] 773791 [F] 773792[F], 773793[F] 773794[F], 773795[F; , 773796[F] 773797[F] 773798[F], 773799[F] 773800[F], 773801 [F , 773802[F] 773803[F] 773804[F], 773805[F] 773806[F],
AHNAK
773807[F; , 773808[F] 773809[F] 773810[F], 773811 [F]
(79026) & 650218[1 3265] 44461 [[FF]],, 308444[F], 308445[F], 308446[F]
A nak 308447[F; , 308448[F] 308449[F] 308450[F], 308451 [F] 308452[F],
(66395) 308453[F; , 308454[F] 308455[F] 308456[F], 308457[F] 308458[F], 308459[F " , 308460[F] 308461 [F] 308462[F], 308463[F] 308464[F], 308465[F; , 308466[F] 308467[F] 308468[F], 308469[F] 308470[F], 308471 [F , 308472[F] 308473[F] 308474[F], 308475[F] 308476[F], 308477[F; , 308478[F] 308479[F] 308480[F], 308481 [F] 308482[F], 308483[F " , 308484[F] 308485[F] 308486[F], 308487[F] 308488[F], 308489[F; , 308490[F] 308491 [F] 308492[F], 308493[F] 308494[F], 308495[F " , 308496[F] 308497[F] 308498[F], 308499[F] 308500[F], 308501 [F , 308502[F] 308503[F] 308504[F], 308505[F] 308506[F], 308507[F; , 308508[F] 308509[F] 308510[F], 308511 [F] 308512[F], 308513[F; , 308514[F] 308515[F] 308516[F], 308517[F] 308518[F], 308519[F; , 308520[F] 308521 [F] 308522[F], 308523[F] 308524[F], 308525[F; , 308526[F] 308527[F] 308528[F], 308529[F]
711518[F], 711519[F], 711520[F], 711521[F], 711522[F],
711523[F; 711524[F], 711525[F], 642012[36645], 170456[F],
642011(3845], 33268[F], 170451 [F], 170452[F], 170453[F], mwuft R
170457[F 170458[F], 170459[F], 170460[F], 170461 [F], 170462[F], ( 170454[F], 170455[F], 33268[210], 170455[-385], 170454[-634], f¾
170463[F 33269[32651], 33270[-439], 170464[-462]
170453[-806], 170452[-1076], 170451[-2694 (10004119
703585[F], 703586[F], 703587[F], 703588[F], 703589[F], 703590[F],
AHR (196) 703591[F], 641043(47497], 32037[F], 154139[F], 154140[F], 703592[F " 641042(47497], 32036[F], 154143[F], 154144[F],
& Ahr 154141[F], 154142[F], 154145[F], 154146[F], 154147[F], 154148[F], 154150[F; 154151[F], 154152[F]
(11622) 154149[F]
643015[F], 718121[F], 718122[F], 718123[F], 718124[F], 643013]
AHRR
4928], 34816[F], 188705[F], 188706[F], 188707[F], 188709[F], 643014[F; 643016(10799], 643012[-4928], 34815[F], 188708[F],
(57491) & 188710[F], 188711[F], 188716[F], 188717[F], 188718[F], 188719[F], 188712[F " 188713[F], 188714[F], 188715[F], 188722[F], 34813]-
Ahrr 188720[F], 188721[F], 34814[-2384], 188704[-3156], 188703[-3485], 2384]
(11624) 1887021-4126]
641675[F], 708563[F], 708564[F], 708566[F], 708567[F], 708568[F],
708569[F], 708570[F], 708571[F], 708573[F], 708574[F], 708575[F],
AHSA1 708576[F], 641673[-389], 708562[-847], 641677[-4922], 32812[F], 641676[F], 708565[F], 708572[F], 708577[F], 641674[-389], 641678|
(10598) & 164415[F], 164416[F], 164418[F], 164419[F], 164420[F], 164421[F], 4922], 708561 [-4976], 32813[F], 164417[F], 164427[F], 164434[F],
Ahsal 164422[F], 164423[F], 164424[F], 164425[F], 164426[F], 164428[F], 32811 [-373]
(217737) 164429[F], 164430[F], 164431[F], 164432[F], 164433[F], 32810]- 373], 164414[-854]
638315[F], 684497[F], 684498[F], 684499[F], 684500]F], 684501[F], AHSA2 684502[F], 638313[97], 684496[-3862], 28693[F], 116121[F], (130872) &
638314[F], 28692[F]
116122[F], 116123[F], 116124[F], 116125[F], 116126[F], A sa2 28691[2680], 116120[-2144 " (268390)
646684[F], 745991[F], 745992[F], 646682(2687], 39805[F], AHSG 250132[F], 250133[F], 250134[F], 39803[2346], 250131[-2395], 646683(2687], 39804(2346] (197) & 250130[-3384] Ahsg
629404[F], 860443[F], 860445[F], 860446[F], 629403(10340], AICDA 16733[F], 493666[F], 493667[F], 493668[F], 493670[F], 493671 [F], (57379) &
860444[F], 629402[10340], 16732[F], 493669[F]
493672[F], 16734(4138], 493673[-971], 493674[-2355], 493675]- Aicda 2720], 493676[-2837], 493677]-3067] (11628)
648152[F], 932868[F], 757841 [33], 648150[-3672], 757839[-4322], 648151[F], 757840[F], 932867[F], 757840(55], 41814[F], 41823[F], AIF1 (199) 41815[F], 41824[F], 275710[F], 275708[-3555 275709[F], 275707[-4737] & Aifl
784511[F], 619301[26672], 619303[-2438], 784513[-2522], 619299]-
AIF1L
3416], 784514[-4507], 784515[-4633], 3608[F], 329459[F], 329460[F] 784512[F], 619302[26672], 619304[-2438], 619300[-3416], 3609[F],
(83543) &
329463[F], 329465[F], 329466[F], 329467[F], 3610[-995], 329469]- 329458[F], 329461[F], 329462[F], 329464[F], 329468[F], 3611[-995]
Aif1l
1091], 3606[-3180], 329470[-3193], 329471 [-3327], 329472[-3669], 3607[-3180]
(108897) 329473[-4609], 329474[-4673] 2 - Page 46 of 1873
651345[F], 909742[F], 909743[F], 909744[F], 909745[F], 909746[F]
AIFM1 909747[F], 909748[F], 909749[F], 651344(36520], 46060[F],
(9131) & 600379[F], 600380[F], 600381 [F], 600382[F], 600383[F], 600384[F], 600385[F], 600386[F], 600387[F], 600388[F], 600389[F], 600390[F],
(26926) 600391 [F], 600392[F], 600393[-66], 46061 [-256], 600394[-3010]
636933[F], 674952[F], 674955[F], 674956[F], 674957[F], 636935[18], 636934[F], 674951[F], 674953[F], 674954[F], 636936[18], 674958]-
AIFM2 645390[11], 26898[F], 95362[F], 95363[F], 95364[F], 95368[F], 305], 26899[F], 95360[F], 95361[F], 95365[F], 95366[F], 95367[F],
(84883) &
95370[F], 95373[F], 95374[F], 95375[F], 95376[F], 95378[F], 95369[F], 95371 [F], 95372[F], 95377[F], 95380[F], 26901[619],
Aifm2
95379[F], 26900[619], 95364[-1922], 95363[-2229], 95384[-3626], 95380[-311], 95365[-556], 95381[-1325], 95382[-1918], 95383]- (71361) 95362[-4370] 3088], 95385[-3766], 95361[-4568], 95360[-4830]
646542[F], 744995[F], 744996[F], 744997[F], 744998[F], 744999[F],
646543[F], 744993[F], 744994[F], 745000[F], 745001 [F], 646545]- AIFM3 745002[F], 646544[-627], 745003[-1680], 39637[F], 248269[F],
627], 744993[-723], 745004[-2738], 39638[F], 248267[F], 248268[F], (150209) & 248271 [F], 248272[F], 248273[F], 248274[F], 248275[F], 248278[F],
248270[F], 248276[F], 248277[F], 39640[-1199], 39636[-2249], Aifm3 396391-1199], 248279[-2157], 39635[-2249], 248281 [-3882], 248266]- 248280[-3213] (72168) 4641]
636417[F], 636419[F], 671281[F], 671282[F], 671283[F], 671288[F],
671290[F], 671291[F], 671292[F], 671295[F], 671298[F], 671299[F],
671300[F], 671303[F], 671304[F], 671305[F], 671306[F], 671307[F], 636416[F], 636418[F], 671284[F], 671285[F], 671286[F], 671287[F], 671308[F], 671309[F], 671311[F], 671312[F], 671313[F], 671314[F], 671289[F], 671293[F], 671294[F], 671296]F], 671297[F], 671301[F], 9332811-27], 933283[-338], 933280[-340], 913818[-2027], 913832]- 671302[F], 671310[F], 671315[F], 671316[F], 671317[F], 671318[F],
AIG1 2338], 913817[-2340], 26196[F], 86938[F], 86939[F], 86941 [F], 9332821-714], 913831[-2714], 26195[F], 86940[F], 86942[F],
(51390) & 86945[F], 86951 [F], 86952[F], 86954[F], 86956[F], 86957[F], 86943[F], 86944[F], 86946[F], 86947[F], 86948[F], 86949[F],
Aig1 86958[F], 86959[F], 86962[F], 86963[F], 86964[F], 86967[F], 86950[F], 86953[F], 86955[F], 86960[F], 86961 [F], 86965[F],
(66253) 86968[F], 86969[F], 86970[F], 86974[F], 86975[F], 86976[F], 86966[F], 86971 [F], 86972[F], 86973[F], 86981 [F], 86984[F],
86977[F], 86978[F], 86979[F], 86980[F], 86982[F], 86983[F], 86988[F], 86994[F], 86995[F], 86996[F], 86998[F], 87000[F],
86985[F], 86986[F], 86987[F], 86989[F], 86990[F], 86991 [F], 87003[F], 26197[-2448], 87004[-4992]
86992[F], 86993[F], 86997[F], 86999[F], 87001 [F], 87002[F], 26198]- 2448], 86937( 4845]
636762[F], 673680[F], 673683[F], 673684[F], 673686[F], 673687[F],
673688[F], 673689[F], 673690[F], 673691 [F], 673693[F], 673694[F], 636761[F], 673681[F], 673682[F], 673685[F], 673692[F], 636759]-
AIM1 (202) 636760[-568], 673678[-4061], 26670[F], 92508[F], 92511[F], 568], 673679[-1439], 26669[F], 92509[F], 92510[F], 92512[F],
& Aim1 92514[F], 92515[F], 92520[F], 92521 [F], 92522[F], 92524[F], 92513[F], 92516[F], 92517[F], 92518[F], 92519[F], 92523[F],
(11630) 92525[F], 92526[F], 92527[F], 92528[F], 92529[F], 92531 [F], 92530[F], 26667[6896], 92507[-1691], 92506[-3686], 92505[-4584] 92532]Fl, 92533[Fl, 26668[6896
625191[F], 826963[F], 826965[F], 826967[F], 826968[F], 826969[F], AIM1L
625190[F], 826962[F], 826964[F], 826966[F], 11143[F], 417859[F], 625192[14470], 11144[F], 417860[F], 417862[F], 417863[F], (55057) & 417861[F], 417857[-1027] 417864[F], 417865[F], 417866[F], 417867[F], 417868[F], 417869[F], Aiml l
417870[F], 11145[10048], 417858[-817] (230806)
618450[F], 667875[F], 667876[F], 667878[F], 618448(10726],
618451[F], 667877[F], 667879[F], 618449(10726], 79884[F], AIM2 79883[F], 79888[F], 79890[F], 79891 [F], 79892[F], 79893[F],
79885[F], 79886[F], 79887[F], 79889[F], 79898[F], 79901 [F], (9447) & 79894[F], 79895[F], 79896[F], 79897[F], 79899[F], 79900[F],
79902[F], 79905[F], 79906[F], 2571 (41501], 2573(3891], 79881]- Aim2 79903[F], 79904[F], 2570(41501], 2572[3891], 79882[-2021], 2574]- 3229] (383619) 23751, 79907[-4316l
623212[F], 812102[F], 812103[F], 812104[F], 812105[F], 812106[F],
812107[F], 812108[F], 812109[F], 812110[F], 812111 [F], 812112[F],
AIMP1 812114[F], 812115[F], 812116[F], 812117[F], 623213(657], 8557[F],
623211[F], 812113[F], 812118[F], 8556[F], 386530[F], 386541]F], (9255) & 386522[F], 386523[F], 386524[F], 386525[F], 386526[F], 386527[F],
386547[F] Aimpl 386528[F], 386529[F], 386531[F], 386532[F], 386533[F], 386534[F],
(13722) 386535[F], 386536[F], 386537[F], 386538[F], 386539[F], 386540[F],
386542[F], 386543[F], 386544[F], 386545[F], 386546[F], 8558[-263]
627843[F], 846372[F], 846373[F], 846374[F], 846375[F], 846376[F], 627842[F], 846377[F], 846380[F], 846381 [F], 627838[1588],
846378[F], 846379[F], 627839[1588], 846370[-225], 846369[-480], 846371[-115], 925088[-139], 846367[-749], 846366[-873], 846382]- AIMP2 846368[-645], 627841 [-4327], 925089[-4713], 14730[F], 464035[F], 2139], 627840[-4327], 846365[-4804], 14729[F], 464038[F], (7965) & 464036[F], 464037[F], 464039[F], 464040[F], 464041 [F], 464042[F], 464043[F], 464044[F], 464045[F], 464047[F], 464050[F], 464051 [F], Aimp2
464046[F], 464048[F], 464049[F], 14726[1557], 14732(245], 464033[-14725[1557], 14731(245], 464034[-98], 464052[-671], 464030[-682], (231872)
201], 464032[-416], 464031[-547], 464054[-4879] 4640291-825], 464053[-984], 464028[-1591]
649974[F], 772239[F], 772241 [F], 649972(403], 772237[-4041], 649973[F], 772240[F], 649971(403], 772238[-3841], 772236[-4221], AlP (9049) 44192[F], 305976[F], 305978[F], 305981[F], 305982[F], 44190(418], 44191[F], 305977[F], 305979[F], 305980[F], 44189(418], 305975]- & Aip 305974[-3528] 3360], 305973[-3708] (11632)
AIPL1
639214[F], 29812[F], 128181[F], 29813H521] 639213[F], 690800[F], 29811[F], 128182[F] (23746) &
AipH
637161[F], 676795[F], 676796[F], 676797[F], 676798[F], 676799[F],
676800[F], 676801[F], 676802[F], 676803[F], 637161 (7361],
929270(2059], 676798[-3296], 676799[-3411], 676800[-3657], AIRE (326) 676801 [-4125], 676802[-4374], 676803[-4452], 27204[F], 99875[F], 637160[-1765], 27205[1635], 99891[-751] & Aire 99876[F], 99877[F], 99878[F], 99879[F], 99880[F], 99881 [F], (11634) 99882[F], 99883[F], 99884[F], 99885[F], 99886[F], 99887[F],
99888[F], 27206[1635], 99889[-10], 99890[-730] TABLE 2 - Page 47 of 1873
625689[F], 831290[F], 831291 [F], 831292[F], 831293[F], 831294[F],
625690[F], 831295[F], 831297[F], 831298[F], 831299[F], 831302[F], 831296[F], 831300[F], 831301 [F], 831303[F], 831304[F], 831305[F],
AJAP1 831306[F], 1 1774[F], 429452[F], 429453[F], 429457[F], 429458[F], 831307[F], 831308[F], 845194[F], 831290[-4738], 11773[F],
(55966) & 429459[F], 429460[F], 429463[F], 429465[F], 429467[F], 429470[F], 429451 [F], 429454[F], 429455[F], 429456[F], 429461 [F], 429462[F],
Ajapl 429472[F], 429473[F], 429474[F], 429478[F], 429479[F], 429484[F], 429464[F], 429466[F], 429468[F], 429469[F], 429471 [F], 429475[F],
(230959) 429488[F], 429489[F], 429491 [F], 429492[F], 429493[F] 429476[F], 429477[F], 429480[F], 429481 [F], 429482[F], 429483[F],
429485[F], 429486[F], 429487[F], 429490[F], 429494[F], 429495[F]
726934[F], 726935[F], 726936[F], 726937[F], 726938[F], 726939[F],
AJUBA
726940[F], 726941 [F], 644133(10830], 726935[-340], 726936[-432],
(84962) &
644135[-3944], 726942[-4633] 726937[-1 180], 726938[-1718], 726939[-2040], 726940[-2326],
Jub 644134[-39 4 4], 36536[F], 210030[F], 210031 [F], 210032[F],
(16475) 210033[F], 210034[F], 210035[F], 210036[F], 210037[F]
36391-947], 329801 [-1004], 329800[-1199], 329799[-1388], 329798]- 619333[F], 784733[F], 784732[26], 3641 [F], 329802[F], 329803[F], AK1 (203) 1497], 329796[-1716], 329795[-1954], 329794[-2339 329802[8], 3640[-947], 329797[-1510 & Ak1
625001 [F], 825588[F], 825589[F], 825590[F], 825591 [F], 825593[F],
825594[F], 825595[F], 825596[F], 825598[F], 825600[F], 825601 [F],
825602[F], 825604[F], 825607[F], 825608[F], 825609[F], 825610[F],
825612[F], 825613[F], 82561 [F], 926079[F], 926080]F], 926081 [F],
926083[F], 926084[F], 926085[F], 926079(1507], 926080(1381], 625002[F], 825592[F], 825597[F], 825599[F], 825603[F], 825605[F], 926081 (1251], 926083(1103], 926084(932], 926085(764], 825608[- 825606[F], 825611 [F], 926082[F], 926078(1637], 926082(1 153],
AK2 (204) 493], 8256091-619], 825610[-749], 825612[-897], 825613[-1068], 825587[-363], 82561 1 [-847], 10929[F], 415443[F], 415448[F],
& Ak2 8256141-1236], 10928[F], 415436[F], 415437[F], 415438[F], 415451 [F], 415455[F], 415456[F], 415458[F], 415459[F], 415464[F],
(1 1637) 415439[F], 415440[F], 415441 [F], 415442[F], 415444[F], 415445[F], 4154351-366], 415459[-512], 415434[-1904], 415464[-2632],
415446[F], 415447[F], 415449[F], 415450[F], 415452[F], 415453[F], 415433[-3477]
415454[F], 415457[F], 415460[F], 415461 [F], 415462[F], 415463[F],
415465[F], 415466[F], 415467[F], 415460[-800], 415461 [-2275],
415462[-2412], 415463 [-2540], 415465[-2683], 415466[-2817],
415467[-3061 ]
650504[F], 776092[F], 776093[F], 776094[F], 776096[F], 776100[F],
650505[F], 650506[F], 776095[F], 776097[F], 776098[F], 776099[F],
776101 [F], 650502[9372], 776091 [-457], 776090[-1478], 776089[- 776102[F], 776103[F], 650503[9372], 650506(1 1 1 1], 776103(40],
1884], 776087[-2715], 776086[-2878], 776085[-3333], 776084[- AK3 776102[-315], 776088[-1922], 776083[-351 1 ], 44822[F], 44823[F],
3403], 44821 [F], 312869[F], 312870[F], 312871 [F], 312873[F], (50808) & 312872[F], 312874[F], 312875[F], 312876[F], 312880[F], 312881 [F],
312877[F], 312878[F], 312879[F], 312884[F], 312885[F], 312888[F], Ak3 312882[F], 312883[F], 312886[F], 312887[F], 312890[F],
312889[F], 312891 [F], 44819[5849], 312867[-1103], 312866[-1412], (56248) 44820(5849], 44824(421 ], 312892[-264], 312893[-401 ], 312868[-950]
312864[-1587], 312863[-1993], 312862[-2856], 312861 [-3252],
312865[-1576], 312860 [-3290], 312855[-4791 ]
312859[-3995], 312858[-4155], 312857[-4619], 312856[-4687]
624440[F], 820942[F], 820943[F], 820944[F], 820945[F], 820946[F],
AK4 (205) 407077[F], 407078[F], 407079[F], 407080[F], 407081 [F], 407082[F],
& Ak4 407083[F], 407084[F], 407085[F], 407086[F], 407087[F], 407088[F],
(1 1639) 407089[F], 10234[48165]
AK4P3
619779[F], 789166[F]
(645619)
623465[F], 813578[F], 813579[F], 813583[F], 813584[F], 813586[F], 813589[F], 813591 [F], 813594[F], 813595[F], 813597[F], 813598[F],
813599[F], 813600[F], 813601 [F], 813602[F], 813608[F], 813609[F],
623466[F], 813580[F], 813581 [F], 813582[F], 813585[F], 813587[F], 918212[1634], 91821 1 [1052], 918210[681 ], 918209[-227], 81361 1 [- 813588[F], 813590[F], 813592[F], 813593[F], 813596[F], 813603[F], 366], 813577[-948], 920414[-1 164], 813576[-1319], 813575[-2227], 813604[F], 813605[F], 813606[F], 813607[F], 813610[F], 623464[- 920413[-2243], 813574[-3164], 813573[-4243], 652062[-4531 ],
4535], 8865[F], 38969 4 [F], 389695[F], 389696[F], 389697[F], 623463[-4535], 8864[F], 389691 [F], 389692[F], 389693[F],
AK5 389702[F], 389706[F], 389708[F], 389709[F], 38971 1 [F], 389712[F], 389698[F], 389699[F], 389700[F], 389701 [F], 389703[F], 389704[F],
(26289) & 389716[F], 389717[F], 389718[F], 389722[F], 389724[F], 389728[F], 389705[F], 389707[F], 389710[F], 389713[F], 389714[F], 389715[F],
Ak5 389731 [F], 389732[F], 389734[F], 389735[F], 389736[F], 389739[F], 389719[F], 389720[F], 389721 [F], 389723[F], 389725[F], 389726[F],
(229949) 389740[F], 389741 [F], 389742[F], 389748[F], 389749[F], 389750[F], 389727[F], 389729[F], 389730[F], 389733[F], 389737[F], 389738[F], 389751 [F], 389755[F], 389759[F], 389760[F], 389761 [F], 389766[F], 389743[F], 389744[F], 389745[F], 389746[F], 389747[F], 389752[F], 389769[F], 389770[F], 389772[F], 389774[F], 389777[F], 8863(5023], 389753[F], 389754[F], 389756[F], 389757[F], 389758[F], 389762[F], 8867[1229], 389778[-238], 389779[-368], 389781 [-1220] 389763[F], 389764[F], 389765[F], 389767[F], 389768[F], 389771 [F],
389773[F], 389775[F], 389776[F], 8862[5023], 8866[1229], 389780[- 448], 389690[-756], 389689[-1022], 389688[-1457], 389687[-2212], 389686[-3139], 389685[-4176] TABLE 2 - Page 48 of 1873
641871 [F], 710558[F], 710559[F], 710560[F], 710562[F], 710564[F],
641870[F], 710556[F], 710557[F], 710561[F], 710563[F], 710567[F],
710565[F], 710566[F], 641869[-4884], 33088[F], 168501 [F],
6 1868[-4884], 33087[F], 168496[F], 168497[F], 168498[F], AK7
168505[F], 168506[F], 168507[F], 168508[F], 168509[F], 168510[F], 168499[F], 168500[F], 168502[F], 168503[F], 168504[F], 168515[F], (122481) &
168511[F], 168512[F], 168513[F], 168514[F], 168516[F], 168518[F], 168517[F], 168519[F], 168520[F], 168521[F], 168522[F], 168524[F], Ak7
168523[F], 168525[F], 168526[F], 168529[F], 168531 [F], 168534[F], 168527[F], 168528[F], 168530[F], 168532[F], 168533[F], 168535[F], (78801)
168536[F], 168538[F], 168540[F], 168541 [F], 168542[F], 168543[F], 168537[F], 168539[F], 168547[F], 168548[F], 33085[-2922]
168544[F], 168545[F], 168546[F], 33089[-2062], 33086[-2922]
619203[F], 783633[F], 783634[F], 783635[F], 783638[F], 619201]- 619204[F], 783636[F], 783637[F], 783639[F], 783640[F], 783641[F], 42], 783632[-4401], 3501 [F], 327803[F], 327806[F], 327807[F], 783642[F], 783643[F], 619202[-42], 3502[F], 327804[F], 327805[F], AK8 327809[F], 327810[F], 327812[F], 327813[F], 327814[F], 327815[F], 327808[F], 327811[F], 327817[F], 327818[F], 327820[F], 327821 [F], (158067) S 327816[F], 327819[F], 327823[F], 327824[F], 327826[F], 327827[F], 327822[F], 327825[F], 327828[F], 327829]F], 327830[F], 327832[F], Ak8 327831 [F], 327835[F], 327837[F], 327838[F], 327842[F], 3499[-432], 327833[F], 327834[F], 327836[F], 327839[F], 327840[F], 327841 [F], (68870) 3278021-3455], 327800[-4466] 35001-432], 3278011-4301]
639689[F], 639690[F], 694855[F], 694856[F], 694857[F], 694858[F], 694859[F], 694860[F], 694861 [F], 694862[F], 694863[F], 694864[F], 639689[36153], 694864[-359], 30347[F], 135301[F], 135302[F],
135303[F], 135304[F], 135305[F], 135306[F], 135307[F], 135308[F], 135309[F], 135310[F], 135311[F], 135312[F], 135313[F],
30348(12984], 135314[-1040], 135315[-1816], 135307[-1962], 135308[-2476], 135309[-2756], 135310[-2836], 135316[-4961]
638911[F], 688892[F], 688893[F] 688894[F], 688895[F], 688896[F],
688897[F], 688900[F], 688901[F] 688902[F], 688903[F], 688904[F],
688905[F], 688906[F], 688908[F] 688909[F], 688910[F], 688911 [F],
688912[F], 29481 [F], 125001[F], 25002[F], 125003[F], 125005[F],
638910[F], 688898[F], 688899[F], 922274[-2628], 922273[-2786], 125006[F], 125009[F], 125010[F] 125011[F], 125012[F], 125013[F], AKAP10
688891 [-4628], 688890[-4786], 29480[F], 125004[F], 125007[F],
125015[F], 125016[F], 125017[F] 125019[F], 125022[F], 125023[F], (11216) &
125008[F], 125014[F], 125018[F], 125020[F], 125021 [F], 125025[F], 125024[F], 125026[F], 125028[F] 125029[F], 125030[F], 125031 [F], AkapIO
125027[F], 125039[F], 125045[F], 125050[F], 29478[-1914], 125000| 125032[F], 125033[F], 125034[F] 125035[F], 125036[F], 125037[F], (56697)
1957], 124999[-2093]
125038[F], 125040[F], 125041 [F] 125042[F], 125043[F], 125044[F],
125046[F], 125047[F], 125048[F] 125049[F], 125051 [F], 125052[F],
294791-1914], 124998[-2135], 124997[-2217], 124996[-3181
124995[-3616], 124994[-4274]
730429[F], 730430[F], 730431 [F], 730432[F], 730433[F], 730434[F], AKAP11
644670[51114], 37187[F], 216963[F], 216964[F], 216965[F], (11215) &
216966[F], 216967[F], 216968[F], 216969[F], 216970[F], 216971[F], Akap11
216972[F] (219181 )
636332[F], 670556[F], 670557[F] 670558[F] 670559[F], 670560[F],
670561 [F], 670562[F], 670563[F] 670564[F] 670565[F], 670566[F],
670567[F], 670568[F], 670569[F] 670570[F] 670571 [F], 670572[F],
670573[F], 670574[F], 670575[F] 670576[F] 670577[F], 670578[F],
670579[F], 670580[F], 670581 [F] 670582[F] 670583[F], 670584[F],
670585[F], 670586[F], 670587[F] 670588[F] 670589[F], 670590[F],
670591 [F], 670592[F], 670593[F] 670594[F] 670595[F], 670596[F],
670597[F], 670598[F], 670599[F] 670600[F] 670601 [F], 670602[F],
670603[F], 670604[F], 670605[F] 670606[F] 670607[F], 670608[F],
670609[F], 670610[F], 670611[F] 670612[F] 670613[F], 670614[F],
670615[F], 670616[F], 670617[F] 670618[F] 920343[F], 920344[F],
920345[F], 920346[F], 920347[F] 920348[F] 920349[F], 920350[F],
920351 [F], 920352[F], 920353[F] 920354[F] 920355[F], 920356[F],
920357[F], 920358[F], 920359[F] 920360[F] 920361 [3209],
920362[2672], 920363(2516], 920364(2335], 920343(1600], AKAP12
920344(247], 670597[-400], 920345[-727], 920346[-1000], 670598[- (9590) &
1753], 670599( 2727], 670600[-3000], 26093[F], 85457[F], 85458[F], Akap12
85459[F], 85460[F], 85461 [F], 85462[F], 85463[F], 85464[F], (83397)
85465[F], 85466[F], 85467[F], 85468[F], 85469[F], 85470[F],
85471 [F], 85472[F], 85473[F], 85474[F], 85475[F], 85476[F],
85477[F], 85478[F], 85479[F], 85480[F], 85481 [F], 85482[F],
85483[F], 85484[F], 85485[F], 85486[F], 85487[F], 85488[F],
85489[F], 85490[F], 85491 [F], 85492[F], 85493[F], 85494[F],
85495[F], 85496[F], 85497[F], 85498[F], 85499[F], 85500[F],
85501 [F], 85502[F], 85503[F], 85504[F], 85505[F], 85506[F],
85507[F], 85508[F], 85509[F], 85510[F], 85511[F], 85512[F],
85513[F], 85514[F], 85515[F], 85516[F], 85517[F], 85518[F],
85519[F], 85520[F], 85521 [F], 85522[F], 85523[F], 85524[F],
85525[F], 85526[F], 85527[F], 85528[F], 85529[F], 85530[F],
85531 [F], 85532[F], 85533[F], 85534[F], 85535[F], 85536[F],
85537[F], 85538[F], 85539[F], 85540[F], 85541 [F], 85542[F],
R5543rFl. R5544F1. R5545rFl. 85546ΓΠ. R5547rFl. R5548rFl. TABLE 2 - Page 49 of 1873
870711[F 870712[F; 870713[F] 870714[F] 870716 [F]
870719[F 870720[F; 870721 [F; 870722[F] 870723[F]
870726[F 870727[F; 870728[F; 870729[F] 870730[F]
870732[F 870733[F; 870734[F; 870735[F] 870736[F]
870738[F 870739[F 870740[F 870741 [F] 870744[F]
870746[F 870747[F; 870749[F; 870752[F] 870754[F]
870757[F 870758[F 870759[F 870760[F] 870761 [F]
870763[F 870764[F; 870766[F; 870767[F] 870769[F]
870772[F 870774[F 870775[F 870777[F] 870780[F]
870783[F 870784[F; 870785[F; 870786[F] 870787[F]
631140[F], 870715[F] 870718[F], 870725[F] , 870742[F], 870743[F], 870790[F 870791 [F 870793[F 870794[F] 870795[F]
870748[F], 870750[F] 870751 [F], 870753[F] 870755[F], 870765[F], 870797[F; 870799[F; 870800[F; 870801 [F] 19454[F],
870768[F], 870771 [F] 870773[F], 870776[F] 870778[F], 870779[F], 517381[F 517382[F 517383[F 517384[F] 517385[F]
870781 [F], 870789[F] 870792[F], 870798[F] 870710[-3406],
517387[F 517388[F; 517390[F; 517392[F] 517393[F]
19455[F], 517389[F], 517391[F], 517395[F] 517396[F], 517400[F], 517397[F 517398[F; 517399[F; 517401 [F] 517402[F] AKAP13
517403[F], 517404[F] 517405[F], 517407[F] , 517409[F], 517414[F], 517408[F 517410[F; 517411[F; 517412[F] 517413[F] (11214) &
517417[F], 517420[F] 517421[F], 517422[F] , 517426[F], 517432[F], 517416[F; 517418[F; 517419[F; 517423[F] 517424[F] Akap13
517449[F], 517451 [F] 517455[F], 517456[F] 517458[F], 517461[F], 517427[F 517428[F; 517429[F; 517430[F] 517431 [F] (75547)
517462[F], 517464[F] 517466[F], 517473[F] 517474[F], 517475[F], 517434[F 517435[F 517436[F 517437[F] 517438[F]
517479[F], 517480[F] 517482[F], 517483[F] , 517484[F], 517488[F], 517440[F 517441 [F 517442[F 517443[F] 517444[F]
517491 [F], 517493[F] 517497[F], 517499[F] , 517503[F], 517505[F], 517446[F 517447[F 517448[F 517450[F] 517452[F]
517506[F], 517507[F] 517508[F], 517511[F] 517512[F], 517525[F], 517454[F 517457[F 517459[F 517460[F] 517463[F]
517531 [F], 517538[F]
517467[F 517468[F 517469[F 517470[F] 517471 [F]
517476[F 517477[F 517478[F 517481 [F] 517485[F]
517487[F 517489[F 517490[F 517492[F] 517494[F]
517496[F 517498[F 517500[F 517501 [F] 517502[F]
517509[F 517510[F 517513[F 517514[F] 517515[F]
517517[F; 517518[F 517519[F 517520[F] 517521 [F]
517523[F 517524[F; 517526[F; 517527[F] 517528[F]
517530[F 517532[F; 517533[F; 517534[F] 517535[F]
517537[F 517539[F; 517540[F; 517541 [F] 517379]-
651291[F], 909259[F], 909260[F], 909262[F], 926710(1782],
AKAP14
909261 [F 651290[-4333], 909261 [-4927], 45941[F], 926709(1663], 926708(1500], 909258[-218], 909257[-337], 909256[- (158798) & 599105[F; 599106[F], 599107[F], 599108[F], 599111 [F], 500], 651289[-4333], 909255[-4635], 45940[F], 599102(F],
Akap14
45939(194], 599096[-3711] 599103[F], 599104[F], 599109[F], 599110[F], 45938(194], 599100]- (434756) 152], 599099[-262], 599098[-353], 599097[-2864]
818099[F], 818100[F], 818101[F] 818102[F], 818103[F], 818104[F],
818105[F], 818106[F], 818107[F] 818110[F], 818111 [F], 818112[F],
818113[F], 818114[F], 818115[F] 818118[F], 818120[F], 818123[F],
818125[F], 818126[F], 818127[F] 818128[F], 818129[F], 818130[F],
818134[F], 818136[F], 818137[F] 818138[F], 818139[F], 818140[F],
818141[F], 818142[F], 818143[F] 818144[F], 818145[F], 818146[F],
818098[F], 818108[F], 818109[F], 818116[F], 818117[F], 818119[F], 818148[F], 818149[F], 818150[F] 920233[F], 920234[F], 920235[F],
818121[F], 818122[F], 818124[F], 818131[F], 818132[F], 818133[F], 920236[F], 920237[F], 920240[F] 920241 [F], 920242[F], 920243[F],
818135[F], 818147[F], 818151[F], 920238[F], 920239[F], 920246[F], 920244[F], 920245[F], 920248[F] 920250[F], 920253[F], 920255[F],
920247[F], 920249[F], 920251 [F], 920252[F], 920254[F], 920261 [F], AKAP2 920256[F], 920257[F], 920258[F] 920259[F], 920260[F], 920264[F],
920262[F], 920263[F], 920265[F], 920277[F], 920281 (2472], (11217) & 920266[F], 920267[F], 920268[F] 920269[F], 920270[F], 920271 [F],
920228(2235], 917845(1819], 917844(1247], 818097( 181], 818096]- Akap2
920272[F], 920273[F], 920274[F] 920275[F], 920276[F],
753], 9760[F], 400711[F], 400714[F], 400715[F], 400716[F], (11641) 920278(4024], 920279(3875], 920280(3308], 920232(3174],
400718[F], 400720[F], 400721[F], 400723[F], 400730[F], 400740[F], 920231(3042], 920230(2733], 920229(2616], 9759[F], 400712[F],
400741[F], 400742[F], 400754[F], 400758[F], 400715[-1322],
400713[F], 400717[F], 400719[F] 400722[F], 400724[F], 400725[F],
400714[-1927]
400726[F], 400727[F], 400728[F] 400729[F], 400731 [F], 400732[F],
400733[F], 400734[F], 400735[F] 400736[F], 400737[F], 400738[F],
400739[F], 400743[F], 400744[F] 400745[F], 400746[F], 400747[F],
400748[F], 400749[F], 400750[F] 400751 [F], 400752[F], 400753[F],
400755[F], 400756[F], 400757[F] 4007591-1139], 400760[-4104],
4007131-4643], 400712[-4880], 400761[-4982]
861240[F], 861243[F], 861244[F], 629529(29666], 629531[-1461], AKAP3
861241[F], 861242[F], 861245[F], 629528(29666], 629530[-1461],
8612461-1874], 861247[-2820], 916337[-3920], 861239[-4094], (10566) & 16902[F], 495112[F], 495113[F], 495116[F], 495117[F], 495118[F],
16903[F], 495110[F], 495111[F], 495114[F], 495115[F], 16905]- Akap3 169041-1710]
1710], 4951191-2121], 495120[-2883], 16901[-3942], 495109[-4095] (11642)
651116[F], 45564[F], 45566[F], 595764[F], 595765[F], 595766[F], AKAP4 595767[F], 595768[F], 595769[F], 595770[F], 595771 [F], 595763]- 651117[F], 907988[F], 45565[F], 45567[F], 595772[F] (8852) & 987] Akap4
706328[F], 706329[F], 706330[F], 706331 [F], 706332[F], 706334[F],
AKAP5 706335[F], 706336[F], 706337[F], 641423(9004], 32527[F],
706333[F], 706338[F], 641424(9004], 32528[F], 160240[F], (9495) & 160235[F], 160236[F], 160237[F], 160238[F], 160239[F], 160241[F],
160251 [F] Akap5 160242[F], 160243[F], 160244[F], 160245[F], 160246[F], 160247[F],
(238276) 160248[F], 160249[F], 160250[F] TABLE 2 - Page 50 of 1873
641150[F], 704570[F], 704571[F] 704572[F], 704573[F], 704574[F],
704576[F], 704578[F], 704580[F] 704581 [F], 704583[F], 704587[F],
641151[F], 704577[F] 704579[F], 704582[F], 704584[F], 704585[F], 704588[F], 704589[F], 704591[F] 704592[F], 704593[F], 704594[F],
704586[F], 704590[F] 704595[F], 704596[F], 704598[F], 704602[F], 704597[F], 704599[F], 704600[F] 704601 [F], 704605[F], 704606[F],
704603[F], 704604[F] 704609[F], 704610[F], 704611 [F], 704612[F], 704607[F], 704608[F], 704614[F] 641148[503787], 641152[-1406],
704613[F], 704615[F] 641149[503787], 32176[F], 32178[F],
704616[-1940], 32175[F], 32177[F] 156312[F], 156314[F],
156313[F], 156320[F] 156322[F], 156327[F], 156328[F], 156329[F], 156315[F], 156316[F], 156317[F] 156318[F], 156319[F], 156321[F], AKAP6
156331 [F], 156333[F] 156336[F], 156339[F], 156341 [F], 156343[F], 156323[F], 156324[F], 156325[F] 156326[F], 156330[F], 156332[F], (9472) &
156345[F], 156346[F] 156347[F], 156350[F], 156351 [F], 156359[F], 156334[F], 156335[F], 156337[F] 156338[F], 156340[F], 156342[F], Akap6
156361 [F], 156363[F] 156366[F], 156369[F], 156370[F], 156372[F], 156344[F], 156348[F], 156349[F] 156352[F], 156353[F], 156354[F], (238161)
156375[F], 156376[F] 156377[F], 156379[F], 156382[F], 156384[F], 156355[F], 156356[F], 156357[F] 156358[F], 156360[F], 156362[F],
156385[F], 156386[F] 156391[F], 156392[F], 156393[F], 156394[F], 156364[F], 156365[F], 156367[F] 156368[F], 156371 [F], 156373[F],
156396[F], 156398[F] 156400[F], 156 4 08[F], 156 4 10[F], 156411[F], 156374[F], 156378[F], 156380[F] 156381[F], 156383[F], 156387[F],
156412[F], 156413[F] 15641 4 [F], 156 4 15[F], 156 4 16[F], 156417[F], 156388[F], 156389[F], 156390[F] 156395[F], 156397[F], 156399[F],
156418[F], 156419[F] 156420[F], 156421[F], 156 4 23[F]
156401[F], 156402[F], 156403[F] 156404[F], 156405[F], 156 4 06[F],
156407[F], 156409[F], 156422[F] 32179[-1166], 156424[-1724]
636566[F], 672209[F], 672210[F] 672211[F], 672212[F], 672213[F],
672214[F], 672216[F], 672217[F] 672220[F], 672221 [F], 672222[F],
672223[F], 672224[F], 672225[F] 672226[F], 672227[F], 672228[F],
672229[F], 672232[F], 672235[F] 672239[F], 672240[F], 919694[F],
919695[F], 919696[F], 919697[F] 919698[F], 919699[F], 919701[F],
919703[F], 919707[F], 925390[F] 919708[3616], 925390[1724],
636565[F], 672218[F], 672219[F], 672230[F], 672234[F], 672236[F],
925389[1592], 925388[-4], 672223[-276], 672208[-408], 925387[- 672237[F], 672238[F], 672241[F], 919700[F], 919702[F], 919704[F], 934], 672207[-2004], 672206[-2934], 26401[F], 89022[F], 89023[F],
919705[F], 919706[F], 919709[2428], 26400[F], 89029[F], 89033[F], AKAP7 89024[F], 89025[F], 89026[F], 89027[F], 89028[F], 89030[F],
89034[F], 89037[F], 89045[F], 89046[F], 89049[F], 89050[F], (9465) & 89031 [F], 89032[F], 89035[F], 89036[F], 89038[F], 89039[F],
89054[F], 89057[F], 89066[F], 89070[F], 89072[F], 89073[F], Akap7 89040[F], 89041 [F], 89042[F], 89043[F], 89044[F], 89047[F],
89074[F], 89075[F], 89079[F], 89083[F], 89084[F], 89085[F], (432442) 89048[F], 89051 [F], 89052[F], 89053[F], 89055[F], 89056[F],
89086[F], 89095[F], 89096[F], 89101[F], 26402[556], 89103[-112], 89058[F], 89059[F], 89060[F], 89061 [F], 89062[F], 89063[F],
89020[-1122], 89105[-1536], 89107[-3136], 89018[-3832]
89064[F], 89065[F], 89067[F], 89068[F], 89069[F], 89071 [F],
89076[F], 89077[F], 89078[F], 89080[F], 89081 [F], 89082[F],
89087[F], 89088[F], 89089[F], 89090[F], 89091 [F], 89092[F],
89093[F], 89094[F], 89097[F], 89098[F], 89099[F], 89100[F],
89102[F], 26403[556], 89021[-421], 89104[-710], 89019[-2012],
89106[-2235]
756938[F], 756939[F], 756940[F], 756941 [F], 756942[F], 756943[F],
756944[F], 756945[F], 756946[F], 756947[F], 756948[F], 756949[F],
756950[F], 756951[F], 756952[F], 926473[F], 926474[F], 926475[F],
926476[F], 926477[F], 926478[F], 926479[F], 926480[F], 926481 [F], AKAP8 926472[3827], 926471(3639], 926470(3538], 926469(3321], (10270) &
417041-4984]
926468(2357], 926467(2243], 648061[-246], 41706[F], 273907[F], Akap8 273908[F], 273909[F], 273910[F], 273911[F], 273912[F], 273913[F], (56399) 273914[F], 273915[F], 273916[F], 273917[F], 273918[F], 273919[F],
273920[F], 273921[F], 273922[F], 273923[F], 273924[F], 273925[F],
273926[F], 273927[F], 273928[F], 41705[-4984]
648061 [F], 756953[F], 756954[F], 756955[F], 756956[F], 756957[F],
6480631-3059], 756958[-3177], 756961 [-3643], 926481 [-4132], AKAP8L
648064[-2484], 648062[-3059], 756959[-3459], 756960[-3551],
926480[-4194], 41706[F], 273929[F], 273930[F], 273931 [F], (26993) &
756962[-3730], 756963[-3784], 41707[-3471], 273941 [-3866],
273932[F], 273933[F], 273934[F], 273935[F], 273936[F], 273937[F], Akap8l
273942[-3956], 273944[-4127], 273945[-4183]
273938[F], 273939[F], 273928[-1666], 41708[-3471], 273940[-3588], (54194) 273943[-4046], 273927[-4227], 273926[-4289]
TABLE 2 - Page 51 of 1873
, 832099[F; 832100[F] 832102[F] 832104[F] 832105[F]
, 832107[F " 832109[F] 832110[F] 832111 [F] 832113[F]
, 832115[F; 832116[F] 832117[F] 832118[F] 832119[F]
, 832121[F 832122[F] 832123[F] 832124[F] 832126[F]
, 832128[F; 832129[F] 832130[F] 832133[F] 832134[F]
, 832136[F " 832137[F] 832138[F] 832139[F] 832140[F]
, 832142[F; 832143[F] 832144[F] 832145[F] 832146[F]
, 832148[F " 832149[F] 832150[F] 832151 [F] 832152[F]
, 832156[F; 832157[F] 832159[F] 832160[F] 832161 [F]
, 832163[F " 832164[F] 832165[F] 832166[F] 832167[F] 625806[F], 832101[F] 832103[F], 832108[F], 832112[F], 832125[F], , 832169[F; 832172[F] 832174[F] 832175[F] 832176[F] 832131[F], 832132[F] 832154[F], 832158[F], 832170[F], 832171[F], , 832180[F; 625807] 1475], 832182[-3976], 11916[F] 832173[F], 832178] F] 832179[F], 832181]F], 11917]F], 431055[F], , 431054[F; 431056[F] 431057[F] 431059[F] 431061 [F] 431058[F], 431060[F] 431064[F], 431067[F], 431071 [F], 431085[F], AKAP9 , 431063[F; 431065[F] 431066[F] 431068[F] 431069[F] 431093[F], 431094[F] 431098[F], 431099[F], 431105[F], 431108[F], (10142) & , 431072[F; 431073[F] 431074[F] 431075[F] 431076[F] 431109[F], 431113[F] 431119[F], 431124[F], 431135[F], 431136[F], Akap9 , 431078[F; 431079[F] 431080[F] 431081 [F] 431082[F] 431137[F], 431139[F] 431140[F], 431141 [F], 431142[F], 431146[F], (100986) , 431084[F; 431086[F] 431087[F] 431088[F] 431089[F] 431149[F], 431154[F] 431160[F], 431162[F], 431163[F], 431165[F], , 431091 [F 431092[F] 431095[F] 431096[F] 431097[F] 431170[F], 431171[F] 431172[F], 431173[F], 431174[F], 431175[F], , 431101[F 431102[F] 431103[F] 431104[F] 431106[F] 431176[F], 431177[F] 431179[F], 431180[F]
, 431110[F " 431111[F] 431112[F] 431114[F] 431115[F]
, 431117[F; 431118[F] 431120[F] 431121 [F] 431122[F]
, 431125[F " 431126[F] 431127[F] 431128[F] 431129[F]
, 431131[F 431132[F] 431133[F] 431134[F] 431138[F]
, 43114 4 [F " 431145[F] 431147[F] 431148[F] 431150[F]
, 4 31152[F; 431153[F] 431155[F] 431156[F] 431157[F]
, 431159[F; 431161[F] 431164[F] 431166[F] 431167[F]
, 431169[F; 431178[F] 119181-468], 4311811 3821],
4311821-4016], 431183[-4184]
636707[F], 673266[F], 673267[F], 673268[F], 673275[F], 673276[F], 636708[F], 673269[F], 673274[F], 918802[F], 26598[F], 91581 [F],
AKD1 673277[F], 918803[F], 918804[F], 918805[F], 636706]-8], 26597[F], 91583[F], 91584[F], 91587[F], 91588[F], 91591[F], 91593[F],
(221264) & 91579[F], 91580[F], 91582[F], 91585[F], 91586[F], 91589[F], 91595[F], 91596[F], 91599[F], 91600[F], 91601[F], 91602[F],
Akd1 91590[F], 91592[F], 91594[F], 91597[F], 91598[F], 91606[F], 91603[F], 91604[F], 91605[F], 91608[F], 91609[F], 91611[F],
(633979) 91607[F], 91610[F], 91613[F], 91615[F], 91616[F], 91618[-1831] 91612[F], 91614[F], 91617[-873], 91619[-2725]
AKIP1
631682[F], 874453[F], 874454[F], 631684[4], 631680[-797], 20127[F] 631683[F], 631685[4], 874455[-295], 631681[-797], 20128[F], (56672) & 524875[F], 524876[F], 524877[F], 20129[433], 20125[-130] 20130[433], 20126[-130], 524878[-280], 524879[-4218] D930014E
17Rik
624870[F], 824541[F], 824544[F], 824546[F], 824547[F], 824548[F], AKIRIN1 824549[F], 824550[F], 10782[F], 413682[F], 413685[F], 413687[F], 624869[F], 824542[F], 824543[F], 824545[F], 10781 [F], 413683[F], (79647) & 413688[F], 413689[F], 413691[F], 413692[F], 413693[F], 413694[F], 413684[F], 413686[F], 413690[F], 413696[F] Akirinl 413695[F], 413697[F], 413698[F] (68050)
AKIRIN2 (55122) &
9270[-308] 913251[F], 926310(2617]
Akirin2 (433693) AKIRIN2-
926310[F], 913251[-127]
AS1
624209[F], 624211[F], 624213[F], 818726[F], 818727[F], 818729[F],
818730[F], 818731[F], 818733[F], 818735[F], 818736[F], 818739[F], 624208[F], 624210[F], 624212[F], 818728[F], 818732[F], 818734[F],
AKNA
818740[F], 818741[F], 818742[F], 818743[F], 624215[-2876], 818746 818737[F], 818738[F], 818744[F], 818724[-1983], 818725[-2007],
(80709) &
3694], 818722[-4254], 9886[F], 9890[F], 402161[F], 402162[F], 624214[-2876], 818723[-2885], 818745[-3686], 9885[F], 9889[F],
Akna
402164[F], 402165[F], 402166[F], 402167[F], 402168[F], 402170[F], 402163[F], 402169[F], 402171[F], 402174[F], 402175[F], 9887]- (100182)
402172[F], 402173[F], 402176[F], 402177[F], 402178[F], 402179[F], 1248], 402160[-1755], 402159[-2638], 402182[-4336]
9888[-1248], 402180[-1745], 402181[-3573]
AKNAD1
622969[F], 810389[F], 810390[F], 810392[F], 8256[F], 382785[F], 622970[F], 810387[F], 810388[F], 810391[F], 810393[F], 8257[F],
(254268) & 382787[F], 382789[F], 382790[F], 382793[F], 382794[F], 382795[F], 382786[F], 382788[F], 382791 [F], 382792[F], 382797[F], 382800[F],
Aknadl 382796[F], 382798[F], 382799[F], 382802[F], 382806[F] 382801[F], 382803[F], 382804[F], 382805[F], 382807[F]
(329738)
624697[F], 822925[F], 822927[F], 822928[F], 822931 [F], 822934[F],
822935[F], 822938[F], 822939[F], 822940[F], 822941 [F], 822942[F], 624696[F], 822926[F], 822929[F], 822930[F], 822932[F], 822933[F],
AKR1A1 822943[F], 822945[F], 822946[F], 822947[F], 822948[F], 822950[F], 822936[F], 822937[F], 822944[F], 822949[F], 10570[F], 411026[F],
(10327) & 10571[F], 411025[F], 411027[F], 411028[F], 411030[F], 411032[F], 411029[F], 411031[F], 411033[F], 411034[F], 411037[F], 411038[F],
Akr1a1 411035[F], 411036[F], 411039[F], 411041 [F], 411042[F], 411043[F], 411040[F], 411049[F], 411054[F], 411056[-1425], 411057[-1529],
(58810) 411044[F], 411045[F], 411046[F], 411047[F], 411048[F], 411050[F], 411059[-2384]
411051 [F], 411052[F], 411053[F], 411055[F], 411058[-1758] TABLE 2 - Page 52 of 1873
628299[F], 628301[F], 850286[F], 850287[F], 850288[F], 850289[F],
850291 [F], 850292[F], 850295[F], 850296[F], 850297[F], 850298[F],
628298[F], 628300[F], 850290[F], 850293[F], 850294[F], 850299[F], AKR1B1 850300[F], 850301[F], 850303[F], 850304[-52], 850305[-426],
850302[F], 850306[-1263], 15313[F], 15315[F], 472149[F], (231) & 15314[F], 15316[F], 472145[F], 472146[F], 472147[F], 472148[F],
472152[F], 472153[F], 472158[F], 472163[F], 472167[-1176], Akr1b3 472150[F], 472151[F], 472154[F], 472155[F], 472156[F], 472157[F],
4721681-1903] (11677) 472159[F], 472160[F], 472161[F], 472162[F], 472164[F], 472165[- 43], 4721661-419], 472169[-3026]
AKR1B10
628303[F], 628304[F], 628306[F], 850307[F], 850308[F], 15321 [F],
628302[F], 628305[F], 850309[F], 15320[F], 472180[F], 472183[F], (57016) &
472179[F], 472181[F], 472182[F], 472185[F], 472187[-323], 47218i 472184[F], 472186[F], 472190[-3261], 472192[-3590] Akr1b10
1833], 472189[-3007], 472191[-3525]
(67861) AKR1B15
850311[F], 850312[F], 850314[F], 850315[F], 850316[F], 925790[F], 850310[F], 850313[F], 925789[F], 925792[F], 15318[F], 15319[F], (441282) & 925791[F], 925793[F], 925794[F], 925795(2436], 15317[F], 472178[F]472172[F], 472173[F], 472174[F], 472175[F], 472176[F], 472177[F] Akr1b8
(14187) AKR1C1
642098[F], 712178[F], 712181[F], 33404[F], 172530[F], 33406[- (1645) &
642097[F], 33403[F], 172529[F], 33405[-4205]
4205], 172531 [-4899] Akr1c21
(77337) AKR1C2
642099[F] 642100[F], 712180[F], 712180[-4065]
(1646) AKR1C3
642096[F], 33395[F], 172505[F], 172506[F], 172507[F], 172508[F], (8644) &
642095[F], 33394[F], 172504[F]
172509[F] Akr1c18
(105349) AKR1D1
628347[F], 850833[F], 850834[F], 850835[F], 15378[F], 473130[F],
(6718) &
473131[F], 473132[F], 473133[F], 473134[F], 473135[F], 473136[F], 628348[F], 15379[F], 473138[F]
Akr1d1 473137[F], 473139[F]
(208665) AKR1E2
642102[F], 712185[F], 712186[F], 712187[F], 3340B[F], 172534[F], 642101[F], 712183[F], 712184[F], 33405[F], 172532[F], 172533[F], (83592) &
172535[F], 172538[F], 172540[F], 172531[-1005] 172536[F], 172537[F], 172539[F] Akr1e1
(56043) AKR7A2 (8574) &
625368[-23], 11338[-34], 420366[-4130]
Akr7a5 (110198)
642007[F], 683867[F], 711483[F], 711484[F], 711485[F], 711486[F],
711487[F], 711488[F], 711489[F], 711490[F], 711491 [F], 711492[F],
711493[F], 711494[F], 711495[F], 711493[-808], 711494[-1072], AKT1 (207) 7114951-1186], 642008[-4828], 33264[F], 170408[F], 170409[F], & Akt1 170410[F], 170411[F], 170412[F], 170413[F], 170414[F], 170415[F], (11651) 170416[F], 170417[F], 170418[F], 170419[F], 170420[F], 170421[F],
170422[F], 170423[F], 33265[-4550]
630770[F], 868319[F], 868320[F], 868321 [F], 868322[F], 868323[F],
630771[F], 630769[-116], 630772[-1652], 868325[-3518], 868316]- AKT1S1 868324[F], 630768[-116], 868318[-855], 868317[-1130], 18932[F],
4138], 868315[-4859], 18933[F], 511998[F], 18931[-146], 18934[- (84335) & 511997[F], 511999[F], 512000[F], 512001 [F], 512002[F], 512003[F],
1727], 512007[-2972], 511993[-3400], 511992[-4058], 512008]- Akt1s1 512004[F], 512005[F], 512006[F], 18930[-146], 511996[-792],
4724] (67605) 511995[-905], 511994[-1119;
638242[F], 683868[F], 683869[F], 683870[F], 683871 [F], 683872[F],
683873[F], 683874[F], 683875[F], 866216[F], 866217[F], 866218[F],
866219[F], 866221[F], 866222[F], 866225[F], 866226[F], 866228[F],
866214[F], 866215[F], 866220[F], 866223[F], 866224[F], 866227[F], 866229[F], 866230[F], 866231[F], 866236[F], 866237[F], 866238[F],
866232[F], 866233[F], 866234[F], 866235[F], 630364(54357],
866239[F], 866240[F], 630363[54357], 18337[F], 506886[F], AKT2 (208)
18338[F], 506884[F], 506885[F], 506888[F], 506891 [F], 506894[F], 506887[F], 506889[F], 506890[F], 506892[F], 506893[F], 506896[F], & Akt2
506895[F], 506898[F], 506900[F], 506903[F], 506904[F], 506911[F], 506897[F], 506899[F], 506901[F], 506902[F], 506905[F], 506906[F], (11652)
506912[F], 506917[F], 506918[F], 506919[F], 506920[F], 506895]- 506907[F], 506908[F], 506909[F], 506910[F], 506913[F], 506914[F],
2486], 506894[-2815]
506915[F], 506916[F], 506921[F], 506922[F], 506923[F], 506924[F],
506925[F], 506926[-730], 506927[-966], 506896[-2322], 506893]- 2943]
668121[F], 668122[F], 668123[F], 668124[F], 668125[F], 668126[F], 668127[F], 668128[F], 668129[F], 668130[F], 668131 [F], 668132[F], 668133[F], 668134[F], 668135[F], 668136[F], 668137[F], 668138[F], 668139[F], 668140[F], 618487[343864], 618484(11859], 668127[- 2901], 668126[-3092], 668125[-3513], 668124[-3742], 2623[F],
AKT3 80558[F], 80559[F], 80560[F], 80561[F], 80562[F], 80563[F],
(10000) &
618485(11859], 2621 [-1677] 80564[F], 80565[F], 80566[F], 80567[F], 80568[F], 80569[F],
Akt3 80570[F], 80571 [F], 80572[F], 80573[F], 80574[F], 80575[F],
(23797) 80576[F], 80577[F], 80578[F], 80579[F], 80580[F], 80581 [F],
80582[F], 80583[F], 80584[F], 80585[F], 80586[F], 80587[F],
80588[F], 80589[F], 80590[F], 80591[F], 80592[F], 80593[F],
80594[F], 80595[F], 80596[F], 80597[F], 2620[-1677], 80557[-4124], 80556[-4301], 80555[-4630], 80554[-4779] TABLE 2 Page 53 of 1873
887888[F], 887889[F], 887890[F], 887891 [F], 887892[F], 887893[F],
887894[F], 887896[F], 887897[F], 887898[F], 929362[F], 929363[F],
929365[F], 929361[3204], 929360[2999], 929366(2888], AKTIP 929359(2796], 929358(2568], 929357(2493], 929367(2396], 887895[F], 929364[F], 633574(369], 22609(F), 554358[F], (64400) & 929368(725], 633575(369], 887899[-1275], 22610[F], 554351[F], 22607(1187], 554350[-4265] Aktip 554352[F], 554353[F], 554354[F], 554355[F], 554356[F], 554357[F], (14339) 554359[F], 554360[F], 554361[F], 554362[F], 22608(1187], 554363[- 6691
818557[F], 818558[F], 818560[F], 818561[F], 818562[F], 818563[F],
818564[F], 818567[F], 818568[F], 818570[F], 624191 (13429], 818559[F], 818565[F], 818566[F], 818569[F], 624190(13429], ALAD 624189[-3938], 9866[F], 401913[F], 401914[F], 401916[F], 624188[-3938], 9865[F], 401915[F], 401923[F], 401924[F], (210) & 401917[F], 401918[F], 401919[F], 401920[F], 401921 [F], 401922[F], 401925[F], 401926[F], 401929[F], 401912[-992], 401932[-2490], Alad 401927[F], 401928[F], 401930[F], 401931[-520], 401933[-3106], 401934[-3176], 401938[-4371] (17025) 401935[-3197], 401936 [-3895], 401937[-3999], 401939[-4880]
635857[F], 904885[F], 904887[F], 904888[F], 904889[F], 904891 [F], ALAS1 904893[F], 932739[-2833], 915269[-4833], 25497[F], 588712[F], 635856[F], 904886[F], 904890[F], 904892[F], 932738 [-1256], (211) & 588714[F], 588715[F], 588716[F], 588717[F], 588719[F], 588720[F], 660580[-3256], 25496[F], 588713[F], 588718[F], 588721 [F] Alasl 588722[F], 588723[F], 588724[F], 588725[F], 588726[F] (11655)
652072[F], 914632[F], 914634[F], 914635[F], 914636[F], 914637[F], 914639[F], 914640[F], 914641[F], 914643[F], 914644[F], 914645[F], 914646[F], 914648[F], 914649[F], 914650[F], 914651 [F], 914653[F],
652071 [F], 914631[F], 914633[F], 914638[F], 914642[F], 914647[F],
914655[F], 652074(21991], 930569(936], 927292[-741], 927291[- 914652[F], 914654[F], 652073[21991], 930570[619], 930571 [-142],
990], 914656[-1064], 927290[-1435], 927288[-2312], 927287[-2406], 927294[-154], 927293[-372], 914657[-1381], 930572[-1493], 914658[ ALAS2
914628[-2741], 914627[-2990], 930573[-3130], 930574[-3401],
2142], 914630[-2154], 927289[-2281], 914629[-2372], 914659[-3493] (212) &
914626[-3435], 914624[-4312], 914623[-4406], 47160[F], 47162[F], 914625[-4281], 47159[F], 47161[F], 612812[F], 612814[F], Alas2
612813[F], 612815[F], 612816[F], 612817[F], 612818[F], 612820[F], 612819[F], 612823[F], 612827[F], 612829[F], 612832[F], 612836[F], (11656)
612821[F], 612822[F], 612824[F], 612825[F], 612826[F], 612828[F], 612837[F], 612839[F], 612842[-978], 612843[-1665], 612844[-3468],
612830[F], 612831[F], 612833[F], 612834[F], 612835[F], 612838[F], 612847[-4477], 612849 [-4697], 612851[-4824]
612840[F], 612841[-701], 612811[-2276], 612810[-4106], 612845[- 4160], 612846[-4442], 612848[-4586], 612850[-4712], 612852[- 4903]
626744[F], 838961[F], 838962[F], 13206[F], 446665[F], 446666[F], ALB (213)
626743[F], 838960[F], 13205[F], 446663[F], 446664[F]
446667[F] & Alb
647110[F], 749760[F], 749761[F], 749762[F], 749763[F], 749764[F],
749765[F], 749766[F], 749767[F], 749769[F], 749771 [F], 749773[F], 647109[F], 749768[F], 749770[F], 749772[F], 749774[F], 749776[F].
ALCAM
749775[F], 749777[F], 749779[F], 749765[-903], 40316[F], 749778[F], 749780[F], 749781 [F], 749772[-3019], 647108[-3670],
(214) & 257353[F], 257354[F], 257355[F], 257356[F], 257357[F], 257360[F], 40315[F], 257358[F], 257359[F], 257362[F], 257363[F], 257365[F],
Alcam 257361 [F], 257364[F], 257366[F], 257368[F], 257371 [F], 257373[F], 257367[F], 257369[F], 257370[F], 257372[F], 257375[F], 257380[F]
(11658) 257374[F], 257376[F], 257377[F], 257378[F], 257379[F], 257383[F], 257381[F], 257382[F], 257385[F], 257390[F], 257391 [F], 257392[F] 257384[F], 257386[F], 257387[F], 257388[F], 257389[F]
630803[F], 868484[F], 868485[F], 868486[F], 868487[F], 868488[F],
ALDH16A1 868489[F], 868490[F], 630804[301], 868491 [-1542], 630801 [-3160],
(126133) & 18966[F], 512220[F], 512221[F], 512222[F], 512223[F], 512224[F], 630802[F], 630800[-3160], 18965[F], 512219[-321], 512218[-1111]
Aldh16a1 512225[F], 512226[F], 512227[F], 512228[F], 512229[F], 512230[F],
(69748) 512231[F], 18967[237], 512232[-717], 512233[-1664]
650666[F], 777522[F], 777523[F] 777524[F], 777525[F], 777526[F],
777529[F], 777530[F], 777535[F] 777536[F], 777537[F], 777538[F],
777540[F], 777541[F], 777543[F] 777544[F], 777545[F], 777546[F],
777549[F], 777550[F], 777551[F] 777552[F], 650664(50859], 650665[F], 777527[F], 777528[F], 777534[F], 777539[F], 777542[F], n il fiA 650668[-4325], 45038[F], 315921 [F], 315922[F], 315923[F], 777547[F], 777548[F], 777553[F], 650663(50859], 923400[-182], ς ο ^ 315924[F], 315925[F], 315928[F] 315929[F], 315930[F], 315931[F], 777554[-2182], 650667[-4325], 45037[F], 315926[F], 315927[F], Alrlh 8 315932[F], 315933[F], 315934[F] 315935[F], 315937[F], 315938[F], 315936[F], 315942[F], 315944[F], 315946[F], 315952[F], 315954[F], Aldm aa1
(56454) 315939[F], 315940[F], 315941[F] 315943[F], 315945[F], 315947[F], 315955[F], 315960[F], 45039[-970], 315962[-1002]
315948[F], 315949[F], 315950[F] 315951[F], 315953[F], 315956[F],
315957[F], 315958[F], 315959[F] 315961[F], 45040[-970], 315963[- 4621]
ALDH1A1
623979[F], 650399[F], 650404[F], 775046[F], 775048[F], 775050[F], 623978[F], 650400[F], 650403[F], 775047[F], 775049[F], 44701 [F], (216) & 775051[F], 44700[F], 310782[F], 310785[F], 310781 [-45] 310783[F], 310784[F], 310786[F] Aldh1a1
(11668)
635423[F], 901557[F], 901558[F], 901560[F], 901561 [F], 901564[F],
635424[F], 901556[F], 901559[F], 901562[F], 901563[F],
901565[F], 635423[112316], 901560[-151], 920655[-1642], 920654[- ALDH1A2
635424[112316], 24928[F], 581835[F], 581838[F], 581839[F],
2314], 901555[-3642], 901554[-4314], 24927[F], 581836[F], (8854) &
581840[F], 581841[F], 581842[F], 581845[F], 581846[F], 581847[F], 581837[F], 581843[F], 581844[F], 581851[F], 581852[F], 581853[F], Aldh1a2
581848[F], 581849[F], 581850[F], 581855[F], 581856[F], 24924[- 581854[F], 581857[F], 24923[-401], 581833[-2287], 581831[-2759], (19378)
401], 5818341-1627], 581832[-2483]
5818301-3326], 581829[-3980;
631048[F], 870163[F], 870166[F], 870167[F], 870168[F], 870169[F],
870170[F], 870171[F], 631045[-2629], 870162[-2943], 19339[F], ra m &
631049[F], 870164[F], 870165[F], 870172[F], 631046[-2629],
516275[F], 516278[F], 516279[F], 516281[F], 516282[F], 516283[F], ^ ' 19340[F], 516276[F], 516277[F], 516280[F], 516288[F], 19337[-2541]
516284[F], 516285[F], 516286[F], 516287[F], 19336[-2541], 516274| Ά ' ύ " Ί3
(56847) 2845], 516273[-4130] TABLE 2 - Page 54 of 1873
ALDH1B1
816953[F], 816954[F], 623974(5639], 9563[F], 398403[F], (219) &
9564[-4866]
398404[F], 398405[F], 398406[F], 9565[-4866] Aldh1b1
(72535)
629035[F], 856394[F], 856395[F], 856398[F], 856400[F], 856401 [F], 629036[F], 856396[F], 856397[F], 856399[F], 922135[41], 856393[-
ALDH1L1 856402[F], 856403[F], 16289[F], 485536[F], 485540[F], 485541 [F], 1959], 16290[F], 485533[F], 485534[F], 485535[F], 485537[F],
(10840) & 485542[F], 485545[F], 485547[F], 485548[F], 485550[F], 485551 [F], 485538[F], 485539[F], 485543[F], 485544[F], 485546[F], 485549[F],
Aldh1l1 485552[F], 485553[F], 485555[F], 485556[F], 485557[F], 485559[F], 485554[F], 485558[F], 485560[F], 485532[-1653], 485531 [-3400],
(107747) 485561 [F] 485530[-4691], 485529[-4800], 16291[-4873]
637370[F], 677740[F], 677742[F], 677743[F], 677744[F], 27500[F], ALDH1L2
637371 [F], 677737[F], 677738[F], 677739[F], 677741 [F], 27501 [F],
102168[F], 102171[F], 102172[F], 102173[F], 102174[F], 102176[F], (160428) & 102166[F], 102167[F], 102169[F], 102170[F], 102175[F], 102164[- 102177[F], 102178[F], 102179[F], 102180[F], 102181 [F], 102165[- Aldh1l2 2385]
29] (216188)
627337[F], 843014[F], 843016[F], 843017[F], 843019[F], 843020[F],
843021 [F], 843022[F], 843024[F], 843025[F], 843026[F], 14077[F],
627336[F], 843015[F], 843018[F], 843023[F], 843027[F], 14076[F], ALDH2 14084[F], 455905[F], 455906[F], 455907[F], 455909[F], 455910[F],
14083[F], 455908[F], 455911[F], 455917[F], 455919[F], 455920[F], (217) & 455912[F], 455913[F], 455914[F], 455915[F], 455916[F], 455918[F],
455922[F], 455924[F], 455927[F], 455928[F], 455931 [F], 455933[F], Aldh2 455921 [F], 455923[F], 455925[F], 455926[F], 455929[F], 455930[F],
455904[-2650], 455937[-3590], 14085[-4455], 455938[-4890] (11669) 455932[F], 455934[-958], 455935[-2296], 455936[-2593], 14086[- 4455]
638882[F], 638885[F], 688780[F], 688781 [F], 688783[F], 688781 [- ALDH3A1
638881 [F], 638884[F], 688782[F], 688779[-642], 688778[-780],
417], 688780[-2431], 933689[-3029], 29451 [F], 124768[F], (218) & 29450[F], 124770[F], 124772[F], 124767[-758], 124766[-856], 29447]
124769[F], 124771[F], 29449[-2533], 124765[-2671], 124764[-2838]. Aldh3a1 4645], 1247621-4666], 29452[-4999]
124763[-2997], 29448[-4645], 29453[-4999] (11670)
638887[F], 688785[F], 688786[F], 688787[F], 688788[F], 688790[F],
688791 [F], 688792[F], 688793[F], 688794[F], 688795[F], 688796[F], ALDH3A2 926093[1978], 688797[-22], 638888[-719], 688784[-3792], 29453[F], (224) &
638886[F], 688789[F], 638889[-719], 29452[F], 124786[F]
124782[F], 124783[F], 124784[F], 124785[F], 124787[F], 124788[F], Aldh3a2 124789[F], 124790[F], 124791[F], 124792[F], 124793[F], 124794[F], (11671) 124795[-45], 124781 [-1432], 124780[-2109], 124779[-2858]
649957[F], 772197[F], 772198[F], 772199[F], 772200[F], 772204[F], ALDH3B1
649958[F], 772201[F], 772202[F], 772203[F], 772216[F], 772219[F],
772217[F], 772218[F], 649957[18441], 649959[-4454], 772205[- (221) & 649958(18441], 649960 [-4454], 44175[F], 305924[F], 305925[F],
4776], 44174[F], 305920[F], 305921 [F], 305922[F], 305923[F], Aldh3b1 305926[F]
305927[F] (67689)
772212[F], 772215[F], 772220[F], 929248[F], 929251 [F], 929252[F],
934551 [442], 934547[386], 934548[385], 934546(381], 934553[340], ALDH3B2
772210[F], 772211[F], 772213[F], 772214[F], 929246[F], 929247[F], 934549[251], 934552[249], 934545[178], 892621 [-1558], 834743[- (222) &
929249[F], 929250[F], 934550[177], 854455 [-1823], 44179[F],
1614], 850417[-1615], 742252[-1619], 910235[-1660], 854454 [-1749], Aldh3b2
305947[F], 305949[F], 305950[F], 305945[-3712]
910234[-1751], 726931 [-1822], 44178[F], 305948[F], 305951 [F], (621603) 305952[F], 305946[-1764]
625376[F], 828545[F], 828546[F], 828550[F], 828551 [F], 828554[F],
828555[F], 828556[F], 828557[F], 625376(31365], 828558[-164],
625373[-1480], 828544[-2052], 828543[-2616], 828542[-2793],
625377[F], 828547[F], 828548[F], 828549[F], 828552[F], 828553[F], ALDH4A1 828541 [-3683], 828540[-3752], 828539[-4113], 828538[-4371],
625377[31365], 625374[-1480], 11347[F], 420567[F], 420568[F], (8659) & 828537[-4448], 828536[-4895], 11346[F], 420566[F], 420569[F],
420572[F], 420573[F], 420574[F], 420575[F], 420578[F], 420579[F], Aldh4a1 420570[F], 420571[F], 420576[F], 420577[F], 420580[F], 420582[F],
420581 [F], 420587[F], 11344[-2509], 11349[-3845], 420591 [-3882] (212647) 420583[F], 420584[F], 420585[F], 420586[F], 420588[F], 420589[F],
420590[F], 11343[-2509], 420565[-2971], 420564[-3451], 420563[- 3614], 11348[-3845], 420562[-4452], 420561 [-4540], 420560[-4873]
ALDH5A1
642351[F], 713686[F], 713688[F], 713690[F], 713691 [F], 642353[- 642350[F], 713687[F], 713689[F], 924564[-165], 713692[-2165],
(7915) & 4563], 33764[F], 176242[F], 176244[F], 176246[F], 176247[F], 642352[-4563], 33763[F], 176243[F], 176245[F], 176248[F],
Aldh5a1
176250[F], 176251[F], 176252[F], 176253[F], 176254[F], 33762[6696]176249[F], 33761[6696], 33765(262], 176241[-952], 176255[-1916]
(214579)
641582[F], 707844[F], 707845[F], 707846[F], 707847[F], 707848[F],
641581[F], 641578(5925], 920511(1514], 920512(1447],
641580(24307], 641579(5925], 920513(1387], 707843[-80], 707842[- ALDH6A1
920514(1060], 707849[-486], 707850[-553], 707852[-940], 920515[- 451], 707851[-613], 707841 [-2281], 32715[F], 163185[F], 163186[F], (4329) &
4852], 32713(10560], 32716[-470], 163201 [-579], 163202[-647],
163187[F], 163188[F], 163189[F], 163190[F], 163191 [F], 163192[F], Aldh6a1
163204[-993], 163205[-3157], 163206[-3241], 163207[-3422],
163193[F], 163194[F], 163195[F], 163196[F], 163197[F], 163198[F], (104776)
163208[-3630]
163199[F], 163200[F], 32714[10560], 32717[-470], 163203[-699] TABLE 2 - Page 55 of 1873
649506[F], 768468[F], 768469[F], 768470[F], 768471 [F], 768473[F],
768474[F], 768475[F], 768476[F], 768477[F], 768478[F], 768479[F],
768481 [F], 768482[F], 768483[F], 768484[F], 768485[F], 768486[F], 649505[F], 768467[F], 768472[F], 768480[F], 768488[F], 768489[F], 768487[F], 923298(1821], 768490[-179], 43595[F], 298094[F], 923299(655], 768491 [-1345], 43594[F], 298093[F], 298100[F],
ALDH7A1 298095[F], 298096[F], 298097[F], 298098[F], 298099[F], 298101[F], 298111[F], 298113[F], 298122[F], 298125[F], 298126[F], 298128[F],
(501) & 298102[F], 298103[F], 298104[F], 298105[F], 298106[F], 298107[F], 298131[F], 298132[F], 298133[F], 298135[F], 298136[F],
Aldh7a1 298108[F], 298109[F], 298110[F], 298112[F], 298114[F], 298115[F], 43596(10498], 298126(32], 298137[-389], 298128[-761], 298090[-
(110695) 298116[F], 298117[F], 298118[F], 298119[F], 298120[F], 298121[F], 2827], 298138[-2841], 298139[-3017], 298131[-3444], 298140]- 298123[F], 298124[F], 298127[F], 298129[F], 298130[F], 298134[F], 3584], 298141 [-3785]
43597(10498], 298127[-364], 298092[-554], 298091[-1077], 298129]- 2155], 298130[-2592], 298142[-4625], 298089[-4942]
ALDH8A1
671952[F], 636510(32722], 26317[F], 88233[F], 88234[F], 88235[F], 671953[F], 636511(32722], 26318[F], 88237[F], 88239[F], 88240[F], (64577) & 88236[F], 88238[F] 88241 [F] Aldh8a1
(237320)
667116[F], 667117[F], 667118[F], 618305(36443], 929496[-1926],
ALDH9A1 929495[-2263], 667115( 3926], 667114[-4263], 2407[F], 78628[F],
(223) &
2405[358], 78627[-1582], 2408[-3354], 78622[-3860] 78629[F], 78630[F], 78631[F], 78632[F], 78633[F], 2406[358],
Aldh9a1 78626[-2727], 78625[-2995], 2409[-3354], 78624[-3452], 78623]- (56752) 3628], 78621[-3876]
624265[F], 631978[F], 631982[F], 652152[F], 727392[F], 819149[F],
819150[F], 819151[F], 819152[F], 819153[F], 819155[F], 819156[F],
819157[F], 822511[F], 876889[F], 876891[F], 876892[F], 876893[F],
876894[F], 876895[F], 876897[F], 876899[F], 876901 [F], 876902[F], 624264[F], 631977[F], 631981[F], 636607[F], 652153[F], 672635[F], 876903[F], 876906[F], 876907[F], 876910[F], 876911 [F], 876913[F], 819154[F], 876890[F], 876896[F], 876898[F], 876900[F], 876904[F],
ALDOA
876915[F], 876916[F], 876917[F], 876918[F], 876919[F], 915138[F], 876905[F], 876908[F], 876909[F], 876912[F], 876914[F], 915139[F],
(226) & 915140[F], 915270[F], 915271[F], 915273[F], 915274[F], 915275[F], 915272[F], 631979[14276], 631977[6458], 631981[-385], 20492[F],
Aldoa 915276[F], 631980[14276], 631978(6458], 876916(7], 631982[-385], 529773[F], 529779[F], 529781 [F], 529783[F], 529788[F], 529789[F],
(11674) 20493(F), 529774[F], 529775[F], 529776[F], 529777[F], 529778(F], 529792[F], 529793[F], 529796[F], 529798]F], 20494(2803], 20496[- 529780[F], 529782[F], 529784[F], 529785[F], 529786[F], 529787[F], 372], 20490[-2685]
529790[F], 529791[F], 529794[F], 529795[F], 529797[F], 529799[F],
529800[F], 20495(2803], 529772[74], 20497[-372], 529800[-1035],
204911-2685], 529771 [-3135], 529770[-3295], 529769[-4047]
ALDOAP2
632186[F]
(228) ALDOB
624050[F], 817459[F], 624049(14917], 9653[F], 9654[F], 399414[F],
9651 [-4435] (229) & 399415[F], 9652[-4435]
Aldob
ALDOC
639433[-631], 692575[-714], 692574[-1546], 639435[-1557], 692572[-639434[-631], 639436[-1557], 692576[-2155], 692573[-3079],
(230) & 3093], 692571 [-3549], 30056[-1653], 30054[-1739], 131183[-1817], 30057[-1653], 30055[-1739], 131184[-2218], 131182[-2237],
Aldoc 131180[-2887], 131177[-4637] 131181 [-2318], 131179[-4324], 131178[-4623], 131185[-4944]
(11676) ALG1
646381[F], 39421[F], 244661[F] (56052) &
Alg1
645966[F], 740929[F], 740930[F], 740931 [F], 740933[F], 740934[F],
ALG10B 740935[F], 740936[F], 740937[F], 740938[F], 38934[F], 239513[F],
645967[F], 740932[F], 38935[F], 239516[F], 239519[F], 239520[F], (144245) & 239514[F], 239515[F], 239517[F], 239518[F], 239521 [F], 239523[- 239522[F] Alg10b 492], 239524[-580], 239525[-1125], 239526[-1249], 239527[-2495],
(380959) 239528[-2595], 239529[-2790]
632645[F], 658750[F], 881002[F], 881003[F], 881004[F], 881005[F],
881006[F], 881007[F], 930095[1860], 930097[1346], 930098(1052],
930099[597], 930100(449], 658751 [-140], 658753[-654], 632643[- 892], 658754[-948], 930101[-1013], 930102[-1238], 930103[-1333], 632646[F], 930096[1375], 658752[-625], 632644[-892], 881001[- ALG11 658755[-1403], 658756[-1551], 881000[-2309], 881008[-3013], 2092], 880999[-4334], 21407[F], 539330[F], 539337[F], 21405[-643], (440138) & 881009[-3238], 881010[-3333], 880998[-4493], 21406[F], 539329[F], 539328[-1646], 539327[-1919], 21409[-1987], 539325[-3036], Alg11 539331 [F], 539332[F], 539333[F], 539334[F], 539335[F], 539336[F], 539324[-3675], 539322[-4402] (207958) 539338[F], 539339[F], 539340[F], 539341 [F], 539342[F], 539343[F],
539344[F], 539345[F], 21404[-643], 21408[-1987], 539326[-2112],
539323[-3832]
645920[F], 740692[F], 740693[F], 740694[F], 740695[F], 740696[F],
ALG12 740697[F], 645922[-181], 740698[-548], 38888[F], 239105[F], 645919[F], 645921[-181], 740699[-1291], 740700[-1413], 740701[- (79087) & 239106[F], 239108[F], 239109[F], 239110[F], 239112[F], 239113[F], 1734], 740702[-2973], 38887[F], 239107[F], 239111 [F], 38889[-286]
Alg12 239114[F], 239115[F], 239116[F], 239117[F], 38890[-286], 239118[- 239119[-1230], 239120[-1343], 239121 [-1853], 239122]-2489]
(223774) 5581 TABLE 2 - Page 56 of 1873
652049[F], 806369[F], 914468[F], 914469[F], 914471 [F], 914472[F],
914473[F], 914474[F], 914475[F], 914476[F], 914477[F], 914478[F],
914480[F], 914481[F], 914482[F], 914483[F], 914485[F], 914487[F],
914488[F], 914489[F], 914490[F], 914491 [F], 914492[F], 914493[F],
914495[F], 914496[F], 914497[F], 914498[F], 914499[F], 914500[F],
914501 [F], 914503[F], 914504[F], 914505[F], 914506[F], 914507[F], 652050[F], 914467[F], 914479[F], 914484[F], 914486[F], 914494[F],
ALG13 914508[F], 914509[F], 914510[F], 914511[F], 914512[F], 914513[F], 914502[F], 921973[F], 921978[F], 921980[F], 921988[F], 921996[F],
(79868) 914514[F], 921974[F], 921975[F], 921976[F], 921977[F], 921979[F], 914467[-88], 652051 [-3267]
921981[F], 921982[F], 921983[F], 921984[F], 921985[F], 921986[F],
921987[F], 921989[F], 921990[F], 921991 [F], 921992[F], 921993[F],
921994[F], 921995[F], 921997[F], 921998[F], 921999[F], 922000[F],
922001 [F], 922002[F], 922003[F], 922004[F], 922005[F], 922006[F],
922007[2607], 922008(2062]
623060[F], 810997[F], 810999[F], 811000[F], 811001 [F], 811005[F],
811008[F], 811009[F], 811010[F], 8373[F], 384233[F], 384234[F], 623061[F], 810998[F], 811002[F], 811003[F], 811004[F], 811006[F], ALG14 384236[F], 384238[F], 384239[F], 384240[F], 384244[F], 384245[F], 811007[F], 811011[F], 811012[F], 8374[F], 384235[F], 384237[F], (199857) & 384246[F], 384247[F], 384248[F], 384249[F], 384250[F], 384254[F], 384241[F], 384242[F], 384243[F], 384251 [F], 384252[F], 384253[F], Alg14 384255[F], 384256[F], 384258[F], 384261 [F], 384262[F], 384263[F], 384257[F], 384259[F], 384260[F], 384264[F], 384267[F] (66789) 384265[F], 384266[F], 384268[F], 384269[F], 384270[-2119]
624017[F], 817235[F], 817236[F], 817237]F], 817238[F], 817234]- ALG2
6240181-288], 817239[-371], 9611[-270], 398968[-354] 771], 9610[F], 398963[F], 398964[F], 398965[F], 398966[F], (85365) &
398967[F], 398962[-1060] Alg2
ALG3
646626[7], 646627[-129], 745473[-357], 646624[-2435], 745471]-
646628[-129], 745472[-273], 646625[-2435], 39737[-836], 249219]- (10195) &
3242], 745474[-3586], 39735[-77], 39736[-836], 249220[-1063],
979], 39734[-3411] Alg3
249218[-2266], 249221[-3195], 39733[-3411], 249217[-4094]
(208624)
622006[F], 804435[F], 804436[F], 804437[F], 804438[F], 804439[F],
804440[F], 804441[F], 804442[F], 804443[F], 804444[F], 622008]- 622007[F], 622009[-1385], 804434[-3142], 804433[-3318], 7071 [F], ALG5 1385], 7070[F], 371299[F], 371301[F], 371302[F], 371303[F], 371300[F], 371310[F], 371314[F], 7073[-143], 371298[-1394], (29880) & 371304[F], 371305[F], 371306[F], 371307[F], 371308[F], 371309[F], 371297[-1548], 371296[-2835], 371295[-3186], 371294]-3364], Alg5 371311[F], 371312[F], 371313[F], 371315[F], 7072[-143], 371316]- 3712931-4023], 371292[-4872] (66248) 10081
820749[F], 820750[F], 820751[F], 820752[F], 820753[F], 820756[F], 820748[F], 820754[F], 820755[F], 916271[F], 921823[-2237],
ALG6 916272[F], 10202[F], 406640[F], 406641[F], 406642[F], 406644[F], 820757[-4237], 10203[F], 406639[F], 406643[F], 406645[F],
(29929) & 406646[F], 406647[F], 406648[F], 406649[F], 406650[F], 406651 [F], 406655[F], 406656[F], 406657[F], 406658[F], 406661 [F], 406662[F],
Alg6 406652[F], 406653[F], 406654[F], 406659[F], 406660[F], 406663[F], 10205[-778], 10201[-2656], 406638[-3324], 406637[-3392], 406636]- (320438) 10204]-7781 35391
631398[F], 872663[F], 872665[F], 872668[F], 872669[F], 19776[F], ALG8
631399[F], 872664[F], 872666[F], 872667[F], 872670[F], 19777[F], 521411[F], 521413[F], 521415[F], 521416[F], 521417[F], 521420[F], (79053) &
521412[F], 521414[F], 521418[F], 521419[F], 521422[F], 521423[F] 521421 [F] Alg8
634971[F], 897791[F], 897793[F], 897794[F], 897795[F], 897796[F],
897797[F], 897800[F], 897808[F], 897809[F], 897810[F], 897811[F],
897812[F], 897814[F], 897815[F], 634969[605], 897790[-125], 633738[F], 634972[F] 897792[F], 897798[F], 897799[F], 897801 [F], 897789[-562], 24383[F], 575048[F], 575049[F], 575050[F], 897807[F], 897813[F] 634973(854], 634970[605], 24384[F], ALG9 575051 [F], 575053[F], 575058[F], 575059[F], 575060[F], 575062[F], 575052[F], 575054[F] 575055[F], 575056[F], 575057[F], 575061 [F], (79796) & 575063[F], 575064[F], 575068[F], 575069[F], 575070[F], 575071 [F], 575065[F], 575066[F] 575067[F], 575073[F], 575074[F], 575075[F], Alg9 575072[F], 575077[F], 575078[F], 575079[F], 575080[F], 575081 [F], 575076[F], 575084[F] 575089[F], 24382[718], 575092[-664], 24385] (102580) 575082[F], 575083[F], 575085[F], 575086[F], 575087[F], 575088[F], 1775]
575090[F], 575091[F], 24381 [718], 575047[-140], 575046[-528],
575093[-690], 575094[-770]
TABLE 2 - Page 57 of 1873
761613[F; 761614[F; 761615[F] 761616[F], 761617[F], 761618[F]
761620[F; 761621 [F 761622[F] 761624[F], 761627[F], 761629[F]
761633[F; 761635[F; 761638[F] 761639[F], 761640[F], 761643[F]
761611[F] 761612[F] 761619[F] 761623[F] 761625[F] 761626[F], 761645[F 761647[F; 761649[F] 761650[F], 761651 [F], 761652[F]
761628[F] 761630[F] 761631 [F] 761632[F] 761634[F] 761636[F], 761653[F 761655[F " 761656[F] 761662[F], 761663[F], 761665[F]
761637[F] 761641 [F] 761642[F] 761644[F] 761646[F] 761648[F], 761666[F 761667[F; 761668[F] 761671[F], 761673[F], 761677[F]
761654[F] 761657[F] 761658[F] 761659[F] 761660[F] 761661[F], 761678[F 761679[F " 761681[F] 761682[F], 761685[F], 761688[F]
761664[F] 761669[F] 761670[F] 761672[F] 761674[F] 761680[F], 761689[F 761691 [F 761692[F] 761694[F], 761695[F], 761696[F]
761683[F] 761684[F] 761686[F] 761687[F] 761690[F] 761693[F], 761697[F 761698[F " 761699[F] 761700[F], 761701 [F], 761702[F]
761705[F] 761706[F] 761710[F] 761713[F] 761714[F] 761715[F], 761703[F 761704[F; 761707[F] 761708[F], 761709[F], 761711[F]
761717[F] 761720[F] 761721 [F] 761722[F] 761723[F] 761724[F], 761712[F 761716[F " 761718[F] 761719[F], 761725[F], 761726[F]
761727[F] 761728[F] 761729[F] 761731 [F] 761733[F]
761730[F 761732[F; 648680[728802], 42544[F], 2838 4 9[F],
648679(728802], 42543[F], 283843[F], 28384 4 [F], 2838 4 5[F]
283850[F; 283851 [F 283852[F] 283853[F] 283854[F] 283855[F]
283846[F] 283847[F] 283848[F] 283857[F] 283858[F] 283861 [F] 283856[F; 283859[F; 283860[F] 283864[F] 283866[F] 283868[F]
283862[F] 283863[F] 283865[F] 283867[F] 283869[F] 283872[F] 283870[F; 283871 [F 283873[F] 283877[F] 283878[F] 283880[F]
283874[F] 283875[F] 283876[F] 283879[F] 283883[F] 283884[F] ALK (238) 283881 [F; 283882[F; 283885[F] 283886[F] 283887[F] 283891 [F]
283888[F] 283889[F] 283890[F] 283892[F] 283896[F] 283898[F] & Alk 283893[F; 283894[F; 283895[F] 283897[F] 283900[F] 283901 [F]
283899[F] 283903[F] 283906[F] 283908[F] 283910[F] 283915[F] (11682) 283902[F; 283904[F; 283905[F] 283907[F] 283909[F] 283911[F]
283917[F] 283920[F] 283922[F] 283923[F] 283925[F] 283928[F] 283912[F 283913[F " 283914[F] 283916[F] 283918[F] 283919[F]
283929[F] 283930[F] 283931 [F] 283933[F] 283934[F] 283935[F] 283921 [F 283924[F; 283926[F] 283927[F] 283932[F] 283936[F]
283937[F] 283942[F] 283943[F] 283949[F] 283950[F] 283952[F] 283938[F 283939[F " 283940[F] 283941 [F] 283944[F] 283945[F]
283955[F] 283956[F] 283957[F] 283961 [F] 283962[F] 283969[F] 283946[F; 283947[F; 283948[F] 283951 [F] 283953[F] 283954[F]
283970[F] 283972[F] 283973[F] 283974[F] 283977[F] 283978[F] 283958[F 283959[F " 283960[F] 283963[F] 283964[F] 283965[F]
283983[F] 283987[F] 283988[F] 283989[F] 284002[F] 284007[F] 283966[F; 283967[F; 283968[F] 283971 [F] 283975[F] 283976[F]
284008[F] 284010[F] 284012[F] 284013[F] 284014[F] 284019[F] 283979[F 283980[F " 283981 [F] 283982[F] 283984[F] 283985[F]
284020[F] 284024[F] 284026[F] 284027[F] 284028[F] 284029[F] 283986[F; 283990[F; 283991 [F] 283992[F] 283993[F] 283994[F]
284031 [F] 284034[F] 284035[F] 284036[F] 284037[F] 284038[F] 283995[F 283996[F " 283997[F] 283998[F] 283999[F] 284000[F]
284039[F] 284042[F] 284043[F] 284044[F] 284045[F] 284046[F] 284001 [F 284003[F; 284004[F] 284005[F] 284006[F] 28 4 009[F]
284048[F] 284051 [F] 284052[F] 284053]F] 284054 [F] 284056[F] 284011[F; 284015[F; 284016[F] 284017[F] 284018[F] 28 021[F]
425411-4713]
284022[F; 284023[F; 284025[F] 284030[F] 284032[F] 28 4 033[F]
284040[F; 284041 [F 284047[F] 284049[F] 284050[F] 28 4 055[F]
42542Γ-47 31
641682[F; 708613[F; 708615[F] 708616[F] 708617[F] 708618[F]
708619[F; 708621 [F 708622[F] 708623[F] 708624[F] 708625[F]
708626[F; 708627[F; 708628[F] 708629[F] 708630[F] 708631 [F]
641681[F], 708614[F], 708620[F], 708632[F], 708634[F], 641683]- 708633[F; 925149(1484], 641684[-62], 708612[-516], 32819[F], ALKBH1
62], 7086351-162], 708636[-2220], 32818[F], 164534[F], 164544[F], 164532[F; 164533[F 164535[F] 164536[F], 164537[F], 164538[F] (8846) &
164546[F], 164551[F], 164553[F], 164561[F], 164565[F], 164568[F], 164539[F 164540[F 164541 [F] 164542[F], 164543[F], 164545[F] AlkbM
32820[-55], 164569[-154], 164531 [-652], 164570[-3279], 164571[- 164547[F 164548[F 164549[F] 164550[F], 164552[F], 164554[F] (211064)
3960]
164555[F 164556[F 164557[F] 164558[F], 164559[F], 164560[F]
164562[F 164563[F 164564[F] 164566[F], 164567[F], 32821[-55],
164530[-716]
ALKBH2
931373[1971], 841624[-29], 627152[-161], 627154[-4105], 627153[-4105], 841625[-4255], 13840[-2211], 453072[-2390], (121642) & 13839(788], 453071[-207], 13841[-2211], 453074[-4052] 453073[-3781] Alkbh2
(231642) ALKBH3
620095[F], 791211[F], 791214[F], 791215[F], 791216[F], 791217[F],
(221120) &
620097(3128], 4610(2945] 620096[3128], 4608[F], 342141 [F], 342142[F], 342143[F],
Alkbh3 342144[F], 342145[F], 342146[F], 342147[F], 4609[2945]
(69113) ALKBH4
627623[602], 627621[-68], 845201 [-1299], 845202[-4635], 845200[- (54784) &
627622(602], 627620[-68], 14439[-2705]
4889], 14440[-2705], 461254[-3408], 461253[-4750] Alkbh4
(72041)
638860[F], 688634[F], 688635[F], 688636[F], 916478[F], 688637[- ALKBH5 734], 638859[-4177], 29407[F], 124421 [F], 124422[F], 124423[F], (54890) &
638861 [F], 638858[-4177], 29408[-2350]
124424[F], 124425[F], 124426[F], 124427[F], 124428[F], 124429[F], Alkbh5 124430[F], 29409[-2350] (268420)
630487[F], 867120[F], 867121[F], 867122[F], 630489[-299], 630486| 419], 867119[-1191], 867118[-1300], 867117[-1438], 867116[-1617],
ALKBH6
630488[-299], 867123[-422], 867124[-512], 867125[-644], 867126[- 867115[-1694], 867114[-1924], 867113[-2703], 867112[-4836],
(84964) & 861], 8671271-2343], 18494[-511], 508618[-639], 508619[-729], 18493[F], 508615[F], 508616[F], 508617[F], 18492[-384], 18495[- Alkbh6 5086201-852], 508621 [-1055], 508622[-2437] 511], 508614[-1209], 508613[-1314], 508612[-1449], 508611 [-1593],
(233065) 508610[-1670], 508609[-1898], 508608[-2957], 508623[-3122],
508624[-4577]
ALKBH7
648535[-3528], 648537[-4318], 42348[-980], 280872[-2647],
(84266) &
648536[-4318], 42349[-4061], 280875[-4224], 280876[-4969] 280871 [-3015], 42350[-4061], 280873[-4096], 280874[-4182],
Alkbh7 280877[-4990]
(66400)
634248[F], 885590[F], 893268[F], 893270[F], 893271 [F], 893272[F],
ALKBH8 922882(1143], 885589[-857], 23468[F], 566020[F], 566021 [F],
(91801) &
916410[F], 234691-2342], 566038[-4335] 566022[F], 566023[F], 566024[F], 566025[F], 566026[F], 566027[F],
Alkbh8 566028[F], 566029[F], 566030[F], 566031 [F], 566032[F], 566033[F],
(67667) 566034[F], 566035[F], 566036[F], 566037[F] TABLE 2 - Page 58 of 1873
640954[F], 640952[-55], 703058[-678], 31932[F], 152949[F], ALLC
640955[F], 640953[-55], 31933[F], 152948[F], 152953[F], 152954[F].
152950[F], 152951[F], 152952[F], 31930[-292], 152947[-668], (55821 ) & 31931 [-292], 152946[-2354], 152945[-2418]
152944[-3166] Allc
628926[F], 855517[F], 855518[F], 855519[F], 855520[F], 855521 [F], 855522[F], 855523[F], 855524[F], 855525[F], 855526[F], 855527[F], 855528[F], 855529[F], 855533[F], 855539[F], 628927 [12023],
16137[F], 483770[F], 483771 [F], 483772[F], 483773[F], 483774[F], ALMS1
855531 [F], 855532[F], 855534[F], 855535[F], 855536[F], 855537[F],
483775[F], 483776[F], 483777[F], 483778[F], 483779[F], 483780[F], (7840) & 855538[F], 855540[F], 855541 [F], 918567[F], 918568[F], 918569[F],
483781[F], 483782[F], 483783[F], 483784[F], 483785[F], 483786[F], Almsl 918570[F], 918571[F], 918572[F], 918573[F], 918574[F], 918575[F]
483787[F], 483788[F], 483789[F], 483790[F], 483791 [F], 483792[F], (236266) 483793[F], 483794[F], 483795[F], 483796[F], 483797[F], 483798[F], 483799[F], 16138[18247], 483800[-885], 483801 [-1094], 483802[- 2059], 483803[-2394]
ALMS1P
628928[-2508], 855553[-3788], 855555[-3958], 855552[-4096] 628929[-2508], 855530[-2833], 855554[-4045]
(200420) ALOX12
639152[F], 690497[F], 690496[-309], 29743[F], 127693[F],
639153[F], 690498[F], 29744[F], 127695[F], 127696[F], 127698[F] (239) &
127694[F], 127697[F]
Alox12 ALOX12B (242) &
639068[F], 690055[F], 29659[F], 127108[F] 639069[F], 690054[F], 29660[F], 127107[F]
Alox12b (11686)
690499[F], 690500[F], 690501[F], 690502[F], 690504[F], ALOX12P2
690503[F], 639154(6750]
639155(6750] (245)
ALOX15
639156[F], 29747[F], 127705[F], 127706[F], 127707[F] (246) &
Alox15
ALOX15B
690056[F], 690057[F], 639070(10015], 29661[F], 127109[F],
639071[10015], 29662[F], 127110[F] (247) &
127111[F]
Alox8
629291[F], 859442[F], 859443[F], 859444[F], 859447[F], 859448[F].
629292[F], 859445[F], 859446[F], 859450[F], 16590[F], 491502[F], 859449[F], 859451 [F], 859452[F], 16589[F], 491501[F], 491503[F], ALOX5 491508[F], 491509[F], 491511[F], 491512[F], 491513[F], 491514[F], 491504[F], 491505[F], 491506[F], 491507[F], 491510[F], 491517[F], (240) & 491515[F], 491516[F], 491521[F], 16588[-529], 491498[-1094], 491518[F], 491519[F], 491520[F], 491522[F], 491523[F], 16587[- Alox5 491495[-1966], 491491[-4127], 491489[-4991] 529], 491500[-818], 491499[-1005], 491497[-1329], 491496[-1681], (11689)
491494[-2645], 491493[-3025], 491492[-3358], 491490[-4558]
ALOX5AP
627943[F], 627945[F], 847081[F], 627943(28989], 14886[F], 627944[F], 847079[F], 847080[F], 627944(28989], 14887[F], (241) & 14888[F], 465826[F], 465827[F], 465821 [-206] 465822[F], 465823[F], 465824[F], 465825[F] Alox5ap
(11690) ALOXE3
639067[F], 690049[F], 690050[F], 690051 [F], 690052[F], 690053[F],
639066[-2123], 639065[-3058], 690048[-3776], 29657[-2922], (59344) & 639067[22812], 29658[F], 127101[F], 127102[F], 127103[F],
29656[-3786], 127099[-4464] Aloxe3 127104[F], 127105[F], 127106[F], 127100[-125]
(23801)
931768[1478], 659897[-522], 1243[-1582], 64063[-3529], 64062[- ALP I (248)
1242[-1582], 64064[-2821]
3820] & Alpi
811657[F], 811666[F], 811673[F], 811674[F], 811676[F], 811677[F],
811678[F], 811679[F], 811680[F], 623140(144350], 8470[F],
811656[F], 811675[F], 623139(144350], 8469[F], 385559[F], ALPK1 385561 [F], 385562[F], 385563[F], 385565[F], 385566[F], 385567[F],
385560[F], 385564[F], 385570[F], 385574[F], 385575[F], 385578[F], (80216) & 385568[F], 385569[F], 385571[F], 385572[F], 385573[F], 385576[F],
385579[F], 385580[F], 385581 [F], 385582[F], 385583[F], 385586[F], Alpkl 385577[F], 385584[F], 385585[F], 385587[F], 385590[F], 385591 [F],
385588[F], 385589[F], 385593[F], 385595[F], 385596[F] (71481) 385592[F], 385594[F], 385597[F], 385598[F], 385599[F], 385600[F],
385601 [F], 385602[F], 385603[F], 385604[F], 385605[F]
649659[F], 649661[F], 769656[F] 769657[F], 769659[F], 769661 [F],
769662[F], 769663[F], 769664[F] 769666[F], 7696B8[F], 769669[F],
649658[F], 649660[F], 769658[F], 7696B0[F], 769665[F], 769667[F], 769670[F], 769672[F], 769677[F] 649657(98084], 934307[353],
769671[F], 769673[F], 769674[F], 769675[F], 769676[F], ALPK2 846207[-1647], 43770[F], 300471 [F], 300473[F], 300474[F],
649656(98084], 43769[F], 300472[F], 300475[F], 300477[F], (115701) & 300476[F], 300480[F], 300481[F] 300482[F], 300483[F], 300484[F],
300478[F], 300479[F], 300486[F], 300489[F], 300494[F], 300496[F], Alpk2 300485[F], 300487[F], 300488[F] 300490[F], 300491 [F], 300492[F],
300497[F], 300498[F], 300499[F], 300501 [F], 300502[F], 300506[F], (225638) 300493[F], 300495[F], 300500[F] 300503[F], 300504[F], 300505[F],
300508[F], 300509[F], 300510[F], 43767(84004], 43771[30768]
300507[F], 300511[F], 300512[F] 300513[F], 300514[F], 300515[F],
43768[84004], 43772[30768]
631228[F], 871514[F], 871515[F], 871516[F], 871517[F], 871522[F],
871524[F], 871527[F], 871528[F], 871529[F], 871530[F], 871532[F], 631229[F], 871518[F], 871519[F], 871520[F], 871521 [F], 871523[F],
ALPK3 871533[F], 871535[F], 871536[F], 871537[F], 19553[F], 518879[F], 871525[F], 871526[F], 871531 [F], 871534[F], 19554[F], 518883[F],
(57538) & 518880[F], 518881[F], 518882[F], 518888[F], 518889[F], 518891 [F], 518884[F], 518885[F], 518886[F], 518887[F], 518890[F], 518892[F],
Alpk3 518894[F], 518897[F], 518898[F], 518899[F], 518900[F], 518901 [F], 518893[F], 518895[F], 518896[F], 518905[F], 518906[F], 518908[F],
(116904) 518902[F], 518903[F], 518904[F], 518907[F], 518909[F], 518910[F], 518911[F]
518912[F], 518913[F], 518914[F], 518915[F] TABLE 2 - Page 59 of 1873
625323[F], 828020[F], 828021[F], 828022[F], 828023[F], 828024[F],
828025[F], 828026[F], 828027[F], 828028[F], 828029[F], 828030[F],
828031 [F], 828032[F], 828033[F], 828034[F], 828035[F], 828036[F],
828037[F], 828038[F], 828039[F], 828040[F], 828041 [F], 828042[F],
828043[F], 828044[F], 828045[F], 1 1288[F], 419641 [F], 419642[F],
ALPL (249) 419643[F], 419644[F], 419645[F], 419646[F], 419647[F], 419648[F],
& Alpl 419649[F], 419650[F], 419651[F], 419652[F], 419653[F], 419654[F],
(1 1647) 419655[F], 419656[F], 419657[F], 419658[F], 419659[F], 419660[F],
419661 [F], 419662[F], 419663[F], 419664[F], 419665[F], 419666[F],
419667[F], 419668[F], 419669[F], 419670[F], 419671 [F], 419672[F],
419673[F], 419674[F], 419675[F], 419676[F], 419677[F], 419678[F],
419679[F]
ALPPL2
617393[F], 617394(3036], 659896[-159], 1243[F], 1244[F], 64059[-
617392[F], 1242[F], 64061 [-2572] (251 ) & 174], 64060[-646], 64058[-2352], 64062[-4207], 64063[-4498]
Alppl2
616990[F], 656492[F], 656493[F], 656497[F], 656498[F], 656500[F],
656501 [F], 656502[F], 656503[F], 656505[F], 656506[F], 656507[F],
656509[F], 656510[F], 656512[F], 656513[F], 656514[F], 656515[F],
656516[F], 656517[F], 656518[F], 656519[F], 616993[63], 616992[- 1568], 656510[-1882], 656509[-1957], 756[F], 56942[F], 56943[F], 616989[F], 656494[F], 656499[F], 656504]F], 656508[F], 656511 [F], ALS2 56945[F], 56946[F], 56947[F], 56948[F], 56950[F], 56952[F], 656520[F], 6169911-1568], 755[F], 56944[F], 56949[F], 56951[F], (57679) & 56953[F], 56954[F], 56955[F], 56958[F], 56960[F], 56961 [F], 56956[F], 56957[F], 56959[F], 56965[F], 56968[F], 56972[F], Als2 56962[F], 56963[F], 56964[F], 56966[F], 56967[F], 56969[F], 56976[F], 56986[F], 757[6566] (74018) 56970[F], 56971 [F], 56973[F], 56974[F], 56975[F], 56977[F],
56978[F], 56979[F], 56980[F], 56981 [F], 56982[F], 56983[F],
56984[F], 56985[F], 758[6566], 56953[-120], 759[-130], 56987[-983],
56941 [-3541], 56940[-4783]
636039[F], 906146[F], 906149[F], 906150[F], 906152[F], 906155[F],
636040[F], 906147[F], 906148[F], 906151 [F], 906153[F], 906154[F], ALS2CL 636037[-120], 906152[-2247], 906150[-4497], 25724[F], 591099[F],
636038[-120], 906153[-1841], 906151[-4254], 25725[F], 591100[F], (259173) & 591 102[F], 591 104[F], 591105[F], 591106[F], 591107[F], 591109[F],
591 101[F], 591 103[F], 591108[F], 591110[F], 591111 [F], 591113[F], Als2cl 591 112[F], 591 114[F], 591116[F], 25722[-59], 591097[-3709],
591 115[F], 257231-59], 591098[-1162] (235633) 5910961-4089]
656467[F], 656469[F], 656471 [F], 656472[F], 656473[F], 656474[F],
656468[F], 656470[F], 920051[F], 920053[F], 920053(3715], 616986] ALS2CR11
920050[F], 920052[F], 920054[F], 920055[F], 920056[F], 920057[F], 4506], 656475[-4691], 656476[-4764], 656477[-4854] (151254)
6169851-4506]
616971[F], 656394[F], 656396[F], 656399[F], 656422[F],
ALS2CR12 923245[131], 923244[-1170], 923243[-1240], 656421 [-1869],
616972[F], 656395[F], 656397[F], 656398[F], 656423[F], 730[F], (130540) &
656420[-3170], 656419[-3240], 729[F], 56734[F], 56735[F],
56738[F], 56740[F], 56741 [F], 56743[F], 56746[F] Als2cr12
56736[F], 56737[F], 56739[F], 56742[F], 56744[F], 56745[F],
(108812) 56747]Fl
617014[F], 656663[F], 656664[F], 656665[F], 656666[F], 617012]
28], 6566601-198], 656658[-4305], 786[F], 57307[F], 57308[F], 617015[F], 617013[-28], 656659[-695], 656657[-4337], 787[F], ALS2CR8 57312[F], 57314[F], 57316[F], 57317[F], 57318[F], 57319[F], 57309[F], 57310[F], 57311[F], 57313[F], 57315[F], 57321 [F], (79800) & 57320[F], 57323[F], 57325[F], 57326[F], 57328[F], 57330[F], 57322[F], 57324[F], 57327[F], 57329[F], 57331 [F], 57335[F], Carf 57332[F], 57333[F], 57334[F], 57336[F], 57337[F], 784(449], 57306[- 785[449], 57305[-685], 57302[-3796], 57301 [-4355], 57300[-4945] (241066) 2131, 57304f-1034l, 57303[-3764
637639[F], 637640[-563], 679584[-1015], 27834[F], 106022[F], ALX1
637638[F], 679582[F] 679583[F], 27833[F], 106021 [F], 106023[F]
27835[-431], 106024[-899 " (8092) &
622909[F], 810090[F], 810093[F], 810096[F], 8196[F], 382291 [F], 622910[F], 810091[F] 810092[F], 810094[F], 810095[F], 8197[F], ALX3 (257) 382294[F], 382297[F] 382292[F], 382293[F] 382295[F], 382296|F & Alx3
620087[F], 791 121 [F] 791122[F], 791124[F], 791125[F], 791126[F],
620086[F], 791 120[F], 791123[F], 791128[F], 791130[F], 791135[F], 791 127[F], 791 129[F] 791131 [F], 791132[F], 791133[F], 791134[F], ALX4 791 138[F], 620088(22222] , 791 119[-12], 4599[F], 341986[F], 791 136[F], 791 137[F] 620089(22222], 4600[F], 341988[F], (60529) & 341987[F], 341990[F], 341995[F], 341997[F], 341999[F], 342000[F], 341989[F], 341991 [F] 341992[F], 341993[F], 341994[F], 341996[F], Alx4 342005[F], 342009[F], 4601 (20313] 341998[F], 342001 [F] 342002[F], 342003[F], 342004[F], 342006[F], (11695)
342007[F], 342008[F] 4602[20313]
AMACR
645027[-2276], 733607[-4924], 37669[-1017], 224092[-2987], 37672[-645026[F], 645028[-2276], 37671[F], 224093[F], 37670[-1017], (23600) & 4084] 37673[-4084] Amacr
(171 17) A BN
838720[F], 838721[F], 928653[F], 928654[F], 13177[F], 446179[F],
838719[F], 928652[3808], 13176[F], 446178[F] (258) &
446180[F], 446177[-3768], 446176[-4290]
Ambn AMBP
624203[F], 818675[F], 818678[F], 624201 [-3533], 818673[-3615], 624202[F], 818676[F], 818677[F], 928026(2037], 818674[37],
(259) & 9880[F], 402091 [F], 402092[F], 402095[F], 9878[-3569], 402089[- 624200[-3533], 818672[-4349], 9879[F], 402093[F], 402094[F],
Ambp 3657] 402090[32], 9877[-3569], 402088[-4401]
(11699) TABLE 2 - Page 60 of 1873
620047[F] 790775[F], 790776[F], 790777[F], 790778[F], 790779[F], 790780[F] 790781 [F], 790782[F], 790783[F], 790784[F], 790785[F], 790786[F] 790787[F], 790788[F], 790789[F], 790790[F], 790791 [F], 790792[F] 790793[F], 790794[F], 790795[F], 790796[F], 790797[F], 790798[F] 918834[-470], 790774[ 2470], 4549[F], 341370[F],
341371 [F] 341372[F], 341373[F], 341374[F], 341375[F], 341376[F], AMBRA1 341377[F] 341378[F], 341379[F], 341380[F], 341381 [F], 341382[F], (55626) & 341383[F] 341384[F], 341385[F], 341386[F], 341387[F], 341388[F], Ambral 341389[F] 341390[F], 341391 [F]. 341392[F], 341393[F], 341394[F], (228361) 341395[F] 341396[F], 341397[F]. 341398[F], 341399[F], 341400[F], 341401 [F] 341402[F], 341403[F]. 341404[F], 341405[F], 341406[F], 341407[F] 341408[F], 341409[F]. 341410[F], 341411 [F], 341412[F], 341413[F] 341414[F], 341415[F]. 341416[F], 3 4 1 4 17[F], 341418[F], 341419[F] 341420[F], 341421 [F] 341422[F], 3 4 1 4 23[F], 341424[F]
648929[F], 763775[F], 763776[F], 763777[F], 763778[F], 763779[F],
AMD1 763780[F], 763781[F], 763782[F], 763783[F], 854084[F], 927499[F],
(262) 927495(3143], 927496(2818], 927497(2483], 927498(2332]
AMDHD1
637531(25258], 637535[-642], 637533[-679], 27681(F], 104537(F), 637530[25258], 637534[-642], 637532[-679], 27680[F], 104533[F], (144193) & 27683[-597], 104539[-1270], 104540[-2834] 104534[F], 104535[F], 104536[F], 104538[F], 27682[-597] Amd dl
(71761)
647728[F], 754847[F], 754849[F], 754851 [F], 647728[9377],
647729[F], 754846[F], 754848[F], 754850[F], 754852[F], 754853[F], AMDHD2
647730[-141], 754854[-566], 754855[-729], 754856[-3433], 754857[- 647729(9377], 41336[F], 269970[F], 269971 [F], 269972[F], (51005) &
4693], 41335[F], 269973[F], 269975[F], 269977[F], 269979[F],
269974[F], 269976[F], 269978[F], 269980[F], 269981 [F], 41334]- Amdhd2
41337[-129], 269982[-623], 269983[-783], 269984[-3181], 269985[- 4907] (245847)
4046], 269986[-4389], 41333[-4907]
AMELX
652249[F], 652252[F], 916157[F], 47397[F], 47400[F], 616207[F],
652248[F], 916156[-3726], 47396[F], 616206[-1237], 616205[-3980] (265) & 6162041-4815]
Amelx
6217151-3600], 802351 [-3849], 633616[-4003], 22671[-2198], 633617[F], 633618[-3603], 633615[-4003], 22672[F], 22670[-2198], AMFR 554941 [-4508], 554940[-4714; 226731-2854] (267) &
637286[-177], 637284[-434], 677253[-494], 677252[-1123], 677251[- AMH (268)
637285[-177], 27364[-846], 100943[-4246], 100944[-4347] 1510], 27363[-322], 27365[-846], 100941 [-1052], 100942[-1153], & Amh
100940[-1418], 100939[-4789] (11705)
AMHR2
646259[F], 742850[F], 39277[F], 243395[F], 39279[-4387], 243400[- 646260[F], 742851[F], 39278[F], 243396[F], 243397[F], 2 4 3398[F],
(269) & 4 623], 243401 [-4705], 243402[-4794], 243403[-4965] 39280[-4387], 243399[-4613]
Am r2 AMICA1
634843[F], 897159[F], 897160[F], 634843(31331], 634845[807],
634844[F], 897161[F], 634844(31331], 634846[807], 634842[-1595], (120425) & 634841[-1595], 897159[-4607], 24244[F], 573930[F], 573931[F],
24245[F], 573935[F], 24247[1357], 24243[-1744] Amical 573932[F], 573933[F], 573934[F], 24246[1357], 24242[-1744]
(270152) AMIG01
622936[F], 810236[F], 810237[-229], 622934[-419], 810238[-2188], (57463) &
622935[-419], 8222[-426], 382503[-3667]
8223[F], 382504[F], 382505[F], 382506[F], 8221 [-426] Amigol
(229715) AMIG02
931953[418], 931954[-1014], 741616[-1582], 741617[-3014],
(347902) &
39040[302] 39039[302], 241181[-1266], 241182[-3016], 241183[-3803], 241184[
Amigo2 4134]
(105827) AMIG03
635936[F], 905411[F], 635932[-4489], 905409[-4495], 905408[-4710] 635937[F], 905410[F], 905412[-3822], 635933[-4489], 905407[- (386724) & 25577[F], 589618[F], 25573[-4370], 589616[-4384], 589620[-4488], 4895], 25578[F], 589617[-11], 589619[-3656], 25574[-4370],
Amigo3 589615[-4606], 589621[-4921] 589614[-4787]
(320844)
914353[F], 914354[F], 914355[F] 914356[F], 914357[F], 914359[F],
914360[F], 914361[F], 914362[F] 914363[F], 914364[F], 914366[F],
914367[F], 914368[F], 914369[F] 914371 [F], 914372[F], 914373[F],
914374[F], 914377[F], 914379[F] 914380[F], 914381 [F], 914383[F],
914384[F], 914385[F], 914387[F] 914389[F], 914390[F], 914391 [F], 865490[F], 914358[F], 914365[F], 914370[F], 914376[F], 914378[F], 914392[F], 914393[F], 914395[F] 652038(123912], 47086[F], 914382[F], 914386[F], 914388[F], 914394[F], 914396[F], 918338[F], AMMECR1 611925[F], 611927[F], 611928[F] 611929[F], 611930[F], 611931[F], 652037[123912], 47085[F], 611926[F], 611933[F], 611934[F], (9949) & 611932[F], 611935[F], 611936[F] 611937[F], 611938[F], 611939[F], 611940[F], 611945[F], 611947[F], 611949[F], 611951 [F], 611955[F], Ammecrl 611941 [F], 611942[F], 611943[F] 611944[F], 611946[F], 611948[F], 611961[F], 611963[F], 611968[F], 611969[F], 611972[F], 611974[F], (56068) 611950[F], 611952[F], 611953[F] 611954[F], 611956[F], 611957[F], 611976[F]
611958[F], 611959[F], 611960[F] 611962[F], 611964[F], 611965[F],
611966[F], 611967[F], 611970[F] 611971[F], 611973[F], 611975[F],
611924[27] 611923[-1 67], 611922[-324], 611921[-1370], 611920[- 1811] TABLE 2 - Page 61 of 1873
649161[F], 765728[F], 765729[F], 765735[F], 765737[F], 765738[F],
649160[F], 765727[F], 765730[F], 765731[F], 765732[F], 765733[F],
765739[F], 765740[F], 765741 [F], 765742[F], 926748[2787],
765734[F], 765736[F], 926749[2904], 926746[2623], 765730[-176],
926747[2694], 765729[-293], 765728[-386], 649163[-3477],
765727[-457], 649162[-3477], 43160[F], 292557[F], 292560[F],
43161 [F], 292558[F], 292559[F], 292565[F], 292566[F], 292570[F], 292561 [F], 292562[F], 292563[F], 292564[F], 292567[F], 292568[F], Ammecrl I
292572[F], 292573[F], 292574[F], 292575[F], 292576[F], 292577[F], 292569[F], 292571[F], 292555[-3913] (225339)
43162(2859], 292578[-1647], 292556[-3784], 292579[-4722]
AMN
641963(8185], 641965[-1536], 711256[-2871], 33210[F], 169946[F], 641964(8185], 641966[-1536], 33211[F], 169944[F], 169945[F],
(81693) & 169947[F], 33208[-3954], 169943[-4327] 33209[-3954]
Amn
629854[F], 863692[F], 863694[F], 863695[F], 629852[-2054], AMN1 17383[F], 500826[F], 500827[F], 500828[F], 500830[F], 500831 [F], 629853[F], 863693[F], 629851 [-2054], 17382[F], 500829[F], (196394) & 500833[F], 500835[F], 500836[F], 500837[F], 500838[F], 500839[F], 500832[F], 500834[F], 500843[F], 500847[-3], 500825[-4967] Amn1 500840[F], 500841[F], 500842[F], 500844[F], 500845[F], 500846[F] (232566)
652061 [F], 914558[F], 914559[F], 914562[F], 914563[F], 914566[F],
914568[F], 914569[F], 914570[F], 914571 [F], 914572[F], 914573[F], AMOT
652060[F], 914560[F], 914561 [F], 914564[F], 914565[F], 914567[F], 914574[F], 914575[F], 914572[-3716], 914573[-4093], 47109[F], (154796) &
914576[F], 47108[F], 612341[F], 612342[F], 612345[F], 612346[F], 612339[F], 612340[F], 612343[F], 612344[F], 612348[F], 612350[F], Amot
612347[F], 612349[F]
612351[F], 612352[F], 612353[F], 612354[F], 612355[-11], 612356[- (27494) 4584], 612357[-4646]
893812[F], 893813[F], 893814[F] 893815[F], 893816[F], 893819[F],
893822[F], 893823[F], 893824[F] 893825[F], 893826[F], 893827[F],
893828[F], 893829[F], 893830[F] 893831 [F], 893832[F], 893835[F],
893836[F], 893837[F], 893838[F] 893839[F], 893840[F], 893842[F],
893843[F], 893844[F], 893845[F] 893846[F], 893847[F], 893817[F], 893818[F] 893820[F], 893821 [F], 893833[F], 893834[F], 634345[108326], 893850[-3399] 23600[F], 567460[F], 567461[F], 893841[F], 893848[F] 634344(108326]. 2497], 23599[F],
AMOTL1 567462[F], 567463[F], 567464[F] 567467[F], 567470[F], 567471 [F], 567465[F], 567466[F] 567468[F], 567469[F], 567478[F], 567479[F],
(154810) & 567472[F], 567473[F], 567474[F] 567475[F], 567476[F], 567477[F], 567480[F], 567481 [F] 567483[F], 567484[F], 567491 [F], 567493[F],
AmotH 567482[F], 567485[F], 567486[F] 567487[F], 567488[F], 567489[F], 567494[F], 567507[F] 567508[F], 567510(F], 567512[F], 567514[F],
(75723) 567490[F], 567492[F], 567495[F] 567496[F], 567497[F], 567498[F], 567516[F], 567519[F] 567526[F], 567527[F], 567531 [F], 567533]- 567499[F], 567500[F], 567501[F] 567502[F], 567503[F], 567504[F], 2562]
567505[F], 567506[F], 567509[F] 567511[F], 567513[F], 567515[F],
567517[F], 567518[F], 567520[F] 567521 [F], 567522[F], 567523[F],
567524[F], 567525[F], 567528[F] 567529[F], 567530[F], 567532]- 1864], 567534[-3502]
904300[F], 904301[F], 904302[F], 904303[F], 904304[F], 904305[F],
AMOTL2 904306[F], 904307[F], 904308[F], 904309[F], 904311 [F],
904299[F], 904310[F], 635789(18678], 927841(882], 904297[-1118], (51421 ) & 635788(18678], 904298[-1037], 25416[F], 587596[F], 587597[F],
25417[F], 587595[F], 587606[F], 587593[-1126] Amotl2 587598[F], 587599[F], 587600[F], 587601 [F], 587602[F], 587603[F],
(56332) 587604[F], 587605[F], 587607[F], 587594[-1049]
809490[F], 809491[F], 809492[F], 809493[F], 622815(22459],
AMPD1
622813[F], 809489[F], 622814[22459], 8082[F], 381207[F], 622816[-2987], 8083[F], 381206[F], 381208[F], 381211 [F],
(270) & 381209[F], 381210[F], 381215[F], 381218[F], 381219[F], 8081 [- 381212[F], 381213[F], 381214[F], 381216[F], 381217[F], 381220[F],
Ampdl 1520], 381205[-2197], 381204[-2420] 381221[F], 381222[F], 381223[F], 381224[F], 381225[F], 8084]- (229665) 2938]
622927[F], 810190[F], 810191[F], 810192[F], 810193[F], 810194[F], AMPD2
622929(1070], 810196[-2857], 810197[-2935], 810199[-4962], 810195[F], 622928(1070], 810195[-422], 810198[-3484], 810194]- (271) & 8216(1045], 382449[-2895], 382450[-2963], 382452[-4238] 4211], 8214[F], 382443[F], 382444[F], 382445[F], 382446[F], Ampd2
382447[F], 382448[F], 8215(1045], 382451 [-3554], 382453[-4574] (109674)
631709[F], 874697[F], 874698[F], 874699[F], 874700[F], 874701 [F], 631710[F], 874696[F], 874702[F], 874703[F], 874704[F], 874708[F], 874705[F], 874706[F], 874707[F], 874709[F], 874710[F], 874711 [F], 874712[F], 631712[14438], 874696[-2856], 874713[-2932], 874714[- AMPD3 631711(14438], 874699[-185], 874698[-3201], 874697[-3597], 4121], 20160[F], 525389[F], 525390[F], 525391[F], 525392[F], (272) & 20159[F], 525383[F], 525384[F], 525385[F], 525386[F], 525387[F], 525395[F], 525397[F], 525401 [F], 525403[F], 20162(11947], Ampd3 525388[F], 525393[F], 525394[F], 525396[F], 525398[F], 525399[F], 525404[-393], 525405[-1169], 525406[-2475], 525381 [-2624], (11717) 525400[F], 525402[F], 20161(11947], 525382[- 4 03] 525407[-3433], 525408[-3723], 525409[- 4 247] TABLE 2 - Page 62 of 1873
642195[F] 642197[F], 713137[F] 713138[F] 713140[F] , 713141[F],
713142[F] 713143[F], 713145[F] 713147[F] 713150[F] 713151[F],
713152[F] 713153[F], 713155[F] 713156[F] 713157[F] 713159[F],
713160[F] 713161[F], 713162[F] 713163[F] 713164[F] , 713165[F],
713166[F] 713169[F], 713170[F] 713171[F] 713174[F] , 713176[F],
713177[F] 713178[F], 713179[F] 713180[F] 33567[F] 33569[F], 642196[F], 713136[F] 713139[F], 713144[F], 713146[F], 713148[F], 174931 [F] 174933[F], 174935[F] 174936[F] 174937[F] 174938[F], 713149[F], 713154[F] 713158[F], 713167[F], 713168[F], 713172[F], A PH 174939[F] 174940[F], 174942[F] 174943[F] 174945[F] , 174946[F], 713173[F], 713175[F] 33568[F], 174932[F], 174934[F], 174941[F], (273) & 174947[F] 174948[F], 174949[F] 174950[F] 174955[F] , 174956[F], 174944[F], 174951 [F] 174952[F], 174953[F], 174954[F], 174961[F], Amph 174957[F] 174958[F], 174959[F] 174960[F] 174962[F] 174963[F], 174966[F], 174984[F] 174986[F], 174988[F], 174989[F], 174994[F], (218038) 174964[F] 174965[F], 174967[F] 174968[F] 174969[F] 174970[F], 174995[F], 174997[F] 175002[F], 174930[32]
174971 [F] 174972[F], 174973[F] 174974[F] 174975[F] , 174976[F],
174977[F] 174978[F], 174979[F] 174980[F] 174981 [F] 174982[F],
174983[F] 174985[F], 174987[F] 174990[F] 174991 [F] 174992[F],
174993[F] 174996[F], 174998[F] 174999[F] 175000[F] , 175001 [F],
175003[F] 175004[F], 175005[F] 175006[F] 175007[F]
635946[F], 905475[F], 635947[1357], 905476[-145], 635945[-266], 905474[-557], 931660[-2594], 905477[-3901], 905478[-4594], AMT (275)
635948[-4684], 905479[-4778], 905480[-4868], 25589[F], 589713[F] & Amt 25590[681], 25588[-422], 589712[-725], 589714[-1171], 589715[- (434437) 3964], 255911-4495], 589716[-4590], 589717[-4774], 589718[-4864]
AMTN
838713[F], 928816(3697], 13177[F], 446155[F], 446156[F],
13176[F] (401138) &
446157[F], 446158[-1638], 446154[-1743]
Amtn AMY1A
810535[F], 622989(8246], 8294[F], 383147[F] 622988(8246], 8293[F], 383145[F], 383146[F], 383144[-640] (276) &
Amy2a5
810535[F], 622989(8245] 622988(8245]
622991[F], 810536[F] 622990[F]
AMY2A
622993[F], 810537[F], 8296[F], 383156[F], 383157[F], 383152[-2140] 622992[F], 8295[F], 383154[F], 383155[F], 383153[-572] (279) &
Amy1
AMY2B
810540[F], 622995[538], 8284[F], 383122[F] 810538[F], 926692[F], 622994[538], 8283[F], 383121[F] (280) &
Amy2b
627776[F], 845954[F], 845955[F], 845956[F], 845957[F], 845958[F],
AMZ1 14641 [F], 462987[F], 462988[F], 462989[F], 462990[F], 462991 [F],
(155185) & 462992[F], 462993[F], 462994[F], 462995[F], 462996[F], 462997[F],
Amz1 462998[F], 462999[F], 463000[F], 463001 [F], 463002[F], 463003]- (231842) 155], 463004[-4256], 14640[-4746]
699064[F], 699065[F], 699066[F], 930041 [F], 930042[F],
A Z2 930043(2936], 930044(1551], 930045(1434], 930046(1354], 699067]- (51321) & 449], 6990681-566], 699069[-646], 640362[-2017], 31094[F], 6403631-2017], 31095[F], 142438[F], 142439[F]
Amz2 142435[F], 142436[F], 142437[F], 142440[F], 142441 [F], 142442[F],
(13929) 142443[F], 142444[F], 142445[-1215], 142446[-3880]
620591 [F] 794684[F] 794687[F], 794688[F], 794689[F]
794690[F] 794691 [F] 794693[F], 794694]F], 794695[F]
794697[F] 794698[F] 794700[F], 794701 [F], 794702[F]
794703[F] 794704[F] 794706[F], 794708[F], 794709[F]
794711[F] 794712[F] 794715[F], 794718[F], 794719[F]
794721 [F] 794722[F] 794724[F], 794725[F], 794726[F]
794727[F] 794728[F] 794730[F], 794731 [F], 794733[F]
794734[F] 794735[F] 794683[-523], 5196[F], 348927[F],
620590[F], 794685[F] 794696[F], 794707[F], 794710[F], 794714[F], 348928[F] 348929[F] 348932[F], 348933[F], 348934[F] ANAPC1
794716[F], 794717[F] 794720[F], 794732[F], 5195[F], 348930[F],
348935[F] 348936[F] 348938[F], 348939[F], 348940[F] (64682) &
348942[F], 348944[F] 348949[F], 348959[F], 348964[F], 348967[F], 348941 [F] 348943[F] 348946[F], 348947[F], 348948[F] Anapd
348971 [F], 348976[F] 348980[F], 348982[F], 348986[F], 348987[F], 348950[F] 348951 [F] 348953[F], 348954[F], 348955[F] (17222)
348990[F], 348994[F] 349005[F], 349010[F], 5193[-451]
348956[F] 348957[F] 348960[F], 348961 [F], 348962[F]
348963[F] 348965[F] 348968[F], 348969[F], 348970[F]
348972[F] 348973[F] 348975[F], 348977[F], 348978[F]
348979[F] 348981 [F] 348984[F], 348985[F], 348988[F]
348989[F] 348991 [F] 348993[F], 348995]F], 348996[F]
348997[F] 348998[F] 349000[F], 349001 [F], 349002[F]
349003[F] 349004[F] 349007[F], 349008[F], 349009[F]
349011[F] 349012[F] 349014[F], 349015[F], 51941-451 TABLE 2 - Page 63 of 1873
633363[F], 886135[F], 886136[F] 886137[F], 886138[F], 886139[F],
886140[F], 886142[F], 886143[F] 22364[F], 551000[F], 551002[F],
ANAPC10 551006[F], 551007[F], 551008[F] 551010[F], 551011 [F], 551012[F], 633364[F], 8861 4 1[F], 22365[F], 551001 [F], 551003[F], 551004[F],
(10393) & 551013[F], 551014[F], 551015[F] 551016[F], 551017[F], 551019[F], 551005[F], 551009[F], 551018[F], 551021[F], 551025[F], 551028[F],
Anapd 0 551020[F], 551022[F], 551023[F] 551024[F], 551026[F], 551027[F], 551036[F], 551037[-957], 551038[-1925]
(68999) 551029[F], 551030[F], 551031[F] 551032[F], 551033[F], 551034[F],
551035[F]
ANAPC10
624589[F], 748532[F] 624588[F]
P1
640673[F], 700950[F], 700951 [F], 700952[F], 640671 [-30], 618380[- 125], 679513[-168], 679600[-168], 679512[-170], 7009 4 8[-2 4 18],
640672[F], 700953[F], 700954[F], 640670[-30], 700949[-2161],
819265[-2439], 679601 [-2538], 700947[-3149], 700946[-3332], ANAPC11 640674[-3717], 31467[F], 146291[F], 146294[F], 146295[F],
819266[-3347], 819267[-3411], 700945[-3423], 667590[-3435], (51529) & 146297[F], 146298[F], 146299[F], 146300[F], 146301 [F], 146303[F],
640675[-3717], 700955[-4350], 31468[F], 146289[F], 146290[F], Anapd 1 146304[F], 31465[38], 31469[-1862], 146288[-2136], 146306[-3974],
146292[F], 146293[F], 146296[F], 146302[F], 31466(38], 31470[- (66156) 146307[-4374]
1862], 146287[-2378], 146305[-2468], 146286[-3112], 146285[- 3294], 146284[-3382], 146283[-4588]
635785[F], 904291[F], 904293[F], 904294[F], 904295[F], 904296[F], ANAPC13
635786[F], 904292[F], 635786[7666], 635784[270], 904290[-805],
635785[7666], 635783[270], 904291[-4], 25 4 13[F], 587585[F], (25847) &
904289[-1354], 904288[-1648], 25414[F], 587584[F], 25412[251],
587586[F], 587587[F], 587588[F], 587589[F], 587590[F], 587591 [F], Anapd 3
587582[-590], 587581[-1 4 18], 587580[-1595], 587579[-3503]
25411 [251], 587583[22 (69010)
ANAPC16
674583[F], 674584[F], 636888(19858], 636889[-6], 674586[-2668],
636890[-6], 674585[-241], 674587[-2826], 26848[309], 94640[-265], (119504) &
26846[F], 94638[F], 94639[F], 26847[309], 94637[-3], 94641[-916], 94643[-1830], 94645[-3834] Anapd 6
94636[-991], 94642[-1682], 94644[-3752]
(52717)
783018[F], 783019[F], 783020[F], 783021[F], 783022[F], 783023[F],
ANAPC2 783024[F], 783025[F], 619059[13803], 619057( 2861], 619060[-
619058[-2861], 783017[-4075], 619061 [-4718], 3335[-2473], (29882) & 4718], 3336[F], 326771 [F], 326772[F], 326773[F], 326774[F],
326770[-3623], 3338[-3993] Anapc2 326775[F], 326776[F], 326777[F], 326778[F], 326779[F], 326780[F],
(99152) 3334[-2473l, 3337[-3993 "
836510[F], 836512[F], 836513[F], 836514[F], 836515[F], 836516[F],
836518[F], 836519[F], 924590[F], 924592[F], 924593[F], 924594[F], ANAPC4
836511[F], 836517[F], 924591[F], 924597(2831], 12768[F],
924595[F], 924596[F], 924598(2302], 924599(2183], 923081 [-4459], (29945) &
441417[F], 441418[F], 441420[F], 441422[F], 441426[F], 441430[F], 12767[F], 441419[F], 441421[F], 441423[F], 441424[F], 441425[F], Anapc4
441433[-1664], 441415[-4145]
441427[F], 441428[F], 441429[F], 441431[F], 441432[F], 441416[- (52206) 37571
625863[F], 625865[F], 625867[F], 832588[F], 832597[F], 832598[F],
832599[F], 832600[F], 832601[F], 832602[F], 832604[F], 832605[F],
832606[F], 832608[F], 832610[F], 832611[F], 832612[F], 832613[F],
832668[F], 832669[F], 832670[F], 832671 [F], 832672[F], 843328[F],
843329[F], 843331[F], 843332[F], 843333[F], 843334[F], 843335[F],
843336[F], 843337[F], 843338[F], 843339[F], 843340[F], 843341 [F],
843342[F], 843343[F], 843344[F], 843345[F], 843346[F], 843347[F],
843350[F], 843351[F], 843352[F], 843354[F], 843357[F], 843358[F],
625864[F], 625866[F], 625868[F], 832607[F], 832609[F], 843330[F], 923961 [F], 923963[F], 923964[F], 923965[F], 923966[F], 923967[F],
843348[F], 843349[F], 843353[F], 843355[F], 843356[F], 923971 [F], 923968[F], 923969[F], 923970[F], 923973[F], 923974[F], 923975[F], ANAPC5
923972[F], 923976[F], 923978[F], 923979(4055], 14126[F],
923977[F], 923980[3925], 923981 [3284], 843358[-463], 923962[- (51433) &
456586[F], 456588[F], 456589[F], 456591 [F], 456595[F], 4 56609[F], 1421], 843327[-3421], 922967[-4257], 14127[F], 456582[F], Anapc5
456610[F], 456625[F], 456627[F], 456628[F], 456632[F], 4 56634[F], 456583[F], 456584[F], 456585[F], 456587[F], 456590[F], 456592[F], (59008)
456635[F], 14128[-1362], 14130[-2434], 456640[-2674], 456641[- 456593[F], 456594[F], 456596[F], 456597[F], 456598[F], 456599[F],
3467], 456642[-4151]
456600[F], 456601[F], 456602[F], 456603[F], 456604[F], 456605[F],
456606[F], 456607[F], 456608[F], 456611[F], 456612[F], 456613[F],
456614[F], 456615[F], 456616[F], 456617[F], 456618[F], 456619[F],
456620[F], 456621[F], 456622[F], 456623[F], 456624[F], 456626[F],
456629[F], 456630[F], 456631[F], 456633[F], 456636[F], 456637[- 243], 456638[-457], 14129[-1362], 456581 [-1484], 456580[-1615],
456639[-1708], 14131[-2434], 456579[-2505], 456578[-3413],
456643[-4734]
ANAPC7
627365[F], 843221[F], 843222[F], 14115[F], 456385[F], 456386[F], (51434) & 456387[F], 456388[F], 456389[F], 456390[F] Anapc7
(56317)
644067[F], 726583[F], 644067[5414], 931348[3170], 726584[-61],
ANG (283) 726583[-3426], 36427[F], 209010[F], 209011[F], 209012[-65],
726597[F], 931349[F] & Ang
209013[-1854], 209014[-2847], 209015[-3320], 209016[-3458],
(11727) 209017[-3799], 209010[-4241]
708451[F], 708452[F], 708453[F], 708458[F], 708460[F], 708461[F],
708463[F], 708464[F], 926554[F], 926555[F], 926557[F], 926558[F], ANGEL1
708459[F], 708462[F], 926556[F], 926559[F], 641651 [-4218], 926560[F], 926553[3922], 926552[3397], 641654(583], 32787[F], (23357) &
32788[F], 164219[F], 164222[F], 164225[F], 164229[F], 32786[-4812] 164215[F], 164216[F], 164217[F], 164218[F], 164220[F], 164221[F], AngeH
164223[F], 164224[F], 164226[F], 164227[F], 164228[F], 164230[F], (68737)
164231 [F], 32789[494] TABLE 2 - Page 64 of 1873
669806[F], 669807[F], 669808[F], 669809[F], 669810[F], 669811[F], ANGEL2 618698[23284], 618700[-126], 669812[-886], 2879[F], 83899[F], 618699[23284], 669805[-2140], 2880[F], 83900[F], 83903[F], (90806) & 83901 [F], 83902[F], 83905[F], 83906[F], 83907[F], 83909[F], 83904[F], 83908[F], 83900[-1154] Angel2 83910[F], 2881 [-1153], 83899[-1457], 83911[-1541] (52477)
645233[F], 735728[F], 735729[F], 735730[F], 735731 [F], 735732[F],
735735[F], 735736[F], 735738[F], 735739[F], 735741 [F], 735742[F],
645232[F], 735733[F], 735734[F], 735737[F], 735740[F], ANGPT1 735743[F], 645235[690], 735744[-2313], 37985[F], 228967[F],
645234[690], 37984[F], 228968[F], 228969[F], 228970[F], (284) & 228972[F], 228974[F], 228975[F], 228976[F], 228977[F], 228980[F],
228971[F], 228973[F], 228978[F], 228979[F], 228984[F], 228987[F], Angptl 228981 [F], 228982[F], 228983[F], 228985[F], 228986[F], 228990[F],
228988[F], 228989[F], 228992[F], 228993[F], 37986[556] (11600) 228991 [F], 228994[F], 228995[F], 228996[F], 228997[F], 37987[556],
228998[1], 228999[-2330]
632617[F], 880709[F], 880713[F], 880714[F], 880715[F], 880717[F],
632616[F], 632618[F], 880710[F], 880711[F], 880712[F], 880716[F], 880719[F], 880721[F], 880723[F], 880724[F], 880726[F], 880727[F], 880718[F], 880720[F], 880722[F], 880725[F], 880731 [F], 880733[F], 880728[F], 880729[F], 880730[F], 880732[F], 916373[F], 880735[-
ANGPT2 880734[F], 880705[-4393], 21331[F], 21335[F], 538157[F], 159], 880736[-1210], 880708[-3825], 880707[-3939], 880706[-4103],
(285) & 538158[F], 538160[F], 538162[F], 538165[F], 538168[F], 538171 [F], 21330[F], 21334[F], 538159[F], 538161[F], 538163[F], 538164[F],
Angpt2 538173[F], 538175[F], 538177[F], 538180[F], 538185[F], 538188[F], 538166[F], 538167[F], 538169[F], 538170[F], 538172[F], 538174[F],
(11601) 538190[F], 538191[F], 538192[F], 538156[-687], 538154[-2925], 538176[F], 538178[F], 538179[F], 538181[F], 538182[F], 538183[F], 538153[-3320] 538184[F], 538186[F], 538187[F], 538189[F], 538193[-173], 538194|
881], 538155[-948], 538195[-2718], 538196[-3663], 538197[-4527]
620911[F], 620913[F], 797014[F], 797015[F], 797016[F], 797019[F], 620912[F], 620914[F], 797011[F], 797012[F], 797013[F], 797017[F], ANGPT4
797020[F], 797021[F], 797022[F], 797023[F], 797010[-4726], 797018[F], 5601[F], 5603[F], 354015[F], 354016[F], 354018[F], (51378) &
5600[F], 5602[F], 354017[F], 354019[F], 354020[F], 354021 [F], 354022[F], 354023[F], 354024[F], 354025[F], 354026[F], 354027[F], Angpt4
354028[F], 354029[F], 354030[F], 354031[F], 354032[F], 354033[-97] 354014[-2721], 354034[-2925] (11602)
ANGPTL1
618116[F], 665729[F], 665730[F], 665731 [F], 665732[F],
618117[F], 665733[F], 2192[F], 76119[-602], 76114[-1062], 76120[- (9068) & 618118(20461], 665734[-4760], 2191[F], 2193[F], 76115[F], 76116[F]
1187], 76122[-2252], 76123[-2437], 76113[-4567] AngptH 76117[F], 76118[F], 76121[-1494], 76124[-3573]
(72713) ANGPTL2
619358[F], 7849501-1976], 784951 [-2096], 784952[-2386], 784953]- (23452) &
619357[F], 7849491-451], 3665[F], 330133[-339], 330131[-3232] 3902], 3666[F], 330134[-1791], 330135[-1913], 330132[-2073],
Angptl2 330136[-2109], 330137[-3190]
(26360) ANGPTL3
624414[F], 820686[F], 820687[F], 820688[F], 820685[-2234],
(27329) &
624413[F], 10186[F], 10188[F] 10187[F], 10189[F], 406457[F], 406458[F], 406459[F], 406456]- Angptl3 1871]
(30924)
757151[F], 757152[F], 757154[F], 757156[F], 757158[F], 757159[F],
757162[F], 757163[F], 757164[F], 757165[F], 757166[F], 929734[F], 757153[F], 757155[F], 757157[F], 757160[F], 757161 [F], 757167[F],
ANGPTL4 929735[F], 929738[F], 929739[F], 929740[F], 929741 (3957], 929733[F], 929736[F], 929737[F], 929731(2612], 929729(2479],
(51129) & 929732(2638], 929730(2580], 929728(2387], 929727(2278], 929743(2144], 929744(1911], 757168[-89], 41764[F], 274527[F],
AngptW 929742(2193], 41765[F], 274525[F], 274526[F], 274528[F], 274529[F], 274532[F], 274535[F], 274536[F], 274542[F], 274543[- (57875) 274530[F], 274531[F], 274533[F], 274534[F], 274537[F], 274538[F], 123], 274544[-4810]
274539[F], 274540[F], 274541 [F], 274545[-4964]
634309[F], 893549[F], 893550[F], 893551[F], 634307(1508], 893548[- ANGPTL5
634308(1508]
221] (253935)
894216[F], 894217[F], 894218[F], 634426(10331], 634425(691],
8942151-93], 894214[-180], 894213[-715], 894212[-789], 894211[- 923], 894210[-1039], 894209[-2319], 894208[-2373], 894207[-2649],
ANGPTL6 894206[-4545], 894205[-4815], 23722[F], 568385[F], 568386[F],
(83854) & 568387[F], 568388[F], 568389[F], 23721 [567], 568384[-93], 568383]
Angptl6 180], 568382[-553], 568381[-627], 568380[-772], 568379[-893],
(70726) 568378[-2181], 568377( 2313], 568376[-2367], 568375[-2581],
568374[-3582], 568373[-3716], 568372[-3897], 568371 [-4005],
568370[-4406]
ANGPTL7
625569[F], 830099[F], 830100[F], 625571(6630], 830101 [-881],
(10218) &
625570[F], 11634[F], 427330[-1894] 11633[F], 11635[F], 427327[F], 427328[F], 427329[-743], 427331[
Angptl7 4880]
(654812) TABLE 2 - Page 65 of 1873
632681[F], 632683[F], 881258[F], 881259[F], 8812B0[F], 881263[F],
881269[F], 881270[F], 881271[F], 881272[F], 881275[F], 881276[F],
632682[F], 881257[F], 881261 [F], 881262[F], 881264[F], 881265[F], 881277[F], 881278[F], 881279[F], 881280[F], 881287[F], 881290[F],
881266[F], 881267[F], 881268[F], 881273[F], 881274[F], 881281[F], 881291 [F], 881292[F], 632683(10954], 632684[-2407], 881287[- 881282[F], 881283[F], 881284[F], 881285[F], 881286[F], 881288[F], 3621], 21444[F], 21446[F], 539790[F], 539791 [F], 539792[F],
881289[F], 881289[-2032], 881288[-2249], 21445[F], 539789[F], ANK1 539793[F], 539798[F], 539799[F], 539800[F], 539802[F], 539803[F],
539794[F], 539795[F], 539796[F], 539797[F], 539801 [F], 539804[F], (286) & 539806[F], 539811[F], 539812[F], 539813[F], 539814[F], 539815[F],
539805[F], 539807[F], 539808[F], 539809[F], 539810[F], 539816[F], Ank1 539817[F], 539818[F], 539821[F], 539823[F], 539824[F], 539825[F],
539819[F], 539820[F], 539822[F], 539828[F], 539829[F], 539838[F], (11733) 539826[F], 539827[F], 539830[F], 539831 [F], 539832[F], 539833[F],
539839[F], 539840[F], 539842[F], 539843[F], 539846[F], 539847[F], 539834[F], 539835[F], 539836[F], 539837[F], 539841 [F], 539844[F],
539848[F], 539849[F], 539850[F], 539854[F], 539855[F], 539856[F], 539845[F], 539851[F], 539852[F], 539853[F], 539857[F], 539859[F],
539858[F], 539862[F], 539863[F], 539822[-4627]
539860[F], 539861[F], 539864[F], 539865[F], 539866[F], 539823[- 2101], 21447[-2773]
623134[F], 633866[F], 811545[F] 811546[F], 811549[F] 811552[F],
811554[F], 811555[F], 811557[F] 811558[F], 811559[F] 811560[F],
811564[F], 811565[F], 811566[F] 811568[F], 811569[F] 811572[F],
623133[F], 633867[F] 811547[F], 811548[F], 811550[F], 811551[F], 811573[F], 811574[F], 811576[F] 811577[F], 811578[F] 811579[F],
811553[F], 811556[F] 811561[F], 811562[F], 811563[F], 811567[F], 811580[F], 811581[F], 811582[F] 811583[F], 811584[F] 811586[F], ANK2
811570[F], 811571[F] 811575[F], 811585[F], 811595[F], 811597[F], 811587[F], 811588[F], 811589[F] 811590[F], 811591 [F] 811592[F], (287) &
811598[F], 811601[F] 811606[F], 811608[F], 811614[F], 889801[F], 811593[F], 811594[F], 811596[F] 811599[F], 811600[F] 811602[F], Ank2
889802[F], 889803[F] 623131 [565657], 8461[F], 385336[F],
811603[F], 811604[F], 811605[F] 811607[F], 811609[F] , 811610[F], (109676)
385338[F], 385340[F] 385341 [F], 385343[F], 385347[F], 385340]- 811611[F], 811612[F], 811613[F] 811615[F], 811616[F] , 811617[F],
3322]
889804[F], 889805[F], 623132(565657] 8115871-1987], 8462[F],
385333[F], 385334[F], 385335[F] 385337[F], 385339[F] , 385342[F],
385344[F], 385345[F], 385346[F] 385339[-2352]
637028[F], 637030[F], 637032[F] 675755[F], 675756[F], 675757[F],
675758[F], 675761[F], 675764[F] 675765[F], 675766[F], 675767[F],
675768[F], 675771[F], 675772[F] 675775[F], 675776[F], 675777[F],
675780[F], 675782[F], 675784[F] 675785[F], 675786[F], 675788[F],
675789[F], 675792[F], 675793[F] 675794[F], 675795[F], 675799[F], 637029[F], 637031[F], 675759[F], 675760[F], 675762[F], 675763[F], 675800[F], 675801[F], 675802[F] 675805[F], 675806[F], 675809[F], 675769[F], 675770[F], 675773[F], 675774[F], 675778[F], 675779[F], 675810[F], 675811[F], 675813[F] 675817[F], 675819[F], 675820[F], 675781[F], 675783[F], 675787[F], 675790[F], 675791 [F], 675796[F], 675822[F], 675823[F], 675824[F] 675825[F], 675826[F], 675827[F], 675797[F], 675798[F], 675803[F], 675804[F], 675807[F], 675808[F], 675828[F], 675829[F], 675830[F] 675831 [F], 675832[F], 675833[F], 675812[F], 675814[F], 675815[F], 675816[F], 675818[F], 675821[F], 675835[F], 675837[F], 675838[F] 675839[F], 675840[F], 675841 [F], 675834[F], 675836[F], 675842[F], 675843[F], 675851 [F], 675852[F], 675844[F], 675845[F], 675846[F] 675847[F], 675848[F], 675849[F], 675860[F], 675864[F], 637027[707155], 675773[-815], 920568[- 675850[F], 675853[F], 675854[F] 675855[F], 675856[F], 675857[F], 1815], 675865[-3815], 27025[F], 27027[F], 27029[F], 27032[F],
675858[F], 675859[F], 675861[F] 675862[F], 675863[F], 97301[F], 97302[F], 97307[F], 97308[F], 97309[F], 97310[F],
637026(707155], 675823[-160], 675772[-3330], 27024[F], 27026[F], 97311[F], 97316[F], 97319[F], 97321[F], 97324[F] 97326[F],
27028[F], 27030[F], 27031 [F], 97300[F], 97303[F], 97304[F], 97327[F], 97331 [F], 97333[F], 97334[F], 97335[F] 97338[F], A K3 97305[F], 97306[F], 97312[F], 97313[F], 97314[F], 97315[F] 97342[F], 97344[F], 97347[F], 97349[F], 97354[F] 97355[F], (288) & 97317[F], 97318[F], 97320[F], 97322[F], 97323[F], 97325[F] 97357[F], 97358[F], 97360[F], 97361[F], 97362[F] 97363[F], Ank3 97328[F], 97329[F], 97330[F], 97332[F], 97336[F], 97337[F] 97366[F], 97367[F], 97368[F], 97373[F], 97376[F] 97377[F], (11735) 97339[F], 97340[F], 97341 [F], 97343[F], 97345[F], 97346[F] 97378[F], 97380[F], 97383[F], 97385[F], 97386[F] 97387[F],
97348[F], 97350[F], 97351 [F], 97352[F], 97353[F], 97356[F] 97389[F], 97390[F], 97391 [F], 97395[F], 97396[F] 97399[F],
97359[F], 97364[F], 97365[F], 97369[F], 97370[F], 97371 [F] 97401 [F], 97402[F], 97403[F], 97404[F], 97406[F] 97410[F],
97372[F], 97374[F], 97375[F], 97379[F], 97381 [F], 97382[F] 97411[F], 97414[F], 97416[F], 97418[F], 97419[F] 97420[F],
97384[F], 97388[F], 97392[F], 97393[F], 97394[F], 97397[F] 97421 [F], 97424[F], 97427[F], 97428[F], 97432[F] 97433[F],
97398[F], 97400[F], 97405[F], 97407[F], 97408[F], 97409[F] 97434[F], 97440[F], 97445[F], 97451[F], 97458[F] 97461 [F],
97412[F], 97413[F], 97415[F], 97417[F], 97422[F], 97423[F] 97462[F], 97463[F], 97464[F], 97467[F], 97468[F] 97470[F],
97425[F], 97426[F], 97429[F], 97430[F], 97431 [F], 97435[F] 97471 [F], 97477[F], 97479[F], 97486[F], 97487[F] 97495[F],
97436[F], 97437[F], 97438[F], 97439[F], 97441 [F], 97442[F] 97496[F], 97504[F], 97509[F], 97511[F], 27034[15189], 97298[-901], 97443[F], 97444[F], 97446[F], 97447[F], 97448[F], 97449[F] 97451[-2952], 97512[-3281]
97450[F], 97452[F], 97453[F], 97454[F], 97455[F], 97456[F]
97457[F], 97459[F], 97460[F], 97465[F], 97466[F], 97469[F]
97472[F], 97473[F], 97474[F], 97475[F], 97476[F], 97478[F]
97480rFl 97481 TF1 9748?iFl 97483iFl 97484iFl 97485iFl
617166[F], 616902[271], 655789[-74], 657910[-74], 922346[-92], ANKAR
617167[F], 655790[F], 616903[271], 969[F], 59768[F], 59777[F], 655791 [-2092], 968[F], 59769[F], 59770[F], 59771 [F], 59772[F], (150709) & 59780[F], 59781 [F] 59773[F], 59774[F], 59775[F], 59776[F], 59778[F], 59779[F], 967[- Ankar
25], 597671-79] (319695)
ANKDD1A
635338[F], 900531[F], 900533[F], 900534[F], 926441 [-2983], 900528
635337[F], 926443[-2347], 926442[-2931], 900530[-4347], 900529[- (348094) & 4983], 24816[F], 24818[F], 579919[F], 579921[F], 579923[F],
4931], 24815[F], 24817[F], 579920[F], 579922[F], 579918[-3477] Ankddla 579924[F], 579925[-140], 24819[-907]
(384945)
643229[F], 719491[F], 719492[F], 719493[F], 643227[-686], 719489| ANKDm B
643230[F], 719490[F], 719494[F], 643228[-686], 35089[F],
1959], 719495[-2973], 719488[-4439], 719487[-4974], 35088[F], 7?f¾7fi m o 192027[F], 192028[F], 192029[F], 192032[F], 192034[F], 192035[F],
192026[F], 192030[F], 192031[F], 192033[F], 192037[F], A kriri h 192036[F], 192038[F], 192039[F], 192040[F], 35087[1054], 192019[-
35086[1054], 192025[-380], 192024[-2769], 192023[-2977], 192022[- Ankdd1 b 1511 (271144)
3447], 192021 [-3669], 192020[-3953] TABLE 2 - Page 66 of 1873
639707[F], 694933[F], 694934[F], 694936[F], 694939[F], 694944[F],
639706[F], 694935[F], 694937[F], 694938[F], 694940[F], 694941 [F], 694945[F], 694947[F], 694949[F], 694950[F], 694951 [F], ANKFN1
694942[F], 694943[F], 694946[F], 694948[F], 639708(75510],
639709[75510], 639705[6902], 639704[-2291], 694932[-2787], (162282) &
694952[-444], 639703[-2291], 30371[F], 135473[F], 135475[F],
30372[F], 135470[F], 135471[F], 135472[F], 135474[F], 135478[F], Ankfnl
135476[F], 135477[F], 135481[F], 135482[F], 135 4 84[F], 135485[F], 135479[F], 135480[F], 135483[F], 135487[F], 135488[F], 135489[F], (382543)
135486[F], 135491 [F], 30368[-2136]
135490[F], 135492[F], 30370(5908], 30369[-2136], 135469[-2504]
639239[F] 690984[F], 690985[F] 690986[F] 690987[F], 690988[F],
690989[F] 690990[F], 690991 [F] 690993[F] 690994[F], 690996[F],
690997[F] 690998[F], 690999[F] 691001 [F] 691004]F], 691005[F],
691006[F] 691007[F], 691009[F] 691010[F] 691012[F], 691013[F],
691014[F] 691015[F], 691016[F] 691017[F] 691018[F], 691020[F],
921101 [F] 921102[F], 921103[F] 921105[F] 921106[F], 921108[F], 639240[F], 690983[F] 690992[F], 690995[F], 691000[F], 691002[F], 921109[F] 921110[F], 921111[F] 921112[F] 921113[F], 921114[F], 691003[F], 691008[F] 691011[F], 691019[F], 691021 [F], 921104[F],
ANKFY1 921116[F] 29837[F], 128468[F], 28469[F] 128471[F], 1 28472[F], 921107[F], 921115[F] 921117(3372], 29838[F], 128467[F],
(51479) & 128473[F] 128474[F], 128475[F] 128476[F] 128477[F], 128478[F], 128470[F], 128479[F] 128480[F], 128483[F], 128492[F], 128493[F],
Ankf l 128481 [F] 128482[F], 128484[F] 128485[F] 128486[F], 128487[F], 128494[F], 128497[F] 128509[F], 128511[F], 128512[F], 128515[F],
(11736) 128488[F] 128489[F], 128490[F] 128491 [F] 128495[F], 128496[F], 128519[F], 128523[F] 128529[F], 128530[F], 128538[F], 128540[F], 128498[F] 128499[F], 128500[F] 128501 [F] 128502[F], 128503[F], 29836[-1906]
128504[F] 128505[F], 128506[F] 128507[F] 128508[F], 128510[F],
128513[F] 128514[F], 128516[F] 128517[F] 128518[F], 128520[F],
128521 [F] 128522[F], 128524[F] 128525[F] 128526[F], 128527[F],
128528[F] 128531 [F], 128532[F] 128533[F] 128534[F], 128535[F],
128536[F] 128537[F], 128539[F]
734308[F], 734309[F], 734310[F], 734311[F], 734314[F], 734316[F],
734318[F], 734320[F], 734322[F], 734323[F], 734325[F], 734326[F],
734327[F], 734329[F], 734330[F], 734331 [F], 734332[F], 734333[F],
734334[F], 734335[F], 734336[F], 734337[F], 734338[F], 734339[F],
734340[F], 734341[F], 734342[F], 914270[F], 914271 [F], 914272[F], 734305[F], 734306[F], 734307[F], 734312[F], 734313[F], 734315[F], 914273[F], 914274[F], 914275[F], 914276[F], 645088(163107], 734317[F], 734319[F], 734321[F], 734324[F], 734328[F],
ANKH
645090(66484], 37784[F], 225912[F], 225914[F], 225915[F], 645089(163107], 645087[-3596], 734304[-4959], 37785[F],
(56172) & 225916[F], 225917[F], 225918[F], 225919[F], 225924[F], 225926[F], 225910[F], 225911[F], 225913[F], 225920[F], 225921 [F], 225922[F],
Ank 225930[F], 225932[F], 225934[F], 225936[F], 225938[F], 225939[F], 225923[F], 225925[F], 225927[F], 225928[F], 225929[F], 225931 [F],
(11732) 225940[F], 225942[F], 225944[F], 225945[F], 225946[F], 225947[F], 225933[F], 225935[F], 225937[F], 225941 [F], 225943[F], 225951 [F], 225948[F], 225949[F], 225950[F], 225952[F], 225953[F], 225955[F], 225954[F], 225956[F], 37783[-3226]
225957[F], 225958[F], 225959[F], 225960[F], 225961 [F], 225962[F],
225963[F], 225964[F], 225965[F], 225966[F], 225967[F], 225968[F],
225969[F], 225970[F], 225971[F], 225972[F], 225973[F], 225974[F],
225975[F], 37786(52274]
649271 [F] 766630[F], 766631[F], 766632[F], 766633[F], 766634[F],
766635[F] 766636[F], 766637[F], 766639[F], 766640[F], 766641 [F],
766642[F] 766651[F], 766652[F], 766653[F], 766654[F], 766656[F],
766657[F] 766660[F], 766661[F], 766662[F], 766663[F], 766664[F],
766665[F] 766666[F], 766667[F], 766668[F], 766669[F], 766670[F],
766672[F] 766673[F], 766675[F], 766677[F], 766678[F], 919825[F],
919826[F] 919827[F], 919828[F], 919830[F], 919831 [F], 919834[F],
919835[F] 919836[F], 919837[F], 919838[F], 919839[F], 919840[F],
649272[F], 766638[F], 766655[F], 766658[F], 766659[F], 766671 [F], 919841 [F] 919842[F], 919843[F], 919844[F], 919846[F], 919847[F],
766674[F], 766676[F], 919829[F], 919832[F], 919833[F], 919845[F], 919849[F] 919851[F], 919852[2633], 919711(1391], 919712(574],
919848[F], 919850[F], 919710(1810], 919713(440], 766679[-190],
766680[-609], 766681 [-1426], 919714[-3182], 43302[F], 294383[F], ANKHD1
766682[-1560], 43303[F], 294390[F], 294392[F], 294393[F],
294384[F] 294385[F], 294386[F], 294387[F], 294388[F], 294389[F], (54882) &
294394[F], 294401[F], 294404[F], 294405[F], 294406[F], 294408[F], 294391 [F] 294395[F], 294396[F], 294397[F], 294398[F], 294399[F], Ankhdl
294410[F], 294414[F], 294418[F], 294426[F], 294438[F], 294440[F], 294400[F] 294402[F], 294403[F], 294407[F], 294409[F], 294411[F], (108857)
294443[F], 294444[F], 294448[F], 294450[F], 294463[F], 294466[F], 294412[F] 294413[F], 294415[F], 294416[F], 294417[F], 294419[F],
294470[F], 294473[-179], 294476[-1372], 43301[-4328], 294382[- 294420[F] 294421[F], 294422[F], 294423[F], 294424[F], 294425[F],
4434], 294381 [-4585]
294427[F] 294428[F], 294429[F], 294430[F], 294431 [F], 294432[F],
294433[F] 294434[F], 294435[F], 294436[F], 294437[F], 294439[F],
294441 [F] 294442[F], 294445[F], 294446[F], 294 44 7[F], 294 4 49[F],
294451 [F] 294452[F], 294453[F], 294454[F], 294455[F], 294456[F],
294457[F] 294458[F], 294459[F], 294460[F], 294461 [F], 294462[F],
294464[F] 294465[F], 294467[F], 294468[F], 294469[F], 294471 [F],
294472[F] 2944741-533], 294475[-1250], 43300[-4328], 294477]- 4385] TABLE 2 - Page 67 of 1873
649271 [F], 766630[F], 766631 [F] 766632[F], 766633[F], 766634[F],
766635[F], 766636[F], 766637[F] 766639[F], 766640[F], 766641 [F],
766642[F], 766651 [F], 766652[F] 766653[F], 766654[F], 766656[F],
766657[F], 766660[F], 766661 [F] 766662[F], 766663[F], 766664[F],
766665[F], 766666[F], 766667[F] 766668[F], 766669[F], 766670[F], 649272[F], 766638[F], 766655[F], 766658[F], 766659[F], 766671[F], ANKHD1- 766672[F], 766673[F], 766675[F] 766677[F], 766678[F], 766680[F], 766674[F], 766676[F], 766679[F], 766682[F], 919710[F], 919713[F], EIF4EBP3 766681 [F], 766683[F], 919711[F] 919712[F], 919714[F], 919825[F], 919829[F], 919832[F], 919833[F], 919845[F], 919848[F], 919850[F] (404734) 919826[F], 919827[F], 919828[F] 919830[F], 919831 [F], 919834[F],
919835[F], 919836[F], 919837[F] 919838[F], 919839[F], 919840[F],
919841[F], 919842[F], 919843[F] 919844[F], 919846[F], 919847[F],
919849[F], 919851[F], 919852[F] 649273[-830], 766684[-2477]
625800[F], 832032[F], 832033[F], 832034[F], 832037[F], 832039[F],
832040[F], 832041[F], 832042[F], 832043[F], 832044[F], 832045[F],
832046[F], 832047[F], 832048[F], 832049[F], 832050[F], 832051 [F],
832053[F], 832054[F], 832055[F], 832056[F], 832058[F], 832060[F],
832061 [F], 832062[F], 832063[F], 832064[F], 832065[F], 832066[F],
625799[F], 832035[F], 832036[F], 832038[F], 832052[F], 832057[F], 832067[F], 832068[F], 832071[F], 832072[F], 832074[F], 832075[F],
832059[F], 832069[F], 832070[F], 832073[F], 625801 [-133], 832077| 832076[F], 625802[-133], 832079[-1081], 11911[F], 430924[F],
432], 832078[-864], 832080[-3003], 832081[-3591], 832082[-4017], 4 30925[F], 4 30926[F], 430929[F], 430935[F], 430936[F], 430937[F], ANKIB1
11910[F], 430927[F], 430928[F], 430930[F], 430931[F], 430932[F], 4 30938[F], 4 30940[F], 430941[F], 430942[F], 430943[F], 430944[F], (54467) &
430933[F], 430934[F], 430939[F], 430948[F], 430957[F], 430958[F], 430945[F], 430946[F], 430947[F], 430949[F], 430950[F], 430951 [F], Ankibl
430959[F], 430966[F], 430970[F], 430972[F], 430978[F], 430982[F], 430952[F], 430953[F], 430954[F], 430955[F], 430956[F], 430960[F], (70797)
430991[F], 430992[F], 430993[F], 430995[F], 430996[F], 431003[F], 430961 [F], 430962[F], 430963[F], 430964[F], 430965[F], 430967[F],
431004[F], 119121-53], 431008[-164], 431009[-542], 431011 [-2698], 430968[F], 430969[F], 430971[F], 430973[F], 430974[F], 430975[F],
431012[-2955], 431013[-3267]
430976[F], 430977[F], 430979[F], 430980[F], 430981 [F], 430983[F],
430984[F], 430985[F], 430986[F], 430987[F], 430988[F], 430989[F],
430990[F], 430994[F], 430997[F], 430998[F], 430999[F], 431000[F],
431001[F], 431002[F], 431005[F], 431006[F], 431007[F], 11913[-53],
431010[-736]
ANKK1 (255239) &
634939[12572], 24348[F], 574849[F]
Ankkl (244859) ANKLE1
633241[F], 633239[-2291], 885204[-4583], 22204[-1087], 548807]- (126549) &
633240[F], 22205[-826], 548808[-1769]
2692], 548806[-2849], 22206[-4264] Anklel
(234396)
840994[F], 840995[F], 840996[F], 916303[F], 13714[F], 13716[F], A KLE2 451563[F], 451564[F], 451565[F], 451566[F], 451567[F], 451568[F], (23141) &
694062[F], 916304[F], 13715[F], 13712(^562], 451562[-4804]
451569[F], 451570[F], 451571[F], 13717[-2466], 451572[-2636], Ankle2 451573[-4369], 13713[-4562] (71782)
617511[F], 660810[F], 660811[F], 660812[F], 617514[-2065], 617512 617510[F], 660806[F], 660807[F], 660808[F], 660809[F], 617513]- ANKMY1 2713], 660813[-3439], 1394[F], 65759[F], 65765[F], 65766[F], 2065], 1393[F], 65760[F], 65761[F], 65762[F], 65763[F], 65764[F], (51281) &
65767[F], 65768[F], 65769[F], 65770[F], 65775[F], 65776[F], 1392]- 65771[F], 65772[F], 65773[F], 65774[F], 1391[-2791], 65758[-347 4 ], Ankmyl 2791], 1395[-4058], 1397[-4654], 65777[-4756], 65757[-4857] 1396[-4654] (241158)
641053[F], 703642[F], 703643[F], 703649[F], 703650[F], 703651 [F],
703652[F], 703653[F], 703656[F], 703657[F], 703659[F], 703660[F], 641054[F], 703641[F], 703645[F], 703654[F], 703655[F], 703658[F],
ANKMY2 703661[F], 641051[-316], 703640[-2729], 703639[-2925], 32053[F], 641052[-316], 703638[-3227], 32054[F], 154269[F], 154272[F],
(57037) & 154270[F], 154271[F], 154273[F], 154277[F], 154280[F], 154281[F], 154274[F], 154275[F], 154276[F], 154278[F], 154279[F], 154288[F],
Ankmy2 154282[F], 154283[F], 154284[F], 154285[F], 154286[F], 154287[F], 154289[F], 154292[F], 154296[F], 32052[958], 154268[-2747],
(217473) 154290[F], 154291[F], 154293[F], 154294[F], 154295[F], 154297[F], 154264[-3963]
32051 [958], 154267[-3085], 154266[-3543], 154265[-3699]
ANKRA2
643269[F], 719814[F], 719815[F], 643268[-55], 719813[-124],
643267[-55], 719812[-240], 928945[-2197], 719810[-3803], 719816[- (57763) &
719811[-1595], 719809[-4784], 719808 [-4933], 35136[F], 192647[F], 4197], 35134[-199], 192645[-381], 192643[-1974] Ankra2
192648[F], 35135[-199], 192646[-268], 192644[-969], 192642[-2291]
(68558) ANKRD1
650602[F], 776826[F], 776827[F], 776828[F], 776829[F], 776830[F],
650601[F], 776832[F], 44946[F], 314505[F], 314510[F], 314513[- (27063) & 776831[F], 44947[F], 314506[F], 314507[F], 314508[F], 314509[F],
103] Ankrdl 314511[F], 314512[F]
(107765)
632543[F], 880099[F], 880100[F], 880101[F], 880102[F], 880103[F], 880104[F], 880105[F], 880106[F], 880107[F], 880108[F], 21200[F], ANKRD10 536088[F], 536089[F], 536090[F], 536091 [F], 536092[F], 536093[F], (55608) & 536094[F], 536095[F], 536096[F], 536097[F], 536098[F], 536099[F], AnkrdIO 536100[F], 536101[F], 536102[F], 536103[F], 536104[F], 536105[F], (102334) 536106[F], 536106[29], 536088[-381] TABLE 2 Page 68 of 1873
634128[F] 892376[F], 892377[F] 892378[F] 892379[F] 892380 [F],
892381 [F] 892382[F], 892383[F] 892384[F] 892385[F] 892386[F],
892387[F] 892388[F], 892389[F] 892390[F] 892391 [F] 892392[F],
892393[F] 892394[F], 892395[F] 892396[F] 892397[F] 892398[F],
892399[F] 892400[F], 892401 [F] 892402[F] 892403[F] 892404[F],
892405[F] 892406[F], 892407[F] 892408[F] 892409[F] 892410[F],
892411[F] 892412[F], 892413[F] 892414[F] 892415[F] 892416[F],
892417[F] 892418[F], 892419[F] 892420[F] 892421 [F] 892422[F],
892423[F] 892424[F], 892425[F] 892426[F] 892427[F] 892428[F],
892429[F] 892430[F], 892431 [F] 892432[F] 892433[F] 892434[F],
892435[F] 892436[F], 892437[F] 892438[F] 892439[F] 892440[F],
892441 [F] 892442[F], 892443[F] 892444[F] 892445[F] 892446[F],
892447[F] 892448[F], 892449[F] 892450[F] 892451 [F] 892452[F],
930413(1637], 892453]-363], 23295[F], 563601 [F], 563602[F]
563603[F] 563604[F] 563605[F] 563606[F] 563607[F] 563608[F] ANKRD11
916407[F], 930414(1042], 930415(846], 892454[-958], 892455[- 563609[F] 563610[F] 563611[F] 563612[F] 563613[F] 563614[F] (29123) &
1154], 232961-180], 563808[-1348], 563809[-1477], 563810[-1702], 563615[F] 563616[F] 563617[F] 563618[F] 563619[F] 563620[F] Ankrd11
5638111-1928]
563621 [F] 563622[F] 563623[F] 563624[F] 563625[F] 563626[F] (77087) 563627[F] 563628[F] 563629[F] 563630[F] 563631 [F] 563632[F]
563633[F] 563634[F] 563635[F] 563636[F] 563637[F] 563638[F]
563639[F] 563640[F] 563641 [F] 563642[F] 563643[F] 563644[F]
563645[F] 563646[F] 563647[F] 563648[F] 563649[F] 563650[F]
563651 [F] 563652[F] 563653[F] 563654[F] 563655[F] 563656[F]
563657[F] 563658[F] 563659[F] 563660[F] 563661 [F] 563662[F]
563663[F] 563664[F] 563665[F] 563666[F] 563667[F] 563668[F]
563669[F] 563670[F] 563671 [F] 563672[F] 563673[F] 563674[F]
563675[F] 563676[F] 563677[F] 563678[F] 563679[F] 563680[F]
563681 [F] 563682[F] 563683[F] 563684[F] 563685[F] 563686[F]
563687[F] 563688[F] 563689[F] 563690[F] 563691 [F] 563692[F]
563693[F] 563694[F] 563695[F] 563696[F] 563697[F] 563698[F]
563699[F] 563700[F] 563701 [F] 563702[F] 563703[F] 563704[F]
563705fFl. 563706fFl. 563707iFl 56370RF1. 563709F1. 563710 1.
648605[F], 711688[F], 711689[F] 711690[F], 760873[F], 760874[F],
760875[F], 760876[F], 760877[F] 760878[F], 760879[F], 760880[F],
760881 [F], 760882[F], 760883[F] 760884[F], 760885[F], 760886[F],
760889[F], 760890[F], 760891[F] 760892[F], 760893[F], 760894[F],
760895[F], 760896[F], 760897[F] 760900[F], 760901 [F], 760902[F],
760904[F], 760905[F], 760906[F] 760907[F], 760910[F],
648606(1079], 760910( 556], 648608( 2407], 760911 [-2410],
648604[F], 760887[F], 760888[F], 760903[F], 760908[F], 760909[F], 42439(F), 282145[F], 282147[F], 282148[F], 282149[F], 282150[F],
648607[-2407], 42438[F], 282146[F], 282156[F], 282164[F], ANKRD12
282151[F], 282152[F], 282153[F] 282154[F], 282155[F], 282157[F],
282165[F], 282178[F], 282179[F], 282181[F], 282183[F], 282186[F], (23253) & 282158[F], 282159[F], 282160[F] 282161[F], 282162[F], 282163[F],
282193[F], 282194[F], 282197[F], 282200[F], 282202[F], 282209[F], Ankrd12 282166[F], 282167[F], 282168[F] 282169[F], 282170[F], 282171[F],
282211[F], 282212[F], 282214[F], 282216[F], 282222[F], 282223[F], (106585) 282172[F], 282173[F], 282174[F] 282175[F], 282176[F], 282177[F],
282224[F], 282226[F], 42441[-1747], 282230[-3793]
282180[F], 282182[F], 282184[F] 282185[F], 282187[F], 282188[F],
282189[F], 282190[F], 282191[F] 282192[F], 282195[F], 282196[F],
282198[F], 282199[F], 282201[F] 282203[F], 282204[F], 282205[F],
282206[F], 282207[F], 282208[F] 282210[F], 282213[F], 282215[F],
282217[F], 282218[F], 282219[F] , 282220[F], 282221 [F], 282225[F],
282227[F], 42440[848], 282144[-1384], 42442[-1747], 282228[-2386].
282229[-3783], 282231 [-4537]
627180[F], 841792[F], 841794[F], 841797[F], 841798[F], 841799[F],
841800[F], 841801[F], 841802[F], 841803[F], 841804[F], 841805[F], 627181[F], 841793[F], 841795[F], 841796[F], 841806[F], 841807[F],
ANKRD13 841808[F], 841809[F], 841810[F], 627178(39624], 627176[641], 627179[39624], 627177[641], 926422[-620], 841811 [-2620], 841791
A (88455) 13867[F], 453351 [F], 453353[F], 453355[F], 453357[F], 453358[F], 3439], 841790[-4457], 841789[-4753], 13868[F], 453352[F],
& 453359[F], 453360[F], 453362[F], 453364[F], 453365[F], 453366[F], 453354[F], 453356[F], 453361 [F], 453363[F], 453376[F], 453377[F],
Ankrd13a 453367[F], 453368[F], 453369[F], 453370[F], 453371 [F], 453372[F], 13866[379], 453350[-1987], 13870[-2374], 453349[-2869], 453348[- (68420) 453373[F], 453374[F], 453375[F], 453378[F], 453379[F], 453380[F], 3126], 453381 [-3180]
13865[379], 13869[-2374], 453347[-4889]
639393[F], 692129[F], 692130[F], 692131[F], 692133[F], 692135[F], ANKRD13 692136[F], 692137[F], 692138[F], 692140[F], 692141 [F], 639391[- 639392[F], 692132[F], 692134[F], 692139[F], 639394[310], 692142[- B (124930) 765], 6921281-1358], 30012[F], 130509[F], 130510[F], 130511[F], 3852], 30011[F], 130512[F], 130515[F], 130519[F], 130520[F], & 130513[F], 130514[F], 130516[F], 130517[F], 130518[F], 130521[F], 130522[F], 130523[F], 30013[311], 130527[-3610], 130528[-4942] Ankrd13b 130524[F], 130525[F], 130526[F], 30010[-781], 130508[-1374] (268445) TABLE 2 - Page 69 of 1873
623513[F], 814045[F], 814047[F] 814048[F], 814049[F], 814050[F],
814051 [F], 814052[F], 814053[F] 814054[F], 814055[F], 814056[F],
814057[F], 814058[F], 814059[F] 814061 [F], 814062[F], 814063[F],
921242(2011], 814044(11], 8927[F], 390796[F], 390798[F],
390800[F], 390802[F], 390803[F] 390804[F], 390806[F], 390807[F], 623514[F], 814046[F], 814060[F], 8928[F], 390797[F], 390799[F], ANKRD13 390808[F], 390809[F], 390810[F] 390811[F], 390812[F], 390813[F], 390801[F], 390805[F], 390815[F], 390827[F], 390830[F], 390833[F], C (81573) 390814[F], 390816[F], 390817[F] 390818[F], 390819[F], 390820[F], 390836[F], 390838[F], 390840[F], 390846[F], 390855[F], 390856[F], & 390821 [F], 390822[F], 390823[F] 390824[F], 390825[F], 390826[F], 390858[F], 8929[-3634], 390863[-4222], 390864[-4491], 390865[- Ankrd13c 390828[F], 390829[F], 390831[F] 390832[F], 390834[F], 390835[F], 4554], 390866[-4838] (433667) 390837[F], 390839[F], 390841[F] 390842[F], 390843[F], 390844[F],
390845[F], 390847[F], 390848[F] 390849[F], 390850[F], 390851 [F],
390852[F], 390853[F], 390854[F] 390857[F], 390859[F], 390860[F],
390861 [-42], 390862[-172], 390795[-223]
ANKRD13
649992[F], 772288[F], 649990[-991], 649994[-2731], 772290[-3827],
649991[F], 649993[-2731], 772289[-3666], 44209[F], 306041[F], D (338692) 44210[F], 306042[F], 306044[F], 306046[F], 44208[-945], 44212[- 306043[F], 306045[F], 306047[F], 44211 [-2860], 306048[-3769] & 2860], 306049[-3930], 306050[-4777]
Ankrd13d
618893[F], 781823[F], 781824[F], 781825[F], 618891 [-288], 781821 [
ANKRD16
434], 781819[-938], 3119[F], 324008[F], 324009[F], 324010[F], q
324011[F], 324012[F], 324013[F], 324014[F], 324015[F], 324016[F], 618894 [ Ρ 1· 92938411947], 781822[-53], 618892[-288], 781820[-440], (54522) &
3120[F], 324007[F], 3118[-166], 324005[-312] Ankrd16
324017[F], 324018[F], 324019[F], 3117[-166], 324006[-306], 324004[- (320816) 735]
838943[F], 838944[F] 838945[F], 838946[F], 838947[F] 838948[F] 838949[F], 838950[F] 838951 [F], 838952[F], 838953[F] 838954[F] 838955[F], 838956[F] 838957[F], 838958[F], 916300[F] 13203[F], 446620[F], 446621 [F] 446622[F], 446623[F], 446624[F]
^ 6625 ^ 1 ' ANKRD17 446626[F], 446627[F] 446628[F], 446629[F], 446630[F] 446631 [F], ,J „
626742[-381], 838959[-495], 13204[-433], 446662[-561] 446632[F], 446633[F] 446634[F], 446635[F], 446636[F] 446637[F], ( ° 5 J] &
446638[F], 446639[F] 446640[F], 446641 [F], 446642[F] 44664 3 [ F j, *™ 446644[F], 446645[F] 446646[F], 446647[F], 446648[F] 446649[F], (81702) 446650[F], 446651 [F] 446652[F], 446653[F], 446654[F] 446655[F] 446656[F], 446657[F] 446658[F], 446659[F], 446660[F] 446661 [F]
13202[-3168], 446619[-3991]
ANKRD18
623979[F] 623978[F]
A (253650) ANKRD19 623978[F] 623979[F]
P (138649)
777927[F], 777928[F], 650718(11121], 650720[-460], 777930[-692],
ANKRD2
777931[-961], 650716[-1282], 777926[-1989], 777925[-2266], 777929[F], 650719(11121], 650721[-460], 650717[-1282], 777923[- (26287) &
777924[-4293], 777922[-4503], 45096[F], 316612[F], 316615[F], 4411], 777932[-4970], 45097[F], 316613[F], 316614[F], 316616[F],
Ankrd2 45098[-452], 316617[-677], 316618[-931], 45094[-1386], 316611[- 45099[-452], 45095[-1386], 316607[-3975]
(56642) 2077], 316610[-2354], 316609[-3682], 316608[-3855], 316606[-4067]
ANKRD20
623978[F] 623979[F]
A1 (84210) ANKRD20 623979[F] 623978[F]
A2 ANKRD20 623978[F] 623979[F]
A3 ANKRD20 623978[F] 623979[F], 788272[F]
A4 ANKRD20 880850[F], 921241 [F]
A8P ANKRD20
885159[F], 885160[F], 885161[F], 924917[F], 924918[F], 924919[F]
A9P ANKRD22
650578[F], 650576[7913], 776688[-2524], 44915[F], 314145[F],
650579[F], 776691[F], 650577[7913], 44916[F], 314149[F], (118932) &
314146[F], 314147[F], 314148[F], 314151[F], 44913(4063], 314144[ 314150[F], 314152[F], 44914(4063] Ankrd22
4171]
(52024)
654299[F], 654300[F], 654301[F], 654302[F], 654303[F],
931035(3656], 931036(3523], 931037(3051], 931038[2676],
ANKRD23 931039(2175], 931040(1812], 931041(1536], 654304[-188], 654305[-
654298[F], 931034[F], 929825[-1775], 654306[-3775], 616691[- (200539) & 464], 616690[-2503], 616692[-3965], 654297[-4146], 372[F],
3965], 371[F], 52411[F], 52421[-1646], 52422[-3178], 52423[-3817] Ankrd23 52412[F], 52413[F], 52414[F], 52415[F], 52416[F], 52417[F], 52418[- (78321) 174], 52419[-460], 52420[-1506], 370[-2295], 52410[-4005], 52409[- 42581
ANKRD24
637345[F], 677513[F], 677514[F], 916458[-754], 648478[-4728],
(170961) & 916459[F], 637344[-754], 27435[-741], 27437[-1445], 101509[-2045] 27436[F], 101504[F], 101505[F], 101506[F], 101507[F], 101508[F],
Ankrd24
27438[-1445], 101510[-2428], 101511[-4882]
(70615)
683076[F], 722075[F], 722076[F], 722078[F], 782795[F], 782796[F], 629327[F], 683070[F], 683075[F], 722077[F], 788271 [F], 792420[F], ANKRD26 788273[F], 792419[F], 875929[F], 875930[F], 880849[F], 921230[F], 859646[F], 859647[F], 875934[F], 880921 [F], 16638[F], 492045[F], (22852) & 921231[F], 921232[F], 921233[F], 921234[F], 921235[F], 921236[F], 492046[F], 492047[F], 492048[F], 492049[F], 492050[F], 492051 [F], Ankrd26 921237[F], 921239[F], 921240[F], 921238[2451] 492052[F], 492053[F], 492054[F], 492055[F], 492056[F] (232339) TABLE 2 - Page 70 of 1873
880843[F], 880844[F], 880846[F], 880847[F], 880922[F], 880923[F],
880924[F], 880926[F], 880928[F], 880929[F], 880930[F], 885323[F], 880842[F], 880845[F], 880925[F], 880927[F], 880931 [F], 885325[F], ANKRD26 885324[F], 921127[F], 921128[F], 921130[F], 921131 [F], 921132[F], 885326[F], 921126[F], 921129[F], 921135[F], 921137[F], 921141[F], P1 921133[F], 921134[F], 921136[F], 921138[F], 921139[F], 921140[F], 921144[F], 921145[F] (124149) 921142[F], 921143[F]
ANKRD26
881844[F], 921840[F]
P3
630603[F], 867586[F], 867587[F], 867588[F], 867589[F], 867590[F], 630602[-657], 867584[-936], 867583[-2584], 18658[F], 509667[F],
ANKRD27 509668[F], 509669[F], 509670[F], 509671 [F], 509672[F], 509673[F],
630601[-657], 867585[-717], 18656[-663], 509666[-708], 18659[- (84079) &
509674[F], 509675[F], 509676[F], 509677[F], 509678[F], 509679[F], 2736], 509662[-4579] Ankrd27
509680[F], 18657[-663], 509665[-920], 509677[-2406], 509664]- (245886) 2476], 18660[-2736], 509663[-3011], 509681 [-3399], 509682[-3805], 509683[-4403], 509684[-4745]
643821[F], 725062[F], 725063[F], 725064[F], 725065[F], 725066[F], 725067[F], 725068[F], 725069[F], 725070[F], 725071 [F], 725072[F],
ANKRD28 35984[F], 205065[F], 205066[F], 205067[F], 205068[F], 205069[F],
(23243) &
899102[F], 920062(2414] 205070[F], 205071[F], 205072[F], 205073[F], 205074[F], 205075[F],
Ankrd28 205076[F], 205077[F], 205078[F], 205079[F], 205080[F], 205081 [F],
(105522) 205082[F], 205083[F], 205084[F], 205085[F], 205064[-518], 205063| 590], 35983[-624]
649015[F], 764480[F], 764481[F], 764491[F], 42974[F], 289769[F], 649014[F], 764477[F], 764478[F], 764479[F], 764482[F], 42973[F], ANKRD29 289770[F], 289771[F], 289776[F], 289779[F], 289781 [F], 289782[F], 289772[F], 289773[F], 289774[F], 289775[F], 289777[F], 289778[F], (147463) & 289783[F], 289784[F], 289787[F], 289794[F], 289795[F], 289796[F], 289780[F], 289785[F], 289786[F], 289788[F], 289789[F], 289790[F], Ankrd29 289800[F] 289791[F], 289792[F], 289793[F], 289797[F], 289798[F], 289799[F] (225187)
ANKRD30
885310[F], 921017[F] 885309[F], 921016[F]
B (374860)
719543[F], 719544[F], 719546[F], 719547[F], 719548[F], 719550[F], ANKRD31
719545[F], 719549[F], 919411[F], 919415[F]
919409[F], 919410[F], 919412[F], 919413[F], 919414[F], 919416[F] (256006)
643062[F], 718399[F], 718400[F] 718401[F], 718402[F], 718403[F],
718404[F], 718405[F], 718409[F] 718411[F], 718412[F], 718414[F],
718415[F], 718416[F], 718417[F] 643064[-81], 34875[F], 189534[F],
189535[F], 189536[F], 189537[F] 189538[F], 189539[F], 189541[F], 643061[F], 718406[F], 718407[F], 718408[F], 718410[F], 718413[F],
ANKRD32 189542[F], 189544[F], 189547[F] 189548[F], 189549[F], 189551[F], 643063[-81], 34874[F], 189540[F], 189543[F], 189545[F], 189546[F]
(84250) & 189553[F], 189554[F], 189555[F] 189556[F], 189559[F], 189560[F], 189550[F], 189552[F], 189557[F], 189558[F], 189569[F], 189571[F],
Ankrd32 189561 [F], 189562[F], 189563[F] 189564[F], 189565[F], 189566[F], 189573[F], 189574[F], 189578[F], 189583[F], 189586[F], 189587[F],
(105377) 189567[F], 189568[F], 189570[F] 189572[F], 189575[F], 189576[F], 189590[F], 34876[-47]
189577[F], 189579[F], 189580[F] 189581[F], 189582[F], 189584[F],
189585[F], 189588[F], 189589[F] 189591[F], 189592[F], 189593[F],
189594[F], 189595[F], 34877[-47], 34878[-205]
ANKRD33 (341405) &
646190[F], 742497[F], 39204[F], 242890[F], 242892[F], 242893[F] 646191[F], 742498[F], 39205[F], 242891[F], 242894[-205]
Ankrd33 (208258)
645108[F], 734608[F], 734612[F], 734613[F], 734618[F], 734619[F],
645107[F], 734609[F], 734610[F], 734611[F], 734614[F], 734615[F], 734620[F], 734621[F], 734623[F], 921337(1793], 734625[-207], ANKRD33
734616[F], 734617[F], 734622[F], 734624[F], 37805[F], 226519[F], 37806[F], 226518[F], 226521[F], 226526[F], 226527[F], 226529[F], B (651746)
226520[F], 226522[F], 226523[F], 226524[F], 226525[F], 226528[F], 226530[F], 226531[F], 226532[F], 226536[F], 226537[F], 226538[F], &
226533[F], 226534[F], 226535[F], 226539[F], 226541 [F], 226544[F], 226540[F], 226542[F], 226543[F], 226545[F], 226546[F], 226547[F], Ankrd33b
226548[F], 226549[F], 226550[F], 226551 [F], 226552[F], 226554[F], 226553[F], 226555[26], 37807[-601], 226556[-709], 226532[-2141], (67434)
226533[-1877], 226528[-3988]
226531 [-2269], 226530[-2873], 226529[-3018]
808558[F], 808559[F], 808562[F], 622690(3154], 916262[-120], ANKRD34 808557[-662], 622692[-1437], 808564[-1578], 808565[-1987], A (284615)
808560[F], 808561[F], 622689[3154], 622691 [-1437], 808563[-1485].
8085661-2199], 7939[F], 379521[F], 379522[F], 379525[F], 7941 [- & 7938[F], 379523[F], 379524[F], 7940[-1334], 379526[-1377]
1334], 3795271-1470], 379528[-1890], 379529[-2092], 7937[-2453], Ankrd34a 3795201-3295], 379519[-3818] (545554)
ANKRD34
643160[F], 718987[F], 643159(1531] 35010[F], 191046[F], B (340120)
643158[1531], 35008(1257]
35009[1257] &
Ankrd34b ANKRD34
903160[F], 903161[F], 903162[F], 635640[12464], 25222[F], C (390616)
903159[F], 635639[12464], 25221 [F], 585307[F]
585308[F], 585309[F], 585310[F] &
Ankrd34c ANKRD35
622696[F], 749247[F], 808598[F], 808601 [F], 808602[F], 808603[F], 622697[F], 749246[F], 808599[F], 808600[F], 808604[F], 808605[F],
(148741) & 7947[F], 379585[F], 379586[F], 379587[F], 379590[F], 379591 [F], 808597[9], 7948[F], 379582[F], 379583[F], 379584[F], 379588[F],
Ankrd35 379592[F], 379594[F] 379589[F], 379593[F], 379595[F]
(213121 ) TABLE 2 - Page 71 of 1873
638140[F], 28459[F], 113123[F], 113124[F], 113125[F], 113131[F], ANKRD36
638139[F], 28458[F], 113122[F], 113126[F], 113127[F], 113128[F],
113133[F], 113134[F], 113137[F], 113138[F], 113140[F], 113141[F], (375248) & 113129[F], 113130[F], 113132[F], 113135[F], 113136[F], 113139[F]
113142[F], 113144[F], 113146[F], 113147[F], 113148[F], 113150[F], Ankrd36 113143[F], 113145[F], 113149[F], 113152[F]
113151[F] (76389)
ANKRD37 (353322) &
632947[297], 21806[552], 21804[535] 21805[552]
Ankrd37 (654824)
616692[F], 654308[F], 931041[-1466], 616694[-1695], 931040[-1742]
931039[-2089], 654309 [-2310], 931038[-2601], 931037[-2989],
616691[F], 654307[F], 929825[1851], 654306[-149], 616693[-1695], ANKRD39 654310[-3039], 931036 [-3452], 654305[-3466], 931035[-3575],
654311 [-3053], 931034[-4891], 371[F], 52422[F], 52423[F], (51239) & 654304[-3742], 654303 [-4089], 654302[-4601], 654301 [-4989],
52424[F], 52425[F], 52427[F], 52421[-751], 373[-1436], 52431[- Ankrd39 372[F], 52426[F], 52428[F], 52420[-891], 374[-1436], 52419[-1941],
2784] (109346) 52429[-2042], 52418[-2227], 52417[-2588], 52430[-2770], 52416[- 2945], 52415[-3220], 52414[-3710], 52413[-3835], 52412[-4417]
695291 [F], 695292[F], 695293[F], 695294[F], 695295[F], 695298[F], 695289[F], 695290[F], 695296[F], 695297[F], 695299[F], 695300[F],
ANKRD40 695301 [F], 695302[F], 639745[14719], 639747[-1486], 695305[- 695303[F], 639746[14719], 639748[-1486], 695304[-2997],
(91369) & 4750], 30419[F], 136123[F], 136124[F], 136125[F], 136126[F], 30420[F], 136119[F], 136120[F], 136121 [F], 136122[F], 136129[F],
Ankrd40 136127[F], 136128[F], 136131[F], 136134[F], 136135[F], 136134[- 136130[F], 136132[F], 136133[F], 136136[F], 136132[-59], 136133[- (71452) 572], 30421 [-1446], 136135[-2088], 136138[-3646] 137], 30422[-1446], 136136[-2113], 136137[-2761]
631360[F], 872420[F], 872421[F], 872422[F], 872423[F], 872424[F],
872426[F], 872427[F], 872428[F], 923233[-673], 872418[-2673],
631359[F], 872425[F], 923234[25], 872419[-1975], 631361 [-4472], ANKRD42 631362[-4472], 19733[F], 520868[F], 520869[F], 520871[F],
631363[-4906], 19732[F], 520870[F], 520872[F], 520874[F], (338699) & 520873[F], 520875[F], 520876[F], 520878[F], 520879[F], 520881 [F],
520877[F], 520880[F], 520885[F], 520886[F], 520887[F], 520888[F], Ankrd42 520882[F], 520883[F], 520884[F], 520890[F], 520892[F], 520893[F],
520889[F], 520891 [F], 19730[-1222], 19734[-2595], 19736[-2805] (73845) 520894[F], 19731[-1222], 520867[-1253], 19735[-2595], 520866[- 43981
ANKRD43 (134548) &
638694[3449], 29178[F]
Ankrd43 (237761 )
616916[F], 616918[F], 655936[F] 655938[F], 655939[F], 655940[F],
655945[F], 655949[F], 655951[F] 655952[F], 655953[F], 655954[F],
655955[F], 655956[F], 655957[F] 655958[F], 655959[F], 655960[F], 616915[F], 616917[F], 655937[F], 655941[F], 655942[F], 655943[F], 655961 [F], 655962[F], 655963[F] 655964[F], 655965[F], 655966[F], 655944[F], 655946[F], 655947[F], 655948[F], 655950[F], 655970[F], 655967[F], 655968[F], 655969[F] 655971 [F], 655972[F], 655974[F], 655973[F], 655975[F], 655977[F], 655979[F], 655983[F], 655986[F], 655976[F], 655978[F], 655980[F] 655981 [F], 655982[F], 655984[F], 655987[F], 655988[F], 655990[F], 655992[F], 655993[F], 655995[F], 655985[F], 655989[F], 655991[F] 655994[F], 616918(27072], 655996[F], 616917[27072], 652[F], 654[F], 55822[F], 55826[F],
ANKRD44 655956[-372], 653[F], 655[F], 55821[F], 55823[F], 55824[F], 55827[F], 55828[F], 55829[F], 55830[F], 55831 [F], 55832[F],
(91526) & 55825[F], 55833[F], 55840[F], 55841 [F], 55844[F], 55847[F], 55834[F], 55835[F], 55836[F], 55837[F], 55838[F], 55839[F],
Ankrd44 55848[F], 55850[F], 55851 [F], 55853[F], 55854[F], 55855[F], 55842[F], 55843[F], 55845[F], 55846[F], 55849[F], 55852[F],
(329154) 55856[F], 55857[F], 55858[F], 55859[F], 55860[F], 55861 [F], 55863[F], 55867[F], 55868[F], 55869[F], 55873[F], 55877[F],
55862[F], 55864[F], 55865[F], 55866[F], 55870[F], 55871 [F], 55880[F], 55881 [F], 55883[F], 55885[F], 55887[F], 55889[F],
55872[F], 55874[F], 55875[F], 55876[F], 55878[F], 55879[F], 55890[F], 55894[F], 55895[F], 55897[F], 55905[F], 55906[F],
55882[F], 55884[F], 55886[F], 55888[F], 55891 [F], 55892[F], 55908[F], 55909[F], 55910[F], 55911[F], 55913[F], 55916[F],
55893[F], 55896[F], 55898[F], 55899[F], 55900[F], 55901 [F], 55917[F], 55919[F], 55920[F]
55902[F], 55903[F], 55904[F], 55907[F], 55912[F], 55914[F],
55915[F], 55918[F]
ANKRD45
618173[F], 666270[F], 666273[F], 666275[F], 666276[F], 666277[F], 618174[F], 666271[F], 666272[F], 666274[F], 666279[F], 77176[F],
(339416) & 666278[F], 77175[F], 77178[F], 77180[F], 77183[F], 77184[F], 77177[F], 77179[F], 77181[F], 77182[F], 77187[F], 77188[F],
Ankrd45 77185[F], 77186[F], 77189[F], 77191[F], 2254(25129] 77190[F], 77192[F], 2255(25129]
(73844) ANKRD46
645166[F], 735124[F], 735123[-792], 37883[F], 227680[F], 227679[- (157567) &
645165[F], 37882[F], 227681[F]
660], 227678[-2524] Ankrd46
(68839) ANKRD49
634353[F], 893874[F], 893877[F], 634355[-119], 893879[-675],
634354[F], 893875[F], 893876[F], 893878[F], 893873[-4], 23609[F], (54851) &
893880[-793], 893881 [-1264], 23608[F], 567575[F], 567578[-972], 567576[F], 567577[F], 567574[-84], 567579[-1351] Ankrd49
23610[-1688], 567580[-2121], 567581[-2205], 567582[-2586]
(56503) ANKRD5
620734[F], 795721[F], 5376[F], 350986[F], 350988[F], 350990[F], 620735[F], 5377[F], 350987[F], 350989[F], 350984[-3858], 3509911 (63926) & 350985[-727] 4884] Ankrd5
(319196)
803681 [F], 803682[F], 803683[F], 803684[F], 803685[F], 803686[F],
ANKRD50 803688[F], 803689[F], 803690[F], 803693[F], 621885(47678], 803680[F], 803687[F], 803691[F], 803692[F], 621884[47678],
(57182) & 6897[F], 369631 [F], 369632[F], 369633[F], 369634[F], 369635[F], 6896[F], 369630[F], 369638[F], 369642[F], 369644[F], 369649[F],
Ankrd50 369636[F], 369637[F], 369639[F], 369640[F], 369641 [F], 369643[F], 369650[F]
(99696) 369645[F], 369646[F], 369647[F], 369648[F], 369651 [F] TABLE 2 - Page 72 of 1873
637986[F], 681913[F], 681914[F], 681915[F], 681918[F], 681921 [F],
681922[F], 681923[F], 681924[F], 681925[F], 681926[F], 681929[F], 637987[F], 681916[F], 681917[F], 681919[F], 681920[F], 681927[F],
ANKRD52 681930[F], 681933[F], 681936[F], 681937[F], 681938[F], 637988[ 4 1] 681928[F], 681931[F], 681932[F], 681934[F], 681935[F],
(283373) & 681939[-49 4 ], 28282[F], 111017[F], 111018[F], 111019[F], 637989[41], 681940[-1221], 28283[F], 111020[F], 111021[F],
Ankrd52 111022[F], 111025[F], 111026[F], 111027[F], 111028[F], 111029[F], 111023[F], 111024[F], 111031[F], 111032[F], 111035[F], 111036[F],
(237615) 111030[F], 111033[F], 111034[F], 111037[F], 111040[-331], 111041 [ ■ 111038[-68], 111039[-277], 28285[-1923], 111044[-3137]
593], 111042[-736], 28284[-1923], 111043[-2487]
ANKRD53
628889[F], 855132[F], 855134[F], 855135[F], 628891 [-438], 855136[- (79998) &
1575], 16096[F], 483087[F], 483089[F], 483090[F], 16098[-553], 628890[F], 855133[F], 16097[F], 483088[F], 16095[-3593]
Ankrd53 483091[-1566], 16094[-3593], 483086[-3690]
(75305) ANKRD54
645662[F], 38568[F], 235218[F], 235219[F], 38569[-1800], 38567[- (129138) & 1916], 235220[-2770], 235217[-3726] Ankrd54
(223690)
643451[F], 721318[F], 721319[F], 721321[F], 721322[F], 721325[F],
643450[F], 721320[F], 721323[F], 721324[F], 721326[F], 721328[F], 721327[F], 721330[F], 643449[133590], 35369[F], 35371 [F], ANKRD55 721329[F], 643448(133590], 35368[F], 35370[F], 195700[F], 195699[F], 195701[F], 195702[F], 195703[F], 195706[F], 195707[F], (79722) & 195704[F], 195705[F], 195708[F], 195709[F], 195713[F], 195715[F], 195710[F], 195711[F], 195712[F], 195714[F], 195717[F], 195720[F], Ankrd55 195716[F], 195718[F], 195719[F], 35370[-742], 195713[-4510] 195721[F], 195722[F], 195723[F], 35371 [-742], 195712[-4454], (77318)
195714[- 4 880]
ANKRD56
626815[F], 626817[F], 839276[F], 932182[-1155], 932183[-2416],
626816[F], 626818[F], 839274[F], 839275[F], 13290[F], 447322[F], (345079) &
8392771-3155], 839278[-4416], 13289[F], 447324[F], 13291[304],
447323[F], 13292(304] Ankrd56
447325[-2607], 447326[-3910]
(78088) ANKRD57
636868[F], 674454[F], 674456[F], 674457[48], 636866[-127], 636869[F], 674453[F], 674455[F], 636867[-127], 26826[F], 94386[F]
(65124) & 26825[F], 94385[F], 94387[F], 94389[F], 94390[F], 26823[1761], 94388[F], 26824[1761], 94384[-2583], 94383[-2652], 94382[-2814],
Ankrd57 94380[-3091] 94381 [-2904], 94379[-3143], 94378[-3637]
(268301) ANKRD58
651285[F], 909223[F], 933010(222], 909222 [-1778], 45932[F], 933009[-1573], 909221 [-3573], 45933[F], 599034[-3375], 599031[- (347454) & 45934[F], 599033[F], 599032[-2238] 3698], 599030[-4473] Ankrd58
(245381 )
623746[F], 815575[F], 815576[F], 815577[F], 815578[F], 815583[F]
815584[F], 815585[F], 815586[F], 815589[F], 815590[F], 815591 [F]
815592[F], 815593[F], 815594[F], 815595[F], 815596[F], 815598[F]
815600[F], 815601[F], 815604[F], 815606[F], 815607[F], 815608[F]
623745[F], 815579[F], 815580[F], 815581[F], 815582[F] 815587[F], 815609[F], 815610[F], 815613[F], 815614[F], 815615[F], 815617[F]
815588[F], 815597[F], 815599[F], 815602[F], 815603[F] 1, 815605[F], 815618[F], 815620[F], 815621[F], 815623[F], 815625[F], 815626[F]
815612[F], 815616[F], 815619[F], 815622[F], 815624[F]], 815627[F], 815600[-1765], 815601 [-1976], 815604[-2631], 9245[F], 394764[F],
815602[-2661], 815603[-3040], 815605[-3052], 9244[F] , 394766[F], 394765[F], 394768[F], 394769[F], 394773[F], 394777[F], 394779[F] ANKRD6
394767[F], 394770[F], 394771 [F], 394772[F], 394774[F] ], 394775[F], 394780[F], 394781[F], 394782[F], 394783[F], 394785[F], 394787[F] (22881) &
394776[F], 394778[F], 394784[F], 394786[F], 394798[F] ], 394801 [F], 394788[F], 394789[F], 394790[F], 394791 [F], 394792[F], 394793[F]
394802[F], 394803[F], 394805[F], 394806[F], 394809[F] 394810[F], 394794[F], 394795[F], 394796[F], 394797[F], 394799[F], 394800[F] I, Ankrd6
394812[F], 394814[F], 394818[F], 394819[F], 394825[F] 394828[F], 394804[F], 394807[F], 394808[F], 394811[F], 394813[F], 394815[F] I, (140577)
394830[F], 394836[F], 394839[F], 394844[F], 394846[F] I, 394847[F], 394816[F], 394817[F], 394820[F], 394821 [F], 394822[F], 394823[F]
394849[F], 394852[F], 394854[F], 394855[F], 394857[F]
394824[F], 394826[F], 394827[F], 394829[F], 394831 [F], 394832[F] I, 394860[F],
394862[F], 394863[F]
394833[F], 394834[F], 394835[F], 394837[F], 394838[F], 39 4 840[F]
394841 [F], 394842[F], 394843[F], 394845[F], 394848[F], 394850[F]
394851 [F], 394853[F], 394856[F], 394858[F], 394859[F], 394861 [F]
394840[-382], 394841[-509], 394842[-2132]
ANKRD60
621441[F], 800864[F], 800866[-565], 800867[-2327], 6250[F],
621440[F], 800865[F], 800868[-3659], 6249[F], 361194[F], (140731) & 361193[F], 361195[F], 361196[F], 6252[-760], 361198[-1246],
361197[F], 6251 [-760], 361194[-852] Ankrd60 361193[-1485]
(70065) ANKRD63
620348[-1467], 620346[-3956], 4919[-888], 4917[-1079], 345787[- (10013124
620349[-1467], 620347[-3956], 4920[-888], 4918[- 1079]
4033] 4) &
Gm1337 ANKRD65 (441869) &
11845[F], 430403[-1994], 430402[-3326], 430401[-3568] 831737[F], 932089[2598], 11846[F], 430404[F], 430405[-3376]
E230028L1 ORik ANKRD7 (56311 ) &
628143[F], 15133[F], 469344[F]
Ankrd7 (75196) ANKRD9 (122416) &
641958[-4379], 33203[-2957] 641957[-4379], 33202[-2957]
Ankrd9 (74251) TABLE 2 - Page 73 of 1873
647926[F], 647928[F], 755827[F], 755828[F], 755830[F], 755832[F],
755834[F], 755835[F], 755836[F], 755838[F], 755839[F], 755840[F],
755841 [F], 755842[F], 755843[F], 755844[F], 755846[F], 755848[F],
755851 [F], 755852[F], 755853[F], 755854[F], 755855[F], 755857[F],
755858[F], 755859[F], 755861[F], 755863[F], 755864[F], 755866[F], 647927[F], 755829[F] 755831 [F], 755833[F], 755837[F] 755845[F], 755868[F], 755875[F], 755877[F], 755878[F], 755879[F], 755880[F], 755847[F], 755849[F] 755850[F], 755856[F], 755860[F] 755862[F], 755881 [F], 755882[F], 647925[1378], 755826[-685], 41548[F], 755865[F], 755867[F] 755869[F], 755870[F], 755871 [F] 755872[F],
41550[F], 271777[F], 271779[F], 271780[F], 271781 [F], 271783[F], 755873[F], 755874[F] 755876[F], 41549[F], 271778[F] 271782[F], ANKS1A 271784[F], 271787[F], 271790[F], 271792[F], 271793[F], 271794[F], 271785[F], 271786[F] 271788[F], 271789[F], 271791 [F] 271795[F], (23294) & 271796[F], 271797[F], 271799[F], 271802[F], 271804[F], 271805[F], 271798[F], 271800[F] 271801 [F], 271803[F], 271806[F] 271812[F], Anksl 271807[F], 271808[F], 271809[F], 271810[F], 271811 [F], 271813[F], 271818[F], 271819[F] 271820[F], 271822[F], 271825[F] 271826[F], (224650) 271814[F], 271815[F], 271816[F], 271817[F], 271821 [F], 271823[F], 271827[F], 271832[F] 271837[F], 271842[F], 271844[F] 271848[F], 271824[F], 271828[F], 271829[F], 271830[F], 271831 [F], 271833[F], 271850[F], 271851 [F] 271853[F], 271854[F], 271855[F] 271856[F], 271834[F], 271835[F], 271836[F], 271838[F], 271839[F], 271840[F], 271857[F], 271859[F] 271861 [F], 271863[F], 415521-1161]
271841[F], 271843[F], 271845[F], 271846[F], 271847[F], 271849[F],
271852[F], 271858[F], 271860[F], 271862[F], 271864[F], 271865[F],
271866[F], 271867[F], 271868[F], 271869[F], 41547[899], 271776[- 1108], 415511-1161], 271775[-2363], 271774[-3127]
637493[F], 637496[F], 678619[F], 678620[F], 678621 [F], 678623[F] 637494[F], 637497[F], 678622[F], 678632(F], 678635[F], 678636[F], 678624[F], 678625[F], 678626[F], 678627[F], 678628[F], 678629[F] 678640[F], 678641[F], 678644[F], 678648[F], 678657[F], 678659[F], 678630[F], 678631[F], 678633[F], 678634[F], 678637[F], 678638[F] 678660[F], 678662[F], 678665[F], 678666[F], 678668[F], 678669[F], 678639[F], 678642[F], 678643[F], 678645[F], 678646[F], 678647[F] 678670[F], 678671[F], 678674[F], 678675[F], 678681 [F], 678682[F], 678649[F], 678650[F], 678655[F], 678656[F], 678658[F], 678661 [F] 678683[F], 678687[F], 678688[F], 678692[F], 678693[F], 678696[F], 678663[F], 678664[F], 678667[F], 678672[F], 678673[F], 678676[F] 678697[F], 678698[F], 678699[F], 678702[F], 678703[F], 678704[F], 678677[F], 678678[F], 678679[F], 678680[F], 678684[F], 678685[F] 678705[F], 678706[F], 678708[F], 678709[F], 678710[F], 678712[F], 678686[F], 678689[F], 678690[F], 678691 [F], 678694[F], 678695[F] 678713[F], 678715[F], 678716[F], 678718[F], 678719[F], 678724[F], 678700[F], 678701[F], 678707[F], 678711[F], 678714[F], 678717[F] 678725[F], 678728[F], 678729[F], 678735[F], 678738[F], 678739[F], 678720[F], 678721[F], 678722[F], 678723[F], 678727[F], 678730[F] 678741[F], 678742[F], 6787 4 8[F], 6787 4 9[F], 678750[F], 678751[F], 678731 [F], 678732[F], 678733[F], 678734[F], 678736[F], 678737[F] 678752[F], 678758[F], 678759[F], 678763[F], 678764[F], 678765[F], 678740[F], 678743[F], 678744[F], 678745[F], 678746[F], 678747[F] 678767[F], 678770[F], 678771 [F], 678772[F], 678774[F], 678776[F], 678753[F], 678754[F], 678755[F], 678756[F], 678757[F], 678760[F] 678777[F], 637494(1241657], 637497(91071], 637492(1635],
678761 [F], 678762[F], 678766[F], 678768[F], 678769[F], 678773[F] 637499(643], 678738[-1773], 678779[-2297], 678780[-3512],
678775[F], 678778[F], 637493(1241657], 637496(91071], 6787811-3751], 27638[F], 103823[F], 103825[F], 103826[F], ANKS1B 637491(1635], 637498(643], 678691[-1600], 678690[-1949], 678689[ -103835[F], 103836[F], 103838[F], 103839[F], 103853[F], 103856[F], (56899) & 3691], 27637[F], 27639[F], 103824[F], 103827[F], 103828[F], 103857[F], 103860[F], 103861[F], 103862[F], 103863[F], 103866[F], Ankslb 103829[F], 103830[F], 103831[F], 103832[F], 103833[F], 103834[F] 103867[F], 103879[F], 103881[F], 103882[F], 103883[F], 103884[F], (77531) 103837[F], 103840[F], 103841[F], 103842[F], 103843[F], 103844[F] 103885[F], 103888[F], 103891[F], 103892[F], 103893[F], 103894[F], 103845[F], 103846[F], 103847[F], 103848[F], 103849[F], 103850[F] 103897[F], 103898[F], 103900[F], 103907[F], 103915[F], 103917[F], 103851[F], 103852[F], 103854[F], 103855[F], 103858[F], 103859[F] 103918[F], 103921[F], 103923[F], 103927[F], 103928[F], 103929[F], 103864[F], 103865[F], 103868[F], 103869[F], 103870[F], 103871[F] 103930[F], 103931[F], 103932[F], 103934[F], 103936[F], 103939[F], 103872[F], 103873[F], 103874[F], 103875[F], 103876[F], 103877[F] 103941[F], 103944[F], 103945[F], 103952[F], 103953[F], 103954[F], 103878[F], 103880[F], 103886[F], 103887[F], 103889[F], 103890[F] 103955[F], 103956[F], 103957[F], 103958[F], 103959[F], 103962[F], 103895[F], 103896[F], 103899[F], 103901[F], 103902[F], 103903[F] 103964[F], 103965[F], 103966[F], 103970[F], 103973[F], 103974[F], 103904[F], 103905[F], 103906[F], 103908[F], 103909]F], 103910[F] 103976[F], 103978[F], 103980[F], 103981]F], 103982[F], 103983[F], 103911[F], 103912[F], 103913[F], 103914[F], 103916[F], 103919[F] 103984[F], 103987[F], 103988[F], 103991[F], 103998[F], 103999[F], 103920[F], 103922[F], 103924[F], 103925[F], 103926[F], 103933[F] 104000[F], 104001[F], 104002[F], 104003[F], 104004[F], 104005[F], 103935[F], 103937[F], 103938[F], 103940[F], 103942[F], 103943[F] 104006[F], 104010[F], 104012[F], 104015[F], 104016[F], 104017[F], 103946[F], 103947[F], 103948[F], 103949[F], 103950[F], 103951[F] 104021[F], 104022[F], 104026[F], 104028[F], 104029[F], 104030[F], 103960[F], 103961[F], 103963[F], 103967[F], 103968[F], 103969[F] 104031[F], 104036[F], 104039[F], 104040[F], 104042[F], 104043[F], 103971TF1. 103972iFl. 103975iFl 103977F1. 103979F1. 103985iFl 104045iFl. 104047iFl 104048rFl. 104050F1. 104051 l. 104052 1.
646365[F], 743553[F], 743555[F], 743556[F], 743558[F], 743559[F]
646364[F], 743554[F], 743557[F], 743560[F], 743563[F], 743567[F], 743561 [F], 743562[F], 743564[F], 743565[F], 743566[F], 743568[F]
932617(504], 932616(102], 646366(90], 743552[-1496], 743551[- ANKS3 743569[F], 646367[90], 646363[-2275], 743550[-2686], 39405[F],
1898], 646362[-2275], 39404[F], 244571[F], 244572[F], 244575[F], (124401) & 244570[F], 244573[F], 244574[F], 244576[F], 244577[F], 244578[F]
244580[F], 244584[F], 244588[F], 244591 [F], 244592[F], 244593[F], Anks3 244579[F], 244581[F], 244582[F], 244583[F], 244585[F], 244586[F]
244596[F], 244597[F], 244598[-4], 39406[-50], 39400[-381], 244569| (72615) 244587[F], 244589[F], 244590[F], 244594[F], 244595[F], 39407[-50],
1168], 244568[-1490], 39402[-1785], 244599[-3342], 244566[-3686] 39401[-381], 39403[-1785], 244567[-2182]
ANKS4B
631846[F], 875912[F], 875913[F], 20328[F], 527777[F], 527778[F], (257629) &
20330[-2662], 527779[-4631]
20329[-2662] Anks 4 b
(72074) ANKS6
624009[F], 817177[F], 817178[F], 817182[F], 817176[-121], 9600[F], 624008[F], 817179[F], 817180[F], 817181[F], 817183[F], 817184[F],
(203286) & 398845[F], 398846[F], 398848[F], 398849[F], 398850[F], 398855[F], 9599[F], 398847[F], 398851 [F], 398852[F], 398853[F], 398854[F],
Anks6 398856[F], 398857[F], 9598[-4906] 398858[F], 398859[F], 398860[F], 398861 [F]
(75691) ANKUB1
622041[F], 804627[F], 804628[F], 804630[F], 7111[F], 371729[F],
622040[F], 804629[F], 7110[F], 371733[F], 371738[F], 371739[F], (389161) & 371730[F], 371731[F], 371732[F], 371734[F], 371735[F], 371736[F],
371740[F] Gm410 371737[F], 371741[F]
(242037) A KZF1
617244[F], 658450[F], 658451[F], 658452[F], 658453[F], 658454[F],
617245[F], 658449[F], 617245(6888], 617247(1919], 1053[F], (55139) & 658455[F], 617244(6888], 617246(1919], 1052[F], 60652[F],
60651[F], 1055(1845], 60658[-1212] Ankzfl 60653[F], 60654[F], 60655[F], 60656[F], 60657[F], 1054(1845]
(52231) TABLE 2 - Page 74 of 1873
894585[F], 894586[F], 894590[F], 89459 4 [F], 894595[F], 894596[F],
894597[F], 894598[F], 894599[F], 894600[F], 894601 [F], 894602[F],
916416[F], 922832[1774], 894584[-226], 23819[F], 569203[F],
634499[F], 894587[F], 894588[F], 894589[F], 894591 [F], 894592[F], 569204[F], 569205[F], 569206[F], 569209[F], 569213[F], 569214[F], A LN
894593[F], 23818[F], 569207[F], 569208[F], 569210[F], 569211[F], 569215[F], 569216[F], 569220[F], 569221[F], 569224[F], 569226[F], (54443) &
569212[F], 569217[F], 569218[F], 569219[F], 569222[F], 569223[F], 569228[F], 569229[F], 569230[F], 569232[F], 569236[F], 569237[F], Anln
569225[F], 569227[F], 569231 [F], 569233[F], 569234[F], 569235[F], 569240[F], 569241[F], 569242[F], 569243[F], 569245[F], 569247[F], (68743)
569238[F], 569239[F], 569244[F], 569246[F], 569254[F], 569256[F] 569248[F], 569249[F], 569250[F], 569251 [F], 569252[F], 569253[F],
569255[F], 569257[F], 569258[F], 23817[-522], 569202[-811],
569201 [-969]
632438[F], 879421[F], 879422[F], 879423[F], 879424[F], 879425[F], 879426[F], 879430[F], 879431 [F], 879433[F], 879434[F], 879438[F],
632439[F], 879420[F], 879427[F], 879428[F], 879429[F], 879432[F],
879440[F], 879441[F], 879443[F], 920684[F], 920686(1237],
879435[F], 879436[F], 879437[F], 879439[F], 879442[F], 920683[F],
879445[-763], 920684[-2616], 879443[-4616], 21044[F], 534490[F], 920685[1810], 920687(1029], 920683[642], 879444[-190], 879446]- AN01
534491[F], 534492[F], 534493[F], 534496[F], 534497[F], 534498[F], 971], 879442[-1358], 21045[F], 534489[F], 534494[F], 534495[F], (55107) &
534502[F], 534503[F], 534504[F], 534505[F], 534506[F], 534507[F], 534499[F], 534500[F], 534501[F], 534510[F], 534512[F], 534515[F], Ano1
534508[F], 534509[F], 534511[F], 534513[F], 534514[F], 534519[F], 534516[F], 534517[F], 534518[F], 534520[F], 534522[F], 534525[F], (101772)
534521[F], 534523[F], 534524[F], 534526[F], 534528[F], 534530[F], 534527[F], 534529[F], 534533[F], 534534[F], 534539[F], 534540[F],
534531[F], 534532[F], 534535[F], 534536[F], 534537[F], 534538[F], 534544[F], 534550[-2974]
534541[F], 534542[F], 534543[F], 534545[F], 534546[F], 534547[F], 534548[-73], 534549[-2253], 21046[-3519], 534551[-3726]
636242[F], 907575[F], 907578[F], 907580[F], 907581 [F], 907582[F],
907583[F], 907584[F], 907585[F], 907587[F], 907589[F], 907591 [F],
907592[F], 907593[F], 907594[F], 907595[F], 907596[F], 907597[F],
636241[F], 907576[F], 907577[F], 907579[F], 907586[F], 907588[F], 907598[F], 918324(2001], 907574(1], 25986[F], 594485[F], ANO10
907590[F], 25985[F], 594486[F], 594487[F], 594489[F], 594490[F], 594488[F], 594491[F], 594492[F], 594494[F], 594496[F], 594497[F], (55129) &
594493[F], 594495[F], 594502[F], 594512[F], 594513[F], 594514[F], 594498[F], 594499[F], 594500[F], 594501 [F], 594503[F], 594504[F], Ano10
594515[F], 594518[F], 594519[F], 594521[F], 594522[F], 594523[F], 594505[F], 594506[F], 594507[F], 594508[F], 594509[F], 594510[F], (102566)
594528[F], 594529[F]
594511[F], 594516[F], 594517[F], 594520[F], 594524[F], 594525[F],
594526[F], 594527[F], 594530[F], 594531 [F], 594532[F], 594533[F],
594534[F], 594535[F], 594536[F], 594537[F], 594538[F], 594484[-3]
629511[F] 629513[F], 861095[F], 861099[F], 861100[F], 861101[F],
861102[F] 861103[F], 861107[F], 861108[F], 861111 [F], 861113[F],
861114[F] 861115[F], 861118[F], 861121[F], 861123[F], 861124[F], 629512[F] 629514[F], 861096[F], 861097[F], 861098[F], 861104[F], 861127[F] 861128[F], 861132[F], 861134[F], 861135[F], 861136[F], 861105[F] 861106[F], 861109[F], 861110[F], 861112[F], 861116[F], 861138[F] 861139[F], 861141[F], 861143[F], 861144[F], 861145[F], 861117[F] 861119[F], 861120[F], 861122[F], 861125[F], 861126[F], 861147[F] 861149[F], 861150[F], 861151[F], 861152[F], 861153[F], 861129[F] 861130[F], 861131[F], 861133[F], 861137[F], 861140[F], 861155[F] 861156[F], 861157[F], 861160[F], 861162[F], 861164[F], 861142[F] 861146[F], 861148[F], 861154[F], 861158[F], 861159[F], 861165[F] 861167[F], 861171[F], 861173[F], 861174[F], 861176[F], 861161[F] 861163[F], 861166[F], 861168[F], 861169[F], 861170[F], 861178[F] 629507( 2645], 629510( 2896], 861094[-4801], 16884[F], 861172[F] 861175[F], 861177[F], 629508[-2645], 16885[F],
16886[F], 494878[F], 494880[F], 494881 [F], 494887[F], 494888[F], 16887[F], 494879[F], 494882[F], 494883[F], 494884[F], 494885[F],
AN02
494889[F] 494890[F], 494891 [F], 494892[F], 494893[F], 494896[F], 494886[F] , 494895[F], 494898[F], 494899[F], 494900[F],
(57101) & 494897[F] 494906[F], 494907[F], 494908[F], 494909[F], 494910[F], 494901 [F] , 494903[F], 494904[F], 494905[F], 494912[F],
Ano2 494911[F] 494913[F], 494915[F], 494917[F], 494918[F], 494919[F], 494914[F] , 494920[F], 494921 [F], 494922[F], 494924[F],
(243634) 494923[F] 494926[F], 494928[F], 494929[F], 494931 [F], 494932[F], 494925[F] , 494930[F], 494933]F], 494934 [F], 494935[F], 494936[F] 494940[F], 494941 [F], 494943[F], 494945[F], 494947[F], 494937[F] , 494939[F], 494942[F], 494944[F], 494946[F], 494949[F] 494951 [F], 494952[F], 494953[F], 494956[F], 494957[F], 494948[F] , 494954[F], 494955[F], 494958[F], 494960[F], 494959[F] 494961 [F], 494962[F], 494963[F], 494964[F], 494965[F], 494967[F] , 494970[F], 494977[F], 494978[F], 494979[F], 494966[F] 494968[F], 494971 [F], 494972[F], 494973[F], 494974[F], 494980[F] , 494985[F], 494988[F], 494990[F], 494992[F], 494975[F] 494976[F], 494981 [F], 494982[F], 494983[F], 494986[F], 494994[F] , 494997[F], 495001 [F], 495002[F], 495004[F], 494987[F] 494989[F], 494991 [F], 494993[F], 494996[F], 494998[F], 495005[F] , 495009[F], 495012[F], 495016[F], 16881]- 494999[F] 495000[F], 495003[F], 495007[F], 495008[F], 495010[F], 3740]
495011[F] 495013[F], 495014[F], 495015[F], 495017[F], 16880]-
3740], 16883[-3993]
620255[F], 620257[F], 620259[F], 792405[F], 792406[F], 792408[F],
792409[F], 792412[F], 792414[F], 792415[F], 792416[F], 792417[F], 620256[F], 620258[F], 792407[F], 792410[F], 792411 [F], 792413[F], 792418[F], 620254[-3729], 4805[F], 4807[F], 344541[F], 344543[F], 620253[-3729], 4804[F], 4806[F], 344539[F], 344540[F], 344542[F], 344545[F], 344548[F], 344549[F], 344551 [F], 344554[F], 344555[F], 344544[F], 344546[F], 344547[F], 344550[F], 344552[F], 344553[F], AN03 344556[F], 344557[F], 344559[F], 344563[F], 344564[F], 344565[F], 344558[F], 344560[F], 344561 [F], 344562[F], 344570[F], 344571 [F], (63982) & 344566[F], 344567[F], 344568[F], 344569[F], 344574[F], 344576[F], 344572[F], 344573[F], 344575[F], 344583[F], 344585[F], 344587[F], Ano3 344577[F], 344578[F], 344579[F], 344580[F], 344581 [F], 344582[F], 344588[F], 344589[F], 344590[F], 344591 [F], 344594[F], 344595[F], (228432) 344584[F], 344586[F], 344592[F], 344593[F], 344596[F], 344597[F], 344598[F], 344599[F], 344600[F], 344605[F], 4804(267401],
344601 [F], 344602[F], 344603[F], 344604[F], 344606[F], 3445401-201], 344539[-930]
4805[267401], 4803(3366], 344538[-21] TABLE 2 - Page 75 of 1873
637470[F] 637472[F], 678511[F], 678512[F], 678514[F], 678515[F],
678516[F] , 678517[F], 678518[F], 678519[F], 678520[F], 678525[F],
637469[F], 637471 [F], 678510[F], 678513[F], 678521 [F], 678522[F], 678527[F] , 678528[F], 678529[F], 678530[F], 678532[F], 678533[F],
678523[F], 678524[F], 678526[F], 678531 [F], 678536[F], 678537[F], 678534[F] 678535[F], 678538[F], 678539[F], 678541 [F], 678542[F],
678540[F], 678544[F], 678546[F], 838403[F], 637473(696],
678543[F] 678545[F], 637474[696], 678547[- 1372], 27612[F],
27611[F], 27613[F], 103593[F], 103595[F], 103596[F], 103597[F], AN04 27614[F]. 103594[F], 103598[F], 103600[F], 103603[F], 103604[F],
103599[F], 103601[F], 103602[F], 103607[F], 103608[F], 103609[F], (121601) & 103605[F] , 103606[F], 103610[F], 103612[F] 103613[F], 103614[F],
103611[F], 103616[F], 103618[F], 103620[F], 103621 [F], 103622[F], Anc 103615[F] 103617[F], 103619[F], 103623[F] 103624[F], 103627[F],
103625[F], 103626[F], 103628[F], 103629[F], 103632[F], 103633[F], (320091 ) 103630[F] 103631 [F], 103635[F], 103637[F] 103638[F], 103640[F],
103634[F], 103636[F], 103639[F], 103642[F], 103646[F], 103648[F], 103641 [F] , 103643[F], 103644[F], 103645[F] 103647[F], 103649[F],
103650[F], 103651[F], 103656[F], 103660[F], 103664[F], 103666[F], 103652[F] , 103653[F], 103654[F], 103655[F] 103657[F], 103658[F],
103670[F], 27615[637], 103672(22]
103659[F] 103661 [F], 103662[F], 103663[F] 103665[F], 103667[F],
103668[F] 103669[F], 103671[F], 27616[637] 103673[-1517]
AN05
630958[F], 869443[F], 19183[F], 514026[F], 514030[F], 514032[F], 630959[F], 869441[F], 869442[F], 869444[F], 19184[F], 514027[F], (203859) & 514033[F], 514034[F], 514035[F], 514037[F] 514028[F], 514029[F], 514031[F], 514036[F], 514038[F], 514039[F] Ano5
(233246)
646031[F], 646034[F], 741337[F], 741338[F], 741339[F], 741340[F], 741341[F], 741342[F], 741343[F], 741344[F], 741345[F], 741346[F], 741347[F], 741348[F], 741349[F], 741350[F], 741351 [F], 741352[F], 741353[F], 741354[F], 741355[F], 741356[F], 741357[F], 741358[F], 741359[F], 741360[F], 741361[F], 741362[F], 741363[F], 741364[F], 741365[F], 741366[F], 741367[F], 741368[F], 741369[F], 741370[F], 741371[F], 646031[216369], 646034(216259], 646030(1683],
39015[F], 240617[F], 240618[F], 240619[F], 240620[F], 240621 [F],
AN06 240622[F], 240623[F], 240624[F], 240625[F], 240626[F], 240627[F],
646032[F], 646033[F], 646033(216259], 39016[F], 39017(2012], (196527) ί
240628[F], 240629[F], 240630[F], 240631 [F], 240632[F], 240633[F], 240678[-2314], 240679[-2417] Ano6
240634[F], 240635[F], 240636[F], 240637[F], 240638[F], 240639[F],
(105722) 240640[F], 240641[F], 240642[F], 240643[F], 240644[F], 240645[F], 240646[F], 240647[F], 240648[F], 240649[F], 240650[F], 240651 [F], 240652[F], 240653[F], 240654[F], 240655[F], 240656[F], 240657[F], 240658[F], 240659[F], 240660[F], 240661 [F], 240662[F], 240663[F], 240664[F], 240665[F], 240666[F], 240667[F], 240668[F], 240669[F], 240670[F], 240671[F], 240672[F], 240673[F], 240674[F], 240675[F], 240676[F], 39018(2012], 39014(801], 240677[-1510], 240680[- 4025], 240681 [-4180]
617537[F], 660968[F], 660969[F], 660970[F], 660971 [F], 660973[F],
617537(7570], 924046[-270], 924048[-336], 924051[-737], 924052]- 617538[F], 660972[F], 660974[F], 617538(7570], 924045[-154],
1090], 924053[-1304], 924055[-2052], 660976[-2270], 660978[-2336].924047[-312], 924049[-578], 924050[-729], 924054[-1781], 660975]-
AN07
660981 [-2737], 924056[-2751], 925518[-2825], 660968[-2882], 2154], 660977[-2312], 660979[-2578], 660980[-2729], 924057[- (50636) & 660982[-3090], 660983[-3304], 660985[-4052], 660986[-4751], 2857], 924058[-3478], 660984[-3781], 660987[-4857], 1421 [F],
Ano7 660967[-4825], 1420[F], 66016[F], 66017[F], 66018[F], 66020[F], 66014[F], 66015[F], 66019[F], 66021[F], 66024[F], 66025[F],
(404545) 66022[F], 66023[F], 66027[F], 66028[F], 66030[F], 1422[-2427], 66026[F], 66029[F], 66031[F], 1423[-2427], 66032[-2657], 66034[- 66033[-2774], 66035[-2839], 66038[-3164], 66039[-3585], 66040[- 2815], 66036[-3004], 66037[-3154], 1419[-4106], 66041[-4205]
3758], 1418[-4106], 66042[-4505]
633244[F], 633242[75], 931393[-2047], 931391 [-2693], 885207[ AN08
633243[75], 931392[-1171], 885206[-3171], 22208[410], 22211[- 4047], 693409[-4693], 22209[F], 548812[F], 548813[F], 548814[F], (57719) & 1817], 548815[-2995], 548817[-4571] 22207[410], 548811[-729], 22210[-1817], 548816[-3697], 548818[- Ano8
4766] (382014)
AN09
632315[-484], 878854[-858], 878853[-2183], 878851 [-3185], 878850[-878855[F], 878856[F], 878857[F], 632316(24067], 632314[-484],
(338440) &
3391], 20900[-629], 533375[-937], 533374[-2233], 533373[-2989], 878852[-3022], 20901[F], 533376[F], 533377[F], 533378[F],
Ano9 533372[-3932], 533370[-4682], 533369[-4743], 533368[-4907] 533379[F], 20899[-629], 533371[-4508]
(71345)
635258[F], 899738[F], 899739[F], 899740[F], 899741 [F], 899742[F],
899743[F], 899744[F], 899745[F], 899746[F], 899747[F], 899748[F],
899749[F], 899750[F], 899751[F], 899752[F], 899753[F], 899754[F], ANP32A 635261 [42027], 635260[2708], 24725[F], 578534[F], 578535[F], (8125) &
635259[F], 24723[-4685]
578536[F], 578537[F], 578538[F], 578539[F], 578540[F], 578541 [F], Anp32a 578542[F], 578543[F], 578544[F], 578545[F], 578546[F], 578547[F], (11737) 578548[F], 578549[F], 578550[F], 578551 [F], 578552[F], 578553[F],
24724[2706], 24722[-4685]
ANP32A-
635258[F], 635261[F], 899743[-3621], 899742[-4418] 635259[F]
IT1 TABLE 2 - Page 76 of 1873
623997[F], 817023[F], 817024[F], 817025[F], 817028[F], 817029[F],
817030[F], 817031[F], 817032[F], 817033[F], 817034[F], 817035[F],
817037[F], 817038[F], 817039[F], 817041[F], 817043[F], 817045[F],
817046[F], 817047[F], 817048[F], 817049[F], 817051 [F], 623998[F], 817021[F], 817022[F], 817026[F], 817027[F], 817036[F],
ANP32B 925495(1927], 925494(987], 817020[-73], 817019[-1013], 9586[F], 817040[F], 817042[F], 817044[F], 817050[F], 9587[F], 398578[F],
(10541) & 398579[F], 398580[F], 398581[F], 398584[F], 398585[F], 398586[F], 398582[F], 398583[F], 398592[F], 398593[F], 398597[F], 398602[F],
Anp32b 398587[F], 398588[F], 398589[F], 398590[F], 398591 [F], 398594[F], 398607[F], 398609[F], 398611[F], 398616[F], 398620[F],
(67628) 398595[F], 398596[F], 398598[F], 398599[F], 398600[F], 398601 [F], 398577[33], 398574[-3014], 398573[-4611]
398603[F], 398604[F], 398605[F], 398606[F], 398608[F], 398610[F],
398612[F], 398613[F], 398614[F], 398615[F], 398617[F], 398618[F],
398619[F], 398621[F], 398576[-235], 398575[-1096]
625485[F], 829310[F], 829311[F], 829312[F], 829313[F], 829309[30], ANP32BP1
618001[F], 664626[F], 934032[F], 877871[-304]
664627[-60], 829314[-196], 664628[-218 (646791)
ANP32C 9172071-4400]
(23520)
685568[F], 685569[F], 934492[F], 934493[F], 934496[F], 909571]- ANP32D
934495[F], 909570[-123]
908] (23519)
ANP32E
622653[F], 808414[F], 808415[F], 808416[F], 808417[F], 7887[F],
(81611) & 379252[F], 379253[F], 379254[F], 379255[F], 379256[F], 379257[F],
Anp32e 379258[F], 379259[F]
(66471)
631190[F], 871137[F], 871138[F], 871140[F], 871145[F], 871146[F],
871147[F], 871151[F], 871152[F], 871153[F], 871154[F], 871155[F], 631189[F], 871139[F], 871141[F], 871142[F], 871143[F], 871144[F], ANPEP 19508[F], 518182[F], 518183[F], 518185[F], 518186[F], 518190[F], 871148[F], 871149[F], 871150[F], 19507[F], 518184[F], 518187[F], (290) & 518191[F], 518193[F], 518194[F], 518195[F], 518199[F], 518200[F], 518188[F], 518189[F], 518192[F], 518196[F], 518197[F], 518198[F], Anpep 518201[F], 518202[F], 518203[-236], 518204[-3411], 518205[-3508], 518209[-4916] (16790) 518206[-3622], 518207 [-3728], 518208[-4084]
628965[F], 855826[F], 855827[F], 855828[F], 855829[F], 855831 [F]
855832[F], 855833[F], 855834[F], 855836[F], 855837[F], 855838[F]
855839[F], 855842[F], 855844[F], 855846[F], 855848[F], 855849[F]
628964[F], 855830[F], 855835[F], 855840[F], 855841 [F], 855843[F], 855850[F], 855851[F], 855853[F], 855854[F], 855856[F], 855857[F]
855845[F], 855847[F], 855852[F], 855855[F], 855858[F], 855859[F], 855862[F], 855863[F], 855865[F], 855866[F], 855867[F], 855868[F]
855860[F], 855861[F], 855864[F], 855874[F], 855875[F], 855876[F], 855869[F], 855870[F], 855871[F], 855872[F], 855873[F], 855878[F]
855877[F], 855880[F], 855881 [F], 855883[F], 855884[F], 855886[F], 855879[F], 855882[F], 855885[F], 855889[F], 855891 [F], 855893[F]
855887[F], 855888[F], 855890[F], 855892[F], 855894[F], 855898[F], 855895[F], 855896[F], 855897[F], 855901 [F], 855902[F], 855904[F]
855899[F], 855900[F], 855903[F], 628964[236028], 855855[-680],
855905[F], 855906[F], 628965[236028], 855854[-3083], 16199[F],
16198[F], 484477[F], 484482[F], 484487[F], 484488]F], 484491[F], ANTXR1 84473[F], 484474[F], 484475[F], 484476[F], 484478]F], 484479[F]
484492[F], 484495[F], 484497[F], 484501 [F], 484502[F], 484506[F], (84168) & 484480[F], 484481[F], 484483[F], 484484[F], 484485[F], 484486[F]
484509[F], 484510[F], 484511[F], 484512[F], 484513[F], 484514[F], Antxrl 484489[F], 484490[F], 484493[F], 484494[F], 484496[F], 484498[F]
484516[F], 484518[F], 484519[F], 484520[F], 484521 [F], 484522[F], (69538) 484499[F], 484500[F], 484503[F], 484504[F], 484505[F], 484507[F]
484523[F], 484526[F], 484528[F], 484529[F], 484542[F], 484543[F], 484508[F], 484515[F], 484517[F], 484524[F], 484525[F], 484527[F]
484544[F], 484545[F], 484548[F], 484549[F], 484550[F], 484556[F], 484530[F], 484531[F], 484532[F], 484533[F], 484534[F], 484535[F]
484557[F], 484559[F], 484561 [F], 484562[F], 484563[F], 484565[F], 484536[F], 484537[F], 484538[F], 484539[F], 484540[F], 484541 [F]
484567[F], 484569[F], 484571 [F], 484573[F], 484574[F], 484576[F], 484546[F], 484547[F], 484551[F], 484552[F], 484553[F], 484554[F]
484579[F], 484580[F], 484581 [F], 484582[F], 484583[F], 484586[F], 484555[F], 484558[F], 484560[F], 484564[F], 484566[F], 484568[F]
484588[F], 484590[F]
484570[F], 484572[F], 484575[F], 484577[F], 484578[F], 484584[F]
484585[F], 484587[F], 484589[F], 484591 [F], 484592[F], 484593[F]
484594[F], 484595[F], 484596[F]
626855[F], 626856[F], 839552[F], 839553[F], 839554[F], 839556[F], 626854[F], 839555[F], 839557[F], 839559[F], 839561 [F], 839562[F], 839558[F], 839560[F], 839566[F], 839568[F], 839569[F], 839570[F], 839563[F], 839564[F], 839565[F], 839567[F], 839572[F], 839573[F],
ANTXR2 839571[F], 626855(169779], 13407[F], 44 8229[F], 448230[F], 626854(169779], 13406[F], 44 8232[F], 448234[F], 448235[F],
(118429) & 44 8231[F], 448233[F], 448236[F], 448239[F], 4482 4 0[F], 44 8243[F], 448237[F], 448238[F], 448241 [F], 448242[F], 44 8244[F], 448245[F],
Antxr2 44 8248[F], 448251[F], 448252[F], 448253[F], 448256[F], 44 8257[F], 448246[F], 448247[F], 448249[F], 448250[F], 44 8254[F], 448255IF],
(71914) 44 8258[F], 448263[F], 448269[F], 448270[F], 448271 [F], 13408]- 448259[F], 448260[F], 448261 [F], 448262[F], 44 8264[F], 448265IF], 392], 4 48275[-761] 448266[F], 448267[F], 448268[F], 448272[F], 448273[F], 448274[F]
ANXA1
623978[F], 650397[F], 775032[F], 775033[F], 775034[F], 775035[F],
(301) & 775036[F], 775037[F], 775038[F], 909265[F], 44698[F], 310750[F], 623979[F], 650396[F], 775039[F], 44697[F], 310757[F]
Anxal 310751[F], 310752[F], 310753[F], 310754[F], 310755[F], 310756[F]
(16952) ANXA10
884304[F], 633090(95205], 22005[F], 546255[F], 5 4 6257[F], 884303[F], 633089[95205], 884302[-6], 22004[F], 546254[F], (11199) & 546258[F], 546261[F], 546262[F], 546263[F], 546264[F] 546256[F], 546259[F], 546260[F], 546253[-66] Anxal 0
(26359) TABLE 2 - Page 77 of 1873
723999[F], 724000[F], 724001[F], 724002[F], 724003[F], 724009[F],
643710[F], 724004[F], 724005[F], 724006[F], 724007[F], 724008[F], 724011[F], 724012[F], 724015[F], 724016[F], 724032[F], 916528[F],
724010[F], 724013[F], 724014[F], 35841 [F], 35846[F], 202900[F], ANXA11 643709[1173], 35840[F], 202893[F], 202894[F], 202895[F],
202902[F], 202909[F], 202910[F], 202911[F], 202913[F], 202914[F], (311) & 202896[F], 202897[F], 202898[F], 202899[F], 202901 [F], 202903[F],
202915[F], 202916[F], 202918[F], 202919[F], 202921 [F], 202923[F], Anxa11 202904[F], 202905[F], 202906[F], 202907[F], 202908[F], 202912[F],
202927[F], 202928[F], 202929[F], 35848[-702], 202892[-991], (11744) 202917[F], 202920[F], 202922[F], 202924[F], 202925[F], 202926[F],
2029321-1565], 202933[-3956], 202934[-4782]
202930[F], 202931[F], 35845[937], 35847[-702], 202891 [-4423]
ANXA13
645342[F], 736503[F], 736504[F], 645340[8154], 230793[F], 645341[F], 736505[F], 736506[F], 736507[F], 736508[F], 736509[F],
(312) & 230794[F], 230795[F], 230801[F], 230805[F], 38127[40549], 230796[F], 230797[F], 230798[F], 230799[F], 230800[F], 230802[F],
Anxa13 38125[6889] 230803[F], 230804[F], 230806[F], 38126(40549]
(69787)
901334[F], 901336[F], 901337[F], 901340[F], 901341 [F], 901342[F],
901343[F], 901345[F], 901347[F], 901349[F], 901350[F], 901351[F],
901335[F], 901338[F], 901339[F], 901344[F], 901346[F], 901348[F], ANXA2 901352[F], 901353[F], 901354[F], 901355[F], 635392(50662],
901356[F], 635393(50662], 24886[F], 581401[F], 581404[F], (302) & 24885[F], 581400[F], 581402[F], 581403[F], 581406[F], 581407[F],
581405[F], 581408[F], 581411[F], 581413[F], 581416[F], 581426[F], Anxa2 581409[F], 581410[F], 581412[F], 581414[F], 581415[F], 581417[F],
24887[-2635], 581399[-3296] (12306) 581418[F], 581419[F], 581420[F], 581421[F], 581422[F], 581423[F],
581424[F], 581425[F]
ANXA2P1
622275[F], 622277[F], 806048[-775] 622276[F], 622278[F], 806047[-2236]
(303)
ANXA2P3 9332731-1571], 675457[-3571]
(305)
626839[F], 839496[F], 839497[F], 839499[F], 839500[F], ANXA3
839494[F], 839495[F], 839498[F], 626837[58860], 13382[F],
626838(58860] , 13383[F], 448091 [F], 448092[F], 448093[F], (306) & 448086[F], 448087[F], 448088[F], 448089[F], 448090[F], 448094[F],
448096[F], 448097[F], 13384[-319], 448099[-1268], 448100[-1479], Anxa3 448095[F], 448098[F]
448101[-2890], 448102[-3452], 13385[-3535], 448103[-3755] (11 45)
628959[F], 855713[F], 855714[F], 855715[F], 855716[F], 855718[F],
855719[F], 855720[F], 855721[F], 855722[F], 855723[F], 628957]-
3221], 8557101-3225], 855709[-3299], 855708[-3832], 855707[-4024].628958[F], 855711[F], 855712[F], 855717[F], 16191[F], 484249[F], ANXA4 8557061-4788], 16192[F], 484250[F], 484254[F], 484255[F], 484251[F], 484252[F], 484253[F], 484259[F], 484260[F], 484263[F], (307) &
484256[F], 484257[F], 484258[F], 484261 [F], 484262[F], 484264[F], 484269[F], 484270[F], 484272[F], 484274[F], 484275[F], 484276[F], Anxa4 484265[F], 484266[F], 484267[F], 484268[F], 484271 [F], 484273[F], 484277[F], 484278[F], 484279[F] (11746) 484280[F], 484281[F], 16190[-3455], 484248[-3515], 484247[-3582],
484246[-4183], 484245 [-4342], 484244[-4685]
621845[F], 803488[F], 803489[F], 803490[F], 803491 [F], 803492[F],
ANXA5 803493[F], 803494[F], 803495[F], 803498[F], 621843(28306],
621844[F], 803496[F], 803497[F], 621842(28306], 6842[F], (308) & 6843[F], 369221 [F], 369222[F], 369223[F], 369224[F], 369225[F],
369229[F], 369231[F], 369232[F], 369234[F], 369235[F], 6844[-48] Anxa5 369226[F], 369227[F], 369228[F], 369230[F], 369233[F], 6845[-48],
(11747) 369236[-820l, 369237[-4240
638734[F], 638735[F], 687901[F], 687902[F], 687904[F], 687906[F],
687907[F], 687908[F], 687911[F], 687912[F], 687914[F], 687917[F], 638733[F], 687900[F], 687903[F], 687905[F], 687909[F], 687910[F],
ANXA6 687918[F], 687919[F], 638734(40727], 687917[-1711], 687918]- 687913[F], 687915[F], 687916[F], 687920[F], 638733(40727],
(309) & 1873], 29231[F], 29232[F], 122869[F], 122870[F], 122874[F], 687916[-1554], 29230[F], 122868[F], 122871[F], 122872[F],
Anxa6 122875[F], 122877[F], 122878[F], 122879[F], 122880[F], 122883[F], 122873[F], 122876[F], 122881 [F], 122882[F], 122885[F], 122886[F],
(11 49) 122884[F], 122888[F], 122889[F], 122892[F], 122893[F], 122894[F], 122887[F], 122890[F], 122891 [F], 122898[F], 122900[F]
122895[F], 122896[F], 122897[F], 122899[F]
643637[F], 723087[F], 723089[F], 723090[F], 723091 [F], 723092[F], ANXA7
643636[F], 723088[F], 924811(1835], 723096[-165], 35758[F],
723093[F], 723094[F], 723095[F], 35759[F], 201257[F], 201259[F], (310) &
201258[F], 201260[F], 201265[F], 201271[F], 201273[F], 35756]- 201261[F], 201262[F], 201263[F], 201264[F], 201266[F], 201267[F], Anxa7
3037]
201268[F], 201269[F], 201270[F], 201272[F], 35757[-3037] (11750)
725403[F], 725404[F], 725405[F], 725406[F], 725408[F], 725409[F], ANXA8 725411[F], 725412[F], 643880[16034], 36049[F], 36053[F], 725407[F], 725410[F], 643881(16034], 36050[F], 36054[F], (653145) & 205688[F], 205689[F], 205690[F], 205691 [F], 205693[F], 205694[F], 205692[F], 205695[F] Anxa8 205696[F], 205697[F] (11 52)
622623[F], 808242[F], 622621[345], 808241 [-4271], 808240[-4692], ANXA9
622624[F], 622622(345], 928926[-728], 808243[-2728], 7851 [F], 808239[-4934], 7850[F], 378954[F], 378956[F], 378958[F], (8416) & 378955[F], 378957[F], 7849[725], 378953[-2825], 378960[-4473] 7848[725], 378959[-3141], 378952[-3414], 378951 [-3693], 378950[- Anxa9
3926] (71790)
642214[F], 713258[F], 713263[F], 713264[F], 713265[F], 713266[F],
713270[F], 713271[F], 713272[F], 713273[F], 713275[F], 713276[F],
642215[F], 713256[F] 713257[F], 713259[F], 713260[F], 713261 [F], 713277[F], 918591[-452], 918590[-705], 713278[-2452], 713255[- 713262[F], 713267[F] 713268[F], 713269[F], 713274[F], 33599[F], 2705], 33598[F], 175211[F], 175212[F], 175215[F], 175216[F], AOAH
175208[F], 175209[F] 175210[F], 175213[F], 175214[F], 175218[F], 175217[F], 175222[F], 175223[F], 175225[F], 175230[F], 175231[F], (313) &
175219[F], 175220[F] 175221 [F], 175224[F], 175226[F], 175227[F], 175232[F], 175233[F], 175234[F], 175235[F], 175236[F], 175237[F], Aoa
175228[F], 175229[F] 175243[F], 175244[F], 175245[F], 175247[F], 175238[F], 175239[F], 175240[F], 175241[F], 175242[F], 175246[F], (27052)
175248[F], 175249[F] 175250[F], 175253[F], 175255[F], 175262[F], 175251[F], 175252[F], 175254[F], 175256[F], 175257[F], 175258[F],
175263[F], 33595(5845]
175259[F], 175260[F], 175261[F], 175264[F], 175265[F], 175266[F],
175267[F], 33594(5845], 175207[-2710], 175268[-4917] TABLE 2 - Page 78 of 1873
640103[-476], 640102[-1342], 697284[-1630], 697282[-2015],
640101[-1342], 697286[-1342], 697285[-1518], 697283[-1777], 697280[-2282], 697287[-2361], 697278[-2428], 697275[-2661], AOC2 697281 [-2189], 697279[-2273], 697277[-2 4 64], 697276[-2639],
97289[-2978], 30810[-909], 30809[-1524], 139168[- (314) & 139170[-1524], 30808[-1524], 139169[-1682], 139167[-1934], 697288[-2830], 6
1800], 139166[-2178], 139164[-2443], 139162[-2602], 139159[- Aoc2 1391651-2357], 139163[-2434], 139161 [-2640], 139160[-2811],
2833], 139171[-2913], 139172[-3343], 139173[-3479], 139174[- (237940) 139158[-4606]
4207], 139175[-4403]
AOC3
640103[F], 697287[F], 697288[F], 697289[F], 697290[F], 697291 [F],
(8639) & 30810[F], 139171[F], 139172[F], 139173[F], 139174[F], 139175[F], Aoc3 139176[F], 139177[F], 139178[-4159]
(11754)
656286[F], 656287[F], 656289[F], 656291 [F], 656292[F], 656293[F],
656294[F], 656295[F], 656296[F], 656299[F], 656300[F], 656301 [F],
656284[F], 656285[F], 656288[F], 656290[F], 656297[F], 656298[F], AOX1 656302[F], 616956(84961], 616954[-1912], 656283[-3618], 703[F],
616957(84961], 616955[-1912], 704[F], 56448[F], 56449[F], (316) & 56447[F], 56453[F], 56454[F], 56455[F], 56456[F], 56458[F],
56450[F], 56451[F], 56452[F], 56457[F], 56461[F], 56463[F], Aox1 56459[F], 56460[F], 56462[F], 56464[F], 56465[F], 56467[F],
56466[F], 56472[F], 56473[F], 56474[F], 702[-3688], 56446[-3945] (11761) 56468[F], 56469[F], 56470[F], 56471 [F], 56475[F], 56476[F],
56477[F], 56478[F], 56479[F], 56480[F], 701 [-3688], 56445[-4483]
616958[F], 656305[F], 656306[F], 656307[F], 656309[F], 656310[F], 616959[F], 656308[F], 656312[F], 656313[F], 921175[68], 921174[- AOX2P 656311[F], 656314[F], 656315[F 30], 656304]- 1932], 656303[-2030; (344454)
623144[F], 811685[F], 811686[F], 811687[F], 811688[F], 811689[F],
AP1AR 623142[27843], 811684[-696], 8474[F], 385613[F], 385614[F], 623143[F], 794348[F], 811690[F], 623141(27843], 8473[F],
(55435) & 385616[F], 385619[F], 385620[F], 385621[F], 385622[F], 385624[F], 385615[F], 385617[F], 385618[F], 385623[F], 385626[F], 385628[F],
Aplar 385625[F], 385627[F], 385629[F], 385631[F], 8472(24872], 385612[- 385630[F], 385632[F], 8471(24872]
(211556) 1175], 38561K-1497]
638115[F], 638117[F], 682903[F], 682905[F], 682907[F], 682910[F], 638116[F], 638118[F], 682904[F], 682906[F], 682908[F], 682909[F], 682911[F], 682913[F], 682914[F], 682915[F], 682917[F], 682918[F], 682912[F], 682916[F], 682920[F], 682921 [F], 682923[F], 682925[F], 682919[F], 682922[F], 682924[F], 682928[F], 28432[F], 28434[F], 682926[F], 682927[F], 28433[F], 28435[F], 112811[F], 112813[F], 112809[F], 112810[F], 112812[F], 112814[F], 112815[F], 112816[F], AP1 B1
112821 [F], 112822[F], 112823[F], 112826[F], 112827[F], 112828[F],
(162) & 112817[F], 112818[F], 112819[F], 112820[F], 112824[F], 112825[F], 112829[F], 112831 [F], 112832[F], 112833[F], 112834[F], 112836[F], 112830[F], 112835[F], 112837[F], 112838[F], 112839]F], 112841 [F], 112840[F], 112842[F], Ap1 b1
112844[F], 112845[F], 112846[F], 112849[F],
(11764) 112843[F], 112847[F], 112848[F], 112854[F], 112855[F], 112858[F], 112850[F], 112851 [F], 112852[F], 112853[F], 112856[F], 112857[F], 112859[F], 112860[F], 112863[F], 112864[F], 112865[F], 112866[F], 112861 [F], 112862[F], 112867[F], 112868[F], 112870[F], 112872[F], 112869[F], 112871[F], 112875[F], 112835[-1751] 112873[F], 112874[F], 1128361-154], 112834[-2893]
633896[F], 890138[F], 890139[F], 890141[F], 890142[F], 890143[F],
890144[F], 890145[F], 890146[F], 890148[F], 890149[F], 890150[F],
890151[F], 890152[F], 890153[F], 890154[F], 890155[F], 890157[F],
890159[F], 890160[F], 890162[F], 890165[F], 890166[F], 890167[F],
890168[F], 890169[F], 890170[F], 890172[F], 890173[F], 890174[F],
890175[F], 890176[F], 633898(4234], 921956(1873], 890137[-127], 633897[F], 890140[F], 890147[F], 890156[F], 890158[F], 890161 [F], 890177[-2222], 23004[F], 558756[F], 558758[F], 558760[F], 890163[F], 890164[F], 890171 [F], 633899(4234], 921955(1793],
AP1 G1 558761 [F], 558762[F], 558763[F], 558765[F], 558766[F], 558767[F], 890136[-207], 23005[F], 558757[F], 558759[F], 558764[F],
(164) & 558769[F], 558770[F], 558771[F], 558772[F], 558773[F], 558774[F], 558768[F], 558778[F], 558783[F], 558784[F], 558786[F], 558790[F], 558775[F], 558776[F], 558777[F], 558779[F], 558780[F], 558781 [F], 558796[F], 558801[F], 558804[F], 558807[F], 558810[F], 558811 [F], Ap1g1
(11765) 558782[F], 558785[F], 558787[F], 558788[F], 558789[F], 558791 [F], 558815[F], 558818[F], 558821 [F], 23007(4220], 558754( 161],
558792[F], 558793[F], 558794[F], 558795[F], 558797[F], 558798[F], 23009[-4332]
558799[F], 558800[F], 558802[F], 558803[F], 558805[F], 558806[F],
558808[F], 558809[F], 558812[F], 558813[F], 558814[F], 558816[F],
558817[F], 558819[F], 558820[F], 558822[F], 558823[F], 558824[F],
558825[F], 558826[F], 23006(4220], 558755[-119], 558827 [-1730],
23008[-4332]
727165[F], 727166[F], 727167[F], 727171[F], 644172(8342],
727164[F], 727168[F], 727169[F], 727170[F], 727172[F], 727173[F], 644168[455], 727174[-291], 727161[-680], 727175[-931], 727176[-
AP1 G2 644173[8342], 644169(455], 727163[-410], 727162[-615], 727160[- 1271], 727177[-2250], 727159[-2282], 727178[-2701], 727158[- (8906) & 1746], 727157[-3531], 36578[F], 210320[F], 210321[F], 210325[F], 3133], 36577[F], 210322[F], 210323[F], 210324[F], 210328[F],
Ap1g2 210326[F], 210327[F], 210329[F], 36574(475], 210330[-122], 210319| 36573(475], 210331[-571], 210332[-1138], 210317[-1295], 210333[- (11766) 1039], 2103181-1239], 210316[-2245], 210313[-4038], 210336[-4251] 1438], 210334[-2418], 210335[-2538], 210315[-2862], 210314[-
3649], 2103371-4453]
AP1M1
916387[F], 22264[-2949], 549263[-3775] 633280[F], 885372[F], 22263[F], 549258[F], 549259[F], 549260[F], (8907) &
549261 [F], 549262[F]
Ap1m1
AP1M2
634454[F], 894342[F], 894343[F], 23752[F], 23756[F], 568609[F],
634455[F], 699740[F], 634453[-3525], 23753[F], 23757[F], (10053) & 568607[F], 568608[F], 568612[F], 568615[-1699], 23755[-4036] 568610[F], 568611[F], 568613[F], 568614[F], 568606[-116], 568616|
Ap1m2 2029]
(11768)
AP1S1
627640[F], 845375[F], 845376[F], 845377[F], 845378[F], 627638[- 627639[F], 845379[F], 845380[F], 627637[-1065], 845373[-2428],
(1174) & 1065], 845374[-2183], 14465[F], 461660[F], 461661 [F], 461662[F], 14464[F], 461663[F], 461664[F], 461667[F], 461668[F], 461669[F],
Ap1s1 461665[F], 461666[F], 14463[-1274], 461659[-2612] 14462[-1274], 461658[-2860] (11769)
rtr I o
925481 [-922], 823231 [-2922] 916624[-2546], 823232[-2879] TABLE 2 - Page 79 of 1873
658802[F], 658806[F], 658807[F], 658808[F], 658811 [F], 658815[F], 617770[F], 658803[F], 658804[F], 658805[F], 658809[F], 658810[F], AP1S3 617303[82258], 1117[F], 61316[F], 61320[F], 61321 [F], 61322[F], 658812[F], 658813[F], 658814[F], 617302(82258], 1116[F], (1303 4 0) & 61327[F], 61328[F], 61329[F], 61330[F], 61331[F], 61332[F], 61317[F], 61318[F], 61319[F], 61323[F], 61324[F], 61325[F], Ap1s3 61336[F] 61326[F], 61333[F], 61334[F], 61335[F], 61337[F] (252903)
630779[F], 868346[F], 868349[F], 868352[F], 868355[F], 868356[F]
630778[F], 868347[F], 868348[F], 868350[F], 868351 [F], 868353[F], 868357[F], 868360[F], 868361[F], 868362[F], 868363[F], 868364[F]
868354[F], 868358[F], 868359[F], 630776(3825], 868345[-247], AP2A1 630777(3825], 924704(1952], 868365[-48], 868344[-495], 630781]-
630780[-3664], 630775[-4129], 18940[F], 512032[F], 512033[F], (160) & 3664], 868366[-3756], 18941[F], 512031[F], 512034[F], 512037[F],
512035[F], 512036[F], 512038[F], 512039[F], 512043[F], 512044[F], Ap2a1 512040[F], 512041[F], 512042[F], 512046[F], 512047[F], 512048[F]
512045[F], 512050[F], 18938[2465], 18942[-134], 512030[-225], (11771) 512049[F], 512051[F], 512052[F], 512053[F], 512054[F], 512055[F]
18937[-2272], 512028[-3746], 512027[-4172]
18939(2465], 512056[-92], 18943[-134], 512029[-372], 512057[-2769]
632357[F], 836396[F], 836398[F], 878968[F], 878969[F], 878973[F],
878974[F], 878975[F], 878976[F], 878977[F], 878978[F], 878980[F],
878981 [F], 878983[F], 878984[F], 878985[F], 878986[F], 878987[F],
632360[-949], 878989[-3857], 878990[-4275], 878991 [-4617],
632358[F], 632359[F], 836397[F], 878967[F], 878979[F], 878982[F], 878992[-4733], 878995[-4772], 878996[-4879], 20943[F], 533584[F],
632361[-949], 878988[-1295], 878994[-4556], 20944[F], 20945[F], AP2A2 533585[F], 533587[F], 533588[F], 533591 [F], 533593[F], 533594[F],
533586[F], 533589[F], 533590[F], 533592[F], 533597[F], 533600[F], (161 ) & 533595[F], 533596[F], 533598[F], 533599[F], 533602[F], 533603[F],
533601[F], 533606[F], 533608[F], 533612[F], 533613[F], 533617[F], Ap2a2 533604[F], 533605[F], 533607[F], 533609[F], 533610[F], 533611[F],
533621[F], 533625[F], 533628[F], 533631[F], 533632[F], 20947[- (11772) 533614[F], 533615[F], 533616[F], 533618[F], 533619[F], 533620[F],
798], 533639[-1122]
533622[F], 533623[F], 533624[F], 533626[F], 533627[F], 533629[F],
533630[F], 533633[F], 533634[F], 533635[F], 533636[F], 533637[F],
533638[F], 20946[-798], 533640[-3630], 533641 [-3825], 533642[- 4155], 533643[-4272], 533644[-4754]
639542[F], 693526[F], 693527[F], 693528[F], 693529[F], 693530[F],
693532[F], 693533[F], 693534[F], 693536[F], 693537[F], 693538[F],
693540[F], 693541[F], 693542[F], 693543[F], 693544[F], 693546[F],
693547[F], 693548[F], 693549[F], 693550[F], 693551 [F], 693553[F],
639543[F], 693524[F], 693525[F], 693531 [F], 693535[F], 693539[F], 693555[F], 693557[F], 693558[F], 639541 [-89], 639544[-4758],
693545[F], 693552[F], 693554[F], 693556[F], 639545 [-4758], AP2B1 30186[F], 132837[F], 132838[F], 132841[F], 132843[F], 132844[F],
30187[F], 132836[F], 132839[F], 132840[F], 132842[F], 132845[F], (163) & 132847[F], 132851[F], 132852[F], 132853[F], 132855[F], 132856[F],
132846[F], 132848[F], 132849[F], 132850[F], 132854[F], 132859[F], Ap2b1 132857[F], 132858[F], 132860[F], 132861[F], 132862[F], 132863[F],
132864[F], 132871[F], 132873[F], 132879[F], 132880[F], 132885[F], (71770) 132865[F], 132866[F], 132867[F], 132868[F], 132869[F], 132870[F],
132888[F], 132891[F], 30189[-4102]
132872[F], 132874[F], 132875[F], 132876[F], 132877[F], 132878[F],
132881[F], 132882[F], 132883[F], 132884[F], 132886[F], 132887[F],
132889[F], 132890[F], 132892[F], 132893[F], 30185[-109], 132835[- 3454], 132834[-3967]. 30188[-4102]
646621 [F], 745448[F], 745449[F], 745450[F], 745451 [F], 745452[F], 745453[F], 745454[F], 745455[F], 745456[F], 745457[F], 745458[F], 745459[F], 777273[F], 777274[F], 777275[F], 786574[F], 786577[F],
650646[F], 777272[F], 777276[F], 777277[F], 777278[F], 777279[F],
786579[F], 786581 [F], 786583[F], 786584[F], 786586[F], 786590[F], 777280[F], 777281[F], 777282[F], 786575[F], 786576[F], 786578[F], AP2M1
885442[F], 885443[F], 885444[F], 885445[F], 885446[F], 646618[- 786580[F], 786582[F], 786585[F], 786587[F], 786588[F], 786589[F], (1173) &
1319], 745462[-1849], 646623[-2026], 6 4 6620[-3211], 7 4 5 4 47[- 930031 [4939], 930032(2458], 930030[2455], 930033(2392], Ap2m1
3701], 745446[-4010], 39730[F], 249189[F], 249190[F], 249191 [F], 930034(2149], 930029(2052], 646622[-2026], 745463[-2722], (11773)
249192[F], 249193[F], 249194[F], 249195[F], 249196[F], 249197[F], 646619[-3211], 745464[-4236], 39728[-2933], 39731[-4522]
249198[F], 249199[F], 249200[F], 249201[-1242], 249202[-1331],
39729[-2933], 249188| -3602], 249187[-3916], 249203[-4346],
397321-4522]
AP2S1
630084[F], 864902[F], 864903[F], 17876[F], 504181[F], 504183[F],
630085[F], 17877[F], 504182[F], 504184[F] (1175) & 504185[F]
Ap2s1
TABLE 2 - Page 80 of 1873
719189[F; 719190[F; 719191[F] 719193[F; , 719195[F]
719197[F; 719198[F; 719199[F; 719201 [F; , 719205[F]
719207[F 719208[F; 719209[F; 719210[F; , 719211[F]
719213[F; 719214[F 719218[F 719219[F; , 719221 [F]
719224[F 719225[F 719227[F 719228[F " , 719229[F]
719232[F 719234[F 719235[F 719236[F; , 719237[F]
719239[F 719240[F 719241[F 719242[F " , 719243[F]
719245[F 719246[F 719248[F 719249[F; , 719250[F]
719252[F 719253[F 719254[F 719255[F " , 719256[F]
719259[F 719260[F 719262[F 719264[F; , 719265[F]
719267[F 719268[F 719269[F 719270[F " , 719271 [F] 643198[F], 719188[F] 719192[F], 719194[F] 719200[F], 719202[F], 719273[F 719274[F 719275[F 719276[F; , 719277[F] 719203[F], 719204[F] 719215[F], 719216[F] 719217[F], 719220[F], 719279[F 35052[F], I91498[F] 91499[F] 191501[F], 719222[F], 719226[F] 719231[F], 719233[F] 719247[F], 719257[F], 191504[F; 191505[F; 191507[F; 191508[F; , 191509[F] 719261[F], 719263[F] 643196[-49], 719187[- 2341], 35053[F],
191511[F 191512[F; 191513[F; 191517[F; , 191521[F] 191496[F], 191497[F] 191500[F], 191503[F] 191506[F], 191514[F], AP3B1 191523[F; 191524[F; 191526[F; 191527[F; , 191529[F] 191515[F], 191516[F] 191518[F], 191519[F] 191520[F], 191525[F], (8546) & 191531[F 191532[F; 191533[F; 191534[F; , 191535[F] 191528[F], 191536[F] 191537[F], 191545[F] 191546[F], 191548[F], Ap3b1 191539[F; 191540[F; 191541 [F; 191542[F; , 191543[F] 191549[F], 191552[F] 191553[F], 191556[F] 191569[F], 191573[F], (11774) 191547[F " 191550[F 191551 [F 191554[F " , 191555[F] 191575[F], 191578[F] 191588[F], 191594[F] 191597[F], 191601[F], 191558[F; 191559[F 191560[F 191561 [F; , 191562[F] 191603[F], 191607[F] 191611[F], 191617[F] 191618[F], 191620[F], 191564[F " 191565[F 191566[F 191567[F " , 191568[F] 191627[F], 191630[F] 191632[F], 191640[F] 35051 [-35], 191495[- 191571[F 191572[F 191574[F 191576[F; , 191577[F] 2149]
191580[F " 191581[F 191582[F 191583[F " , 191584[F]
191586[F; 191587[F 191589[F 191590[F; , 191591[F]
191593[F " 191595[F 191596[F 191598[F " , 191599[F]
191602[F; 191604[F 191605[F 191606[F; , 191608[F]
191610[F " 191612[F 191613[F 191614[F " , 191615[F]
191619[F; 191621[F 191622[F 191623[F; , 191624[F]
191626[F; 191628[F; 191629[F; 191631 [F; , 191633[F]
191635[F; 191636[F; 191637[F; 191638[F; , 191639[F]
191642[F; 191643[F; 191644[F; 191645[F; , 191646[F]
191648rF " 1 649iF 1 1650F 191651 [F " . 191R52iF
631235[F], 871578[F], 871579[F], 871584[F], 871585[F], 871586[F],
871576[F; 871577[F 871580[F , 871581 [F; , 871582[F], AP3B2
871587[F], 871590[F], 631237[-588], 19560[F], 519011 [F],
871588[F; 871589[F 19561[F] 519009[F] 519010[F], (8120) &
519012[F], 519014[F], 519019[F], 519020[F], 519021 [F], 519022[F], 519015[F; 519016[F; 519017[F; , 519018[F; , 519023[F], Ap3b2
519024[F], 519025[F], 519026[F], 519029[F], 519030[F], 19562[- 519028[F 519031[F; 19559[-4932] (11775)
347], 519032[-2542], 19558[-4932]
AP3D1
637280[F], 677223[F], 677224[F], 677225[F], 637278[-4723],
(8943) &
637279[-4723], 27357[-4999] 27358[F], 100874[F], 100875[F], 100876[F], 100877[F], 100878[F],
Ap3d1 100879[F], 100880[F], 100881 [F], 27356[-4999]
(11776) AP3M1
643659[F], 723265[F], 643660[-116], 723266[-313], 35781[F],
677527[F], 677528[F], 677529[F], 677530[F], 925773[F], 925774[F], (26985) &
201531[F], 201532[F], 201533[F], 35782[-130], 201534[-297],
925775[F], 925776[F], 643661[-116], 35783[-130], 201536[-2714] Ap3m1
201535[-2486]
(55946)
632677[F], 881176[F], 881177[F], 881178[F], 881179[F], 881180[F], 632676[F], 881181[F], 881182[F], 881183[F], 632674[-4015], AP3M2 632675[-4015], 881172 [-4723], 21440[F], 539679[F], 539680[F], 881175[-4250], 881174[-4341], 881173[-4671], 881171 [-4926], (10947) & 539681 [F], 539682[F], 539683[F], 539684[F], 539685[F], 539688[F], 21439[F], 539686[F], 539687[F], 539691 [F], 21437[-4495], 539678[- Ap3m2 539689[F], 539690[F], 21438[-4495 4703], 539677[-4794] (64933)
649431 [F], 767956[F], 767957[F], 767958[F], 767960[F], 767963[F],
649432[F], 649433[F], 767959[F], 767961 [F], 767962[F], 43491 [F], AP3S1 767964[F], 767965[F], 767966[F], 767967[F], 649430[-59], 43490[F],
43492[F], 296909[F], 296913[F], 296915[F], 296916[F], 296917[F], (1176) & 296907[F], 296908[F], 296910[F], 296911[F], 296912[F], 296914[F],
296918[F], 296919[F], 296920[F], 296921[F], 296922[F], 296924[F], Ap3s1 296923[F], 296925[F], 296927[F], 296928[F], 296929[F], 296930[F],
296926[F] (11777) 296931 [F], 43489[-76]
631192[F], 871156[F], 871158[F], 871161[F], 871162[F], 871163[F],
871165[F], 871166[F], 871167[F], 871168[F], 871169[F], 871173[F], 631191[F], 871157[F], 871159[F], 871160[F], 871164[F], 871170[F],
AP3S2 871174[F], 871175[F], 19510[F], 518215[F], 518217[F], 518220[F], 871171[F], 871172[F], 19509[F], 518216[F], 518218[F], 518219[F],
(10239) & 518221[F], 518222[F], 518225[F], 518226[F], 518228[F], 518229[F], 518223[F], 518224[F], 518227[F], 518232[F], 518237[F], 518238[F],
Ap3s2 518230[F], 518231[F], 518233[F], 518234[F], 518235[F], 518236[F], 518241[F], 518242[F], 518243[F], 518247[F], 518248[F], 19511[- (11778) 518239[F], 518240[F], 518244[F], 518245[F], 518246[F], 518249[F], 4717], 518254[-4757]
518250[F], 518251[F], 518252[F], 518253[F], 19512[-4717]
AP4B1
622827[-130], 622828[-1331], 809591[-1360], 8098[F], 381382[F],
809592[F], 929823[3551], 622826[-130], 8097[F], 381383[F], (10717) &
381384[F], 381385[F], 8095[-71], 381388[-153], 8096[-1075],
381386[F], 381387[F], 8094[-71] Ap4b1
381381 [-1105]
(67489)
620544[F], 794417[F], 794418[F], 794419[F], 794423[F], 794424[F],
794425[F], 794426[F], 921215[2019], 794427[19], 5140[F], 620545[F], 794420[F], 794421 [F], 794422[F], 5141 [F], 348396[F], AP4E1 348395[F], 348400[F], 348404[F], 348408[F], 348409[F], 348411[F], 348397[F], 348398[F], 348399[F], 348401 [F], 348402[F], 348403[F], (23431) & 348412[F], 348413[F], 348414[F], 348415[F], 348417[F], 348421[F], 348405[F], 348406[F], 348407[F], 348410[F], 348416[F], 348418[F], Ap4e1 348422[F], 348423[F], 348424[F], 348425[F], 348426[F], 348427[F], 348419[F], 348420[F], 348429[F], 5143[-838] (108011) 348428[F], 5142[-838], 348430[-4304] TABLE 2 - Page 81 of 1873
627704[F], 845681[F], 627703[459], 647113[-128], 845680[-192], 845679[-280], 845677[-480], 845676[-941], 845675[-1034], 845674]- 1339], 845673[-1385], 845672[-1412], 749782[-1421], 845671 ]- 1464], 845670[-1743], 749783[-2104], 845669[-2106], 845668]- 2302], 749784[-2360], 845667[-2444], 749785[-2454], 749786]- 2870], 845666[-2872], 749787[-3249], 845665[-3251], 749788]-
627702[459], 845678[-351 ], 845664[-3316], 14545(414], 462160[- 3561], 845663[-3571], 749789[-3760], 845662[-3775], 749790]- 407], 462145[-3638]
3840], 845661 [-3843], 14547[F], 462163[F], 14546(414], 462162]-
(11781)
244], 462161[-333], 462159[-505], 462158[-971], 462157[-1062],
462156[-1350], 462155[-1431], 462154[-1586], 462153[-1675],
462152[-2286], 462151 [-2550], 462150[-2741], 462149[-2883],
462148[-3154], 462147[-3271], 462146[-3573], 462144[-3861],
462143[-4062], 462142[-4130]
704395[F], 704396[F], 704397[F], 704398[F], 704399[F], 704400[F],
922564[F], 922565[F], 922566[F], 922567[F], 922563(3475], 704401[F], 922568[F], 641134(925], 704394[-325], 704393 [-4148], AP4S1
641133[925], 32150[F], 155936[F], 155937[F], 155938[F], 155941 [F], 32151 [F], 155939[F], 155940[F], 155945[F], 155947[F], 155948[F], (11154) & 155942[F], 155943[F], 155944[F], 155946[F], 155949[F], 155950[F], 155952[F], 155953[F], 155954[F], 155956[F], 32153(1396], 155935[- Ap4s1 155951 [F], 155955[F], 155957[F], 32152[1396], 155933[-3333], 218], 155934[-2143], 155932( 3315], 155931 ( 4391], 32155[-4775] (11782) 155958[-4232], 32154[-4775]
637499[F], 678779[F], 678780[F], 678781 [F], 678782[F], 678783[F],
678785[F], 678786[F], 678787[F], 678788[F], 678790[F], 678791 [F],
678792[F], 678793[F], 678794[F], 678795[F], 678797[F], 678800[F],
678801 [F], 678802[F], 678803[F], 637501 [-488], 637497[-1741],
678777[-2983], 27643[F], 104163[F], 104164[F], 104165[F], 637498[F], 678784[F], 678789[F], 678796[F], 678798[F], 678799[F], 104166[F], 104167[F], 104168[F], 104170[F], 104171 [F], 104172[F], 637500[-488], 637496[-1741], 678778[-2002], 27642[F], 104169[F], APAF1 104173[F], 104174[F], 104180[F], 104181 [F], , 104182[F], 104183[F], 104175[F], 104176[F], 104177[F], 104178[F], 104179[F], 104184[F], (317) & 104185[F], 104186[F], 104187[F], 104189[F], , 104190[F], 104193[F], 104188[F], 104191[F], 104192[F], 104196[F], 104197[F], 104206[F], Apafl 104194[F], 104195[F], 104198[F], 104199[F], , 104200[F], 104201 [F], 104210[F], 104218[F], 104220[F], 104226[F], 27640[-144], 27644[- (11783) 104202[F], 104203[F], 104204[F], 104205[F], , 104207[F], 104208[F], 195], 104161 [-3005]
104209[F], 104211[F], 104212[F], 104213[F], , 104214[F], 104215[F],
104216[F], 104217[F], 104219[F], 104221 [F], , 104222[F], 104223[F],
104224[F], 104225[F], 104227[F], 104228[F], 27641 [ ■ -144], 27645]- 195], 1041621-2194], 104229[-2628], 104230[-3968]
623978[F], 650443[F] 662583[F], 775391 [F] , 775392[F] 775395[F],
623979[F], 650442[F], 775393[F] 775394[F] 775396[F] , 775400[F], 775397[F], 775398[F] 775399[F], 775401 [F] , 775402[F] 775403[F], 775404[F], 775406[F], 775411[F] 775412[F] 775413[F] 775415[F], 775405[F], 775407[F] 775408[F], 775409[F] 775410[F] 775414[F], 775417[F], 775418[F], 775419[F] 775421 [F] 775423[F] 775424[F], 775416[F], 775420[F] 775422[F], 775425[F] 775428[F] 775429[F], 775426[F], 775427[F], 775431 [F] 775433[F] 775435[F] , 775439[F], 775430[F], 775432[F] 775434[F], 775436[F] , 775437[F] 775438[F],
APBA1 775440[F], 775442[F], 44750[F], 31 1582[F] 31 1584[F], 311585[F], 775441 [F], 775443[F] 775444[F], 44751 [F], 311581 [F] 311583[F],
(320) & 311586[F], 311589[F], 311590[F] 311592[F] 311594[F] 311595[F], 31 1587[F], 311588[F] 311591 [F], 311593[F] 311596[F] 311602[F],
Apbal 311597[F], 311598[F], 311599[F] 311600[F] 311601 [F] 311603[F], 31 1604[F], 311605[F] 311606[F], 311607[F] 311608[F] 311609[F],
(319924) 311610[F], 311613[F], 311620[F] 311621 [F] 311622[F] , 311624[F], 31 1611[F], 311612[F] 311614[F], 311615[F] , 311616[F] 311617[F], 311626[F], 311627[F], 311629[F] 311631 [F] 311633[F] , 311634[F], 31 1618[F], 311619[F] 311623[F], 311625[F] , 311628[F] 311630[F], 311636[F], 311638[F], 311640[F] 311646[F] 311648[F] 311650[F], 31 1632[F], 311635[F] 311637[F], 311639[F] 311641 [F] 311642[F], 311654[F], 311655[F], 311657[F] 31 1643[F], 311644[F] 311645[F], 311647[F] 311649[F] 311651 [F],
31 1652[F], 311653[F] 311656[F], 311658[F] , 311659[F]
631026[F], 869943[F], 869944[F], 869946[F], 869947[F], 869948[F],
869949[F], 869950[F], 869951[F], 869952[F], 869954[F], 869955[F],
869956[F], 869957[F], 869958[F], 869960[F], 869961 [F], 869962[F],
631027[F], 869945[F], 869953[F], 869959[F], 631029[-1938],
869963[F], 631028[-1938], 19310[F], 515793[F], 515798[F],
19311 [F], 515791[F], 515792[F], 515794[F], 515795[F], 515796[F], 515799[F], 515800[F], 515802[F], 515803[F], 515809[F], 515810[F], APBA2
515797[F], 515801[F], 515804[F], 515805[F], 515806[F], 515807[F], 515812[F], 515816[F], 515817[F], 515820[F], 515821 [F], 515823[F], (321 ) &
515808[F], 515811[F], 515813[F], 515814[F], 515815[F], 515818[F], 515826[F], 515827[F], 515828[F], 515829[F], 515830[F], 515831 [F], Apba2
515819[F], 515822[F], 515824[F], 515825[F], 515832[F], 515834[F], 515833[F], 515837[F], 515838[F], 515839[F], 515840[F], 515841 [F], (11 84)
515835[F], 515836[F], 515842[F], 515843[F], 515855[F], 515859[F], 515844[F], 515845[F], 515846[F], 515847[F], 515848[F], 515849[F],
515863[F], 19313[-2209]
515850[F], 515851[F], 515852[F], 515853[F], 515854[F], 515856[F],
515857[F], 515858[F], 515860[F], 515861 [F], 515862[F], 515864[F],
515865[F], 19312[-2209]
637317[F], 677384[F], 677385[F], 677386[F], 677387[F], 677388[F], APBA3 677389[F], 931453[-3027], 27383[F], 27400[F], 101248[F], 931452 [-3603], 27384[F], 101245[-3192], 101254[-3503], 101243]- (9546) & 101249[F], 101250[F], 101251[F], 101252[F], 101253[F], 101247]- 4360], 101255[-4610], 101242[-4623], 27399[-4803] Apba3 670], 101246[-2871], 101244[-4241], 27398[-4803] (57267) TABLE 2 - Page 82 of 1873
631618[F] 874005[F], 874006[F], 874008[F], 874010[F], 874012[F],
874013[F] 874016[F], 874017[F], 874019[F], 874020[F], 874021 [F], 631617[F], 874007[F], 874009[F], 874011[F], 874014[F], 874015[F], APBB1 87 4 023[F] 874024[F], 631616[-112], 874004[-1110], 20041 [F], 874018[F], 874022[F], 874025[F], 20040[F], 523963[F], 523965[F], (322) & 523962[F] 523964[F], 523966[F], 523968[F], 523970[F], 523971 [F], 523967[F], 523969[F], 523972[F], 523973[F], 523976[F], 523981 [F], Apbbl 523974[F] 523975[F], 523977[F], 523978[F], 523979[F], 523980[F], 523984[F] (11 85) 523982[F] 523983[F], 20039[-91], 523961[-1015]
618995[F], 782712[F], 782713[F], 782715[F], 782716[F], 782717[F],
618996[F], 782711[F], 782714[F], 782720[F], 782721 [F], 782722[F], 782718[F], 782719[F], 782723[F], 782728[F], 782729[F], 782730[F], APBB1 IP
782724[F], 782725[F], 782726[F], 782727[F], 3262[F], 326079[F],
3261 [F], 326080[F], 326081 [F], 326082[F], 326083[F], 326085[F], (54518) &
326084[F], 326087[F], 326092[F], 326093[F], 326096[F], 326097[F], 326086[F], 326088[F], 326089[F], 326090[F], 326091 [F], 326094[F], Apbbl ip
326098[F], 326103[F], 326105[F], 326106[F], 326107[F], 326108[F], 326095[F], 326099[F], 326100[F], 326101 [F], 326102[F], 326104[F], (54519)
326109[F]
326110[F], 326111[F], 326112[F], 3263[2073]
837256[F], 837257[F], 837258[F], 837259[F], 837261 [F], 837262[F],
837264[F], 837265[F], 837266[F], 837267[F], 837268[F], 837274[F],
837275[F], 837278[F], 837279[F], 837281 [F], 837282[F], 837284[F],
837285[F], 837286[F], 837287[F], 837289[F], 837290[F], 837295[F],
837299[F], 837301[F], 837302[F], 837303[F], 837308[F], 837310[F],
837311[F], 837312[F], 837314[F], 837315[F], 837316[F], 837317[F],
837323[F], 837325[F], 837326[F], 837327[F], 837328[F], 837329[F],
837260[F] 837263[F] 837269[F] 837270[F] 837271 [F], 837272[F], 837333[F], 837334[F], 837335[F], 837336[F], 837337[F], 837338[F],
837273[F]. 837276[F] 837277[F] 837283[F] 837288[F], 837291 [F], 837339[F], 837340[F], 837341 [F], 837342[F], 837344[F], 837345[F],
837292[F], 837293[F] 837294[F] 837296[F] 837297[F], 837298[F], 837347[F], 837349[F], 837350[F], 837351 [F], 837353[F], 837354[F],
837300[F]. 837304[F] 837305[F] 837306[F] 837307[F], 837309[F], 837355[F], 837356[F], 837357[F], 837360[F], 837361 [F], 837362[F],
837313[F]. 837318[F] 837319[F] 837320[F] 837321 [F], 837322[F], 837363[F], 837364[F], 837365[F], 837366[F], 837367[F], 837368[F],
837324[F]. 837330[F] 837331 [F] 837332[F] 837343[F], 837346[F], 626482[402801], 917835[2666], 626480[-41], 837255[-242], 837254[-
837348[F], 837352[F] 837358[F] 837359[F] 626481 [402801],
1702], 12882[F], 443223[F], 443224[F], 443225[F], 443227[F],
626479[-41 12881 [F] 443226[F], 443229[F] 443235[F], 443236[F] 443228[F], 443230[F], 443231[F], 443232[F], 443233[F], 443234[F] APBB2
443237[F]. 443238[F] 443239[F] 443240[F] 443241 [F], 443242[F],
443243[F] 443244[F], 443245[F] , 443249[F], 443250[F] 443252[F] (323) &
443246[F]. 443247[F] 443248[F] 443251 [F] 443254[F], 443259[F], 443253[F] 443255[F], 443256[F] , 443257[F], 443258[F] 443260[F] Apbb2
443262[F]. 443263[F] 443265[F] 443266[F] 443269[F], 443271 [F], 443261 [F] 443264[F], 443267[F] , 443268[F], 443270[F] 443272[F] (11787)
443273[F], 443274[F] 443275[F] 443276[F] 443280[F], 443281 [F], 443277[F] 443278[F], 443279[F] 443283[F], 443285[F] 443286[F]
443282[F], 443284[F] 443289[F] 443290[F] 443293[F], 443294[F], 443287[F] 443288[F], 443291 [F] 443292[F], 443295[F] 443296[F]
443297[F], 443303[F] 443304[F] 443305[F] 443306[F], 443307[F], 443298[F] 443299[F], 443300[F] 443301 [F], 443302[F] 443309[F]
443308[F] 443310[F] 443313[F] 443316[F] 443322[F], 443324[F], 443311[F] 443312[F], 443314[F] 443315[F], 443317[F] 443318[F]
443326[F]. 443327[F] 443331 [F] 443332[F] 443335[F], 443341 [F], 443319[F] 443320[F], 443321 [F] 443323[F], 443325[F] 443328[F]
443343[F]. 443344[F] 443345[F] 443346[F] 443352[F], 443358[F], 443329[F] 443330[F], 443333[F] 443334[F], 443336[F] 443337[F]
443360[F]. 443362[F] 443364[F] 443375[F] 443377[F], 443379[F], 443338[F] 443339[F], 443340[F] 443342[F], 443347[F] 443348[F]
443389[F]. 443391 [F] 443226[-285], 12879] 695], 443247[-4857]
443349[F] 443350[F], 443351 [F] 443353[F], 443354[F] 443355[F]
443356[F] 443357[F], 443359[F] 443361 [F], 443363[F] 443365[F]
443366[F] 443367[F], 443368[F] 443369[F], 443370[F] 443371 [F]
443372[F] 443373[F], 443374[F] 443376[F], 443378[F] 443380[F]
443381 [F] 443382[F], 443383[F] 443384[F], 443385[F] 443386[F]
443387[F] 443388[F], 443390[F] 443392[F], 443393[F] 443394[F]
44339f>rFl. 44339firFl. 443397iFl 44339R 1. 443399 1. 443400iFl.
649275[F], 766685[F], 766688[F], 649277(137], 626390[-1266], 649274[F], 766686[F], 766687[F], 649276(137], 649273[-769], APBB3 766689[-2342], 766690[-2717], 766692[-3241], 766693[-3505], 626389[-1266], 766691 [-2848], 836448[-2848], 43305[F], 294482[F], (10307) &
43306[F], 294481 [F], 294484[F], 43308[153], 43303[-1995], 294485[- 294483[F], 43307[153], 43304[-840], 43302[-1995], 294480[-2000], Apbb3
2552], 294486[-2904], 294488[-3428], 294489[-3692] 294479[-2387], 294487[-3035] (225372)
649202[F], 766036[F], 766037[F], 766038[F], 766039[F], 766040[F], 766041[F], 766042[F], 766043[F], 766044[F], 766045[F], 766046[F], 766047[F], 766048[F], 766049[F], 766050[F], 766051 [F], 766052[F], 649201(949], 43218[F], 293283[F], 293284[F] 293285[F],
APC (324) 293286[F], 293287[F], 293288[F], 293289[F], 293290[F], 293291 [F],
649200[949], 43216[790] & Ape
293292[F], 293293[F], 293294[F], 293295[F], 293296[F], 293297[F],
(11789) 293298[F], 293299[F], 293300[F], 293301 [F], 293302[F], 293303[F], 293304[F], 293305[F], 293306[F], 293307[F], 293308[F], 293309[F], 293310[F], 293311[F], 293312[F], 293313[F], 43217(790],
293282[10], 293281 [-4148], 293280( 4665]
637250[F], 677099[F], 677100[F], 677101 [F], 677102[F], 677104[F], 637251[F], 677103[F], 637252(44], 677106[-1871], 27321 [F], APC2 677105[F], 27320[F], 100620[F], 100621[F], 100622[F], 100624[F], 100619[F], 100623[F], 100626[F], 27322(4], 100627[-839], 100628[- (10297) & 100625[F], 100618[-937] 1148], 1006291-1927] Apc2
649625[F], 769288[F], 769289[F], 769290[F], 769291 [F], 769292[F],
769293[F], 769295[F], 769296[F], 769297[F], 769298[F], 649623[- 649626[F], 769285[F], 769286[F], 769287[F], 769294[F], 649624[- APCDD1 226], 769299[-247], 769300[-575], 769301[-641], 43732[F], 226], 769284[-1107], 43733[F], 299731 [F], 299732[F], 299733[F], (147495) & 299735[F], 299736[F], 299738[F], 299739[F], 299740[F], 299741 [F], 299734[F], 299737[F], 299742[F], 43731 [-196], 299730( 1028], Apcddl 299743[F], 299744[F], 299745[F], 299746[F], 299747(44], 43730[- 299750[-1459] (494504) 196], 299748[-292], 299749[-359], 299729[-2440]
APCDD1L
800938[F], 923201[F]
(164284) TABLE 2 - Page 83 of 1873
905426[F], 905427[F], 905428[F], 635939(9283], 635938[-422], APEH
635937[-2137], 916435[-2452], 6359 4 1[-3861], 905429[-4998], 635936[-2137], 916436[-2452], 905425[-2765], 635940[-3861], (327) & 25578[-2066], 25582[-2812], 589640[-3990] 25580[F], 589637[F], 589638[F], 589639[-74], 25579[-385], 25577]- Apeh
2066], 589636[-2712], 25581[-2812] (235606)
APEX1
644064[F], 726580[F], 726581[F], 644063[-22], 36422[F], 36423[F],
(328) & 209001 [F], 209002[F]
Apexl
914660[F], 914661[F], 914664[F], 914665[F], 930573[F], 930574[F], 914657[F], 914658[F], 914659[F], 914662[F], 914663[F], 930572[F], 930577[2387], 930578(2239], 930569(1820], 914656[-180], 930581 [- 930571[2912], 930575[2647], 930576(2472], 930570[2169],
835], 652074[-1252], 652072[-1275], 914655[-1640], 914668[-2835], 930579(1936], 930580(691], 930568[218], 930567(117], 914666[- APEX2 922959[-3097], 914653[-3711], 47160[F], 612845[F], 612846[F], 64], 652073[-1252], 652071[-1275], 914667[-1309], 736023[-1782], (27301) & 612848[F], 612850[F], 612852[F], 612853[F], 612854]F], 612855[F], 736022[-1883], 914654[-1946], 914652[-4430], 47159[F], 612842(F] Apex2 612857[F], 612858[F], 612859[F], 612860[F], 612861 [F], 612862[F], 612843[F], 612844[F], 612847[F], 612849[F], 612851 [F], 612856[F], (77622) 612865[F], 612866[F], 47164[-78], 612841[-152], 47162[-867], 612863[F], 612864[F], 612867[-72], 47163[-78], 47161[-867],
6128401-1254], 612838 [-2915], 612869[-3017] 612868[-1315], 612839[-1554], 612837[-3577], 612836[-4281]
APH1A
618181[F], 666304[F], 808409[F], 808410[F], 808411 [F],
(51107) &
622649[-3534] 622651(3665], 622652[-319], 622650[-3534], 808408[-4927],
Gm15429 2263[F], 77227[F]
(10003962
APH1B
635363[F], 900918[F], 925665(1387], 900917[-613], 24844[F], 635362[F], 900924[F], 24843[F], 580640[F], 580641 [F], 580643[F], (83464) & 580639[F], 580642[F], 580644[F] 24845[-3253] Aphlb
(208117)
620109[F], 791261[F], 791262[F], 791263[F], 791264[F], 791265[F], 791266[F], 791267[F], 791268[F], 620108(738], 791260[-127], API5 4622[F], 342217[F], 342218[F], 342219[F], 342220[F], 342221 [F], (8539) &
851879[F], 925514(2291]
342222[F], 342223[F], 342224[F], 342225[F], 342226[F], 4621(743], Api5 342216[-94], 342215[-400], 342214[-469], 342213[-4806], 4620[- (11800) 4991]
791586[F], 791588[F], 791589[F], 791590[F], 791591 [F], 791592[F], APIP 620149(33761], 620147[-201], 4676[F], 342990[F], 342991 [F], 791587[F], 620150[33761], 620148[-201], 620151 [-3100], 4677[F], (51074) & 342993[F], 342994[F], 342995[F], 342997[F], 342998[F], 342999[F], 342989[F], 342992[F], 342996[F], 4675[-160] Apip 343000[F], 46741-160] (56369)
APITD1
625591[F], 830365[F], 11653[F], 11655[F], 427714[F], 427718 -224], 625590[F], 830366[F], 11652[F], 11654[F], 427715[F], 427716[F], (378708) & 427719[-3188], 427713[-3439], 11656[-4817], 427720[-4854] 427717[F] Apitd 1
(69928)
628976[F], 855941[F], 855943[F], 855944[F], 855945[F], 855947[F], 628975[F], 628977[F], 855942[F], 855946[F], 638248[-291], 6839311 APLF 855948[F], 638249[-291], 638247[-300], 16210[F], 484644[F], 3290], 16209[F], 16211[F], 484646[F], 484651 [F], 484653[F], (200558) & 484645[F], 484647[F], 484648[F], 484649[F], 484650[F], 484652[F], 484654[F], 484659[F], 484660[F], 484662[F], 484664[F], 16212[- Aplf 484655[F], 484656[F], 484657[F], 484658[F], 484661 [F], 484663[F] 212], 4846651-2754] (72103)
APLN
651330[F], 909639[F], 909640[F], 909641 [F], 909642[F], 46046[F],
(8862) & 600226[F], 600227[F], 600228[F], 600229[F]
Apln APLP1
630496[-1363], 867138[-1372], 867141 [-4393], 18502[-1949], 630495[-1363], 867139[-2368], 867140[-2526], 18501 [-1949],
(333) & 508638[-1958], 508641 [-3451], 508642[-3507], 508643[-4520] 508639[-2897], 508640[-3059], 508644[-4806]
Aplpl
634584[F], 895364[F], 895367[F], 895368[F], 895369[F], 895370[F],
895371 [F], 895372[F], 895373[F], 895374[F], 895376[F], 895378[F],
895379[F], 895381[F], 895382[F], 895385[F], 895388[F], 895390[F],
895393[F], 895395[F], 895396[F], 895397[F], 895399[F], 895401 [F], 634583[F], 895365[F] 895366[F], 895375[F], 895377[F], 895380[F],
895403[F], 895404[F], 895406[F], 895407[F], 895408[F], 895411[F], 895383[F], 895384[F] 895386[F], 895387[F], 895389[F], 895391 [F],
895412[F], 895413[F], 895415[F], 895418[F], 895420[F], 895421[F], 895392[F], 895394[F] 895398[F], 895400[F], 895402[F], 895405[F], 634584[74952], 922167[2063], 895418[-521], 895420[-618], 895421 [-895409[F], 895410[F] 895416[F], 895417[F], 895419[F],
APLP2
684], 23921 [F], 23922[F], 570751[F], 570752[F], 570753[F], 634583[74952], 895419[-534], 23920[F], 570749[F], 570750[F],
(334) &
570754[F], 570755[F], 570756[F], 570757[F], 570758[F], 570759[F], 570760[F], 570762[F] 570765[F], 570768[F], 570769[F], 570771 [F],
Aplp2
570761 [F], 570763[F], 570764[F], 570766[F], 570767[F], 570770[F], 570772[F], 570774[F] 570776[F], 570777[F], 570779[F], 570780[F],
(11804)
570773[F], 570775[F], 570778[F], 570782[F], 570783[F], 570784[F], 570781[F], 570785[F] 570787[F], 570789[F], 570793[F], 570797[F],
570786[F], 570788[F], 570790[F], 570791[F], 570792[F], 570794[F], 570799[F], 570801[F] 570802[F], 570804[F], 570805[F], 570809[F],
570795[F], 570796[F], 570798[F], 570800[F], 570803[F], 570806[F], 570815[F], 570820[F] 570824[F], 570826[F], 23917[-1080], 570747|
570807[F], 570808[F], 570810[F], 570811[F], 570812[F], 570813[F], 2913]
570814[F], 570816[F], 570817[F], 570818[F], 570819[F], 570821 [F],
570822[F], 570823[F], 570825[F], 570827[F], 570748(44], 570828[- 10], 23918( 1080]
APOA1
634880[F], 897414[F], 24282[F], 574335[F], 24281 [-4434], 574334]-
634881 [-2635], 897415[-2978], 24283[-2542], 574336[-2866] (335) &
4832], 574333[-4954]
Apoal TABLE 2 - Page 84 of 1873
806842[F], 622359[2376], 622358[-8], 806841 [-370], 806840[-495], 806839[-878], 806838[-994], 806837[-1129], 806836[-1286], APOA1 BP 806835[-2091], 806834[-4343], 622360[-4610], 7530[F], 376426[F], (128240) &
622361 [-4610]
7529[-402], 376425[-569], 376424[-678], 376423[-948], 376422[- Apoal bp 1039], 376421 [-1162], 376420[-1301], 376419[-2066], 376418[- (246703) 4986]
618359[F], 933284[F], 667511 [29], 667512[-5], 618357[-2367], APOA2 667510[-2474], 618355 [-4207], 667509[-4793], 2472[F], 79303[F], (336) &
618358[-2367], 618356[-4207], 2471[-2538], 2469[-4351]
79304[3], 79302[-1892], 2470[-2538], 79301 [-2644], 2468( 4351], Apoa2 79300[-4862] (11807)
APOA4
634883[F], 897416[F], 897417[F], 634884(1183], 634882(1 163],
(337) & 24285(F), 574337[F], 574338[F], 24284(1190], 24286[1183]
Apoa4 APOA5
(116519) &
897418[F], 634885(2998], 574339[F], 24287[3288]
Apoa5 (661 13)
701744[F], 701745[F], 701746[F], 701749[F], 701750[F], APOB
701747[F], 701748[F], 640805(31631], 148107[F], 148108[F],
640804(31631], 148104[F], 148105[F], 148106[F], 148109[F], (338) &
31633[28268]
148110[F], 31632(28268 Apob
629406[F], 860451[F], 860453[F], 16736[F], 493679[F], 493680[F], APOBEC1
493683[F], 493684[F], 493685[F], 493686[F], 493687[F], 493688[F], 629405[F], 16735[F], 493678[F], 493681 [F], 493682[F], 493689[F], (339) & 493690[F], 493692[F], 493694[F], 493695[F], 16738[-2957], 493696[- 493691[F], 493693[F], 16737[-2957], 493697[-3900] Apobed 3828], 4936981-4044], 493699[-4197], 493700[-4280], 493701 [-4636] (1 1810)
759560[F], 759561[F], 648419(11314], 648416[-1883], 759558[
APOBEC2
759562[F], 648420(11314], 648418(1970], 759559[-747], 648417[- 2093], 759557[-2353], 759556[-2450], 759555[-2530], 759553[- (10930) & 1883], 759554[-3533], 42170[F], 279032[F], 279035[F], 279036[F], 401 1], 42169[F], 279033[F], 279034[F], 42166[-1959], 279030[- Apobec2 42168(2405], 279031 [-1296], 42167[-1959], 279026[-3589] 2143], 279029( 2354], 279028( 2451], 279027( 2531], 279025[- (1 1811) 3959]
APOBEC3
645705[F] 645706[F]
A (200315)
645705[F], 38613[F], 38617[F], 235662[F], 235663[F], 235664[F], APOBEC3
645706[F], 38614[F], 38618[F], 235658[F], 235659[F], 235660[F],
235665[F], 235666[F], 235668[F], 235669[F], 235671 [F], 235673[F]. B (9582) &
235661[F], 235667[F], 235670[F], 235672[F], 235657[-904], 235679| 235674[F], 235675[-394], 235676[-21 12], 235677[-2394], 235678[- Apobec3
4189]
2569] (80287)
739042[F], 739043[F], 931587(2274], 931586(2206], 931585[-1200], APOBEC3
739044[F], 931588[3481]
739041 [-3200] C (27350)
APOBEC3
931588[-3372] 931587[-4579], 931586[-4647]
D (140564)
739045[F], 739047[F], 739048[F], 930776[F], 930778[F], 930779(F), APOBEC3
739046[F], 930777(F)
930778(3366], 930779(3051; H (164668)
APOBEC4
618043[F], 618045[F], 665049[F], 665048[-2355], 2096[F], 2098[F], 618044[F], 665050[F], 2097[F], 74734[-785], 74735[-2117], 74731 [- (403314) & 74733(F), 74732[-3893], 74736[-4784] 4510] Apobec4
(71281)
631961 [F], 631964[F], 876832[F], 876833[F], 876834[F], 876835(F), 631962(F), 631965[F], 876837[F], 876841 [F], 931650(1830],
APOBR
876836[F], 876838[F], 876839[F], 876840[F], 876842[F], 876843(F), 876831[-170], 928694[-799], 928693[-1091], 930546[-1468],
(55911 ) & 876844[F], 20473[F], 20476[F], 529682[F], 529683[F], 529684[F], 930547[-1623], 876830[-2799], 876829[-3091], 876845[-3468],
Apobr 529685[F], 529686[F], 529687[F], 529689[F], 529690[F], 529691 (F), 876846[-3623], 20474(F), 20477[F], 529688[F], 529692[F], 529681 [- (171504) 529693[F], 529694(F), 529695[F], 529678[-2651] 191 ], 529680[-1868], 529679[-2168], 529696)-2795], 529697[-3065]
630186[F], 865338(F), 865340(F), 18030(F), 505053[F], 505055[F], APOC1 505055[-5], 18031 [-3449], 505056[-3739], 505057[-3893], 505058[- (341 ) &
630185(F), 865339[F], 18029[F], 505054[F], 505054(3]
4001], 505059[-4127], 505060[-4237], 505061 [-4404], 505062[-4633). Apod 505063[-4977] (11812)
APOC3
634881[F], 897415[F], 634882[-4119], 24283[F], 574336[F], 24284[-
634880[-2676], 897414[-4083], 24282[-2582], 574335[-3932] (345) &
4542]
Apoc3 APOD
746927[F], 746928(F), 746929[F], 746930(F), 646794(15493],
(347) & 39932[F], 252001(F), 252002(F), 252003[F], 252004(F), 252005(F),
Apod 252006[F], 252007(F), 252008[F]
(11815)
630187[F], 865341(F), 865342[F], 865343[F], 865344[F], 865345(F),
865346[F], 865347(F), 865348[F], 865349[F], 865350[F], 630189[- APOE
2092], 865351 [-2322], 865352( 2649], 18031 (F), 505056[F], 630188[-2092], 865353[-2655], 18032[-2145], 505069( 2594], (348) &
505057(F), 505058(F), 505059[F], 505060[F], 505061 [F], 505062(F), 18029[-3582], 505054[-3605] Apoe 505063[F], 505064[F], 505065[F], 505066[F], 18033[-2145], 505067[- (11816) 2336], 505068[-2588], 18030[-3582], 505055[-3600]
APOF
932579(1986], 681882[-14], 637978[-317], 681883[-710], 681884[-
6379771-317], 681885[-3808], 681886[-4079], 28273[F], 110940[- (319) &
1801], 28274[F], 1 10937[-55], 110938[-744], 110939[-1778],
2200], 110945[-3924] Apof
110941 [-2599], 110942[-2710], 1 10943[-2995], 1 10944[-3106]
(103161 ) APOH
640347(F), 31079(F), 142228(F) 640348[F], 698945[F], 31080[F], 142226[F], 142227[F]
(350) &
738383(F), 738386[F], 738388(F), 928783[F], 928782(2550], APOL1 738375[F], 738396(F), 928780[F], 928784[F]
928781 [2356] (8542) TABLE 2 - Page 85 of 1873
APOL2
738373[F], 738374[F], 738384[F], 738387[F], 738395[F], 738397[F],
38499[F], 234682[F], 234683[F], 234684[F], 234686[F], 234688[F], (23780) &
928950[F], 928952[F], 928949(3649], 928953(3215], 928948(3213], 234689[-386], 234681[-411], 234690[-1638] Apol8
928951(2754], 38498[F], 234685[F], 234687[F], 234691[-4623]
(239552)
738382[F], 738399[F], 738400[F], 927605[F], 927610(2714], 738376[F], 738390[F], 738391 [F], 927604[F], 927606[F], 927607[F], APOL3 927609(2552], 927608(2337], 738398(337 927607(2502], 927606(2501; (80833)
APOL4
738381 [F], 738389[F], 928496[F], 928498[F] 738380[F], 738385[F], 928495[F], 928497[F]
(80832) APOL5 645594[F] 645595[F]
(80831) APOL6
645589[F], 738218[F], 38460[F], 234305[F], 234306[F],
645588[F], 38459[F], 38457(5595], 234303[-2558] (80830) &
38458(5595], 234304[-518]
Apol6 APOLD1
629655[F], 862110[F], 862111[F], 862112[F], 862113[F], 922771 [F],
(81575) & 629655(5395], 629653[-3545], 17103[F], 497133[F], 497134[F], 6296521-3534], 629654[-3545], 862109[-4456]
Apoldl 497135[F]
(381823)
648147[F], 757787[F], 757788[F], 932439(1697], 932437(306],
932436(227], 932435[-59], 757786[-303], 757784[-1694], 757783[-
648148[F], 757789[F], 932438(899], 757785[-1101], 648146[-2459], 1773], 757782[-2059], 928957[-2190], 648149[-2722], 757790[- APOM 642187[-3892], 713079 [-4342], 928960[-4556], 41815[F], 41820[F], 3412], 757791 [-3523], 757792[-3637], 928958[-3638], 757793[- (55937) & 275644[F], 275647[F], 275648[-532], 275641[-1249], 41818[-2555], 4190], 928959[-4331], 928961 [-4925], 41814[F], 41819[F], Apom 275637[-4619] 275643[F], 275645[F], 275646[F], 275642[-308], 275640[-1839], (55938)
275639[-1918], 275638[-2160], 41821[-2675], 275649[-3636],
275650[-3749], 275651 [-3854], 275652[-4435]
619736[F], 626813[F], 642918[F], 650552[F], 651667[F], 717728[F],
717729[F], 717730[F], 725981[F], 725982[F], 776525[F], 776526[F],
776527[F], 788645[F], 788646[F], 839273[F], 894615[F], 911700[F],
626814[F], 638695[F], 651668[F], 687636[F], 911707[F], 651666[- APOO 911702[F], 911703[F], 911704[F], 911705[F], 911706[F], 911708[F],
65], 911699[-886], 911698[-932], 46576[F], 605234[F], 605236[F], (79135) & 911709[F], 911710[F], 911711[F], 651665[-65], 46575[F], 605231[F],
605237[F], 605246[F], 605250[F], 605256[F], 46573(7519], 605230[- Apoo 605232[F], 605233[F], 605235[F], 605238[F], 605239[F], 605240[F],
1013], 6052291-1144] (68316) 605241 [F], 605242[F], 605243[F], 605244[F], 605245[F], 605247[F],
605248[F], 605249[F], 605251[F], 605252[F], 605253[F], 605254[F],
605255[F], 605257[F], 46572(7519], 46574[-2393], 605228[-4457]
651865[F], 913148[F], 913150[F], 913151[F], 913152[F], 913153[F],
APOOL
651867[1032], 46833[F], 608684[F], 608687[F], 608688[F], 651866[F], 913149[F], 651868[1032], 46834[F], 608685[F],
(139322) & 608689[F], 608691[F], 608692[F], 608693[F], 608696[F], 608697[F], 608686[F], 608690[F], 608694[F], 608695[F], 608698[F], 608700[F],
Apool 608699[F], 608701[F], 608703[F], 608704[F], 608705[F], 608706[F], 608702[F], 608707[F], 608711[F], 608712[F]
(68117) 608708[F], 608709[F], 608710[F], 608713[F], 608714[F]
641982(1542], 711383[-1923], 711381 [-2487], 711380[-2807], APOPT1
641981[1542], 711382[-2463], 33234[F], 170180[F], 170181[F], 711379[-3110], 33235[F], 170188[F], 170190[F], 170191[F], (84334) & 170182[F], 170183[F], 170184[F], 170185[F], 170186[F], 170187[F], 170192[F], 170193[F], 33233[1472], 170190[-1926], 170179[-2007], 2810002N0 170189[F], 170194[F], 33232[1472], 170178[-2547], 170197[-4569] 170177[-2571], 170176[-2891], 170191 [-3119], 170175[-3194], 1 Rik
170192[-3549], 170195[-3677], 170196[-4399] (68020)
647278[F], 647279[F], 751040[F], 751041[F], 751042[F], 751043[F], 751044[F], 751045[F], 751046[F], 751047[F], 751048[F], 751049[F], 751050[F], 751051[F], 751052[F], 751053[F], 751054[F], 751055[F], 751056[F], 751057[F], 647278(290518], 647279[135], 751054[-
APP (351) 4277], 40546[F], 40547[F], 260177[F], 260178[F], 260179[F],
647280[F], 647280[135], 40548[F] & App
260180[F], 260181[F], 260182[F], 260183[F], 260184[F], 260185[F],
(11820) 260186[F], 260187[F], 260188[F], 260189[F], 260190[F], 260191 [F], 260192[F], 260193[F], 260194[F], 260195[F], 260196[F], 260197[F], 260198[F], 260199[F], 260200[F], 260201 [F], 260202[F], 260203[F], 260204[F], 260205[F], 260206[F], 260207[F], 260208[F]
693975[F], 693976[F], 693977[F], 916487[F], 30248[F], 133687[F], APPBP2
133688[F], 133689[F], 133690[F], 133691 [F], 133692[F], 133693[F], (10513) &
133694[F], 133695[F], 133696[F], 133697[F], 133698[F], 133699[F], Appbp2 133700[F], 133701 [F], 133686[-2135]
643727[F], 724129[F], 724130[F], 724131[F], 724132[F], 724133[F],
724134[F], 724135[F], 724136[F], 724137[F], 724138[F], 724139[F],
724140[F], 724141[F], 724142[F], 724144[F], 724145[F], 724147[F],
724148[F], 724149[F], 643725[5120], 724127[-2951], 35886[F],
643726[F], 724143[F], 724146[F], 643724(5120], 724126[-3221], APPL1 203387[F], 203389[F], 203390[F], 203391 [F], 203392[F], 203393[F],
35885[F], 203388[F], 203398[F], 203403[F], 203411[F], 203418[F], (26060) & 203394[F], 203395[F], 203396[F], 203397[F], 203399[F], 203400[F],
203419[F], 203420[F], 203424[F], 203425[F], 203426[F], 203427[F], AppH 203401 [F], 203402[F], 203404[F], 203405[F], 203406[F], 203407[F],
203428[F], 35883[-3116], 203385[-3979] (72993) 203408[F], 203409[F], 203410[F], 203412[F], 203413[F], 203414[F],
203415[F], 203416[F], 203417[F], 203421 [F], 203422[F], 203423[F],
203429[F], 203430[F], 203431[F], 203432[F], 35884[-3116], 203386[- 3700] TABLE 2 - Page 86 of 1873
637374[F], 677751[F], 677752[F], 67775 4 [F], 677759[F], 677764[F],
637373[F], 677750[F] 677753[F], 677755[F], 677756[F], 677757[F], 677765[F], 677767[F], 677768[F], 677769[F], 677770[F], 677773[F],
677758[F], 677760[F] 677761 [F], 677762[F], 677763[F], 677766[F], APPL2 677775[F], 677775[-2551], 637372[- 4 163], 27504[F], 102191[F],
677771 [F], 677772[F] 27503[F], 102190[F], 102193[F], 102195[F], (55198) & 102192[F], 102194[F], 102196[F], 102200[F], 102203[F], 102204[F],
102197[F], 102198[F] 102199[F], 102201[F], 102202[F], 102205[F], Appl2 102207[F], 102209[F], 102211[F], 102212[F], 102213[F], 102215[F],
102206[F], 102208[F] 102210[F], 102214[F], 102216[F], 102217[F], (216190) 102218[F], 102219[F], 102220[F], 102222[F], 102223[F], 102224[F],
102221 [F]
27502[-3548]
892317[F], 892318[F], 892319[F], 892320[F], 932442[F], 932443[F],
932444[F], 932441[2089], 634115[-210], 634116[-996], 892316[- APRT
1031], 634118[-1799], 892315[-3952], 892314[-4728], 23280[F], 892321[F], 932445(2370], 634117[-1799], 23279[F], 563443[F], (353) & 563439[F], 563440[F], 563441[F], 563442[F], 563445[-970], 23278[- 563444[-365] Aprt 1081], 563438[-1099], 563437[-1890], 563446[-1919], 563447[-3309] (11821) 563448[-3570], 563449[-4338], 563436[-4656]
623797[F], 815991[F], 926071(1672], 926072(718], 815992[-328], APTX 815993[-1282], 9323[F], 395915[F], 395916[F], 395917[F], 395918]- (54840) & 402], 395919[-1007] Aptx
628649[F], 853286[F], 853287[F], 853288[F], 853290[F], 853293[F], AQP1 853294[F], 853293[-130], 853285[-232], 15741[F], 478037[F], 628650[F], 853289[F], 853291 [F], 853292[F], 853292[-708], 8532911 (358) & 478038[F], 478039[F], 478041[F], 478044[F], 478045[F], 478036]- 1488], 15742[F], 478040[F], 478042[F], 478043[F] Aqp1 158] (11826)
AQP10
622475[34], 807561 [-3321], 807560[-4003], 807559[-4953] 622474[34]
(89872) AQP11 (282679) &
631415[F], 872761[F], 19795[F], 521618[F]
Aqp11 (66333) AQP12A
617522[F], 660840[F], 660841[F], 1405[F], 65825[F], 65826[F], (375318) &
1406[-3184]
1407[-3184], 65827[-3662] Aqp12
(208760)
742169[F], 742170[F], 646144(5442], 39146[F], 242139[F], AQP2
6461451-2192], 742171[-3545]
242140[F] (359) &
623817[F], 623819[F], 816121[F], 816122[F], 816123[F], 816124[F], AQP3 816125[F], 816127[F], 816128[F], 816129[F], 816130[F], 816131[F], (360) &
623816[F], 623818[F], 816126[F], 9342[F], 396142[F], 9344[-258]
9343[F], 396138[F], 396139[F], 396140[F], 396141[F], 396143[F], Aqp3 396144[F], 396145[F], 396146[F], 396147[F], 396137(45], 9345[-258] (11828)
649053[F], 649055[F], 764766[F], 43020[F], 290396[F], 290397[F], 649052[F], 649054[F], 764767[F], 764767[-2123], 43019[F], AQP4 43022(599], 290399[-239i; 290398[F], 43021 [599] (361) &
646145[F], 742171[F], 742172[F], 742173[F], 742174]F], 39147]F], AQP5 242141 [F], 242142[F], 242143[F], 242144[F (362) & 623815[F], 816117[F], 816118[F], 816120[F], 9341[F], 396131[F], 623814[F], 816119[F], 9340[F], 396130[F], 396132[F], 396134[F], AQP7 396133[F], 396136[F] 396135[F] (364) &
AQP7P2
623979[F] 623978[F]
(389756) AQP7P3
623978[F] 623979[F]
(441432) AQP8
631928[F], 20424[F], 528990[F]
(343) &
635422[F], 901546[F], 901547[F], 901548[F], 901549[F], 901550[F], AQP9 901551[F], 9238471-602], 901553[-2602], 24924[F], 581808[F], 635421[F], 923846[-273], 901552[-2273], 24923[F], 581811[F], (366) & 581809[F], 581810[F], 581812[F], 581813[F], 581814[F], 581815[F], 581816[F], 581817[F], 581818[F], 24925[-503], 581820[-3031] Aqp9 581819[-33], 24926[-503], 581821 [-3263], 581822[-3476] (64008)
AQPEP
649434[F], 767969[F], 767970[F], 767973[F], 43493[F], 296934[F],
649435[F], 767968[F], 43494[F], 296932[F], 296933[F], 296936[F], (206338) & 296935[F], 296937[F], 296938[F], 296939[F], 296940[F], 296941 [F],
296944[F], 296946[F], 296948[F], 296949[F] 483340311 296942[F], 296943[F], 296945[F], 296947[F]
5Rik
677517[F], 792656[F], 792657[F], 792658[F], 792659[F], 792660[F], 792661 [F], 792662[F], 792663[F], 792664[F], 792665[F], 792666[F],
AQR
792667[F], 792668[F], 620293(113293], 4854[F], 345090[F],
(9716) &
726712[F], 920619[F] 345091 [F], 345092[F], 345093[F], 345094[F], 345095[F], 345096[F],
Aqr 345097[F], 345098[F], 345099[F], 345100[F], 345101 [F], 345102[F],
(11834) 345103[F], 345104[F], 345105[F], 345106[F], 345107[F], 345108[F], 345109[F], 345110[F], 345111[F], 345112[F], 345113[-3975]
651699[F], 911854[F], 911855[F], 911856[F], 911857[F], 911858[F],
651698[F], 911853[F], 911859[F], 911862[F], 911865[F], 911866[F], 911860[F], 911861[F], 911863[F], 911864[F], 911867[F], 911869[F], 911868[F], 911871[F], 911872[F], 651698(161565], 46612[F], 911870[F], 651699[161565], 46613[F], 605600[F], 605602[F],
605599[F], 605601[F], 605607[F], 605612[F], 605615[F], 605617[F], 605603[F], 605604[F], 605605[F], 605606[F], 605608[F], 605609[F], 605618[F], 605623[F], 605624[F], 605625[F], 605628[F], 605630[F], 605610[F], 605611[F], 605613[F], 605614[F], 605616[F], 605619[F], 605631 [F], 605634[F], 605637[-388], 605638[-4647] 605620[F], 605621[F], 605622[F], 605626[F], 605627[F], 605629[F],
605632[F], 605633[F], 605635[F], 605636[F] TABLE 2 - Page 87 of 1873
651247[F], 908983[F], 908984[F], 908985[F], 929622[2000], ARAF
908982[0], 45762[F], 597850[F], 597851 [F], 597852[F], 597853[F], (369) & 597854[F], 597855[F], 45762[11978], 597849[-56], 597852[-3040], Araf
597853[-3118], 59785 [-3501], 5978 8[-4954] (11836)
631528[F], 873462[F], 873463[F], 873464[F], 873466[F], 873476[F],
873477[F], 873479[F], 873482[F], 873484[F], 873485[F], 873486[F],
873487[F], 873488[F], 873489[F], 873490[F], 873491 [F], 873492[F], 631529[F], 873465[F], 873467[F], 873468[F], 873474[F], 873475[F], 873493[F], 873494[F], 631525[-1610], 873476[-4084], 19916[F], 873478[F], 873480[F], 873481 [F], 873483[F], 631526[-1610],
ARAP1 522940[F], 522942[F], 522944[F], 522946[F], 522948[F], 522950[F], 873475[-4313], 873474[-4380], 19917[F], 522941 [F], 522943[F],
(116985) S 522951 [F], 522952[F], 522953[F], 522954[F], 522957[F], 522958[F], 522945[F], 522947[F], 522949[F], 522955[F], 522956[F], 522960[F],
Arapl 522959[F], 522962[F], 522963[F], 522965[F], 522966[F], 522968[F], 522961[F], 522964[F], 522967[F], 522969[F], 522972[F], 522973[F],
(69710) 522970[F], 522971[F], 522974[F], 522975[F], 522976[F], 522977[F], 522985[F], 19914[-1441], 522973[-3063], 522972[-3135], 522939]- 522978[F], 522979[F], 522980[F], 522981 [F], 522982[F], 522983[F], 3448], 522938[-4226], 522956[-4672], 522955[-4739]
522984[F], 522959[26], 522974[-821], 19913[-1441], 522963[-1532],
5229581-2006], 522971 [-3832], 522970[-4124], 522957[-4516]
626421 [F], 650289[F], 774210[F], 836787[F], 836791 [F], 836792[F],
836793[F], 836794[F], 836796[F], 836797[F], 836798[F], 836799[F],
836800[F], 836801[F], 836803[F], 836806[F], 836807[F], 836810[F],
626420[F], 836786[F], 836788[F], 836789]F], 836790[F], 836795[F], 836811 [F], 836813[F], 836814[F], 836815[F], 836817[F], 836818[F],
836802[F], 836804[F], 836805[F], 836808[F], 836809[F], 836812[F], 836819[F], 12806[F], 442116[F], 442117[F], 442118[F], 442124[F], ARAP2
836816[F], 836820[F], 12805[F], 442115[F], 442119[F], 442120[F], 442125[F], 442126[F], 442127[F], 442128[F], 442129[F], 442130[F], (116984) &
442121[F], 442122[F], 442123[F], 442131 [F], 442139[F], 442141 [F], 442132[F], 442133[F], 442134[F], 442135[F], 442136[F], 442137[F], Arap2
442143[F], 442145[F], 442148[F], 442150[F], 442151 [F], 442152[F], 442138[F], 442140[F], 442142[F], 442144[F], 442146[F], 442147[F], (212285)
442158[F], 442159[F], 442160[F], 442166[F], 442170[F], 442172[F], 442149[F], 442153[F], 442154[F], 442155[F], 442156[F], 442157[F],
442173[F], 442174[F], 442180[F], 442183[F]
442161 [F], 442162[F], 442163[F], 442164[F], 442165[F], 442167[F],
442168[F], 442169[F], 442171[F], 442175[F], 442176[F], 442177[F],
442178[F], 442179[F], 442181[F], 442182[F]
649310[F], 767073[F], 767075[F], 767079[F], 767084[F], 767085[F], 649309[F], 767074[F], 767076[F], 767077[F], 767078[F], 767080[F],
ARAP3 649308[-1984], 767072[-2206], 767070[-3581 ], 767069[-3959], 767081[F], 767082[F], 767083[F], 767086[F], 649307[-1984],
(64411 ) & 43342[F], 295091 [F], 295093[F], 295094[F], 295097[F], 295099[F], 767071 [-2909], 43341[F], 295092[F], 295095[F], 295096[F],
Arap3 295101 [F], 295106[F], 295107[F], 295107[-918], 43340[-2847], 295098[F], 295100[F], 295102[F], 295103[F], 295104[F], 295105[F],
(106952) 295090[-3072], 295088[-4459], 295087[-4816] 295108[F], 295108[-956], 43339[-2847], 295089[-3744]
634821 [F], 757914[F], 757915[F], 757916[F], 757917[F], 757919[F],
757920[F], 757921[F], 757922[F], 757923[F], 757924[F], 757926[F], 634820[F], 757918[F], 757925[F], 757927[F], 757929[F], 757930[F], 757928[F], 757931[F], 897034[F], 897037[F], 897039]F], 897041 [F], 757932[F], 757933[F], 757934[F], 897030[F], 897031 [F], 897032[F], ARCN1 897042[F], 897043[F], 897044[F], 897046[F], 897047[F], 897048[F], 897033[F], 897035[F], 897036[F], 897038[F], 897040[F], 897045[F], (372) & 897049[F], 897050[F], 634819[-4581], 24222[F], 573772[F], 634818[-4581], 24221[F], 573768[F], 573769[F], 573770[F], Arcnl 573775[F], 573777[F], 573779[F], 573780[F], 573783[F], 573784[F], 573771[F], 573773[F], 573774[F], 573776[F], 573778[F], 573781 [F], (213827) 573785[F], 573786[F], 573788[F], 573789[F], 573791 [F], 573792[F], 573782[F], 573787[F], 573790[F], 573793[F], 573796[F], 573797[F] 573794[F], 573795[F], 573798[F], 573799[F], 573800[F], 24223[-98]
616814[F], 649849[F], 655238[F], 655239[F], 655240[F], 655241 [F],
655242[F], 655243[F], 688340[F], 688341 [F], 688344[F], 688345[F],
688346[F], 688347[F], 688348[F], 688349[F], 688351 [F], 688353[F],
ARF1 688354[F], 713060[F], 767971[F], 767972[F], 771488[F], 771489[F], 688342[F], 688343[F], 688350[F], 688352[F], 688355[F], 688356[F],
(375) & 771490[F], 771491[F], 771492[F], 771493[F], 916473[F], 638815[- 688357[F], 916472[F], 688357[45], 29350[F], 123873[F], 123876[F],
Arf1 1514], 29351[F], 123871 [F], 123872[F], 123874[F], 123875[F], 123880[F], 123888[F], 123891 [F], 123894[F], 123895[F], 123896[F]
(11840) 123877[F], 123878[F], 123879[F], 123881 [F], 123882[F], 123883[F],
123884[F], 123885[F], 123886[F], 123887[F], 123889[F], 123890[F],
123892[F], 123893[F], 29349[-2689], 123870[-3908]
ARF3
646098[F], 741888[F], 741889[F], 741890[F], 741891 [F], 741892[F],
(377) & 741893[F], 39098[F], 241674[F], 241675[F], 241676[F], 241677[F],
Arf3 241678[F], 241679[F], 241680[F], 241681 [F], 241682[F]
(11842) ARF4
643721[F], 724112[F], 724113[F], 643723[-4910], 35878[F],
926487[1726], 724111 [-274], 643722[-4910], 35876[-12], 203298[- (378) &
203299[F], 203300[F], 203301 [F], 203302[F], 35877[-12], 203297[- 347], 35879[-2698], 203296[-4283] Arf4
441 ], 203303[-2260], 35880[-2698], 35875[-4793]
(11843)
628193[F], 628194[F], 849163[F], 849164[-373], 628196[-1923], ARF5
628195[-1923], 849165[-4477], 15198[-1288], 470273[-2338],
15196[F], 15197[F], 470271 [F], 470272[-424], 15199[-1288], (381 ) & 470274[-4836]
470270[-4850] Arf5
641278[F], 705411[F], 705412[F], 705413[F], 705414[F], 705415[F],
705416[F], 705417[F], 705418[F], 705419[F], 705420[F], 705421 [F], ARF6 909362[F], 641277[652], 705410[-563], 32362[F], 158412[F], (382) & 158413[F], 158414[F], 158415[F], 158416[F], 158417[F], 158418[F], Arf6 158419[F], 158420[F], 158421[F], 158422[F], 32361 [582], 158411 [- (11845) 478] TABLE 2 - Page 88 of 1873
ARFGAP1
621545[F], 928235[-1390], 621547[-3049], 801589[-3390], 6423[- 801590[F], 801591[F], 621546(15800], 621548[-3049], 6424[F], (55738) & 105], 6 4 21[-411], 6425[-1398], 364352[-1790] 364353[F], 364354[F], 364353[13], 6422[-411], 6426[-1398] Arfgapl
(228998)
620030[F], 790678[F], 790679[F], 790680[F], 858557[F], 620031 [-
ARFGAP2 2050], 7906821-2593], 790677[-3159], 790676[-3304], 790675[-3718].
620032[-2050], 790681 [-2145], 4534[4212], 341172[-950], 341175[- (84364) & 790674[-4268], 341169[F], 341170[F], 341171 [F], 4532(12252],
3903], 4535[-3919] Arfgap2 4533[4212], 341173[-1350], 341174[-2375], 341168[-3547], 341167[- (77038) 3680], 341166[-4110], 341165[-4310]
ARFGAP3
645831[F], 740014[F], 740015[F], 740016[F], 38766[F], 237588[F],
740017[F], 740018[F], 740019[F], 740020[F], 922960[F], 922961[F], (26286) &
237589[F], 237590[F], 237591 [F], 237592[F], 237593[F], 237594[F], 922962[F], 922963[F] Arfgap3
237595[F], 237596[F], 237597[F], 237598[F], 237599[F], 237600[F]
(66251)
616488[F], 652569[F], 652570[F], 652571[F], 652572[F], 652574[F],
652576[F], 652577[F], 652578[F], 652580[F], 652581 [F], 652582[F],
652583[F], 652584[F], 652585[F], 652586[F], 652588[F], 652589[F],
652590[F], 652591[F], 652592[F], 652593[F], 652594[F], 652595[F],
616487[F], 652573[F], 652575[F], 652579[F], 652587[F], 85[F],
652596[F], 652597[F], 616486[-1034], 86[F], 48439[F], 48440[F],
48443[F], 48445[F], 48447[F], 48448[F], 48449[F], 48450[F], ARFGEF1 48441 [F], 48442[F], 48444[F], 48446[F], 48451 [F], 48452[F],
48454[F], 48456[F], 48459[F], 48460[F], 48464[F], 48465[F], (10565) & 48453[F], 48455[F], 48457[F], 48458[F], 48461 [F], 48462[F],
48467[F], 48479[F], 48480[F], 48481[F], 48482[F], 48492[F], Arfgefl 48463[F], 48466[F], 48468[F], 48469[F], 48470[F], 48471 [F],
48495[F], 48496[F], 48499[F], 48500[F], 48502[F], 48504[F], (211673) 48472[F], 48473[F], 48474[F], 48475[F], 48476[F], 48477[F],
48506[F]
48478[F], 48483[F], 48484[F], 48485[F], 48486[F], 48487[F],
48488[F], 48489[F], 48490[F], 48491 [F], 48493[F], 48494[F],
48497[F], 48498[F], 48501 [F], 48503[F], 48505[F], 48507[F],
48508[F], 48509[F], 48510[F], 84[-730]
621329[F], 800213[F], 800214[F] 800215[F] 800218[F], 800220[F],
800221 [F], 800225[F], 800226[F] 800227[F] 800230[F], 800231 [F],
800232[F], 800233[F], 800234[F] 800236[F] 800237[F], 800238[F],
800239[F], 800240[F], 800241 [F] 800243[F] 800244[F], 800245[F],
621330[F], 800216[F] 800217[F], 800219[F], 800222[F], 800223[F], 800247[F], 800248[F], 800249[F] 800251 [F] 800252[F], 6085[F],
800224[F], 800228[F] 800229[F], 800235[F], 800242[F], 800246[F], 359690[F], 359691 [F], 359692[F] 359693[F] 359694[F], 359697[F], ARFGEF2
800250[F], 800253[F] 6086[F], 359695[F], 359696[F], 359698[F], 359699[F], 359700[F], 359702[F] 359706[F] 359707[F], 359708[F], (10564) &
359701 [F], 359703[F] 359704[F], 359705[F], 359709[F], 359710[F], 359713[F], 359714[F], 359715[F] 359716[F] 359717[F], 359720[F], Arfgef2
359711[F], 359712[F] 359718[F], 359719[F], 359725[F], 359733[F], 359721 [F], 359722[F], 359723[F] 359724[F] 359726[F], 359727[F], (99371)
359739[F], 359743[F] 359746[F], 359750[F], 359751 [F], 359756[F], 359728[F], 359729[F], 359730[F] 359731 [F] 359732[F], 359734[F],
359760[F], 359765[F]
359735[F], 359736[F], 359737[F] 359738[F] 359740[F], 359741 [F],
359742[F], 359744[F], 359745[F] 359747[F] 359748[F], 359749[F],
359752[F], 359753[F], 359754[F] 359755[F] 359757[F], 359758[F],
359759[F], 359761 [F], 359762[F] 359763[F] 359764[F]
622282[F], 806098[F], 806099[F], 806100[F], 806101 [F], 806103[F],
806104[F], 806105[F], 806106[F], 806107[F], 806109[F], 806110[F],
806111[F], 806112[F], 806113[F], 806114[F], 806115[F], 806116[F],
806117[F], 622284(19321], 7443[F], 375104[F], 375105[F], 622281[F], 806102[F], 622283(19321], 7442[F], 375108[F], ARFIP1 375106[F], 375107[F], 375109[F], 375111[F], 375113[F], 375115[F], 375110[F], 375112[F], 375114[F], 375116[F], 375123[F], 375125[F], (27236) & 375117[F], 375118[F], 375119[F], 375120[F], 375121 [F], 375122[F], 375129[F], 375137[F], 375138[F], 375140[F], 375141 [F], 375147[F], Arfipl 375124[F], 375126[F], 375127[F], 375128[F], 375130[F], 375131[F], 7444[16731] (99889) 375132[F], 375133[F], 375134[F], 375135[F], 375136[F], 375139[F],
375142[F], 375143[F], 375144[F], 375145[F], 375146[F], 375148[F],
7445(16731]
631623(439], 631621[-745], 874051[-1043], 874053[-2173], 874050[- ARFIP2
631622[439], 631620[-745], 874052[-774], 874049[-3669],
3289], 874048[-4625], 20046(362], 20044[-628], 524014[-975], (23647) &
20045[362], 20043[-628], 524015[-821], 524012[-3956]
524016( 2110], 524013( 3513], 524011( 4690 Arfip2
621569[F], 801664[F], 801665[F], 801667[F], 801668[F], 801669[F],
801670[F], 801671[F], 801672[F], 801673[F], 801674(F], 621571 [- 621568[F], 801666[F], 621570[-24], 801677[-720], 801679[-1003],
ARFRP1 24], 8016751-378], 801676[-674], 801678[-908], 621567[-2388], 621566[-2388], 801663[-2777], 6448[F], 364491[F], 6450[478],
(10139) & 6449[F], 364488[F], 364489[F], 364490[F], 364492[F], 364493[F], 364503[-410], 364505[-690], 6446[-1071], 364487[-1245], 364506[- Arfrpl 364494[F], 364495[F], 364496[F], 364497[F], 364498[F], 364499[F], 2051], 364507[-351 ], 364508[-4386], 364509[-4622], 364510[- (76688) 364500[F], 6451[478], 364501[-142], 364502[-364], 364504[-592], 4747]
6447[-1071]
636563[F], 672199[F], 929522[-116], 636564[-233], 672204[-1579], ARG1
672205[-2116], 636561 [-2414], 672198[-2553], 672197[-4163], 636562[F], 672200[F], 672201 [F], 672202[F], 672203[F], 26395[F], (383) &
26396[F], 88979[F], 26397[-147], 26394[-1524], 88978[-1666], 88984 88980[F], 88981[F], 88982[F], 88983[F] Arg1 2012], 88985[-2558], 88977[-3120], 88976[-3249 (11846)
641472[F], 706695[F], 706696[F], 706697[F], 706698[F], ARG2
641471[F], 641473[570], 706699[-1685], 32586[F], 161033[F], 641474(570], 706700[-4742], 706701 [-4824], 32587[F], 161031[F], (384) & 161036[F], 32588[286], 161040[-1515] 161032[F], 161034[F], 161035[F], 161037[F], 32589(286], 161038[- Arg2
52], 1610391-211], 161041[-4153], 161042[-4235] (11847)
ARGFX
646938[-2513] 646937[-2513]
(503582) TABLE 2 - Page 89 of 1873
632516[F], 879861[F], 879862[F], 879863[F], 8798B5[F], 879866[F],
879867[F], 879869[F], 879870[F], 879871 [F], 879872[F], 879873[F],
879874[F], 879875[F], 879876[F], 879878[F], 879879[F], 879880[F],
879881 [F], 879882[F], 879883[F], 879884[F], 879885[F], 879886[F],
ARGLU1 879887[F], 924122[-4922], 21160[F], 535488[F], 535489[F], 632513[F], 632515[F], 879864[F], 879868[F], 879877[F], 879888[F],
(55082) & 535490[F], 535492[F], 535493[F], 535494[F], 535496[F], 535497[F], 924123[-4782], 21159[F], 535491[F], 535495[F], 535506[F],
Arglul 535498[F], 535499[F], 535500[F], 535501 [F], 535502[F], 535503[F], 535511[F], 535522[F], 535523[F], 21157[-1845], 535486[-4629]
(234023) 535504[F], 535505[F], 535507[F], 535508[F], 535509[F], 535510[F],
535512[F], 535513[F], 535514[F], 535515[F], 535516[F], 535517[F],
535518[F], 535519[F], 535520[F], 535521[F], 535524[F], 535525[F],
21158[-1845], 535487[-2322], 535485[-4717]
620040[F], 790737[F], 790738[F], 790740[F], 790741 [F], 790742[F], 620041[F], 790739[F], 790743[F], 790744[F], 790745[F], 790746[F], 790747[F], 790748[F], 790736[-208], 620038[-444], 790735[-693], 620039[-444], 620043[-1063], 790750[-3117], 790751 [-3253],
790734[-1014], 620042[-1063], 790749[-2591], 790752[-3439], 790753[-3781], 790733[-3938], 790754[-4262], 4543[F], 341296[F], ARHGAP1
790732[-4364], 4542[F], 341294[F], 341295[F], 341297[F], 341300[F], 341306[F], 341307[F], 341308[F], 341309[F], 341310[F], (392) &
341298[F], 341299[F], 341301[F], 341302[F], 341303[F], 341304[F], 341311[F], 341312[F], 341313[F], 341314[F], 341316[F], 341317[F], Arhgapl 341305[F], 341315[F], 341318[F], 341319[F], 341320[F], 4544[1613], 4545[1613], 341321[-106], 4541[-325], 341322[-854], 341324]- (228359) 341293[-96], 4540[-325], 341292[-563], 341291[-878], 341295[-1489] 2705], 341325[-2795], 341327[-3177], 341328[-3593], 341290]- 341323[-2327], 341294[-2674], 341326[-2913], 341289[-4217] 3794]
, 633322[F; 885679[F], 885680[F], 885683[F], 885684[F]
, 885686[F " 885687[F], 885688[F], 885690[F], 885691 [F]
, 885694[F; 885695[F], 885698[F], 885699[F], 885700[F]
, 885702[F " 885703[F], 885704[F], 885705[F], 885706[F]
, 885708[F; 885709[F], 885710[F], 885711 [F], 885713[F]
, 88571 SIP; 885718[F], 885719[F], 885720[F], 885721 [F]
633320[F], 633323[F], 885678[F], 885681 [F], 885682[F], 885689[F], , 885725[F; 885726[F], 885727[F], 885729]F], 885730[F]
885692[F], 885696[F], 885697[F], 885712]F], 885716[F], 885717[F], , 885733[F; 885736[F], 885737[F], 885738[F], 885739[F]
885722[F], 885724[F], 885728[F], 885732[F], 885734[F], 885735[F], , 22318[F], 22320[F], 550153[F], 550154[F], 550156[F],
885741[F], 633324[752], 22317[F], 22319[F], 22321[F], 550152[F], , 550160[F; 550162[F], 550163[F], 550164[F], 550165[F] ARHGAP1
550155[F], 550158[F], 550159[F], 550161[F], 550167[F], 550168[F], , 550169[F; 550171[F], 550174[F], 550175[F], 550176[F] 0 (79658)
550170[F], 550172[F], 550173[F], 550177[F], 550178[F], 550181 [F], , 550180[F " 550182[F], 550183[F], 550184[F], 550187[F] &
550185[F], 550186[F], 550191[F], 550192[F], 550196[F], 550197[F], , 550189[F; 550190[F], 550193[F], 550194[F], 550195[F] Arhgapl 0
550211[F], 550212[F], 550215[F], 550218[F], 550219[F], 550220[F], , 550199[F " 550200[F], 550201 [F], 550202[F], 550203[F] (78514)
550221[F], 550227[F], 550229[F], 550235[F], 550236[F], 550237[F], , 550205[F; 550206[F], 550207[F], 550208[F], 550209[F]
550238[F], 550239[F], 550248[F], 550256[F], 550259[F], 550262[F], , 550213[F " 550214[F], 550216[F], 550217[F], 550222[F]
550264[F], 550266[F], 550267[F], 550268[F], 550270[F], 550271 [F], , 550224[F; 550225[F], 550226[F], 550228[F], 550230[F]
550278[F], 22322[853]
, 550232[F " 550233[F], 550234[F], 550240[F], 550241 [F]
, 550243[F; 55024 4 [F], 5502 4 5[F], 5502 4 6[F], 550247[F]
, 550250[F " 550251[F], 550252[F], 550253[F], 550254[F]
, 550257[F; 550258[F], 550260[F], 550261 [F], 550263[F]
, 550269[F; 550272[F], 550273[F], 550274]F], 550275[F]
, 550277[F;
620287[F], 792610[F], 792611[F], 792612[F], 792613[F], 792614[F],
792615[F], 792616[F], 792617[F], 792618[F], 792619[F], 792621 [F],
792622[F], 792623[F], 792624[F], 792625[F], 792626[F], 792627[F],
792628[F], 792629[F], 792631[F], 792632[F], 792633[F], 792634[F],
792635[F], 792637[F], 792638[F], 792639[F], 792641 [F], 792642[F],
792622[8], 792621 [-180], 792619[-429], 792618[-584], 792617[-788],
ARHGAP1 792616[-956], 792615[-1121], 792614[-1330], 792613[-1422],
620286[F], 792620[F], 792630[F], 792636[F], 792640[F], 792620]- 1A (9824) 792612[-1671], 792611 [-1700], 620285[-1970], 792609[-2326],
408], 620284[-1970], 4847[F], 345041[F], 345047[F], 345054[F], & 792610[-2752], 792608[-3013], 4848[F], 345026[F], 345027[F],
345064[F], 345068[F], 4845[-2365] Arhgapl 1a 345028[F], 345029[F], 345030[F], 345031 [F], 345032[F], 345033[F],
(228482) 3 4 5034[F], 345035[F], 345036[F], 345037[F], 345038[F], 345039[F],
3 4 5040[F], 345042[F], 345043[F], 3450 44 [F], 345045[F], 345046[F],
345048[F], 345049[F], 345050[F], 345051 [F], 345052]F], 345053[F],
345055[F], 345056[F], 345057[F], 345058[F], 345059[F], 345060[F],
345061 [F], 345062[F], 345063[F], 345065[F], 345066[F], 345067[F],
345069[F], 345070[F], 4846[-2365], 345025[-2715], 345024[-3060] TABLE 2 - Page 90 of 1873
648951 [F] 763977[F; 763978[F] 763979[F], 763981 [F], 763982[F],
763984[F] 763985[F 763986[F] 763987[F], 763988[F], 763989[F],
763990[F] 763991 [F 763992[F] 763993[F], 763994[F], 763995[F],
763996[F] 763997[F 763998[F] 763999[F], 764000[F], 764001 [F],
764002[F] 764003[F 764004[F] 764005[F], 764006[F], 764007[F],
764008[F] 764009[F 764010[F] 764012[F], 764013[F], 764015[F],
764016[F] 764017[F 764018[F] 764019[F], 764020[F], 764021[F],
764022[F] 764023[F 764024[F] 764025[F], 764027[F], 76 4 029[F],
764030[F] 764031 [F 764032[F] 920292[19 4 0], 920291[164 4 ],
763976[ 60] 763975I 356], 42892[F], 288612[F], 288613[F], 648950[F], 763980[F], 763983[F], 764011[F], 76 4 014[F], 764026[F],
ARHGAP1 288614[F] 288615[F; 288616[F] 288618[F], 288620[F], 288621[F], 764028[F], 42891[F], 288617[F], 288619[F], 288624[F], 288625[F],
2 (94134) 288622[F] 288623[F; 288626[F] 288627[F], 288628[F], 288629[F], 288632[F], 288634[F], 288637[F], 288651 [F], 288656[F], 288666[F],
& 288630[F] 288631 [F 288633[F] 288635[F], 288636[F], 288638[F], 288670[F], 288680[F], 288683[F], 288684[F], 288685[F], 288686[F],
Ar gap12 288639[F] 288640[F; 288641 [F] 288642[F], 288643[F], 288644[F], 288688[F], 288693[F], 288694[F], 288695[F], 288700[F], 288702[F],
(75415) 288645[F] 288646[F; 288647[F] 288648[F], 288649[F], 288650[F], 288710[F], 288714[F], 288716[F], 288720[F]
288652[F] 288653[F; 288654[F] 288655[F], 288657[F], 288658[F],
288659[F] 288660[F " 288661 [F] 288662[F], 288663[F], 288664[F],
288665[F] 288667[F; 288668[F] 288669[F], 288671 [F], 288672[F],
288673[F] 288674[F " 288675[F] 288676[F], 288677[F], 288678[F],
288679[F] 288681 [F 288682[F] 288687[F], 288689[F], 288690[F],
288691 [F] 288692[F " 288696[F] 288697[F], 288698[F], 288699[F],
288701 [F] 288703[F; 288704[F] 288705[F], 288706[F], 288707[F],
288708[F] 288709[F " 288711[F] 288712[F], 288713[F], 288715[F],
288717[F] 288718[F " 288719[F]
776239[F], 786353[F], 786354[F], 786355[F], 786356]F], 786359[F],
786361 [F], 786362[F], 786366[F], 786367[F], 786369[F], 786370[F],
619491[F], 786352[F], 786357[F], 786358[F], 786360[F], 786363[F], 786371 [F], 786372[F], 786374[F], 786375[F], 786378[F], 786379[F],
786364[F], 786365[F], 786368[F], 786373[F], 786376[F], 786377[F], 786385[F], 786386[F], 786387[F], 786389[F], 786391 [F], 786394[F],
786380[F], 786381[F], 786382[F], 786383[F], 786384[F], 786388[F], 786395[F], 786396[F], 786397[F], 786398[F], 786399[F], 786403[F],
786390[F], 786392[F], 786393[F], 786400[F], 786401 [F], 786402[F], 786404[F], 786405[F], 786407[F], 786408[F], 786410[F], 786412[F],
786406[F], 786409[F], 786411[F], 786413[F], 619490[638968],
619489(638968], 3841 [F], 332775[F], 332776[F], 332778[F],
3842[F], 3843[F], 332774[F], 332777[F], 332784[F], 332786[F], ARHGAP1 332779[F], 332780[F], 332781[F], 332782[F], 332783[F], 332785[F],
332787[F], 332788[F], 332789[F], 332791 [F], 332793[F], 332794[F], 5 (55843) 332790[F], 332792[F], 332795[F], 332796[F], 332797[F], 332799[F],
332798[F], 332800[F], 332802[F], 332803[F], 332808[F], 332809[F], & 332801 [F], 332804[F], 332805[F], 332806[F], 332807[F], 332811[F],
332810[F], 332816[F], 332817[F], 332824[F], 332825[F], 332826[F], Arhgap15 332812[F], 332813[F], 332814[F], 332815[F], 332818[F], 332819[F],
332827[F], 332831[F], 332832[F], 332835[F], 332836[F], 332837[F], (76117) 332820[F], 332821[F], 332822[F], 332823[F], 332828[F], 332829[F],
332838[F], 332839[F], 332843[F], 332845[F], 332846[F], 332847[F], 332830[F], 332833[F], 332834[F], 332840[F], 332841 [F], 332842[F],
332851[F], 332852[F], 332854[F], 332857[F], 332859[F], 332862[F], 332844[F], 332848[F], 332849[F], 332850[F], 332853[F], 332855[F],
332863[F], 332866[F], 332868[F], 332869[F], 332870[F], 332874[F], 332856[F], 332858[F], 332860[F], 332861 [F], 332864[F], 332865[F],
332878[F], 332879[F], 332880[F], 332881 [F], 332882[F], 332884[F], 332867[F], 332871[F], 332872[F], 332873[F], 332875[F], 332876[F],
332886[F], 332887[F], 332888[F], 332891 [F]
332877[F], 332883[F], 332885[F], 332889[F], 332890[F], 332892]- 2746], 332893[-2906]
631925[F], 876465[F], 876466[F], 876467]F], 876468[F], 876469[F], 876470[F], 876471 [F], 876472[F], 876473]F], 876474[F], 876475[F], ARHGAP1 876476[F], 930928(840], 876477[ 1160], 20421 [F], 528928[F], 7 (55114)
20423(133], 528949[-565] 528929[F], 528930[F], 528931 [F], 528932[F], 528933[F], 528934[F], &
528935[F], 528936[F], 528937[F], 528938[F], 528939[F], 528940[F], Ar gap17 528941 [F], 528942[F], 528943[F], 528944[F], 528945[F], 528946[F], (70497) 528947[F], 528948[F], 20422[133] , 528950[-2128], 528951 [-2570]
636581[F], 672310[F], 672311[F], 672312[F], 672313[F], 672314[F],
672315[F], 672317[F], 672318[F], 672320[F], 672325[F], 672309]-
ARHGAP1 1643], 26428[F], 89332[F], 89333[F], 89334[F], 89336[F], 89337[F], 636582[F], 672316[F], 672319[F], 672321 [F], 672322[F], 672323[F],
8 (93663) 89338[F], 89340[F], 89341 [F], 89342[F], 89343[F], 89344[F], 672324[F], 26429[F], 89335[F], 89339[F], 89346[F], 89351 [F],
& 89345[F], 89347[F], 89348[F], 89349[F], 89350[F], 89352[F], 89359[F], 89360[F], 89362[F], 89363[F], 89364[F], 89369[F],
Ar gap18 89353[F], 89354[F], 89355[F], 89356[F], 89357[F], 89358[F], 89371 [F], 89373[F], 89331 [-2087], 89330[-2607]
(73910) 89361 [F], 89365[F], 89366[F], 89367[F], 89368[F], 89370[F],
89372[F], 89374[F], 89329[-2789]
650702[F], 777804[F], 777805[F] 777807[F], 777808[F], 777812[F],
777814[F], 777815[F], 777816[F] 777817[F], 777819[F], 777820[F],
ARHGAP1 777821 [F], 777822[F], 777823[F] 316422[F], 316423[F], 316425[F], 650701[F], 777806[F], 777809[F], 777810]F], 777811 [F], 777813[F],
9 (84986) 316426[F], 316427[F], 316429[F] 316430[F], 316433[F], 316435[F], 777818[F], 316424[F], 316428[F], 316431[F], 316432[F], 316434[F],
& 316436[F], 316438[F], 316439[F] 316441[F], 316442[F], 316443[F], 316437[F], 316440[F], 316445[F], 316447[F], 316453[F], 316454[F],
Ar gap19 316444[F], 316446[F], 316448[F] 316449[F], 316450[F], 316451[F], 316456[F], 316457[F], 316459[F], 45079(35461]
(71085) 316452[F], 316455[F], 316458[F] 316460[F], 316461 [F], 316462[F],
316463[F], 316464[F], 316465[F] 45080(35461] TABLE 2 - Page 91 of 1873
751928[F], 751929[F], 893263[F], 897886[F], 897887[F], 897888[F], ARHGAP2
897885[F], 897889[F], 634995[135390], 634997[28304], 24407[F], 897890[F], 897892[F], 897893[F], 634996[135390], 63 4 998[28304], 0 (57569) 575217[F], 575218[F], 575219[F], 575220[F], 575225[F], 575226[F], 24408[F], 575221[F], 575222[F], 575223[F], 575224[F], 575227[F], & 575232[F], 575234[F], 575237[F], 24409[20247], 575238[- 532] 575228[F], 575229[F], 575230[F], 575231 [F], 575233[F], 575235[F], Ar gap20
575236[F], 24410(20247] (244867)
618983[F] 782636[F] 782638[F] 782639[F] 782640[F] 782641 [F],
782642[F] 782643[F], ; 782644[F] 782645[F] 782646[F] 782647[F],
782648[F] 782650[F], ; 782652[F] 782653[F] 782655[F] 782656[F],
782657[F] 782658[F] 782659[F] 782660[F] 782662[F] 782664[F],
782665[F] 782666[F] 782667[F] 782668[F] 782669]F] 782670[F],
782671 [F] 782672[F] 782673[F] 782675[F] 782676[F] 3244[F],
325870[F] 325872[F] 325873[F] 325874[F] 325875[F] 325876[F], 618982[F], 782635[F] 782637[F], 782649[F], 782651 [F], 782654[F], ARHGAP2 325877[F] 325878[F] 325879[F] 325880[F] 325881 [F] 325882[F], 782661 [F], 782663[F] 782674[F], 3243[F], 325869[F], 325871 [F], 1 (57584) 325883[F] 325884[F] 325885[F] 325886[F] 325888[F] 325889[F], 325887[F], 325890[F] 325897[F], 325900[F], 325905[F], 325908[F], & 325891 [F] 325892[F] 325893[F] 325894[F] 325895[F] 325896[F], 325909[F], 325914[F] 325916[F], 325918[F], 325922[F], 325934[F], Ar gap21 325898[F] 325899[F] 325901 [F] 325902[F] 325903[F] 325904[F], 325940[F], 325943[F] 325945[F] (71435) 325906[F] 325907[F] 325910[F] 325911[F] 325912[F] 325913[F],
325915[F] 325917[F] 325919[F] 325920[F] 325921 [F] 325923[F],
325924[F] 325925[F] 325926[F] 325927[F] 325928[F] 325929[F],
325930[F] 325931 [F] 325932[F] 325933[F] 325935[F] 325936[F],
325937[F] 325938[F] 325939[F] 325941 [F] 325942[F] 325944[F],
325946[F] 325947[F]
643862[F], 725324[F], 725325[F], 725326[F], 725327[F], 725331 [F],
725334[F], 725336[F], 725337[F], 725338[F], 725339[F], 725341 [F],
725343[F], 725344[F], 725345[F], 725346[F], 725347[F], 725348[F],
916530[F], 36029[F], 36031[F], 205505[F], 205506[F], 205507[F], 643863[F], 725328[F] 725329[F], 725330[F], 725332[F], 725333[F], ARHGAP2 205509[F], 205512[F], 205514[F], 205515[F], 205517[F], 205518[F], 725335[F], 725340[F] 725342[F], 36030[F], 205508[F], 205510[F], 2 (58504) 205519[F], 205520[F], 205521[F], 205522[F], 205523]F], 205524[F], 205511[F], 205513[F] 205516[F], 205526]F], 205527[F], 205529[F], & 205525[F], 205528[F], 205531[F], 205532[F], 205535[F], 205537[F], 205530[F], 205533[F] 205534[F], 205536[F], 205541 [F], 205543[F], Ar gap22 205538[F], 205539[F], 205540[F], 205542[F], 205544[F], 205545[F], 205550[F], 205553[F] 205555[F], 205556[F], 205504[-1989] (239027) 205546[F], 205547[F], 205548[F], 205549[F], 205551 [F], 205552[F],
205554[F], 205557[F], 205558[F], 205559[F], 205560[F], 205561 [F],
205562[F], 205563[F], 205564[F], 205565[F]
639900[F], 696142[F], 696143[F], 696145[F], 696146]F], 696147[F],
639901 [F], 639902[F] 696144[F], 696151[F], 696153[F], 696154[F], 696148[F], 696149[F], 696150[F], 696152[F], 696155[F], 696159[F],
696156[F], 696157[F] 696158[F], 696160[F], 696162[F], 696164[F], 696161[F], 696163[F], 696166[F], 696169[F], 696171 [F], 696172[F],
696165[F], 696167[F] 696168[F], 696170[F], 696177[F], 696179[F], 696173[F], 696174[F], 696175[F], 696176[F], 696178[F], 696181[F],
696180[F], 696186[F] 696187[F], 696188[F], 696190[F], 696191[F], ARHGAP2 696182[F], 696183[F], 696184[F], 696185[F], 696189[F], 696193[F],
696192[F], 696194[F] 6961401-584], 30596[F], 30597[F], 137496[F] 3 (57636) 696141[34], 696137[-2258], 696138[-2789], 696139[-3027], 30595[F],
137498[F], 137500[F] 137501[F], 137503[F], 137504[F], 137506[F], & 137495[F], 137497[F], 137499[F], 137502[F], 137505[F], 137507[F],
137510[F], 137513[F] 137518[F], 137520[F], 137521 F], 137522[F], Arhgap23 137508[F], 137509[F], 137511[F], 137512[F], 137514[F], 137515[F],
137529[F], 137530[F] 137533[F], 137534[F], 137536[F], 137537[F], (58996) 137516[F], 137517[F], 137519[F], 137523[F], 137524[F], 137525[F],
137539[F], 137541 [F] 137542[F], 137543[F], 137548[F], 137550[F], 137526[F], 137527[F], 137528[F], 137531[F], 137532[F], 137535[F],
137551 [F], 137552[F] 137553[F], 137554[F], 137556[F], 137494]- 137538[F], 137540[F], 137544[F], 137545[F], 137546[F], 137547[F],
74], 137493[-1926], 137492[-3743], 137490[-4925]
137549[F], 137555[F], 137491[-4202]
626920[F] 840036[F] 840037[F 840038[F], 840040[F], 840044[F]
626921 [F], 840039[F] 840041 [F], 840042[F], 840043[F], 840046[F], 840045[F] 840047[F] 840049[F; 840051 [F], 840052[F], 840053[F]
840048[F], 840050[F] 840056[F], 840057[F], 840060[F], 840061 [F], 840054[F] 840055[F] 840058[F 840059[F], 840064[F], 840065[F]
840062[F], 840063[F] 840066[F], 840067[F], 840068[F], 840069[F], 840071 [F] 840072[F] 840073[F; 840074[F], 840075[F], 840076[F]
840070[F], 840078[F] 917542[F], 917544[F], 917545[F], 917546[F], 840077[F] 840079[F] 840080[F 840081 [F], 840082[F], 840083[F]
917549[F], 917551 [F] 917553[F], 917559[F], 917560F], 917563[F], 917539[F] 917540[F] 917541 [F 917543[F], 917547[F], 917548[F]
917564[F], 917565[F] 917566[F], 917569[F], 917570[F], 917571[F], 917550[F] 917552[F] 917554[F 917555[F], 917556[F], 917557[F] ARHGAP2
917572[F], 917573[F] 917560[-2263], 917559]-2609], 840057]- 917558[F] 917561[F] 917562[F; 917567[F], 917568[F], 917574[F] 4 (83478)
4263], 840056I-4609], 13491[F], 449270[F], 449272[F], 449274[F], 917575[F] 917576[F] 917577[F; 9175771-4507], 13490[F], &
449277[F], 449279[F] 449280[F], 449281 [F], 449282[F], 449283[F], 449269[F] 449271 [F] 449273[F; 449275[F], 449276[F], 449278[F] Ar gap24
449284[F], 449286[F] 449287[F], 449289[F], 449291 [F], 449294[F], 449285[F] 449288[F] 449290[F; 449292[F], 449293[F], 449295[F] (231532)
449296[F], 449297[F] 449299[F], 449301 [F], 449302[F], 449303[F], 449298[F] 449300[F] 449304[F; 449305[F], 449307[F], 449309[F]
449306[F], 449308[F] 449310[F], 449313[F], 449314[F], 449317[F], 449311[F] 449312[F] 449315[F 449316[F], 449321 [F], 449322[F]
449318[F], 449319[F] 449320[F], 449323[F], 449325[F], 449326[F], 449324[F] 449328[F] 449329[F; 449330[F], 449332[F], 449339[F]
449327[F], 449331 [F] 449333[F], 449334[F], 449335[F], 449336[F], 449340[F] 449343[F] 449344[F 449346[F], 449347[F], 449348[F]
449337[F], 449338[F] 449341 [F], 449342[F], 449345[F], 449349[F], 449351 [F] 449352[F] 449353[F; 449355[F], 449356[F], 449357[F]
449350[F], 449354[F] 449360[F], 449361 [F], 449362[F], 449364[F] 449358[F] 449359[F] 449363[F TABLE 2 - Page 92 of 1873
, 855912[F], 855914[F], 855915[F], 855916[F], 855917[F],
, 855919[F], 855920[F], 855921 [F], 855923[F], 855925[F],
628970[F], 855913[F] 855922[F], 855924[F], 855933[F], 855934[F], , 855927[F], 855932[F], 855937[F], 628971 (92016], ARHGAP2
855935[F], 855936[F] 628970(92016], 855924[-4181], 16204[F],
484602[F], 484603[F], 484605[F], 484607[F], 484608[F], 5 (9938) &
484604[F], 484606[F] 484613[F], 484615[F], 48461 [F], 484619[F], , 484610[F], 484611[F], 484612[F], 484614[F], 484616[F], Ar gap25
484625[F], 484626[F] 484628[F], 484630[F], 484632[F], 484633[F], , 484620[F], 484621[F], 484622[F], 484623[F], 484624[F], (232201 )
484634[F], 484636[F] 4846191-3623]
, 484629[F], 484631[F], 484635[F], 484637[F], 484638[F],
, 767245[F], 767246[F], 767247[F] 767248[F], 767251 [F],
, 767253[F], 767254[F], 767255[F] 767256[F], 767260[F],
, 767262[F], 767265[F], 767266[F] 767267[F], 767268[F],
, 767275[F], 767276[F], 767277[F] 767278[F], 767279[F],
, 767281 [F], 767282[F], 767283[F] 767285[F], 767286[F],
, 767289[F], 767290[F], 767291 [F] 767293[F], 767294[F],
, 767297[F], 767300[F], 767302[F] 767303[F], 767304[F], 767249[F], 767250[F], 767257[F] 767258[F], 767259[F], , 767309[F], 767310[F], 767312[F] 767313[F], 767314[F], 767264[F], 767269[F], 767271 [F] 767272[F], 767273[F], , 767319[F], 767320[F], 767321 [F] 767323[F], 767324[F], 767284[F], 767288[F], 767292[F] 767295[F], 767298[F], , 767326[F], 767327[F], 767328[F] 767331 [F], 767333[F], 767301 [F], 767306[F], 767307[F] 767308[F], 767311 [F], , 767335[F], 767337[F], 767338[F] 767339[F], 767342[F], 5 767316[F], 767317[F], 767322[F] 767329[F], 767330[F], , 649336(458277], 649340[10927],, 767347[-642], 43376[F], 767336[F], 767340[F], 767341 [F] 767343[F], 767345[F], 295436[F], 295437[F], 295438[F], 295439[F], 295440[F], 649337[458277], 649341 [10927], 43377[F], 43379[F], ARHGAP2 , 295444[F], 295445[F], 295446[F] 295447[F], 295448[F], 295442[F], 295449[F], 295450[F] 295451 [F], 295457[F], 6 (23092) , 295453[F], 295454[F], 295455[F] 295456[F], 295459[F], 295464[F], 295466[F], 295467[F] 295468[F], 295469[F], & , 295461 [F], 295462[F], 295463[F] 295465[F], 295471 [F], 295481[F], 295485[F], 295491 [F] 295492[F], 295496[F], Ar gap26 , 295473[F], 295474[F], 295475[F] 295476[F], 295477[F], 295498[F], 295502[F], 295503[F] 295504[F], 295507[F], (71302) , 295479[F], 295480[F], 295482[F] 295483[F], 295484[F], 295510[F], 295513[F], 295514[F] 295515[F], 295517[F], , 295487[F], 295488[F], 295489[F] 295490[F], 295493[F], 8 295521 [F], 295524[F], 295526[F] 295527[F], 295529[F], , 295495[F], 295499[F], 295500[F] 295501 [F], 295505[F], 295535[F], 295539[F], 295545[F] 295546[F], 295547[F], , 295509[F], 295511[F], 295512[F] 295516[F], 295519[F], 295560[F], 295561 [F], 295564[F] 295568[F], 295574[F], , 295522[F], 295523[F], 295525[F] 295528[F], 295530[F], 295577[F], 295578[F], 295579[F] 295581 [F], 295582[F], , 295533[F], 295534[F], 295536[F] 295537[F], 295538[F], 43381 (9249], 295584[-1041]
, 295541 [F], 295542[F], 295543[F] 295544[F], 295548[F],
, 295550[F], 295551 [F], 295553[F] 295554[F], 295555[F],
, 295557[F], 295558[F], 295559[F] 295562[F], 295563[F],
, 295566[F], 295567[F], 295569[F] 295570[F], 295571 [F],
, 295573[F], 295576[F], 295580[F] 43380(9249], 295583]-
640217[F], 640219[F], 697784[F], 697785[F], 697786[F], 697788[F],
ARHGAP2 640220(1118], 640221 [-1512], 697789[-2852], 697791 [-4320],
640218[F], 697783[F], 697787[F], 640222[-1512], 697790[-3463], 7 (201176)
697786[-4321], 30930[F], 30932[F], 30933[F], 139969[F], 139970[F] 30931 [F], 139968[F], 139971[F], 139974[F], 139977[F], 30935[-58i ; &
139972[F], 139973[F], 139975[F], 139976[F], 139978[F],
1399801-1902] Ar gap27
30933(1721], 30932[-49], 139972[-302], 30934[-581 ], 139976[-949],
(544817) 139979[-1305], 139981 [-2659], 139982[-3255], 139975[-3526]
761 158[F], 761161[F], 761163[F], 761165[F] 648629(81039],
42467[F], 282698[F], 282703[F], 282704[F] 282705[F], 282708[F], 761 159[F], 761162[F], 761164[F], 761166[F], 761167[F], 761168[F], 282709[F], 282710[F], 282711[F], 282712[F] 282713[F], 282715[F], 761 169[F], 648628[81039], 42466[F], 282699[F], 282700[F], ARHGAP2 , 282717[F], 282720[F], 282723[F] 282725[F], 282731 [F], 282701[F], 282702[F], 282706[F], 282707[F], 282714[F], 282718[F], 8 (79822) , 282734[F], 282735[F], 282736[F] 282737]F], 282738[F], 282719[F], 282721[F], 282722[F], 282724]F], 282726[F], 282727[F], & , 282741 [F], 282743[F], 282744[F] 282745[F], 282746[F], 282728[F], 282729[F], 282730[F], 282732[F], 282740[F], 282742[F], Ar gap28 , 282749[F], 282750[F], 282751 [F] 282753[F], 282754[F], 282748[F], 282752[F], 282755[F], 282756[F], 282757[F], 282761 [F], (268970) , 282759[F], 282760[F], 282763[F] 282764[F], 282765[F], 282762[F], 282769[F], 282770[F], 282771 [F], 282772[F], 282773[F] , 282767[F], 282768[F]
811123[F], 811125[F], 811126[F], 811128[F], 811129[F],
811131[F], 811133[F], 811134[F], 811135[F], 811136[F],
ARHGAP2 811138[F], 811139[F], 623077(65848], 8392[F],
811 124[F], 811127[F], 811132[F], 623078(65848], 8393[F], 9 (9411 ) & 384429[F], 384430[F], 384431 [F], 384433[F], 384434[F],
384432[F], 384435[F], 384438[F], 384443(F], 384444(F) Ar gap29 384437[F], 384439[F], 384440[F], 384441 [F], 384442[F],
(214137) 384446[F], 384447[F], 384448[F], 384449[F], 384450[F],
384452[F]
656567[F], 667554[F], 667556[F], 667561 [F], 667562[F], 667563[F],
667564[F], 667565[F], 667566[F], 618374(23015], 618372[-343],
618376[-954], 692032[-1068], 667552[-1392], 667551 [-2382], 667553[F], 667555[F], 667557[F], 667558[F], 667559[F], 667560[F], ARHGAP3 667568[-4054], 667550[-4133], 667570[-4723], 692033[-4726], 618375[23015], 618373[-343], 618377[-954], 667567[-1509], 0 (257106) 667548[-4874], 2487[F], 79368[F], 79369[F], 79370[F], 79371 [F], 667569[-4170], 667549[-4280], 2488[F], 79367[F], 79372[F], & 79373[F], 79374[F], 79376[F], 79377[F], 79381 [F], 79382[F], 79375[F], 79378[F], 79379[F], 79380[F], 2486[-360], 2490[-1072], Arhgap30 79383[F], 79384[F], 79385[F], 79386[F], 79387[F], 79388[F], 2485[- 79390[-1612], 79363[-3742], 79392[-3895], 79393[-4678] (226652) 360], 79389[-430], 79366[-1023], 2489[-1072], 79365[-1880], 79391 [ ■
3302], 79364[-3605], 79362[-4361 ] TABLE 2 - Page 93 of 1873
646973[F], 748512[F], 748513[F], 748514[F], 748515[F], 748516[F],
748517[F], 748518[F], 748519[F], 748520[F], 748521 [F], 748522[F],
646972[F], 748523[F], 748526[F], 748528[F], 748529[F], 748534[F], ARHGAP3 748524[F], 748525[F], 748527[F], 748530[F], 748531 [F], 748533[F],
748535[F], 748536[F], 748537[F], 748538[-94], 40144[F], 255031 [F] 1 (57514) 40145[F], 255021 [F], 255022[F], 255023[F], 255024[F], 255025[F],
255033[F], 255035[F], 255040[F], 255041 [F], 255044[F], 255045[F], & 255026[F], 255027[F], 255028[F], 255029[F], 255030[F], 255032[F],
255051[F], 255052[F], 255053[F], 255054[F], 255056[F], 255057[- Ar gap31 255034[F], 255036[F], 255037[F], 255038[F], 255039[F], 255042[F],
88] (12549) 255043[F], 255046[F], 255047[F], 255048[F], 255049[F], 255050[F],
255055[F]
634598[F], 634599[F], 895500[F], 895501 [F], 895502[F], 895503[F], 895504[F], 895505[F], 895506[F], 895507[F], 895508[F], 895509[F], 895510[F], 895511[F], 895512[F], 895513[F], 895514[F],
ARHGAP3 634599(101741], 895504[-3891], 23941 [F], 23942[F], 570999[F],
2 (9743) & 571000[F], 571001[F], 571002[F], 571003[F], 571004[F], 571005[F],
Ar gap32 571006[F], 571007[F], 571008[F], 571009[F], 571010[F], 571011[F],
(330914) 571012[F], 571013[F], 571014[F], 571015[F], 571016[F], 571017[F], 571018[F], 571019[F], 571020[F], 571021[F], 571022[F], 571023[F], 571024[F], 571025[F], 23942[83602], 571010[-3268]
867165[F], 867166[F], 867167[F], 867168[F], 867171 [F], 867173[F], ARHGAP3
867164[F], 867169[F], 867170[F], 867172[F], 630505(13290], 867174[F], 630504(13290], 630503[-2], 867163[-3549], 885312]- 3 (115703) 928998(1038], 885313[-962], 18511[F], 508710[F], 508715[F], 3736], 8671621-3917], 18510[F], 508711[F], 508712[F], 508713[F], & 508716[F], 508717[F], 508719[F] 508714[F], 508718[F], 508720[F], 508721 [F], 18509[-2], 508709]- Ar gap33
3178], 508708[-3545], 18512[-4123], 508707[-4404], 508722[-4537] (233071)
630083[F] 864855[F], 864857[F] 864858[F] 864860]F] 864862[F]
864863[F] 864864[F], 864865[F] 864867[F] 864868[F] 864870[F]
864871 [F] 864873[F], 864874[F] 864876[F] 864877[F] 864878[F]
864879[F] 864881 [F], 864882[F] 864883[F] 864884[F] 864885[F]
864886[F] 17866[F], 504027[F]. 504030[F], 504032[F] 504033[F],
630082[F], 864853[F], 864854[F] 864856[F], 864859[F], 864861 [F], 504035[F] 504038[F], 504039[F] 504040[F] 504041 [F] 504043[F]
864866[F], 864869[F], 864872[F] 864875[F], 864880[F], 17865[F], 504044[F] 504046[F], 504047[F] 504048[F] 504049[F] 504050[F]
504028[F], 504029[F], 504031 [F] 504034[F], 504036[F], 504037[F], 504051 [F] 504052[F], 504054[F] 504055[F] 504056[F] 504057[F] ARHGAP3
504042[F], 504045[F], 504053[F] 504058[F], 504061 [F], 504065[F], 504059[F] 504060[F], 504062[F] 504063[F] 504064[F] 504066[F] 5 (2909) &
504067[F], 504068[F], 504074[F] 504078[F], 504082[F], 504087[F], 504069[F] 504070[F], 504071 [F] 504072[F] 504073[F] 504075[F] Grl l
504102[F], 504103[F], 504104[F] 504107[F], 504111 [F], 504116[F], 504076[F] 504077[F], 504079[F] 504080[F] 504081 [F] 504083[F] (232906)
504117[F], 504120[F], 504128[F] 504130[F], 504131 [F], 504132[F], 504084[F] 504085[F], 504086[F] 504088[F] 504089[F] 504090[F]
504133[F], 504134[F], 504135[F] 504137[F], 17867(1171], 504140[- 504091 [F] 504092[F], 504093[F] 504094[F] 504095[F] 504096[F]
1567], 504141[-1941], 504142[-3216]
504097[F] 504098[F], 504099[F] 504100[F] 504101 [F] 504105[F]
504106[F] 504108[F], 504109[F] 504110[F] 504112[F] 504113[F]
504114[F] 504115[F], 504118[F] 504119[F] 504121 [F] 504122[F]
504123[F] 504124[F], 504125[F] 504126[F] 504127[F] 504129[F]
504136[F] 504138[F], 504139[F] 17868(1171]
ARHGAP3
651357[F], 909866[F], 909867[F], 909869[F], 909862[-1686],
651356[F], 909863[F], 909864[F], 909865[F], 909868[F], 46078[F], 6 (158763)
909861 [-3888], 46079[F], 600646[F], 600648[F], 600649[F],
600643[F], 600644[F], 600645[F], 600647[F], 600650[F], 600651 [F] &
600652[F], 600653[F], 600642[-1623], 600641]-3769]
Ar gap36
645573[F], 738174[F], 738175[F], 738177[F], 738181 [F], 738182[F],
738183[F], 738184[F], 738185[F], 738187[F], 738188[F], 738189[F],
38444[F], 234169[F], 234170[F], 234171 [F], 234172[F], 234173[F],
645572[F], 738176[F], 738178[F], 738179[F], 738180[F], 738186[F], 234175[F], 234176[F], 234182[F], 234183[F], 234184[F], 234185[F],
932198[199], 738173[-1801], 38443[F], 234174[F], 234177[F], ARHGAP3 234189[F], 234190[F], 234191[F], 234192[F], 234193[F], 234194[F],
234178[F], 234179[F], 234180[F], 234181[F], 234186[F], 234187[F], 9 (80728) 234195[F], 234196[F], 234197[F], 234198[F], 234199[F], 234202[F],
234188[F], 234200[F], 234201 [F], 234203[F], 234207[F], 234209[F], & 234204[F], 234205[F], 234206[F], 234208[F], 234210[F], 234211[F],
234217[F], 234218[F], 234220[F], 234222[F], 234228[F], 234232[F], Arhgap39 234212[F], 234213[F], 234214[F], 234215[F], 234216[F], 234219[F],
234233[F], 234234[F], 234235[F], 234241 [F], 234245[F], 234250[F], (223666) 234221 [F], 234223[F], 234224[F], 234225[F], 234226[F], 234227[F],
2341681-1411], 234166[-4603]
234229[F], 234230[F], 234231[F], 234236[F], 234237[F], 234238[F],
234239[F], 234240[F], 234242[F], 234243[F], 234244[F], 234246[F],
234247[F], 234248[F], 234249[F], 234167[-4204]
651546[F], 910945[F], 910946[F], 910947[F], 910948[F], 910949[F],
910950[F], 910952[F], 910955[F], 651544(1164], 910956[-2252], ARHGAP4
651545[F], 910951[F], 910953[F], 910954[F], 910957[-2392],
910960[-3893], 910961 [-4305], 910962[-4543], 46371[F], 603094[F], (393) &
910958[-3774], 910959[-3873], 46370[F], 603100[F], 603104[F],
603095[F], 603096[F], 603097[F], 603098[F], 603099[F], 603101 [F], Arhgap4
603105[F], 603110[-4321]
603102[F], 603103[F], 603106[F], 603107[F], 603108[F], (171207) 46369(1152], 603109[-4202], 603111 [-4955]
ARHGAP4
798830[F], 798831[F], 798834[F], 798836[F], 621158(48121], 798832[F], 798833[F], 798835[F], 621159(48121], 5874[F],
0 (343578) 5873[F], 357188[F], 357191 [F], 357194[F], 357196[F], 357197[F], 357189[F], 357190[F], 357192[F], 357193[F], 357195[F], 357198[F],
& 357200[F], 5871 [-4594] 357199[F], 5872[-4594]
Arhgap40 TABLE 2 - Page 94 of 1873
893572[F; 893575[F] 893579[F] 893580[F] 893581 [F]
893584[F; 893585[F] 893586[F] 893588[F] 893589[F]
893591 [F 893592[F] 893593[F] 893594[F] 893595[F]
893597[F " 893598[F] 893600[F] 893602[F] 893603[F]
893605[F; 893606[F] 893607[F] 893608[F] 893609[F]
893611[F 893612[F] 23558[F] 566848[F], 566851 [F],
634316[F], 893573[F] 893574[F], 893576[F], 893577[F], 893578[F], 566853[F; 566859[F] 566860[F] 566862[F] 566863[F]
893583[F], 893587[F] 893599[F], 893601 [F], 23557[F], 566849[F], 566865[F " 566866[F] 566867[F] 566868[F] 566869[F] ARHGAP4
566850[F], 566854[F] 566855[F], 566856[F], 566857[F], 566858[F], 566871 [F 566872[F] 566873[F] 566874[F] 566875[F] 2 (143872)
566861 [F], 566879[F] 566881 [F], 566883[F], 566884[F], 566885[F], 566877[F " 566878[F] 566880[F] 566882[F] 566886[F] &
566887[F], 566894[F] 566896[F], 566903[F], 566907[F], 566915[F], 566889[F; 566890[F] 566891 [F] 566892[F] 566893[F] Arhgap42
566919[F], 566920[F] 566924[F], 566925[F], 566927[F], 566928[F], 566897[F; 566898[F] 566899[F] 566900[F] 566901 [F] (71544)
566929[F], 566930[F] 566933[F], 566941 ]F], 566943[F], 566951 [F], 566904[F; 566905[F] 566906[F] 566908[F] 566909[F]
566953[F], 23559(2727], 566956] 4485]
566911[F 566912[F] 566913[F] 566914[F] 566916[F]
566918[F; 566921 [F] 566922[F] 566923[F] 566926[F]
566932[F; 566934[F] 566935[F] 566936[F] 566937[F]
566939[F; 566940[F] 566942[F] 566944[F] 566945[F]
566947[F " 566948[F] 566949[F] 566950[F] 566952[F]
23560[2727], 566955]- 4325]
638966[F] 689273[F " 689275[F 689277[F 689280[F], 689281 [F]
689282[F] 689283[F; 689284[F; 689285[F; 689286[F], 689287[F]
689288[F] 689290[F " 689292[F 689293[F 689294[F], 689295[F]
689296[F] 689297[F; 689298[F; 689302[F; 689303[F], 689304[F]
689307[F] 689308[F; 689309[F; 689310[F; 689312]F], 689313[F]
689315[F] 689316[F; 689320[F; 689323[F; 689325[F], 689326[F]
689327[F] 689328[F; 689329[F; 689330[F; 689331 [F], 689332[F] 638965[F], 689274[F], 689276[F], 689278[F], 689279[F], 689289[F], 689333[F] 689335[F; 689336[F; 689337[F; 689339[F], 689340[F] 689291[F], 689299[F], 689300[F], 689301[F], 689305[F], 689306[F], 689342[F] 689343[F; 689344[F; 689347[F; 638968(1047], 689311[F], 689314[F], 689317[F], 689318[F], 689319[F], 689321[F], 29551 [F]. 125786[F], 25788[F]. 25790[F] 25793[F], 125794[F], 689322[F], 689324[F], 689334[F], 689338[F], 689341 [F], 689345[F], 125795[F] 125796[F 125797[F 125798[F 125799[F], 125800[F] 689346[F], 638967[1047], 638964[37], 689272[-754], 689271]- 125801 [F] 125802[F 125803[F 125804[F 125806[F] 125807[F] 2103], 689270[-2794], 29550[F], 125787[F], 125789[F], 125791 [F], ARHGAP4 125808[F] 125810[F " 125812[F 125813[F 125815[F] 125816[F] 125792[F], 125805[F], 125809[F], 125811[F], 125814[F], 125817[F], 4 (9912) & 125818[F] 125819[F; 125820[F 125821 [F 125823[F] 125824[F] 125822[F], 125826[F], 125834[F], 125835[F], 125836[F], 125840[F], Arhgap44 125825[F] 125827[F 125828[F 125829[F 125830[F] 125831 [F] 125841[F], 125847[F], 125851[F], 125853[F], 125857[F], 125858[F], (216831) 125832[F] 125833[F 125837[F 125838[F 125839[F] 125842[F] 125862[F], 125863[F], 125864[F], 125865[F], 125868[F], 125871[F], 125843[F] 125844[F 125845[F 125846[F 125848[F] 125849[F] 125875[F], 125876[F], 125883[F], 125886[F], 125888[F], 125889[F], 125850[F] 125852[F 125854[F 125855[F 125856[F] 125859[F] 125896[F], 125899[F], 125907[F], 125911[F], 125915[F], 125918[F], 125860[F] 125861 [F 125866[F 125867[F 125869[F] 125870[F] 125923[F], 125924[F], 29552[976], 29549[37], 125785[-445],
125872[F] 125873[F 125874[F; 125877[F; 125878[F] 125879[F] 1257841-1658], 125783[-2287]
125880[F] 125881 [F 125882[F; 125884[F; 125885[F] 125887[F]
125890[F] 125891 [F 125892[F; 125893[F; 125894[F] 125895[F]
125897[F] 125898[F 125900[F; 125901 [F; 125902[F] 125903[F]
125904[F] 125905[F 125906[F 125908[F 125909[F] 125910[F]
125912[F] 125913[F " 125914[F 125916[F 125917[F] 125919[F]
125920[F] 125921 [F 125922[F 125925[F 29553(976]
641146[F], 704520[F], 704521[F], 704522[F], 704523[F], 704524[F],
704525[F], 704526[F], 704528[F], 704529[F], 704531 [F], 704532[F],
704534[F], 704535[F], 704536[F], 704538[F], 704539[F], 704540[F],
704541 [F], 704543[F], 704544[F], 704545[F], 704546[F], 704547[F],
704548[F], 704549[F], 704550[F], 704551 [F], 704552]F], 704553[F],
704554[F], 704555[F], 704556[F], 704557[F], 704559[F], 704561 [F],
704562[F], 704565[F], 704566[F], 704567[F], 704568[F], 704569[F],
641147[F], 704527[F], 704530[F], 704533[F], 704537[F], 704542[F], 921832[1922], 933318(945], 704519[-78], 704518[-1055], 32169[F],
704558[F], 704563[F], 704564[F], 933317[-2055], 704517[-4055], ARHGAP5 32171[F], 156231[F], 156232[F], 156234[F], 156235[F], 156237[F],
32170[F], 32172[F], 156230[F], 156233[F], 156236[F], 156240[F], (394) & 156238[F], 156239[F], 156241[F], 156242[F], 156243[F], 156244[F],
156245[F], 156256[F], 156257[F], 156258[F], 156271 [F], 156274[F], Arhgap5 156246[F], 156247[F], 156248[F], 156249[F], 156250[F], 156251[F],
156275[F], 156283[F], 156285[F], 156289[F], 156290[F], 156292[F], (11855) 156252[F], 156253[F], 156254[F], 156255[F], 156259[F], 156260[F],
156296[F]
156261[F], 156262[F], 156263[F], 156264[F], 156265[F], 156266[F],
156267[F], 156268[F], 156269[F], 156270[F], 156272[F], 156273[F],
156276[F], 156277[F], 156278[F], 156279[F], 156280[F], 156281[F],
156282[F], 156284[F], 156286[F], 156287[F], 156288[F], 156291[F],
156293[F], 156294[F], 156295[F], 156297[F], 156298[F], 156299[F],
156300[-440], 156301[-833], 156229[-3389], 156228[-3459], 156227]- 3579], 156226[-3948], 156302[-3950], 156225]-4947] TABLE 2 - Page 95 of 1873
652249[F], 652251[F], 652252[F], 916120[F], 916121 [F], 916124[F], 652248[F], 652250[F], 916122[F], 916123[F], 916126[F], 916127[F], 916125[F], 916128[F], 916129[F], 916130[F], 916131 [F], 916135[F], 916132[F], 916133[F], 916134[F], 916137[F], 916138[F], 916140[F], 916136[F], 916139[F], 916143[F], 916144[F], 916145[F], 916146[F], 916141[F], 916142[F], 916147[F], 916149[F], 916152[F], 916154[F], 916148[F], 916150[F], 916151[F], 916153[F], 916155[F], 916157[F], 916156[F], 916158[F], 916159[F], 916161[F], 916163[F], 916165[F], 916160[F], 916162[F], 916164[F], 916166[F], 916167[F], 916168[F], 916169[F], 916170[F], 916159[-3036], 916169[-3717], 916170[-4633] 916166[-521], 916167[-618], 916168[-1220], 47397[F], 47399[F],
47396[F], 47398[F], 616128[F], 616131[F], 616132[F], 616133[F], 47400[F], 616127[F], 616129[F], 616130[F], 616134[F], 616135[F], ARHGAP6 616138[F], 616139[F], 616141[F], 616142[F], 616145[F], 616146[F], 616136[F], 616137[F], 616140[F], 616143[F], 616144[F], 616147[F], (395) & 616149[F], 616151[F], 616152[F], 616153[F], 616154[F], 616155[F], 616148[F], 616150[F], 616156[F], 616157[F], 616158[F], 616160[F], Arhgap6 616159[F], 616161[F], 616163[F], 616164[F], 616166[F], 616169[F], 616162[F], 616165[F], 616167[F], 616168[F], 616172[F], 616173[F], (11856) 616170[F], 616171[F], 616176[F], 616183[F], 616184[F], 616186[F], 616174[F], 616175[F], 616177[F], 616178[F], 616179[F], 616180[F], 616188[F], 616192[F], 616195[F], 616199[F], 616200[F], 616202[F], 616181[F], 616182[F], 616185[F], 616187[F], 616189[F], 616190[F], 616203[F], 616205[F], 616206[F], 616208[F], 616209[F], 616210[F], 616191[F], 616193[F], 616194[F], 616196[F], 616197[F], 616198[F], 616211[F], 616212[F], 616215[F], 616217[F], 616220[F], 616222[F], 616201[F], 616204[F], 616207[F], 616213[F], 616214[F], 61B216[F], 616224[F], 616228[F], 616229[F] 616218[F], 616219[F], 616221[F], 616223[F], 616225[F], 616226[F],
616227[F], 616182[-214], 616181[-958]
645865[F], 740234[F], 740236[F], 740237[F], 740238[F], 740239[F],
740240[F], 873469[F], 873470[F], 873471 [F], 873472[F], 873473[F], 645866[F], 740235[F], 740241 [F], 740242[F], 38810[F], 238054[F], ARHGAP8 38809[F], 238055[F], 238056[F], 238059[F], 238061 [F], 238062[F], 238057[F], 238058[F], 238060[F], 238063[F], 238065[F], 238068[F], (23779) & 238064[F], 238066[F], 238067[F], 238069[F], 238070[F], 238071 [F], 238072[F], 238074[F], 238075[F], 238079[F], 238082[F], 238083[F], Arhgap8 238073[F], 238076[F], 238077[F], 238078[F], 238080[F], 238081 [F], 238088[F], 238089[F], 238090[F] (73167) 238084[F], 238085[F], 238086[F], 238087[F], 238091 [-2058]
637930[F], 681612[F], 637930[7339], 929317[1651], 929318(1437],
ARHGAP9 929319[995], 929320(872], 681614[-349], 681615[-563], 681616[- 637931[F], 681610[F], 681611[F], 681613[F], 637931 (7339],
(64333) & 1005], 681617[-1128], 929321[-3211], 28218[F], 110454[F], 681611[-1510], 681610[-1573], 929322[-3985], 28219[F], 110455[F]
Arhgap9 28220(4687], 110456( 259], 110457( 473], 110458( 927], 110459[- 28221(4687], 110453( 1660], 110452( 1759], 28223( 2446]
(216445) 10501, 28222f-24461, 110460[-4671
640668[F], 700933[F], 700934[F], 700935[F], 700936[F], 700937[F],
700938[F], 700939[F], 700940[F], 700941 [F], 700942[F], 700943[F],
ARHGDIA
700944[F], 857712[F], 857713[F], 857715[F], 857716[F], 857717[F],
(396) & 857718[F], 857719[F], 640668(3680], 640669(3234], 700944[-402], 640667[F], 857714[F], 928181[-4807], 31462[-3900], 146263[-3973]
Arhgdia 31463[F], 146264[F], 146265[F], 146266[F], 146267[F], 146268[F],
(192662) 146269[F], 146270[F], 146271[F], 146272[F], 146273[F], 146274[F],
146275[F], 31464(3042], 146276[-995], 146277[-1210]
629693[F], 629694[F], 862328[F], 862329(F], 862330[F], 862331 [F],
ARHGDIB
862332[F], 862333[F], 629691 [-3441], 862327[-3957], 862334[-
629695[F], 629692[-3441] 8623261-4325], 17159[F], 17156[-1527], (397) &
4191], 17157[F], 17158[F], 497591 [F], 497592[F], 497593[F],
4975891-2221] Arhgdib
497594[F], 497595[F], 497596[F], 497597[F], 17155[-1527], 497590|
(11857) 1873], 4975981-2149], 497599[-4652]
647863[F], 755410[F], 647861[-109], 755409[-2324], 647859[-4436], ARHGDIG
647864[F], 755411[F], 647862[-109], 647860[-4436], 647866[-4640],
647865[-4640], 755408[-4874], 755407[-4951], 41476[F], 270952[F]. (398) & 41477[F], 270953[F], 41475[-94], 270951[-474], 41479[-1589], 41473
41474[-94], 41478[-1589], 270950[-1911], 270954[-2241], 41472[- Arhgdig 3363]
3363], 270949[-3822], 270948[-3911], 270947[-4194] (14570)
630263[F], 865524[F], 865525[F], 865526[F], 865527[F], 865529[F], 630264[F], 865523[F], 865528[F], 865532[F], 865533[F], 865534[F], 865530[F], 865531[F], 865536[F], 865538[F], 865524[-61], 630261[- 865535[F], 865537[F], 865539[F], 630262[-942], 865523[-1089], ARHGEF1 942], 18206[F], 505721 [F], 505723[F], 505724[F], 505725[F], 704477[-1969], 865522[-1969], 18207[F], 505720[F], 505722[F], (9138) & 505726[F], 505727[F], 505728[F], 505730[F], 505731 [F], 505732[F], 505729[F], 505733[F], 505734[F], 505735[F], 505736[F], 505737[F], Arhgefl 505739[F], 505741[F], 505721[-26], 18204[-786], 505718[-4648], 505738[F], 505740[F], 505742[F], 18205[-786], 505720[-1217], (16801) 505716[-4860] 505719[-1273], 505717[-4693]
632605[F], 766937[F], 800166[F], 800167[F], 800168[F], 880530[F],
880532[F], 880533[F], 880535[F], 880536[F], 880538[F], 880539[F], 632606[F], 880529[F] 880531 [F], 880534[F], 880537[F], 880544[F], 880540[F], 880541 [F], 880542[F], 880543[F], 880546[F], 21300[F], 880545[F], 880547[F] 880548[F], 21301 [F], 537424[F], 537426[F], ARHGEF1 537425[F], 537427[F], 537429[F], 537430[F], 537431 [F], 537432[F], 537428[F], 537433[F] 537434[F], 537439[F], 537443[F], 537444[F], 0 (9639) & 537435[F], 537436[F], 537437[F], 537438[F], 537440[F], 537441 [F], 537449[F], 537454[F] 537458[F], 537459[F], 537461 [F], 537462[F], Arhgefl 0 537442[F], 537445[F], 537446[F], 537447[F], 537448[F], 537450[F], 537463[F], 537464[F] 537467[F], 537469[F], 537470[F], 537471 [F], (234094) 537451 [F], 537452[F], 537453[F], 537455[F], 537456[F], 537457[F], 537472[F], 537473[F]
537460[F], 537465[F], 537466[F], 537468[F], 21299[-3462] TABLE 2 - Page 96 of 1873
625394[F], 828741[F], 828742[F] 828743[F], 828748[F], 828750[F],
828751 [F], 828753[F], 828754[F] 828757[F], 828760[F], 828761 [F],
828762[F], 828763[F], 828764[F] 828766[F], 828768[F], 828769[F],
828744[F], 828745[F], 828746[F] , 828747[F], 828749[F], 828752[F], 828771 [F], 828772[F], 828774[F] 828776[F], 828777[F], 828779[F],
828755[F], 828756[F], 828758[F] , 828759[F], 828765[F], 828767[F], 828780[F], 828782[F], 828783[F] 625393[158035], 828785[-389],
828770[F], 828773[F], 828775[F] , 828778[F], 828781 [F], 828784[F],
828777[-3866], 11372[F], 11373[F], 420931[F], 420932[F]
625392(158035], 828786[-569], 11371[F], 420934[F], 420935[F],
420933[F], 420938[F], 420939[F] 420945[F], 420946[F], 420948[F], ARHGEF1
420936[F], 420937[F], 420940[F] , 420941 [F], 420942[F], 420943[F], 420949[F], 420951[F], 420952[F] 420954[F], 420955[F], 420957[F], 0L (55160)
420944[F], 420947[F], 420950[F] , 420953[F], 420956[F], 420961 [F], 420958[F], 420959[F], 420960[F] 420963[F], 420966[F], 420970[F], &
420962[F], 420964[F], 420965[F] , 420967[F], 420968[F], 420969[F], 420971 [F], 420972[F], 420973[F] 420974[F], 420975[F], 420976[F], ArhgeflOI
420980[F], 420981 [F], 420982[F] , 420984[F], 420987[F], 420991 [F], 420977[F], 420978[F], 420979[F] 420983[F], 420985[F], 420986[F], (72754)
420992[F], 420996[F], 421000[F] , 421002[F], 421003[F], 421007[F], 420988[F], 420989[F], 420990[F] 420993[F], 420994[F], 420995[F],
421016[F], 421017[F], 421023[F] , 421025[F], 421027[F], 421030[F], 420997[F], 420998[F], 420999[F] 421001[F], 421004[F], 421005[F],
421031[F], 421032[F], 421033[F] , 421034]F], 421035[F], 421025]- 421006[F], 421008[F], 421009[F] 421010[F], 421011 [F], 421012[F],
363], 4210271-4250]
421013[F], 421014[F], 421015[F] 421018[F], 421019[F], 421020[F],
421021[F], 421022[F], 421024[F] 421026[F], 421028[F], 421029[F],
421036[F], 421037[F], 421024[-228], 421026[-1438]
622332[F], 806653[F], 806654[F], 806655[F] 806656[F], 806657[F],
806658[F], 806659[F], 806660[F], 806661 [F] 806662[F], 806663[F],
806664[F], 806666[F], 806667[F], 806669[F] 806671 [F], 806672[F],
622333[F], 806652[F], 806665[F], 806668[F], 806670[F], 806675[F], 806674[F], 806676[F], 806677[F], 806678[F] 806683[F], 806685[F],
806679[F], 806680[F], 806681 [F], 806682[F], 806684[F], 806694[F], 806686[F], 806687[F], 806688[F], 806689[F] 806690[F], 806691 [F],
806700[F], 806702[F], 806703[F], 806704[F], 622336(1443],
806692[F], 806693[F], 806695[F], 806696[F] 806697[F], 806698[F],
806705[-2545], 806706[-2864], 806707[-3553], 7503[F], 7504[F],
806699[F], 806701[F], 622335[1443], 7502[F] , 376153[F] , 376154[F], ARHGEF1
376161[F], 376162[F], 376164[F], 376168[F], 376169[F], 376170[F], 376155[F], 376156[F], 376157[F], 376158[F] 376159[F], 376160[F], 1 (9826) &
376172[F], 376173[F], 376177[F], 376179[F], 376180[F], 376181[F], 376163[F], 376165[F], 376166[F], 376167[F] 376171 [F], 376174[F], Arhge l 1
376183[F], 376184[F], 376186[F], 376190[F], 376194[F], 376195[F], 376175[F], 376176[F], 376178[F], 376182[F] 376185[F], 376187[F], (213498)
376196[F], 376198[F], 376199[F], 376205[F], 376208[F], 376212[F], 376188[F], 376189[F], 376191[F], 376192[F] 376193[F], 376197[F],
376219[F], 376225[F], 376227[F], 376228[F], 376229[F], 376230[F], 376200[F], 376201[F], 376202[F], 376203[F] 376204[F], 376206[F],
7506[1278], 376148[-915], 376231 [-1539], 376232[-1850], 376233]- 376207[F], 376209[F], 376210[F], 376211[F] 376213]F], 376214[F],
2469]
376215[F], 376216[F], 376217[F], 376218[F] 376220[F], 376221 [F],
376222[F], 376223[F], 376224[F], 376226[F] 7505(1278] 3761521-3]
3761511-585], 376150] ■ 713], 3761491-912]
896657[F], 896658[F], 896662[F], 896663[F] 896664[F], 896665[F],
896666[F], 896667[F], 896668[F], 896669[F] 896670[F], 896672[F],
896674[F], 896675[F], 896676[F], 896678[F] 896679[F], 896680[F],
896681 [F], 896682[F], 896683[F], 896685[F] 896687[F], 896690[F],
896691 [F], 896692[F], 896695[F], 896696[F] 896697[F], 896698[F],
896699[F], 896700[F], 896701[F], 896702[F] 896703[F], 896704[F],
896705[F], 896706[F], 896707[F], 896708[F] 634751 (152127], 634752[F], 896671[F], 896673[F], 896677[F], 896684[F], 896686[F], 896710[-636], 634754[-3219], 896711 [-3287], 24143[F], 573084[F], 896688[F], 896689[F], 896693[F], 896694[F], 634750(152127],
573085[F], 573087[F], 573089[F], 573090[F] 573091 [F], 573092[F], 896709(26], 634753[-3219], 24142[F], 24144[F], 573086[F], ARHGEF1 573093[F], 573094[F], 573095[F], 573096[F] 573097[F], 573098[F], 573088[F], 573099[F], 573101[F], 573106[F], 573108[F], 573109[F], 2 (23365) 573100[F], 573102[F], 573103[F], 573104[F] 573105[F], 573107[F], 573111[F], 573118[F], 573124[F], 573133[F], 573135[F], 573136[F], & Arhgefl 2 573110[F], 573112[F], 573113[F], 573114[F] 573115[F], 573116[F], 573138[F], 573142[F], 573144[F], 573148[F], 573152[F], 573153[F], (69632) 573117[F], 573119[F], 573120[F], 573121[F] 573122]F], 573123[F], 573155[F], 573159[F], 573160[F], 573162]F], 573166[F], 573170[F], 573125[F], 573126[F], 573127[F], 573128[F] 573129[F], 573130[F], 573172[F], 573173[F], 573176[F], 24145[-2930], 573179[-4193]
573131[F], 573132[F], 573134[F], 573137[F] 573139[F], 573140[F],
573141[F], 573143[F], 573145[F], 573146[F] 573147[F], 573149[F],
573150[F], 573151[F], 573154[F], 573156[F] 573157[F], 573158[F],
573161[F], 573163[F], 573164[F], 573165[F] 573167[F], 573168[F],
573169[F], 573171[F], 573174[F], 573175[F] 573177[-413], 24146[- 2930], 573178[-2998]
ARHGEF1
639047[F], 639048[F], 689990[F], 689991 [F], 689992[F], 689993[F],
5 (22899)
639049[F], 296381-123], 127022[-3221], 127023[-3856] 29636[F], 127013[F], 127014[F], 127015[F], 127016[F], 127017[F],
& Arhgefl 5 127018[F], 127019[F], 127020[F], 29637[-123], 127021 [-1338]
(442801 ) ARHGEF1
625712[F], 831394[F], 831395[F], 831396[F], 831398[F], 11803[F], 625711[F], 831397[F], 625710(2205], 831393[-340], 11802[F],
6 (27237) 429678[F], 429679[F], 429680[F], 429682[F], 429684[-529], 11800[- 429681 [F], 429683[F], 11801[2129], 429677[-145], 11799[-2747],
& Arhgefl 6 2747], 429673[-3582] 429676[-2779], 429675[-3083], 429674[-3424]
(230972)
631514[F], 873389[F], 873390[F], 873391 [F], 873392[F], 873393[F], ARHGEF1 873394[F], 873395[F], 873396[F], 873388[-1408], 19902[F], 7 (9828) &
522767[F], 522768[F], 522769[F], 522770[F], 522771 [F], 522772[F], Arhgefl 7 522773[F], 522774[F], 522775[F], 522776[F], 522777[F] (207212) TABLE 2 - Page 97 of 1873
632453[F], 879550[F], 879551[F], 879552[F], 879556[F], 879557[F],
879558[F], 879559[F], 879560[F], 879561 [F], 879562[F], 879563[F], 632454[F], 877426[F], 877427[F], 877428[F], 877429[F], 879553[F], 879564[F], 879566[F], 879567[F], 632455[-4389], 21065[F], 879554[F], 879555[F], 879565[F], 879568[F], 879569[F], 879570[F], 534794[F], 534795[F], 534796[F], 534797[F], 534799[F], 534800[F], 879571[F], 879572[F], 632457[-4223], 632456[-4389], 879573[- ARHGEF1 534801 [F], 534804[F], 534805[F], 534806[F], 534807[F], 534811[F], 4542], 21066[F], 534798[F], 534802[F], 534803[F], 534808[F], 8 (23370) 534814[F], 534816[F], 534818[F], 534819[F], 534820[F], 534825[F], 534809[F], 534810[F], 534812[F], 534813[F], 534815[F], 534817[F], & Arhgef18 534826[F], 534827[F], 534828[F], 534829[F], 534830[F], 534831 [F], 534821[F], 534822[F], 534823[F], 534824[F], 534842[F], 534846[F], (102098) 534832[F], 534833[F], 534834[F], 534835[F], 534836[F], 534837[F], 534847[F], 534848[F], 534849[F], 534850[F], 21068[-286], 21069[- 534838[F], 534839[F], 534840[F], 534841 [F], 534843[F], 534844[F], 1437], 534851 [-2408], 21064[-2707], 534852[-3056], 534792[-3671] 534845[F], 21067[-286], 21063[-2707], 534793[-3527]
ARHGEF1
828907[F], 828909[F], 828910[F], 625425(14041], 828906[-281],
9 (128272) 11413[F], 421260[F], 421262[F], 421263[F], 421264[F], 421265[F], 828908[F], 625426(14041], 11414[F], 421261[F], 421266[-13]
& Ar gef19 4212591-263]
(213649)
622401[F], 807104[F], 807107[F], 807108[F], 807110[F], 807112[F],
622402[F], 807105[F], 807106[F], 807109[F], 807111 [F], 807117[F], 807113[F], 807114[F], 807115[F], 807116[F], 807118[F], 807120[F], ARHGEF2
807119[F], 622403[-92], 807103[-2891], 807102[-3678], 807101[- 807104[-222], 622404[-3888], 807121 [-3895], 807100[-4839], (9181)
4251], 807098[-4979]
807099[-4910]
637917[-374], 681521[- 44 7], 681522[-863], 681523[-998], 681524[-
637916[F], 681514[F], 681515[F], 681516[F], 681517[F], 681518[F], 2076], 637915[-2216], 681513[-2681], 681512[-2801], 681525[-2872] ARHGEF2
681519[F], 681520[F], 681520[-424], 637914[-2216], 681511[-3312], 681526[-3044], 681527 [-3155], 637919[-4538], 681528[-4890], 5 (115557)
637918[-4538], 28203[F], 110331[F], 110332[F], 110333[F],
28204[-322], 110338[-393], 110339[-745], 110340[-879], 110341 [- 6 Ar gef25
110334[F], 110335[F], 110336[F], 110337[F], 28201 [-1874], 110328| 1851], 28202[-1874], 110330[-2336], 110329[-2464], 110342[-2860], (52666)
3165], 28205[-4879]
110343[-3032], 110344 [-3143], 28206[-4879]
622098[F], 804858[F], 804861 [F], 804862[F], 804863[F], 804864[F],
622099[F], 804857[F], 804859[F], 804860[F], 804868[F], 804870[F], 804865[F], 804866[F], 804867[F], 804869[F], 804872[F], 804873[F],
804871[F], 804876[F], 804879[F], 804880[F], 80 4 881 [F], 80 4 882[F], ARHGEF2 804874[F], 804875[F], 804877[F], 804878[F], 7196[F], 37224 4 [F],
7197[F], 372242[F], 372243[F], 372245[F], 3722 4 6[F], 372250[F], 6 (2608 4 ) 372247[F], 372248[F], 372249[F], 372251 [F], 372252[F], 372253[F],
372257[F], 372258[F], 372259[F], 372263[F], 372264[F], 372265[F], & Arhgef26 372254[F], 372255[F], 372256[F], 372260[F], 372261 [F], 372262[F],
372266[F], 372272[F], 372276[F], 372277[F], 372278[F], 372279[F], (622434) 372267[F], 372268[F], 372269[F], 372270[F], 372271 [F], 372273[F],
372280[F], 372281 [F], 372282[F]
372274[F], 372275[F]
643731[F], 724201[F], 724202[F], 724203[F], 724204[F], 724205[F],
72 4 207[F], 724208[F], 724215[F], 724219[F], 724225[F], 72 4 227[F],
724229[F], 724230[F], 724231[F], 724234[F], 724235[F], 724236[F],
724237[F], 724238[F], 724239[F], 724242[F], 724243[F], 724244[F],
724245[F], 724246[F], 724247[F], 724248[F], 724249[F], 724252[F],
724253[F], 724254[F], 724256[F], 724257[F], 724258[F], 724260[F], 643732[F] 724206[F] 724209[F], 724210[F], 724211 [F] 724212[F],
724261[F], 724262[F], 724263[F], 724264[F], 724269[F], 724272[F], 724213[F] 724214[F] 724216[F], 724217[F], 724218[F] 724226[F],
724273[F], 724274[F], 724276[F], 724277[F], 724280[F], 724284[F], 724228[F] 724232[F] 724233[F], 724240[F], 724241 [F] 724250[F],
724285[F], 724269[-166], 918015[-376], 724258[-846], 724286[- 724251[F] 724255[F] 724259[F], 724265[F], 724266[F] 724267[F],
2376], 35890[F], 203570[F], 203571 [F], 203572[F], 203574[F], 724268[F] 724270[F] 724271 [F], 724275[F], 724278[F] 724279[F], ARHGEF3
203576[F], 203577[F], 203578[F], 203581[F], 203584[F], 203585[F], 724281[F] 724282[F] 724283[F], 35891 [F], 203573[F] 203575[F], (50650) &
203586[F], 203587[F], 203588[F], 203589[F], 203590[F], 203592[F], 203579[F] 203580[F] 203582[F], 203583[F], 203591 [F] 203599[F], Arhgef3
203593[F], 203594[F], 203595[F], 203596[F], 203597[F], 203598[F], 203601[F] 203607[F] 203614[F], 203623[F], 203624[F] 203625[F], (71704)
203600[F], 203602[F], 203603[F], 203604[F], 203605[F], 203606[F], 203626[F] 203629[F] 203630[F], 203631 [F], 203633[F] 203636[F],
203608[F], 203609[F], 203610[F], 203611[F], 203612[F], 203613[F], 203638[F] 203642[F] 20364 4 [F], 203646[F], 203648[F] 203649[F],
203615[F], 203616[F], 203617[F], 203618[F], 203619[F], 203620[F], 203651[F] 203652[F] 203653[F], 203654[F], 203655[F] 203656[F],
203621[F], 203622[F], 203627[F], 203628[F], 203632[F], 203634[F], 35893[194] 203663[-2886], 203567[-4123]
203635[F], 203637[F], 203639[F], 203640[F], 203641 [F], 203643[F],
203645[F], 203647[F], 203650[F], 203657[F], 203658[F], 203659[F],
35892[194], 203660[-1090], 203661[-1948], 203569[-2131], 203662[- 2716], 203568[-3136], 203664[-3411], 203665[-4619], 203566[-4733],
203666[-4879]
ARHGEF3
762524[F], 762525[F], 762526[F], 762528[F], 762529[F],
3 648782(37672], 648784(17494], 648785(1774], 285527[F], 762522[F], 762523[F], 762527[F], 648783(37672], 762521 [-618],
(10027171 285528[F], 285529[F], 285530[F], 285533[F], 285534[F], 285535[F], 285526[F], 285531[F], 285532[F], 285536[F], 285537F], 285539[F],
5) & 285538[F], 285542[F], 285543[F], 285544[F], 285545[F], 285547[F], 285540[F], 285541 [F], 285546[F], 42663(63000]
Arhgef33 285548[F], 42662(63000], 42664(17494], 42665(521]
(381112) ARHGEF3
649584[F], 769048[F], 769049[F], 769050[F], 649582[-2653],
649583[F], 769047[F], 649581 [-2653], 43689[F], 299308[F], 7 (389337) 43690[F], 299309[F], 299310[F], 299311[F], 299312[F], 299313[F],
299314[F], 299316[F], 299318[F], 43687[-4566] & Arhgef37 299315[F], 299317[F], 299319[F], 43688[-4566]
(328967)
623226[F], 812172[F], 812173[F], 812174[F], 812177[F], 920116[F], 623225[F], 812175[F], 812176[F], 812178[F], 623225(79643], ARHGEF3 920117[F], 623226(79643], 623222[-228], 623224[-1714], 8572[F], 623221[-228], 623223[-1714], 8571[F], 386656[F], 386657[F], 8 (54848) 386653[F], 386654[F], 386655[F], 386658[F], 386663[F], 386665[F], 386659[F], 386660[F], 386661[F], 386662[F], 386664[F], 386667[F], & Ar gef38 386666[F], 386668[F] 386669[F], 386670[F], 386671 [F] (77669) TABLE 2 - Page 98 of 1873
616667[F], 616669[F], 654138[F], 654143[F], 654148[F], 654149[F], 654155[F], 616668[641], 616671[-606], 654156[-2027], 654157]- 2229], 654158[-2819], 654159[-3046], 654160[-3353], 654161 ]-
616666[F], 654139[F], 654142[F], 654144[F], 654145[F], 654146[F], ARHGEF4
3478], 654162[-3820], 654163[-4021], 654164[-4133], 654165]- 654147[F], 654150[F], 654151[F], 654152[F], 654153[F], 654154[F], (50649) &
4356], 654166[-4500], 654167[-4588], 339[F], 341[F], 52146[F],
616670[-606], 338[F], 52147[F], 52148[F], 52149[F], 52150[F], Ar gef4
52152[F], 3431-465], 52153[-1655], 52154[-1802], 52155[-2342],
52151 [F], 342[-465] (226970)
52156[-2571], 52157[-2748], 52158[-2928], 52159[-3047], 52160]- 3339], 52161[-3505], 52145[-3552], 52162[-3619], 52163[-3818],
52164[-3957], 52165[-4064], 52166[-4808]
644082[F], 644083[F], 726614[F], 726615]F], 726616[F], 726617[F],
644081[F], 726613[F], 726619[F], 726621[F], 726622[F], 726624[F], 726618[F], 726620[F], 726623[F], 644085[-194], 726628[-348],
726625[F], 726626[F], 726627[F], 644084[-194], 726631[-1530], 7266291-586], 726630[-1173], 726632[-1606], 726633[-1984],
ARHGEF4 7266361-2695], 726637[-2894], 726638[-3120], 726640[-3349], 7266341-2121], 726635[-2613], 726639[-3234], 726642[-4041],
0 (55701) 7266411-3703], 726643[-4342], 36465[F], 209159[F], 209166[F], 36466[F], 36467[F], 209160[F], 209161[F], 209162[F], 209163[F],
& Arhgef40 209168[F], 209169[F], 209171[F], 209172[F], 209173[F], 209174[F], 209164[F], 209165[F], 209167[F], 209170[F], 36469(172],
(268739) 36468[172], 209178[-1113], 209183[-2700], 209184[-2884], 209185[- 209175[17], 209176[-218], 209177[-810], 209179[-1189], 209180]- 3110], 209187[-3351], 209188[-3717], 209190[-4346] 1977], 209181[-2114], 209182[-2606], 209186[-3224], 209189]- 4041]
ARHGEF5
628462[F], 851702[F], 851703[F], 851704]F], 851705[F], 851707[F],
628461[F], 851699[F], 851700[F], 851701[F], 851706]F], 851710[F], (7984) &
851708[F], 851709[F], 15521[F], 474832[F], 474833[F], 474834[F], 15520[F], 474829[F], 474830[F], 474831 [F], 474836[F], 474840[F] Ar gef5
474835[F], 474837[F], 474838[F], 474839[F]
(54324)
910357[F], 910358[F], 910359[F], 910360[F], 910361 [F], 910364[F],
ARHGEF6 651426[115568], 46208[F], 601597[F], 601598[F], 601599[F], 910362[F], 910363[F], 910365[F], 651425(115568], 46207[F],
(9459) & 601600[F], 601601[F], 601604[F], 601606[F], 601609[F], 601610[F], 601602[F], 601603[F], 601605[F], 601607[F], 601608[F], 601613[F],
Arhgef6 601611[F], 601612[F], 601614[F], 601615[F], 601617[F], 601619[F], 601616[F], 601618[F], 601620[F]
(73341) 601621]F1
632547[F], 880120[F], 880122[F], 880123[F], 880124[F], 880125[F],
880126[F], 880127[F], 880129[F], 880130[F], 880131 [F], 880132[F],
880133[F], 880134[F], 880135[F], 880136[F], 880138[F], 880139[F],
880140[F], 880142[F], 880143[F], 880144[F], 880145[F], 880146[F],
880147[F], 920341[F], 632547[141482], 880123[-225], 880132[-420], 632548[F], 880121[F], 880128[F], 880137[F], 880141 [F], 880148[F], 880131[-492], 632546[-644], 880119[-831], 880130[-926], 21207[F], 632548(141482], 920342(3631], 21208[F], 536137[F], 536140[F], ARHGEF7
536136[F], 536138[F], 536139[F], 536142[F], 536143[F], 536144[F], 536141[F], 536147[F], 536151[F], 536153[F], 536158[F], 536159[F], (8874) & 536145[F], 536146[F], 536148[F], 536149[F], 536150[F], 536152[F], 536160[F], 536164[F], 536167[F], 536171[F], 536173[F], 536175[F], Arhgef7 536154[F], 536155[F], 536156[F], 536157[F], 536161 [F], 536162[F], 536176[F], 536177[F], 536181[F], 536184[F], 536185[F], 536190[F], (54126) 536163[F], 536165[F], 536166[F], 536168[F], 536169[F], 536170[F], 536194[F]
536172[F], 536174[F], 536178[F], 536179[F], 536180[F], 536182[F],
536183[F], 536186[F], 536187[F], 536188[F], 536189[F], 536191[F],
536192[F], 536193[F], 536145[-131], 21206[-593], 536135[-759],
5361911-2794], 536192[-3688], 536144[-4313]
651679[F], 911726[F], 911729[F], 911730[F], 911731 [F], 911732[F],
911733[F], 911736[F], 911738[F], 911739[F], 911741 [F], 911742[F], 651678[F], 911727[F], 911728[F], 911734[F], 911735[F], 911737[F],
ARHGEF9 911743[F], 911745[F], 919642[F], 919643[F], 919644(3535], 911740[F], 911744[F], 919645(2708], 46589[F], 605282[F],
(23229) & 919646(2120], 46590[F], 605281[F], 605284[F], 605286[F], 605283[F], 605285[F], 605291 [F], 60529 4 [F], 605297[F], 605299[F],
Arhgef9 605287[F], 605288[F], 605289[F], 605290[F], 605292[F], 605293[F], 605300[F], 605302[F], 605303[F], 605304[F], 605307[F], 605308[F],
(236915) 605295[F], 605296[F], 605298[F], 605301 [F], 605305[F], 605306[F], 605309[F], 605312[F]
605310[F], 605311[F]
TABLE 2 - Page 99 of 1873
826809[F] 826811[F], 826813[F] 826814[F] 826817[F], 826819[F],
826821 [F] 826822[F], 826823[F] 826824[F] 826825[F], 826827[F],
826828[F] 826829[F], 826830[F] 826831 [F] 826833[F], 826834[F],
826835[F] 826837[F], 826839[F] 826840[F] 826841 [F], 826842[F],
826844[F] 826845[F], 826846[F] 826847[F] 826848[F], 826849[F],
826850[F] 826851 [F], 826854[F] 826856[F] 826859[F], 826860[F],
826862[F] 826863[F], 826864[F] 826865[F] 826866[F], 826867[F],
826868[F] 826869[F], 826870[F] 826872[F] 826875[F], 826876[F], 826808[F], 826810[F], 826812[F], 826815[F], 826816[F], 826818[F], 826877[F] 826879[F], 826880[F] 826881 [F] 826883[F], 826884[F], 826820[F], 826826[F], 826832[F], 826836[F], 826838[F], 826843[F], 826885[F] 826887[F], 826888[F] 826889[F] 625178(86075], 826852[F], 826853[F], 826855[F], 826857[F], 826858[F], 826861 [F], 826890] 2382] 6251 76] ■ 4861], 1 127[F], 417642[F], 417644[F], 826871 [F], 826873[F], 826874[F], 826878[F], 826882[F], 826886[F], ARID1A 417646[F] 417647[F], 417650[F] 417652[F] 417654[F], 417655[F], 625177(86075], 11126[F], 417641 [F], 417643[F], 417645[F], (8289) & 417656[F] 417657[F], 417658[F] 417659[F] 417660[F], 417662[F], 417648[F], 417649[F], 417651 [F], 417653[F], 417661 [F], 417667[F], Arid 1a 417663[F] 417664[F], 417665[F] 417666[F] 417668[F], 417669[F], 417673[F], 417675[F], 417683[F], 417687[F], 417690[F], 417691[F], (93760) 417670[F] 417671[F], 417672[F] 417674[F] 417676[F], 417677[F], 417697[F], 417701[F], 417702[F], 417704[F], 417706[F], 417707[F], 417678[F] 417679[F], 417680[F] 417681[F] 417682[F], 417684[F], 417708[F], 417711[F], 417717[F], 417718[F], 417720[F], 417727[F], 417685[F] 417686[F], 417688[F] 417689[F] 417692[F], 417693[F], 417729[F], 417731[F], 417732[F], 417736[F], 417742[F], 417747[F] 417694[F] 417695[F], 417696[F] 417698[F] 417699[F], 417700[F],
417703[F] 417705[F], 417709[F] 417710[F] 417712[F], 417713[F],
417714[F] 417715[F], 417716[F] 417719[F] 417721 [F], 417722[F],
417723[F] 417724[F], 417725[F] 417726[F] 417728[F], 417730[F],
417733[F] 417734[F], 417735[F] 417737[F] 417738[F], 417739[F],
417740[F] 417741 [F], 417743[F] 417744[F] 417745[F], 417746[F],
417748[F] 417749[F], 417750[F] 417751[-2752]
647492[F] 752791 [F], 752792[F] 752793[F] 752794[F] 752795 [F]
752796[F] 752797[F], 752798[F] 752799[F; 752800[F] 752801 [F]
752803[F] 752804[F], 752805[F] 752806[F; 752807[F] 752808[F]
752810[F] 752811[F], 752812[F] 752814[F 752815[F] 752817[F]
752819[F] 752820[F], 752821 [F] 752822[F; 752823[F] 752829[F]
752830[F] 752831 [F], 752832[F] 752833[F 752834[F] 752835[F]
752836[F] 752838[F], 752841 [F] 752843[F; 752844[F] 752845[F]
752846[F] 752847[F], 752848[F] 752849[F 752850[F] 752851 [F]
752852[F] 752853[F], 752854[F] 752855[F; 752856[F] 752857[F]
752858[F] 752859[F], 752861 [F] 752862[F 752863[F] 752864[F] 647493[F] 752790[F] 752802[F], 752809[F], 752813[F], 752816[F], 752865[F] 752866[F], 752867[F] 752869[F; 752870[F] 752871 [F] 752824[F] 752837[F] 752839[F], 752840[F], 752842[F], 752860[F], 752872[F] 752873[F], 752874[F] 752875[F 752876[F] 752877[F] 752868[F] 752878[F] 752879[F], 752882[F], 752885[F], 752890[F], 752880[F] 752881 [F], 752883[F] 752884[F; 752886[F] 752887[F] 752891 [F] 752892[F] 752893[F], 752895[F], 752897[F], 752900[F], 752888[F] 752889[F], 752894[F] 752896[F; 752898]F] 752899[F] 752909[F] 752916[F] 752918[F], 752921 [F], 752922[F], 40852[F], 752901 [F] 752902[F], 752903[F] 752904[F; 752905[F] 752906[F] 264008[F] 264018[F] 264019[F], 264022[F], 264023[F], 264025[F], ARID1B 752907[F] 752908[F], 752910[F] 752911[F; 752912[F] 752913[F] 264027[F] 264028[F] 264030[F], 264041 [F], 264052[F], 264056[F], (57492) & 752914[F] 752915[F], 752917[F] 752919[F; 752920[F] 40851 [F], 264057[F] 264060[F] 264064[F], 264065[F], 264066[F], 264076[F], Arid 1b 263985[F] 263986[F], 263987[F] 263988[F; 263989[F] 263990[F] 264079[F] 264080[F] 264081 [F], 264083[F], 264091 [F], 264092[F], (239985) 263991 [F] 263992[F], 263993[F] 263994[F; 263995[F] 263996[F] 264112[F] 264113[F] 264125[F], 264131[F], 264136[F], 264137[F], 263997[F] 263998[F], 263999[F] 264000[F 264001 [F] 264002[F] 264139[F] 264141[F] 264145[F], 264149[F], 264150[F], 264155[F], 264003[F] 264004[F], 264005[F] 264006[F; 264007[F] 264009[F] 264161[F] 264162[F] 264163[F], 264164[F], 264165[F], 264167[F], 264010[F] 264011[F], 264012[F] 264013[F 264014[F] 264015[F] 264169[F] 264173[F] 264183[F], 264184[F], 264196[F], 264198[F], 264016[F] 264017[F], 264020[F] 264021 [F 264024[F] 264026[F] 264201 [F] 264202[F] 263984[-98]
264029[F] 264031 [F], 264032[F] 264033[F 264034[F] 264035[F]
264036[F] 264037[F], 264038[F] 264039[F; 264040[F] 264042[F]
264043[F] 264044[F], 264045[F] 264046[F 264047[F] 264048[F]
264049[F] 264050[F], 264051 [F] 264053[F; 264054[F] 264055[F]
264058[F] 264059[F], 264061 [F] 264062[F; 264063[F] 264067[F]
264068[F] 264069[F], 264070[F] 264071 [F; 264072[F] 264073[F]
264074[F] 264075[F], 264077[F] 264078[F; 264082[F] 264084[F]
264085[F] 264086[F], 264087[F] 264088[F; 264089[F] 264090[F]
7fi4093iFl ?R4n94iFl ?fi4095iFl ?fi409firFl ?R4097[F1 ?R4n98iFl TABLE 2 - Page 100 of 1873
646035[F] 741379[F] 741380[F], 741381[F] , 741382[F; , 741383[F]
741384[F] 741385[F] 741387[F], 741388[F] , 741389[F; , 741390[F]
741391 [F] 741392[F] 741393[F], 741394[F] , 741395[F " , 741396[F]
741398[F] 741400[F] 741401[F], 741402[F] , 741403[F; , 741404[F]
741406[F] 741408[F] 741409[F], 741410[F] , 741411 [F " , 741412[F]
741414[F] 741415[F] 741416[F], 741417[F] , 741418[F; , 741420[F]
741421 [F] 39024[F], 240775[F], 240776[F], 240777[F], 240778[F], 646036[F], 741386[F], 741397[F], 741399[F], 741405[F], 741407[F], 240779[F] 240780[F] 240781 [F], 240782[F] , 240783[F; , 240784[F] 741413[F], 741419[F], 932591[-1370], 741378[-3370], 932590]- 240785[F] 240787[F] 240788[F], 240789[F] , 240790[F " , 240791 [F] 3457], 932589[-3861], 39025[F], 240786[F], 240793[F], 240799[F],
ARID2 240792[F] 240794[F] 240795[F], 240796[F] , 240797[F; , 240798[F] 240801 [F], 240811[F], 240812[F], 240814[F], 240815[F], 240816[F],
(196528) S 240800[F] 240802[F] 240803[F], 240804[F] , 240805[F; , 240806[F] 240818[F], 240822[F], 240824[F], 240825[F], 240827[F], 240831 [F],
Arid2 240807[F] 240808[F] 240809[F], 240810[F] , 240813[F; , 240817[F] 240834[F], 240840[F], 240843[F], 240846[F], 240856[F], 240859[F],
(77044) 240819[F] 240820[F] 240821 [F], 240823[F] , 240826[F; , 240828[F] 240860[F], 240862[F], 240863[F], 240871 [F], 240875[F], 240877[F], 240829[F] 240830[F] 240832[F], 240833[F] , 240835[F; , 240836[F] 240878[F], 240879[F], 240886[F], 39022[-2898], 240774[-2934],
240837[F] 240838[F] 240839[F], 240841 [F] , 240842[F; , 240844[F] 2407731-4761]
240845[F] 240847[F] 240848[F], 240849[F] , 240850[F; , 240851 [F]
240852[F] 240853[F] 240854[F], 240855[F] , 240857[F " , 240858[F]
240861 [F] 240864[F] 240865[F], 240866[F] , 240867[F; , 240868[F]
240869[F] 240870[F] 240872[F], 240873[F] , 240874[F " , 240876[F]
240880[F] 240881 [F] 240882[F], 240883[F] , 240884[F " , 240885[F]
240887[F] 240888[F] 39021 [-2898]
637222[F], 676991[F], 676992[F], 676993[F], 676994[F], 676997[F], ARID3A
637223[F], 676995[F], 676996[F], 27293[F], 100434[F], 100441[F], 676998[F], 676999[F], 27292[F], 100433[F], 100435[F], 100436[F], (1820) &
100442[F], 100444[F], 100445[F], 100446[F], 27291[-4797], 27294[- 100437[F], 100438[F], 100439[F], 100440[F], 100443[F], 100447[F], Arid3a
4970]
100448[F], 100449[F], 100450[F], 27290[-4797] (13496)
898835[F], 898836[F], 898838[F], 898839[F], 898841 ]F], 898842[F],
898843[F], 898844[F], 898845[F], 898848[F], 898849[F], 898850[F],
898833[F], 898834[F], 898837[F], 898840[F], 898846[F], 898847[F], 898851 [F], 898852[F], 898853[F], 898856[F], 898857[F], 898858[F],
898854[F], 898855[F], 898859[F], 898861[F], 635156(56922], ARID3B 898860[F], 635157[56922], 635159(54520], 24592[F], 24594[F],
635158(54520], 24591[F], 24593[F], 576987[F], 576988[F], (10620) & 576989[F], 576990[F], 576992[F], 576995[F], 576997[F], 576998[F],
576991[F], 576993[F], 576994[F], 576996[F], 577000[F], 577004[F], Arid3b 576999[F], 577001[F], 577002[F], 577003[F], 577006[F], 577008[F],
577005[F], 577007[F], 577010[F], 577012[F], 577017[15], 577018[- (56380) 577009[F], 577011[F], 577013[F], 577014[F], 577015[F], 577016[F],
148], 577022[-2244], 577024[-2474]
577019[-326], 577020[-708], 576986[-1425], 577021 [-2072], 577023[- 2257], 576985[-3244]
ARID3C
623848[F], 623870[F], 816316[F], 816318[F], 623846[-933], 816315[-
623847[F], 623871[F], 816317[F], 816319[-164], 623845[-933], (138715) & 1421], 816314[-3506], 816313[-4137], 9380[F], 396478[F], 396480[F]
9379[F], 396479[F], 396481 [F], 9377[-643], 396476[-2227] Arid3c 9378[-643], 396477[-1145], 396475[-2350], 396474[-3932]
(550619)
641319[F], 705647[F], 705648[F], 705649[F], 705650[F], 705651[F],
925487[1130], 705645[-870], 925486[-4739], 32414[F], 158886[F], ARID4A
158887[F], 158888[F], 158889[F], 158890[F], 158891 [F], 158892[F], (5926) &
916505[F], 925488[1692], 705646[-308], 32412[-77], 158885[-309]
158893[F], 158894[F], 158895[F], 158896[F], 158897[F], 32413[-77] Arid4a
158884[-845], 158883[-1920], 158882[-2045], 158881 [-3772], (238247) 158880[-3937], 158879[-4124], 158878[-4244]
TABLE 2 - Page 101 of 1873
642165[F], 712825[F 712826[F; 712827[F] 712828[F] 712829[F]
712830[F], 712831[F 712832[F 712833[F] 712834[F] 712835[F]
712836[F], 712837[F 712842[F 712843[F] 712844[F] 712845[F]
712846[F], 712847[F 712848[F 712849[F] 712850[F] 712851 [F]
712852[F], 712855[F 712857[F 712858[F] 712859[F] 712860[F]
712861 [F], 712862[F 712863[F 712864[F] 712865[F] 712866[F]
712867[F], 712868[F 712869[F 712871 [F] 712872[F] 712873[F]
712874[F], 712875[F 712877[F 712878[F] 712879[F] 712880[F]
712881 [F], 712882[F 712883[F 712884[F] 712885[F] 712886[F]
712887[F], 712888[F 712889[F 642163[-336], 33517[F]
17 4 153[F], 174154[F; 174155[F 174156[F] 174157[F] 174159[F] 642166[F], 642167[F], 712853[F], 712854[F], 712856[F], 712870[F], 174160[F], 174161[F 174162[F; 174163[F] 174164[F] 174165[F] 712876[F], 712890[F], 642164[-336], 712824[-503], 712823[-2371], 174166[F], 174167[F; 174168[F; 174169[F] 174170[F] 17 4 171 [F] 33518[F], 33519[F], 174158[F], 174174[F], 174175[F], 17 4 177[F], ARID4B 174172[F], 174173[F; 174176[F; 174178[F] 174179[F] 17 4 182[F] 174180[F], 174181[F], 174185[F], 174189[F], 174214[F], 174215[F], (51742) & 174183[F], 174184[F; 174186[F; 174187[F] 174188[F] 174190[F] 174216[F], 174218[F], 174219[F], 174223[F], 174224[F], 174226[F], Arid4b 174191 [F], 174192[F; 174193[F; 174194[F] 174195[F] 174196[F] 174228[F], 174233[F], 174237[F], 174239[F], 174251 [F], 174257[F], (94246) 174197[F], 174198[F; 174199[F 174200[F] 174201 [F] 174202[F] 174259[F], 174263[F], 174270[F], 174276[F], 33516[-51], 174152[- 174203[F], 174204[F 174205[F 174206[F] 174207[F] 174208[F] 528], 174151[-1974]
174209[F], 174210[F; 174211[F 174212[F] 174213[F] 174217[F]
174220[F], 174221[F 174222[F 174225[F] 174227[F] 174229[F]
174230[F], 174231[F 174232[F 174234[F] 174235[F] 174236[F]
174238[F], 174240[F 174241 [F 174242[F] 174243[F] 174244[F]
174245[F], 174246[F 174247[F 174248[F] 1742 4 9[F] 174250[F]
174252[F], 174253[F 174254[F 174255[F] 174256[F] 174258[F]
174260[F], 174261[F 174262[F 17426 4 [F] 17 4 265[F] 174266[F]
174267[F], 174268[F 174269[F 174271 [F] 17 4 272[F] 174273[F]
174274[F], 174275[F 33515[-51 1741501-2709], 174149 [-2939],
1741481-3178], 174147[-4006]
ARID5A
616681 [F], 654232[F], 654234[F], 654236[F], 616680[1967],
616682[F], 654230[F], 654231 [F], 654233[F], 65 4 235[F], 362[F], (10865) & 65 4 237[37], 361 [F], 52308[F], 52310[F], 52312[F], 52313[F],
52305[F], 52306[F], 52307[F], 52309[F], 52311[F] Arid5a 360(1952], 52304[-974]
(214855)
637011 [F], 637013[F], 675597[F] 675598[F], 675599[F], 675600[F],
675601 [F], 675602[F], 67560 4 [F] 675605[F], 675606[F], 675607[F],
675609[F], 675610[F], 675611[F] 675612[F], 675613[F], 675614[F],
675615[F], 675617[F], 675619[F] 675621 [F], 675622[F], 675623[F],
675625[F], 675626[F], 675627[F] 675630[F], 675631 [F], 675632[F],
675636[F], 675639[F], 675641[F] 675642[F], 675643[F], 675644[F],
675645[F], 675646[F], 675647[F] 675648[F], 675649[F], 675653[F], 637010[F], 637012[F], 675603[F], 675608[F], 675616[F], 675618[F], 675654[F], 675655[F], 675657[F] 675658[F], 675659[F], 675664[F], 675620[F], 675624[F], 675628[F], 675629[F], 675633[F], 675634[F], 675666[F], 675667[F], 675668[F] 675670[F], 675673[F], 675675[F], 675635[F], 675637[F], 675638[F], 675640[F], 675650[F], 675651 [F], 675676[F], 675677[F], 675678[F] 675679[F], 675681 [F], 675683[F], 675652[F], 675656[F], 675660[F], 675661 [F], 675662[F], 675663[F], 675684[F], 675686[F], 675687[F] 675688[F], 675690[F], 675691 [F], 675665[F], 675669[F], 675671 [F], 675672[F], 675674[F], 675680[F], 675692[F], 675694[F], 675695[F] , 675696[F], 637011 (195270], 675682[F], 675685[F], 675689[F], 675693[F], 637010(195270],
ARID5B 675664[-1926], 27002[F], 27004[F], 96989[F], 96990[F], 96992[F], 675662[-122], 675663[-561], 27001 [F], 27003[F], 96991[F],
(84159) & 96993[F], 96994[F], 96995[F], 96996[F], 96997[F], 96998[F], 96999[F], 97001 [F], 97003[F], 97005[F], 97008[F], 97012[F],
Arid5b 97000[F], 97002[F], 97004[F], 97006[F], 97007[F], 97009[F], 97014[F], 97019[F], 97020[F], 97021[F], 97022[F], 97024[F],
(71371) 97010[F], 9701 1 [F], 97013[F], 97015[F], 97016[F], 97017[F], 97025[F], 97028[F], 97038[F], 97039[F], 97040[F], 97042[F],
97018[F], 97023[F], 97026[F], 97027[F], 97029[F], 97030[F], 97046[F], 97050[F], 97051 [F], 97052[F], 97053[F], 97054[F],
97031 [F], 97032[F], 97033[F], 97034[F], 97035[F], 97036[F], 97057[F], 97062[F], 97065[F], 97067[F], 97068[F], 97069[F],
97037[F], 97041 [F], 97043[F], 97044[F], 97045[F], 97047[F], 97071 [F], 97076[F], 97080[F], 97082[F], 97083[F], 97084[F],
97048[F], 97049[F], 97055[F], 97056[F], 97058[F], 97059[F], 97085[F], 97086[F], 97091 [F], 97094[F], 97098[F], 97100[F],
97060[F], 97061 [F], 97063[F], 97064[F], 97066[F], 97070[F], 97103[F], 969861-748]
97072[F], 97073[F], 97074[F], 97075[F], 97077[F], 97078[F],
97079[F], 97081 [F], 97087[F], 97088[F], 97089[F], 97090[F],
97092[F], 97093[F], 97095[F], 97096[F], 97097[F], 97099[F],
97101 [F], 97102[F], 97104[F], 97105[F], 97106[F], 96988[-3], 96987]- 472], 96985[-754], 96984[-1303], 96983[-1829], 96982[-2529], 96981
2726], 96980[-2867] TABLE 2 - Page 102 of 1873
635205[F] 899251 [F] 899252[F] 899253[F] 899255[F], 899256[F]
899257[F] 899258[F] 899259[F] 899260[F] 899262[F], 899264[F]
899265[F] 899266[F] 899267[F] 899268[F] 899269[F], 899270[F]
899271 [F] 899272[F] 899273[F] 899275[F] 899276[F], 899277[F]
899278[F] 899279[F] 899280[F] 899281 [F] 899282[F], 899283[F]
899284[F] 899290[F] 899291 [F] 899292[F] 899293[F], 899294[F]
899295[F] 899296[F] 24647[F]. 577605[F] 577606[F], 577607[F],
577609[F] 577610[F] 577611[F] 577612[F] 577614[F], 577615[F]
635204[F], 899254[F], 899261 [F], 899263[F], 899288[F], 899289[F], 577616[F] 577617[F] 577618[F] 577620[F] 577621 [F], 577624[F]
24646[F], 577608[F], 577613[F], 577619[F], 577622[F], 577623[F], ARIH1 577626[F] 577627[F] 577629[F] 577630[F] 577631 [F], 577632[F]
577625[F], 577628[F], 577636[F], 577638[F], 577643[F], 577650[F], (25820) & 577633[F] 577634[F] 577635[F] 577637[F] 577639[F], 577640[F]
577654[F], 577655[F], 577666[F], 577671 [F], 577672[F], 577673[F], Arihl 577641 [F] 577642[F] 577644[F] 5776 5[F] 577646[F], 577647[F]
577695[F], 577698[F], 577699[F], 577700[F], 577701 [F], 577702[F], (23806) 577648[F] 577649[F] 577651 [F] 577652[F] 577653[F], 577656[F]
577703[F]
577657[F] 577658[F] 577659[F] 577660[F] 577661 [F], 577662[F]
577663[F] 577664[F] 577665[F] 577667[F] 577668[F], 577669[F]
577670[F] 577674[F] 577675[F] 577676[F] 577677[F], 577678[F]
577679[F] 577680[F] 577681 [F] 577682[F] 577683[F], 577684[F]
577685[F] 577686[F] 577687[F] 577688[F] 577689[F], 577690[F]
577691 [F] 577692[F] 577693[F] 577694[F] 577696[F], 577697[F]
577704[F] 577705[F] 577706[F] 577707[F] 577708[F], 577709[F]
577710[F] 577711[F] 577712[F] 577713[F] 577714[-81]
635968[F], 905604[F], 905605[F] 905606[F], 905607[F], 905608[F],
905610[F], 905612[F], 905613[F] 905614[F], 905615[F], 905616[F],
905618[F], 905619[F], 905620[F] 905622[F], 905623[F], 905624[F],
635967[F], 905609[F] 905611[F], 905617[F], 905621 [F], 905626[F], 905625[F], 905627[F], 905629[F] 905630[F], 6359661-4614],
905628[F], 905631 [F] 635965[-4614], 25611[F], 589934[F], ARIH2 25612[F], 589929[F], 589930[F], 589931 [F], 589932[F], 589933[F],
589936[F], 589942[F] 589946[F], 5899 4 9[F], 589951 [F], 589954[F], (10425) & 589935[F], 589937[F], 589938[F] 589939[F], 589940[F], 589941 [F],
589955[F], 589957[F] 589959[F], 589961 [F], 589964[F], 589966[F], Arih2 589943[F], 589944[F], 5899 4 5[F] 589947[F], 5899 4 8[F], 589950[F],
589972[F], 589975[F] 589977[F], 589979[F], 25613(1017], 589980[- (23807) 589952[F], 589953[F], 589956[F] 589958[F], 589960]F], 589962[F],
2142]
589963[F], 589965[F], 589967[F] 589968[F], 589969[F], 589970[F],
589971 [F], 589973[F], 58997 4 [F] 589976[F], 589978[F],
25614(1017], 589981[-2179]
635286[F], 635287[F], 678453[F], 678454[F], 678455[F], 678456[F],
678457[F], 678458[F], 678459[F], 678460[F], 678461 [F], 900110[F], 637462[F], 637464[13192], 678452[-444], 27606[F], 103505[F], ARL1 (400) 900111[F], 637463[13192], 27605[F], 103497[F], 103498[F], 103506[F], 27604[-311], 103496[-493], 27608[-2664], 103510]- & Aril 103499[F], 103500[F], 103501[F], 103502[F], 103503[F], 103504[F], 3464], 103511[-3825] (104303) 103507[F], 103508[F], 103509[8], 27607[-2664], 103512[-4926]
642718[F], 716351[F], 716352[-134], 642717[-3692], 716350[-3838], ARL10
875800[F], 930384(3986], 34322[-3055], 182007[-4732] 7163491-3939], 34321(6115], 182004[-1016], 182005[-1310], 34323[-(285598) &
3055], 1820061-4698] Arl10
ARL11
644321[F], 644322[F], 728127[F], 36775[F], 36776[F], 212456[F], (115761) &
36770[-4811]
212457[-107], 212458[-1182], 36771[-4811] Arl11
(219144) ARL13A
651907[F], 913566[F], 927438[-2571], 913567[-4571], 46923[F], 651908[F], 46924[F], 46926[F], 609935[F], 609936[F], 609937[F], (392509) & 46925[F], 609934[F], 609939[-1237], 609940[-3097] 609938[F] Arl13a
(74448)
647196[F], 750380[F], 750381[F], 750382[F], 750384[F], 750385[F],
ARL13B 40415[F], 258558[F], 258559[F], 258560[F], 258561[F], 258564[F], 647195[F], 647197[F], 750379[F], 750383[F], 40414[F], 40416[F],
(200894) & 258567[F], 258568[F], 258569[F], 258570[F], 258571 [F], 258572[F], 258557[F], 258562[F], 258563[F], 258565[F], 258566[F], 258579[F],
Arl13b 258573[F], 258574[F], 258575[F], 258576[F], 258577[F], 258578[F], 258580[F], 258581 [F], 258582[F]
(68146) 258583[F], 258584[F]
TABLE 2 - Page 103 of 1873
643481 [F; 643483[F] 721514[F; , 721515[F] 721517[F] 721518[F]
721519[F; 721520[F] 721522[F; , 721523[F] 721525[F] 721526[F]
721528[F; 721530[F] 721531[F; , 721533[F] 721534[F] 721535[F]
721536[F 721537[F] 721538[F , 721539[F] 721541 [F] 721542[F]
721543[F 721544[F] 721545[F , 721549[F] 721551 [F] 721552[F] 643482[F; 643484[F; 721513[F 721516[F] 721521 [F] 721524[F] 721553[F 721555[F] 721556[F , 721560[F] 721561 [F] 721562[F] 721527[F " 721529[F 721532[F 721540[F] 721546[F] 721547[F] 721563[F 721566[F] 721567[F , 721568[F] 721569[F] 721570[F] 721548[F; 721550[F 721554[F 721557[F] 721558[F] 721559[F] 721571 [F 721573[F] 721574[F , 721575[F] 721576[F] 721579[F] 721564[F " 721565[F 721572[F 721577[F] 721578[F] 721586[F] 721580[F 721581 [F] 721582[F , 721583[F] 721584[F] 721585[F] 721587[F; 721588[F 721590[F 721591 [F] 721592[F] 721593[F] 721589[F 721597[F] 721598[F , 721599[F] 721600[F] 721601 [F] 721594[F " 721595[F 721596[F 721618[F] 721625[F] 721629[F] 721602[F 721603[F] 721604[F , 721605[F] 721606[F] 721607[F] 721632[F; 721633[F 721635[F 721637[F] 721640[F] 721641 [F] 721608[F 721609[F] 721610[F , 721611[F] 721612[F] 721613[F] 721645[F " 721646[F 721647[F 721649[F] 721652[F] 721655[F] 721614[F 721615[F] 721616[F , 721617[F] 721619[F] 721620[F] 721656[F; 721659[F 721660[F 721662[F] 35417[F] 35419[F],
721621 [F; 721622[F] 721623[F; , 721624[F] 721626[F] 721627[F] 196089[F 196092[F; 196096[F 196098[F] 196099 [F] 196101[F] 721628[F; 721630[F] 721631[F; , 721634[F] 721636[F] 721638[F] 196102[F; 196109[F; 196111[F 196112[F] 196115[F] 196117[F] ARL15 721639[F; 721642[F] 721643[F; , 721644[F] 721648[F] 721650[F] 196122[F; 196125[F; 196130[F 196136[F] 196137[F] 196141[F] (54622) & 721651 [F; 721653[F] 721654[F; , 721657[F] 721658[F] 721661 [F] 196146[F 196150[F; 196159[F 196161[F] 196165[F] 196167[F] Arl15 721663[F; 721664[F] 35416[F]. 35418[F], 1 96090[F], 196091 [F] 196169[F; 196173[F; 196175[F 196178[F] 196179[F] 196180[F] (218639) 196093[F 196094[F] 196095[F , 196097[F] 196100[F] 196103[F] 196181[F 196182[F 196185[F; 196186[F] 196192[F] 196193[F] 196104[F 196105[F] 196106[F , 196107[F] 196108[F] 196110[F] 196202[F 196203[F 196204[F 196209[F] 196210[F] 196220[F] 196113[F 196114[F] 196116[F , 196118[F] 196119[F] 196120[F] 196221 [F 196222[F 196224[F 196225[F] 196226[F] 196227[F] 196121[F 196123[F] 196124[F , 196126[F] 196127[F] 196128[F] 196228[F 196229[F 196230[F 196255[F] 196262[F] 196264[F] 196129[F 196131[F] 196132[F , 196133[F] 196134[F] 196135[F] 196268[F 196270[F 196271 [F; 196276[F] 196277[F] 196278[F] 196138[F 196139[F] 196140[F , 196142[F] 196143[F] 196144[F] 196282[F 196284[F 196287[F 196290[F] 196292[F] 196293[F] 196145[F 196147[F] 196148[F , 196149[F] 196151 [F] 196152[F] 196294[F 196296[F 196297[F 196298[F] 196299[F] 196303[F] 196153[F 196154[F] 196155[F , 196156[F] 196157[F] 196158[F] 19630 4 [F 196305[F 196306[F 196308[F] 196313[F] 196316[F] 196160[F 196162[F] 196163[F , 196164[F] 196166[F] 196168[F] 196320[F 196321 [F 196323[F 196325[F] 196327[F] 196328[F] 196170[F 196171[F] 196172[F , 196174[F] 196176[F] 196177[F] 196330[F
196183[F; 196184[F] 196187[F; , 196188[F] 196189[F] 196190[F]
196191[F; 196194[F] 196195[F; , 196196[F] 196197[F] 196198[F]
196199[F; 196200[F] 196201 [F; , 196205[F] 196206[F] 196207[F]
196208iF 1 6211 TFl 1 6212iF 1 621 F1 196214F1. 196215iFl.
640660[-47], 700882[-440], 700885[-3595], 31 4 32[F], 31455[-33], 640659[-47], 700883[-3215], 700884[-3553], 700886[- 4 842], ^ 146187[-388], 146190[-2886] 31431[F], 31454[-33], 146188[-2564], 146189[-2850], 146191[-3942] ^ri16
ARI 17A
697919[F], 697920[F], 926374[F], 926375[F] 697918[F], 697921 [F], 926376[F], 926373(2575]
( lozb) ARL17B
697814[F], 922913[F] 697813[F], 922912[F]
(10050608
650108[F], 773038[F], 773039[F], 773040[F], 773041 [F], 773042[F],
773043[F], 773044[F], 773045[F], 773046[F], 773047[F], 773048[F],
ARL2 (402) 773049[F], 773037[-176], 44328[F], 307251[F], 307252[F],
44329[156], 307267[-2659] & Arl2 307253[F], 307254[F], 307255[F], 307256[F], 307257[F], 307258[F],
(56327) 307259[F], 307260[F], 307261[F], 307262[F], 307263[F], 307264[F],
44330[156], 307250[-176], 307265[-2354], 307266[-2463]
ARL2BP
633641 [-2463], 633642[-2590], 923341 [-3690], 923340[-3844], (23568) &
633640[-2463], 22697[-471]
22698[-471], 22699[-1182], 555247[-3577], 555248[-4764] Arl2bp
(107566)
650861 [F], 779035[F], 779036[F], 779037[F], 779038[F], 779039[F],
779040[F], 779041[F], 779043[F], 7790 44 [F], 779045[F], 779046[F], 650860[F], 779042[F], 7790 4 8[F], 650862[-107], 779052[-437],
779047[F], 779049[F], 779050[F], 779051[F], 650863[-107], 779054[- 779053[-523], 779055[-1824], 779056[-1989], 779057[-4043],
ARL3 (403) 1073], 45253[F], 318427[F], 318428[F], 318429[F], 318430[F], 45252[F], 318435[F], 318437[F], 318444[F], 318445[F], 318446[F],
& Arl3
318431[F], 318432[F], 318433[F], 318434[F], 318436[F], 318438[F], 318447[F], 45254[-275], 318454[-554], 318455[-671], 318458[- (56350) 318439[F], 318440[F], 318441[F], 318442[F], 318443[F], 318448[F], 2295], 318459[-2416], 318461[-2592], 318462[-2702], 318463[- 318449[F], 318450[F], 318451[F], 318452[F], 318453[2], 45255[-275] 3841]
318456[-818], 318457[-1532], 318460[-2545], 318464[-3958]
641074[F], 703751[F], 703752[F], 703753[F], 703754[F], 758218[F], ARL4A 931717[408], 703750[-1592], 32074[F], 154638[F], 154639[F], 641073[F], 32073[F], 154636[-1388] (10124) & 154640[F], 154641[F], 154637[-900], 154635[-3175 Arl4a 617442[F], 660305[F], 660306[F], 660307[F], 660308[F], 660309[F], ARL4C 660310[F], 660311[F], 660312[F], 913885[F], 660313[-596], 1300[F], 617441[F], 660304[F], 775067[F], 775068[F], 660303[-290], 660314| (10123) & 64819[F], 64820[F], 64821 [F], 64822[F], 64823[F], 64824[F], 1286], 1299[F], 64818[F], 64817[-227], 64828[-1030], 64816[-4614] Arl4c 64825[F], 64826[F], 64827[-406; (320982)
ARL4D
697349[F], 640125[1970], 30833[F], 139283[F] (379) &
Arl4d TABLE 2 - Page 104 of 1873
786907[F], 786908[F], 786912[F], 786913[F], 786914[F], 786916[F],
786917[F], 786918[F], 786919[F], 786920[F], 786921 [F], 786922[F],
786923[F], 786924[F], 619545[27526], 619547[-106], 786906[-1167],
786909[F], 786910[F], 786911[F], 786915[F], 786925[F], ARL5A 786905[-1445], 619549 [-4167], 3913[F], 334023[F], 334024[F],
619544(27526], 619546[-106], 786926[-2935], 619548[-4167], (26225) & 334025[F], 334026[F], 334027[F], 334031 [F], 334032[F], 334033[F],
3912[F], 334028[F], 334029[F], 334030[F], 334040[F], 334041 [F], Arl5a 334034[F], 334035[F], 334036[F], 334037[F], 334038[F], 334039[F],
334052[F], 39141-102], 334053[-2715], 3916[-3334] (75423) 334042[F], 334043[F], 334044[F], 334045[F], 334046[F], 334047[F],
334048[F], 334049[F], 334050[F], 334051[F], 3915[-102], 3917[- 3334]
618938[F], 782085[F], 782086[F], 782087[F], 782088[F], 782089[F], ARL5B 782090[F], 782091[F], 782092[-790], 3176[F], 324625[F], 324626[F], (221079) &
3175[-291]
324627[F], 324628[F], 324629[F], 324630[F], 324631 [F], 324632[F], Arl5b 324633[F], 324634[F], 324635[F], 3174[-291], 324636[-913] (75869)
ARL5C
696395[F], 696396[F], 639919[9206], 30618[F], 137866[F], (390790) &
639918[9206], 30617[F], 137865[F], 137869[F], 30615[-3134]
137867[F], 137868[F], 137870[F], 30616[-3134], 137864[-4126] Arl5c
(217151 )
647182[F], 750323[F], 647184[762], 750324[-442], 647186[-3222],
647181[F], 750320[F], 750321 [F], 750322[F], 647183[762], 647185[- ARL6 750325[-4993], 40401 [F], 258351[F], 258352[F], 258353[F],
3222], 40400[F], 258357[F], 258358[F], 258359[F], 258360[F], (84100) & 258354[F], 258355[F], 258356[F], 258363[F], 258366[F],
258361[F], 258362[F], 258364[F], 258365[F], 40402(2396], 40404[- Arl6 40403(2396], 258367[-231], 258350[-453], 40405[-2688], 258368[- 2688], 258369[-4833] (56297) 44121
631791[-1334], 875634[-2616], 875633[-3202], 631793[-3317],
ARL6IP1 875635[-3332], 875636[-3453], 875632[-3482], 875631 [-3756],
202691-1681], 527186[-1694], 527187[-1815], 20267[-2698], 527185[- 1™ " 133 , 631792 -3317 , 20268[-1681], 20266I-2698], (23204) & 3709], 5271891-3745], 527184[-3878], 527183[-3984], 527190[-4005] s ^ l aa L " -" aa J. i au[- b a Arl6ip1
(54208) 527182[-4224], 527181 [-4628], 527179[-4727], 527178[-4876]
ARL6IP1P
644110[-3427] 898880[F], 932318[2196], 917122(2038], 898879(38]
1
ARL6IP4
627423[F], 843666[F], 843667[F], 627422[-286], 627424[-564],
627425[-564], 843668[-1852], 843669[-2509], 843671 [-3289], (51329) & 8436701-3280], 14178[F], 457289[F], 457290[F], 14179[-492], 14177]
14180[-492], 457291 [-1768], 457292[-2463], 457294[-3243] Arl6ip4 623], 4572931-3234], 457288[-3509]
(65105)
857543[F], 857544[F], 857545[F], 857546[F], 857547[F], 857548[F],
ARL6IP5 857549[F], 629107[20523], 629109[-2637], 629106[-4519], 857542[- (10550) &
629108[-2637], 629105[-4519] 4564], 857541 [-4786], 16373[F], 487549[F], 487550[F], 487551 [F],
Arl6ip5 487552[F], 487553[F], 487554[F], 487555[F], 487556[F], 487557[F],
(65106) 487558[F], 487559[F], 487560[F]
ARL6IP6
619556[F], 787108[F], 787109[F], 3925[F], 334360[F], 334361 [F], (151188) &
6195551-400], 787107[-3593], 3924[-798], 334359[-3859]
334362[F], 334363[F], 334364[F] Arl6ip6
(65103)
617890[F], 663809[F], 663811[F], 663812[F], 663813[F], 663814[F],
ARL8A 663816[F], 663817[F], 663819[F], 617888[-2273], 617892[-3324],
617891[F], 663810[F], 663815[F], 663818[F], 617889[-2273], (127829) & 663820[-3381], 663808[-4053], 1907[F], 72391[F], 72393[F],
1908[F], 72392[F], 72395[F], 72399[F], 72402[F], 1906[-1506] Arl8a 72394[F], 72396[F], 72397[F], 72398[F], 72400[F], 72401 [F],
(68724) 72403[F], 1905[-1506], 72390[-3755], 1909[-3964], 72404[-4021]
629175[F] 858391 [F], 858392[F] 858393[F] 858394[F], 858395[F],
858396[F] 858397[F], 858398[F] 858399[F] 858400[F], 858401 [F],
858402[F] 858403[F], 858404[F] 858405[F] 858406[F], 858407[F],
858408[F] 858410[F], 858411[F] 858412[F] 858413[F], 858414[F],
858415[F] 858416[F], 858417[F] 858418[F] 858419[F], 858420[F],
858421 [F] 858423[F], 858424[F] 858425[F] 858426[F], 16454[F],
489421 [F] 489422[F], 489423[F] 489424[F] 489425[F], 489426[F], 629176[F], 858409[F], 858422[F], 923032(1939], 858427[-61], ARL8B 489427[F] 489429[F], 489430[F] 489431 [F] 489432[F], 489434[F], 16455[F], 489428[F], 489433[F], 489441 [F], 489443(F], 489448[F], (55207) & 489435[F] 489436[F], 489437[F] 489438[F] 489439[F], 489440[F], 489454[F], 489456[F], 489458[F], 489464[F], 489482[F], 489487[- Arl8b 489442[F] 489444[F], 489445[F] 489446[F] 489447[F], 489449[F], 146], 16457[-4836] (67166) 489450[F] 489451 [F], 489452[F] 489453[F] 489455[F], 489457[F],
489459[F] 489460[F], 489461 [F] 489462[F] 489463[F], 489465[F],
489466[F] 489467[F], 489468[F] 489469[F] 489470[F], 489471 [F],
489472[F] 489473[F], 489474[F] 489475[F] 489476[F], 489477[F],
489478[F] 489479[F], 489480[F] 489481 [F] 489483[F], 489484[F],
489485[F] 489486[F], 16456[-4836]
626627[F], 626629[F], 838402[F], 626625[-1520], 838401 [-1743], ARL9 838400[-1886], 838399[-1964], 838398[-3430], 838397[-4560], 626628[F], 626630[F], 626626[-1520], 838396[-4598], 13064[F], (132946) & 838395[-4633], 13063[F], 445366[F], 13065(3037], 13061[-4116], 445365[F], 445367[F], 13066(3037], 13062[-4116] Arl9 445364[-4324], 445363[-4468], 445362[-4524 (384185) TABLE 2 - Page 105 of 1873
621691 [F], 802233[F], 802234[F], 802237[F], 802239[F], 802240[F], ARMC1
621690[F], 802232[F], 802235[F], 802236[F], 802238[F], 6632[F], 802241[F], 6633[F], 366213[F], 366214[F], 366217[F], 366219[F], (55156) &
366212[F], 366215[F], 366216[F], 366218[F], 366223[F], 366225[F], 366220[F], 366221[F], 366222[F], 366224[F], 366226[F], 366227[F], Armd
366232[F], 366233[F], 366234[F]
366228[F], 366229[F], 366230[F], 366231 [F], 366235[F] (74252)
625926[F], 833060[F], 833062[F], 833063[F], 833065[F], 833066[F],
833067[F], 833068[F], 833069[F], 625922[-312], 625928[-920], 625927[F], 833059[F], 833061 [F], 833064[F], 625923[-312], ARMC10 12176[F], 433897[F], 433899[F], 433900[F], 433904[F], 433905[F], 12177[F], 433898[F], 433901 [F], 433902[F], 433903[F], 433906[F], (83787) & 433907[F], 433909[F], 433910[F], 433913[F], 433914[F], 433916[F], 433908[F], 433911[F], 433912[F], 433915[F], 12173[-348], 433896]- ArmdO 433917[F], 433918[F], 433919[F], 433920[F], 12178[-307], 12172]- 1085] (67211) 348], 433921 [-3397], 433895[-4329]
636724[F], 673360[F], 673362[F], 673363[F], 673365[F], 673368[F], 636725[F], 673361[F], 673364[F], 673366[F], 673367[F], 673370[F], 673369[F], 673372[F], 636722(97946], 636726(538], 673374[-162],
ARMC2 673371[F], 673373[F], 636723[97946], 91799[F], 91808[F], 91809[F], 91793[F], 91794[F], 91795[F], 91796[F], 91797[F], 91798[F],
(84071) & 91811[F], 91812[F], 91813[F], 91814[F], 91815[F], 91816[F], 91800[F], 91801[F], 91802[F], 91803[F], 91804[F], 91805[F],
Armc2
91818[F], 91819[F], 91822[F], 91824[F], 91825[F], 91827[F], 91806[F], 91807[F], 91810[F], 91817[F], 91820[F], 91821[F],
(213402)
26620[78177], 26622(18576] 91823[F], 91826[F], 26619(78177], 26621(18576], 26623(475],
91828[-213]
618967[F], 782358[F], 782360[F], 782361 [F], 782364[F], 782365[F],
618966[F], 782359[F], 782362[F], 782363[F], 3214[F], 325285[F], 782366[F], 782367[F], 3215[F], 325284[F], 325288[F], 325290[F], ARMC3 325286[F], 325287[F], 325289[F], 325294[F], 325299[F], 325301 [F], 325291 [F], 325292[F], 325293[F], 325295[F], 325296[F], 325297[F], (219681) & 325302[F], 325303[F], 325306[F], 325309[F], 325310[F], 325314[F], 325298[F], 325300[F], 325304[F], 325305[F], 325307[F], 325308[F], Armc3 325315[F], 325317[F] 325311[F], 325312[F], 325313[F], 325316[F], 325318[F], 325319[F], (70882)
325320[F]
648965[F], 764109[F], 764110[F], 764112[F] 764114[F], 764117[F],
764111[F], 764113[F], 764115[F], 764116[F], 764119[F] 764120[F], 764118[F], 42910[F], 288871[F], 288872[F] 288873[F], 288874[F],
916597[F], 42909[F], 288869[F], 288870[F], 288882[F] 288886[F], 288875[F], 288876[F], 288877[F], 288878[F] 288879[F], 288880[F], ARMC4
288887[F], 288888[F], 288889[F], 288890[F], 288892[F] 288894[F], 288881 [F], 288883[F], 288884[F], 288885[F] 288891 [F], 288893[F], (55130) &
288895[F], 288896[F], 288897[F], 288899[F], 288900[F] 288902[F], 288898[F], 288901[F], 288903[F], 288904[F] 288905[F], 288906[F], Armc4
288908[F], 288909[F], 288911[F], 288913[F], 288915[F] 288916[F], 288907[F], 288910[F], 288912[F], 288914[F] 288919[F], 288920[F], (74934)
288917[F], 288918[F], 288921 [F], 288925[F], 288926[F] 288929[F], 288922[F], 288923[F], 288924[F], 288927[F] 288928[F], 288930[F],
288932[F], 288933[F]
288931 [F]
ARMC5
632078[F], 877439[F], 877440[F], 632077[427], 877438[-349],
(79798) &
632079[-4843], 20604[F], 530675[F], 530676[F], 20603[676], 530674|632080[-4843], 20606[-1710], 530677[-1981]
Armc5 142], 530673[-974], 20605[-1710], 530678[-2197]
(233912)
633176[F], 884939[F], 884941 [F], 884942[F], 884944[F], 633178[-6], ARMC6
633175[F], 884940[F], 884943[F], 633177]-6], 884946[-2579],
884945[-2519], 22128[F], 548079[F], 548081[F], 548082[F], (93436) &
22127[F], 548080[F], 548083[F], 548088[F], 548089[F], 548091 [F], 548084[F], 548085[F], 548086[F], 548087[F], 548090[F], 548092[F], Armc6
22129(217], 548094[-2330], 548095[-4953]
22130[217], 5480931-2273; (76813)
640479[F], 699675[F], 640480[27], 699676[3], 699677[-534],
640478[F], 640481[38], 640476[-3833], 640482 [-4983], 31243[F], ARMC7
699678[-917], 640477[-3833], 640483[-4983], 31244[F], 143724[F], 143723[F], 143725[F], 143726[F], 143727[F], 143728[F], 143729[F], (79637) &
143730[F], 143731[F], 143732[F], 143734[F], 143735[F], 143736[F], 143733[F], 31246[-1061], 31241[-1277], 143740[-2559], 143719]- Armc7
31245[51], 143737[12], 143738[-433], 143739[-806], 31242[-1277], 4854] (276905)
143722[-2515], 143721[-3137], 143720[-4638]
635741 [F], 903965[F], 903967[F], 903968[F], 903969[F], 903970[F],
903971 [F], 903973[F], 903974[F], 903975[F], 903976[F], 903977[F],
903979[F], 903980[F], 903981[F], 903982[F], 903983[F], 903984[F],
903985[F], 903987[F], 903988[F], 903989[F], 903990[F], 903991 [F],
903993[F], 903994[F], 903996[F], 903997[F], 903998[F], 903999[F],
904000[F], 904001[F], 904002[F], 904003[F], 635739(703], 903964]- 698], 903963[-801], 903987]- 1397], 25359[F], 586822[F], 586823[F], 635740[F] 903966[F] 903972[F], 903978[F], 903986[F], 903992[F], 586824[F], 586826[F], 586827[F], 586828[F], 586829[F], 586830[F], 903995[F] 904004[F] 635738[703], 903962[-2430], 25358[F], ARMC8 586832[F], 586833[F], 586834[F], 586835[F], 586836[F], 586837[F], 586825[F] 586831 [F] 586843[F], 586844[F], 586845[F], 586849[F], (25852) & 586838[F], 586839[F], 586840[F], 586841 [F], 586842[F], 586846[F], 586855[F] 586862[F] 586865[F], 586866[F], 586871 [F], 586872[F], Armc8 586847[F], 586848[F], 586850[F], 586851 [F], 586852[F], 586853[F], 586873[F] 586876[F] 586877[F], 586884[F], 586886[F], 586895[F], (74125) 586854[F], 586856[F], 586857[F], 586858[F], 586859[F], 586860[F], 25356(1510], 5868211 ■ 2518], 586855[-4501]
586861 [F], 586863[F], 586864[F], 586867[F], 586868[F], 586869[F],
586870[F], 586874[F], 586875[F], 586878[F], 586879[F], 586880[F],
586881 [F], 586882[F], 586883[F], 586885[F], 586887[F], 586888[F],
586889[F], 586890[F], 586891[F], 586892[F], 586893[F], 586894[F],
25357(1510], 586858[-408], 586857[-899], 586856[-2724], 586854]- 4675], 586853[-4843] TABLE 2 - Page 106 of 1873
617379[F], 659761[F], 659762[F], 659763[F], 659764[F], 659765[F],
659766[F], 659768[F], 659769[F], 659770[F], 659772[F], 659773[F],
659775[F], 659776[F], 659779[F], 1222[F], 63764[F], 63765[F], 617380[F], 618819[F], 659767[F], 659771[F], 659774[F], 659777[F], 63766[F], 63767[F], 63768[F], 63769[F], 63770[F], 63771 [F], 659778[F], 659780[F], 781092[F], 1223[F], 63773[F], 63776[F], ARMC9 63772[F], 63774[F], 63775[F], 63777[F], 63778[F], 63779[F], 63781[F], 63782[F], 63788[F], 63791[F], 63794[F], 63802[F], (80210) & 63780[F], 63783[F], 63784[F], 63785[F], 63786[F], 63787[F], 63804[F], 63808[F], 63810[F], 63811[F], 63812[F], 63813[F], Armc9 63789[F], 63790[F], 63792[F], 63793[F], 63795[F], 63796[F], 63814[F], 63816[F], 63817[F], 63818[F], 1226(3903], 63763[-354], (78795) 63797[F], 63798[F], 63799[F], 63800[F], 63801 [F], 63803[F], 63762[-1842], 63814[-3954], 63822[-4128], 63761[-4730]
63805[F], 63806[F], 63807[F], 63809[F], 63815[F], 63819[F],
1225[3903], 63820[-581], 63821[-2755], 63815[-4459]
AR CX2
651932[F], 913676[F], 913677[F], 913678[F], 913679[F], 913680[F],
(9823) & 931582(1347], 913675[-653], 46952]F], 610162[F], 610163[F],
Armcx2 610164[F], 610165[F], 610166[F], 610161[-1353], 610160[-3045]
(67416)
632069[F], 648471[F], 651930[F], 759972[F], 759973[F], 877394[F],
ARMCX3 877395[F], 913672[F], 913673[F], 913674[F], 648471 (4267],
632068[F], 648470[F], 651931[F], 759974[F], 877396[F], (51566) & 632069(3471], 651929(775], 877395(524], 759973[-114], 913671[-
648470(4267], 632068(3471], 759974[-154], 877396[-158], 46951[F] Armcx3 167], 46950[F], 610155[F], 610156[F], 610157[F], 610158[F],
(71703) 46949[786l, 610154[-1481
651925[F], 651926[F], 651927[F], 913641[F], 913642[F], 913643[F],
913644[F], 913645[F], 913646[F], 913647[F], 913648[F], 913649[F],
913650[F], 913651[F], 913652[F], 913653[F], 913654[F], 913655[F],
913656[F], 913657[F], 913658[F], 913659[F], 913660[F], 913661[F],
913662[F], 913663[F], 913664[F], 913667[F], 913668[F], 913669[F], ARMCX4 920550[F], 920551[F], 920552[F], 621594[-4144], 913640[-4308], (10013175 913639[-4843], 801780 [-4864], 46947[F], 610141[F], 610142[F], 651928[F], 913666[F], 621595[-4144], 46948[F], 610149[F] 5) & 610143[F], 610144[F], 610145[F], 610146[F], 610147[F], 610148[F], Armcx4 610150[F], 610151[F], 610152[F], 610140[6], 46946[-1], 610139]- (102910) 378], 610138[-758], 610137[-1082], 610136[-2228], 610135[-2434],
610134[-2527], 610133[-2665], 610132[-2936], 610131[-3187],
610130[-3305], 610129[-3650], 610128[-3741], 610127[-3838],
46945[-3861], 610126[-4140]
ARMCX6
651929[F], 913670[F], 913671[-4915], 46949[F], 610153[F], 610154| (54470) & 4954] Armcx6
(278097)
632124( 4126] ^
622630[F], 808256[F], 808258[F] 808259[F], 808261 [F], 808262[F],
808264[F], 808265[F], 808266[F] 808267[F], 808268[F], 808270[F],
808271 [F], 808273[F], 808275[F] 808276[F], 808277[F], 808278[F], 622631[F], 808255[F], 808257[F], 808263[F], 808269[F], 808272[F], 808280[F], 808282[F], 808284[F] 808285[F], 808286[F], 7861 [F], 808274[F], 808279[F], 808281[F], 808283[F], 622632[-1263],
378987[F], 378989[F], 378990[F] 378991 [F], 378993[F], 378996[F], 808287[-3758], 7862[F], 378986[F], 378988[F], 378992[F],
378998[F], 378999[F], 379001 [F] 379002[F], 379003[F], 379005[F], 378994[F], 378995[F], 378997[F], 379000[F], 379004[F], 379012[F], 379006[F], 379007[F], 379008[F] 379009[F], 379010[F], 379011[F], 379014[F], 379020[F], 379023[F], 379025[F], 379027[F], 379032[F],
(11863) 379013[F], 379015[F], 379016[F] 379017[F], 379018[F], 379019[F], 379034[F], 379036[F], 379038[F], 7863[-1969], 7860[-3301],
379021 [F], 379022[F], 379024[F] 379026[F], 379028[F], 379029[F], 378985[-3727], 379041 [-4381]
379030[F], 379031 [F], 379033[F] 379035[F], 379037[F], 379039[F],
379040[F], 7859[-3301 378984]- 4000] TABLE 2 - Page 107 of 1873
631298[F] 631300[F], 871946[F] 871947[F] 871949[F], 871950[F],
871951 [F] 871953[F], 871954[F] 871956[F] 871958[F], 871959[F],
871960[F] 871961 [F], 871962[F] 871963[F] 871964[F], 871968[F], 631297[F], 631299[F] 871948[F], 871952[F], 871955[F], 871957[F], 871969[F] 871971 [F], 871973[F] 871974[F] 871978[F], 871979[F], 871965[F], 871966[F] 871967[F], 871970[F], 871972[F], 871975[F], 871980[F] 871981 [F], 871982[F] 871983[F] 871985[F], 871988[F], 871976[F], 871977[F] 871984[F], 871986[F], 871987[F], 871990[F], 871989[F] 871993[F], 871994[F] 871998[F] 872000[F], 872002[F], 871991[F], 871992[F] 871995[F], 871996[F], 871997[F], 871999[F],
ARNT2 872004[F] 19640[F], 1 9642[F], 51 9784[F], 519785[F], 51 9786[F], 872001 [F], 872003[F] 872005[F], 19639[F], 19641[F], 519787[F],
(9915) & 519788[F] 519789[F], 519790[F] 519791[F] 519792[F], 519794[F], 519793[F], 519796[F] 519798[F], 519799[F], 519801 [F], 519808[F],
Arnt2 519795[F] 519797[F], 519800[F] 519802[F] 519803[F], 519804[F], 519813[F], 519814[F] 519815[F], 519818[F], 519820[F], 519823[F],
(11864) 519805[F] 519806[F], 519807[F] 519809[F] 519810[F], 519811[F], 519824[F], 519825[F] 519834[F], 519836[F], 519837[F], 519840[F], 519812[F] 519816[F], 519817[F] 519819[F] 519821 [F], 519822[F], 519841[F], 519842[F] 519843[F], 519847[F], 519849[F], 519852[F], 519826[F] 519827[F], 519828[F] 519829[F] 519830[F], 519831[F], 519853[F], 519855[F] 519856[F], 519859[F], 519861 [F], 519863[F], 519832[F] 519833[F], 519835[F] 519838[F] 519839[F], 519844[F], 519865[F]
519845[F] 519846[F], 519848[F] 519850[F] 519851 [F], 519854[F],
519857[F] 519858[F], 519860[F] 519862[F] 519864[F]
631741[F], 631743[F], 875152[F], 875154[F], 875156[F], 875159[F],
631740[F], 631742[F], 875151[F], 875153[F], 875155[F], 875157[F],
875163[F], 875169[F], 875170[F], 875172[F], 875174[F], 875175[F], 875158[F], 875160[F], 875161[F], 875162[F], 875164[F], 875165[F],
875177[F], 875178[F], 875179[F], 875181[F], 875182[F], 875183[F], 875166[F], 875167[F], 875168[F], 875171[F], 875173[F], 875176[F],
875184[F], 875185[F], 875186[F], 875187[F], 875188[F], 875192[F], 875180[F], 875189[F], 875190[F], 875191[F], 875196[F], 875197[F],
875193[F], 875194[F], 875195[F], 875198[F], 875202[F], 631745]- 875199[F], 875200[F], 875201[F], 875203[F], 875204[F], 875205[F],
731], 8752061-942], 20202[F], 20204[F], 526194[F], 526196[F], ARNTL 631744[-731], 20201[F], 20203[F], 526193[F], 526195[F], 526197[F],
526200[F], 526204[F], 526208[F], 526209[F], 526214[F], 526216[F], (406) & 526198[F], 526199[F], 526201[F], 526202[F], 526203[F], 526205[F],
526217[F], 526219[F], 526221[F], 526222[F], 526224[F], 526226[F], Arntl 526206[F], 526207[F], 526210[F], 526211[F], 526212[F], 526213[F],
526227[F], 526228[F], 526230[F], 526231 [F], 526233[F], 526234[F], (11865) 526215[F], 526218[F], 526220[F], 526223[F], 526225[F], 526229[F],
526235[F], 526236[F], 526237[F], 526238[F], 526240[F], 526242[F], 526232[F], 526239[F], 526241[F], 526245[F], 526247[F], 526249[F],
526243[F], 526244[F], 526246[F], 526248[F], 526250[F], 526255[F], 526251 [F], 526252[F], 526253[F], 526254[F], 526260[F], 526265[F],
526256[F], 526257[F], 526258[F], 526259[F], 526261 [F], 526262[F], 526266[F], 526268[F], 526269[F], 526270[F], 526272[F], 526273[F],
526263[F], 526264[F], 526267[F], 526271 [F], 20206[-1492], 526276| 526274[F], 526275[F], 20205[-1492]
1699]
ARNTL2
629815[F], 863369[F], 863370[F], 17319[F], 500039[F], 500040[F],
629814[F], 863371[F], 17318[F], 500038[F], 500042[F], 500043[F], (56938) &
500041[F], 500045[F], 500047[F], 500049[F], 500036[-3113],
500044[F], 500046[F], 500048[F], 500050[-767], 500037[-1660] Arntl2
500035[-3180]
(272322)
627869[F], 846556[F], 846559[F], 846560[F], 846561 [F], 846562[F], 627870[F], 846552[F], 846553[F], 846554[F], 846555[F], 846557[F], ARPC1A 846564[F], 846565[F], 14762[F], 464506[F], 464507[F], 464508[F], 846558[F], 846563[F], 14763[F], 464502[F], 464503[F], 464504[F], (10552) & 464512[F], 464513[F], 464514[F], 464515[F], 464516[F], 464517[F], 464505[F], 464509[F], 464510[F], 464511[F], 464518[F], Arpda 464519[F], 464520[F], 464521[F], 14760[163] 14761[163], 464501[-1293] (56443)
627872[F], 714536[F], 846567[F], 846571[F], 927719(1992],
627871 [F], 714537[F], 846568[F], 846569[F], 846570[F], 846572[F],
627874(734], 627875(107], 846566[-8], 846574[-1221], 846575[- ARPC1B 846573[F], 627873[734], 846576[-1322], 846580[-4574], 14764[F],
1300], 846577[-1902], 846578[-3094], 846579[-3168], 14765[F], (10095) & 464524[F], 464525[F], 464527[F], 464528[F], 464529[F], 464530[F],
464523[F], 464526[F], 464533[F], 464536[F], 14767(532], 464522[- Arpdb 464531 [F], 464532[F], 464534[F], 464535[F], 464537[F], 14766(532],
28], 464539[-1483], 464540[-1562], 464542[-2132], 464543[-3192], (11867) 464538[-941], 464541[-1584], 464545[-4130]
464544[-3266], 464546[-4681], 14768[-4987]
617192[F], 658169[F], 658170[F], 658171[F], 658173]F], 658174[F],
658175[F], 658176[F], 658177[F], 658178[F], 658179[F], 658180[F],
658181[F], 658182[F], 658185[F], 754606[F], 754607[F], 658166]- 617193[F], 658167[F], 658168[F], 658172[F], 658183[F], 658184[F], ARPC2 10], 998[F], 60186[F], 60187[F], 60188[F], 60191[F], 60193[F], 658186[F], 999[F], 60184[F], 60185[F], 60189[F], 60190[F], (10109) & 60194[F], 60195[F], 60196[F], 60200[F], 60201 [F], 60202[F], 60192[F], 60197[F], 60198[F], 60199[F], 60210[F], 60216[F], Arpc2 60203[F], 60204[F], 60205[F], 60206[F], 60207[F], 60208[F], 60217[F], 60219[F] (76709) 60209[F], 60211[F], 60212[F], 60213[F], 60214[F], 60215[F],
60218]F1, 60183Γ-511
627363[F], 843209[F], 843211[F], 843212[F], 843215[F], 843216[F],
843217[F], 843218[F], 843219[F], 843220[F], 640694[-4517], 701001 627364[F], 843206[F], 843207[F], 843208[F], 843210[F], 843213[F], ARPC3 4525], 701002[-4708], 701004[-4786], 14113[F], 456366[F], 843214[F], 627362[-2132], 640695[-4517], 701003[-4785], 14114[F], (10094) & 456369[F], 456371[F], 456372[F], 456375[F], 456376]F], 456377[F], 456363[F], 456364[F], 456365[F], 456367]F], 456368[F], 456370[F], Arpc3 456378[F], 456379[F], 456380[F], 456381 [-1478], 456382[-2633], 456373[F], 456374[F] (56378) 4563831-2994]
ARPC3P3
923327[-2855], 923328[-3396], 893917[-4855] 923329[-3460]
(729494)
629210[F], 858804[F], 858806[F], 858807[F], 858809[F], 858812[F]
858813[F], 858814[F], 858816[F], 858817[F], 629210(14076],
629209(304], 858802[-166], 858818[-876], 858801[-1197], 858819]-
629211[F], 858803[F], 858805[F], 858808[F], 858810[F], 858811[F], ARPC4 1449], 858800[-2507], 858820[-3873], 858799[-4574], 490319[F],
858815[F], 629211[14076], 929195[-3221], 858821 [-4135], (10093) & 490321 [F], 490322[F], 490324[F], 490326[F], 490328]F], 490330[F]
490318[F], 490320[F], 490323[F], 490325[F], 490327[F], 490329[F], Arpc4 490331 [F], 490332[F], 490333[F], 490335[F], 490336[F], 490337[F]
490334[F], 16500[12334], 490341 [-3314] (68089) 16499(12334], 490338(19], 16498[-228], 490339[-271], 490317[-684],
4903161-2235], 490315[-2829], 490340[-3069], 490314[-4470],
4903421-4516]
618046[F], 640919[F], 665052[F], 665053[F], 702881 [F], 618044[- ARPC5
618043[-223], 2096[-204], 74736[-4171] 223], 665051[-2376], 2099[F], 74739[F], 74740[F], 2097[-204], (10092) &
74738[-2256], 74737[-2917; Arpc5 TABLE 2 - Page 108 of 1873
619474[F], 786194[F], 786196[F], 619478[-876], 786198[-1855],
619473[F], 786193[F], 786195[F], 619477[-876], 786197[-1340], 786200[-2831], 786201 [-3143], 786202[-4079], 3813[F], 332235[F], ARPC5L 786199[-1990], 3812[F], 332234[F], 332236[F], 332239[F], 3816[818] 332237[F], 332238[F], 332240[F], 332241 [F], 3817[818], 332243[- (81873) & 332242[-997], 332244[-1534], 3814[-2513], 332232[-3013], 332229[- 1430], 332245[-2264], 3815[-2513], 332246[-2567], 332233[-2572], Arpc5l 3337] 3322311-3079], 332230[-3289], 332247[-3385], 332228[-3958], (74192)
3322271-4683]
ARPM1
934403[-274], 622687[-1862], 808540[-2274], 621761 [-2909], 621759[F], 802914[F], 622686[-1862], 808541[-1950], 621760[- (84517) &
802915[-3052], 802917[-4553], 6733[-2215], 367988[-2370], 367990[-2909], 802916[-4391], 6731 [F], 367987[F], 6732[-2215], 367989[- Arpml 3817] 3655]
(76652)
635462[F], 635464[F], 673209[F], 901979[F], 901981 [F], 901982[F],
901983[F], 901985[F], 901986[F], 901987[F], 901989[F], 901990[F],
901978[-111], 24985[F], 582712[F], 582713[F], 582715[F], 635463[F], 635465[F], 673210[F], 852797[F], 901980[F], 901984[F], ARPP19 582716[F], 582717[F], 582718[F], 582719[F], 582721 [F], 582722[F], 901988[F], 24986[F], 582714[F], 582720[F], 582726[F], 582730[F], (10776) & 582723[F], 582724[F], 582725[F], 582727[F], 582728[F], 582729[F], 582735[F], 24988[-979], 582739[-1362], 582741[-1454], 582742[- Arp 19 582731 [F], 582732[F], 582733[F], 582734[F], 582736[F], 582737[F], 2023], 582743[-2181] (59046) 582712[-24], 24987[-979], 582738[-1118], 582740[-1396], 582744[- 4733]
636061[F], 636063[F], 636065[F], 906288[F], 906290[F], 906293[F], 906294[F], 906296[F], 906297[F], 906298[F], 906301 [F], 906303[F],
636062[F], 636064[F], 636066[F], 906286[F], 906287[F], 906289[F],
906304[F], 906306[F], 906307[F], 636063(303], 906303[-509],
906291 [F], 906292[F], 906295[F], 906299[F], 906300[F], 906302[F],
906301[-877], 906310[-2061], 906304[-2630], 906306[-4034],
906305[F], 906308[F], 636064[303], 906309[29], 906311 [-2693],
25751 [F], 25753[F], 591376[F], 591377[F], 591379[F], 591380[F], ARPP21 906305[-3128], 25752[F], 25754[F], 591375[F], 591378[F],
591381[F], 591382[F], 591383[F], 591385[F], 591386[F], 591388[F], (10777) & 591384[F], 591387[F], 591389[F], 591391 [F], 591392[F], 591394[F],
591390[F], 591393[F], 591395[F], 591396[F], 591399[F], 591400[F], Arpp21 591397[F], 591398[F], 591403[F], 591404[F], 591405[F], 591406[F],
591401[F], 591402[F], 591407[F], 591409[F], 591410[F], 591412[F], (74100) 591408[F], 591411[F], 591415[F], 591421 [F], 591422[F],
591413[F], 591414[F], 591416[F], 591417[F], 591418[F], 591419[F], 25754[29728], 25756[749], 591403[-132], 591424[-181], 591391[- 591420[F], 591423[F], 25753[29728], 25755[749], 591409[-1163], 2361], 591411[-3314], 591406[- 4 450]
591423[-1911], 591390[-2533], 591410[-2797], 591400[-3080],
591402[-3801], 591401 [-4008], 591399[-4800], 591412[-4910]
912023[F], 912024[F], 651723[13505], 651724[-3314], 46637[F], ARR3 606003[F], 606004[F], 46638[-1077 (407) &
631462[F], 631464[F], 873086[F], 873087[F], 873088[F], 873090[F],
873092[F], 873093[F], 873094[F], 873096[F], 873097[F], 873098[F],
631463[F], 873089[F], 873091 [F], 873095[F], 873099[F], 873104[F], 873100[F], 873101[F], 873102[F], 873103[F], 873105[F], 873108[F], ARRB1
873106[F], 873107[F], 873110[F], 19848[F], 522248[F], 522249[F], 873109[F], 873111[F], 19847[F], 19849[F], 522243[F], 522244[F], (408) &
522251[F], 522254[F], 522258[F], 522261 [F], 522263[F], 522264[F], 522245[F], 522246[F], 522247[F], 522250[F], 522252[F], 522253[F], Arr l
522267[F], 522268[F], 522269[F], 522274[F], 522276[F], 522277[F], 522255[F], 522256[F], 522257[F], 522259[F], 522260[F], 522262[F], (109689)
522280[F]
522265[F], 522266[F], 522270[F], 522271 [F], 522272[F], 522273[F],
522275[F], 522278[F], 522279[F], 522281 [F]
ARRB2
639160[F], 690512[F], 690513[F], 690514[F], 29751 [F], 127717[F],
(409) & 127718[F], 127719[F]
Arrb2 ARRDC1
619033[-3631] 619032[-3631]
(92714) ARRDC2
633220[F], 885118[F], 633220[5489], 633221[-2013], 22176[F], (27106) &
633222[-2013], 22178[-2327]
548462[F], 548461 [44], 22177[-1552], 22179[-2327], 548463[-4023] Arrdc2
(70807)
643077[F], 664645[F], 718481[F] 718482[F], 718483[F], 718485[F],
718487[F], 718488[F], 718489[F] 718490[F], 718491 [F], 718492[F], ARRDC3 718493[F], 718494[F], 718495[F] 718496[F], 34900[F], 189836[F], 643078[F], 643079[F], 718480[F], 718484[F], 718486[F], 34901 [F], (57561) & 189837[F], 189838[F], 189840[F] 189842[F], 189843[F], 189844[F], 34902[F], 189835[F], 189839[F], 189841 [F] Arrdc3 189845[F], 189846[F], 189847[F] 189848[F], 189849[F], 189850[F], (105171) 189851 [F]
ARRDC5 (645432) &
923343[-4937], 42311[-3033], 280461[-3568] 42310[-1236]
Arrdc5 (76920)
740853[F], 740856[F], 740858[F], 740860[F], 931340(4044], 645957[F], 740854[F], 740855[F], 740857[F], 740859[F], 740861 [F], ARSA 931341[4007], 931342(3554], 931343[3072], 38918[F], 239392[F], 38917[F], 239393[F], 239394[F], 239396[F], 239398[F], 239400[F], (410) & 239395[F], 239397[F], 239399[F], 239391 [-2282 38925(1210], 239401 [-1228 Arsa TABLE 2 - Page 109 of 1873
643188[F], 719110[F], 719112[F], 719113[F], 719114[F], 719115[F],
643189[F], 719111[F], 719122[F], 719125[F], 719126[F], 719128[F], 719116[F], 719117[F], 719118[F], 719119[F], 719120[F], 719121[F],
719129[F], 719132[F], 918651[F], 918652[F], 918654[F], 918655[F], 719123[F], 719124[F], 719127[F], 719130[F], 719131 [F], 719133[F],
918658(3405], 918651(1894], 719125[-106], 918652[-4178], ARSB 918653[F], 918656[F], 918657(3876], 918659(2683], 35041[F],
35042[F], 191342[F], 191347[F], 191349[F], 191350[F], 191351[F], (411) & 191339[F], 191340[F], 191341[F], 191343[F], 191344[F], 191345[F],
191352[F], 191353[F], 191354[F], 191355[F], 191358[F], 191359[F], Arsb 191346[F], 191348[F], 191356[F], 191357[F], 191360[F], 191361[F],
191362[F], 191363[F], 191364[F], 191366[F], 191368[F], 191371[F], (11881) 191365[F], 191367[F], 191369[F], 191370[F], 191373[F], 191374[F],
191372[F], 191375[F], 191377[F], 191379[F], 191380[F], 191382[F], 191376[F], 191378[F], 191381[F], 191383[F], 191385[F], 191389[F],
191384[F], 191386[F], 191387[F], 191388[F], 191391 [F]
191390[F], 191392[F]
640362[F], 640364[F], 699070[F], 699072[F], 699073[F], 699075[F],
699078[F], 699079[F], 699080[F], 699081 [F], 699082[F], 699084[F], 640363[F], 640365[F], 699071 [F], 699074[F], 699076[F], 699077[F],
699085[F], 699086[F], 930046(683], 640366(648], 930045(594], 699083[F], 699087[F], 640367(648], 640369[-421], 699088[-506],
930044(472], 640368[-421], 930043[-918], 699069[-1317], 699068[- 699089[-690], 699090[-842], 699091[-941], 699092[-1106], 699093[- ARSG
1406], 6990671-1528], 699094[-2061], 699066[-2918], 31094[F], 1917], 31095[F], 142459[F], 142461 [F], 142462[F], 142463[F], (22901) &
142458[F], 142460[F], 142464[F], 142465[F], 142466[F], 142467[F], 142469[F], 142470[F], 142477[F], 142481 [F], 142486[F], Ar¾g
142468[F], 142471[F], 142472[F], 142473[F], 142474[F], 142475[F], 31097(1533], 31099(1088], 142489[-86], 142490[-298], 142491[- (74008)
142476[F], 142478[F], 142479[F], 142480[F], 142482[F], 142483[F], 520], 142492[-618], 142493[-793], 142494[-986], 142481 [-2234],
142484[F], 142485[F], 142487[F], 142488[F], 31096(1533], 142457[-2991], 142496[-3763], 142455[-3924]
31098(1088], 142495[-1117], 142456[-3366], 142480[-3981]
ARSI
768908[F], 768909[F], 768910[F], 768911[F], 649560(6531],
649561(6531], 43666[F], 299088[F] (340075) & 43665[F], 299087[F], 299089[F], 299090[-565], 299091[-710]
Arsi
623126[F], 623127[F], 811493[F], 811494[F], 811497[F], 811
