polyketides

Cross-Reference to Related Application

[0001] This application claims the benefit of priority of United States of America Provisional Patent Application No. 61/647,768 filed May 16, 2012, the contents of which being hereby incorporated by reference in its entirety for all purposes.

Background of the invention

[0002] Polyketide synthases (PKSs) are a family of multi-domain enzymes or enzyme complexes that produce polyketides, a large class of secondary metabolites in bacteria, fungi, plants, and some animals. The PKS genes are often organized to a single operon in prokaryotes' and organized as gene clusters in eukaryotes that express multi-domain proteins usually including a ketosynthase domain (KS), an acyltransferase domain (AT), a

ketoreductase domain (KR), a dehydratase domain (DH), and an acyl carrier protein domain (ACP) and may additionally include other domains such as enoylreductase, methyltransferase depending on the type of PKS.

[0003] Although type I iPKSs that form aromatic polyketide biosynthesis are widely distributed in fungi (38), bacterial Type I PKSs are mostly multi-modular PKSs and aromatic polyketide biosynthesis in bacteria is usually catalyzed by type II PKS. The discovery of the bacterial iPKSs for aromatic polyketide biosynthesis has revealed bacterial iPKS that bear great resemblance to fungal iPKSs. AviM (39, 40) and Cal05(4i) catalyze the biosynthesis of the monoyclic orsellinic acid (OSA) moiety for avilamycin (AVI) and calicheamicin (CAL). ChlBl(42, 43), MdpB( and PokMl (45) catalyze the biosynthesis of 6- methylsalicyclic acid (6-MSA) moiety for chlorothricin (CHL), maduropeptin (MDP), polyketomyces (POK) and pactamycin (PTM). NcsB(4<5, 47) catalyzes fhe biosynthesis of bicyclic 2-hydroxyl-5-methyl-naphthoic acid (NPA) for neocarzinostatin (NCS); and AziB (48) catalyzes the biosynthesis of bicylcic 5-methyl-NPA for Azinomycin B.

[0004] Saccharopolyspora erythraea is a mycelium-forming actinomycete that has been used for the industrial-scale production of the clinically important macrolide antibiotic erythromycin A. The gene clusters for erythromycin biosynthesis (ery)(35) and for a second modular PKS of unknown function (pke)(36) have been previously identified. Recently, Oliynyk et al. reported the complete genome sequencing of Saccharopolyspora erythraea NRRL23338 and revealed further nine uncharacterized PKS gene clusters for polyketide biosynthesis (37). None of the hypothetical products of these PKS gene clusters has been detected, even with extensive fermentation experiments using 50 different solid and liquid media conducted (36).

[0005] One type of polyketide include Isocoumarins and dihydroisocoumarins that are widely occurring natural products that contain the basic isocoumarin (lH-2-benzopyran-l- one; 3,4-benzo-2-pyrone (1)) scaffold (1-4) (Fig. 1). Isocoumarins and dihydroisocoumarins are in prevalence among the products of secondary metabolism of plants and lower microorganisms but also among insect pheromones and venoms (2, 5-8). Isocoumarins and dihydroisocoumarins exhibit a wide structural diversity. An increasing number of these compounds are being discovered with some of them exhibiting pharmaceutically interesting activities. One of the best known dihydroisocoumarins is mellein (2) or 4-dihydro-8-hydroxy- 3-methylisocoumarin. Mellein, which may function as a pheromone, has been isolated from several fungal species and the secretory grand of ants (9-13). As a trail pheromonal molecule used by ants, mellein can be potentially exploited as insecticide agent for ant control.

[0006] Naturally occurring or synthetic isocoumarins or dihydroisocoumarins exhibit a broad spectrum of biological activities and some of them are being developed as therapeutic agents. Among the most important dihydroisocoumarins, AI-77 B (13) is endowed with gastroprotective properties but free of effects on the central nervous system (14). AI-77 B and its structural analogs were isolated from a culture broth of Bacillus pumilus AI-77(i5). AI-77 B is a member of a unique drug class because it exhibits noncentral suppressive, nonanticholinergic and non-antihistaminergic properties in spite of its potent

antiulcerogenicity action against stress ulcers induced in rats by restraint and water- immersion. Coriandrin (3) is a novel furoisocoumarin isolated from Coriandrum satiuum L. in 1988. It is structurally related to the psoralens and therapeutically useful in the treatment of HIV virus infection and skin diseases (16-19). Three structurally related

dihydroisocoumarins (hydrangenol (15), phyllodulcin (16) and thunberginol A (17)) from the processed leaves of Hydrangea macrophylla var. thunbergii promote adipogenesis of 3T3-L1 cells and exhibit anti-diabetic properties (20-24). Phyllodulcin (16) is also a lead compound in the discovery of novel low calorie sweeteners (24, 25). Isolation and characterization of several new isocoumarins that include paraphaeosphaerin A (14) from Paraphaeosphaeria quadriseptana has been reported (26-28). Paraphaeosphaerin A exhibits moderate cytotoxic activities against a human leukemia cell line (HL 60). Ochratoxin A (8) is a fungal secondary metabolite consisting of a chlorinated isocoumarin derivative linked to L-phenylalanine (29- 31). First discovered in 1965, ochratoxin A is a fungal metabolite that is a potent teratogen and hepatotoxin and has been classified as a possible carcinogen for humans because it forms DNA adducts. An immunomodulatory effect of ochratoxin A on a human

monocyte/macrophage cell line has been established.

[0007] Several synthetic isocoumarins and dihydroisocoumarins also exhibit biological activities and are being evaluated as therapeutic agents. NM-3 (10) is a synthetic analogue of cytogenin (4), and potentiates antineoplastic effects of other chemotherapeutic agents and inhibits angiogenesis (32, 33). This compound is currently in phase I clinical trials. The isocoumarin 185322 (9), an analogue of NM-3, is also an inhibitor of microtubule assembly, and induces mitotic arrest and apoptosis of multiple myeloma cells (34). In addition, several isocoumarins are synthetic intermediates en route to other classes of compounds.

[0008] The biosynthesis mechanisms for many Isocoumarins and dihydroisocoumarins remain largely speculative today. Chemical synthesis methods are known. These are usually performed under argon atmosphere with toxic chemicals and organic solvents such as DMF, Boronic acid, toluene's, palladium, bromocide or ethyl acetate. Current production methods generate toxic by-products that results in high disposal or environmental costs.

Summary

[0009] A first aspect of the invention includes An isolated polypeptide having polyketide synthase activity, wherein said polypeptide comprises (i) an amino acid sequence set forth in SEQ ID NO:l ; or (ii) an amino acid sequence having at least 60, at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 % sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 over its entire length; or (iii) an amino acid sequence having at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 sequence homology with the amino acid sequence set forth in SEQ ID NO: 1 over its entire length; or (iv) a functional fragment of any one of (i) to (iii).

[0010] Another aspect of the invention includes a chimeric polyketide synthase comprising (i) a ketosynthase domain (KS); (ii) an acyltransferase domain (AT); (iii) a thioester hydrolase domain (TH); (iv) a ketoreductase domain (KR); and (v) an acyl carrier protein domain (ACP), in the N- to C-terminal orientation KS-AT-TH-KR-ACP, wherein said chimeric polyketide synthase is based on the polyketide synthase with the amino acid sequence set forth in SEQ ID NO: 1 wherein any one, two or three of the domains (i)-(v) of the polyketide synthase with the amino acid sequence set forth in SEQ ID NO: 1 , preferably the AT and/or TH and/or KR domain, have been replaced by heterologous domains from other polyketide synthases. [0011] Another aspect of the invention includes a polyketide synthase mutein comprising (i) a ketosynthase domain (KS); (ii) an acyltransferase domain (AT); (iii) a thioester hydrolase domain (TH); (iv) a ketoreductase domain (KR); and (v) an acyl carrier protein domain (ACP), in the N- to C-terminal orientation KS- AT-TH-KR- ACP , wherein said polyketide synthase mutein is based on the polyketide synthase with the amino acid sequence set forth in SEQ ID NO: 1 wherein any one, two, three, four or five of the domains (i)-(v) of the polyketide synthase with the amino acid sequence set forth in SEQ ID NO: l, preferably the AT and/or TH and/or KR domain, contain one or more mutations that alter their substrate specificity or enzymatic activity.

[0012] Another aspect of the invention includes an Isolated nucleic acid molecule comprising a nucleotide sequence encoding for the polypeptide, the chimeric polyketide synthase or the polyketide synthase mutein of the invention.

[0013] Another aspect of the invention comprises a chimeric nucleic acid molecule comprising (i) a nucleic acid sequence expressing a ketosynthase domain (KS); (ii) a nucleic acid sequence expressing an acyltransferase domain (AT); (iii) a nucleic acid sequence expressing a thioester hydrolase domain (TH); (iv) a nucleic acid sequence expressing a ketoreductase domain (KR); and (v) a nucleic acid sequence expressing an acyl carrier protein domain (ACP), in the N- to C-terminal orientation KS-AT-TH-KR-ACP, wherein said chimeric nucleic acid molecule is based on a nucleic acid sequence set forth in SEQ ID NO:2 wherein any one, two or three of the nucleic acids (i)-(v) of the nucleic acid sequence set forth in SEQ ID NO:2, preferably the nucleic acid sequence expressing the AT and/or TH and/or KR domain, have been replaced by heterologous domains from other nucleic acids expressing polyketide synthases.

[0014] Another aspect of the invention includes a host cell comprising the nucleic acid molecule of the invention. [0015] Another aspect of the invention includes a method for the production of a polypeptide, the chimeric polyketide synthase or the polyketide synthase mutein of the invention, comprising the steps of

(i) cultivating a host cell under conditions that allow the expression of the

polypeptide, chimeric polyketide synthase or polyketide synthase mutein; and

(ii) isolating the polypeptide, chimeric polyketide synthase or polyketide synthase mutein from said host cell.

[0016] Another aspect of the invention includes a method for the production of a polyketide, comprising the steps of

(i) Contacting the polypeptide, chimeric polyketide synthase or polyketide synthase mutein of the invention with a suitable substrate under conditions that allow enzymatic production of said polyketide;

(ii) Isolating the produced polyketide. Brief Description of the Drawings

[0017] The drawings are not necessarily drawn to scale, emphasis instead generally being placed upon illustrating the principles of various embodiments. In the following description, various embodiments of the invention are described with reference to the following drawings.

Figure 1. Biologically active natural and synthetic mellein and isocoumarin derivatives. Figure 2. (A) SDS-PAGE for SACE5532 and Sfp eluted from Ni ²⁺ -NTA column. (B) Gel filtration of SACE5532 and Sfp using a HiLoad™ 16/60 Superdex™ 200 column. (C) SDS- PAGE gels of the recombinant SACE5532, (D) Sfp and (E) stand-alone KR domain proteins. Figure 3. (A) HPLC analysis of the product of SACE5532 in vitro reaction along with the negative controls with the wavelength of the UV-Vis detector set at 314 nm. (B) Absorption spectrum of the PKS product. Figure 4. Time-dependent synthesis of mellein (2) by mellein synthase by using acetyl-CoA, malonyl-CoA and NAPDH as substrates

Figure 5. HPLC analysis of the product of SACE5532 produced by in vitro reaction and co- expression of SACE5532 and Sfp in E. coli cells

Figure 6. A. HPLC analysis of the product of SACE5532(AACP:NcsB-ACP) and wild-type SACE5532 with B. UV detection at 314 nm. C. Selective reduction of the ?-keto group of the diketide analogs by the KR domain of SACE5532 Keto-reductase activity of the KR domains of SACE5532 and NcsB towards trans- 1-decalone ((18), left panel), acetoacetyl-SNAC ((20), middle panel) and S-Ethyl acetothioacetate ((19), right panel). D. Ketoreducase activity of the stand-alone KRSACE5532 domain towards di-, and triketide analogs.

Figure 7. H ¹ and ¹³ C NMR spectra of the product mellein (2). (CDC1 ₃ , 400 MHz).

Figure 8. Bacterial iPKSs for aromatic polyketide biosynthesis. (A) ChlB l , MdpB and PokMl for 6-methylsalicyclic acid (6-MSA) biosynthesis. (B) NcsB for 2-hydroxyl-5- methyl-naphthoic acid (NPA) biosynthesis. (C) AziB for 5-methyl-NPA biosynthesis. (D) mellein synthase for mellein (2) biosynthesis.

Figure 9. Biosynthetic mechanism of mellein by the iterative polyketide synthase.

Figure 10. Synthesis of mellein and isocoumarin derivatives by protein engineering and domain swapping. A. Engineering of the AT domain to use different starter unit (B) or engineering or replacement of KR/TH domain to alter reduction pattern. C. Active site of the acetyl and malonyl-specific acyltransferase (AT) domain of the mellein synthase (yellow/light grey) with a malonyl moiety attached to the catalytic serine. The blue (dark Grey) structures are from another PKS at domain with sole specificity towards malonyl-CoA. Figure 11. Production of 6-mefhylsalicylic acid (6-MSA) by an engineered mellein synthase. Detailed description [0018] We have constructed a recombinant polyketide synthase based on one of the dozens of orphan PKS like genes revealed in the sequencing of the genome of S. erythraea NRRL23338. This uncharacterized orphan PKS is SACE5532 (or PKS8), which is predicted to be a single-modular PKS enzyme. Our bioinformatic studies show that SACE5532 exhibits a head-to-tail homology to several characterized bacterial iterative type I PKSs (iPKSs) for aromatic polyketide biosynthesis. SACE5532 has at least five predicted protein domains based on sequence homology: a ketosynthase (KS), an acyltransferase (AT), a ketoreductase (KR), a dehydratase (DH), and an acyl carrier protein (ACP) domain. We present evidence to show that the KR domain alone is able to recognize and differentiate polyketide intermediates. Understanding the activity of different protein domains on the formation of polyketides has enabled us to design recombinant polyketide synthases' able to produce specific polyketides. For example the stringent stereo-specificity with which each KR domain performs keto reduction allows us to design an enzyme capable of forming a specific polyketide core structure.

[0019] Accordingly, a first aspect of the invention includes An isolated polypeptide having polyketide synthase activity, wherein said polypeptide comprises (i) an amino acid sequence set forth in SEQ ID NO: 1 ; or (ii) an amino acid sequence having at least 60, at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 % sequence identity with the amino acid sequence set forth in SEQ ID NO:l over its entire length; or (iii) an amino acid sequence having at least 70, at least 80, at least 85, at least 90, at least 95, at least 97, at least 98 or at least 99 sequence homology with the amino acid sequence set forth in SEQ ID NO: 1 over its entire length; or (iv) a functional fragment of any one of (i) to (iii).

[0020] "Polyketide synthase activity" is catabolism of polyketides or intermediates as described herein from simple 2-, 3-, 4-carbon building blocks such as acetyl-CoA, propionyl CoA, butyryl-CoA and their activated derivatives, malonyl-, methylmalonyl- and ethylmalonyl-CoA. Preferably, Polyketide synthase activity comprises condensation of the carbon building blocks and ketoreductase of the condensed building blocks. Preferably, Polyketide synthase activity includes iterative type I synthase activity. In a preferred embodiment the isolated polypeptide has mellein synthase activity. This allows the isolated peptide to be capable of synthesizing mellein in the presence of a suitable substrate.

[0021] ? Polypeptides of the present invention have about 2000 amino acids, encode an enzyme having polyketide synthase activity and preferably comprise SEQ ID NO. 1 or a sequence having homology with the amino acid sequence set forth in SEQ ID NO: 1. SEQ ID NO. 1 is the expression product of a putative polyketide synthase like gene revealed in the sequencing of the genome of Saccharopolyspora. erythraea strain NRRL23338.

[0022] The polypeptides of the invention also comprise several functional domains. Specifically the KS domain consists of amino acids 20 to 439 of the amino acid sequence shown as SEQ ID NO: 1 or allelic variants, homologues or fragments, thereof; the AT domain consists of amino acids 530 to 853 of the amino acid sequence shown as SEQ ID NO: 1 or allelic variants, homologues or fragments, thereof; the TH domain consists of amino acids 888 to 1043 of the amino acid sequence shown as SEQ ID NO: 1 or allelic variants, homologues or fragments, thereof; the KR domain consists of amino acids 1146 to 1613 of the amino acid sequence shown as SEQ ID NO: 1 or allelic variants, homologues or fragments, thereof; and the ACP domain consists of amino acids 1623 to 1693 of the amino acid sequence shown as SEQ ID NO: 1 or allelic variants, homologues or fragments, thereof. Fragments and derivatives of full length polypeptides, particularly include fragments or derivatives having substantially the same biological activity. A particularly preferred polypeptide consists of amino acids domains KS, AT, TH, KR and ACP mentioned above. [0023] The term "polypeptide" refers to a polymer of amino acids and its equivalent and does not refer to a specific length of the product; thus, peptides, oligopeptides and proteins are included within the definition of a polypeptide. This term also does not refer to, or exclude modifications of the polypeptide, for example, glycosylates, acetylations, phosphorylations, and the like. Included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, natural amino acids, etc.), polypeptides with substituted linkages as well as other modifications known in the art, both naturally and non-naturally occurring.

[0024] In the context of the present invention, a homologous sequence is taken to include an amino acid sequence which is at least 60, 70, 80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level over at least 20, 50, 100, 200, 300 or 400 amino acids with the amino acid sequences set out in SEQ ID. NO 1. In particular, homology should typically be considered with respect to those regions of the sequence known to be essential for the function of the protein rather than non-essential neighbouring sequences. Preferred polypeptides of the invention comprise a contiguous sequence having greater than 50, 60 or 70% homology, more preferably greater than 80 or 90% homology, to one or more of amino acids of SEQ ID NO: 1.

[0025] Other preferred polypeptides comprise a contiguous sequence having greater than 40, 50, 60, or 70% homology, of SEQ ID No: 1 and are capable of binding to SEQ ID No: l . Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity. The terms "substantial homology" or "substantial identity", when referring to polypeptides, indicate that the polypeptide or protein in question exhibits at least about 70% identity with an entire naturally-occurring protein or a portion thereof, usually at least about 80% identity, and preferably at least about 90 or 95% identity.

[0026] Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

[0027] Percentage (%) homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).

[0028] Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.

[0029] However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Affine gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.

[0030] Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package and others known in the art. Examples of other software that can perform sequence comparisons include, but are not limited to, the BLAST package and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching.

[0031] Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

[0032] Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

[0033] The polypeptide homologues include those having the amino acid sequences, wherein one or more of the amino acids is substituted with another amino acid which substitutions do not substantially alter the biological activity of the molecule. A polypeptide homologue according to the invention preferably has 80 percent or greater amino acid sequence identity to the polypeptide amino acid sequence set out in SEQ ID NO: 1. Examples of polypeptide homologues within the scope of the invention include the amino acid sequence of SEQ ID NOS: 1 wherein: (a) one or more aspartic acid residues is substituted with glutamic acid; (b) one or more isoleucine residues is substituted with leucine; (c) one or more glycine or valine residues is substituted with alanine; (d) one or more arginine residues is substituted with histidine; or (e) one or more tyrosine or phenylalanine residues is substituted with tryptophan.

[0034] Preferably "protein" or "polypeptide" refers to a protein or polypeptide encoded by the nucleic acid sequence SEQ ID NO.2, variants or fragments thereof. Also included are proteins encoded by DNA that hybridize under high or low stringency conditions, to the encoding nucleic acids. Closely related polypeptides or proteins retrieved by antisera to the polypeptide of SEQ ID NO. 1 is also included.

[0035] "Protein modifications or fragments" are provided by the present invention for the polypeptides or fragments thereof which are substantially homologous to primary structural sequences but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate unusual amino acids. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling, e.g., with radionuclides, and various enzymatic modifications, as will be readily appreciated by those well skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as P, ligands which bind to labeled antiligands (e.g., antibodies), fluorophores, chemiluminescent agents, enzymes, and antiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods of labeling polypeptides are well known in the art.

[0036] Another aspect of the invention includes a chimeric polyketide synthase comprising (i) a ketosynthase domain (KS); (ii) an acyltransferase domain (AT); (iii) a thioester hydrolase domain (TH); (iv) a ketoreductase domain (KR); and (v) an acyl carrier protein domain (ACP), in the N- to C-terminal orientation KS-AT-TH-KR-ACP, wherein said chimeric polyketide synthase is based on the polyketide synthase with the amino acid sequence set forth in SEQ ID NO: 1 wherein any one, two or three of the domains (i)-(v) of the polyketide synthase with the amino acid sequence set forth in SEQ ID NO:l , preferably the AT and/or TH and/or KR domain, have been replaced by heterologous domains from other polyketide synthases.

[0037] Providing sequences that originate from different species or strains or are expression products from different locations on a genome allows the recombinant polyketide synthase to be customized. This domain swapping has the advantage of designing an end product polyketide by adding a domain that will lead to the desired polyketide.

[0038] In various embodiments the chimeric polyketide synthase comprises the KS domain comprising an amino acid sequence selected from the amino acid sequences set forth in SEQ ID Nos:3-8; the AT domain comprising an amino acid sequence selected from the amino acid sequences set forth in SEQ ID Nos:9-14; the TH domain comprising an amino acid sequence selected from the amino acid sequences set forth in SEQ ID Nos: 15-20; the KR domain comprising an amino acid sequence selected from the amino acid sequences set forth in SEQ ID Nos:21-26; and/or the ACP domain comprising an amino acid sequence selected from the amino acid sequences set forth in SEQ ID Nos:27-32.

[0039] In one embodiment the chimeric polyketide synthase comprises: the KS domain comprising the amino acid sequence set forth in SEQ ID NO: 3; the AT domain comprising the amino acid sequence set forth in SEQ ID NO:9; the TH domain comprising the amino acid sequence set forth in SEQ ID NO: 16; the KR domain comprising the amino acid sequence set forth in SEQ ID NO:22; and/or the ACP domain comprising the amino acid sequence set forth in SEQ ID NO:27.

[0040] Essentially this example is the mellein synthase wherein the TH and KR domain is removed and replaced by an TH and KR domain from another polyketide synthase. [0041] Preferably the KR domain is able to reduce a ketone group at C5. Currently all known polyketide synthases from bacteria are known to reduce a ketone group at C5. For example the amino acid sequence selected from the amino acid sequences set forth in SEQ ID Nos:21- 26 from ChlBl, MdpB, PokMl, NcsB, AziB and mellein synthase all reduce a ketone group at C5. Figure 8 depicts the synthesis of the various baterial iPKS showing the intermediate ketone reductase step and the KS domain that is responsible for this ketone reduction. [0042] In one embodiment the nucleic acid expressing a KR domain espresses a peptide having SEQ ID NO. 23 from the ChlBl iPKS, or SEQ ID NO. 24 from the MdpB iPKS or SEQ ID NO. 25 from the PokMl iPKS.

[0043] In one embodiment the KR domain is able to reduce a ketone group at C5 and C9. /

This may be isolated from the iPKS of NcsB. The nucleic acid expressing a KR domain of NcsB comprises SEQ ID NO. 22; Ketone reduction with this KR domain may form 2- hydroxyl-5 -methyl -NP A or 6-MSA.

[0044] In one embodiment the KR domain is able to reduce a ketone group at C3, C5 and C9. This may be isolated from the iPKS of AziB.The nucleic acid expressing a KR domain of AziB espresses a peptide having SEQ ID NO. 26. Ketone reduction with this KR domain may 5-methyl-NPA.

[0045] In one embodiment the chimeric polyketide synthase comprises the KS domain comprising the amino acid sequence set forth in SEQ ID NO:3; the AT domain comprising the amino acid sequence set forth in SEQ ID NO: 10; the TH domain comprising the amino acid sequence set forth in SEQ ID NO: 15; the KR domain comprising the amino acid sequence set forth in SEQ ID NO:21 ; and/or the ACP domain comprising the amino acid sequence set forth in SEQ ID NO:27.

[0046] Essentially this example is the mellein synthase wherein the AT domain is removed and replaced by an AT domain from another polyketide synthase forming a herterologous construct. Swapping of the AT domain allows the loading of various starter units to produce mellein derivatives or other isocoumarin derivatives. The active site of the AT domain is depicted at Figure IOC. this site has specificity to the building blocks acetyl-CoA and malonyl-CoA. Specific AT domains will determine the affinity for the number, type, and or ratio of these building blocks.

[0047] Another aspect of the invention includes a polyketide synthase mutein comprising (i) a ketosynthase domain ( S); (ii) an acyltransferase domain (AT); (iii) a thioester hydrolase domain (TH); (iv) a ketoreductase domain (KR); and (v) an acyl carrier protein domain (ACP), in the N- to C-terminal orientation KS-AT-TH-KR-ACP, wherein said polyketide synthase mutein is based on the polyketide synthase with the amino acid sequence set forth in SEQ ID NO:l wherein any one, two, three, four or five of the domains (i)-(v) of the polyketide synthase with the amino acid sequence set forth in SEQ ID NO: l, preferably the AT and/or TH and/or KR domain, contain one or more mutations that alter their substrate specificity or enzymatic activity.

[0048] A "mutein" as described herein referes to a polypeptide arising as a result of a mutation or a polypeptide arising as a result of a recombinant nucleic acid proceedure. We have shown in the lab that to change the substrate specificity of the KS or KR domain, we need to mutate multiple amino acid residues of at least 2 or 10 or preferably more than 10 amino acid residues. The number of mutated amino acid residues varies, depending on the property of the new substrate and polyketide intermediates. The mutations may be performed on the nucleic acid to optimise the sequence for expression in a host organism. As such single point mutations may result in the result in an expression product as set forth in SEQ ID NO. 1 with a single variation. Alternatively, multiple may be performed on the nucleic acid resulting in at least 2 amino acid residues or 10 amino acid residues or preferably more than 10 amino acid residues varying from the expression product as set forth in SEQ ID NO. 1.

[0049] Another aspect of the invention includes an Isolated nucleic acid molecule comprising a nucleotide sequence encoding for the polypeptide, the chimeric polyketide synthase or the polyketide synthase mutein of the invention.

[0050] The term "isolated nucleic acid" as used herein refers to any nucleic acid molecule in any possible configuration, such as single stranded, double stranded or a combination thereof. Isolated nucleic acids include for instance DNA molecules, RNA molecules, analogues of the DNA or RNA generated using nucleotide analogues or using nucleic acid chemistry, locked nucleic acid molecules (LNA), peptide nucleic acid molecules (PNA) and tecto-RNA molecules. DNA or RNA may be of genomic or synthetic origin and may be single or double stranded. Such nucleic acid can be e.g. mRNA, cRNA, synthetic RNA, genomic DNA, cDNA, synthetic DNA, a copolymer of DNA and RNA, oligonucleotides, etc. Any nucleic acid capable of expressing the polypeptides of the invention including the KS, AT, TH, KR and ACP domains in a host cell would be suitable.

[0051] Many nucleotide analogues are known and can be used in the isolated nucleic acid of the invention. A nucleotide analogue is a nucleotide containing a modification at for instance the base, sugar, or phosphate moieties. As an illustrative example, a substitution of

2'-OH residues of siRNA with 2'F, 2'O-Me or 2Ή residues is known to improve the in vivo stability of the respective RNA. Modifications at the base moiety include natural and synthetic modifications of A, C, G, and T/U, different purine or pyrimidine bases, such as uracil-5-yl, hypoxanthin-9-yl, and 2-aminoadenin-9-yl, as well as non-purine or non-pyrimidine nucleotide bases. Other nucleotide analogues serve as universal bases. Universal bases include 3-nitropyrrole and 5-nitroindole. Universal bases are able to form a base pair with any other base. Base modifications often can be combined with for example a sugar modification, such as for instance 2'-0-methoxyethyl, e.g. to achieve unique properties such as increased duplex stability.

[0052] In a prefered embodiment the isolated nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:2 adapted for expression in a given host codon-optimized variant thereof.

[0053] In one embodiment the isolated nucleic acids expressing the polyketide synthase are isolated from Saccharopolyspora erythraea having SEQ ID NO. 2 and optimized for protein expression in a host cell. Such a recombinant nucleic acid can express a mellein synthase and can be used in the production of mellein as described herein. Our recombinant polyketide synthase formed a partially reducing iterative polyketide synthase able to produce mellein or derivatives. Remarkably, despite the shared homology with several fungal and bacterial PKSs, the mellein synthase exhibits a distinct keto-reduction pattern in the synthesis of the pentaketide. We determined that the unique patterning can be transferred to other polyketide synthase by adjusting the recombinant polyketide synthase by replacing the domain sequences from other PKSs to produce other polyketides.

[0054] In one embodiment the recombinant isolated nucleic acic can express a mellein synthase and can be used in the production of mellein as described herein. In which case the polykedide synthase is mellein synthase. In this embodiment the mellein synthase may be used for the preparation of mellein (2) having the structure

ellein (2)

[0055] The construct can be synthesised de novo for protein expression of mellein synthase in a cell and then mellein can be synthesized by using a cell based system or an in vitro system.

[0056] The term " host codon-optimized variant " as used herein, refers to the addition or modification of a nucleic acid sequence needed for gene sequence expression. They include promoters and or enhancers as known in the art. Promoter regions vary from organism to organism, but are well known to persons skilled in the art for different organisms. For example, in prokaryotes, the promoter region contains both the promoter (which directs the initiation of RNA transcription) as well as the DNA sequences which, when transcribed into RNA, will signal synthesis initiation. Such regions will normally include those 5'-non-coding sequences involved with initiation of transcription and translation, such as the TATA box, capping sequence, CAAT sequence, and the like.

[0057] The factional promoter is preferably a strong promotor capable of high levels of transcription to drive rapid polyketide synthase expression. Generally viral promoters have these criteria as these are required for efficient viral propagation, and they frequently induce much higher levels of transcription than eukaryotic promoters by using mechanisms to control and recruit host transcription machinery. Moreover, viral promoters tend to be far more compact and hence easier to manipulate and accommodate into gene vectors. Human cytomegalovirus major immediate early gene promoter (hCMV) would by suitable. Other suitable viral promoters include the simian virus 40 (SV40), Rous sarcoma virus long terminal repeat (RSV-LTR), Moloney murine leukaemia virus (MoMLV) LTR, and other retroviral LTR promoters. Any other suitable promotor known in the art capable of high levels of of transcription would be suitable. The isolated nucleic acid of the invention is operably linked to the promoter, and preferably lies 3' to the promoter sequence, more preferably lies directly adjacent to the promoter sequence.

[0058] In one embodiment the nucleic acid molecule is comprised in a vector.

[0059] The term "vector" relates to a single or double-stranded circular nucleic acid molecule that can be transfected into cells and replicated within or independently of a cell genome. A circular double-stranded nucleic acid molecule can be cut and thereby linearized upon treatment with restriction enzymes. An assortment of nucleic acid vectors, restriction enzymes, and the knowledge of the nucleotide sequences cut by restriction enzymes are readily available to those skilled in the art. A nucleic acid molecule encoding a polyketide synthase can be inserted into a vector by cutting the vector with restriction enzymes and ligating the pieces together. Preferably the vector is a plasmid

[0060] Another aspect of the invention comprises a chimeric nucleic acid molecule comprising (i) a nucleic acid sequence expressing a ketosynthase domain (KS); (ii) a nucleic acid sequence expressing an acyltransferase domain (AT); (iii) a nucleic acid sequence expressing a thioester hydrolase domain (TH); (iv) a nucleic acid sequence expressing a ketoreductase domain (KR); and (v) a nucleic acid sequence expressing an acyl carrier protein domain (ACP), in the N- to C-terminal orientation KS-AT-TH-KR-ACP, wherein said chimeric nucleic acid molecule is based on a nucleic acid sequence set forth in SEQ ID NO:2 wherein any one, two or three of the nucleic acids (i)-(v) of the nucleic acid sequence set forth in SEQ ID NO:2, preferably the nucleic acid sequence expressing the AT and/or TH and/or KR domain, have been replaced by heterologous domains from other nucleic acids expressing polyketide synthases. [0061] The domain swapping to form a chimeric nucleic acid molecule allows for the smart design of enzymes. Whereby the nucleic acid sequence set forth in SEQ ID NO:2 that expresses mellein synthase is used as a scaffold and specific domains of SEQ ID NO. 2 are removed and replaced by domains with similar activity from neucleic acids that express different herterogous polyketide synthases.

[0062] In one embodiment the chimeric nucleic acid molecule comprises, the nucleic acid sequence expressing the KS domain comprising a nucleic acid sequence selected from nucleic acid sequences set forth in SEQ ID Nos:33 and 34; the nucleic acid sequence expressing the AT domain comprising a nucleic acid sequence selected from nucleic acid sequences set forth in SEQ ID Nos:35 and 36; the nucleic acid sequence expressing the TH domain comprising a nucleic acid sequence selected from nucleic acid sequences set forth in SEQ ID Nos:37 and 38; the nucleic acid sequence expressing the KR domain comprising a nucleic acid sequence selected from nucleic acid sequences set forth in SEQ ID Nos:39 and 40; and/or the nucleic acid sequence expressing the ACP domain comprising a nucleic acid sequence selected from nucleic acid sequences set forth in SEQ ID Nos:41 and 42.

[0063] In one embodiment the chimeric nucleic acid molecule comprises: the nucleic acid sequence expressing the KS domain comprising the nucleic acid sequence set forth in SEQ ID NO:33; the nucleic acid sequence expressing the AT domain comprising the nucleic acid sequence set forth in SEQ ID NO:35; the nucleic acid sequence expressing the TH domain comprising the nucleic acid sequence set forth in SEQ ID NO:38; the nucleic acid sequence expressing the KR domain comprising the nucleic acid sequence set forth in SEQ ID NO:40; and/or the nucleic acid sequence expressing the ACP domain comprising the nucleic acid sequence set forth in SEQ ID NO:41.

[0064] In such an example the TH and KR domain of SEQ ID NO. 2 has been replaced with an TH and KR domain SEQ ID NO. 38 and 40 from a NcsB polyketide synthase. In similar embodiments where the chimeric nucleic acid uses SEQ ID NO. 2 as the scaffold and where a TH and KR expressing domain from another polyketide synthase replaces the TH and KR expressing domain the new expressed KR domain reduces a ketone group differently from the native KR domain.

[0065] This may allow the expressed chimeric polyketide synthase to be used for the preparation of a wide range of mellein derivatives, intermediates and isocoumarins such as 6- methylsalicyclic acid (6-MSA); 2-hydroxyl-5 -methyl -naphthoic acid; 6-methylsalicyclic acid (6-MSA); mellein and 5 methyl- naphthoic acid.

[0066] In one embodiment the chimeric nucleic acid molecule comprises: the nucleic acid sequence expressing the KS domain comprising the nucleic acid sequence set forth in SEQ ID NO:33; the nucleic acid sequence expressing the AT domain comprising the nucleic acid sequence set forth in SEQ ID NO:36; the nucleic acid sequence expressing the TH domain comprising the nucleic acid sequence set forth in SEQ ID NO:37; the nucleic acid sequence expressing the KR domain comprising the nucleic acid sequence set forth in SEQ ID NO:39; and/or the nucleic acid sequence expressing the ACP domain comprising the nucleic acid sequence set forth in SEQ ID NO:41.

[0067] In such an example the AT domain of SEQ ID NO. 2 has been replaced with an AT domain SEQ ID NO. 35 from a NcsB polyketide synthase. In similar embodiments where the chimeric nucleic acid uses SEQ ID NO. 2 as the scaffold and where an AT domain from another polyketide synthase replaces the AT domain. The resulting polyketide synthase may be used for the preparation of hydrangenol (15) as depicted in Figure 10B or, phyllodulcin (16), AI-77B (13) or NM-3 (10) having the following structures

Hydrangenol (15) Phyllodulcin (16)

N -3 (10)

AI-77 B (13) , respectively.

[0068] Another aspect of the invention includes a host cell comprising the nucleic acid molecule of any one of the invention.

[0069] The host cell may be any suitable host cell for recombinant production. The cell may be a procariotic cell or a eukariotic cell. There are many cell based systems known in the art. In one embodiment the host cell is a prokaryotic cell, preferably an E.coli cell. [0070] Another aspect of the invention includes a method for the production of a polypeptide, the chimeric polyketide synthase or the polyketide synthase mutein of the invention, comprising the steps of

(iii) cultivating a host cell under conditions that allow the expression of the

polypeptide, chimeric polyketide synthase or polyketide synthase mutein; and

(iv) isolating the polypeptide, chimeric polyketide synthase or polyketide synthase mutein from said host cell.

[0071] The method may further comprising the step of purifying the polypeptide, chimeric polyketide synthase or polyketide synthase mutein.

[0072] The isolated nucleic acid or the chimeric nucleic acid described above may be used to express the polypeptide, chimeric polyketide synthase or polyketide synthase mutein in the host cell.

[0073] This has the advantage of being able to express the polypeptide, the chimeric polyketide synthase or the polyketide synthase mutein in a cost effective cell based system. The biocatalyst can then be used in the cell based system to produce a polyketide or the polyketide synthase can be isolated and biochemically used to synthesize a polyketide.

[0074] Another aspect of the invention includes a method for the production of a polyketide, comprising the steps of

(iii) Contacting the polypeptide, chimeric polyketide synthase or polyketide

synthase mutein of the invention with a suitable substrate under conditions that allow enzymatic production of said polyketide;

(iv) Isolating the produced polyketide.

[0075] The capability to produce polyketides enzymatically ensures that there is no need to use toxic chemicals such as organic solvents or the generation of toxic by products in the production of polyketides such as mellein.

[0076] The polyketide is preferably a dihydroisocoumarin or isocoumarin or intermediate, preferably selected from the group consisting of mellein and derivatives thereof, 6- methylsalicylic acid, hydrangenol, 2-hydroxyl-5-methyl-naphthoic acid, 5 -methyl -naphthoic aeidNM-3, AI-77 B, Phyllodulcin, Coriandrin, cytogenin, scopanne A, Reticulol, ochratoxin, Bacilosarcins, Paraphaeoshaerin and thunberginol.

[0077] In one embodiment the substrate is acetyl Coenzyme A and/or malonyl Coenzyme A.

[0078] Preferably step (i) is carried out in the presence of NADPH, acetyl Coenzyme A, and malonyl Coenzyme A.

[0079] In one embodiment the method may further comprising the steps of: Incubating the functional polyketide sythase in an environment with a mineral salt, NADPH, acetyl

Coenzyme A, and Malonyl Coenzyme A; and Isolating a polyketide synthesised. Preferably, the salt is magnesium chloride.

[0080] In one embodiment the enzyme may be incubated with Sfp and CoA before any enzymatic reactions. In this example the polyketide may be produced in vitro, malonyl-CoA synthetase may be used to regenerate malonyl-Co A from coenzyme A and malonate to improve production. The environment may further includes a supply of phosphopantetheinyl transferase (PPTase) in this embodiment. Addition of PPTase allows for high production yield.

[0081] The method may be an in vitro or an in vivo method. The in vitro method is the production of a plyketide biochemically. The in vivo method is the production of a plyketide in a host cell.

[0082] The in vitro method may further comprise the use of malonyl-CoA synthetase to regenerate the substrate malonyl-CoA from coenzyme A and malonate.

[0083] The in vivo method may further comprising the use a vector expressing a

phosphopantheiyl transferase (PPTase) Sfp amino acid comprising a sequence set forth in SEQ ID NO. 43. Preferably in this embodiment the isolated nucleic acid or chimeric nucleic acid described above may be co-expressed with a PPTase. Increased expression of PPTase allows for high production yield.

[0084] Preferably the cells are grown in a nutritionally rich medium.preferably the nutritionally rich medium is lysogeny medium, more preferably the nutritionally rich medium includes glycerol most preferably the glycerol is 10%.

[0085] The isolation may be performed by any method know in the art. Preferably the isolation is performed by chromatography.

[0086] Preferably the polyketide produced by the method comprises a polyketide of formula 1

wherein:

"— " represents a bond that may be present or absent;

Rl is H, substituted or unsubstituted CI -CIO alkyl, substituted or

unsubstituted C2-C15 alkenyl, substituted or unsubstituted C2- C15 alkynyl, substituted or unsubstituted C3-C15 cycloalkyl, substituted or unsubstituted C3-C15 cycloalkenyl, substituted or unsubstituted C3-C15 heterocycloalkyl, substituted or

unsubstituted C3-C15 heterocycloalkenyl, substituted or unsubstituted C6-C15 aryl, or substituted or unsubstituted C6- C15 heteroaryl, preferably C1-C4 alkyl or substituted or unsubstituted C6 aryl;

R2, R3, and R4 are independently selected from the group consisting of H, halo, CI -CIO alkyl, C2-C15 alkenyl, C2-C15 alkynyl, -C(O)- R, -NRR', -OR, -SR, -COOR, -CN, -N0 ₂ , -C(0)-NRR\ -NR'- C(0)-R, -S0 ₂ -R and -(S0 ₂ )-OR or R2 and R3 can combine to form a substituted or unsubstituted 5- or 6-membered

(hetero)aromatic, aliphatic or heterocyclic ring comprising 1, 2 or 3 heteroatoms selected from N, O and S;

R5 and R6 are independently H or -OR; and

R and R' are independently selected from the gro p consisting of H and CI -CIO alkyl. [0087] The term "aliphatic", alone or in combination, refers to a straight chain or branched chain hydrocarbon comprising at least one carbon atom. Aliphatics include alkyls, alkenyls, and alkynyls. In certain embodiments, aliphatics are optionally substituted, i.e. substituted or unsubstituted. Aliphatics include, but are not limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, ethenyl, propenyl, butenyl, ethynyl, butynyl, propynyl, and the like, each of which may be optionally substituted. As used herein, aliphatic is not intended to include cyclic groups.

[0088] The term "optionally substituted" or "substituted or unsubstituted" refers to a group in which none, one, or more than one of the hydrogen atoms have been replaced with one or more groups such as, but are not limited to, alkyl, alkenyl, alkynyl, heteroalkyl, cycloalkyl, aryl, alkylaryl, or heteroaryl.

[0089] The term "alkyl", alone or in combination, refers to a fully saturated aliphatic hydrocarbon. In certain embodiments, alkyls are optionally substituted, i.e. substituted or unsubstituted. In certain embodiments, an alkyl comprises 1 to 10 carbon atoms, for example 2 to 8 carbon atoms, wherein (whenever it appears herein in any of the definitions given below) a numerical range, such as "1 to 10" or "CI -CIO", refers to each integer in the given range, e.g. "CI -CIO alkyl" means that an alkyl group comprising only 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, 7 carbon atoms, 8 carbon atoms, 9 carbon atoms, or 10 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, tert-amyl, pentyl, hexyl, heptyl, octyl and the like. In certain embodiments, one or more carbon atoms may be replaced by a heteroatom to form a heteroalkyl (see definition below). In various embodiments, Rl is C1-C4 alkyl, such as methyl or ethyl.

[0090] The term "alkenyl", alone or in combination, refers to an aliphatic hydrocarbon having one or more carbon-carbon double-bonds, such as two or three carbon-carbon double- bonds. In certain embodiments, alkenyls are optionally substituted, i.e. substituted or unsubstituted. In certain embodiments, an alkenyl comprises 2 to 15 carbon atoms, for example 2 to 10 carbon atoms. "C2-C15 alkenyl" means that an alkenyl group comprising only 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, 7 carbon atoms, 8 carbon atoms, 9 carbon atoms, 10 carbon atoms, 1 1 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, or 15 carbon atoms. Examples of alkenyls include, but are not limited to, ethenyl, propenyl, butenyl, 1,4-butadienyl, pentenyl, hexenyl, 4- methylhex-l-enyl, 4-ethyl-2-methylhex-l-enyl and the like. In certain embodiments, one or more carbon atoms may be replaced by a heteroatom to form a heteroalkenyl (see definition below).

[0091] The term "alkynyl", alone or in combination, refers to an aliphatic hydrocarbon having one or more carbon-carbon triple-bonds, such as two or three carbon-carbon triple- bonds. In certain embodiments, alkynyls are optionally substituted, i.e. substituted or unsubstituted. In certain embodiments, an alkynyl comprises 2 to 15 carbon atoms, for example 2 to 10 carbon atoms. "C2-C15 alkynyl" means that an alkynyl group comprising only 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms, 6 carbon atoms, 7 carbon atoms, 8 carbon atoms, 9 carbon atoms, 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, or 15 carbon atoms. Examples of alkynyls include, but are not limited to, ethynyl, propynyl, butynyl, and the like. In certain embodiments, one or more carbon atoms may be replaced by a heteroatom to form a heteroalkynyl (see definition below).

[0092] The term "aromatic" refers to a group comprising a covalently closed planar ring having a delocalized [pi]-electron system comprising 4n+2 [pi] electrons, where n is an integer. Aromatic rings may be formed by five, six, seven, eight, nine, or more than nine atoms. Aromatics may be optionally substituted. Examples of aromatic groups include, but are not limited to phenyl, naphthalenyl, phenanthrenyl, anthracenyl, tetralinyl, fluorenyl, indenyl, and indanyl. The term aromatic includes, for example, benzenoid groups, connected via one of the ring- forming carbon atoms, and optionally carrying one or more substituents selected from an aryl, a heteroaryl, a cycloalkyl, a non-aromatic heterocycle, a halo, a hydroxy, an amino, a cyano, a nitro, an alkylamido, an acyl, a C1-C6 alkoxy, a C1-C6 alkyl, a C1-C6 hydroxyalkyl, a C1-C6 aminoalkyl, an alkylsulfenyl, an alkylsulfinyl, an alkylsulfonyl, an sulfamoyl, or a trifluoromethyl. In certain embodiments, an aromatic group is substituted at one or more of the para, meta, and/or ortho positions. Examples of aromatic groups comprising substitutions include, but are not limited to, phenyl, 3-halophenyl, 4- halophenyl, 3-hydroxyphenyl, 4-hydroxyphenyl, 3-aminophenyl, 4-aminophenyl, 3- methylphenyl, 4-methylphenyl, 3-methoxyphenyl, 4-methoxyphenyl, 4- trifluoromethoxyphenyl, 3-cyanophenyl, 4-cyanophenyl, dimethylphenyl, naphthyl, hydroxynaphthyl, hydroxymethylphenyl, (trifluoromethyl)phenyl, alkoxyphenyl, 4- morpholin-4-ylphenyl, 4-pyrrolidin-l-ylphenyl, 4-pyrazolylphenyl, 4-triazolylphenyl, and 4- (2-oxopyrrolidin-l-yl)phenyl.

[0093] The term "aryl" refers to an aromatic ring wherein each of the atoms forming the ring is a carbon atom. Aryl rings may be formed by five, six, seven, eight, nine, or more than nine carbon atoms. Aryl groups may be optionally substituted. In various embodiments, Rl is C6 aryl, which can be substituted or unsubstituted.

[0094] The term "heteroatom" refers to an atom other than carbon or hydrogen. Heteroatoms are typically independently selected from oxygen, sulfur, nitrogen, and phosphorus, but are not limited to those atoms. In embodiments in which two or more heteroatoms are present, the two or more heteroatoms may all be the same as one another, or some or all of the two or more heteroatoms may each be different from the others. [0095] In various embodiments, R2 and R3 can combine to form a substituted or unsubstituted 5- or 6-membered (hetero) aromatic, aliphatic or heterocyclic ring comprising 1, 2 or 3 heteroatoms selected from N, O and S.

[0096] The term "heteroaryl" refers to an aromatic heterocycle. Heteroaryl rings may be formed by three, four, five, six, seven, eight, nine, or more than nine atoms. Heteroaryls may be optionally substituted. Examples of heteroaryl groups include, but are not limited to, aromatic C3-C8 heterocyclic groups comprising one oxygen or sulfur atom or up to four nitrogen atoms, or a combination of one oxygen or sulfur atom and up to two nitrogen atoms, and their substituted as well as benzo- and pyrido-fused derivatives, for example, connected via one of the ring-forming carbon atoms. In certain embodiments, heteroaryl groups are optionally substituted with one or more substituents, independently selected from halo, hydroxy, amino, cyano, nitro, alkylamido, acyl, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 hydroxyalkyl, C1-C6 aminoalkyl, alkylsulfenyl, alkylsulfinyl, alkylsulfonyl, sulfamoyl, or trifluoromethyl. Examples of heteroaryl groups include, but are not limited to, unsubstituted and mono- or di-substituted derivatives of furan, benzo furan, thiophene, benzothiophene, pyrrole, pyridine, indole, oxazole, benzoxazole, isoxazole, benzisoxazole, thiazole, benzothiazole, isothiazole, imidazole, benzimidazole, pyrazole, indazole, tetrazole, quinoline, isoquinoline, pyridazine, pyrimidine, purine and pyrazine, furazan, 1,2,3-oxadiazole, 1,2,3- thiadiazole, 1,2,4-thiadiazole, triazole, benzotriazole, pteridine, phenoxazole, oxadiazole, benzopyrazole, quinolizine, cinnoline, phthalazine, quinazoline, and quinoxaline. In some embodiments, the substituents are halo, hydroxy, cyano, or C1-C6 alkyl.

[0097] The term "non-aromatic ring" refers to a group comprising a covalently closed ring that is not aromatic.

[0098] The term "alicyclic" refers to a group comprising a non-aromatic ring wherein each of the atoms forming the ring is a carbon atom. Alicyclic groups may be formed by three, four, five, six, seven, eight, nine, or more than nine carbon atoms. In certain embodiments, alicyclics are optionally substituted, i.e. substituted or unsubstituted. In certain embodiments, an alicyclic comprises one or more unsaturated bonds, such as one, two or three carbon- carbon double-bonds. Alicyclics include cycloalkyls and cycloalkenyls. Examples of cycloalkyls include, but are not limited to, cyclopropane, cyclobutane, cyclopentane, cyclohexane, and cycloheptane. Examples of cycloalkenyls include, but are not limited to, cyclopentene, cyclopentadiene, cyclohexene, 1,3-cyclohexadiene, 1 ,4-cyclohexadiene, and cycloheptene.

[0099] The term "heteroaliphatic", alone or in combination, refers to a group comprising an aliphatic hydrocarbon (such as alkyl, alkenyl, and alkynyl) and one or more heteroatoms. In certain embodiments, heteroaliphatics are optionally substituted, i.e. substituted or unsubstituted. Certain heteroaliphatics are acylaliphatics, in which the one or more heteroatoms are not within an aliphatic chain. Heteroaliphatics include heteroalkyls, including, but not limited to, acylalkyls, heteroalkenyls, including, but not limited to, acylalkenyls, and heteroalkynyls, including, but not limited acylalkynyls.

[00100] The term "heterocycle" refers to a group comprising a covalently closed ring wherein at least one atom forming the ring is a carbon atom and at least one atom forming the ring is a heteroatom. Heterocyclic rings may be formed by three, four, five, six, seven, eight, nine, or more than nine atoms. Any number of those atoms may be heteroatoms (i.e., a heterocyclic ring may comprise one, two, three, four, five, six, seven, eight, nine, or more than nine heteroatoms). Herein, whenever the number of carbon atoms in a heterocycle is indicated (e.g., C1-C6 heterocycle), at least one other atom (the heteroatom) must be present in the ring. Designations such as "C1-C6 heterocycle" refer only to the number of carbon atoms in the ring and do not refer to the total number of atoms in the ring. It is understood that the heterocylic ring will have additional heteroatoms in the ring. In heterocycles comprising two or more heteroatoms, those two or more heteroatoms may be the same or different from one another. Heterocycles may be optionally substituted. Binding to a heterocycle can be at a heteroatom or via a carbon atom. Examples of heterocycles include heterocycloalkyls (where the ring contains fully saturated bonds) and heterocycloalkenyls (where the ring contains one or more unsaturated bonds) such as, but are not limited to the following:

wherein D, E, F, and G independently represent a heteroatom. Each of D, E, F, and G may be the same or different from one another.

[00101] The term "ring" refers to any covalently closed structure. Rings include, for example, carbocycles (e.g., aryls and alicyclics), heterocycles (e.g., heteroaryls and non- aromatic heterocycles), aromatics (e.g., aryls and heteroaryls), and non-aromatics (e.g., alicyclics and non-aromatic heterocycles). Rings may be optionally substituted.

[00102] The term "alkylaryl" refers to a group comprising an aryl group bound to an alkyl group.

[00103] The term "halogen", or "halo" for short, refers to fluorine (F), chlorine (CI), bromine (Br) or iodine (I).

[00104] In various embodiments, the polyketide of formula (1) is selected from the group consisting of:

Isocoumarin (1)

Melleih (2)

Cytogenin (4)

Ochratoxin (8) 185322 (9)

N -3 (10) 11 Bacilosarcins B (12)

Hydrangenol (15) Phyllodulcin (16) Thunberginol A (17) In certain embodiments, the polyketide of formula (1) is

NM-3 (10)

AI-77 B (13)

Hydrangenol (15) ^ul Phyllodulcin (16)

[00106] Another aspect of the invention includes a method of making a polyketide reductase comprising the steps of: Cloning the recombinant nucleic acid comprising a functional promoter; and a nucleic acid sequence expressing a ketoreductase domain (KR) into an expression vector; Transfrering the vector into a cell for expression; and Isolating the polyketide reductase capable of reducing a diketide substrate.

[00107] In various embodiments of the recombinant nucleic acid, the polyketide synthase is used for the preparation of a polyketide of formula 1

(1) as defined previously.

[00108] In one embodiment the nucleic acids expressing the S, AT, TH, KR and ACP domains are isolated from Saccharopolyspora erythraea having SEQ ID NO. 1 and optimized for protein expression in a host cell. Such a recombinant nucleic acic can express a mellein synthase and can be used in the production of mellein as described herein. Our recombinant polyketide synthase formed a partially reducing iterative polyketide synthase able to produce mellein or derivatives. Remarkably, despite the shared homology with several fungal and bacterial PKSs, the mellein synthase exhibits a distinct keto-reduction pattern in the synthesis of the pentaketide. We determined that the unique patterning can be transferred to other polyketide synthase by adjusting the recombinant polyketide synthase by replacing the domain sequences from other PKSs to produce other polyketides.

[00109] The host cell is preferably the same as described herein to be suitable. Preferably the cell is an E. coli.

[00110] In one embodiment the nucleic acid sequence expressing the KS domain comprises SEQ ID NO. 2 the nucleic acid sequence expressing the AT domain comprises SEQ ID NO. 4 the nucleic acid sequence expressing the TH domain comprises SEQ ID NO. 6 the nucleic acid sequence expressing the KR domain comprises SEQ ID NO. 8 and the nucleic acid sequence expressing the ACP domain comprise SEQ ID NO. 10. Such a recombinant nucleic acic can express a mellein synthase and can be used in the production of mellein as described herein. In which case the polykedide synthase is mellein synthase. In this embodiment the mellein synthase may be used for the preparation of mellein (2) having the structure

Mellein (2)

[00111] In another embodiment in the recombinant nucleic acid construct at least one of the nucleic acid sequences expressing KS, AT, KR, DH or ACP domains originates from a different polyketide synthase gene than the origin of the other nucleic acid expressing domains. The idea and advantages of domain swapping are the same as discussed earlier.

[00112] In one embodiment the at least one nucleic acid domain comprises AT. An example where the AT domain has been replaced comprises the nucleic ^' acid sequence expressing the KS domain comprises SEQ ID NO. 2; the nucleic acid sequence expressing the TH domain comprises SEQ ID NO. 6; the nucleic acid sequence expressing the KR domain comprises SEQ ID NO. 8; and the nucleic acid sequence expressing the ACP domain comprise SEQ ID NO. 10 and the nucleic acid sequence expressing the AT domain is isolated from a polyketide synthase gene that is not identical to SEQ ID NO. 1.

[00113] In one embodiment the recombinant nucleic acid is a mellein synthase scaffold where an AT domain from another polyketide synthase replaces the AT domain and may be used as a polyketide synthase for the preparation of hydrangenol (15), phyllodulcin (16), AI- 77B (13) or NM-3 (10) having the following structures

Hydrangenol (15) Phyllodulcin (16)

NM-3 (10)

AI-77 B (13) , respectively.

[00114] In another embodiment the at least one nucleic acid domain comprises TH and KR.An example where the TH and KR domains are replaces comprises the nucleic acid sequence expressing the KS domain comprises SEQ ID NO. 2; the nucleic acid sequence expressing the AT domain comprises SEQ ID NO. 4; the nucleic acid sequence expressing the ACP domain comprise SEQ ID NO. 10 and the nucleic acid sequence expressing the TH and KR domain is isolated from a polyketide synthase gene that is not identical to SEQ ID NO. 1. [00115] Preferably the KR domain that is swapped in to replace the mellein KR is able to reduce a ketone group at C5 as described herein.

[00116] In one embodiment the recombinant nucleic acid has a mellein synthase scaffold where a TH and KR domain from another polyketide synthase replaces the TH and KR domain and may be used as a polyketide synthase for the preparation of 6-methylsalicyclic acid (6-MSA). In this embodiment the nucleic acid expressing a KR domain may espresses a peptide having SEQ ID NO. 22, SEQ ID NO. 23 or SEQ ID NO. 24. Alternatively the KR domain is able to reduce a ketone group at C5 and C9 and may express a KR domain comprising SEQ ID NO. 18. In this example where the TH an KR domain are from a NcsB iPSK the polyketide synthase may be used for the preparation of 6-methylsalicyclic acid (6- MSA); 2-hydroxyl-5-methyl-naphthoic acid; 6-methylsalicyclic acid (6-MSA); or mellein.

[00117] Alternatively the KR domain is able to reduce a ketone group at C3, C5 and C9 and may comprise a KR domain comprising SEQ ID NO. 25. In this example where the TH an KR domain are from a AziB iPSK the polyketide synthase may be used for the preparation of 5 methyl- naphthoic acid.

[00118] Discovery of an iterative polyketide synthase protein SACE5532 as the first mellein synthase not only enables the enzymatic synthesis of mellein as an insecticide pheromone by fermentation but also opens the door for the engineering of the enzyme to produce other structural derivatives. This invention is of great significance because the use of mellein synthase as an enzyme or a cell-based biocatalyst provides a cost-effective and environmentally sustainable method for synthesizing other isocoumarin and

dihydroisocoumarin compounds.

[00119] The use of the recombinant polyketide synthase produces a biocatalyst that provides an environmentally benign method to synthesize pharmaceutically important isocoumarins. [00120] Optimization of the gene sequence allows us to over-express the enzyme in large quantity in E. coli expression system. Polyketides can be easily harvested from the culture medium without lysing the cells. This effectively forms a continuous culture and optimizes production allowing a shortened production time and improved production yield.

[00121] By using engineered recombinant polyketide synthase, pharmaceutically important isocoumarins can be synthesized by the fermentation without protein purification.

Examples

[00122] The results we present below demonstrate that SACE5532 is an enzyme that produces mellein as the sole product. SACE5532 is therefore the first mellein synthase that has ever been fully characterized. Discovery of the mellein synthase not only enables the enzymatic synthesis of mellein as an insecticide pheromone by fermentation but also opens the door for the engineering of the enzyme to produce other structural derivatives. This invention is of great significance because the use of mellein synthase as enzyme- or cell- based biocatalyst provides a cost-effective and environmentally sustainable method for synthesizing other isocoumarin and dihydroisocoumarin compounds.

Mellein (2) production

[00123] Mellein can be synthesized by using the in vitro method using the isolated recombinant mellein synthase or in vivo method by using a cell-based system by fermentation. To guarantee high expression yield, the gene sequences of the five proteins were designed with the codons optimized for E. coli expression (the whole gene sequence was optimized). The optimized gene was synthesized and cloned into pET28 expression vector and

transformed into BL21(DE3) E. coli strain. Activation of SACE5532 by

phosphopantetheinyl transferase (PPTase) is required for the optimal function of the PKS. A significant amount of soluble SACE5532 could be expressed when the protein was co- expressed with the PPTase Sfp in E. coli. Growing the cells in the LB medium supplemented with 10% glycerol further improved the protein yield. The two proteins eluted from Ni - NTA column was approximately 85% pure as estimated by SDS-PAGE analysis (Fig. 2A). - SACE5532 was further separated from Sfp by size-exclusion gel filtration. The theoretical molecular weight of SACE5532 is 188.8 kDa. Gel filtration analysis showed the elution volume of the protein was 64.3 ml (Fig. 2B) with an estimated molecular weight of -190 kDa, suggesting that SACE5532 is present mainly as a monomer in solution. The concentrated proteins can be stored at -80°C for at least one week before the loss of enzymatic activity.

[00124] E. coli TOP 10™ was used as a general host for sub-cloning. E. coli BL-21(DE3) (Novagen) was used as the heterologous host for protein expression. Vectors pET-28b(+) and pCDF-2 Ek/LIC were obtained from Novagen™. The reported protein sequences for

SACE5532, have been deposited in Genbank under the accession number YP_001 107644, described herein as SEQ ID NO.l. The genes were synthesized based on the reported protein sequences and were carried by the pUC57 plasmid. Xhol and Ndel restriction sites are added to the C-terminus and N-terminus respectively. The plasmid that contains the Sfp-encoding gene was obtained from Christopher Walsh's lab at Harvard Medical School. Coenzyme A, acetyl-CoA, malonyl-CoA, NADPH, ATP, malonic acid and other chemicals were purchased from Sigma- Aldrich and stored at -20°C. ¹³ C-labeled malonic acid was purchased from Cambridge Isotope. The gene encoding Sfp was cloned into pCDF-2 plasmid to give pCDF- Sfp.

[00125] The plasmid pUC57- SACE5532 was digested with Ndel-Xhol to yield the SACE5532 expression product. The SACE5532 fragment was gel-purified and ligated into the identical sites of pET-28b(+) to give pET28- SACE5532.

[00126] Co-expression ofSA CE5532 and Sfp - pET28-SACE5532 and pCDF-Sfp were co-transformed into E. coli BL21(DE3) competent cells. The gene encoding Sfp was cloned into pCDF-2 plasmid to give pCDF-Sfp. The cells were plated on LB medium supplemented with 50 μg/ml kanamycin and 50 μg/ml streptomycin. The colonies were screened by PCR to confirm the existence of both pET28-SACE5532 and pCDF-Sfp. A single colony was used to - . inoculate 20 ml of LB medium containing both kanamycin (50 μg/ml) and streptomycin (50 μg/ml), and incubated overnight at 37°C at 200 rpm. A 5 ml aliquot was transferred to 500 ml of LB medium (added with 10% glycerol) containing both kanamycin (50 μg/ml) and streptomycin (50 μg/ml), and grown at 37°C at 200 rpm. When OD ₆₀₀ reached -0.5 (~4 h), the culture was cooled down to 16°C, induced with 0.8 mM IPTG. After incubation at 16°C for an additional ~20 h at 130 rpm, cells were harvested and spun at 8,000 rpm. The cell pellet was re-suspended in lysis buffer [50 mM NaH ₂ P0 ₄ (pH 8.0), 300 mM NaCl, 20 mM imidazole, 5 mM β-ΜΈ and 10% (v/v) glycerol] and lysed by soni cation. After centrifugation at 20,000 rpm for 30 minutes at 4°C, the supernatant was filtered by 0.45 μπι membrane and loaded onto HiTrap™ Ni ²⁺ -NTA column (GE Healthcare). The column was then washed by lysis buffer and wash buffer containing 40 mM imidazole before eluted with elution buffer containing 500 mM imidazole. The eluted SACE5532 and Sfp were further purified by gel filtration using a HiLoad™ 16/60 Superdex™ 200 column (GE Healthcare). Proteins were desalted into Tris buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM DTT and 10% (v/v) glycerol]. The purity was determined by SDS-PAGE. The protein concentration and profile were examined by UV-Vis spectrometer before the proteins were flash frozen in liquid nitrogen and stored in -80°C freezer.

[00127] Malonyl-CoA synthetase can be used to regenerate the substrate malonyl-CoA from coenzyme A and malonate in in vitro synthesis of mellein to improve production yield. Co-expression with phosphopantheiyl transferase (PPTase) to activate mellein synthase also results in high production yield.

[00128] In vitro enzymatic assays and kinetic analysis. [00129] To identify the product of S ACE5532, SACE5532 was first examined by in vitro activity assay. As mentioned earlier, PPTase is needed to transfer the phosphopantetheine component of CoA onto a conserved Ser of ACP domain to activate the SACE5532.

Although SACE5532 is co-expressed with the PPTase Sfp, we found a large portion of SACE5532 is still not fully modified in vivo. To increase the percentage of activated

SACE5532, the protein was further incubated with Sfp and CoA before any enzymatic reactions. After that, to the reaction mixture acetyl-CoA, malonyl-CoA and NADPH were added to initiate the enzymatic reaction. Real-time To our delight, UV-Vis spectroscopy showed that the absorbance of NADPH at 342 nm decreased immediately after the reaction started, indicating that SACE5532 was enzymatic active. Product analysis was conducted with a HPLC system equipped with a RP-C18 column and a DAD detector. A new species was detected on the chromatogram with absorbance at 246 and 314 nm (Fig. 3). When acetyl- CoA was not included in the reaction mixture, NADPH was not consumed, indicating that SACE5532 uses acetyl-CoA as a starter unit.

[00130] To confirm that the new compound is indeed produced by SACE5532, three control experiments were conducted. The first two control reactions were carried out without the extender substrate malonyl-CoA or without modifying protein Sfp. The third control reaction replaced the wild type SACE5532 with the mutant SACE5532-C184A as described below. According to the HPLC analysis, no product was detected for any of these control reactions (Fig.3). These experiments strongly suggest that the product is enzymatically generated by SACE5532 by using the substrates acetyl-CoA and malonyl-CoA. In addition, kinetic experiment was conducted to examine the time-dependent formation of the product. Equal volumes of reaction mixtures incubated for 0, 15, 30, 45, 60, 75, 90, and 120 minute were quenched by HC1 and examined by HPLC. The peak area of 5 at 314 nm increased steadily during the first 60 minutes and leveled off after that (Fig. 4). This is fully consistent with an enzymatic reaction with the rate of product formation deceasing with the depletion of substrates.

[00131] For the enzymatic assays of SACE5532, a typical enzymatic reaction contained 3 of MgCl ₂ (1 M), 8 μΐ of CoA (50 mM), 70 JLIL of SACE5532 (11.3 mg/ml), 20 of Sip (27.9 mg/ml) and 93 μΐ of reaction buffer [50 mM Tris (pH 8.5), 150 mM NaCl and 1 mM DTT]. After incubation at 30°C for 20 min, the reaction mixture was added with 5 μΐ, οΐ NADPH (10 mM), Ιμΐ of acetyl CoA (100 mM) and 2 μ\ of malonyl CoA (100 mM) and incubated at 30°C for 3 h. The reaction was quenched with 5 μΙ_, of 6 mM HCl and vortexed to totally precipitate the enzymes. Then the mixture was spun at 14,800 rpm for 10 min and the supernatant was loaded for HPLC analysis.

[00132] For the kinetic analysis of SACE5532 reaction, a total volume of 200 μΐ _^ of the reaction was carried out under the same conditions as above. 20 μΐ _^ aliquots were taken from the reaction mixture at 0 min, 15 min, 30 min, 45 min, 1 h, 1 h 15 min, 1 h 30 min and 2 h. The aliquot at each time point was quenched with 5 μί of 6 mM HCl and vortexed to totally precipitate the enzymes. Then the mixture was spun at 14,800 rpm for 10 min and the supernatant was loaded for HPLC analysis.

[00133] HPLC analysis was performed with an analytical eclipse XDB CI 8 column (4.6 * 150 mm) using an Agilent 1200 HPLC. A full gradient was employed from 100% buffer A (HPLC grade water with 0.045% TFA) to 40% buffer A + 60% Buffer B (100% acetonitrile with 0.045% TFA) at 1 ml/min in 60 minutes.

[00134] Production of mellein by in vivo protein co-expression.

[00135] To find out if the SACE5532 product 2 can also be produced in vivo, the medium of the E. coli cells co-expressing SACE5532 and Sfp was extracted with organic solvent. The cell culture was supplemented with 10 mM MgCl ₂ after induction to facilitate the modification of SACE5532 by Sfp. HPLC analysis of the medium extract using HPLC showed that 1 was also produced by SACE5532 in E. coli cells (Fig. 5).

[00136] To produce SACE5532 product in vivo, SACE5532 and Sfp were co-expressed in

E. coli BL21(DE3) strain under the similar conditions described above for protein expression, except that the cells were added with 10 mM MgCl ₂ after induction.

[00137] For SACE5532 product isolation, the cells were centrifuged at 4 °C and 8,000 rpm for 10 min. After removal of the cell pellets, the resulting supernatant was extracted twice with an equal volume of ethyl acetate. The combined organic extract was immediately dried over anhydrous magnesium sulfate, concentrated in vacuum, and resolved in methanol for HPLC analysis.

[00138] Large scale preparation of mellein -

[00139] High yield of mellein synthesis - when co-expressed with Sfp PPTase, the mellein synthase can readily produce grams of mellein by this fermentation method. Kilogram production can be readily scaled up.

[00140] For the scaled-up reaction, malonyl-CoA was synthesized in vitro by using the malonyl-CoA synthase MatB. The MatB reaction was carried out in 60 mL of 100 mM HEPES buffer (pH 8.0), containing 20 mM malonic acid, 10 mM MgCl ₂ , 5 mM ATP, 1 mM Co A and 30 mg MatB. The reaction was incubated at 23 °C overnight and analyzed by HPLC to ensure formation of malonyl-CoA. The SACE5532 reaction was set up by adding 400 μΐ of 100 mM acetyl-CoA, 1.5 ml of 10 mM NADPH and 3 ml of SACE5532 and Sfp mixture purified together after PD-10 column (~ 60 mg). After incubation of the reaction in 30°C water bath for 2 h, additional 1.5 ml of 10 mM NADPH was added into the reaction mixture. The reaction was further incubated in 30°C water bath for 2 h. The final reaction mixture was extracted twice with ethyl acetate (2 ^χ 60 ml). The combined organic extract was

immediately dried over anhydrous magnesium sulfate and concentrated in vacuum. The compound was purified by preparative thin layer chromatography (TLC) with hexane: ethyl acetate (5: 1). The pure fractions collected from preparative TLC were collected to be analyzed by LC-MS and NMR spectroscopy for structure determination. The preparation of ^l3 C-labeled SACE5532 product followed essentially the same protocol described above except that ¹³ C-malonic acid was used to replace the normal malonic acid. TLC purification of the labeled product was performed the same way described above.

[00141] The plasmid pUC57-MatB was digested with Ndel-Xhol to yield the matB. The 5-kB math fragment was gel-purified and ligated into the identical sites of pET-28b(+) to give pET28-MatB. Then the plasmid harboring the matB gene was sequenced and

transformed into E. coli strain BL21(DE3) for protein expression.

[00142] Expression and purification of MatB - The expression and purification of MatB were similar to the procedure described below for Sfp, except that cells were grown in LB media supplemented with 50 μg/ml kanamycin.

Mellein can be easily harvested from the culture medium without lysing the cells. This effectively forms a continuous culture.

[00143] We have optimized the reaction and purification conditions to shorten production time and improve production yield.

[00144] Structure determination of mellein.

[00145] The absorption spectrum and molecular weight of the product indicate that the product of SACE5532 is different from these of the known bacterial iPKSs (Table 1). To determine the structure of 2, about 0.5 mg of 2 purified by preparative TLC was dissolved in CDC1 ₃ and characterized by ID Ή NMR, ID ¹³ C NMR and 2D 1H, Ή-NOESY NMR.

Table 1. SACE3352 and homologous bacterial iPKSs. Gene Ref Access no. Organism Identity%/Homology%

Streptomyces

AAM77986 carzinostaticus subsp. 51/66

NcsB (46, 47) neocarzinostaticus

AziB (48)

ABY83164 Streptomyces sahachiroi 48/64

Streptomyces

PokMl (45) ACN64831 49/63

diastatochromogenes

Streptomyces

(42, 43) AAZ77673 46/61 ChlBl antibioticus

MdpB (44)

ABY66019 Actinomadura madurae 47/60

Micromonospora

AAM70355 48/62

echinospora

Cal05 (41)

Streptomyces

AviM (39, 40) AAK83194 48/61

viridochromogenes

High-resolution LC-MS was carried out on a Michrom R l 8 column (0.1 χ 50 mm). The gradient employed in the analysis was from 99% buffer A (HPLC grade water with 0.1% FA) + 1 % buffer B (100% acetonitnle with 0.1 % FA) to 40% buffer A + 60% buffer B in 30 minutes. The flow rate was set at Ιμΐ/min and the UV detector was set at 314 nm. The ionization energy was set with Nanospray Ionization source for the Finnigan LTQ Orbitrap mass spectrometer (Thermo Electron). The results were analyzed with the software Xcalibur for the determination of plausible molecular compositions based on the observed m/z. LC-MS revealed a [M+H] ⁺ ion with a mlz of 179.07 for the unknown product, which suggests a molecular formula of C ₁₀ Hio0 ₃ (calculated mlz = 178.06xx) with six degrees of unsaturation. Moreover, the ¹³ C-labeled product prepared from double ¹³ C-labeled malonic acid exhibits a [M+H] ⁺ ion with a mlz of 187.10, indicating that eight of the ten carbons of the product were 13

originated from C-labeled malonic acid while the remaining two are from the unlabelled acetyl-CoA.

[00146] ID Ή NMR, ID ¹³ C NMR and 2D NOESY spectra were collected on a Bruker 400 MHz NMR spectrometer (Bruker DPX 400) using CDC1 ₃ as the solvent and TMS as the internal reference. 2D HSQC was collected on a Bruker 700 MHz NMR spectrometer. About 0.5 mg of the SACE5532 product was obtained from large-scale in vitro reactions for NMR analysis. The NMR data together with the MS results allowed us to deduce the structure of the product (4-dihydro-8-hydroxy-3-methylisochromen-l-one or mellein) (Fig. 7, Table 2). The chemical shifts and coupling constants for the one-dimensional Ή NMR spectrum

[CDC1 _. 3, 400 MHz,] are: δ 4.73 (1H, m, H-3), δ 2.93 (2H, d, J= 12 Hz, H-4), 6 6.69 (1H, J = 12 Hz, H-5), δ 7.41 (1H, t, J= 7.8 Hz, H-6), δ 6.89 (1H, d, J= 8.4 Hz, H-7), δ 1.53 (3H, d, J = 6.4 Hz, Η-11), δ 11.03 (1H, s, OH-C8). The chemical shifts for the one-dimensional 13C NMR [CDC1 ₃ , 400 MHz] spectrum are: 8 169.94 (C-1), δ 76.09 (C-3), δ 34.63 (C-4), δ 117.88 (C-5), δ 136.13 (C-6), δ 116.27 (C-7), δ 162.23 (C-8), δ 108.32 (C-9), δ 139.38 (C-10), δ 20.76 (C-11). 2D 1H, IH-NOESY NMR [CDC1 ₃ , 400 MHz]: (H-7, H-6), (H-6, H-5), (H-5, H-4), (H-4, H-3), (H-4, H-l 1), (H-l 1, H-3). The ID 1H NMR and ID ¹³ C NMR are also in excellent agreement with those obtained for a chemically synthesized mellein (49).

Table 2. NMR data for the mellein

Carbon No. δ Ή (ppm) δ 'X (ppm)

169.94

3 4.73 (1H, m) 76.09 4 2.93 (2H, d, J= 7.2 Hz) 34.63

5 6.69 (lH, d, J= 7.2 Hz) 1 17.88

6 7.41 (lH, t, J= 7.8 Hz) . 136.13

7 6.89 (1H, d, J = 8.4 Hz) 116.27

8 162.23

9 108.32

10 139.38

11 1.53 (3H, d, J= 6.4 Hz) 20.76

8-OH 11.03 (1H, s)

[00147] SACE5532 is the first mellein-synthesizing enzyme that has been discovered and fully characterized. Given the potent biological and pharmaceutical activities of some isocoumarin and mellein derivatives, the enzyme holds great promise as a biocatalyst for synthesizing commercially valuable isocoumarin derivatives. Specifically, the mellein synthase can be utilized as discussed herein.

[00148] By co-expressing with the phosphopantheiyl transferase (PPTase) Sfp, the newly discovered mellein synthase can be used to prepare mellein (4-dihydro-8-hydroxy-3- methylisocoumarin) as synthetic intermediate or starting material for industrial processes.

Recombinant P S for production of mellein derivatives or isocoumarin derivatives

[00149] Engineering of the acyltransferase (AT) domain of the mellein synthase allows the loading of various starter units to produce mellein or isocoumarin derivatives. The acyltransferase (AT) domain of the mellein synthase can also be engineered or replace to use starter units other the acetyl-CoA to generate mellein derivatives (such as the anti-diabetic compound hydrangenol ) (Fig. 10B & C). [00150] Engineering or replacement of the acyltransferase (AT) domain of the mellein synthase will allow the synthesis of pharmaceutically important isocoumarins such as the

anti-diabetic hydrangenol (15), low calorie sweeter phyllodulcin (16), gastro-protective AI-77 -= ~=. ^ B (13) the antineoplastic agent NM-3 (10) by using the engineered enzyme as a biocatalyst.

Compared to the more traditional chemical synthetic method, the use of the biocatalyst will provide a much more cost-effective and environmentally sustainable alternative.

[00151] Given the versatility of the iterative polyketide synthases in making PKS products with different chain length and reduction pattern, engineering or replacement of the

ketoreductase (KR) domain of the mellein synthase will allow the synthesis of other classes of compounds as synthetic intermediates or precursors.

Recombinant PKS for production of 6-methylsalicylic acid

[00152] Engineering of the mellein synthase by domain swapping with domains from

other PKSs allows the synthesis of 6-methylsalicylic acid (6-MSA).

[00153] Bacterial iPKSs exhibit distinct selective reduction patterns in aromatic

polyketide biosynthesis, which is likely to be governed by the KR domain. Given some

preliminary domain swapping experiments, it seems the selective reduction pattern and chain length can be controlled by engineering or replacing the KR domain. This will allow the use of engineered SACE5532 to produce isocoumarins that bear hydroxyl groups at various

positions or even non-isocoumarin (pentaketide) compounds (e.g. tetra- or hexaketide

compounds) (Fig. 10A).

[00154] Our studies on the stand alone KR domain suggested that the reduction pattern of the PKS is solely determined by the KR domain. Based on this observation, we hypothesized that the replacement of the KR domain by the KR from other iPKSs could alter the reduction pattern may lead to the synthesis of new product. Indeed, we demonstrated that, by replacing the TH-KR didomain of the mellein synthase by the TH-KR domain from NcsB (), we could obtain 6-methylsalicylicc acid (6-MSA) instead of mellein (Fig. 11). 6-MSA is a polyketide produced by a wide variety of fungi and bacteria. It is the first identifiable intermediate in the biosynthesis of patulin, which is used as an antibiotic in veterinary medicine and is also a cause of apple spoilage in cider manufacture. Interestingly, the replacement of the ACP domain does not affect product formation and the replacement of the KR domain led to the loss of enzymatic activity. Structural modeling showed extensive contacts at the TH-KR interface, but minimal contact at the AT-TH and KR-ACP interface. These results indicate maintenance of the domain-domain interaction between the TH and KR domains is crucial in engineering these iterative PKSs. Together, these domain-swapping experiments confirm the engineerability of the mellein synthase that can be further exploited in the future for the production of other tetraketide, pentaketide, hexaketide or heptaketide compounds.

[00155] Bacterial iPKSs exhibit distinct selective reduction patterns in aromatic polyketide biosynthesis, which is likely to be governed by the KR domain. For example, the ketoreductase (KR) domain in AziB selectively reduces the ketone groups at C3, C5, and C9 positions, which is distinct from the actions of the KR domain of NcsB that reduces the keto groups at C5 and C9 positions (Fig. 8). Similarly ChlBl , MdpB and PokM reduce ketone group at C5. Our experiments indicate that SACE5532 mellein synthase reduces ketone groups at C5 and C9. How the KR domain selectively reduces certain keto groups at certain positions of the polyketide intermediates remains unknown. Based on the structure of the product mellein and the domain composition of the mellein synthase, we proposed a catalytic mechanism of the iterative PKS (Fig. 9). Selective reduction of the keto groups is likely to occur during the synthesis of mellein as well. Given some preliminary domain swapping experiments, it seems the selective reduction pattern and chain length can be controlled by engineering or replacing the KR domain. This will allow the use of engineered SACE5532 to produce isocoumarins that bear hydroxyl groups at various positions or even non- isocoumarin (pentaketide) compounds (e.g. tetra- or hexaketide compounds) (Fig. 10A).

Recombinant PKS containing KR domain only

[00156] We cloned and expressed the stand-alone KR domains from SACE5532 (1170 - 1638 aa) and NcsB (1152 - 1641 aa). Both KR domains are soluble and enzymatically active as demonstrated by the reduction of trans- 1-decalone (18), a non-specific substrate used for assaying the activity of KR domains (Fig. 6c).

[00157] To clone the stand-alone KR domain of SACE5532, the PCR reaction was performed using pUC57-SACE5532 as a template with the following primers: SACE5532- KR (forward) 5'- TTTCATATGCGCGATCTGGCGTATGAAATCATTTGG -3' / (reverse) 5'- TTTCTCGAGGCCGGTATCGCCGCTCGCGGTCAGTTC -3'. Successful reaction mixtures consisted of 52 ng of template DNA, 300 nM each primer, 300 mM dNTPs, , lx KAPAHiFi™ Fidelity Buffer, and 1.0 U of KAPAHiFi™ DNA Polymerase in a final volume of 50 μΐ. The PCR program was as follows: initial denaturing at 95°C for 5 min; 6 cycles at 95°C for 30 s, 45°C for 30 s, and 72°C for 40 s; 30 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 40 s; and an additional 7 min at 72°C. The 1500-bp PCR product was gel-purified and digested with Ndel-Xhol. The digested SACE5532-KR fragment was gel-purified and ligated into the identical sites of pET-28b(+) to give pET28-SACE5532KR. Then the plasmid harboring the SACE5532-KR was sequenced and transformed into E. coli strain BL21(DE3) for protein expression.

[00158] To clone the stand-alone KR domain of NcsB, the PCR reaction was performed using pUC57-NcsB-TH-KR as a template with the following primers: NcsB-KR (forward) 5'- TTTCATATGAGCGAACTGGTTCACGAAATCGTCTGG -3' / (reverse) 5'- TTTCTCGAGGCCATCCGTTTCGCCAGACACCGGCAG -3'. Successful reaction mixtures consisted of 100 ng of template DNA, 300 nM each primer, 300 mM dNTPs, , 1 ^χ KAPAHiFi™ Fidelity Buffer, and 1.0 U of KAPAHiFi™ DNA Polymerase in a final volume of 50 μΐ. The PCR program was as follows: initial denaturing at 95°C for 5 minutes; 6 cycles at 95°C for 30 seconds, 45°C for 30 seconds, and 72°C for 40 seconds; 30 cycles at 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds; and an additional 7 minutes at 72°C. The 1.5-kb PCR product was gel-purified and digested with Ndel and Xhol restriction enzymes. The digested SACE5532-KR fragment was gel-purified and ligated into the identical sites of pET-28b(+) to give pET28-NcsB-KR. Then the plasmid harbouring the gene fragment was sequenced and transformed into E. coli strain BL21(DE3) for protein expression.

[00159] Enzymatic assay of the stand-alone KR domains

[00160] The in vitro assays of the ketoreductase (KR) domain activity were conducted by using a semi-micro quartz cuvette and a Shimazu UV- Vis 1700 spectrophotometer. When ircms- 1-decalone was used as the substrate, a typical enzymatic reaction contained 0.82 mg/ml KR _S ACE5 ₅ 3 ₂ or R _CS B protein, 0.25 mM NADPH and 10 mM ira«s-l -decalone in 100 mM Tris buffer (pH 8.0) in a total volume of 200 μΐ. The reaction was incubated at 37°C within the sample chamber through an external temperature controller. When S-Ethyl acetothioacetate was used as the substrate, a typical enzymatic reaction contains 0.02 mg/ml KRS _AC E55 ₃ 2 or KR _NCSB , 0.25 mM NADPH and 3.7 mM S-Ethyl acetothioacetate in 100 mM HEPES buffer (pH 8.5) in a total volume of 200 μΐ. The reaction was incubated at 20°C within the sample chamber through an external temperature controller. When acetoacetyl- SNAC was used as the substrate, a typical enzymatic reaction contains 1.46 mg/ml

KR _SA CE5 ₅₃ 2 or KR _NCSB , 0.25 mM NADPH and 3.3 mM acetoacetyl-SNAC (20) or 5- oxohexanoyl-SNAC (21) in 100 mM HEPES buffer (pH 8.5) in a total volume of 200 μΐ. The reaction was incubated at 30°C within the sample chamber through an external temperature controller. The reaction progress was monitored continuously by recording the NADPH absorbance at 340 nm.

[00161] Expression and purification of SACE5532-KR and KR-NscB - The expression and purification of SACE5532-KR and KR-NscB were similar to the procedure described below for Sfp, except that cells were grown in LB media supplemented with 50 ^g/ml kanamycin.

[00162] For the assay of the reductase activity of SACE5532-KR, and KR-NscB the reactions were conducted in a semi-micro quartz cuvette and monitored with a Shimazu UV- Vis 1700 spectrophotometer. 0.25 mM NADPH and 10 mM trans- 1-decal one were added into 200 μΐ of reaction buffer [50 mM Tris (pH 8.0), 150 mM NaCl and 1 mM DTT]. The absorption at 340 nm was auto-zeroed before adding SACE5532-KR or KR-NscB. As soon as 0.82 mg/ml SACE5532-KR or KR-NscB was added, the reaction progress was monitored by the UV-Vis spectrophotometer by recording the absorption at 340 nm for 20 min. The reaction was incubated at 37°C within the sample chamber through an external temperature controller.

Recombinant PKS using the SACE5532 scaffold and replacing the ACP domain with an NcsB ACP domain.

[00163] Domain swapping was conducted by replacing the ACP domain of SACE5532 with that of NcsB to generate SACE5532(AACP:ncs£-ACP). The plasmid pUC57-NcsB- ACP and pUC57-SACE5532 was digested with Clal-Xhol. The 500-bp ncsB-AC? fragment was gel-purified and ligated into the identical sites of pUC57-SACE5532 to give pUC57- SACE5532 (AACP:NcsB-ACP). The plasmid was sequenced using pUC57 reverse sequence primer. Then the plasmid pUC57-SACE5532(AACP:NcsB-ACP) was digested with Ndel- Xhol to yield SACE5532(AACP:ncs5-ACP). The 5-kbp SACE5532(AACP:«cs5-ACP) fragment was gel-purified and ligated into the identical sites of pET-28b(+) to give pET28- pUC57-SACE5532(AACP:NcsB-ACP).

[00164] Co-expression ofSA CE5552(AACP:NcsB-ACP) and Sfp - The co-expression of SACE5532(AACP:NcsB-ACP) and Sfp was also carried out following the similar procedure described for SACE5532 and Sfp.

[00165] The reported protein sequences for SACE5532, and NcsB have been deposited in Genbank under the accession numbers of YP 001 107644, and AAM77986.

[00166] For the enzymatic assays of SACE5532 (AACP:NcsB-ACP), a typical enzymatic reaction contained 3 μΐ. of MgCl ₂ (1 M), 8 μ\ of CoA (50 mM), 70 μΐ. of SACE5532 (1 1.3 mg/ml), 20 of Sfp (27.9 mg/ml) and 93 μΐ of reaction buffer [50 mM Tris (pH 8.5), 150 mM NaCl and 1 mM DTT]. After incubation at 30°C for 20 min, the reaction mixture was added with 5 ΐ. of NADPH (10 mM), Ιμΐ of acetyl CoA (100 mM) and 2 μΐ of malonyl CoA (100 mM) and incubated at 30°C for 3 h. The reaction was quenched with 5 μΙ_ of 6 mM HCl and vortexed to totally precipitate the enzymes. Then the mixture was spun at 14,800 rpm for 10 min and the supernatant was loaded for HPLC analysis.

The effect of the catalytic residue in the KS domain

[00167] The third control reaction replaced the wild type SACE5532 with the mutant SACE5532-C184A, in which the predicted essential residue Cys ¹⁸⁴ in the KS domain was replaced by Ala. To generate the SACE5532-C184A mutant, the PCR reaction was performed using pET28- SACE5532 as a template with the following primers: C184A (forward) 5'- CCTGACCATTGATACTGCTGCCGCGGGCAGC -3' / (reverse) 5'- GCTGCCCGCGGCAGCAGTATCAATGGTCAGG -3'. Successful reaction mixtures consists of 100 ng of template DNA, 300 nM each primer, 300 mM dNTPs, , lx

KAPAHiFi™ Fidelity Buffer, and 0.5 U of KAPAHiFi™ DNA Polymerase in a final volume of 25 μΐ. The PCR program was as following: initial denaturing at 96°C for 5 min, followed by 18 cycles at 96°C for 50 s, 54°C for 50 s, and 68°C for 6 min, and completed by an additional 7 min at 68°C. Upon completion, 1 μΐυ (10 U) of Dpnl was added directly to the PCR mixture and digested at 37°C for 2 h. An aliquot (5 μΐ) of the mixture was directly transformed into E. coli Top 10 competent cells and plated on LB supplemented with 50 ^g/ml kanamycin. The mutant constructs were confirmed by sequencing to give pET28- SACE5532-C184A.

[00168] For the enzymatic assays of SACE5532-C184A, a typical enzymatic reaction contained 3 /xL of MgCl ₂ (1 M), 8 μ\ of CoA (50 mM), 70 of SACE5532 (1 1.3 mg/ml), 20 μΐ of Sfp (27.9 mg/ml) and 93 μ\ of reaction buffer [50 mM Tris (pH 8.5), 150 mM NaCl and 1 mM DTT]. After incubation at 30°C for 20 min, the reaction mixture was added with 5 ΐ, of NADPH (10 mM), Ιμΐ of acetyl CoA (100 mM) and 2 μ\ of malonyl CoA (100 mM) and incubated at 30°C for 3 h. The reaction was quenched with 5 of 6 mM HC1 and vortex ed to totally precipitate the enzymes. Then the mixture was spun at 14,800 rpm for 10 min and the supernatant was loaded for HPLC analysis.

Expression and purification of Sfp

[00169] pCDF-Sfp was transformed into E. coli BL21(DE3) competent cells. The cells were plated on LB medium supplemented with 50 μg/ml streptomycin. A single colony was used to inoculate 20 ml of LB medium supplemented with 50 μg/ml streptomycin, and incubated overnight at 37°C at 200 rpm. A 5 ml aliquot was transferred to 500 ml of LB medium supplemented with 50 μg/ml streptomycin, and grown at 37°C at 200 rpm. When OD ₆ oo reached ~0.6 (~3 h), the culture was cooled down to 16°C and induced with 0.2 mM IPTG. After incubation at 16°C for an additional ~20 h at 130 rpm, cells were harvested and spun at 8,000 rpm. The cell pellet was re-suspended in lysis buffer [50 mM NaH ₂ P0 ₄ (pH 8.0), 300 mM NaCl, 20 mM imidazole, 5 mM β-ΜΕ and 10% (v/v) glycerol] and lysed by sonication. After centrifugation at 20,000 rpm for 30 minutes at 4°C, the supernatant was filtered by 0.45 μηι membrane and loaded onto HiTrap™ Ni ²⁺ -NTA column. The column was then washed by lysis buffer and wash buffer containing 40 mM imidazole before eluted with elution buffer containing 500 mM imidazole. The eluted protein was further purified by gel filtration using a HiLoad™ 16/60 Superdex™ 200 column. Proteins were desalted into Tris buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 1 mM DTT and 10% (v/v) glycerol]. Its purity was determined to be >90 % by SDS-PAGE. The protein was concentrated, flash frozen in liquid nitrogen, and stored in -80°C freezer.

Liquid chromatography coupled Mass spectrometry (LC-MS)

[00170] High-resolution LC-MS was performed by using a Michrom Rpl 8 column (0.1 * 50 mm). The gradient employed in the analysis was from 99% buffer A (HPLC grade water with 0.1% FA) + 1% buffer B (100% acetonitrile with 0.1% FA) to 40% buffer A + 60% buffer B in 30 minutes. The flow rate was set at 1 μΐ/min and the UV detector was set at 314 nm. The ionization energy was set with Nanospray Ionization source for the Finnigan LTQ Orbitrap mass spectrometer (Thermo Electron). The results were analyzed with the software Xcalibur for the deduction of the plausible molecular formulas based on the observed m/z.

[00171] NMR spectroscopy

[00172] One-dimensional Ή, ¹³ C NMR and two-dimensional NOESY spectra were collected on a Bruker 400 MHz NMR spectrometer (Bruker DPX 400) with CDC1 ₃ as the solvent and TMS as the internal reference. The colorless powder form of the enzymatic product obtained from the large scale in vitro reactions was used for NMR analysis. The chemical shifts and coupling constants for the 1H NMR spectrum [CDC1 ₃ , 400 MHz,

Supporting Figure S5] are: δ 4.73 (1H, m, H-3), δ 2.93 (2H, d, J= 7.2 Hz, H-4), δ 6.69 (1H, J

- 7.2 Hz, H-5), δ 7.41 (1H, t, J= 7.8 Hz, H-6), δ 6.89 (1H, d, J= 8.4 Hz, H-7), δ 1.53 (3H, d,

J= 6.4 Hz, H-l 1), δ 11.03 (1H, s, OH-C8). The chemical shifts for the '. ³ C NMR spectrum

[CDC1 ₃ , 400 MHz, Supporting Figure S6] are: δ 169.94 (C-l), δ 76.09 (C-3), δ 34.63 (C-4), δ 117.88 (C-5), δ 136.13 (C-6), δ 1 16.27 (C-7), δ 162.23 (C-8), δ 108.32 (C-9), δ 139.38 (C-10), δ 20.76 (C-l 1). 2D Ή, "H-NOESY NMR [CDC1 ₃ , 400 MHz, Supporting Figure S7]: (H-7, H-6), (H-6, H-5), (H-5, H-4), (H-4, H-3), (H-4, H-l 1), (H-l 1 , H-3). The 1H NMR and ¹³ C NMR are also in excellent agreement with those obtained for a synthesized mellein.

[00173] Measurement of the specific rotation by polarimeter

25

[00174] The specific rotation [a]o of the enzymatic product was measured by using a polarimeter as -123° (c 0.43, CHC1 ₃ , 25 °C ), which is similar to the specific ration measured for the synthetic (R)-(-) -mellein ([a] _D ²² = -102° (c 0.53, CHC1 ₃ ), Islam et al, Tetrahedron 63 (2007) 1074-1079).

[00175] Synthesis of N-acetylcysteamine (SNAC) thioesters.

[00176] Acetoacetyl-SNAC (20). The diketide analog acetoacetyl-SNAC was prepared according to the reported procedure (Gilbertt, I et al, Bioorg. Med. Chem. Lett., 1995, 5, 1587-1590). Analytical thin layer chromatography (TLC) was performed using pre-coated silica gel plate. Visualization was achieved by UV light (254 nm) and/or KMn0 ₄ stain. Flash chromatography was performed using silica gel and a gradient solvent system (EtOAc:hexane as eluent). NMR spectra were recorded at room temperature on Bruker DPX 400

spectrometers with CDCI3 as the solvent and TMS as the internal reference. Ή NMR spectrum [CDC1 ₃ , 400 MHz]: δ 5.95 (1H, s, NH), δ 2.27 (3H, s, H-l), δ 3.71 (2H, m, H-3), δ 3.10 (2H, m, H-5), δ 3.46 (2H, m, H-6), δ 1.97 (3H, s, H-8). ¹³ C NMR spectrum [CDC1 ₃ , 400 MHz]: 199.86, 192.29, 170.47, 58.03, 39.17, 30.29, 29.25, 23.17.

[00177] 5-oxohexanoyl-SNAC (21). The 4-acetylbutyric acid (65 mg, 0.5 mmol) was dissolved in 5 ml of DMF at 0°C and then treated with diphenylphosphoryl azide (163 μΐ, 0.75 mmol) and triethylamine (129 μΐ, 1 mmol) for 2 h with stirring. N-acetylcysteamine (HSNAC, 64 μΐ, 0.6 mmol) was added to the solution. The mixture was stirred at room temperature for an additional 3 h. The reaction was quenched with the addition of 25 ml of H ₂ 0 and extracted twice with ethyl acetate. The organic layer was dried, and the title compound was purified with silica gel chromatograph to give 40 mg of solid powder (34% yield): Ή NMR (CDC1 ₃ , 400 MHz): δ 6.03 (br, 1H), 3.40 (q, J = 6.0 Hz, 2H), 3.00 (t, J= 6.4 Hz, 2H), 2.58 (t, J = 7.2 Hz, 2H), 2.49 (t, J = 6.4 Hz, 2H), 2.12 (s, 3H), 1.95 (s, 3H), 1.91 (t, J = 7.2 Hz, 2H); ¹³ C NMR (CDC1 ₃ , 100 MHz): δ 207.8, 199.4, 170.4, 42.9, 42.1, 39.5, 29.9, 28.6, 23.2, 19.4.

[00178] By "comprising" it is meant including, but not limited to, whatever follows the word "comprising". Thus, use of the term "comprising" indicates that the listed elements are required or mandatory, but that other elements are optional and may or may not be present.

[00179] By "consisting of is meant including, and limited to, whatever follows the phrase "consisting of. Thus, the phrase "consisting of indicates that the listed elements are required or mandatory, and that no other elements may be present.

[00180] The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use such terms and^expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[00181] By "about" in relation to a given numberical value, such as for temperature and period of time, it is meant to include numerical values within 10% of the specified value. [00182] The invention has been described broadly and generically herein. Each of the narrower species and sub-generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[00183] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described ^" in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. References

1. Pal, S., Chatare, V., and Pal, M. Isocoumarin and Its Derivatives: An Overview on their Synthesis and Applications, Current Organic Chemistry 15, 782-800.

2. Inayat Ur, R., Arfan, M., and Khan, G. A. (1998) Naturally occurring isocoumarins, Journal of the Chemical Society of Pakistan 20, 76-87.

3. Matsui, M., Mori, K., and Arasaki, S. (1964) SYNTHESIS OF ISOCOUMARINS .1.

(PLUSMINUS)-MELLEIN, Agricultural and Biological Chemistry 28, 896-&.

4. Yuan, H. Q., Junker, B., Helquist, P., and Taylor, R. E. (2004) Synthesis of anti- angiogenic isocoumarins, Current Organic Synthesis 1, 1-9. Bi, Y. M., Bi, X. B., Zhao, Q. R., Fang, A., and Chen, Y. G. (2006) Dihydroisocoumarins from the fungus Cephalosporium sp AL031, Polish Journal of Chemistry 80, 397-401.

Aue, R., Mauli, R., and Sigg, H. P. (1966) PRODUCTION OF 6-METHOXY- MELLEIN BY SPORORMIA BIPARTIS CAIN, Experientia 22, 575-&.

Brand, J. M., Fales, H. M, Sokolosk.Ea, Macconne.Jg, Blum, M. S., and Duffield, R. M. (1973) IDENTIFICATION OF MELLEIN IN MANDIBULAR GLAND SECRETIONS OF CARPENTER ANTS, Life Sciences 13, 201-211.

Kern, F., Klein, R. W., Janssen, E., Bestmann, H. J., Attygalle, A. B., Schafer, D., and Maschwitz, U. (1997) Mellein, a trail pheromone component of the ant Lasius fuliginosus, Journal of Chemical Ecology 23, 779-792.

Cole, R. J., and Cox, R. H. (1981) Handbook of toxic fungal metabolites, Academic Press, New York.

Dai, J., Carte, B. K., Sidebottom, P. J., Sek Yew, A. L., Ng, S., Huang, Y., and Butler, M. S. (2001) Circumdatin G, a new alkaloid from the fungus Aspergillus ochraceus, J Nat Prod 64, 125-126.

Devys, M., Barbier, M., Bousquet, J. F., and Kollmann, A. (1992) Isolation of the New (-)-(3r,4s)-4-Hydroxymellein from the Fungus Septoria-Nodorum Berk, Z Naturforsch C 47, 779-781.

Devys, M., Bousquet, J. F., Kollmann, A., and Barbier, M. (1980) Dihydroisocoumarins and Mycophenolic-Acid of Culture-Medium of a Phytopathogenic Fungus, Septoria-Nodorum, Phytochemistry 19, 2221-2222.

Krohn, K., Bahramsari, R., Florke, U., Ludewig, K., KlicheSpory, C, Michel, A., Aust, H. J., Draeger, S., Schulz, B., and Antus, S. (1997) Dihydroisocoumarins from fungi: Isolation, structure elucidation, circular dichroism and biological activity, Phytochemistry 45, 313-320.

Broady, S. D., Rexhausen, J. E., and Thomas, E. J. (1991) TOTAL SYNTHESIS OF AI-77-B, Journal of the Chemical Society-Chemical Communications, 708-710.

Shimojima, Y., Hayashi, H., Ooka, T., and Shibukawa, M. (1982) STUDIES ON AI- 77S, MICROBIAL PRODUCTS WITH PHARMACOLOGICAL ACTIVITIES .1. PRODUCTION, ISOLATION AND PHARMACOLOGICAL STUDIES OF AI-77S, Agricultural and Biological Chemistry 46, 1823-1829. Ceska, O., Chaudhary, S. K., Warrington, P., Ashwoodsmith, M. J., Bushnell, G. W., and Poulton, G. A. (1988) CORIANDRIN, A NOVEL HIGHLY PHOTOACTIVE COMPOUND ISOLATED FROM CORIANDRUM-SATIVUM, Phytochemistry 27, 2083-2087.

Ashwoodsmith, M. J., Warrington, P. J., Jenkins, M., Ceska, O., and Romaniuk, P. J. (1989) PHOTOBIOLOGICAL PROPERTIES OF A NOVEL, NATURALLY- OCCURRING FUROISOCOUMARIN, CORIANDRIN, Photochemistry and Photobiology 50, 745-751.

Baba, K., Xiao, Y. Q., Taniguchi, M., Ohishi, H., and Kozawa, M. (1991) ISOCOUMARINS FROM CORIANDRUM-SATIVUM, Phytochemistry 30, 4143- 4146.

Cai, Y. N., Bennett, D., Nair, R. V., Ceska, O., Ashwoodsmith, M. J., and Digiovanni, J. (1993) INHIBITION AND INACTIVATION OF MURINE HEPATIC ETHOXYRESORUFIN AND PENTOXYRESORUFIN O-DEALKYLASE BY NATURALLY-OCCURRING COUMARINS, Chemical Research in Toxicology 6, 872-879.

Asen, S., Cathey, H. M., and Stuart, N. W. (1960) ENHANCEMENT OF GIBBERELLIN GROWTH-PROMOTING ACTIVITY BY HYDRANGENOL ISOLATED FROM LEAVES OF HYDRANGEA MACROPHYLLA, Plant Physiology 35, 816-819.

Suzuki, H., Ikeda, T., Matsumoto, T., and Noguchi, M. (1977) ISOLATION AND IDENTIFICATION OF HYDRANGENOL AND UMBELLIFERONE FROM CULTURED-CELLS OF AMACHA (HYDRANGEA-MACROPHYLLA SERINGE VAR THUNBERGII MAKINO), Agricultural and Biological Chemistry 41, 205-206. Kakegawa, H., Matsumoto, H., and Satoh, T. (1988) INHIBITORY EFFECTS OF HYDRANGENOL DERIVATIVES ON THE ACTIVATION OF HYALURONIDASE AND THEIR ANTIALLERGIC ACTIVITIES, Planta Medica, 385-389.

oshikawa, M., Matsuda, H., Shimoda, H., Shimada, H., Harada, E., Naitoh, Y., Miki, A., Yamahara, J., and Murakami, N. (1996) Development of bioactive functions in hydrangeae dulcis folium .5. On the antiallergic and antimicrobial principles of hydrangeae dulcis folium .2. Thunberginols C, D, and E, thunberginol G 3'-0- glucoside, (-)-hydrangenol 4'-0-glucoside, and (+)-hydrangenol 4'-0-glucoside, Chemical & Pharmaceutical Bulletin 44, 1440-1447.

Matsuda, H., Shimoda, H., Yamahara, J., and Yoshikawa, M. (1999) Effects of phyllodulcin, hydrangenol, and their 8-O-glucosides, and thunberginols A and F from Hydrangea macrophylla, SERINGE var. thunbergii MAKING on passive cutaneous anaphylaxis reaction in rats, Biological & Pharmaceutical Bulletin 22, 870-872.

Yasuda, T., Kayaba, S., Takahashi, K., Nakazawa, T., and Ohsawa, K. (2004) Metabolic fate of orally administered phyllodulcin in rats, J Nat Prod 67, 1604-1607. Lee, H. B., and Oh, H. (2006) Two new fungal metabolites from an epiphytic fungus Paraphaeosphaeria species, Bulletin of the Korean Chemical Society 27, 779-782. Wijeratne, E. M. K., Paranagama, P. A., and Gunatilaka, A. A. L. (2006) Five new isocoumarins from Sonoran desert plant-associated fungal strains Paraphaeosphaeria quadriseptata and Chaetomium chiversii, Tetrahedron 62, 8439-8446.

Paranagama, P. A., Wijeratne, E. M. K., and Gunatilaka, A. A. L. (2007) Uncovering biosynthetic potential of plant-associated fungi: Effect of culture conditions on metabolite production by Paraphaeosphaeria quadriseptata and Chaetomium chiversii, J Nat Prod 70, 1939-1945.

Xiao, H., Madhyastha, S., Marquardt, R. R., Li, S. Z., Vodela, J. K., Frohlich, A. A., and Kemppainen, B. W. (1996) Toxicity of ochratoxin A, its opened lactone form and several of its analogs: Structure-activity relationships, Toxicology and Applied Pharmacology 137, 182-192.

Harris, J. P., and Mantle, P. G. (2001) Biosynthesis of ochratoxins by Aspergillus ochraceus, Phytochemistry 58, 709-716.

Frisvad, J. C, Frank, J. M., Houbraken, J., Kuijpers, A. F. A., and Samson, R. A. (2004) New ochratoxin A producing species of Aspergillus section Circumdati, Studies in Mycology, 23-43.

Nakashima, T., Hirano, S., Agata, N., Kumagai, H., Isshiki, K., Yoshioka, T., Ishizuka, M., Maeda, K., and Takeuchi, T. (1999) Inhibition of angiogenesis by a new isocoumarin, NM-3, Journal of Antibiotics 52, 426-428.

Agata, N., Hirano, S. I., Abe, C, Nakashima, T., Tsuchiya, A., Kumagai, H., Isshiki, K., Yoshioka, T., Ishizuka, L., and Takeuchi, T. (2000) Suppression of type II collagen-induced arthritis by a new isocoumarin, NM-3, Research Communications in Molecular Pathology and Pharmacology 108, 297-+. Kawano, T., Agata, N., Kharbanda, S., Avigan, D., and Kufe, D. (2007) A novel isocoumarin derivative induces mitotic phase arrest and apoptosis of human multiple myeloma cells, Cancer Chemotherapy and Pharmacology 59, 329-335.

Staunton, J., and Wilkinson, B. (1997) Biosynthesis of Erythromycin and Rapamycin, Chem Rev 97, 2611-2630.

Boakes, S., Oliynyk, M., Cortes, J., Bohm, I., Rudd, B. A., Revill, W. P., Staunton, J., and Leadlay, P. F. (2004) A new modular polyketide synthase in the erythromycin producer Saccharopolyspora erythraea, J Mol Microbiol Biotechnol 8, 73-80.

Oliynyk, M., Samborskyy, M., Lester, J. B., Mironenko, T., Scott, N., Dickens, S., Haydock, S. F., and Leadlay, P. F. (2007) Complete genome sequence of the erythromycin-producing bacterium Saccharopolyspora erythraea NRRL23338, Nat Biotechnol 25, 447-453.

Shen, B. (2000) Biosynthesis of Aromatic Polyketides Biosynthesis, (Leeper, F., and Vederas, J., Eds.), pp 1-51, Springer Berlin / Heidelberg.

Gaisser, S., Trefzer, A., Stockert, S., Kirschning, A., and Bechthold, A. (1997) Cloning of an avilamycin biosynthetic gene cluster from Streptomyces viridochromogenes Tu57, J Bacteriol 179, 6271-6278.

Weitnauer, G., Muhlenweg, A., Trefzer, A., Hoffmeister, D., Sussmuth, R. D., Jung, G., Welzel, K., Vente, A., Girreser, U., and Bechthold, A. (2001) Biosynthesis of the orthosomycin antibiotic avilamycin A: deductions from the molecular analysis of the avi biosynthetic gene cluster of Streptomyces viridochromogenes Tu57 and production of new antibiotics, Chem Biol 8, 569-581.

Ahlert, J., Shepard, E., Lomovskaya, N„ Zazopoulos, E., Staffa, A., Bachmann, B. O., Huang, K., Fonstein, L., Czisny, A., Whitwam, R. E., Farnet, C. M., and Thorson, J. S. (2002) The calicheamicin gene cluster and its iterative type I enediyne PKS, Science 297, 1173-1 176.

Jia, X.-Y., Tian, Z.-H., Shao, L., Qu, X.-D., Zhao, Q.-F., Tang, J., Tang, G.-L., and Liu, W. (2006) Genetic Characterization of the Chlorothricin Gene Cluster as a Model for Spirotetronate Antibiotic Biosynthesis, Chem Biol 13, 575-585.

Shao, L., Qu, X. D., Jia, X. Y., Zhao, Q. F., Tian, Z. H., Wang, M., Tang, G. L., and Liu, W. (2006) Cloning and characterization of a bacterial iterative type I polyketide synthase gene encoding the 6-mefhylsalicyclic acid synthase, Biochem Biophys Res Commun 345, 133-139. Van Lanen, S. G., Oh, T.-j., Liu, W., Wendt-Pienkowski, E., and Shen, B. (2007) Characterization of the maduropeptin biosynthetic gene cluster from Actinomadura madurae ATCC 39144 supporting a unifying paradigm for enediyne biosynthesis, Journal of the American Chemical Society 129, 13082-13094.

Daum, M., Peintner, I., Linnenbrink, A., French, A., Weber, M., Paululat, T., and Bechthold, A. (2009) Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin, Chembiochem 10, 1073-1083.

Liu, W., Nonaka, K., Nie, L., Zhang, J., Christenson, S. D., Bae, J., Van Lanen, S. G., Zazopoulos, E., Farnet, C. M., Yang, C. F., and Shen, B. (2005) The neocarzinostatin biosynthetic gene cluster from Streptomyces carzinostaticus ATCC 15944 Involving two iterative type I polyketide synthases, Chem Biol 12, 293-302.

Sthapit, B., Oh, T.-J., Lamichhane, R., Liou, K., Lee, H. C, Kim, C.-G., and Sohng, J. K. (2004) Neocarzinostatin naphthoate synthase: an unique iterative type I PKS from neocarzinostatin producer Streptomyces carzinostaticus, FEB S Letters 566, 201-206. Zhao, Q., He, Q., Ding, W., Tang, M., Kang, Q., Yu, Y., Deng, W., Zhang, Q., Fang, J., Tang, G., and Liu, W. (2008) Characterization of the Azinomycin B Biosynthetic Gene Cluster Revealing a Different Iterative Type I Polyketide Synthase for Naphthoate Biosynthesis, Chem Biol 15, 693-705.

Islam, M. S., Ishigami, K., and Watanabe, H. (2007) Synthesis of (-)-mellein, (+)- ramulosin, and related natural products, Tetrahedron 63, 1074-1079.