The present invention relates to a method for detecting an RNA virus in a sample, comprising the steps of a) releasing viral RNA from said sample; b) amplifying at least parts of the viral RNA comprised in said sample; c) contacting the amplified viral RNA of step a) with a type VI Cas nuclease, a crRNA, and a reporter RNA; and d) detecting cleavage of said reporter RNA, thereby detecting said RNA virus, and to methods and uses related thereto. The present invention also relates to a method for detecting a target RNA and/or a target DNA in a sample of a subject, the method comprising the steps of a) contacting said sample with a Type V Cas nuclease, a Type V crRNA targeting said target DNA, a type VI Cas nuclease, a Type VI crRNA targeting said target RNA, a reporter RNA and a reporter DNA; and b) detecting cleavage of said reporter RNA, thereby detecting said target RNA; and/or detecting cleavage of said reporter DNA, thereby detecting said target DNA, and to methods uses and means related thereto.

The new SARS-like coronavirus SARS-CoV-2 (also known as 2019-nCoV), the virus causing coronavirus disease 2019 (COVID-19), is spreading fast throughout the worldwide population. Currently, there is no specific therapy or vaccination known. Prevention of transmission is based on isolation quarantine of carriers. Equally, potential carriers are usually placed under quarantine. However, a vast majority of infected people do not develop noticeable clinical symptoms. RT-PCR tests can identify subjects who are currently infected with SARS-CoV-2; however, such tests require specific equipment, which may not be available in less developed countries.

CRISPR (Clustered, Regularly Interspaced Short Palindromic Repeats) systems in bacteria and archaea mediate specific degradation of foreign, invading nucleic acids. They comprise a CRISPR-associated (Cas) nuclease which can be programmed by short guideRNAs (gRNAs) to induce double-strand breaks at specific, sequence-complementary DNA loci. Besides applications in modification of the genetic composition of cells, CRISPR system have also been used in molecular detection of specific sequences, single-nucleotide variants, and pathogens (cf. e.g. Zhou et al. (2018), J Cell Mol Med 22:5807). Diverse CRISPR-Cas systems have been adopted for genome engineering in mammalian cells and animals, most prominently the CRISPR-Cas9 system from Streptococcus pyogenes (SpyCas9). CRISPR Cas type VI systems are unusual in that the nuclease is an RNase. Moreover, once activated by a ssRNA sequence complementary to their crRNA spacer, type VI Cas nucleases have unspecific RNase activity. This property was used by Kellner et al. (2019), Nature Protocols 14:2986 to establish an assay system testing for the presence of specific polynucleotide with fluorescence and lateral flow readouts. The method was later applied to detection of Coronavirus SARS-CoV-2 (Zhang et al. (2020), "SHERLOCK COVID-19 Testing Kit Instructions", v. 20200321, (www.broadinstitute.org/files/publications/special/COVID-19 detection (updated). pdf). A similar assay using a Cas 12 nuclease, which has DNase activity, was provided recently by Joung et al. (2020), "Point-of-care testing for COVID-19 using SHERLOCK diagnostics", v. 20200505 (www.stopcovid.science/docs/STOPCovid Whitepaper.pdf and Huang et al. (2020), Biosensors and Bioelectronics 164:112316). Nonetheless, also these methods require incubations at specific temperatures, which may not be possible to achieve where appropriate equipment is not available. Recently, saliva was proposed as a suitable sample material for SARS-CoV-2 detection (Wyllie et al. (2020), medRxiv 2020.04.16.20067835; doi.org/10.1101/2020.04.16.20067835).

There is, thus, a need in the art for improved means and methods for detecting RNA virus infection, in particular SARS-CoV-2 infection, avoiding the drawbacks ad requirements of the prior art. This problem is solved by the means and methods disclosed herein with the features of the independent claims. Advantageous embodiments which might be realized in an isolated fashion or in any arbitrary combinations are listed in the dependent claims.

In accordance, the present invention relates to a method for detecting an RNA virus in a sample, comprising the steps of a) releasing viral RNA from said sample; b) amplifying at least parts of the viral RNA comprised in said sample; c) contacting the amplified viral RNA of step b) with a Type VI Cas nuclease, a crRNA, and a reporter RNA; and d) detecting cleavage of said reporter RNA, thereby detecting said RNA virus.

The method of the present invention is an in vitro method. Moreover, it may comprise steps in addition to those explicitly mentioned above. For example, further steps may relate, e.g., to providing a sample for step a), or contacting the viral RNA with further reagents in steps b), c) and/or d). Moreover, one or more of said steps may be aided or performed by automated equipment, however, preferably specialized equipment is not necessary to perform the method in its entirety.

In general, terms used herein are to be given their ordinary and customary meaning to a person of ordinary skill in the art and, unless indicated otherwise, are not to be limited to a special or customized meaning. As used in the following, the terms “have”, “comprise” or “include” or any arbitrary grammatical variations thereof are used in a non-exclusive way. Thus, these terms may both refer to a situation in which, besides the feature introduced by these terms, no further features are present in the entity described in this context and to a situation in which one or more further features are present. As an example, the expressions “A has B”, “A comprises B” and “A includes B” may both refer to a situation in which, besides B, no other element is present in A (i.e. a situation in which A solely and exclusively consists of B) and to a situation in which, besides B, one or more further elements are present in entity A, such as element C, elements C and D or even further elements. Also, as is understood by the skilled person, the expressions "comprising a" and "comprising an" preferably refer to "comprising one or more", i.e. are equivalent to "comprising at least one".

Further, as used in the following, the terms "preferably", "more preferably", "most preferably", "particularly", "more particularly", "specifically", "more specifically" or similar terms are used in conjunction with optional features, without restricting further possibilities. Thus, features introduced by these terms are optional features and are not intended to restrict the scope of the claims in any way. The invention may, as the skilled person will recognize, be performed by using alternative features. Similarly, features introduced by "in an embodiment" or similar expressions are intended to be optional features, without any restriction regarding further embodiments of the invention, without any restrictions regarding the scope of the invention and without any restriction regarding the possibility of combining the features introduced in such way with other optional or non-optional features of the invention.

As used herein, the term "standard conditions", if not otherwise noted, relates to IUPAC standard ambient temperature and pressure (SATP) conditions, i.e. preferably, a temperature of 25°C and an absolute pressure of 100 kPa; also, preferably, standard conditions include a pH of 7. Moreover, if not otherwise indicated, the term "about" relates to the indicated value with the commonly accepted technical precision in the relevant field, preferably relates to the indicated value ± 20%, more preferably ± 10%, most preferably ± 5%. Further, the term "essentially" indicates that deviations having influence on the indicated result or use are absent, i.e. potential deviations do not cause the indicated result to deviate by more than ± 20%, more preferably ± 10%, most preferably ± 5%. Thus, “consisting essentially of’ means including the components specified but excluding other components except for materials present as impurities, unavoidable materials present as a result of processes used to provide the components, and components added for a purpose other than achieving the technical effect of the invention. For example, a composition defined using the phrase “consisting essentially of’ encompasses any known acceptable additive, excipient, diluent, carrier, and the like. Preferably, a composition consisting essentially of a set of components will comprise less than 5% by weight, more preferably less than 3% by weight, even more preferably less than 1% by weight, most preferably less than 0.1% by weight of non-specified component(s).

The term "fragment" of a biological macromolecule, preferably of a polynucleotide or polypeptide, is used herein in a wide sense relating to any sub-part, preferably subdomain, of the respective biological macromolecule comprising the indicated sequence, structure and/or function. Thus, the term includes sub-parts generated by actual fragmentation of a biological macromolecule, but also sub-parts derived from the respective biological macromolecule in an abstract manner, e.g. in silico.

The term "RNA virus" is known to the skilled person to relate to any virus having RNA as a genome. Preferably, the virus is a human and/or animal pathogenic virus, more preferably a human pathogenic virus. Preferably, the RNA virus is a virus having single-stranded RNA as a genome, preferably is a coronavirus or an influenza virus. More preferably, the RNA virus is a coronavirus as specified herein below. In accordance with the above, "viral RNA" preferably is the RNA a viral particle carries as a genome, or a fragment thereof. However, viral RNA preferably may also comprise free, i.e. non-capsid bound, viral RNA produced by an infected cell.

The term "coronavirus" is understood by the skilled person to relate to a group of viruses from the order Nidovirales, having a positive-sense single-stranded RNA genome with a size of approx. 25 to 35 kilobases. Preferably, the coronavirus is a beta-coronavirus, more preferably a severe acute respiratory syndrome coronavirus (SARS-CoV)-2, SARS-CoV-1, or Middle East respiratory syndrome coronavirus (MERS-CoV). Preferably the coronavirus is SARS-CoV-2. Preferably, the terms "SARS-CoV-2" and "severe acute respiratory syndrome coronavirus 2" relate to the virus identified in Genbank entry NCBI:txid2697049. Symptoms and diseases caused by coronavirus infection and in particular SARS-CoV-2 infection are known to the skilled person. In a preferred embodiment, the coronavirus is HCoV-NL63, HCoV-229E, HCoV-OC43, and HCoV-HKUl, all of which are known to the skilled person.

Thus, in a preferred embodiment, the RNA virus is selected from the list consisting of SARS- CoV-2, an influenza virus, HCoV-NL63, HCoV-229E, HCoV-OC43, and HCoV-HKUl. In case two RNA viruses shall be detected, they are, in a preferred embodiment, SARS-CoV-2 and an influenza virus.

The term "sample" refers to a sample of biological origin, preferably a sample from a subject. Preferably, the sample is a sample of separated cells or a sample from a tissue or an organ. Tissue or organ samples may be obtained from any tissue or organ by, e.g., biopsy. Separated cells may be obtained from the body fluids, such as lymph, blood, plasma, serum, liquor and other, or from the tissues or organs by separating techniques such as centrifugation or cell sorting. Preferably, the sample is a tissue or body fluid sample which is known or suspected to comprise an RNA virus. More preferably the sample is a sample of a body fluid, preferably saliva, sputum, blood, plasma, serum, lacrimal fluid, nasal discharge, urine, or stool sample. Preferred samples are from saliva, sputum, nasal discharge, and nasal swabs; most preferably, the sample is a saliva or sputum sample. The sample can be obtained from the subject by routine techniques which are well known to the person skilled in the art, e.g., venous or arterial puncture, nasal swabs, or open biopsy including aspiration of tissue or cellular material from a subject.

In a preferred embodiment, the sample is a sample of gurgle liquid. Thus, preferably, the sample is a liquid sample obtained by providing to the subject a gurgling medium and the subject gurgling with the gurgling medium, which after gurgling is referred to as "gurgling sample". Preferably, the gurgling medium is an aqueous liquid, more preferably a sterile aqueous liquid. Preferably, the gurgling liquid is saline (NaCl 0.9% (w/v)) or PBS. Preferably, the volume of gurgling medium is of from 1 ml to 20 ml, more preferably of from 2 ml to 8 ml. Preferably, said gurgling is performed for at least 10 s, more preferably at least 30 s, most preferably at least 60 s. Thus, preferably said gargling is performed for of from 10 s to 5 min, more preferably of from 30 s to 2 min, most preferably of from 45 s to 2 min. Also preferably, the gurgling is performed for of from 2 s to 120 s, more preferably of from 5 s to 60 s. Preferably, the subject from which the gurgling sample is derived from is instructed to collect all liquid remaining in mouth and/or throat after gurgling 2-3 times and to add it to the gurgling sample Preferably, of from 1 mΐ to 100 mΐ of the gurgling sample is used in the subsequent analysis, more preferably of from 2 mΐ to 50 mΐ.

The term "releasing" is, in principle, understood by the skilled person. As used herein, the term preferably relates to making viral RNA accessible at least partially to the reagents used in step b), preferably to the enzyme or enzymes contacted with the viral RNA in step b). Preferably, releasing comprises disassembling and/or denaturing viral capsid polypeptides and, if present, a viral membrane. In case of samples comprising cells, it preferably is sufficient to disassemble the cytoplasmic membrane of at least part of the cells comprised in said sample. Preferably, releasing comprises contacting the sample with a surfactant, such as Triton X, or a non-ionic surfactant such as Oleth-8. Also, preferably, releasing comprises contacting sample with the aforesaid surfactant Triton X-100 at a concentration of from 0.05% (w/v) to 5% (w/v), preferably of from 0.1% (w/v) to 1% (w/v), more preferably of from 0.15% (w/v) to 0.5% (w/v), most preferably of about 0.2% (w/v). Also preferably, releasing comprises contacting sample with Oleth-8 at a concentration of from 0.10% (w/v) to about 0.40% (w/v), preferably of from about 0.15% (w/v) to about 0.35% (w/v), more preferably of from about 0.20% (w/v) to about 0.30% (w/v), still more preferably about 0.25% (w/v), most preferably 0.25% (w/v). The sample may be heated during the release step, e.g. to at least 90°C for about 5 min. Preferably, the sample is maintained at the same temperature as in the other steps during release, i.e. at a temperature of from 20°C to 45°C, preferably at a temperature of 20°C to 37°C, more preferably at a temperature of about 25°C; as the skilled person will understand, in case the sample is maintained at the same temperature as for the other steps during release, the release step may be comprised in amplification step b). Also, preferably, the viral RNA released is used for the following steps as it is obtained by the aforesaid steps or a combination thereof. Thus, preferably, releasing does not comprise a nucleic acid extraction step. Also, preferably, steps a) and b) are performed in the same reaction tube. Preferably, at least the reaction mixture of step c), preferably the reaction mixtures of steps b) and c), more preferably the reaction mixtures of steps a) to c), comprise at least one RNase inhibitor, preferably an Inhibitor of RNAses A, B, and C, particularly a murine RNase inhibitor, more preferably an inhibitor of RNases A, B, C, 1, and Tl, such as the commercially available SUPERase™ RNase inhibitor. In a preferred embodiment, extraction comprises contacting the sample with a DNA extraction buffer comprising at least one detergent, preferably as specified elsewhere herein. Preferably extraction comprises contacting the sample with a commercially available DNA extraction buffer, preferably as described herein in the Examples. In a preferred embodiment, extraction comprises, preferably consists of, heating the sample to a temperature of from 65°C to 100°C, preferably of from 80°C to 100°, more preferably of from 90°C to 100°C, most preferably about 95°C, for a time of from 1 min to 30 min, preferably of from 2 min to 15 min, more preferably of from 3 min to 10 min, even more preferably for about 5 min, most preferably for 5 min. Thus, in a preferred embodiment, extraction comprises, preferably consists of, heating the sample to a temperature of about 95°C for about 5 min, preferably a temperature of 95°C for 5 min. In a preferred embodiment, an RNase inhibitor, preferably as specified herein above, is added prior to the heating step, preferably at a concentration of from 1 U/mI to 20 U/mI, more preferably of from 2 U/mI to 10 U/mI, still more preferably of from 3 U/mI to 5 U/mI, most preferably about 4 U/mI.

The term "amplifying" is used herein in its commonly accepted meaning, i.e. relating to a procedure causing the amount of at least a part of the viral RNA to increase compared to the amount after release of viral RNA from the sample. Methods for amplifying RNA are, in principle, known in the art. Preferred are isothermal methods; thus, preferably, amplifying viral RNA is accomplished via an RNA-dependent RNA polymerase (EC 2.7.7.48), preferably using appropriate primers. More preferably, the viral RNA is amplified by a reverse-transcriptase recombinase polymerase amplification (RT-RPA) reaction. Also, preferably, amplifying further comprises a second amplification step by a T7 RNA polymerase transcription reaction producing amplified viral RNA. RT-RPA and T7 RNA polymerase protocols are known in the art. Appropriate primers are known e.g. from Zhang et al. (2020), cited herein above. Preferably, in case the S gene of SARS-CoV-2 shall be targeted, primers S-RPA-Forward (5’- GAAATTAATACGACTCACTATAGGGAGGTTTCAAACTTTACTT GCTTTACATAGA -3’; SEQ ID NO:l) and S-RPA-reverse (5’-

TCCT AGGTT GAAGAT AACCC AC AT AAT AAG-3 ', SEQ ID NO:2) are used; and in case Orfla shall be targeted, primers Orfla-RPA-Forward (5’- GAAATTAATACGACTCACTATAGGGCGAAGTTGTAGGAGACATTATACTTAAACC -3’; SEQ ID NO:3) and Orfla-RPA-Reverse (5’-

TAGTAAGACTAGAATTGTCTAC ATAAGC AGC-3 ’ , SEQ ID NO:4) are used. More preferably, in case the N gene of SARS-CoV-2 shall be targeted, primers N-RPA- Forward_vl (5’- gaaattaatacgactcactatagggT AATC AGAC AAGGAACTGATT AC AAAC ATTG-3 ’ ; SEQ ID NO:8) and N-RPA-Reverse_vl (5’- GACTTCCATGCCAATGCGCGACATTCCGAAGA-3', SEQ ID NO: 9) or primers N-RPA-Forward_v2 (5’- gaaattaatacgactcactataggg ACT AATC AGAC AAGGAACTGATT AC AAAC AT -3 ’ ; SEQ ID NO: 10) and N-RPA-Reverse_v2 (5’- CACGTTCCCGAAGGTGTGACTTCCATGCCAAT -3', SEQ ID NO: 11) are used; and in case E shall be targeted, primers E-RPA-Forward_vl (5’- gaaattaatacgactcactatagggGTT AATAGTT AATAGCGT ACTTCTTTTTCTTGC-3 ’ ; SEQ ID NO: 12) and E-RPA-Reverse_vl (5’- TTAACAATATTGCAGCAGTACGCACACAATC -3’, SEQ ID NO: 13) or primers E-RPA-Forward_v2 (5’- gaaattaatacgactcactatagggATAGTTAATAGCGTACTTCTTTTTCTTGCTTTC -3’; SEQ ID NO: 14) and E-RPA-Reverse_v2 (5’-

T AC AAGACTC ACGTT AAC AAT ATT GC AGC AG-3 ', SEQ ID NO: 15) are used.

In a preferred embodiment, the amplifying comprises contacting the sample with an RPA reaction mixture, more preferably an RT-RPA reaction mixture. RPA reaction mixtures have been described (cf. e.g. US 2008/0076160, US 2011/0065106) and are commercially available, e.g. as TABAS03KIT from TwistDx Ltd, UK (Liu et al. (2021), Food Chemistry: 127608, (doi.org/10.1016/j.foodchem.2020.127608). Preferably, the RPA reaction mixture is used at from 1.5 fold to 5fold, more preferably at twofold, the concentration described by Kellner et al. (2019), Nature Protocols 14:2986 as "onefold"; this preferably corresponds to 0.3fold to lfold, preferably 0.4fold the concentration recommended by TwistDx Ltd, UK for their mix; in such case, the primer concentration used preferably is 0,5mM each. In view of the above, preferably, the concentration of components in the RPA mixture (i.e. as 2xRPA) preferably are at least 40 mM for RecA, 0.2 pM for RecF, 0.25 pM for RecO, 1 pM for RecR, 2 to 20 pM for SSB, 10 units for DNA polymerase V, 10 units for DNA polymerase, 1 pM for RuvA, lpM for RuvB, 1 pM for RuvC, and/or 20 nM for RecG; and are at least 40 nM for PriA, 40 nM for PriB, 0.2 pM for DnaT, 0.2 pM for DnaB, 0.4 pM for DnaC, 0.4 pM for DnaG, 4 pM for beta-Clamp, 1 pM for DNAX Clam loader, 1 pM for Polymerase core complex, 10 units for DNA polymerase I, and/or 4 units for DNA ligase, if present.

In a preferred embodiment, the amplifying comprises contacting said sample and/or said viral RNA with a reverse transcriptase, i.e. preferably comprises a step of reverse transcription. The reverse transcriptase is preferably selected from M-MuLV reverse transcriptase, ProtoScript II™ reverse transcriptase, and Superscript III™ reverse transcriptase, more preferably is M- MuLV reverse transcriptase. Preferably, the reverse transcription step is performed in the absence of added RNase H.

In a preferred embodiment, the incubation time for the amplifying step is of from 15 min to 60 min, preferably of from 30 min to 50 min, more preferably about 45 min, most preferably is 45 min, preferably under the conditions described herein above and/or in the Examples.

The term "Type VI Cas nuclease", also known as C2c2 Type or CasRx Cas nuclease, relates to a Cas nuclease targeting RNA, which, once being activated by a ssRNA sequence being complementary to its crRNA spacer, has unspecific RNase activity and cleaves any RNA in its vicinity. Preferably, the type VI Cas nuclease is a Casl3a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease, more preferably is a Casl3a nuclease. A type VI Cas nuclease can be isolated e.g. from Leptotrichia wadeii, Leptotrichia buccalis, Leptotrichia shahii, Ruminococcus flavefaciens, Bergeyella zoohelcum, Prevotella buccae, or Listeria seeligeri. Preferably, in particular in case step c) is performed at a temperature of 20°C to 37°C, more preferably at a temperature of about 25°C, the type VI Cas nuclease is Casl3a from Leptotrichia buccalis. Also preferably, the type VI Cas nuclease is Casl3b from Capnocytophaga canimorsus Cc5 (CcaCasl3b). Moreover, type VI Cas nucleases and expression plasmids for their production are publicly available. Preferably, the type VI Cas nuclease is produced as a His ₆ -Sumo-Cas nuclease fusion polypeptide and, more preferably, is purified by at least one of His ₆ -Affmity purification, Sumo affinity purification, and size exclusion chromatography purification. More preferably, the type VI Cas nuclease is produced as a His ₆ -Sumo-Cas nuclease fusion polypeptide and its purification comprises His ₆ -Affmity chromatography, Sumo affinity chromatography, and size exclusion chromatography, preferably in the given order. Preferably, the concentration of the Type VI Cas nuclease in the reaction mixture in step c) is of from 20 to 150 nM, preferably of from 50 nM to 100 nM, more preferably is about 90 nM.

The term "crRNA" is used herein in relation to a combined crispr RNA (crRNA) of a type VI CRISPR/Cas system. Preferably, the crRNA comprises at least 20, preferably at least 25, more preferably comprises 28 nucleotides complementary to the target sequence. As used herein, the term "complementary", if not otherwise noted, relates to at least 90%, more preferably at least 95%, still more preferably 99% complementarity. Most preferably complementarity relates to 100% complementarity over the aforementioned number of nucleotides. Means and methods for designing crRNAs are known in the art. Preferred crRNase are those disclosed in Zhang et al. (2020), ibd. Thus, preferably, in case Leptotrichia wadeii Casl3a is used and the S gene of a SARS-CoV-2 shall be targeted, the crRNA comprises the sequence of S-crRNA (5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGCAGCACCAGCUGUCCA ACCUGAAGAAG-3’, SEQ ID NO: 5), and in case the Orfla shall be targeted, the crRNA comprises the sequence of Orfla-crRNA (5’-

GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCCAACCUCUUCUGUAAU UUUUAAACUAU-3 ’ , SEQ ID NO:6).Most, preferably, in case Leptotrichia wadeii Casl3a is used and the N gene of a SARS-CoV-2 shall be targeted, the crRNA comprises the sequence of N-crRNA (5’-

GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGAACGCUGAAGCGCUGG GGGCAAAUUGU-3’, SEQ ID NO: 16), and in case the E gene shall be targeted, the crRNA comprises the sequence of E-crRNA (5’-

GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCGAAGCGCAGUAAGGA UGGCUAGUGUA-3 ’ , SEQ ID NO: 17). In a preferred embodiment, preferably in case a variant SARS-CoV-2 comprising a deletion of amino acids 69 and/or 70 of the spike polypeptide shall be detected, the crRNA comprises the sequence of crRNA HV69-70 (5 - GAUUUAGACUACCCCAAAAACGAAGGGGACUAAACUUGGUCCCAGAGACAUGU AUAGC AUGGA-3 ' (SEQ ID NO: 30), and/or the sequence of crRNA delHV69-70 (5’- GAUUUAGACUACCCCAAAAACGAAGGGGACUAAACCCAUUGGUCCCAGAGAUA GCAUGGAACC-3', SEQ ID NO:31). In a preferred embodiment, the concentration of the crRNA in the reaction mixture is of from 20 to 150 nM, preferably of from 50 nM to 100 nM, more preferably is about 90 nM.

The term "reporter RNA", in principle, relates to any polynucleotide comprising at least one pair of ribonucleotides connected via a covalent bond cleavable by a Cas RNase activity, the cleavage of which can be determined. Preferably, the reporter RNA comprises at least a first label, preferably attached towards one of the ends of said reporter RNA, the term "towards the end" relating to an attachment within 10 nucleotides from an end, preferably within 5 nucleotides from an end, more preferably at the terminal nucleotide. Further, the term "attached", as used herein, includes any type of attachment, covalent or non-covalent, which is sufficiently stable to allow detection of the association of the label and the reporter RNA or fragment thereof. Thus, preferably, the label or labels preferably is/are linked to the reporter RNA by non-covalent bonds and the two molecules have a dissociation constant of at most 10 ⁶ mo 1/1, more preferably of at most 10 ⁷ mol/1, most preferably at most 10 ⁸ mol/1. Also, preferably, the reporter RNA and the label or labels are covalently connected. More preferably, the reporter RNA comprises a first and a second label, wherein the first label is attached towards the 5' end of the reporter RNA and the second label is attached towards the 3' end of the reporter RNA. Preferably, a dye is the first label and a quencher is the second label; appropriate dye/quencher pairs are known in the art. More preferably, at least one of said first and second labels is an affinity label, i.e. a label with affinity for a binding partner; in such case, detecting cleavage of said reporter RNA preferably comprises binding of said affinity label to a solid surface. Suitable affinity pairs are known in the art, e.g. the streptavidin/biotin affinity pair. Thus, one of the first and second labels may e.g. be biotin. Also, preferably, the second label is a second affinity label non-identical to the first affinity label and/or is a detectable label, in particular a dye. More preferably, the second label is a fluorescein, preferably 6- carboxyfluorescein or fluorescein; antibodies specifically recognizing fluoresceins are available, thus said label may be detected optically or via an immunological detection method. Preferably, the second label is a chemical group specifically detected by antibodies conjugated to gold particles, as Exemplified in the lateral flow assay described herein in the Examples. Preferably, the reporter RNA has the sequence of the lateral-flow-reporter described by Zhang et al. (2020), ibd, (5 ^, -6-FAM-mArArUrGrGrCmAmArArUrGrGrCmA-Bio-3 ^, , SEQ ID NO: 7, with 6-FAM: 6-carboxyfluorescein, Bio: Biotin; rX (X=A, U, G, or C): ribonucleotides; mA: 2'-0-methyl-adenosine). In an also preferred embodiment, the reporter RNA has the sequence of the lateral-flow-reporter described by Kellner et al. (2019), Nature Protocols 14:2986, (5'-6- FAM/rUrUrUrUrUrU/3'-Bio (SEQ ID NO:24)) or 5'-TEX615-T*A*rArUG*C*-3IAbRQSp-3', SEQ ID NO:25, with TEX615:Texas Red®, * following a base indicates a phosphorothioate bond to the following nucleotide, and IAbRQSp is a Iowa Black® RQ-Sp). Preferably, the reporter RNA, in particular the reporter RNA having SEQ ID NO: 7, is present in the assay at an amount of up to 100 pmol, more preferably up to 50 pmol, still more preferably up to 20 pmol, most preferably up to 10 pmol, per assay mixture. Also preferably, the reporter RNA, in particular the reporter RNA having SEQ ID NO:7, is present in the assay at an amount of from about 10 pmol to 100 pmol, more preferably of from about 10 pmol to 50 pmol, still more preferably of from about 10 pmol to 20 pmol, most preferably of about 10 pmol, per assay mixture. As is understood by the skilled person from the description herein, the nucleotide sequence of the reporter RNA is of minor importance, since the activity to be detected is non specific RNase activity caused by the presence of an RNA hybridizing to the crRNA.

The term "detecting cleavage of a reporter RNA" relates to assessing to which extent the reporter RNA was cleaved, wherein said extent may be any fraction of from 0% to 100% of the reporter RNA present in the assay mixture. Suitable methods include all methods enabling establishing whether at least one covalent backbone bond was cleaved by an RNase activity in reporter molecules. Thus, the reporter RNA may e.g. be a mixed DNA/RNA oligonucleotide comprising ribonucleotides near the center of the molecule, such that cleavage by an RNase produces smaller fragments, which can be detected. In case the reporter RNA comprises two labels, RNase activity on such a reporter RNA causes the first label to become separated from the second label, which separation can be detected. Preferably, said detection comprises separation of the first from the second label, e.g. by diffusion. E.g., preferably, in case the reporter RNA comprises a dye and a quencher, increased radiation emission by the dye may be detected. In case the reporter RNA comprises at least one affinity label, detection of cleavage may be performed by lateral flow diffusion, in particular as described by Zhang et al (2020), ibd., and herein in the Examples. In a preferred embodiment, the ratio of signal band intensity to control band intensity is determined in such case. As is understood from the description herein, detecting cleavage of reporter RNA is detecting presence of an RNA hybridizing to the crRNA, i.e. viral RNA and/or amplified viral RNA. More preferably, detecting increased cleavage of reporter RNA compared to a negative control is detecting presence of an RNA hybridizing to the crRNA, i.e. viral RNA and/or amplified viral RNA, and therefore is detecting an RNA virus. Detection of cleavage of reporter RNA may be qualitative, semiquantitative, or quantitative; preferably, detection of cleavage of reporter RNA is qualitative or semiquantitative.

In a preferred embodiment, the incubation time in the detecting cleavage of a reporter RNA, i.e. preferably incubation time in which cleavage of the reporter time occurs, is of from 5 min to 30 min, preferably of from 7 min to 15 min, more preferably about 10 min, most preferably is 10 min, preferably under the conditions as described herein above and/or in the Examples.

Advantageously, it was found in the work underlying the present invention that detection of RNA viruses, in particular coronaviruses, is possible by a method not requiring technical means for temperature adjustment. In an aspect, the method can be performed using only two temperatures, namely the temperature of boiling water, and ambient temperature, e.g. standard temperature, or the body temperature of a mammal. This is particularly advantageous for applications in less developed countries, in which technical instrumentation may be scarce. In a further aspect, the complete method can be performed at the latter temperature. Furthermore, it was found that release of the viral RNA and its amplification can be performed in the same test tube, further simplifying the method.

The definitions made above apply mutatis mutandis to the following. Additional definitions and explanations made further below also apply for all embodiments described in this specification mutatis mutandis.

The present invention also relates to a method for detecting a target RNA and/or a target DNA in a sample of a subject, the method comprising the steps of a) contacting said sample with a Type V Cas nuclease, a Type V crRNA targeting said target DNA, a type VI Cas nuclease, a Type VI crRNA targeting said target RNA, a reporter RNA and a reporter DNA; and b) detecting cleavage of said reporter RNA, thereby detecting said target RNA; and/or detecting cleavage of said reporter DNA, thereby detecting said target DNA.

The term "target RNA", as used herein, preferably relates to a polyribonucleotide of interest, suspected or known to be present in a sample. Preferably, the target RNA comprises at least 20, more preferably at least 25, even more preferably at least 28 nucleotides. Thus, in case a longer RNA shall be detected, the target RNA may be said RNA as such, or may be a fragment thereof having the aforesaid length. In accordance, the term "at least a fragment" may relate to a subportion of an polynucleotide, but also to the full-length polynucleotide; preferably, said fragment comprises at least one nucleic acid sequence allowing specific detection of said target RNA, more preferably a specific nucleic acid sequence, even more preferably a nucleic acid sequence of at least 20 nucleotide, more preferably at least 25 nucleotides, even more preferably at least 28 nucleotides which is known or expected to be unique in said sample. Thus, preferably, the target RNA does not consist of low-complexity sequences, such as short repeat sequences. The target RNA may, in principle, be any type of RNA, such as double-stranded or single-stranded RNA, or linear or circular RNA. Preferably, the target RNA is an RNA being of diagnostic or therapeutic interest. Thus, preferably, the target RNA is at least a fragment of a genome of an RNA virus or viroid, preferably of an RNA virus. Also preferably, the target RNA is at least a fragment of an RNA of a pathogen, e.g. an RNA encoded by a pathogen as specified herein below, such as an RNA expressed from a promoter and/or one or more gene(s) of a virus, a bacterium, or a eukaryotic pathogen. Also preferably, the target RNA is at least a fragment of an endogenous RNA, i.e. an RNA expressed by cells of the subject, preferably cells known or suspected to be comprised in the sample. Endogenous RNAs are known to the skilled person and include in particular mRNAs, miRNAs, tRNAs, ribosomal RNAs (rRNAs), snRNAs, snoRNAs, and siRNAs; preferably, the endogenous RNA is an mRNA. As the skilled person understands, the target RNA may also be allele-specific, i.e. indicative of a specific allele of a gene. Also, the target RNA may be cell-type-specific, e.g. in case at least a fragment of an RNA, e.g. mRNA, expressed only by (a) certain type(s) of cell(s) is used as target RNA. Thus the target RNA may be at least a fragment of a cell-type specific RNA, e.g. a cancer- specific RNA, such as an mRNA of a cancer-specific marker. As the skilled person understands, specificity may also be achieved by a specific combination of sample and target RNA, such as testing for melanocyte markers in a blood sample, e.g. in screening for circulating melanoma cells.

The term "target DNA", as used herein, preferably relates to a polydeoxyribonucleotide of interest, suspected or known to be present in a sample or producible therefrom. The target DNA may, preferably, be any type of DNA, such as double-stranded or single-stranded DNA, or linear or circular DNA; preferably, the target DNA comprises at least 20, more preferably at least 21, even more preferably at least 24 nucleotides. Preferably, the target DNA is at least a fragment of a DNA of a cell or virus, e.g. of a genomic DNA, an organellar DNA, a plasmid, and the like. More preferably, the target DNA is a reverse transcript of an RNA, preferably an RNA as specified herein above. Thus, the above definitions of the target RNA apply, mutatis mutandis, to the target DNA as well. Preferably, the target DNA is at least a fragment of a a reverse transcript of an RNA comprised in said sample, the term "RNA comprised in said sample" including any and all RNA molecules comprised in the sample, including an RNA optionally added to the sample before, during, or after extraction (spiking). More preferably, the RNA comprised in the sample is an RNA according to the specification of the target RNA herein above. More preferably, the target DNA is a reverse transcript of an endogenous RNA as specified herein above, more preferably of an mRNA, preferably of a housekeeping gene of the subject. Preferably, the target DNA is a control DNA, in particular a control for sample extraction, sample reverse transcription, and/or absence of RNases. The term "pathogen" is understood by the skilled person and includes, preferably, any and all organisms, viruses, and viroids causing disease in a non-identical organism. Thus, the pathogen preferably is a bacteriophage, a plant pathogen, a pathogen of livestock, laboratory, or companion animal, more preferably of a mammal, most preferably of a human.

The term "Type V Cas nuclease", also known as C2cl Type or Cpfl Cas nuclease, relates to a Cas nuclease targeting DNA, preferably ssDNA, which, once being activated by a DNA sequence being complementary to its Type V crRNA spacer, has unspecific DNase activity and cleaves any DNA, preferably ssDNA, in its vicinity. Preferably, the type V Cas nuclease is a Cas 12a nuclease, more preferably is Cas 12a from Lachnospiraceae bacterium ND2006 (LbCasl2a)(Chen et al. (2018), Science 360(6387):436). A type V Cas nuclease can also be isolated e.g. from Francisella novicida, Acidaminococcus sp., other Lachnospiraceae sp., Alicyclobacillus acidoterrestris, Acidaminococcus sp. BV3L6, or Prevotella sp. Preferably, in particular in case step a) is performed at a temperature of 20°C to 42°C, more preferably at a temperature of about 25°C, the type V Cas nuclease is LbCasl2a. Moreover, type V Cas nucleases and expression plasmids for their production are publicly available. Preferably, the type V Cas nuclease is produced as a His ₆ -Sumo-Cas nuclease fusion polypeptide and, more preferably, is purified by at least one of His ₆ - Affinity purification, Sumo affinity purification, and size exclusion chromatography purification. More preferably, the type V Cas nuclease is produced as a His ₆ -Sumo-Cas nuclease fusion polypeptide and its purification comprises His ₆ - Affmity chromatography, Sumo affinity chromatography, and size exclusion chromatography, preferably in the given order.

As specified herein above, the term "crRNA", unless specified otherwise, relates to a combined crispr RNA (crRNA) of a type VI CRISPR/Cas system, i.e. a Type VI crRNA. In accordance, the term "Type V crRNA" is used herein in relation to a combined crispr RNA (crRNA) of a type V CRISPR/Cas system. As the skilled person is aware of, a Type V crRNA preferably comprises a protospacer adjacent motif (PAM) sequence. Preferably, the Type V crRNA comprises at least 20, preferably at least 21, more preferably comprises 24 nucleotides complementary to the target sequence. Means and methods for designing Type V crRNAs are known in the art. Thus, preferably, in case Casl2 is used and a reverse transcript of an RNaseP mRNA is the target DNA, the Type V crRNA comprises the sequence of SEQ ID NO:23. The term "reporter DNA", preferably, relates to any DNA polynucleotide comprising at least one pair of deoxyribonucleotides connected via a covalent bond cleavable by a Casl2 DNase activity, the cleavage of which can be determined. Preferably, the reporter DNA comprises at least one label, preferably attached towards one of the ends of said reporter DNA, the terms "towards the end" and "attached" having, mutatis mutandis, the meaning as specified herein above in the context of the reporter RNA. Thus, preferably, the label or labels preferably is/are linked to the reporter DNA by non-covalent bonds and the two molecules have a dissociation constant of at most 10 ⁶ mol/1, more preferably of at most 10 ⁷ mol/1, most preferably at most 10 ⁸ mol/1. Also, preferably, the reporter DNA and the label or labels are covalently connected. As used herein, the terms first and second label are preferably used in connection with the reporter RNA as specified herein above; thus, in the context of the target DNA, the terms third and second label are preferably used. Thus, preferably, the reporter DNA comprises a third and a fourth label, wherein the third label is attached towards the 5' end of the reporter DNA and the fourth label is attached towards the 3' end of the reporter DNA. Preferably, a dye is the third label and a quencher is the fourth label; appropriate dye/quencher pairs are known in the art. More preferably, at least one of said third and fourth labels is an affinity label, i.e. a label with affinity for a binding partner; in such case, detecting cleavage of said reporter DNA preferably comprises binding of said affinity label to a solid surface. Suitable affinity pairs are known in the art, e.g. the streptavidin/biotin affinity pair. Thus, one of the third and fourth labels may e.g. be biotin. Also, preferably, the fourth label is a fourth affinity label non-identical to the third affinity label and/or is a detectable label, in particular a dye. More preferably, the fourth label is a digoxigenin; antibodies specifically recognizing digoxigenin are available, thus said label may be detected optically or via an immunological detection method. Preferably, the fourth label is a chemical group specifically detected by antibodies conjugated to gold particles, as Exemplified in the lateral flow assay described herein in the Examples. Preferably, the reporter DNA has the sequence of SEQ ID NO: 18, which may be provided e.g. as reporter DNA according to any one of SEQ ID NOS: 19-22. Preferably, the first to fourth labels, as referred to herein, are mutually non-identical. It may, however, also be envisaged that the reporter RNA and the reporter DNA have the same affinity label, e.g. fluorescein, e.g. in applications such as lateral flow detection.

As the skilled person understands, since the nuclease activities of Type V and Type VI Cas nucleases are, once activated, non-sequence specific, the reporter RNA and/or reporter DNA, e.g. as specified herein, may in principle be used for detection of any target RNA and/or target DNA.

The term "subject", preferably relates to a living organism, more preferably a multicellular organism. The subject preferably is a plant, more preferably a crop plant. More preferably, the subject is a vertebrate, still more preferably a mammal, even more preferably a livestock, laboratory, or companion animal, most preferably is a human.

The method for detecting a target RNA and/or a target DNA preferably is an in vitro method. Moreover, it may comprise steps in addition to those specifically mentioned; e.g. a further step preferably preceding step a) may relate to extracting and/or purifying RNA and/or DNA from said sample; also, the method may be comprised in a method for detecting an RNA virus in a sample as specified elsewhere herein, in particular by using an RNA from the RNA virus as target RNA, and using e.g. a reverse transcript of a housekeeping mRNA of the subject as the target DNA.

Thus, the present invention preferably relates to a method for detecting an RNA virus in a sample, comprising the steps of i) releasing RNA from said sample; ii) amplifying at least parts of the RNA comprised in said sample via a DNA intermediate; iii) detecting a target RNA and a target DNA in the reaction mixture of step ii) according to the method for detecting a target RNA and/or a target DNA according to the present invention; and iv) thereby detecting said RNA virus.

The method for detecting a target RNA and/or a target DNA may comprise detecting a target RNA, detecting a target DNA, or detecting a target RNA and a target DNA, preferably comprises detecting a target RNA and a target DNA. In view of the description herein above, the skilled person understands that, in relation to the polynucleotides comprised in the sample, said method preferably is a method for detecting (i) two non-identical RNAs of interest or (ii) an RNA and a DNA of interest. In accordance, the method for detecting a target RNA and/or a target DNA is applicable in each case where detection of two non-identical RNAs or of an RNA and a DNA is desirable. Preferably, in the method for detecting a target RNA and/or a target DNA, at least one, preferably one, of the target RNA and target DNA, preferably the target DNA, is a control polynucleotide, in particular a control for sample extraction, sample reverse transcription, and/or absence of RNases. Thus, preferably, the target RNA or the target DNA is or is derived from a polynucleotide known to be present in the sample, more preferably is an RNA present in abundance in at least one cell type known to be present in the sample. Preferably, the target RNA or the target DNA is or is derived from an mRNA of a housekeeping gene of at least one cell type known to be present in the sample, more preferably of essentially all cell types suspected to be present in said sample. Most preferably the target RNA or the target DNA is or is derived from an mRNA of a general housekeeping gene of essentially all nucleated cells of said subject, such as RNaseP mRNA in a mammal, in particular a human.

The method for detecting a target RNA and/or a target DNA may comprise additional steps of extracting and/or purifying polynucleotides from the sample, preferably as specified herein above; the method may also comprise one or more steps of concentrating or diluting polynucleotides comprised in the sample.

In case the polynucleotides of interest are known to be present in the sample in high abundance, the method for detecting a target RNA and/or a target DNA may be applied in the absence of an amplification step. Preferably, in particular in case at least one polynucleotide of interest is known or suspected to be present at low abundance in the sample, polynucleotides comprised in the sample are amplified. Said amplification may be non-sequence specific, e.g. by using non-sequence specific primers such as oligo(dT) primers, preferably is sequence specific for at least one polynucleotide of interest. Preferably, amplification is effected as specified herein above. Thus, preferably, amplification comprises at least one step of creating a DNA intermediate of at least one RNA of interest or fragment thereof, e.g. by reverse transcription. Preferably, this step is used for at least one RNA in case two non-identical RNAs shall be detected. In a further step, RNA may be produced from said DNA, e.g. by T7-transcription, preferably as specified herein above and/or in the Examples. As the skilled person understands, it may be sufficient to amplify a fragment of a polynucleotide of interest such as to produce or amplify a target DNA and/or a target RNA.

The method for detecting a target RNA and/or a target DNA, as is understood by the skilled person, is a multiplex method in that it allows detection of a target RNA and a target DNA, i.e. of two polynucleotides of interest. The method may, however, be further multiplexed: In an embodiment, the Type V crRNA and/or Type VI crRNA may be selected as to be specific for a generic group of target RNAs or target DNAs; as a non-limiting example, a crRNA may be selected to bind to a conserved nucleic acid sequence comprised in all SARS viruses; as will be understood, in such case, detecting cleavage of the reporter DNA or reporter RNA is indicative of at least one member of the generic group being present. Similarly, the reporter DNA and/or reporter RNA may be selected such as to be indicative of a generic group of polynucleotides. In a further embodiment, step a) may comprise contacting said sample with a multitude of Type V crRNAs and/or Type VI crRNAs; in such case, detecting cleavage of said reporter RNA and/or of said reporter DNA would be indicative that a target of at least one of said Type V crRNAs and/or Type VI crRNAs was present in the sample. Thus, by way of example, the method may be used to test a sample for the presence of at least one member of a predefined set of viruses and for the presence of at least one member of a predefined set of bacteria, or to test a sample for the presence of at least one member of two predefined sets of viruses, e.g. SARS viruses and influenza viruses.

The term "detecting cleavage" has been specified herein above in the context of a reporter RNA; the same applies mutatis mutandis to reporter DNAs.

The present invention also relates to a type V Cas nuclease and/or a type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject, preferably according to the method for detecting a target RNA and/or a target DNA or a method for detecting an RNA virus in a sample according to the present invention.

The present invention also relates to a method for diagnosing an infection with an RNA virus in a subject, comprising a) detecting an RNA virus in a sample of said subject by a method of the present invention; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.

The present invention further relates to a use of a type VI Cas nuclease, preferably a Cas 13a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease, for detecting an RNA virus, preferably according to the method for detecting an RNA virus described herein above. The present invention also relates to a use of a type VI Cas nuclease, preferably a Casl3a nuclease, a Cas 13b nuclease, a Cas 13c nuclease, or a Cas 13d nuclease, for the manufacture of a diagnostic composition or device for the detection of an RNA Virus, preferably according to the method for detecting an RNA virus described herein above.

Furthermore, the present invention relates to a method for diagnosing an infection with an RNA virus in a subject, comprising a) detecting an RNA virus in a sample of said subject by the method for detecting an RNA virus described herein above; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.

The term "diagnosing", as used herein, means assessing whether a subject suffers from an RNA virus infection, or not. As will be understood by those skilled in the art, such an assessment is usually not intended to be correct for all (i.e. 100%) of the subjects to be identified. The term, however, requires that preferably a statistically significant portion of subjects can be identified (e.g. a cohort in a cohort study). Whether a portion is statistically significant can be determined without further ado by the person skilled in the art using various well known statistic evaluation tools, e.g., determination of confidence intervals, p-value determination, Student's t-test, Mann- Whitney test etc. Details are found in Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York 1983. Preferred confidence intervals are at least 90%, at least 95%, at least 97%, at least 98% or at least 99 %. The p-values are, preferably, 0.1, 0.05, 0.01, 0.005, or 0.0001. More preferably, at least 60%, at least 70%, at least 80% or at least 90% of the subjects of a population can be properly identified by the method of the present invention. Diagnosing according to the present invention may include applications of the method in monitoring, confirmation, and sub-classification of the RNA virus infection.

The present invention also relates to a type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject, preferably according to the method for detecting an RNA virus described herein above.

In a preferred embodiment, the present invention also relates to a method for detecting a variant of a SARS-CoV virus in a sample, said method comprising the steps of a) releasing SARS-CoV RNA from said sample; b) amplifying at least parts of the SARS-CoV RNA comprised in said sample; c) contacting the amplified SARS-CoV RNA of step a) with a Type VI Cas nuclease, a reporter RNA, and (i) with a crRNA comprising the sequence of SEQ ID NO:30, and, spatially separated from (i), (ii) with a crRNA comprising the sequence of SEQ ID NO:31; and d) detecting cleavage of said reporter RNA in (i) and (ii), thereby detecting said RNA virus.

The aforesaid method, preferably, is an in vitro method, and may comprise steps in addition to those specified above, in particular steps as specified herein above for the other methods.

In a further preferred embodiment, the present invention relates to a polynucleotide comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO:30 or 31 or a sequence at least 90% identical thereto.

The term “polynucleotide” is known to the skilled person. As used herein, the term preferably includes nucleic acid molecules comprising or consisting of a nucleic acid sequence or nucleic acid sequences as specified herein. The polynucleotide of the present invention shall be provided, preferably, either as an isolated polynucleotide (i.e. isolated from its natural context) or in genetically modified form. The polynucleotide, preferably, is DNA, including cDNA, or is RNA. The term encompasses single as well as double stranded polynucleotides. Preferably, the polynucleotide is a chimeric molecule, i.e., preferably, comprises at least one nucleic acid sequence, preferably of at least 5 bp, more preferably at least 10 bp, heterologous to the residual nucleic acid sequences. Moreover, preferably, comprised are also chemically modified polynucleotides including naturally occurring modified polynucleotides such as glycosylated or methylated polynucleotides or artificial modified one such as biotinylated polynucleotides. The term polynucleotide, preferably, includes variants of the specifically indicated polynucleotides. More preferably, the term polynucleotide relates to the specific polynucleotides indicated. Thus, polynucleotide variants may be variants of a polynucleotide related to herein comprising a nucleic acid sequence characterized in that the sequence can be derived from the aforementioned specific nucleic acid sequence by at least one nucleotide substitution, addition and/or deletion, wherein the polynucleotide variant shall preferably have the activity of being a crRNA. Preferably, said polynucleotide has at least 90%, more preferably at least 95%, still more preferably at least 97%, even more preferably at least 98%, most preferably at least 99% identity with the sequence of SEQ ID NO:30 or 31. The degree of identity (e.g. expressed as "%identity") between two biological sequences, preferably DNA, RNA, or amino acid sequences, can be determined by algorithms well known in the art. Preferably, the degree of identity is determined by comparing two optimally aligned sequences over a comparison window, where the fragment of sequence in the comparison window may comprise additions or deletions (e.g., gaps or overhangs) as compared to the sequence it is compared to for optimal alignment. The percentage is calculated by determining, preferably over the whole length of the polynucleotide or polypeptide, the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981), by the homology alignment algorithm of Needleman and Wunsch (1970), by the search for similarity method of Pearson and Lipman (1988), by computerized implementations of these algorithms (GAP, BESTFIT, BLAST, PASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI), or by visual inspection. Given that two sequences have been identified for comparison, GAP and BESTFIT are preferably employed to determine their optimal alignment and, thus, the degree of identity. Preferably, the default values of 5.00 for gap weight and 0.30 for gap weight length are used.

In a further preferred embodiment, the present invention relates to a kit comprising the polynucleotide of the present invention in a housing.

The term “kit”, as used herein, preferably refers to a collection of the aforementioned compound(s), means or reagents, which may or may not be packaged together. Preferably, the polynucleotide is comprised in a composition, preferably as a ready-to-use solution, in the kit. The housing may be any kind of container and/or packaging deemed appropriate by the skilled person. The components of the kit may be comprised by separate vials (i.e. as a kit of separate parts) or provided in a single vial. Preferably, the housing is adapted such that the components of the kit may be transported together as a unit. Moreover, it is to be understood that the kit, preferably, is to be used for practicing the methods referred to elsewhere herein. It is, preferably, envisaged that all components are provided in a ready-to-use manner for practicing the methods referred to above. Further, the kit, preferably, contains instructions for carrying out said methods. The instructions can be provided by a user's manual in paper or electronic form. Preferably, the kit comprises a diluent; appropriate diluents are known to the skilled person. Also preferably, the kit further comprises at least one of a Type VI Cas nuclease and a reporter RNA.

In view of the above, the following embodiments are specifically envisaged:

1. A method for detecting an RNA virus in a sample, preferably a saliva or sputum sample, comprising the steps of a) releasing viral RNA from said sample; b) amplifying at least parts of the viral RNA comprised in said sample; c) contacting the amplified viral RNA of step a) with a Type VI Cas nuclease, a crRNA, and a reporter RNA; and d) detecting cleavage of said reporter RNA, thereby detecting said RNA virus.

2. The method of embodiment 1, wherein steps a) and b) are performed in the same reaction tube.

3. The method of embodiment 1 or 2, wherein said step a) comprises contacting said sample with a surfactant, preferably a non-ionic surfactant.

4. The method of any one of embodiments 1 to 3, wherein said step a) comprises contacting said sample with said surfactant at a concentration of from 0.05% (w/v) to 5% (w/v).

5. The method of any one of embodiments 1 to 4, wherein steps b) to c), preferably all steps, are performed at a temperature of from 20°C to 45°C.

6. The method of any one of embodiments 1 to 5, wherein steps b) to c), preferably all steps, are performed at a temperature of 20°C to 37°C.

7. The method of any one of embodiments 1 to 6, wherein steps b) to c), preferably all steps, are performed at a temperature of about 25°C.

8. The method of any one of embodiments 1 to 7, wherein said step a) comprises contacting the viral RNA with a primer and an RNA polymerase, preferably an RNA-dependent RNA polymerase.

9. The method of any one of embodiments 1 to 8, wherein said step b) comprises amplifying said viral RNA by reverse-transcriptase recombinase polymerase amplification (RT-RPA), preferably comprising contacting said viral RNA with MuLV reverse transcriptase.

10. The method of any one of embodiments 1 to 9, wherein said RNA virus is SARS-CoV-2, SARS-CoV-1, or MERS.

11. The method of any one of embodiments 1 to 10, wherein said reporter RNA comprises at least a first label, preferably attached towards one of the ends of said reporter RNA. 12. The method of any one of embodiments 1 to 11, wherein said reporter RNA comprises a first and a second label, wherein the first label is attached towards the 5' end of the reporter RNA and the second label is attached towards the 3' end of the reporter RNA.

13. The method of any one of embodiments 1 to 12, wherein at least one of said first and second label is an affinity label.

14. The method of any one of embodiments 1 to 13, wherein detecting cleavage of said reporter RNA comprises detecting separation of the first label from the second label.

15. The method of any one of embodiments 1 to 14, wherein detecting cleavage of said reporter RNA comprises binding of said affinity label to a solid surface.

16. The method of any one of embodiments 1 to 15, wherein said type VI Cas nuclease is a Casl3a nuclease, a Cas 13b nuclease, a Casl3c nuclease, or a Cas 13d nuclease, preferably is a Casl3a nuclease, more preferably a Casl3a nuclease from Leptotrichia wadeii (LwaCasl3a) or from Leptotrichia buccalis (LbuCasl3a).

17. The method of any one of embodiments 10 to 16, wherein said crRNA binds specifically within the Orfla open reading frame or in the S open reading frame.

18. The method of any one of embodiments 1 to 17, wherein in steps a) and b), the viral RNA is further contacted to an inhibitor of RNases A, B, C, 1, and Tl.

19. Use of a type VI Cas nuclease, preferably a Casl3a nuclease, a Casl3b nuclease, a Casl3c nuclease, or a Casl3d nuclease, for detecting an RNA virus, preferably according to the method of any one of embodiment s 1 to 18.

20. A type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject, preferably according to the method according to any one of embodiments 1 to 19.

21. The type VI Cas nuclease for use of embodiment 20, wherein said RNA virus is a SARS- CoV-2, SARS-CoV-1, or MERS.

22. A method for diagnosing an infection with an RNA virus in a subject, comprising a) detecting an RNA virus in a sample of said subject by the method of any one of embodiments 1 to 19; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.

23. A method for detecting a target RNA and/or a target DNA in a sample of a subject, the method comprising the steps of a) contacting said sample with a Type V Cas nuclease, a Type V crRNA targeting said target DNA, a type VI Cas nuclease, a Type VI crRNA targeting said target RNA, a reporter RNA and a reporter DNA; and b) detecting cleavage of said reporter RNA, thereby detecting said target RNA; and/or detecting cleavage of said reporter DNA, thereby detecting said target DNA.

24. The method of embodiment 23, wherein said target RNA is at least a fragment of a genome of an RNA virus, of a pathogen RNA, or of an endogenous RNA of said subject, preferably an mRNA.

25. The method of embodiment 23 or 24, wherein said target DNA is at least a fragment of a DNA comprised in said sample of said subject.

26. The method of any one of embodiments 23 to 25, wherein said target DNA is a reverse transcript of an RNA comprised in said sample, preferably of an endogenous RNA, more preferably of an RNA of a housekeeping gene of said subject.

27. The method of any one of embodiments 23 to 26, wherein said method further comprises extracting RNA and/or DNA from said sample before step a).

28. The method of any one of embodiments 23 to 27, wherein said target DNA is a control DNA for controlling extraction.

29. The method of any one of embodiments 23 to 28, wherein said target DNA is a control DNA produced from said sample via reverse transcription and is for controlling extraction, reverse transcription and/or absence of RNases.

30. The method of any one of embodiments 23 to 29, wherein said target RNA is at least a fragment of a genome of an RNA virus and wherein said target DNA is a reverse transcript of an endogenous transcript of said subject, preferably of a transcript of a housekeeping gene of said subject.

31. The method of any one of embodiments 23 to 30, wherein said reporter RNA is a single- stranded RNA.

32. The method of any one of embodiments 23 to 31, wherein said reporter RNA comprises a first and a second label, wherein the first label is attached towards the 5' end of the reporter RNA and the second label is attached towards the 3' end of the reporter RNA.

33. The method of any one of embodiments 23 to 32, wherein said reporter DNA is a single- stranded DNA.

34. The method of any one of embodiments 23 to 33, wherein said reporter DNA comprises a third and a fourth label, wherein the third label is attached towards the 5' end of the reporter DNA and the fourth label is attached towards the 3' end of the reporter DNA.

35. The method of any one of embodiments 23 to 34, wherein at least one of said first and second labels is an affinity label and/or wherein at least one of said third and fourth labels is an affinity label. 36. The method of any one of embodiments 23 to 35, wherein at least one of said first and second labels is a quencher and/or wherein at least one of said third and fourth labels is a quencher.

37. The method of any one of embodiments 23 to 36, wherein detecting cleavage of said reporter RNA comprises detecting separation of the first label from the second label and/or wherein detecting cleavage of said reporter DNA comprises detecting separation of the second label from the fourth label.

38. The method of any one of embodiments 23 to 37, wherein the first to fourth labels are mutually non-identical.

39. The method of any one of embodiments 23 to 38, wherein said type VI Cas nuclease is a Casl3a nuclease, a Cas 13b nuclease, a Casl3c nuclease, or a Cas 13d nuclease, preferably is a Casl3a nuclease, more preferably a Casl3a nuclease from Leptotrichia wadeii (LwaCasl3a) or from Leptotrichia buccalis (LbuCasl3a) or from Capnocytophaga canimorsus Cc5 (CcaCasl3b).

40. The method of any one of embodiments 23 to 39, wherein said type V Cas nuclease is a Casl2a nuclease, preferably from Lachnospiraceae bacterium ND2006 Casl2a (LbCasl2a) or Acidaminococcus sp. BV3L6 (AsCasl2a) or a Casl2b nuclease, preferably from Alicy clobacillus acidiphilus (AaCasl2b).

41. A method for detecting an RNA virus in a sample, comprising the steps of i) releasing RNA from said sample; ii) amplifying at least parts of the RNA comprised in said sample via a DNA intermediate; iii) detecting a target RNA and a target DNA in the reaction mixture of step ii) according to the method according to any one of embodiments 23 to 40; and iv) thereby detecting said RNA virus.

42. The method of embodiment 41, wherein said target RNA is an RNA comprised in the genome of the RNA virus.

43. The method of embodiment 41 or 42, wherein said Type VI crRNA binds specifically within the Orfla open reading frame or in the S open reading frame.

44. The method of any one of embodiments 41 to 43, wherein said target DNA is a reverse transcript of a transcript of said subject, preferably an endogenous transcript, more preferably of a transcript of a housekeeping gene of said subject, most preferably of an RNase P transcript.

45. The method of any one of embodiments 41 to 44, wherein step ii) comprises contacting the viral RNA with a primer and an RNA polymerase, preferably an RNA-dependent RNA polymerase. 46. The method of any one of embodiments 41 to 45, wherein said step ii) comprises amplifying said viral RNA by reverse-transcriptase recombinase polymerase amplification (RT-RPA).

47. The method of any one of embodiments 41 to 46, wherein said RNA virus is SARS-CoV- 2, SARS-CoV-1, or MERS.

48. A type V Cas nuclease and/or a type VI Cas nuclease for use in diagnosing an infection with an RNA virus in a subject, preferably according to the method according to any one of embodiments 23 to 47.

49. A method for diagnosing an infection with an RNA virus in a subject, comprising a) detecting an RNA virus in a sample of said subject by a method of any one of embodiments 23 to 47; and b) in case an RNA virus is detected in step a), diagnosing an infection with an RNA virus in said subject.

50. The method of any one of embodiments 1-18 or 22-46, wherein said step b) or ii) comprises amplifying said viral RNA by reverse-transcriptase recombinase polymerase amplification (RT-RPA) and

51. The method embodiment 50, wherein said RT-RPA is performed at at least nominal twofold RPA reaction mixture concentration, preferably at at nominal twofold or threefold, preferably at twofold, concentration.

52. The method of any one of embodiments 1-18, 22-46, 50, and 51, wherein said step b) is performed for about 45 min.

53. The method of any one of embodiments 1-18, 22-46, and 50-52, wherein said step b) comprises contacting said viral RNA with M-MuLV reverse transcriptase.

54. The method of any one of embodiments 1-18, 22-46, and 50-53, wherein said sample is heated during step a), preferably in a DNA extraction buffer.

55. The method of embodiment 54, wherein said heating comprises heating to at least 90°C for about 5 min.

56. The method of any one of embodiments 1-18, 22-46, and 50-55, wherein the concentration of the Type VI Cas nuclease and/ or the crRNA in the reaction mixture in step c) is of from 50 nM to 100 nM, more preferably is about 90 nM.

57. The method of any one of embodiments 1-18, 22-46, and 50-56, wherein step c) or iii) is performed for of from 7 min to 15 min, preferably about 10 min.

58. The method of any one of embodiments 1-18, 22-46, and 50-57, wherein said sample is a gurgling sample, a nasal swab sample, or a sputum sample. 59. The method of any one of embodiments 1-18, 22-46, and 50-58, wherein said crRNA comprises, preferably consists of, the sequence of SEQ ID NO:5, 6, 16, 17, 30, or 31.

60. The method of any one of embodiments 1-18, 22-46, and 50-59, wherein said method comprises step c) contacting (i) a first aliquot of the amplified viral RNA of step a) with a Type VI Cas nuclease, a crRNA comprising the sequence of SEQ ID NO: 31, and a reporter RNA, and (ii) a second aliquot of the amplified viral RNA of step a) with a Type VI Cas nuclease, a crRNA comprising the sequence of SEQ ID NO:30, and a reporter RNA, wherein said contacting of (i) is performed spatially separated from the contacting of (ii).

61. A method for detecting a variant of a SARS-CoV virus in a sample, said method comprising the steps of a) releasing SARS-CoV RNA from said sample; b) amplifying at least parts of the SARS-CoV RNA comprised in said sample; c) contacting the amplified SARS-CoV RNA of step a) with a Type VI Cas nuclease, a reporter RNA, and (i) with a crRNA comprising the sequence of SEQ ID NO:30, and, spatially separated from (i), (ii) with crRNA comprising the sequence of SEQ ID NO:31; and d) detecting cleavage of said reporter RNA in (i) and (ii), thereby detecting said RNA virus.

62. The method of embodiment 61, wherein said method is a method of identifying said SARS- CoV virus as a variant comprising a deletion of amino acids 69 and/or 70 of the spike polypeptide in case cleavage of the reporter RNA is detected in (ii) but not (i).

63. The method of embodiment 61, wherein said method is a method of identifying said SARS- CoV virus as a variant not comprising a deletion of amino acids 69 and/or 70 of the spike polypeptide in case cleavage of the reporter RNA is detected in (i) but not (ii).

64. A polynucleotide comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO:30 or 31 or a sequence at least 90% identical thereto.

65. The polynucleotide of embodiment 64, wherein said polynucleotide comprises, preferably consists of, the nucleic acid sequence of SEQ ID NO:30 or 31.

66. The polynucleotide of embodiment 64 or 65, wherein said polynucleotide is a ribonucleotide, or is a polynucleotide encoding said nucleic acid sequence.

67. A kit comprising the polynucleotide according to any one of embodiments 64-66 in a housing.

68. The kit of embodiment 67, wherein said kit further comprises at least one of a Type VI Cas nuclease and a reporter RNA. All references cited in this specification are herewith incorporated by reference with respect to their entire disclosure content and the disclosure content specifically mentioned in this specification.

Figure Legends

Fig. 1: Schematic representation of the improved assay protocol.

Fig. 2: Results of a SHERLOCK assay targeting SARS-CoV-2 Orfla, modified according to the invention; 5 copies / mΐ of input can be detected.

Fig. 3: Results of a SHERLOCK assay targeting the SARS-CoV-2 S gene, modified according to the invention; 0.5 copies / mΐ of input can be detected.

Fig. 4: Comparison of Superase as RNase inhibitor to murine RNase inhibitor in a SHERLOCK assay; SUPERase reduces background and improves differentiation.

Fig. 5: Optimization of reporter RNA amount; down to 10 pmol can be used without loss of sensitivity.

Fig. 6: comparison of the results of prior art (qRT-PCR) testing for SARS-CoV-2 to the assay of the present invention; results are identical, except for samples close to the detection limit.

Fig. 7: Schematic representation of a Type VI/Type V Cas multiplex assay, exemplified as a fluorescence assay; dsDNA and RNA may be produced e.g. from RNA in a sample, e.g. by RPA as described in the Examples. Target RNA activates Casl3, which in turn cleaves reporter RNA; target DNA activates Cas 12, which in turn cleaves reporter DNA; cleavage of the reporter separates the quencher from the respective fluorophore.

Fig. 8: Specificity of detection by Casl2 and Casl3: A) Fluorescence of TEX615 reporter RNA (SEQ ID NO:26) overtime after incubation with Cas 12, Cas 13, Casl2 crRNA, Casl3 crRNA, and reporter RNA ("multiplex") or with Cas 12, Casl2 crRNA, and reporter RNA ("Casl2") or with Cas 13, Casl3 crRNA, and reporter RNA ("Casl3") or with Casl2 crRNA, Casl3 crRNA, and reporter RNA ("No Cas"); B) Fluorescence of FAM reporter DNA (SEQ ID NO: 19) over time after incubation with Cas 12, Cas 13, Casl2 crRNA, Casl3 crRNA, and reporter DNA ("multiplex") or with Cas 12, Casl2 crRNA, and reporter DNA ("Casl2") or with Cas 13, Casl3 crRNA, and reporter DNA ("Cas 13") or with Cas 12 crRNA, Cas 13 crRNA, and reporter DNA ("No Cas").

Fig. 9: Expected result of lateral flow assays with HybriDetect 2T sticks: for RNA extraction and SARS-CoV2, + indicates the result being positive, i.e. successful RNA extraction and presence of SARS-CoV-2, respectively.

Fig. 10: Flow diagram of atypical testing procedure; approximate time required: sample taking ca. 5 min, RNA extraction ca 2 h (kit) or ca 5 min (heating); RT-RPA ca 25-45 min, T7- polymerase reaction and Cas 13 cleavage ca. 10-30 min, lateral flow detection ca. 2 min.

Fig. 11 : Result of the lateral flow assay with detection of SARS-CoV-2 directly after lysing the sample by heat treatment with QuickExtract DNA Extraction solution and Luna Cell Ready Lysis Buffer; y-axis: ratio of the intensity of the signal band/intensity of the control band (band intensity ratio); NTC: no template control.

Fig. 12: A) Effect of RNase inhibitor addition before heat extraction of samples; B) Comparison of reverse transcriptase (RT) enzymes in the presence or absence of RNase H. M-MuLV showed the best sensitivity (5-2.5 cp/mΐ) in comparison to ProtoScript II or Superscript III, while the addition of RNase H lead to an improvement for Superscript III only. For each copy number, the order of columns is as indicated in the Fig. from top to bottom.

Fig. 13: Comparison of different RPA reaction mix concentrations in detection of SARS-CoV- 2 on a false-negative sample (A) and on several samples close to the limit of detection (LOD, B).

Fig. 14: Optimization of reaction time (A) and crRNA concentration (B) for the Casl3 detection step.

Fig. 15: Comparison of purified RNA (A, B) and heat-treated (C, D) swab samples (A, C) or gurgle water (GW) samples (B, D) as sample material in ADESSO and qRT-PCT in a clinical context; x-axis: ct-value of samples as determined by qRT-PCR, Y-axis: band intensity ratio of said samples.

Fig. 16: Detection of SARS-CoV-2 variants; A) Schematic overview of mutations in the SARS- CoV-2 spike protein in mutants B.1.1.7 (UK variant) and B.1.351 (South Africa Variant); B) Positioning of crRNA HV69-70 and crRNA delHV69-70 in the spike protein sequences of SARS-CoV-2 Wuhan ("wildtype" strain) and the B.1.1.7 variant; C) Schematic representation of positioning of T7-primers in the three clinical samples of the B.1.351 variant.

The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.

Example 1: Improvements of SHERLOCK assays for SARS-CoV-2

The assay for SARS-CoV-2 was performed essentially by the assay proposed by Zhang et al. (2020), cited above, with the following modifications: step (a) lyse patient material directly to liberate RNA: add TritonX to 0.2% final & boil (5 min); step (b) isothermal amplification of viral RNA: add 1,8 pL of patient material to pre-made tube with reagents for reverse transcription and isothermal amplification of viral RNA (25 min); step (c) guide-specific casl3 binding and reporter cleavage: add 1 pL from previous reaction; T7 pol produce RNA that can be detected by Casl3: reporter guide: 5’-/56- FAM/mArArUrGrGrCmAmArArUrGrGrCmA/3Bio/-3’ (SEQ ID NO:7) (30min); step (e) lateral flow readout (dip - strip): anti-bio and anti-fluor antibodies (2 min).

Release and amplification of viral RNA were performed in the same test tube (Fig. 1); SUPERase inhibitor (ThermoFisher Scientific cat# AM2694) was used as RNase inhibitor, and MuLV was found to be a better reverse transcriptase than ProtoScript (Fig. 4).

The sensitivity of the improved assay is at 5 copies of viral RNA/ pi if the Orfla gene is targeted, and is at 0.5 copies of viral RNA/ pi if the S gene is targeted. This compares to 100 and 10 copies, respectively, for the method of Zhang et al.

When releasing is achieved by the non-ionic surfactant Oleth-8, the non-ionic surfactant can be used as a formulation commercialized by Lucigen (QuickExtract DNA Extraction Solution cat# QE09050) or NEB (Luna® Cell Ready Lysis Module #E3032). Example 2: Optimization of reporter RNA amount

As shown in Fig. 5, the amount of reporter RNA per assay can be reduced to 10 pmol without loss of sensitivity. This compares to 200 pmol according to Zhang et al. (2020).

Example 2.1: Comparison to gold standard in clinical samples

The improved assay was compared to results obtained by the present gold standard method (qRT-PCR) in clinical samples. The results were found to be identical, except for two samples close to the detection limit (Fig. 6).

Example 3 : Multiplex detection by fluorescence

In this example, the presence of SARS-CoV2 virus (S gene) and human RNAseP RNAs were detected at the same time. Casl3 and its crRNA, specific for S, detected the RNA produced by T7 polymerase from the amplicon produced during RPA amplification. Casl3 then was activated and cleaved an ssRNA reporter, with subsequent production of TEX615 fluorescent signal. Casl2 and its crRNA, specific for RNAseP, detected directly the dsDNA amplicon resulting from RPA amplification of RNasP mRNA. Upon recognition, Casl2 was activated and cleaved an ssDNA reporter, resulting in a FAM fluorescent signal. The Type V crRNA had the sequence 5'-rUrArA rUrUrU rCrUrA rCrUrA rArGrU rGrUrA rGrArU rGrArC rCrUrG rCrGrA rGrCrG rGrGrU rUrCrU rGrA-3' (SEQ ID NO:23), the reporter DNA had the sequence 5'-6-FAM-TTATTATTATT-Iowa Black® FQ-3' (SEQ ID NO: 19). The Type VI crRNA and the reporter RNA have been described herein above.

Example 4: Multiplex detection by lateral flow

In this example, the presence of SARS-CoV2 virus (S gene) and human RNAseP RNAs are detected at the same time. Casl3 and its crRNA, specific for S, detect the RNA produced by T7 polymerase from the amplicon produced during RPA amplification. Casl3 then gets activated and cleaves a ssRNA reporter containing FAM and Biotin, respectively, at the 5’ and 3’ ends. Casl2 and its crRNA, specific for RNAseP, can detect directly the dsDNA amplicon resulting from RPA amplification of RNase P mRNA. Upon recognition, Casl2 get activated and cleaves an ssDNA reporter, containing FAM and Digoxigenin, respectively, at the 5’ and 3’ ends. The integrity of these reporters, and consequently, the activation state of Casl3 and Casl2, can be detected using HybriDetect 2T sticks (Milenia Biotec, MGHD2 1). The Type V crRNA was the same as in Example 3, the reporter DNA was 5'-6-FAM-TTATTATTATT- biotin-3' (SEQ ID NO:20) or 5'-6-FAM-TTATTATTATT-digoxigenin-3' (SEQ ID NO:21). The Type VI crRNA and the reporter RNA have been described herein above.

Example 5: Methods for Examples 6 to 10

Casl3 purification:

A plasmid encoding the LwaCasl3 insert was transformed into Rosetta cells and purified according to established protocols with substantial modification. Single colonies were inoculated into 25 mL Terrific Broth (TB) (100 ug/mL AMP) and grown to an OD of 0.6 at 37°C degrees while shaking at 150 rpm. The suspension was chilled for 30 min at 4°C and subsequently induced with 0.5 mM IPTG and left shaking for an additional 16h at 21°C. Cells were harvested by centrifugation at 5 k rpm for 15 min at 4°C. The pellet was resuspended in 4x (wt/vol) supplemented lysis buffer (12 cOmplete Ultra EDTA-free tablets, 600 mg of lysozyme and 6 uL of benzoase to lysis buffer (20 mM Tris pH 8.0, 500 mM NaCl, 1 mM DTT)) and lysed by sonication. Lysate was cleared by centrifugation at 10 k rpm for lh at 4°C. Supernatant was purified using a 1 mL HIS-Trap column (Cytiva) slurry and affinity chromatography was performed using the AKTA pure system with lysis buffer for washing steps and an imidazole gradient for elution. After initial purification, the protein sample was incubated with SUMO protease (ThermoScientific) as per the manufacturer’s instructions at 4°C overnight to remove the affinity tags. The sample was then re-applied to a 1 mL HIS-Trap column. Both the SUMO protease (which itself has a 6xHIS tag) and the cleaved affinity tag bind to the resin, while pure Casl3 eluted in the wash step. A final size-exclusion chromatography step was performed using the AKTA pure system using 10 mM HEPES pH 7.0, 5 mM MgC12, 1 M NaCl and 2 mM DTT as gel filtration buffer on a Superdex 16/600 column.

Synthetic SARS-CoV-2 RNA

Fully synthetic SARS-CoV-2 RNA was purchased from Twist Biosciences (MT007544.1 or MN908947.3). In order to test SHERLOCK sensitivity, serial dilutions were prepared in water or in saline, from the initial concentration of 10 ⁶ cp/mΐ to 0.01 cp/pl.

Human clinical sample collection and preparation Clinical samples (nasopharyngeal swabs) were collected at the Medical University Mannheim, Germany.

Instructions to the patients were as follows:

- Open the saline solution (NaCl 0.9% from Braun) by turning the top and squeeze the solution into your mouth. Gargle for at least 45 seconds. Sway the solution back and forth in your mouth several times. Open the cap and spit the solution into the sample tube.

- Pull up the remaining liquid in your throat 2-3 times, collect all remaining liquid in your mouth and spit it into the sample tube.

- Close the test tube securely and shake it vigorously for 3 seconds.

The frozen samples were picked up and transported to our laboratory, where they were either stored at 4°C and a few days later analyzed or immediately analyzed.

RNA extraction

For the first blind test, RNA was extracted from the clinical samples with the QIAamp® Viral RNA Mini kit (Qiagen, #52904) following the manufacturer’s instructions (140pl of swab were extracted and eluted in 60m1).

Lysis of clinical samples for direct SARS-CoV2 detection

Clinical samples were lysed for direct SHERLOCK or ADESSO assay as follows: 10m1 of sample were mixed with 10m1 of QuickExtract DNA Extraction solution (Lucigen, #QE09050), and incubated at 95°C for 5 min. Then the samples were mixed by vortexing and spun down for 15 seconds at lO.OOOg. Finally, 5,6 mΐ of sample (for RT-RPA 2X) were collected from the upper liquid phase, carefully avoiding to aspirate any precipitate, and used in the RT-RPA step. crRNA synthesis and purification

CRISPR-RNAs (crRNAs) were either designed in our lab or synthesized by Integrated DNA Technologies (IDT). To produce the crRNAs in our lab we followed a previously published protocol (Kellner et al. (2019), Nature Protocols 14:2986). In short, the templates for the crRNAs were ordered as DNA oligonucleotides from Sigma-Aldrich with an appended T7 promoter sequence. These oligos were annealed with a T7-3G oligonucleotide, and used in an in vitro transcription (IVT) reaction (HiScribe T7 Quick High Yield RNA Synthesis Kit, NEB, #E2050S). The crRNAs were then purified using Agencourt RNAClean XP Kit (Beckman Coulter, #A63987). The correct size of the crRNAs was confirmed on a UREA gel and the concentration evaluated by nanodrop. Aliquots of lOng/mI of each crRNA were produced to avoid repeated freeze and thaw cycles and stored at -80°C.

Reverse Transcriptase Recombinase polymerase amplification (RT-RPA)

RT-RPA reactions were carried out with TwistAmp Basic (TwistDx, #TABAS03KIT) with the addition of M-MuLV Reverse Transcriptase (NEB, #M0253) and RNase Inhibitor, Murine (NEB, #M0314). Reactions were run at 42°C for 45 minutes in a heat block. A preferred proceeding is (so called RT-RPA 2X): two lyophilized pellets TwistAmp Basic are used to prepare the following master mix for 5 reactions: 59 mΐ of Rehydration Buffer (RB) are mixed with 2,5 mΐ of each primer (forward and reverse) at a concentration of 20mM, 1.5 mΐ of M-MuLV RetroTranscriptase (200U/pl - NEB, #M0253) and 1,5 mΐ of RNase Inhibitor, Murine (40U/pl - NEB, #M0314). The RB-primer-enzyme mix is used to rehydrate two pellets and finally 5m1 of MgOAc are added. The complete mix is aliquoted (14.4m1) on top of 5,6 mΐ of each sample. The RT-RPA protocol was optimized throughout the study. All RPA primers used in this study were designed following the guidelines provided in Kellner et al. (2019), Nature Protocols 14:2986.

Casl3 cleavage reaction for lateral flow readout

The reaction mix for Casl3 activity was prepared by combining 4.3 mΐ of nuclease-free water, 1 mΐ of cleavage buffer (400mM Tris pH 7.4), 1 mΐ of LwaCasl3a protein diluted in Storage Buffer (SB, Kellner et al 2019, loc. cit) to a concentration of 126.6 pg/ml, 0.5 mΐ of crRNA (40 ng/mΐ), 0.5 mΐ of lateral flow reporter (IDT, diluted in water to 20 mM), 0.5 mΐ of SUPERase-In RNase inhibitor (ThermoFisher Scientific, #AM2694), 0.4 mΐ of rNTP solution mix (25mM each, NEB, #N0466), 0.3 mΐ of NxGen T7 RNA Polymerase (Lucigen, #30223-2) and 0.5 mΐ of MgCb (120mM). 1 mΐ of the RT-RPA-amplified product was then added to the mix and, after vortexing and spinning down, the mixture was incubated for 10 minutes at 37°C in a heat block.

Lateral flow readout

Lateral flow detection was performed using commercially available detection strips (Milenia HybriDetect 1, TwistDx, GieBen, #MILENIA01). The 10pl-LwaCasl3a reactions were transferred to a tube already containing 80 mΐ of HybriDetect Assay buffer. After vortexing and spinning down the reaction mix, a lateral flow dipstick was added to the reaction tube. The result was clearly readable after one minute. Once the whole reaction volume was absorbed, the dipstick was removed and photographed with a smartphone camera for band intensity quantification performed with ImageJ software. The results are shown as intensity ratio (test band/control band) and test were considered positive for value of intensity ratio above 0 2

Casl3 cleavage reaction for fluorescence readout

The reaction mix for Casl3 activity was prepared by combining 8.6 pi of nuclease-free water, 2 mΐ of cleavage buffer (400mM Tris pH 7.4), 2 mΐ of LwaCasl3a protein diluted in Storage Buffer (SB) to a concentration of 126.6 pg/ml, 1 mΐ of crRNA (40ng/pl), 1 mΐ of fluorescent reporter (IDT, diluted in water to a final concentration of 4 mM), 1 mΐ of RNase inhibitor, Murine (NEB, #M0314), 0.8 mΐ of rNTP solution mix (25mM each, NEB, #N0466), 0.6 mΐ ofNxGen T7 RNA Polymerase (Lucigen, #30223-2) and 1 mΐ of MgC12 (120mM). 2 mΐ of the RT-RPA- amplified product was then added to the mix. The 20pl-LwaCasl3a reactions were transferred in 5pl-replicates (4 wells each sample) to a 384-well, round black- well, clear-bottom plate (Corning, #3544). The plate was briefly spun down at 500g for 15 sec to remove potential bubbles and placed into a pre-heated GloMax® Explorer plate reader (Promega) at 37°C.

Fluorescence readout

Fluorescence was measured every 5 min for 3 h. Data analysis, if not differently stated, was performed at 30-min timepoint.

Example 6: A SHERLOCK-based assay for SARS-CoV2 detection in clinical samples We assessed the sensitivity of our test when combining the Casl3 detection with an RT-RPA pre-amplification step on SARS-CoV-2 genes S and Orfla. Indeed, we detected SARS-CoV-2 gene S at a concentration of lOaM (5 copies/mΐ) and gene Orfla at a concentration of lOOaM (50 copies/mΐ). This improvement is preferably due to the replacement of ProtoScript II Reverse Transcriptase with M-MuLV Reverse Transcriptase. We then used the set of primers and crRNA for S to conduct a blind test on 30 clinical samples. These samples were nasopharyngeal swabs collected in physiological solution (0.9% NaCl) and analyzed for SARS-CoV-2 via RT- qPCR at the Medical University Hospital Mannheim. The specimens were frozen and transported to our laboratory, where we extracted RNA and performed SHERLOCK in duplicates. Additionally, we also performed the CDC 2019-nCoV Real-Time RT-PCR Diagnostic Panel (REF) as a control. Using SHERLOCK, we were able to identify all 10 positive samples (Table la and b below). Notably, we detected sample 28, which had a very low viral titer (corresponding to a high Ct value). These results demonstrate that SHERLOCK can be used as an alternative method to detect SARS-CoV-2 in RNA extracted from clinical samples.

Table la. SHERLOCK and qRT-PCR results for Samples 1 to 15.

Table lb. SHERLOCK and qRT-PCR results for Samples 16 to 30.

Example 7: SARS-CoV2 direct detection from clinical samples The RNA extraction step is the major time-consuming step for COVID-19 diagnosis (Figure 10). Different studies have already demonstrated that it is possible to omit this step (Smyrlaki et al. (2020), Nat Commun 11:4812; Bruce et al. (2020), PLoS Biol 18(10): e3000896; Arizti- Sanz et al., (2020) Nat Commun 11:5921; Joung etal. (2020), medRxiv 2020.05.04.20091231). Therefore, after demonstrating the high potential of SHERLOCK as a diagnostic test for COVID-19, we attempted to improve our protocol in order to avoid the RNA extraction step, making the test faster and cheaper. First, we compared different lysis methods by treating one known positive sample (sample #30 in Table lb) with either QuickExtract DNA Extraction solution (Lucigen) or Luna Cell Ready Lysis Buffer (NEB) or 5% Triton and incubating it for 5 min at 95°C. We performed the experiment in triplicates for each lysis method and we were able to successfully detect SARS-CoV-2 directly after lysing the sample with QuickExtract DNA Extraction solution and Luna Cell Ready Lysis Buffer (Figure 11). In order to assess the sensitivity of our test on lysate, we spiked in serial dilutions of SARS-CoV-2 synthetic genome in a negative sample lysate obtained with QuickExtract solution and we performed SHERLOCK on the S gene. We were able to consistently detect 10 copies/mΐ, which reflects our in vitro sensitivity as assessed on serial dilutions of SARS-CoV-2 synthetic genome in water. After determining the sensitivity of SHERLOCK on lysate, we proceeded with the evaluation of its diagnostic potential in clinical samples. We performed a second blind test on 160 clinical samples. We considered as positive the samples resulting in an intensity band ratio (test band/control band) higher than 0.2. This threshold was defined based on the intensity band ratio obtained in all the negative controls and samples used in this study. Direct SHERLOCK was able to identify 73 out of 93 positive samples resulting in a sensitivity of 78% (Table 2). Table 2. Identification of positive samples by SHERLOCK vs. qRT-PCR.

Example 8: ADESSO: an optimized and highly sensitive SHERLOCK assay We evaluated alternative reagents and different reaction conditions for several steps in SHERLOCK, namely, 1) sample lysis, 2) RT-RPA and 3) Casl3 detection, to increase both sensitivity and speed of the test. At this stage, we assessed Casl3 activation via a fluorometer to also monitor the speed of the reaction in real time. First, we measured the RNase activity in both swab and gurgle samples collected in saline and lysed with the method selected in Figure 2 (QuickExtract solution and incubation for 5 min at 95°C). To evaluate RNase activity, RNaseAlert was added to the samples following lysis and fluorescence was measured to evaluate the corresponding nuclease activity. Notably, addition of RNase inhibitors in the lysis buffer prior to heating was sufficient to inhibit RNase activity almost completely (Figure 12A). Next, we optimized the RT-RPA step by first comparing different reverse transcriptase (RT) enzymes in the presence or absence of RNase H. Once again, M-MuLV shows the best sensitivity (5-2.5 cp/mΐ) in comparison to ProtoScript II or Superscript III, while the addition of RNase H lead to an improvement for Superscript III only (Figure 12B). Secondly, we used different final concentrations of RPA, where lxRPA corresponds to the standard amount of RPA described in the original SHERLOCK protocol and 5xRPA corresponds to the optimal amount according to the manufacturer’s instructions. To test this, we selected one false negative sample from our previous blind test on lysate (sample #L151, Table 1) and we repeated our assay with different concentrations of RPA. Remarkably, while the sample is still negative with lxRPA, it results positive for final concentrations of RPA from 2x to 5x, with a decrease in band intensity ratio when using the 4xRPA and 5xRPA concentrations (Figure 13 A). Considering this and bearing in mind the cost per single test, we decided to proceed further using a 2xRPA concentration. To further confirm this improvement, we compared lxRPA and 2xRPA on 5 samples with Ct values close to our LOD. We observed an improvement in the 2xRPA reactions with these samples as well (Figure 13B). Furthermore, in order to optimize the Casl3 detection step we made a ten-fold dilution of a positive RT-RPA reaction (50 cp/pl) and we performed Casl3 detection using the original concentration of Casl3-crRNA (45nM- 22.5nM) in comparison to higher amounts (Figure 14B). A concentration of Casl3-crRNA of 90 nM lead to an improved reaction, reaching the plateau after just 15 min, compared to 30 min for the other two concentrations (Figure 14B). We also confirmed that a 10-min incubation for Casl3 detection is sufficient to have a clearly positive output in the lateral flow detection assay (Figure 14A), which is a preferred aspect for a POC test. Moreover, a shorter Casl3 reaction allows us to extend the incubation time of the RT-RPA step for highly sensitive reactions without affecting the total time of the assay. Finally, we assessed the sensitivity of this optimized protocol on serial dilutions of SARS-CoV-2 synthetic genome and we observed a robustly reproducible sensitivity of 2,5 cp/mΐ. We called this new optimized diagnostic assay ADESSO (Accurate Detection of Evolving SARS-CoV-2 through SHERLOCK Optimisation).

Example 9: Evaluation of ADESSO’ s performance on clinical samples in direct comparison to RT-qPCR.

We used ADESSO to test a total of 195 clinical samples in direct comparison to the RT-qPCR protocol routinely used in the clinics. To allow a fair comparison between the methods, we first selected 95 positive and 100 negative individuals (via COBAS RT-qPCR on nasopharyngeal swab (NP)). For each of these specimens, RNA was re-extracted and analyzed by RT-qPCR (Tib Molbiol) and ADESSO. Additionally, ADESSO was also performed directly on unextracted samples. Finally, we also obtained gurgled saline from the same individuals as an alternative sampling method, which would be ideal for point-of-care testing. Those samples were treated exactly as the NP swabs. ADESSO on RNA extracted from swabs was able to correctly identify most positive samples (91 out of 95), resulting in a sensitivity of 96%. Interestingly, all the false negative samples have Ct values higher than 31, corresponding to lower viral loads (<100cp/pl) and therefore a lower probability of spreading the virus (Figure 15A). RT-qPCR (Tib Molbiol) performed on the same samples was largely in agreement with the COB AS RT-qPCR, with highly correlated Ct values. However, using this method we were able to identify 89 out of 95 positive samples resulting in a 94% sensitivity value. As expected, ADESSO on unextracted samples resulted in a lower sensitivity, with all false negative samples having Ct values higher than 29 (~100cp/pl) (Figure 15C). The same analysis was performed on gurgled saline samples. In this case, ADESSO on extracted RNA correctly identified 74 out of 95 positive samples resulting in a sensitivity of 78%, with most false negative samples having Ct values higher than 30 and few with Ct values between 28 and 29 (Figure 15B). Interestingly, this drop in sensitivity does not seem to be related to the detection method but rather to the sampling method. Indeed, the same decrease in sensitivity (to 79%) was observed also for RT-qPCR (TibMolBio), with true positive samples resulting in higher Ct values. Finally, as observed for swabs, ADESSO on unextracted gurgled saline samples resulted in a lower sensitivity (65%). In this latter case, false negative samples have different Ct values, with some corresponding to high viral loads (Figure 15 D). Altogether, these results validate the high potential of ADESSO as a POC test for the detection of SARS-CoV-2 infected individuals. Notably, ADESSO on extracted RNA, either from swab or gargle water, performed as well as RT-qPCR (TibMolBio) in terms of sensitivity and specificity. Additionally, our data also shows an important difference in the detection of SARS-CoV-2 when gurgling with saline was used as a sampling method, which would be better suited to a POC test.

Example 10: Evolution/ Adaptation of ADESSO for detection of SARS-CoV-2 variants: a flexible and powerful assay to rapidly identify specific variants or mutations.

Since the beginning of the pandemic, SARS-CoV-2 has evolved considerably. The first variants to appear carried a D614G mutation, which is now dominant and shared between all the existing variants. While several variants exist, here we focus on two variants of concern, SARS-CoV-2 B.l.1.7 (UK variant) and SARS-CoV-2 B.1.351 (South Africa (SA) variant). SARS-CoV-2 B.l.1.7, also known as 501Y.V1, seems to have an enhanced transmissibility and may be more virulent. It was first detected in England in late 2020 and, after becoming the dominant variant in the UK, it is now spreading quickly all over Europe and worldwide. B.l.1.7 contains eight mutations in the spike gene in addition to the mutation causing the D614G substitution, including deletions (e.g., AHV69-70) (Figure 16A). SARS-CoV-2 B.1.351, also known as 501Y.V2, was first detected in late 2020 in Eastern Cape, South Africa. This variant quickly became dominant locally and displaced other viral lineages in several regions, possibly as a result of increased transmissibility or immune escape. B.1.351 contains nine mutations in the spike gene in addition to the mutation causing the D614G substitution, including clusters of mutations (e.g., mutations leading to D242-244 and R246I) (Figure 16A). It is now essential to quickly identify individuals infected by SARS-CoV-2 variants. The UK variant is the major concern in Europe and Germany, thus we adapted our test to detect the deletion (AHV69-70) specific to this strain. We called this adapted test ADESSO-UK (Figure 16A, B). We optimized RT-RPA primers to amplify the region of SARS-Co-V-2 genome containing HV69-70 and we achieved a sensitivity of 25 cp/mΐ using dilutions of synthetic SARS-CoV-2 genome. Then, we designed two different crRNAs able to recognize either the original Wuhan strain (wild-type (wt)) or the UK variant, called respectively crRNA HV69-70 and crRNA AHV69-70 (Figure 16B). We performed a blind test on positive clinical samples carrying either UK or SA variants. We first applied ADESSO for the detection of SARS-CoV-2 and we were able to detect all positive samples but one (sample #11, Table 3).

Table 3. Detection of SARS-CoV-2 variants with ADESSO variants

Then, using ADESSO-UK (crRNA AHV69-70 or HV69-70) we were able to correctly identify all the samples carrying the UK variants and we could discriminate the ones bearing the SA strain (sample #1-13, Table 3). Interestingly, between the three samples carrying the SA variant, only sample #11 was not detected via ADESSO. Sequencing analysis of the viral genome in these three samples showed that the three samples shared the deletion D242-244, but only sample #11 carried the R246I mutation (Figure 16C). This mutation falls exactly within the bases recognized by the 3’ end of the forward primer used in the RT-RPA step of ADESSO, thus disrupting its function. Notably, the assay seems to be resistant to deletions of several nucleotides occurring in sequences that are complementary to the central region of the primer (Figure 16C).

Literature

- Arizti-Sanz et al, (2020) Nat Commun 11 : 5921

- Bruce et al. (2020), PLoS Biol 18(10): e3000896 - Chen et al. (2018), Science 360(6387):436

- Kellner et al. (2019), Nature Protocols 14:2986

- Wyllie et al. (2020), medRxiv 2020.04.16.20067835; doi.org/10.1101/2020.04.16.20067835

- Huang et al. (2020), Biosensors and Bioelectronics 164:112316

- Joung et al. (2020), "Point-of-care testing for COVID-19 using SHERLOCK diagnostics", v. 20200505, (www.stopcovid.science/docs/STOPCovid Whitepaper.pdf)

- Joung et al. (2020), medRxiv 2020.05.04.20091231

- Liu et al. (2021), Food chemistry: 127608, (doi.org/10.1016/j.foodchem.2020.127608)

- Smyrlaki et al. (2020), Nat Commun 11:4812 - US 2008/0076160 - US 2011/0065106

- Zhang et al. (2020), "SHERLOCK COVID-19 Testing Kit Instructions", v. 20200321, (www.broadinstitute.org/files/publications/special/COVID-19 detection (updated). pdf)

- Zhou et al. (2018), J Cell Mol Med 22:5807