This invention relates to polynucleotide sequences, uses of the polynucleotide sequences and methods to detect small molecules in samples using nanoparticles coated with the polynucleotide sequences.

Introduction

As part of environment testing there is an on-going need for methods of rapidly detecting and quantifying the presence of target molecules. For example, target small molecules such as endocrine-disrupting compounds and hormones are often found as contaminants in the environment. Such contaminants can be found in waterways, soils, biological samples, including both plant and animals, as environmental pollutants from residential, agricultural, commercial and/or industrial applications.

It is known, in some cases, that these small molecular weight compounds, such as those indicated herein, together with their metabolites and/or synthetically modified variants pose a threat to the health of human and wildlife populations by mimicking the activity of endogenous hormones, such as oestrogens. These molecules may act by blocking, mimicking, stimulating or inhibiting the production and function of natural hormones. The organic residues that mimic these endogenous steroidal hormones, and metabolites are lipid soluble, thus have the ability to bio-accumulate in living systems of mammals and marine species. Evidence of this has been identified in human blood plasma, breast milk, foetal tissues and biological fluids [Allmyr et a/., Anal. Chem., 78: 6542-6546, 2006; Hileman, Chemical and Engineering News, 85: 31-33, 2007; Van-Pelt ef a/. Endocrinology, 140: 478- 483, 2001 ; Skakkebaek et a/., Human Reproduction 16: 972-978, 2001; Vandenberg et a/., Endocrine Reviews, 33(3): 2012] Therefore, there is a need for new methods for easy detection of these small molecules.

17p-estradiol Bisphenol A

17a-ethynylestradiol

More conventional methodologies and techniques that are often used for the detection of small compounds include High Performance Liquid Chromatography (HPLC) or Gas Chromatography coupled with Mass Spectrometry (GCMS). These techniques are very useful for this purpose, however, the analyses can be complicated to perform and can take a long period of time to complete. Furthermore, sample concentration is often required for standard chromatographic techniques and cannot be carried out in situ [Campbell, C. G., et al., 2006, Chemosp ere, 65, 1265-80]. Consequently, these techniques cannot be performed on site, they require specialised equipment and trained operators, and do not provide for a rapid assessment of the sample.

There is therefore a need for a convenient, quick and simple method for the detection and quantification of small molecules, especially in the area of environmental and contaminant testing as in human veterinary medicine, such a method can be provided by colorimetric assays which can provide visual indication of the presence of target small molecules.

Aptamers are single-stranded nucleic acids (ssRNA, ssDNA), which unlike traditional nucleic acids, possess unique binding characteristics to specific targets with high affinity and specificity analogous to antibodies [Tuerk, C. Gold, L, Science, 1990, 249(4968), 505-510; Ellington, A.D., Szostak, J.W., Nature, 1990, 346(6287), 818-822.] Aptamers are typically isolated in vitro from combinatorial oligonucleotide libraries, typically containing 10 ¹² to 10 ¹⁵ oligonucleotides, and are chemically synthesised by a process known as SELEX. The oligonucleotides are subjected to a selection process for their ability to bind a specified target and over a number of selection rounds (typically 8-16 rounds); the most specific nucleic acid sequences are isolated. Depending on the techniques used in SELEX, the process might take from days to months [Cho, E. J., Lee, J.W., Ellington, A.D., Ann. Rev. Anal. Chem., 2009, 2(1 ), 241-264; Ellington, A. D., Ann. Rev. Anal. Chem., 2009, 2(1 ), 241 - 264].

Aptamers have been generated for a wide range of targets, ranging from ions to entire cells. The benefits of synthetically evolved DNA aptamers, [Tuerk, C. Gold, L., Science, 1990, 249(4968), 505-510; Ellington, A.D., Szostak, J.W., Nature, 1990, 346(6287), 818-822], led to their widespread use as recognition elements in sensors [McKeague, M., Derosa, M.C., 2012. J. Nucleic Acids, 2012, 748913], DNA aptamers are generated from a random core sequence, and also flanking primers which can later be used for amplification by polymerase chain reaction [McKeague, M., Derosa, M.C., 2012. J. Nucleic Acids, 2012, 748913]. The use of an in vitro process enables the generation and selection of aptamers that can bind toxic targets, which are not possible by immunologically initiated recognition elements, such as antibodies. The small size of aptamers (generally <3 nm in a coiled conformation) also makes them more readily applicable to surface-based aqueous sensing purposes in comparison to antibodies (approximately >10 nm in size) [Song, S., et a/., Trends in Analytical Chemistry, 2008, 27(2), 108-117].

Baker et al., [Olowu, R. A.; Arotiba, O.; Maliu, S. N.; Waryo, T. T.; Baker, P.; Iwouoha, E., Sensors, 2010, 10, 9872] have previously shown that electrochemical DNA aptasensors developed from poly(3,4-ethylenedioxythiophene) (PEDOT) doped with gold nanoparticles (AuNP) have high affinity for the detection of 17 -estradiol. The PEDOT-AuNP are synthesised for the immobilisation of 7 -estradiol. This PEDOT-AuNP is able to reliably detect 17p-estradiol in the range of 0.1 nM-100 nM, with a detection limit of 0.02 nM. In addition, Baker et al. [Olowu, R. A., Ndangili, P.M., Baleg, A. A, Ikpo, C. O., Njomo, N., Baker, P, Iwuoha, E., Int. J. Electrochem. Sci., 2011 , 6, 1686] have also prepared and shown an aptamer biosensor developed from a dendritic first generation poly(propyleneimine)-polythiophene copolymer (shown below)-functionalised gold electrode via biotin-avidin interaction in the determination of endocrine disrupting compounds, especially 17 -estradiol.

The sensor platform and aptasensor were investigated using techniques such as scanning electron microscopy, Fourier transform infrared spectroscopy, electrochemical impedance spectroscopy, cyclic voltammetry and square wave voltammetry. The authors report that the response in the detection of 17p-estradiol was measured using square wave voltammetry with a linear range of the sensor of 0.1 to 100 nM. In addition, this particular aptamer is specific only to 17p~estradiol.

Lee and Gu et al. [Kim, Y. S., Jung, H. S., Matsuura, T., Lee, H. Y., Kawai, T., Gu, M. B. Biosensors and Bioelectronics, 2007, 22, 2525] report the synthesis and use of ssDNA aptamer based electrochemical biosensors by immobilisation of the ssDNA aptamer on a gold electrode chip in the detection of 17p-estradiol, The detection levels of 17p-estradiol are reported to be in the range of from 1000 to 0.1 nM. However, the authors report at lower concentrations, in the range of 0.01 nM to 0.001 nM, their measurements may not be related to the binding of the aptamer to the substrate which makes this particular method unreliable.

US 2012/0088232 teaches a method for the detection of target molecules in patient samples at a point of care location using a point of care lateral flow device. The point-of-care lateral flow device specifically detects cancer markers and proteins, in particular p-glucoprotein (Pgp), by utilising aptamers that have been labelled with appropriate tags such as fluorophores. The aptamers are conjugated to solid supports, such as nanoparticles, and the presence of the target substrate molecules are quantified using techniques, including dynamic light scattering. In this case, dynamic light scattering measures increases in particle sizes associated with aptamer-substrate complex formation.

Many small molecule aptasensors have been developed with original primers retained [Alsager, O. A, Kumar, S., Willmott, G.R., McNatty, K.P., Hodgkiss, J.M., Biosens. Bioelectron. 57C, 2014, 262-268; Kim, Y.S., Jung, H.S., Matsuura, T., Lee, H.Y., Kawai, T., Gu, M.B., Biosens. Bioelectron., 2007, 22, 2525-31], In several instances, sequences have been modified through insertions or deletions outside of the core region but without noticeable reductions in the aptamer affinity for the target molecule [Cekan, P., Jonsson, E.O., Sigurdsson, ST., 2009, Nucleic Acids Res., 37, 3990-5; Huizenga, D.E., Szostak, J.W., 1995, Biochemistry, 34, 656-65].

However, other aptasensors have refined the original sequences, and shown that flanking sequences including the primers can potentially interfere with ligand binding. For example, in the detection of acetamiprid, the 91-mer aptamer has a K _D of 498nM. The aptamer is truncated to the 20-mer stem loop region and achieves detection levels of 5 nM in soil samples when applied in a colorimetric assay. [He, J., Liu, Y., Fan, M., Liu, X., 2011 , J. Agri ^' c, Food Chem., 59, 1582-6 and Shi, H., Zhao, G., Liu, M., Fan, L, Cao, T., J. Hazard. Mater., 2013, 260, 754-761].

Similarly, bisphenol A aptasensors achieve low detection levels on reduction from a 106-mer aptamer (K _D 8.3 nM) for the parent, to 1.2 pM and 400 pM for the reduced aptamer, in electrochemical and colorimetric sensors, respectively [Jo, M., Ahn, J.-Y., Lee, J., Lee, S., Hong, S.W., Yoo, J.-W., Kang, J., Dua, P., Lee, D.-K., Hong, S., Kim, S., 2011 , Oligonucleotides 21 , 85-91] . In the instance of the Ochratoxin A aptamer, more complicated effects are implied: affinity was drastically diminished upon removing both primers from the parent 61-mer (K _D of 640 μΜ vs. 360 nM). However, more selective deletion results in an enhanced K _D of 200 nM [Cruz-Aguado, J. a, Penner, G., 2008, J. Agric. Food Chem., 56, 10456-61]. Any discussion of the prior art throughout the specification should in no way be considered as an admission that such prior art is widely known or forms part of the common general knowledge in the field.

There is therefore a need for a convenient, quick and simple method for the detection and quantification of small molecules, especially in the area of environmental and contaminant testing.

It is therefore an object of the present invention to provide a highly effective method for small molecule detection, or to at least provide the public with a useful alternative.

The method of the present invention is useful In the detection of small molecules in a sample by using an aptamer coated NP to detect the presence of small molecules in a sample using a colorimetric aggregation assay. Summary of the Invention

The present inventors have advantageously and surprisingly found that eliminating the flanking sequences from a 75-mer aptamer, SEQ ID No: 1

(5'- ATACGAGCTTGTTCAATACGAAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTGTGG TGATAGTAAGAGCAATC-3') to provide a 35-mer aptamer, SEQ ID No: 2, sequence AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG provides over an order of magnitude in enhancement when compared to the parent 75-mer sequence that contains the flanking sequence.

The present inventors have also advantageously and surprisingly developed a simple and reliable colorimetric aggregative aptasensor for the detection of small molecules, providing detection limits in the pM range that show excellent selectivity for small target molecules, especially those belonging to the estrogenic steroidal family.

The present invention also shows that the performance of the aptamer in the detection of target small molecules can be achieved not only through binding affinity, but also signal transduction and/or aptamer dissociation from the nanoparticles.

Statements of Invention In a first aspect, the present invention provides for a polynucleotide sequence comprising the sequence; 5'-AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3', SEQ ID No: 2.

Preferably the polynucleotide sequence has 70, 71 , 72, 73, 74, 75, 76 ,77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 % identity to SEQ ID No: 2, 5'-AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3'. Even more preferably the sequence has 71% to 98 % identity. Even more preferably the sequence has 85 % to 72 % identity.

Preferably, the polynucleotide sequence is an aptamer. Preferably, the aptamer is selected from ssDNA and RNA. Most preferably the aptamer is ssDNA.

In an embodiment of the first aspect, the aptamer, when mixed with a nanoparticle (NP) will reversibly coat the surface of the nanoparticle to form an aptamer-coated NP. In an embodiment of the first aspect, there is an increase in the ζ-potential value of the aptamer coated NP when compared to the bare NP.

In an embodiment of the first aspect, the aptamer-coated NP may be stable in solutions containing salt.

In an embodiment of the first aspect, the aptamer may optionally include a fluorescent tag. In an embodiment of the first aspect, the aptamer is specific for small target molecules. The small target molecule to be detected may be selected from chemicals that mimic hormones, hormones, naturally occurring phytoestrogens, narcotics and metabolites thereof. Preferably, the small molecule is an endocrine disrupting compound, a steroidal sex hormone, metabolites or synthetic variants thereof. More preferably, the small molecule is selected from endocrine-disrupting compounds, and metabolites thereof. More Preferably the small molecule belongs to the estrogenic family of compounds. Even more preferably, the small molecules are selected from 17 -oestradiol (E2); oestrone; oestriol; androstenedione; testosterone; dihydrotestosterone; pregnenolone; progesterone; 17a- hydroxyprogesterone, 17a-ethynylestradiol; isoflavones; lignans; coumestans; organohalides including organochlorines, polychlorinated organic compounds, polychlorobiphenyl (PCB); alkylphenols; alkylphenol ethoxylates; phthalates; bisphenol-A (BPA); Bis (4-hydroxyphenyl) methane; cholesterol; adenosine; triclosan; or synthetic steroids such as diethylstilboestrol (DES); cocaine, heroin and any metabolites of the mentioned compounds thereof. Even more preferably, the small molecule to be detected is selected from 17p-oestradiol, testosterone, progesterone, and adenosine.

Alternatively, the small molecule to be detected may also be hormone or a marker of a condition of disease in a body. For example, the aptamer could be selective for the detection of hormones and/or metabolites to establish fertility, or status in an animal. Alternatively, the aptamer can be selected for the detection of known markers of disease, for example overexpression of a cancer gene to detect cancer, detection of molecules associated with infection, or to establish levels of specific metabolites associated with a particular condition.

In an embodiment of the first aspect the aptamer detects small target molecules present in a sample. The sample may be an environmental sample, for example a water sample, soil sample, or even a plant sample. Alternatively, the sample may be from an animal, for example a tissue sample, a hair or wool sample, a urine sample, a blood sample, a serum sample, a saliva sample or a faecal sample.

In an embodiment of the first aspect, the nanoparticle may be selected from nanoparticles, microparticles and quantum dots. Even more preferably the nanoparticle is derived from a noble metal. The noble metal may be selected from gold, ruthenium, rhodium, palladium, silver, and platinum. Preferably the nanoparticle is a gold nanoparticle. In an embodiment of the first aspect, the aptamer detects levels of the small target molecule in the sample in a range of from about 1 pM to about 100 μΜ. More preferably, the aptamer detects the small target molecule in the sample in the range of from about 1 pM to about 100 μΜ. Even more preferably, the aptamer detects the small target molecule in the range of from about 200 pM to about 400 nM.

In an embodiment of the first aspect, the binding of the aptamer to the small target molecule is indicated by a colorimetric change. The colorimetric change may be identified by techniques such as UV-Vis spectroscopy. Preferably, the colorimetric change is visible to the naked eye.

In an embodiment of the first aspect, the aptamer coats the NP in a ratio of the number of NP:aptamer of from about 1 :100 to about 1 :1. More preferably, a NP:aptamer ratio of from about 1 :50 to about 1:1. Even more preferably, a NP:aptamer ratio of from about 1 :10 to about 1 :3.

In a second aspect, the present invention provides for the use of a polynucleotide sequence comprising the sequence 5'-AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3' (SEQ ID No: 2) in the detection of a small molecule.

Preferably the polynucleotide sequence has 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 % identity to 5'- AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3' (SEQ ID No: 2). Even more preferably the sequence has 71% to 98 % identity. Even more preferably the sequence has 85 % to 72 % identity.

Preferably, the polynucleotide sequence is an aptamer. Preferably, the aptamer is selected from ssDNA and RNA. Most preferably the aptamer is ssDNA. In an embodiment of the second aspect, the polynucleotide (aptamer) is used to reversibly coat the surface of the nanoparticle to form a coated NP.

In an embodiment of the second aspect, there is an increase in the ζ-potential value of the aptamer coated NP when compared to the bare NP.

In an embodiment of the second aspect, the coated NP may be stable in solutions containing salt. In an embodiment of the second aspect, the aptamer selectively binds to a small target molecule. The small target molecule to be detected may be selected from chemicals that mimic hormones, hormones, naturally occurring phytoestrogens, narcotics and metabolites thereof. Preferably, the small molecule is an endocrine disrupting compound, a steroidal sex hormone, metabolites or synthetic variants thereof. More preferably, the small molecule is selected from endocrine disrupting compounds, and metabolites thereof. More preferably, the small molecule belongs to the estrogenic family of compounds. Even more preferably, the small molecules are selected from 17 -oestradiol (E2); oestrone; oestriol; androstenedione; testosterone; dihydrotestosterone; pregnenolone; progesterone; 17a- hydroxyprogesterone, 7a-ethynylestradiol; isoflavones; lignans; coumestans; organohalides including organochlorines, polychlorinated organic compounds, polychlorobiphenyl (PCB); alkylphenols; alkylphenol ethoxylates; phthalates; bisphenol-A (BPA); Bis (4-hydroxypheny!) methane; cholesterol; adenosine; triclosan; or synthetic steroids such as diethylstilboestrol (DES); cocaine, heroin and any metabolites of the mentioned compounds thereof. Even more preferably, the small molecule to be detected is selected from 17p-oestradiol, testosterone, progesterone, and adenosine.

Alternatively, the small molecule to be detected may also be hormone or a marker of a condition of disease in a body. For example, the aptamer could be used in the detection of hormones and/or metabolites to establish fertility, or status in an animal. Alternatively, the aptamer can be selected to detect known markers of disease, for example overexpression of a cancer gene to detect cancer, detection of molecules associated with infection, or to establish levels of specific metabolites associated with a particular condition.

In an embodiment of the second aspect, the aptamer detects small target molecule is present in a sample. The sample may be an environmental sample, for example a water sample, soil sample, or even a plant sample. Alternatively, the sample may be from an animal, for example a tissue sample, a hair or wool sample, a urine sample, a blood sample, a serum sample, a saliva sample, a faecal sample, or a sample derived from an animal.

In an embodiment of the second aspect, the nanoparticle may be selected from nanoparticles, microparticles and quantum dots. Even more preferably the nanoparticle is derived from a noble metal. The noble metal may be selected from gold, ruthenium, rhodium, palladium, silver, and platinum. Preferably the nanoparticle is a gold nanoparticle. In an embodiment of the second aspect, the aptamer detects levels of the small target molecule in the sample in a range of from about 1 pM to about 100 μΜ. More preferably, the aptamer detects the small target molecule in the sample in the range of from about 1 pM to about 100 Μ. Even more preferably, the aptamer detects the small target molecule in the range of from about 200 pM to about 400 nM.

In an embodiment of the second aspect, the binding of the aptamer to the small target molecule is indicated by a colorimetric change. The colorimetric change may be identified by techniques such as UV-Vis spectroscopy. Preferably, the colorimetric change is visible to the naked eye.

In an embodiment of the second aspect, the aptamer coats the NP in a ratio in the number of NP:aptamer of from about 1 :100 to about 1 :1. More preferably, a NP:aptamer ratio of from about 1 :50 to about 1 :1. Even more preferably, a NP:aptamer ratio of from about 1 :10 to about 1 :3.

In a third aspect, the invention provides a method of detecting a small molecule in a sample wherein the method comprises:

a. contacting a sample with a nanoparticle coated with a polynucleotide sequence comprising the sequence 5'-

AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3' (SEQ ID No: 2); and b. analysing the sample and measuring change in colour, wherein a colour change is indicative of the presence of the target small molecule. According to the third aspect, the sample in contact with the coated nanoparticle may be incubated prior to analysis.

Preferably, the polynucleotide sequence has 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 % identity to (SEQ ID No: 2) 5'-AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3'. Even more preferably the sequence has 71% to 98 % identity. Even more preferably the sequence has 85 % to 72 % identity.

Preferably, the polynucleotide sequence is an aptamer. Preferably, the aptamer is selected from ssDNA and RNA. Most preferably the aptamer is ssDNA.

In an embodiment of the third aspect, the coating of the NP with the polynucleotide sequence is reversible. In an embodiment of the third aspect, there is an increase in the ζ-potential value of the aptamer coated NP when compared to the bare NP, In an embodiment of the third aspect, the coated NP may be stable in solutions containing salt.

In an embodiment of the third aspect, the aptamer may optionally include a fluorescent tag. In an embodiment of the third aspect, the aptamer is specific for small target molecules. The small target molecule to be detected may be selected from chemicals that mimic hormones, hormones, naturally occurring phytoestrogens, narcotics and metabolites thereof. Preferably, the small molecule is an endocrine disrupting compound, a steroidal sex hormone, metabolites or synthetic variants thereof. More preferably, the small molecule is selected from endocrine disrupting compounds, and metabolites thereof. More preferably, the small molecule belongs to the estrogenic family of compounds. Even more preferably, the small molecules are selected from 17p-oestradiol (E2); oestrone; oestriol; androstenedione; testosterone; dihydrotestosterone; pregnenolone; progesterone; 17a- hydroxyprogesterone, 17a-ethynylestradiol; isoflavones; lignans; coumestans; organohalides including organochlorines, polychlorinated organic compounds, polychlorobiphenyl (PCB); alkylphenols; alkylphenol ethoxylates; phthalates; bisphenol-A (BPA); Bis (4-hydroxyphenyl) methane; cholesterol; adenosine; triclosan; or synthetic steroids such as diethylstilboestrol (DES); cocaine, heroin and any metabolites of the mentioned compounds thereof. Even more preferably, the small molecule to be detected is selected from 17 -oestradiol, testosterone, progesterone, and adenosine.

Alternatively, the small molecule to be detected may also be hormone or a marker of a condition of disease in a body. For example, the aptamer could be selective for the detection of hormones and/or metabolites to establish fertility, or status in an animal. Alternatively, the aptamer can be selected for the detection of known markers of disease, for example overexpression of a cancer gene to detect cancer, detection of molecules associated with infection, or to establish levels of specific metabolites associated with a particular condition. In an embodiment of the third aspect the aptamer detects small target molecule is present in a sample. The sample may be an environmental sample, for example a water sample, soil sample, or even a plant sample. Alternatively, the sample may be from an animal, for example a tissue sample, a hair or wool sample, a urine sample, a blood sample, a serum sample, a saliva sample or a faecal sample.

In an embodiment of the third aspect, the nanoparticle may be selected from nanoparticles, microparticles and quantum dots. Even more preferably the nanoparticle is derived from a noble metal. The noble metal may be selected from gold, ruthenium, rhodium, palladium, silver, and platinum. Preferably the nanoparticle is a gold nanoparticle.

In an embodiment of the third aspect the aptamer detects levels of the small target molecule in the sample in a range of from about 1 pM to about 100 μΜ. More preferably, the aptamer detects the small target molecule in the sample in the range of from about 1 pM to about 100 μΜ. Even more preferably, the aptamer detects the small target molecule in the range of from about 200 pM to about 400 nM. In an embodiment of the third aspect, the binding of the aptamer to the small target molecule is indicated by a colorimetric change. The colorimetric change may be identified by techniques such as UV-Vis spectroscopy. Preferably, the colorimetric change is visible to the naked eye. In an embodiment of the third aspect, the aptamer coats the NP in a ratio of the number of NP:aptamer of from about 1 :100 to about 1 :1. More preferably, a NP:aptamer ratio of from about 1 :50 to about 1 :1. Even more preferably, a NP:aptamer ratio of from about 1 :10 to about 1 :3. In a fourth aspect, the invention provides for a method of detecting a small molecule wherein the method comprises:

a. contacting a polynucleotide comprising the sequence 5'- AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3' SEQ ID No: 2 with a NP to coat the surface of the NP to provide a coated NP;

b. contacting the coated NP with a sample;

c. incubating the sample; and

d. analysing the sample and measuring change in colour, wherein the colour change is indicative of the presence of the target small molecule. Preferably, the polynucleotide sequence has 70, 71 , 72, 73, 74, 75, 76 ,77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 % identity to (SEQ ID No: 2) 5'-AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3'. Even more preferably the sequence has 71 % to 98 % identity. Even more preferably the sequence has 85 % to 72 % identity.

Preferably, the polynucleotide sequence is an aptamer. Preferably, the aptamer is selected from ssDNA and RNA. Most preferably the aptamer is ssDNA.

In an embodiment of the fourth aspect, the coating of the NP with the polynucleotide sequence is reversible. In an embodiment of the fourth aspect, there is an increase in the ζ-potential value of the aptamer coated NP when compared to the bare NP.

In an embodiment of the fourth aspect, the coated NP may be stable in solutions containing salt.

In an embodiment of the fourth aspect, the aptamer may optionally include a fluorescent tag.

In an embodiment of the fourth aspect, the aptamer is specific for small target molecules. The small target molecule to be detected may be selected from chemicals that mimic hormones, hormones, naturally occurring phytoestrogens, narcotics and metabolites thereof. Preferably, the small molecule is an endocrine disrupting compound, a steroidal sex hormone, metabolites or synthetic variants thereof. More preferably, the small molecule is selected from endocrine disrupting compounds, and metabolites thereof. More preferably, the small molecule belongs to the estrogenic family of compounds. Even more preferably, the small molecules are selected from 17 -oestradiol (E2); oestrone; oestriol; androstenedione; testosterone; dihydrotestosterone; pregnenolone; progesterone; 17a- hydroxyprogesterone, 17a-ethynylestradiol; isoflavones; lignans; coumestans; organohalides including organochlorines, polychlorinated organic compounds, polychlorobiphenyl (PCB); alkylphenols; alkylphenol ethoxylates; phthalates; bisphenol-A (BPA); Bis (4-hydroxyphenyl) methane; cholesterol; adenosine; triclosan; or synthetic steroids such as diethylstilboestrol (DES); cocaine, heroin and any metabolites of the mentioned compounds thereof. Even more preferably, the small molecule to be detected is selected from 17P~oestradioI, testosterone, progesterone, and adenosine. Alternatively, the small molecule to be detected may also be hormone or a marker of a condition of disease in a body. For example, the aptamer could be selective for the detection of hormones and/or metabolites to establish fertility, or status in an animal. Alternatively, the aptamer can be selected for the detection of known markers of disease, for example overexpression of a cancer gene to detect cancer, detection of molecules associated with infection, or to establish levels of specific metabolites associated with a particular condition.

In an embodiment of the fourth aspect the aptamer detects small target molecule is present in a sample. The sample may be an environmental sample, for example a water sample, soil sample, or even a plant sample. Alternatively, the sample may be from an animal, for example a tissue sample, a hair or wool sample, a urine sample, a blood sample, a serum sample, a saliva sample or a faecal sample.

In an embodiment of the fourth aspect, the nanoparticle may be selected from nanoparticles, microparticles and quantum dots. Even more preferably the nanoparticle is derived from a noble metal. The noble metal may be selected from gold, ruthenium, rhodium, palladium, silver, and platinum. Preferably the nanoparticle is a gold nanoparticle.

In an embodiment of the fourth aspect the aptamer detects levels of the small target molecule in the sample in a range of from about 1 pM to about 100 μΜ. More preferably, the aptamer detects the small target molecule in the sample in the range of from about 1 pM to about 100 μΜ. Even more preferably, the aptamer detects the small target molecule in the range of from about 200 pM to about 400 nM.

In an embodiment of the fourth aspect, the binding of the aptamer to the small target molecule is indicated by a colorimetric change. The colorimetric change may be identified by techniques such as UV-Vis spectroscopy. Preferably, the colorimetric change is visible to the naked eye.

In an embodiment of the fourth aspect, the aptamer coats the NP in a ratio of the number of NP:aptamer of from about 1 :100 to about 1 :1. More preferably, a NP:aptamer ratio of from about 1 :50 to about 1:1. Even more preferably, a NP:aptamer ratio of from about 1 :10 to about 1 :3.

In a fifth embodiment, the invention provides for a probe selective for E2, wherein the probe comprises a sequence selected from:

I. 5'-AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG-3'. Detailed Description

Definitions

Unless the context clearly requires otherwise, throughout the description and the claims, the words "comprise", "comprising" and the like, are to be construed in an inclusive sense as opposed to an exclusive or exhaustive sense, that is to say, in the sense of "including, but not limited to".

The term "animal" is intended to mean human and non-human subjects. For example, humans; domesticated stock including cows, sheep, goats, horses, pigs; domesticated pets including cats, dogs; wild animals including monkeys, birds, amphibians, reptiles; aquatic life forms such as fish.

The term "aptamer" as described herein is intended to mean a single strand of RNA or DNA that specifically binds to particular target molecules. The term "aptamer" relates to polynucleotide or oligonucleotide sequences. The terms "polynucleotide" or "oligonucleotide" may be used interchangeably and is a term commonly used and understood within the art. Those skilled in the art will readily understand that variation in the sequence code of the aptamer may be varied by standard methodology without substantially affecting the binding of the substrate to the NP-aptamer conjugate.

The term "conformational changes" means a change in the conformational form of the aptamer, for example, a change from a tightly folded structure to a loose linear-type structure that results in opening up of the binding site, or from a loose linear-type structure to a tightly folded structure. This type of alteration would be readily understood by those skilled in the art.

The term "estrogenic family" of compounds means compounds that are chemically related to estrogens. Estrogenic compounds may be natural or synthetic, steroidal or non-steroidal, and includes metabolites of such compounds.

The term "flanking sequences" means non-binding portion of the nucleotide sequences and may include primers. The term "increasing the ζ-potential value" means that the value becomes more negative. This would be readily understood and appreciated by those of skill in the art. The term "moderate salt concentration(s)" means ionic strength of up to about 30 mM.

The term "NP" or "nanoparticle" is also intended to encompass microparticles and quantum dots as well as nanoparticles. That is, nanoparticles, microparticles or quantum dots may be used, and use of one term throughout the specification is not intended to exclude the others, unless expressly stated. The term "NP" or "nanoparticle" is used throughout for convenience and consistency.

The term "relatively high concentration of aptamers" means greater than about 100 n . The term "relatively high E2 concentrations" means concentrations of about 1 μΜ.

The term "sample" is intended to mean a sample isolated or collected from an environmental or biological source and is located ex vivo. The sample may be of biological origin, isolated from an animal or may be collected from the environment. Sources of samples may include without limitation, for example soils, waterways, tissue, blood, serum, urine, saliva, faeces, hair and wool.

The term "salt" is intended to apply to non-toxic salts derived from inorganic or organic acids, including, but not limited by the following salts: halides (chloride, bromide, iodide, fluoride), acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptanoate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethanesulfonate, lactate, maleate, malonate, methanesulfonate, nitrate, oxalate, persulfate, phosphate, picrate, pivalate, propionate, p- toluenesulfonate, salicylate, succinate, sulfate, tartrate, thiocyanate, and undecanoate, and may comprise the cations selected from Na ⁺ , K ⁺ , Ca ²⁺ , g ²⁺ , Li ⁺ .

The term "small molecules" is intended to mean compounds of simple molecular structure with a Mw of from about 60 to about 2000 g mol ^"1 , preferably in the range of from about Mw 100 to 500 g mol ^"1 , more preferably of from about 150 to 350 g mol ^"1 . The molecular weight of such compounds and the calculation of the molecular weights are well known to those of skill in the art. Such compounds include, without limitation, hormone mimics, hormones, naturally occurring phytoestrogens, narcotics and metabolites thereof, organohalides and compounds such as ΙΤβ-oestradiol (E2); oestrone; oestriol; androstenedlone; testosterone; dihydrotestosterone; pregnenolone; progesterone; 17a-hydroxyprogesterone, 17a- ethynylestradiol; isoflavones; lignans; coumestans; organohalides including organochlorines, polychlorinated organic compounds, polychlorobiphenyl (PCB); alkylphenols; alkylphenol ethoxylates; phthalates; bisphenol-A (BPA); Bis (4-hydroxyphenyl) methane; cholesterol; adenosine; triclosan; or synthetic steroids such as diethylstilboestrol (DES); cocaine, heroin and any metabolites of the mentioned compounds thereof. As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise.

Discussion

The present inventors have shown that a specific 35-aptamer sequence (AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG) (SEQ ID No; 2) has a surprising and marked increase in its affinity to estrogenic type compounds. Specifically the shortened aptamer is particularly effective in colorimetric aggregation assays as a means for the detection of small molecules in samples, allowing detection in the pM range compared to the detection in the nM range for the 75-mer E2 aptamer of sequence 5'- ATACGAGCTTGTTCAATACGAAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTGTGG TGATAGTAAGAGCAATC-3' (SEQ ID No: 1 ).

Polynucleotide sequences are generally prepared by methodology known in the art for selecting sequences that bind to a specific target. One such example is the SELEX method. SELEX, or System Evolution of Ligands by Exponential Enrichment is a known method for producing single stranded DNA or RNA molecules that specially bind to a target (Ellington AD & Szostak JW (1990). Nature. 346:818-822,2 and Blackwell TK & Weintraub H (1990) Science 250:1104-1110 ). During the SELEX process, a library of randomly generated polynucleotide sequences are exposed to a target substrate. The randomly generated polynucleotide sequences that fail to bind to the target substrate are removed, usually by affinity chromatography while the polynucleotide sequences that are bound to the target substrate are replicated and amplified by standard amplification techniques such as PCR. The sequences are subject to further SELEX rounds, elution conditions are manipulated to identify polynucleotide sequences with the highest binding affinity for the target substrate.

The aptamers of the present invention are mixed with nanoparticles, and the aptamer coats the nanoparticles. It will be appreciated by those of skill in the art that the term "nanoparticle" is intended to include nanoparticles (NP), microparticles and quantum dots. That is, nanoparticles, microparticles or quantum dots may be used, and use of one term is not intended to limit and/or exclude the other types of particles, unless expressly stated. The electrostatic repulsion between the negatively charged phosphate backbone of aptamer and the citrate surface of the nanoparticles is balanced by the attractive interaction of nitrogen bases, with the NP surfaces [Brown, K.A., et al, 2008, J. Phys. C em. C, 12, 7517-7521]. This also results in an increase in the ζ-potential value of the NPs, for example from -23.5 mV (±0.28) to -40.2 mV (±0.9) and confirms adsorption of the aptamer to the nanoparticles, leading to a dispersion of aptamer coated NPs in solution that are also stable in moderate salt concentrations up to approximately 30 mM ionic strength. When the aptamer binds to a target molecule, a conformational change in the aptamer is induced and this reduces the aptamer affinity to the NPs. The dispersion thereby becomes destabilised towards salt [McKeague, et al,. 2012, J. Nucleic Acids, 748913 and Stoltenburg, R., et al., 2007, Biomol. Eng., 24, 381--403] and the target-bound aptamers dissociate from the NP surface. At an optimum ionic strength, the presence of the target small molecule is identified by a colour change observed when the free NPs (that are no longer protected by aptamers), aggregate with the target small molecule (Figure 1 ).

The degree of aggregation of the NPs to the target small molecule can be quantified by UV- vis absorption and is evident to the naked eye. The aggregation of the NPs to the target small molecule is indicated by colour observed. The colour change is dependent on the concentration of the target small molecule in the sample [Kim, Y.S., et al., 2010, Biosens.

Bioelectron., 26, 1644-9; Li, H., Rothberg, L, 2004, Proc. Natl. Acad. Sci. U. S. A., 101 ,

14036-9; Mei, Z., et al., 2013, Biosens. Bioelectron., 39, 26-30; Shi, H., et al., 2013, J. Hazard. Mater., 260, 754-761 ; Song, K.-M., et al., 2011 , Anal. Biochem,, 415, 175-81;

Yang, C, et al., 2011 , Biosens. Bioelectron., 26, 2724-7; Zheng, Y., 2011 , Sensors

Actuators B Chem., 156, 95-99],

The NPs selected for use with the aptamer of the invention must exhibit a change in optical absorption when aggregation is induced. In the case of noble metal nanoparticles such as gold, the surface plasmon resonance is very sensitive to aggregation, resulting in a strong visible signature. Other types of nanoparticles or microparticles could alternatively be used, including semiconducting particles, quantum dots or polymer nanoparticles. 75-mer aptamer (SEQ ID No: 1)

When the 75-mer E2 aptamer (SEQ ID No: 1 ) is mixed with AuNPs, the ζ-potential value of the AuNPs increases from -23.5 mV (±0.28) to -40.2 mV (±0.9), and is confirmed via a titration with salt, as shown in Figure 2. Aggregation is evidenced by the reduced relative absorption of the unaggregated (free) AuNP surface plasmon peak at 523 nm compared to the aggregated NPs. The aptamer-coated AuNPs lose resistance towards salt after incubating with 100 nM E2, and the aptamer dissociates from the AuNP surface (completely or partially) when binding to E2. This is supported by the less negative ζ-potential (-32.3 mV (± 0.9)) measured for the AuNP- 75-mer after incubation with 1000 nM E2. Figure 2 also identifies the optimal salt concentration required (23.8 mM) for E2 detection for the 75-mer aptamer. The AuNP-75- mer dispersion is on the edge of its stability and the introduction of E2 triggers significant aggregation.

It can be seen in Figure 3 that the AuNP-75-mer aptamer system results in detection of E2 at concentrations above 5 nM when aggregation is measured via absorption spectroscopy. 100 nM E2 can be easily visualised by the naked-eye. Binding induced aggregation turns the pink/red colloidal solution to purple/blue (Figure 4). Transmission electron microscopy and dynamic light scattering measurements exhibit larger aggregates in the presence of E2 consistent with E2-induced aggregation with the AuNPs (Figures 12-15). The lowest detected concentration of E2 using the 75-mer aptamer is 5 nM, with linearity (R ² = 0.92) over the range from 5 nM to 400 nM, before saturation occurs. The colorimetric signals are confirmed as arising from a specific interaction with the aptamer. It is important to note that in a control experiment no colorimetric response is observed when E2 is incubated with bare AuNPs or with poly-T coated AuNPs. Poly-T presents similar electrostatic adsorption properties as the aptamer, and does not interact with targets through a 3D conformation.

Progesterone (P4) and testosterone (T) at 200 nM concentrations also exhibit a strong response when contacted with the AuNP-75-mer colloidal solutions. Testosterone triggers a 55% response and progesterone a 68% response relative to E2 (Figure 5). However, the 75-mer aptamer does not show any selectivity towards the non-steroidal molecules (BPA and BPF).

35-mer aptamer (SEQ ID No: 2)

The 75-mer aptamer is reduced to a 35-mer aptamer by the removal of the 20-mer flanking sequences to provide an aptamer of sequence AAGGGATGCCGTTTGGGCCCAAGTTCGGCATAGTG (SEQ ID No: 2 and Figure 6). In the CD spectrum (Figure 7 and Figure 8), it can be seen that on reducing the sequence from a 75-mer aptamer (SEQ ID No: 1 ) to a 35-mer aptamer (SEQ ID No: 2), the minimum at 248 nm is retained; however, the 270 nm band splits into two overlapping bands at 265 nm and 295 nm, which collectively appear as a single broad feature. This change is a signature pattern of G-quadruplex formation [Karsisiotis, A.I., et al., 2011 , Angew. Chem. Int. Ed. Engl., 50, 10645-8; McManus, S. a, Li, Y., 2013, PLoS One, 8, e64131], and is consistent with previous reports showing that flanking sequences can hinder the formation of G- quadruplex structures [McManus, S. a, Li, Y., 2013, PLoS One, 8, e64131 ; Nonaka, Y., Sode, K., Ikebukuro, K., 2010, Molecules, 15, 215-25]. Incubation of the 35-mer aptamer with 0 μΜ E2 again show further changes In the CD spectrum. It should be noted that, the relatively high concentration of aptamers (greater than 100 nM) required to measure CD spectra can only be used to detect relatively high E2 concentrations (about 1 μΜ).

Adsorption of the 35-mer aptamer (SEQ ID No: 2) to the AuNPs is also confirmed by a more negative ζ-potential compared to the free AuNPs (from -23.5 mV (+0.28) to -29 mV (± 1 )). The smaller difference, compared to the 75-mer aptamer (vida supra), implies that there is a lesser degree of aptamer coverage on the AuNP. When the AuNP-35-mer aptamer is incubated with 1000 nM E2, the ζ-potential decreases to -25 mV (± 0.2). This value is close to the original value of the bare AuNP, meaning that most of the aptamers have completely dissociated from the AuNP surface in the presence of 1000 nM E2. The AuNP-35-mer aptamer has greater resistance to salt compared to the bare NPs (Figure 9). Sensitivity toward E2 is confirmed by the partial loss of resistance observed after incubation with 100 nM E2. When the AuNP-35-mer aptamer is titrated with different concentrations of E2, detection levels of 200 pM are observed (Figure 10). This result in 25- fold enhancement in the sensitivity of the AuNP-35-mer aptamer is observed under optimized salt concentration (23,8 mM), when compared with the 75-mer system (Figure 4). This is a significant and unexpected degree of increase in sensitivity compared to the large 75-mer.

The present invention was also applied to the testing of E2 in rat urine. Significant aggregation is observed when citrate coated AuNPs are exposed to 5 % urine without additional salt (Figure 16). The ionic strength of the rat urine (2.1 mM, as estimated by the conductivity measurement shown in Figure 17) is too low to account for the aggregation based on the stability of AuNPs at up to 10 mM ionic strength in water. However, inclusion of the 35-mer aptamer prevents aggregation in the presence of 5 % urine, and leads to tolerance towards ionic strengths of over 60 mM (over two-fold greater than in water). This observation highlights the potential of the urine matrix to interfere with aggregation based sensing, for example the ability of urine-based proteins and other molecules to sequester ions or adsorb on the surface of AuNPs. Repeating the salt titration experiment in the presence of E2 reveals an optimal ionic strength of 57 nM for sensing E2 in rat urine can be seen in Figure 16a. Figure 16b shows that E2 is detected visually and spectroscopically in concentration ranges from 5 nM up to 1 μΜ, with a linear response between 50 nM to 800 nM (R ² = 0.95) before saturation occurs. Figure 16c also confirms that the sensor retains excellent discrimination against potentially interfering molecules in urine, including those from the same steroidal hormone family. While the sensitivity is 25-fold lower than in water (Figure 2, 10 and 11 ), the improvements resulting from removing a flanking nucleotide sequences are still enough to detect low concentrations of E2 in physiological fluids. On the other hand, the level of detection was found to increase by three orders of magnitude to 5 μΜ for the longer 75-mer system (Figure 16b) which is likely to prevent its practical application. It is ensured that specific binding interactions are resolved via the lack of response when the aptamers were replaced with poly-T. The inventors have successfully shown that the performance of the 35-mer aptamer surpasses existing colorimetric aptasensors providing detection limits to p levels. Without wishing to be bound by theory, it is thought that the improvement in sensitivity and selectivity can be attributed to two factors: i) improved aptamer affinity for small molecules, possibly associated with the observed stabilisation of G-quadraplexes when flanking sequences are eliminated, and ii) suppressed residual affinity of target bound aptamers to AuNPs.

The examples described herein are for purposes of illustrating embodiments of the invention. Other embodiments, methods, and types of analyses are within the capabilities of persons of ordinary skill in the art and need not be described in detail herein. Other embodiments within the scope are considered to be part of this invention.

Abbreviations

AuNP Gold nanoparticles

BPA bisphenol A

BPF Bis(4-hydroxyphenyl methane)

HAuCL, Chloroauric acid

DLS Dynamic Light Scattering

D _t particle diffusion coefficient

E2 17 -oestradiol

FWHM Full Width at Half Maximum

MP microparticle

NP nanoparticle

PALS Phase Analysis Light Scattering

PTA Particle Tracking Analysis P4 Progesterone

ssDNA single strand DNA

T Testosterone

RPS Resistive Pulse Sensing

Description of the Figures

Figure 1 is a schematic depiction of aggregation in the colorimetric assay of E2.

Figure 2 shows determination of the optimal salt concentration (indicated by the dashed arrow) for signal generation by comparison between the salt dependent aggregation of AuNPs («), AuNP-75-mer aptamer (·), and AuNP-75-mer aptamer in the presence of 100 nM E2 (A). Aggregation is measured via the relative absorption at 523 nm as indicated in the inset.

Figure 3 shows raw UV-vis spectra for sensing E2 using the 75-mer aptamer, 0 nM (□), 5 nM (O), 100 nM ( O), 200 nM (^ ) and 400 nM ( ).

Figure 4 shows colorimetric response towards a range of E2 concentrations for the AuNP- 75-mer aptamer (□) when compared with bare AuNPs (O) and AuNP-poly-T controls (Δ). The colour change over the range is from pink/red colloidal solution to purple/blue. Error bars indicate standard deviation of the mean of three experiments.

Figure 5 shows specificity examination of the 75-mer aptamer towards a number of interfering targets at 200 nM concentration. Error bars indicate standard deviation of the mean of three experiments.

Figure 6 shows secondary structure of the 75-mer aptamer predicted by M-fold program indicating the truncation positions.

Figure 7 shows CD spectra for 400 nM of the 75-mer incubated with 0 μΜ (·) E2 and 10 μΜ E2 (A). Figure 8 shows CD spectra for 600 nM of the 35-mer aptamers, incubated with 0 μΜ E2 (·) and 10 μΜ E2 (A.).

Figure 9 shows determination of the optimal salt concentration, indicated by the dashed arrow at 24 mM, for signal generation comparison between the salt dependent aggregation of AuNPs (·) , AuNP-35-mer aptamer (♦), and AuNP-35-mer aptamer in the presence of 100 nM E2 (A).

Figure 10 shows colorimetric responses towards a range of E2 concentrations using the AuNP-35-mer aptamer (□) when compared with bare AuNPs (O) and AuNP-poly-T (Δ) controls (figure inset indicated an extended linear response of the same figure). Error bars indicate standard deviation of the mean of three experiments.

Figure 11 Shows the selectivity of the AuNP-35-mer aptamer colloidal solution for target small molecules at 800pm concentration. Error bars indicate standard deviation of the mean of three experiments.

Figure 12 TEM image (left) and photographs (right) showing the pinkish colour of AuNPs + 0.1 nmol 75-mer aptamer

Figure 13 TEM image (left) and photographs (right) showing the pinkish-red colour of AuNPs + 0.1 nmol 75-mer aptamer and the detection of 100 nM E2.

Figure 14 TEM image (left) and photographs (right) showing the purplish - blue colour of AuNPs + 0.1 nmol 75-mer aptamer and the detection of 400 nM E2.

Figure 15 shows DLS size characterisation for AuNPs + 0.1 nmol 75-mer aptamer (■) and the detection of 100 nM E2 (·) and 400 nM (A). Figure 16 shows (a) Salt dependent aggregation of AuNP-35-mer aptamer and AuNP-35- mer aptamer + 100 nM E2 in rat urine (optimal salt concentration indicated by the black arrow). Photographs of AuNPs and AuNP-35-mer aptamer before and after addition of 5 pl_ rat urine are shown in the inset, legend: · = 35-mer +100 nM E2, ■ = 35-mer; (b) Colorimetric aptasensor response towards a range of E2 concentrations in spiked rat urine using the AuNP-35-mer and AuNP-75-mer aptamers (photograph of the same samples in the top panel) compared with AuNP-poly-T control, legend: □- 35-mer, O- polyT, Δ-75- mer. (d) Specificity examinations of interfering molecules (at 200 nM) in rat urine samples using the AuNP-35-mer aptamer colloidal solution. Error bars indicate standard deviation of the mean of three experiments. Figure 17 shows Standard calibration curve of the conductivity of NaCI solutions to estimate the ionic strength of rat urine. 10 μί. of the rat urine was diluted to 15 ml_, using Milli-Q water, and the conductivity was measured. The final ionic strength of the rat urine sample is 2.1 m ; legend:— diluted rat's urine, —— conductivity calibration curve using NaCI. Figure 18 shows a photograph (top) and UV-vis spectra of the specificity results using the 35-mer aptamer in rat urine samples spiked with 200 nM BPA, BPF, progesterone (P4) and testosterone (T), and E2; legend: «-ΒΡΑ, B-control, - E2, A-BPF, T-T, 4-P4.

Figure 19 shows the absorption spectra of E2 sensing in rat urine samples using the 75-mer aptamer; legend: e-0 E2, *-5 μΜ E2, A-15 μΜ E2, T-25 μΜ E2, -35 μΜ E2, - 50 μΜ

E2.

Figure 20 shows determination of the dissociation constant (K _D ) for the 35-mer aptamer. a) Representative emission spectra of E2 in BWB. b) Calibration curve of E2 and fluorescent intestines of E2 after reaction with NP-35-mer. c) Saturation binding curve of E2 with the NP-35-mer. Experimental data (from plotting normalised unbound fraction f _a against E2 concentration) was fitted using a non-linear regression function as explained in the Methods section in the main text. Examples

17 -estradiol (E2), progesterone, testosterone, Bis(4-hydroxyphenyl methane) (BPF), bisphenol-A (BPA), E2 75-mer aptamer, truncated version 35-mer, poly-thymine ( 8) (poly T) Chloroauricacid (HAuCI ₄ ) and sodium chloride (NaCI) are purchased from Sigma-Aldrich. The aptamers are dissolved in Milli-Q water and stored at -5 °C prior to use. Milli-Q water is used in all experiments (unless stated), and all other chemicals are of analytical grades purchased from standard chemical suppliers.

The aptamers of the present invention can be synthesised by standard synthetic methodologies commonly known and understood by those in the art, for example, synthesis by SELEX. General procedure for the preparation of NPs:

Nanoparticles suitable for application with this invention can be prepared according to standard literature methods. For example: synthesis of AuNPs is described in Jana et al,, 2001 ; synthesis of PtNPs is described in Teranishi et al., 1999; synthesis of AgNPs, is described by Yin et al., 2002); synthesis of PdNPs is described by Ge et al., 2007; synthesis of CoNPs is described by Redel et al., 2009; and synthesis of CuNPs can be found in Wu and Chen, 2004.

Procedure for Synthesis of AuNPs:

HAuCI ₄ (100 mL, 1 mM) is reduced with sodium citrate (10 mL, 38.8 mM) to provide AuNPs of 10nm diameter (Figure 12). [Grabar, K.C., et al, Anal.Chem., 1995, 67, 1217-1225]. An aqueous solution of HAuCI ₄ (100 mL, 1 mM) is vigorously stirred at 250 °C for 0 min and a solution of sodium citrate (10 mL, 38.8 mM) is added at once. The solution is boiled for 10 minutes, and is stirred for another 15 minutes at room temperature. AuNPs solution is stored at 4 °C prior to use. The concentration of AuNPs is calculated according to the Beer- Lambert law, using an extinction coefficient of 2.7 10 ⁸ M ^"1 cm ^"1 at 525 nm [Haiss, W., et al., Anal. Chem., 2007, 79, 4215-21]. The concentration of the AuNPs is estimated to be 14 nM. General Procedure for AuNP-aptamer blending/co-incubation:

Those of skill in the art will realise that the procedure for coating the NPs is a standard general procedure and can be applied to other NPs suitable for application with the invention. AuNPs are used for exemplification and the procedure is not restricted only to AuNPs.

AuNPs are purified by a 1 :10 dilution of AuNPs in Milli-Q water, centrifugation at 12,500 rpm for 15 minutes (MIKRO 120- Hettich). The AuNPs are then re-suspended in Milli-Q water at the original 1 :10 dilution. The removal of the excess citrate is confirmed by ζ-potential values of (-33.46 mV (± 0.35)) before and (-23.5 mV (± 0.28)) after purification. A 0.1 nmole solution of the aptamer in Milli-Q water, or poly-T in the case of control experiments, is prepared and immediately added to the purified AuNPs suspended in 0.3 mL of Milli-Q water, to provide an aptamer concentration of 33.3 nM, with an aptamer: particle number ratio of 3:1 , for a particle number of 2.5 ^χ 10 ¹³ . The NP-aptamer samples are prepared 1 hour prior to sensing experiments.

General Procedure for the preparation of target substrates Appropriate volume of 100% analytical grade EtOH was added to the distilled water to achieve a final working solution with 5% (v/v) EtOH-distilled water solution. Appropriate volumes of the target molecule stock solution (prepared in 100% EtOH) were diluted using the 5% EtOH-dH ₂ 0.

General Procedure for target detection

The sensing of all small molecules was carried out in three independent experiments.

Appropriate concentrations of the target molecule working solutions were added to 100 pL of AuNP-aptamer solution and incubated for 10 mins at room temperature. Subsequently, optimal volume of 0.5 M NaCI solution was added to induce the aggregation of AuNPs which are no longer protected by the adsorbed aptamer molecules. The microcentrifuge tubes containing the solutions were immediately vortexed for 10 sec before analysing for visible colour change and aggregation of AuNPs. The sensing was confirmed by UV-visible spectrophotometer analyses of the solution (100- 800 nm wavelength). For experimental control, 20 μί- of 5% (v/v) EtOH-natural water was added to 100 μΙ_ of AuNP-aptamer complex and treated exactly as the samples.

General Procedure for Salt titration experiments:

Those of skill in the art will realise that this procedure is a standard general procedure and can be applied to other NPs suitable for application with the invention. AuNPs are used for exemplification and the procedure is not restricted only to AuNPs.

The ionic strength of the aptamer solution is independently adjusted to the values stated in Figure 9, by adding different volumes of 0.5 M NaCI to 100 pL samples of bare NPs, NP- aptamer, or NPs-aptamer + 100 n E2. For example, the optimum ionic strength for the AuNP-75-mer aptamer system is 23.8 mM. The samples are allowed to stand for 15 minutes before measuring the degree of aggregation by UV-vis absorption at 523 nm.

General Procedure for K _D measurement:

The procedure for estimating the K _D of the 35-mer was based on that used for the 75-mer [Alsager, O. A; Kumar, S.; Willmott, G. R.; McNatty, K. P.; Hodgkiss, J. M. Biosens. Bioelectron. 2014, 57C, 262]. The aptamer was immobilized on polystyrene nanoparticles, exposed to aliquots of E2, and the fraction bound E2 was measured via UV fluorescence and fit to a binding isotherm after separation of the nanoparticles from the supernatant. 200 nmol of EDC and NHS (20 μΙ_ of 0.01 M in ES) was added to activate 400 pL of carboxylate polystyrene nanoparticles (NPs, 5.2 x 10 ¹⁰ particle mL ^"1 ) in MES for 40 min, followed by addition of 0.1 nmol of 35-mer aptamer and incubation overnight. The samples were centrifuged at 14000 rpm for 30 min and the supernatant was discharged. 1 mL E2 with various concentrations in BWB containing 5% ethanol was added to the samples, sonicated for 10 mins, and incubated overnight. The samples were then centrifuged at 14000 rpm for 30 min, the supernatant was isolated, transferred to a 1 cm quartz cuvette, and the fluorescence of the unbound E2 was collected via 279 nm with a Shimadzu RF-5301 PC spectrofluorophotometer. The measured fluorescence intensities at 310 nm were first converted to concentration via an E2 calibration curve. By expressing a measured E2 concentration as an unbound fraction, f _a , and plotting against total E2 concentration, the K _D was determined as 10 nM by fitting to the binding isotherm in equation 1. We observed a saturation offset at f _a = 0.6 due to partial loss of the NP-35-aptamer conjugate during the centrifugation, and renormalized to f _a (max) 1.

Procedure for E2 detection:

Those of skill in the art will realise that this procedure is a standard general procedure and can be applied to other NPs suitable for application with the invention. AuNPs are used for exemplification and the procedure is not restricted only to AuNPs.

Sample water is collected from the Hutt River, Wellington, New Zealand and pre-treated by stirring 50 mL overnight at room temperature with 1 g of activated charcoal and filtering twice through 0.22 pm syringe-filters to provide treated water. The conductivity of the treated water is measured as 100 ps cm ^"1 (at 25 °C with the pH is 8). Alternatively, Milli-Q water is used instead of treated river water. Stock solutions of the target small molecules are made in ethanol before adding appropriate volumes to the treated water or Milli-Q water, and adjusting the final ethanol content to 5%, ensuring sufficient target small molecule solubility. 20 pL of the pre-treated test samples are added to 100 μί. of AuNP-aptamer solution to obtain different E2 concentrations and provide a total reaction volume of 120 pL. Control samples are made up from blank water containing 5% ethanol. Samples are incubated for 10 minutes at room temperature to facilitate binding to the target. The optimised NaCI concentration determined from the salt titration experiments is added to the target detection solutions (10 mM for bare NPs, 23.8 mM for poly-T/E2 aptamer samples), followed by gentle shaking, The samples are visually inspected after 15 minutes, and the UV-vis absorption of 5 pL aliquots is measured using a Thermo Scientific NanoDrop™ 1000 Spectrophotometer. Animal Urine Study: Rat urine is collected from sexually mature ship rats (Rattus rattus), filtered with 0.22 pm syringe-filters, and spiked with E2 and interfering molecules after adjusting the content of ethanol to 5% (control rat urine sample comprised blank rat urine containing 5% ethanol). 5 pL of spiked urine is added to 100 pL AuNP-poly-T, AuNP-75-mer aptamer or AuNP- 35-mer aptamer, incubated at 50 °C for 10 min, followed by addition of optimised NaCI (57.4 mM), gentle shaking, visual inspection after 15 min and measurement of UV-vis absorption as described above.

ζ-potential measurements forAu nanoparticles:

Those of skill in the art will realise that this procedure is a standard general procedure and can be applied to other NPs suitable for application with the invention, AuNPs are used for exemplification and the procedure is not restricted only to AuNPs.

120 pL samples of bare AuNPs, AuNP-aptamer, and AuNP-aptamer in the presence of 100 nM E2 in milli-Q water, are incubated at room temperature for 1 hour and are centrifuged at 12,500 rpm for 15 minutes. The excess aptamer is removed by decantation of the supernatant and the NPs are re-suspended in 1 mL Milli-Q water. Samples are loaded in a folded capillary cell, inserted into a Zetasizer Nano ZS equipped with a 633 nm laser (Malvern Instruments, UK) and equilibrated at 25 °C for 2 minutes prior to measurement. Measurements are made in triplicate, with fixed parameters of pH 7, viscosity 0.887 mPa s, and refractive index of 1.33. The measurements are reported as average value ± standard deviation.

CD studies:

1 mL solutions of the 75-mer and 35-mer aptamers at 400 nM and 600 nM, respectively, are prepared in water containing 5% ethanol, 23.8 mM NaCI, and 0 or 10 pM of E2. Samples are measured in a 1 cm path length quartz cell. CD spectra are measured using a Chirascan CD spectrometer instrument over the wavelength range from 200 to 400 nm, scanned at 200 nm per minute. References

Alsager, 0. A, Kumar, S„ Willmott, G.R., McNatty, K.P., Hodgkiss, J.M., 2014. Biosens.

Bioelectron. 57C, 262-268.

Brown, K.A., Park, S., Hamad-Schifferli, K., 2008. J. Phys. Chem. C 112, 7517-7521.

Campbell, C.G., Borglin, S.E., Green, F.B., Grayson, A., Wozei, E., Stringfellow, W.T., 2006.

Chemosphere 65, 1265-80.

Cekan, P., Jonsson, E.O., Sigurdsson, ST., 2009. Nucleic Acids Res. 37, 3990-5.

Cruz-Aguado, J. a, Penner, G., 2008. J. Agric. Food Chem. 56, 10456-61.

Ellington, A.D., Szostak, J.W., 1990. Nature 346, 818-22.Ge, J„ Xing, W., Xue, X., Liu, C, Lu, T., Liao, J., 2007. J. Phys. Chem. C 111, 17305-17310.

Geyer, H.J., Rimkus, G.G., Scheunert, I., Kaune, A., Kettrup, K.S.A., G, M.Z.D.C., Larry, M., Donald, G.H., 2000. Bioaccumulation - New Aspects and Developments. Springer- Verlag, Berlin/Heidelberg.

Grabar, K.C., Freeman, R.G., Hommer, M.B., Natan, M.J., 1995. Anal. Chem. 67, 1217- 1225.

Haiss, W., Thanh, N.T.K., Aveyard, J., Fernig, D.G., 2007. Anal. Chem. 79, 4215-21.

He, J., Liu, Y., Fan, ., Liu, X., 2011. J. Agric. Food Chem. 59, 1582-6.

Huizenga, D.E., Szostak, J.W., 1995. Biochemistry 34, 656-65.

Jana, N.R., Gearheart, L, Murphy, C.J., 2001. Adv. Mater. 13, 389-1393.

Jin, R., Wu, G., Li, Z., Mirkin, C.A., Schatz, G.C., 2003. J. Am. Chem. Soc. 125, 1643-54.

Jo, M., Ahn, J.-Y., Lee, J., Lee, S., Hong, S.W., Yoo, J.-W., Kang, J., Dua, P., Lee, D.-K., Hong, S., Kim, S., 2011. Oligonucleotides 21 , 85-91.

Karsisiotis, A.I., Hessari, N.M., Novellino, E., Spada, G.P., Randazzo, A., Webba da Silva, M„ 2011. Angew. Chem. Int. Ed. Engl. 50, 10645-8.

Kim, Y.S., Jung, H.S., Matsuura, T., Lee, H.Y., Kawai, T., Gu, M.B., 2007. Biosens.

Bioelectron. 22, 2525-31.

Kim, Y.S., Kim, J.H., Kim, I A, Lee, S.J., Jurng, J., Gu, M.B., 2010. Bioelectron. 26, 1644-9.

Li, H., Rothberg, L, 2004. Proc. Natl. Acad. Sci. U. S. A. 101, 14036-9.

McKeague, M., Derosa, M.C., 2012. J. Nucleic Acids 2012, 748913.

McManus, S. a, Li, Y., 2013. PLoS One 8, e64131.

Mei, Z., Chu, H., Chen, W., Xue, F., Liu, J., Xu, H., Zhang, R., Zheng, L, 2013. Biosens.

Bioelectron. 39, 26-30.

Nonaka, Y„ Sode, K., Ikebukuro, K., 2010. Molecules 15, 215-25.

Redel, E., Kramer, J., Thomann, R., Janiak, C, 2009. J. Organomet. Chem. 694, 1069- 1075.

Shi, H., Zhao, G., Liu, M., Fan, L, Cao, T., 2013. J. Hazard. Mater. 260, 754-761. Song, K.-M., Cho, „ Jo, H., Min, K., Jeon, S.H., Kim, T„ Han, M.S., Ku, J.K., Ban, C,

2011. Anal. Biochem. 415, 175-81.

Stoltenburg, R„ Reinemann, C, Strehlitz, B., 2007. Biomol. Eng. 24, 381-403.

Teranishi, T., Hosoe, M., Tanaka, T., Miyake, M., 1999. J. Phys. Chem. B 103, 3818-3827. Tuerk, C, Gold, L, 1990, Science (80), 249, 505-510.

Vorlickova, M., Kejnovska, I., Bednarova, K., Renciuk, D., Kypr, J., 2012. Chirality 24, 691- 8.

Wu, J., Chu, H., Mei, Z., Deng, Y., Xue, F., Zheng, L, Chen, W., 2012. Anal. Chim. Acta 753, 27-31.

Wu, S.-H., Chen, D.-H., 2004. J. Colloid Interface Sci. 273, 165-9.

Xue, F., Wu, J., Chu, H., Mei, Z., Ye, Y., Liu, J., Zhang, R., Peng, C, Zheng, L, Chen, W.,

2012. Microchim. Acta 180, 109-115.

Yang, C, Wang, Y. , Marty, J.-L, Yang, X., 2011. Biosens. Bioelectron. 26, 2724-7.

Yin, Y., Li, Z.-Y., Zhong, Z., Gates, B., Xia, Y., Venkateswaran, S„ 2002. J. Mater. Chem.

12, 522-527.

Zhao, W., Brook, M. a, Li, Y., 2008. Chembiochem 9, 2363-71.

Zheng, Y., Wang, Y., Yang, X., 2011. Sensors Actuators B Chem. 156, 95-99.