Field of the invention

The present invention relates to a polypeptide and to a nucleic acid encodingsaid polypeptide, which is involved in the neurite outgrowth stimulating properties of olfactory ensheathing glia (OEG) in the olfactory nerve layer of the primary olfactory nervous system and in the different interaction effects of OEG and Schwann cells (SCs) with meningeal cells (MCs) . These nucleic acids are useful in a method for the treatment of humans after neurotraumatic injury, e.g. after lesion, avulsion or contusion of nerve tissue or spinal cord injury.

Background of the invention

In contrast to the CNS, the primary olfactory nervous system is able to recover following traumatic or toxin-induced injury. Following a lesion, new primary olfactory neurons are formed from a compartment of stem cells in the basal region of the olfactory neuroepithelium (Farbman 1990; Graziadei and Graziadei 1979; Harding et al. 1977) and the newly formed primary olfactory neurons are extending axons towards the olfactory bulb (Doucette et al. 1983; Graziadei and Graziadei 1979; Graziadei et al. 1978). As soon as the axons enter the lamina propria, they become ensheathed by olfactory ensheathing glia (OEG) (Barber and Lindsay 1982; Doucette 1990). In the olfactory nerve layer (ONL), OEG facilitate the entrance of olfactory axons into the CNS and support axonal growth towards the glomeruli where synaptic connections are formed with second order neurons.

Cultured OEG support neurite outgrowth of primary olfactory neurons (Kafitz and Greer 1999; Ramon-Cueto et al. 1993) and of other types of neurons, including dorsal root ganglion neurons, cortical neurons, cerebellar granule neurons and retinal ganglion cells (Au et al. 2007; Chung et al. 2004; Leaver et al. 2006; Sonigra et al. 1999; Van Den Pol and Santarelli 2003). A number of molecules have been implicated in the regeneration-promoting effects of OEG. OEG express neurotrophic growth factors, including nerve growth factor, brain derived neurotrophic factor, glial cell line- derived neurotrophic factor and ciliary neurotrophic factor (Boruch et al. 2001; Lipson et al. 2003; Wewetzer et al. 2001; Woodhall et al. 2001). OEG express a number of cell adhesion molecules and extracellular matrix proteins that may contribute to a growth- supportive environment, including Ll, N-CAM, fibronectin, laminin and collagen type IV (Doucette 1996; Kafitz and Greer 1997; Miragall et al. 1988). In addition, matrix metalloproteinase 2 (MMP2) was recently identified to play a role in the neurite- outgrowth promoting properties of OEG (Pastrana et al. 2006).

Since OEG support axonal growth in the olfactory system and in culture, the capacity of OEG to stimulate regeneration in the lesioned spinal cord following transplantation was studied extensively. Transplanted OEG promote axonal sprouting and sparing of both descending and ascending axons and they are able to remyelinate axons (Li et al. 1997; Ramon-Cueto et al. 2000; Ramon-Cueto et al. 1998; Sasaki et al. 2006; Smith et al. 2002). Furthermore, OEG reduce the formation of cystic cavities and they promote angiogenesis (Plant et al. 2003; Ramer et al. 2004; Ruitenberg et al. 2005). The beneficial effects of OEG transplants on neuroregeneration in the injured spinal cord also became evident as these transplants promote a certain degree of functional recovery.

SCs also promote axonal sprouting after transplantation and are able to remyelinate axons (Baron- Van Evercooren et al. 1992; Felts and Smith 1992; Kromer and Cornbrooks 1985; Li and Raisman 1994; Paino et al. 1994; Takami et al. 2002). However, OEG and SCs differ in their interaction behavior with the two main cellular components of the neural scar, astrocytes (ACs) and meningeal cells (MCs). In contact with SCs, ACs become hypertrophic and show an increased expression of growth- inhibitory chondroitin sulphate proteoglycans (CSPGs) in vitro and in vivo (Garcia- Alias et al. 2004; Lakatos et al. 2003; Takami et al. 2002). SCs and ACs are unable to mix and the interface of both cell types forms a barrier for regrowing axons (Carlstedt 1997; Golding et al. 1997; Lakatos et al. 2000). In contrast to SCs, OEG associate freely with ACs without inducing hypertrophy (Lakatos et al. 2000). In addition to ACs, OEG and SCs also respond differently to cellular contact with MCs. Whereas OEG are able to intermingle with MCs, SCs aggregate and form distinct cell clusters when cocultured with MCs. The distinct interaction behavior of OEG and SCs with scar tissue cells may have important implications for the interpretation of the effects of both cell types after implantation. It will therefore be important to elucidate the molecules responsible for the distinct interaction behavior of OEG and SCs with scar tissue cells in order to improve the effects of cellular transplants. A number of proteins have been implicated in the interaction difference of OEG and SCs with ACs. These include the cell adhesion molecule N-cadherin, CSPGs and heparin sulphate proteoglycans (HSPGs) (Fairless et al. 2005; Grimpe et al. 2005; Santos-Silva et al. 2007; Wilby et al. 1999). Inhibiting the function of N-cadherin as well as degrading CSPGs resulted in more SC-AC intermingling.

In order to identify novel molecules involved in the neuroregeneration- promoting properties of OEG, we have performed two microarray studies. First, the gene expression profile of OEG in the ONL was analyzed at different time points after lesioning the neuroepithelium. Second, the transcriptome of cultured OEG (cOEG) was compared with the transcriptome of cultured SCs (cSCs) and of nOEG. In the present study, we used these two gene expression data sets to identify genes involved in the neurite outgrowth promoting properties of OEG and in the different interaction behavior of OEG and SCs with MCs. We selected 176 target genes that exhibited interesting expression changes in the microarray experiments and that are, based on literature research and gene ontology analysis, potentially involved in 'the stimulation of neurite outgrowth' and 'the interaction behavior with MCs'. Two bioassays, an outgrowth assay and a cluster assay, were established in 96-wells plate format. By using siRNA-mediated knockdown analysis and the Cellomics' High Content Screening platform, we employed medium-throughput functional analysis of an initial set of 60 target genes. We show effects of 7 genes in OEG-mediated stimulation of neurite outgrowth and of 2 genes in cluster formation of SCs.

Brief description of the drawings

Figure 1. Schematic representation of selection criteria used to refine the number of candidate genes. The number of selected genes in each step is represented. A. Selection criteria used for approach 1; gene expression analysis of nOEG in the ONL after lesion. First, genes upregulated after injury with a log ratio of at least 0.5 and a p-value<0.001 were included. Second, only genes upregulated at 3 to 10 days after the lesion were selected, the time period in which new olfactory axons reach the ONL. Third, genes that could be involved in 'neurite outgrowth stimulation' based on their putative function as documented in the literature were selected. Finally, only genes upregulated in the ONL after injury were selected (genes selected for knockdown), which eventually resulted in a list of 84 candidate genes. B. Selection criteria used for approach 2; gene expression analysis of cultured OEG. Similar selection criteria were applied to the cOEG-cSC comparison and the cOEG-nOEG comparison. First, genes with a ² log ratio of at least 1.5 and a p-value<0.001 were included. Second, genes that could be involved in 'the stimulation of neurite outgrowth' or in 'the interaction properties with MCs' were selected based on their gene ontology annotation. Third, the cOEG-cSC comparison and the cOEG-nOEG comparison were linked and genes higher expressed in cOEG in both comparisons were selected as well as genes lower expressed in cOEG in both comparisons (correlated expression changes). The fourth criterium was applied to all genes that did not pass the third criterium. Genes associated with neurite outgrowth or cellular interaction in the literature were added to the list of candidate genes. Finally, target genes were selected for knockdown, which means that for the cOEG-nOEG comparison only genes higher expressed in cOEG than nOEG were selected. This resulted in a final list of 99 candidate genes.

Figure 2. Determination of transfection and knockdown efficiency. A. Transfection of cOEG with the fluorescent control siRNA siGlo Lamin A/C resulted in a transfection efficiency of 75%. Transfection efficiency was based on the number of cells labeled with the fluorescent marker siGlo (red) as percentage of the number of total cells

(Hoechst, bleu). Scalebar = 100 μm. B. Transfection of cOEG with siGlo Lamin A/C resulted in a 83% knockdown efficiency of lamin A/C after 2 days and after 7 days there was still a reduction of 66%. C. Transfection of cSCs with siRNAs for P75 and

GAP-43 resulted in a knockdown efficiency of respectively 89% and 91% after three days. D. A clear reduction of P75 and GAP-43 protein levels could be observed after staining cSCs for P75 and GAP-43 at three days after transfection with siRNA for P75 and GAP-43 (KD = knockdown) Scalebar = 100 μm.

Figure 3. Standardization of the outgrowth and cluster bioassays. Bioassays were standardized using the following 4 types of controls: siGlo, siCtrl, mock and untreated. A. Representative pictures of the outgrowth assay consisting of dissociated DRG neurons plated on an untreated monolayer of OEG (left) and after tracing the neurites using the Cellomics Neuronal Profiling Bioapplication (right). The Bioapplication included identification of neuronal cell bodies, neurites and branch points. Scalebar = 100 μm. B. In the outgrowth assay, total neurite length of DRG neurons gradually increased in time in all conditions. No statistical significant differences were observed between the 4 controls. C. In the OEG-cluster assay, no cell clusters were formed and the total cluster area did not increase over time. No statistical significant differences were observed between the 4 controls. D. In the SC-cluster assay, total cluster area increased over time. Transfection with siCtrl resulted in a statistical significant lower total cluster area then the mock (p=0.015) and the untreated (p=0.001).

Figure 4. Functional validation of candidate genes in the outgrowth assay. A. From the 52 genes tested in the outgrowth assay, 11 genes showed a statistical significant effect in the first experiment. For these 11 genes, the p-values for each individual experiments are represented. Differences were considered statistically significant if p<0.05 (indicated by a dotted line). From the 11 genes, listed on the right, knockdown of 8 genes resulted in a statistical significant reduction of neurite outgrowth in at least 2 of 3 independent experiments. These genes were defined as 'hits' and are marked with an asterisk. Nptxl did show a significant effect in the first and last experiment, but in the last experiment the total neurite length was not reduced (see graphs) B. Graphs of the outgrowth assays from the 9 hits. Graphs of the three independent experiments are shown. Each graph shows the increase of total neurite length of DRG neurons in time on OEG following knockdown of the particular candidate gene compared to the control.

Figure 5. Graphs of the SC-cluster assays. The three graphs represent three independent experiments. Each graph shows the increase of total cluster area in time of SCs in coculture with MCs following knockdown of P75 or GAP-43 compared to the control. Knockdown of P75 in cSCs resulted in a statistical significant decrease of the total cluster area in the first two experiments. Knockdown of GAP-43 in cSCs resulted in a statistical significant decrease of the total cluster area in all 3 independent experiments. Figure 6. Graphs of neurite outgrowth assays. The graph represents the average increase of neurite outgrowth lengths in time of 3 independent experiments. OEG were infected with a lentiviral overexpression construct containing the full coding sequence of the rat Scavenger receptor class B, member 2. The overexpression resulted in a statistical significant increase (p<0.05, (student T-test)) in neurite length as compared to the control condition.

Figure 7 Graphs of neurite outgrowth assays. The graph represents the average increase of neurite outgrowth lengths per neuron in time of 2 independent experiments. Fibroblasts were infected with a lentiviral overexpression construct containing the full coding sequence of the rat Scavenger receptor class B, member 2. Neurons were allowed to grow on these fibroblasts for 24hr. The overexpression resulted in a statistical significant increase of 70% (p<0.01, (one-way Anova)) in neurite length as compared to the control condition. Table 1. Gene Ontology classes including their children that were used for selection of candidate genes. To select genes involved in 'the stimulation of neurite outgrowth' or involved in 'the interaction properties with MCs' in approach 2, all target genes belonging to the presented GO-classes or to one of their branches were selected.

Table 2. List of 60 target genes tested in the outgrowth and cluster assays. The microarray approach in which each gene was identified is represented in the third column; approach 1 refers to the gene expression analysis of the olfactory nerve layer after injury and approach 2 refers to the gene expression analysis of cultured OEG. For approach 2, it is indicated in which comparison the gene was identified; OnO refers to the comparison between cOEG and nOEG and OS refers to the comparison between cOEG and cSCs. For this last comparison it is indicated in which cell type (OEG or SCs) the gene was higher expressed. The last column specifies the bioassay (outgrowth assay, cluster assay or both assays) in which the gene was analyzed.

Table 3. List of 8 genes potentially involved in neurite outgrowth stimulation and 2 genes contributing to MC-induced SC clustering.

Description of the invention Most of the prior art gene expression analyses realized so far have only provided single snapshots of the highly complex biological process of regeneration. Therefore, it is impossible to determine whether regulated genes at a particular timepoint are genes important for the initiation of the outgrowth process, play a role during axon elongation or are involved in target finding or reestablishment of sensory contacts. In order to link a gene to a part of this process, gene expression analysis should be performed in combination with or followed up by functional screening. Functional screening serves to validate or confirm array data. In addition, olfactory ensheathing glia offer the unique opportunity to compare gene expression changes in their natural environment after an injury and in culture at the moment of implantation in the injured spinal cord. The biological interpretation of gene expression is facilitated by the analysis of two related but different processes. Therefore, two gene expression studies were performed by the inventors. First, a high resolution time-course analysis of gene expression changes after an injury to reveal nucleic acids involved in the stimulation of neurite outgrowth of olfactory axons. Second, gene expression profiles of cultured OEG were analyzed to reveal nucleic acids involved in the neurite outgrowth-stimulating properties and the interaction behaviour with MCs of OEG in culture.

A method

In one aspect the present invention relates to a method for promoting or controlling regeneration of a neuronal cell. A first method for promoting or controlling neuroregeneration comprises the step of altering the activity or the steady state level of a polypeptide in a neuronal cell or in a cell in the direct environment of a neuronal cell in need of regeneration, e.g. the supporting glia cells (see also below). A polypeptide of which the activity or steady- state level is altered is preferably a polypeptide selected from the group consisting of: Leprecan, BM385941, Mesothelin, S100A9, Serine (or cysteine) peptidase inhibitor, clade I, member 1, Scavenger receptor class B member 2, NP- 1, and NCAM optionally in combination with p75 and/or GAP-43. These polypeptides are further identified by encoding nucleic sequences as identified in table 3. Therefore, a polypeptide of which the activity or the steady state level is altered preferably is a polypeptide that comprises an amino acid sequence that is encoded by a nucleotide sequence selected from: (a) a nucleotide sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% sequence identity with a nucleotide sequence selected from the group consisting of SEQ ID NO.'s 1-9, 31; each SEQ ID NO corresponding to an encoding sequence of a polypeptide as identified in table 3,

(b) a nucleotide sequence that encodes an amino acid sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% amino acid identity with an amino acid sequence that is encoded by a nucleotide sequence selected from SEQ ID NO.'s; 1-9, 31; each SEQ ID NO corresponding to an encoding sequence of a polypeptide as identified in table 3.

A polypeptide is herein further referred to as a polypeptide of the invention, or is identified by its name or by a SEQ ID NO of an encoding nucleic acid sequence. Each of SEQ ID NO.'s 1-9, or 31 may be respectively replaced herein by each of SEQ ID

NO.'s 10-18 or 32 since SEQ ID NO.'s 10-18, and 32 represent human orthologous genes of rat genes represented by SEQ IQ NO.'s 1-9 and 31.

Throughout this application, each time one refers to a specific nucleotide sequence SEQ ID NO (take SEQ ID NO: 1 as example), one may replace it by: i. a nucleotide sequence comprising a nucleotide sequence that has at least 60% sequence identity with SEQ ID NO:1. ii. a nucleotide sequence the complementary strand of which hybridizes to a nucleotide sequence of (i); iii. a nucleotide sequence the sequence of which differs from the sequence of a nucleotide sequence of (ii) due to the degeneracy of the genetic code. iv. a nucleotide sequence that encodes an amino acid sequence that has at least 60% amino acid identity with an amino acid sequence encoded by a nucleotide sequence SEQ ID NO: 1. To determine whether neurons successfully regenerate at least one of the following parameters will preferably be looked at: neurite outgrowth, median neurite total length and/or mean neurite total length are positively affected. A change in the activity or the steady state level of a polypeptide of the invention preferably results in an altered gene expression state that promotes robust neurite outgrowth and functional recovery. Preferably a polypeptide of the invention is thus a key switch that determines whether a damaged neuron regenerates successfully or not.

An "alteration of the activity or steady state level of a polypeptide" is herein understood to mean any detectable change in the biological activity exerted by the polypeptide or in the steady state level of the polypeptide as compared to the activity or steady- state in a individual who has not been treated. All methods of the invention may be applied in any animal. Preferably, the animal is a mammal. More preferably the mammal is a human being.

The alteration of the amount of a nucleotide sequence is preferably assessed using classical molecular biology techniques such as (real time) PCR, arrays or Northern analysis. Alternatively, according to another preferred embodiment, the alteration of steady state level of a polypeptide is determined directly by quantifying the amount of a polypeptide. Quantifying a polypeptide amount may be carried out by any known technique such as Western blotting or immunoassay using an antibody raised against a polypeptide. The skilled person will understand that alternatively or in combination with the quantification of a nucleic acid sequence and/or the corresponding polypeptide, the quantification of a substrate of the corresponding polypeptide or of any compound known to be associated with the function of the corresponding polypeptide or the quantification of the function or activity of the corresponding polypeptide using a specific assay may be used to assess the alteration of the activity or steady state level of a polypeptide.

In a method of the invention the activity or steady-state level of a polypeptide of the invention may be altered at the level of the polypeptide itself, e.g. by providing a polypeptide of the invention to a neuronal cell from an exogenous source, or by adding an agonist of a polypeptide to a neuronal cell, such as e.g. an antibody against a polypeptide. For provision of a polypeptide from an exogenous source, a polypeptide may conveniently be produced by expression of a nucleic acid encoding a polypeptide in a suitable host cell as described below. Alternatively an agonistic antibody against a polypeptide may be used. Preferably, however, the activity or steady-state level of a polypeptide is altered by regulating the expression level of a nucleotide sequence encoding a polypeptide.

Preferably, the expression level of a nucleotide sequence is regulated in a neuronal cell. The expression level of a polypeptide of the invention is more preferably up-regulated (i.e. increased) by introduction of an expression construct (or vector) into a neuronal cell, whereby the expression vector comprises a nucleotide sequence encoding a polypeptide, and whereby a nucleotide sequence is under control of a promoter capable of driving expression of a nucleotide sequence in a neuronal cell. The expression level of a polypeptide may also be up-regulated by introduction of an expression construct into a neuronal cell, whereby the construct comprises a nucleotide sequence encoding a factor capable of trans-activation of an endogenous nucleotide sequence encoding a polypeptide. Preferably, an increase or an upregulation of the expression level of a nucleotide sequence means an increase of at least 5% of the expression level of the nucleotide sequence using arrays. More preferably, an increase of the expression level of a nucleotide sequence means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. In another preferred embodiment, an increase of the expression level of a polypeptide means an increase of at least 5% of the expression level of the polypeptide using western blotting and/or using ELISA or a suitable assay. More preferably, an increase of the expression level of a polypeptide means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more.

In another preferred embodiment, an increase of a polypeptide activity (such as a DNA binding and/or transcriptional activity) means an increase of at least 5% of a polypeptide activity using a suitable assay. More preferably, an increase of a polypeptide activity means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. DNA binding activity may be assessed in an electrophoretic mobility shift assay (EMSA) using a labeled probe specific for a polypeptide.

Such an alteration (increase) of the activity or steady- state level of a polypeptide as earlier defined herein preferably leads to regeneration of a neuronal cell. A regeneration of a neuronal cell preferably means one or more of the processes including initiation of neuronal outgrowth, neuronal outgrowth, axon elongation, target finding and reestablishment of sensory contacts, up to return of function of the deficient motory or sensory neurons. Suitable assays for regeneration of a neuronal cell are provided in the example in Fl 1 cells and/or in DRG neurons. The assays may be used to determine if an alteration of the activity or steady state level of a polypeptide of the invention is capable of inducing neurite outgrowth and thereby capable of inducing or promoting neuronal regeneration. A method is preferably said to be for promoting generation or regeneration of a neuronal cell when the alteration of the activity or of the steady- state level of a polypeptide in a neuronal cell leads to at least one of a detectable (initiation of) neuronal outgrowth, axon elongation, target finding and reestablishment of sensory contacts and up to return of function of the deficient motory or sensory neurons all as assessed in the example. A detectable (initiation of) neuronal outgrowth and/or axon elongation preferably means a detectable increase in a median neurite total length and/or a detectable increase in the mean neurite total length. An increase in this context preferably means an increase of at least 1%, at least 2%, at least 4%, at least 5%, at least 7%, at least 10%, at least 15%, at least 20%, at least 30%, or even more of said value compared to the same value of a corresponding neuron that will not be administered a polypeptide, a nucleic acid, or a construct of the invention.

In a preferred method of the invention, regeneration of a neuronal cell is promoted by: increasing the activity or the steady-state level of a polypeptide selected from the group consisting of: Leprecan, BM385941, Mesothelin, S100A9, Serine (or cysteine) peptidase inhibitor, clade I, member 1, Scavenger receptor class B member 2, NP-I, and NCAM. Table 3 gives an overview of the full name of each of these polypeptides, the SEQ ID NO' s of their encoding nucleic acid sequence and their accesssion number. In another preferred method of the invention, regeneration of a neuronal cell is promoted by: increasing the activity or the steady- state level of an additional polypeptide selected from p75 and/or GAP-43.

Preferred subcombinations

In yet another preferred method, regeneration of a neuronal cell is promoted by: increasing the activity or the steady- state level of a polypeptide selected from: a Leprecan, BM385941 and Mesothelin and optionally with one or two or three or four or five of: S100A9, Scavenger receptor class B member 2, Serine (or cysteine) peptidase inhibitor, clade I, member 1, NP-I and NCAM.

In yet another preferred method, regeneration of a neuronal cell is promoted by: increasing the activity or the steady- state level of a polypeptide selected from: Scavenger receptor class B member 2 and optionally with one or two or three or four or five or six or seven of: S100A9, NP-I, a Leprecan, Serine (or cysteine) peptidase inhibitor, clade I, member 1, BM385941, Mesothelin and NCAM. All possible optional subcombinations between S100A9, Scavenger receptor class B member 2, NP-I, Serine

(or cysteine) peptidase inhibitor, clade I, member 1 and NCAM are encompassed by the present invention.

Preferably, regeneration of a neuronal cell is promoted by increasing the activity or the steady-state level of a polypeptide selected from: a Leprecan, BM385941 and Mesothelin and optionally with: - S100A9 or

- Scavenger receptor class B member 2 or - NP-I or - NCAM or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1 or - S100A9 and NP-l or - S100A9 and NCAM or

- S100A9 and Scavenger receptor class B member 2 or - Scavenger receptor class B member 2 and NP-I or

- Scavenger receptor class B member 2 and NCAM or - NP-I and NCAM or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1 and S100A9 or - Serine (or cysteine) peptidase inhibitor, clade I, member 1 and Scavenger receptor class B member 2 or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1 and NP- 1 or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1 and NCAM or - S100A9 and Scavenger receptor class B member 2 and NP-I or

- S100A9 and Scavenger receptor class B member 2 and NCAM or

- S100A9 and NP-I and NCAM or

- Scavenger receptor class B member 2 and NCAM and NP-I or

- NP-I and NCAM and S100A9 or - Serine (or cysteine) peptidase inhibitor, clade I, member 1, S100A9 and Scavenger receptor class B member 2 or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1, S100A9 and NP-I or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1, S100A9 and NCAM or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1, NP-I and NCAM or - S100A9 and Scavenger receptor class B member 2 and NCAM and NP-I or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1, S100A9 and Scavenger receptor class B member 2, NP-I or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1, S100A9 and Scavenger receptor class B member 2, NCAM or - Serine (or cysteine) peptidase inhibitor, clade I, member 1, NP-I and NCAM or

- Serine (or cysteine) peptidase inhibitor, clade I, member 1, S100A9 and Scavenger receptor class B member 2, NCAM, NP-I.

Each subcombination is optionally in combination with p75 and/or GAP-43.

In a more preferred method, regeneration of a neuronal cell is promoted by: increasing the activity or the steady- state level of a polypeptide selected from: a Leprecan, BM385941, Mesothelin, S100A9, Serine (or cysteine) peptidase inhibitor, clade I, member 1, and NP-I and optionally increasing the activity or the steady- state level of an additional polypeptide selected from p75 and/or GAP-43.

In another more preferred method, regeneration of the neuronal cell is promoted by: increasing the activity or the steady- state level of a polypeptide selected from: a Leprecan, BM385941, Mesothelin, Serine (or cysteine) peptidase inhibitor, clade I, member 1, Scavenger receptor class B member 2 and NCAM and optionally increasing the activity or the steady-state level of an additional polypeptide selected from p75 and/or GAP-43.

In an even more preferred method, regeneration of the neuronal cell is promoted by: increasing the activity or the steady- state level of a polypeptide selected from: a Leprecan, BM385941 and Mesothelin and optionally increasing the activity or the steady-state level of an additional polypeptide selected from p75 and/or GAP-43.

In a method of the invention the regeneration of a neuronal cell is preferably promoted by increasing the activity or the steady-state level of a polypeptide encoded by a nucleotide sequence selected from:

(a) a nucleotide sequence that has at least 80 % identity with a sequence selected from

SEQ ID No.s' 1-9, and 31; and

(b) a nucleotide sequence that encodes an amino acid sequence that has at least 80 % amino acid identity with an amino acid sequence encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO.'s 1-9 and 31.

Any preferred subselection has earlier defined in the section entitled "preferred subcombinations" using the corresponding name of the polypeptide is also preferred herein by using the corresponding SEQ ID NO. A most preferred selection includes SEQ ID NO.'s 1, 2 and 5. The activity or the steady-state level of a polypeptide is preferably increased by introducing a nucleic acid construct into a neuronal cell, the nucleic acid construct comprising a nucleotide sequence (encoding the polypeptide) under control of a promoter capable of driving expression of the nucleotide sequence in a neuronal cell. Suitable promoters for expression in neuronal cells are further specified herein below.

In all embodiments exemplified, a promoter may be present in a nucleic acid construct used in a method. This promoter is preferably a neuronal specific promoter as later defined herein.

In a method of the invention, a neuronal cell preferably is a neuronal cell in need of regeneration. Such cells may be found at lesions of the nervous system that have arisen from traumatic contusion, avulsion, compression, and/or transection or other physical injury, or from tissue damage either induced by, or resulting from, a surgical procedure, from vascular pharmacologic or other insults including hemorrhagic or ischemic damage, or from neurodegenerative or other neurological diseases. A neuronal cell in need of regeneration may be neuronal cell of the peripheral nervous system (PNS) but preferably is a cell of the central nervous system (CNS). Although a cell in need of regeneration in a method of the invention will usually be a neuronal cell, other types of cells in the environment (vicinity) of a neuronal cell may influence the ability of a neuronal cell to (re)generate). Therefore the invention expressly includes aspects relating to altering the activity or the steady- state level of a polypeptide of the invention in cells in the environment of a neuronal cell in need of (re)generation. Such environmental cells include e.g. glia cells, Schwann cells, scleptomeningeal fibroblasts, blood borne cells that invade the lesion center, astrocytes and meningeal cells.

In a further aspect, the invention pertains to a method for treating a neurotraumatic injury or a neurodegenerative disease in a subject. The method preferably comprises pharmacologically altering the activity or the steady- state level of a polypeptide of the invention as defined above in an injured or degenerated neuron in the subject. Preferably, the alteration is sufficient to induce (axonal) regeneration or regeneration of the injured or degenerated neuron. In this method of the invention, the the neurotraumatic injury may be as described above, and likewise, the injured or degenerated neurons in the subject may be neurons of the PNS and/or CNS. In a method of the invention, a neurodegenerative disease may be a disorder selected from: cerebrovascular accidents (CVA), Alzheimer's disease (AD), vascular-related dementia, Creutzfeldt-Jakob disease (CJD), bovine spongiform encephalopathy (BSE), Parkinson's disease (PD), brain trauma, multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS - Lou Gehrig's disease) and Huntington's chorea.

A method of the invention preferably comprises the step of administering to a subject a therapeutically effective amount of a pharmaceutical composition comprising a nucleic acid construct for modulating the activity or steady state level of a polypeptide as defined herein. A nucleic acid construct may be an expression construct as further specified herein below. Preferably an expression construct is a viral gene therapy vector selected from gene therapy vectors based on an adenovirus, an adeno- associated virus (AAV), a herpes virus, a pox virus and a retrovirus. A preferred viral gene therapy vector is an AAV or Lentiviral vector. More preferably, a lentiviral vector is designed as identified later on herein. In a method, a pharmaceutical composition comprising a nucleic acid construct is preferably administered at a site of neuronal injury or degeneration.

A further aspect of the invention relates to a nucleic acid construct. A nucleic acid construct comprises all or a part of a nucleotide sequence that encodes a polypeptide that comprises an amino acid sequence that is encoded by a nucleotide sequence selected from the group consisting of :

(a) a nucleotide sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% identity with a nucleotide sequence selected from the group consisting of SEQ ID NO.'s 1-9,

31, (b) a nucleotide sequence that encodes an amino acid sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% amino acid identity with an amino acid sequence encoded by a nucleotide sequence selected from SEQ ID NO.'s 1-9, 31.

SEQ ID NO.'s 1-9, 31 may be replaced by SEQ ID NO.'s 10-18, 32 as explained earlier herein. Preferably, a nucleotide sequence is operably linked to a promoter that is capable of driving expression of the nucleotide sequence in a neuronal cell.

Any preferred subselection has earlier defined in the section entitled "preferred subcombinations" using the corresponding name of the polypeptide is also preferred herein by using the corresponding SEQ ID NO. A most preferred nucleic acid construct comprises a nucleotide sequence which is selected from: (a) a nucleotide sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% identity with a sequence selected from the group consisting of SEQ ID NO's 1, 2 and 5.; and (b) a nucleotide sequence that encodes an amino acid sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% amino acid identity with an amino acid sequence encoded by a nucleotide sequence selected from the group consisiting of SEQ ID NO.'s.1, 2 and 5.

In a nucleic acid construct of the invention, a promoter preferably is a promoter that is specific for a neuronal cell. A promoter that is specific for a neuronal cell is a promoter with a transcription rate that is higher in a neuronal cell than in other types of cells. Preferably the promoter's transcription rate in a neuronal cell is at least 1.1, 1.5, 2.0 or 5.0 times higher than in a non-neuronal cell.

A suitable promoter for use in the nucleic acid constructs of the invention and that is capable of driving expression in a neuronal cell includes a promoter of a gene that encodes an mRNA comprising a nucleotide sequence selected from:

(a) a nucleotide sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% identity with a nucleotide sequence selected from the group consisting of SEQ ID NO.'s 1-9, 3 l and,

(b) a nucleotide sequence that encodes an amino acid sequence that has at least 60, 70, 80, 85, 90, 95, 98 or 99% amino acid identity with an amino acid sequence encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO.'s 1-9, 31. Any preferred subselection has earlier defined in the section entitled "preferred subcombinations" using the corresponding name of the polypeptide is also preferred herein by using the corresponding SEQ ID NO. Most preferably a nucleotide sequence is selected from SEQ ID NO.'s 1, 2 and 5. SEQ ID NO.'s 1-9, 31 may be replaced by SEQ ID NO.'s 10-18, 32 as earlier explained herein.

Other suitable promoter for use in a nucleic acid construct of the invention and that is capable of driving expression in a neuronal cell include a GAP43 promoter, a FGF receptor promoter and a neuron specific enolase promoter. A promoter for use in a

DNA construct of the invention is preferably of mammalian origin, more preferably of human origin.

In a preferred embodiment a nucleic acid construct is a viral gene therapy vector selected from gene therapy vectors based on an adenovirus, an adeno-associated virus (AAV), a herpes virus, a pox virus and a retrovirus. A preferred viral gene therapy vector is an AAV or Lentiviral vector. Such vectors are further described herein below.

In a further aspect the invention relates to the use of a nucleic acid construct for modulating the activity or steady state level of a polypeptide as defined herein, for the manufacture of a medicament for promoting regeneration of a neuronal cell, preferably in a method of the invention as defined herein above. Preferably, a nucleic acid construct is used for the manufacture of a medicament for the treatment of a neurotraumatic injury or neurodegenerative disease, preferably in a method of the invention as defined herein above.

In yet another aspect, the invention pertains to a method for diagnosing the status of generation or regeneration of a neuron in a subject. This method comprises the steps of:

(a) determining the expression level of a nucleotide sequence coding for a polypeptide of the invention in the subject's generating or regenerating neuron; and,

(b) comparing the expression level of the nucleotide sequence with a reference value for expression level of the nucleotide sequence, the reference value preferably being the average value for the expression level in a neuron of healthy individuals. Preferably in the method the expression level of the nucleotide sequence is determined indirectly by quantifying the amount of the polypeptide encoded by the nucleotide sequence. More preferably, the expression level is determined ex vivo in a sample obtained from the subject.

In yet a further aspect, the invention relates to a method for identification of a substance capable of promoting regeneration of a neuronal cell. In a preferred embodiment, this substance promotes regeneration of a neuronal cell. The method preferably comprising the steps of:

(a) providing a test cell population capable of expressing a nucleotide sequence encoding a polypeptide of the invention;

(b) contacting the test cell population with the substance;

(c) determining the expression level of the nucleotide sequence or the activity or steady state level of the polypeptide in the test cell population contacted with the substance;

(d) comparing the expression, activity or steady state level determined in (c) with the expression, activity or steady state level of the nucleotide sequence or of the polypeptide in a test cell population that is not contacted with the substance; and, (e) identifying a substance that produces a difference in expression level, activity or steady state level of the nucleotide sequence or the polypeptide, between the test cell population that is contacted with the substance and the test cell population that is not contacted with the substance. Preferably, in a method the expression levels, activities or steady state levels of more than one nucleotide sequence or more than one polypeptide are compared. Preferably, in the method a test cell population comprises a neuronal cell, more preferably primairy sensory neurons (e.g. DRG neurons), cells of the DRG cell line such as e.g. the Fl 1 cell line and/or other cells or cell lines described in the Examples herein. A test cell population preferably comprises mammalian cells, more preferably human cells. In one aspect the invention also pertains to a substance that is identified in a method the aforementioned methods. Preferably, a difference in the expression is an increase in expression level or activity or steady-state level. An increase in expression level or activity or steady-state has preferably the same meaning as given earlier herein.

Sequence identity

"Sequence identity" is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988).

Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al., Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al, J. MoI. Biol. 215:403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894; Altschul, S., et al., J. MoI. Biol. 215:403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity.

Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. MoI. Biol. 48:443-453 (1970); Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89:10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the "Ogap" program from Genetics Computer Group, located in Madison, WI. The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps).

Preferred parameters for nucleic acid comparison include the following: Algorithm: Needleman and Wunsch, J. MoI. Biol. 48:443-453 (1970); Comparison matrix: matches=+10, mismatch=O; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons.

Preferably, when defining an identity percentage by comparison to a given polypeptide sequence or nucleotide sequence, the identity percentage is calculated over the whole sequence as identified by its own SEQ ID NO.

Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic -hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine- valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gin or his; Asp to glu; Cys to ser or ala; GIn to asn; GIu to asp; GIy to pro; His to asn or gin; He to leu or val; Leu to ile or val; Lys to arg; gin or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.

Recombinant techniques and methods for recombinant production of polypeptides

A polypeptide for use in the present invention can be prepared using recombinant techniques, in which a nucleotide sequence encoding a polypeptide of the invention is expressed in a suitable host cell. The present invention thus also concerns the use of a vector comprising a nucleic acid molecule or nucleotide sequence as defined above. Preferably the vector is a replicative vector comprising on origin of replication (or autonomously replication sequence) that ensures multiplication of the vector in a suitable host for the vector. Alternatively the vector is capable of integrating into the host cell's genome, e.g. through homologous recombination or otherwise. A particularly preferred vector is an expression vector wherein a nucleotide sequence encoding a polypeptide as defined above, is operably linked to a promoter capable of directing expression of the coding sequence in a host cell for the vector.

As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of a gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences, including, but not limited to transcription factor binding sites, repressor and activator protein binding sites, and any other sequences of nucleotides known to one of skill in the art to act directly or indirectly to regulate the amount of transcription from the promoter. A "constitutive" promoter is a promoter that is active under most physiological and developmental conditions. An "inducible" promoter is a promoter that is regulated depending on physiological or developmental conditions. A "tissue specific" promoter is only active in specific types of differentiated cells/tissues, such as preferably neuronal cells or tissues.

Expression vectors allow a polypeptide of the invention as defined above to be prepared using recombinant techniques in which a nucleotide sequence encoding a polypeptide of the invention is expressed in a suitable cell, e.g. cultured cell or cell of a multicellular organism, such as described in Ausubel et al., "Current Protocols in Molecular Biology", Greene Publishing and Wiley-Interscience, New York (1987) and in Sambrook and Russell (2001, supra); both of which are incorporated herein by reference in their entirety. Also see, Kunkel (1985) Proc. Natl. Acad. Sci. 82:488 (describing site directed mutagenesis) and Roberts et al. (1987) Nature 328:731-734 or Wells, J. A., et al. (1985) Gene 34: 315 (describing cassette mutagenesis).

Typically, nucleic acids encoding the desired polypeptides are used in expression vectors. The phrase "expression vector" generally refers to nucleotide sequences that are capable of effecting expression of a gene in hosts compatible with such sequences. These expression vectors typically include at least suitable promoter sequences and optionally, transcription termination signals. Additional factors necessary or helpful in effecting expression can also be used as described herein. DNA encoding a polypeptide is incorporated into DNA constructs capable of introduction into and expression in an in vitro cell culture. Specifically, DNA constructs are suitable for replication in a prokaryotic host, such as bacteria, e.g., E. coli, or can be introduced into a cultured mammalian, plant, insect, e.g., Sf9, yeast, fungi or other eukaryotic cell lines.

DNA constructs prepared for introduction into a particular host typically include a replication system recognized by the host, the intended DNA segment encoding the desired polypeptide, and transcriptional and translational initiation and termination regulatory sequences operably linked to the polypeptide-encoding segment. A DNA segment is "operably linked" when it is placed into a functional relationship with another DNA segment. For example, a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence. DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide. Generally, DNA sequences that are operably linked are contiguous, and, in the case of a signal sequence, both contiguous and in reading phase. However, enhancers need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof.

The selection of an appropriate promoter sequence generally depends upon the host cell selected for the expression of the DNA segment. Examples of suitable promoter sequences include prokaryotic, and eukaryotic promoters well known in the art (see, e.g. Sambrook and Russell, 2001, supra). The transcriptional regulatory sequences typically include a heterologous enhancer or promoter that is recognised by the host. The selection of an appropriate promoter depends upon the host, but promoters such as the trp, lac and phage promoters, tRNA promoters and glycolytic enzyme promoters are known and available (see, e.g. Sambrook and Russell, 2001, supra). Expression vectors include the replication system and transcriptional and translational regulatory sequences together with the insertion site for the polypeptide encoding segment can be employed. Examples of workable combinations of cell lines and expression vectors are described in Sambrook and Russell (2001, supra) and in Metzger et al. (1988) Nature 334: 31-36. For example, suitable expression vectors can be expressed in, yeast, e.g. S.cerevisiae, e.g., insect cells, e.g., Sf9 cells, mammalian cells, e.g., CHO cells and bacterial cells, e.g., E. coli. The host cells may thus be prokaryotic or eukarotic host cells. The host cell may be a host cell that is suitable for culture in liquid or on solid media. The host cells are used in a method for producing a polypeptide of the invention as defined above. The method comprises the step of culturing a host cell under conditions conducive to the expression of the polypeptide. Optionally the method may comprise recovery the polypeptide. The polypeptide may e.g. be recovered from the culture medium by standard protein purification techniques, including a variety of chromatography methods known in the art per se. Alternatively, the host cell is a cell that is part of a multicellular organism such as a transgenic plant or animal, preferably a non-human animal. A transgenic plant comprises in at least a part of its cells a vector as defined above. Methods for generating transgenic plants are e.g. described in U.S. 6,359,196 and in the references cited therein. Such transgenic plants may be used in a method for producing a polypeptide of the invention as defined above, the method comprising the step of recovering a part of a transgenic plant comprising in its cells the vector or a part of a descendant of such transgenic plant, whereby a plant part contains the polypeptide, and, optionally recovery of a polypeptide from a plant part. Such methods are also described in U.S. 6,359,196 and in the references cited therein. Similarly, the transgenic animal comprises in its somatic and germ cells a vector as defined above. A transgenic animal preferably is a non-human animal. Methods for generating a transgenic animal are e.g. described in WO 01/57079 and in the references cited therein. Such transgenic animals may be used in a method for producing a polypeptide of the invention as defined above, the method comprising the step of recovering a body fluid from a transgenic animal comprising the vector or a female descendant thereof, wherein the body fluid contains the polypeptide, and, optionally recovery of the polypeptide from the body fluid. Such methods are also described in WO 01/57079 and in the references cited therein. The body fluid containing the polypeptide preferably is blood or more preferably milk.

Another method for preparing a polypeptide of the invention is to employ an in vitro transcription/translation system. DNA encoding a polypeptide is cloned into an expression vector as described supra. The expression vector is then transcribed and translated in vitro. The translation product can be used directly or first purified. Polypeptides resulting from in vitro translation typically do not contain the post- translation modifications present on polypeptides synthesised in vivo, although due to the inherent presence of microsomes some post-translational modification may occur. Methods for synthesis of polypeptides by in vitro translation are described by, for example, Berger & Kimmel, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques, Academic Press, Inc., San Diego, CA, 1987.

Gene therapy

Some aspects of the invention concern the use of a nucleic acid construct or an expression vector comprising a nucleotide sequence as defined above, wherein the vector is a vector that is suitable for gene therapy. Vectors that are suitable for gene therapy are described in Anderson 1998, Nature 392: 25-30; Walther and Stein, 2000,

Drugs 60: 249-71; Kay et al, 2001, Nat. Med. 7: 33-40; Russell, 2000, J. Gen. Virol.

81: 2573-604; Amado and Chen, 1999, Science 285: 674-6; Federico, 1999, Curr.

Opin. Biotechnol.10: 448-53; Vigna and Naldini, 2000, J. Gene Med. 2: 308-16; Marin et al., 1997, MoI. Med. Today 3: 396-403; Peng and Russell, 1999, Curr. Opin.

Biotechnol. JO: 454-7; Sommerfelt, 1999, J. Gen. Virol. 80: 3049-64; Reiser, 2000,

Gene Ther. 7: 910-3; and references cited therein. Particularly suitable gene therapy vectors include Adenoviral and Adeno- associated virus (AAV) vectors. These vectors infect a wide number of dividing and non-dividing cell types including neuronal cells. In addition adenoviral vectors are capable of high levels of transgene expression. However, because of the episomal nature of the adenoviral and AAV vectors after cell entry, these viral vectors are most suited for therapeutic applications requiring only transient expression of the transgene (Russell, 2000, J. Gen. Virol. 81: 2573-2604; Goncalves, 2005, Virol J. 2(1):43) as indicated above. Preferred adenoviral vectors are modified to reduce the host response as reviewed by Russell (2000, supra). Method for neuronal gene therapy using AAV vectors are described by Wang et al., 2005, J Gene Med. March 9 (Epub ahead of print), Mandel et al., 2004, Curr Opin MoI Ther. 6(5):482-90, and Martin et al., 2004, Eye JjS(I l): 1049-55. For neuronal gene transfer AAV serotypes 1, 2 and 5 and 8 are all effective vectors and therefore the preferred AAV serotypes. A preferred retroviral vector for application in the present invention is a lentiviral based expression construct. Lentiviral vectors have the unique ability to infect non-dividing cells (Amado and Chen, 1999 Science 285: 674-6). A preferred lentiviral vector comprises a hCMV promoter or a chicfcen-beta-actin promotor w Uh a hCJVl V enhancer. Two distinct chicken- beta-actin promoter are known that may be used in this context in combination w ith a hCMV enhancer (Sawicki J, A, et al). Each of these promoters is represented by SEQ ID NO:3J and 34. ^' The shorter one may be attractive to be used when the gene to be erexρressed is more than 3.5kb in size ...

Methods for the construction and use of lentiviral based expression constructs are described in U.S. Patent No.'s 6,165,782, 6,207,455, 6,218,181, 6,277,633 and 6,323,031 and in Federico (1999, Curr Opin Biotechnol 10: 448-53) and Vigna et al. (2000, J Gene Med 2000; 2: 308-16).

Generally, gene therapy vectors will be as the expression vectors described above in the sense that they comprise a nucleotide sequence encoding a polypeptide of the invention to be expressed, whereby the nucleotide sequence is operably linked to an appropriate regulatory sequence as indicated above. Such regulatory sequence will at least comprise a promoter sequence. Suitable promoters for expression of the nucleotide sequence encoding the polypeptide from gene therapy vectors include e.g. cytomegalovirus (CMV) intermediate early promoter, viral long terminal repeat promoters (LTRs), such as those from murine moloney leukaemia virus (MMLV) rous sarcoma virus, or HTLV-I , the simian virus 40 (SV 40) early promoter and the herpes simplex virus thymidine kinase promoter. Suitable neuronal promoters are described above.

Several inducible promoter systems have been described that may be induced by the administration of small organic or inorganic compounds. Such inducible promoters include those controlled by heavy metals, such as the metallothionine promoter (Brinster et al. 1982 Nature 296: 39-42; Mayo et al. 1982 Cell 29: 99-108), RU-486 (a progesterone antagonist) (Wang et al. 1994 Proc. Natl. Acad. Sci. USA £1: 8180-8184), steroids (Mader and White, 1993 Proc. Natl. Acad. Sci. USA 90: 5603-5607), tetracycline (Gossen and Bujard 1992 Proc. Natl. Acad. Sci. USA 89: 5547-5551; U.S. Pat. No. 5,464,758; Furth et al. 1994 Proc. Natl. Acad. Sci. USA 91: 9302-9306; Howe et al. 1995 J. Biol. Chem. 270: 14168-14174; Resnitzky et al. 1994 MoI. Cell. Biol. 14: 1669-1679; Shockett et al. 1995 Proc. Natl. Acad. Sci. USA 92: 6522-6526) and the tTAER system that is based on the multi-chimeric transactivator composed of a tetR polypeptide, as activation domain of VP16, and a ligand binding domain of an estrogen receptor (Yee et al., 2002, US 6,432,705).

A gene therapy vector may optionally comprise a second or one or more further nucleotide sequence coding for a second or further protein. The second or further protein may be a (selectable) marker protein that allows for the identification, selection and/or screening for cells containing the expression construct. Suitable marker proteins for this purpose are e.g. the fluorescent protein GFP, and the selectable marker genes HSV thymidine kinase (for selection on HAT medium), bacterial hygromycin B phosphotransferase (for selection on hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection on G418), and dihydrofolate reductase (DHFR) (for selection on methotrexate), CD20, the low affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for their use are provided in Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3 ^rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York.

Alternatively, a second or further nucleotide sequence may encode a protein that provides for fail-safe mechanism that allows to cure a subject from the transgenic cells, if deemed necessary. Such a nucleotide sequence, often referred to as a suicide gene, encodes a protein that is capable of converting a prodrug into a toxic substance that is capable of killing the transgenic cells in which the protein is expressed. Suitable examples of such suicide genes include e.g. the E.coli cytosine deaminase gene or one of the thymidine kinase genes from Herpes Simplex Virus, Cytomegalovirus and Varicella-Zoster virus, in which case ganciclovir may be used as prodrug to kill the IL- 10 transgenic cells in the subject (see e.g. Clair et al., 1987, Antimicrob. Agents Chemother. 31_: 844-849).

A gene therapy vector is preferably formulated in a pharmaceutical composition comprising a suitable pharmaceutical carrier as defined below.

Antibodies Some aspects of the invention concern the use of an antibody or antibody- fragment that specifically binds to a polypeptide of the invention as defined above. A prefered antibody is an agonistic antibody. Methods for generating antibodies or antibody-fragments that specifically bind to a given polypeptide are described in e.g. Harlow and Lane (1988, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY) and WO 91/19818; WO 91/18989; WO 92/01047; WO 92/06204; WO 92/18619; and US 6,420,113 and references cited therein. The term "specific binding," as used herein, includes both low and high affinity specific binding. Specific binding can be exhibited, e.g., by a low affinity antibody or antibody-fragment having a Kd of at least about 10 ^"4 M. Specific binding also can be exhibited by a high affinity antibody or antibody-fragment, for example, an antibody or antibody-fragment having a Kd of at least about of 10 ^"7 M, at least about 10 ^"8 M, at least about 10 ^"9 M, at least about 10 ^"10 M, or can have a Kd of at least about 10 ^"11 M or 10 ^"12 M or greater.

Peptidomimetics

Peptide-like molecules (referred to as peptidomimetics) or non-peptide molecules that specifically bind to a polypeptide of the invention or to its receptor polypeptide and that may be applied in any of the methods of the invention as defined herein as agonists of a polypeptide of the invention and they may be identified using methods known in the art per se, as e.g. described in detail in US 6,180,084 which incorporated herein by reference. Such methods include e.g. screening libraries of peptidomimetics, peptides, DNA or cDNA expression libraries, combinatorial chemistry and, particularly useful, phage display libraries. These libraries may be screened for agonists of a polypeptide by contacting the libraries with substantially purified polypeptides of the invention, fragments thereof or structural analogues thereof.

Pharmaceutical compositions The invention further relates to a pharmaceutical preparation comprising as active ingredient at least one of a polypeptide, an antibody, a nucleic acid construct or a gene therapy vector as defined above. The composition preferably at least comprises a pharmaceutically acceptable carrier in addition to the active ingredient.

In a preferred aspect of the invention, a nucleotide sequence or a polypeptide encoded by said nucleotide sequence or a nucleic acid construct all as earlier defined herein are for use as a medicament. This medicament is preferably for promoting regeneration of a neuronal cell and/or for treating a neurotraumatic injury or neurodegenerative disease. All these methods have been extensively defined earlier herein. In some methods, a polypeptide or antibody of the invention as purified from mammalian, insect or microbial cell cultures, from milk of transgenic mammals or other source is administered in purified form together with a pharmaceutical carrier as a pharmaceutical composition. Methods of producing pharmaceutical compositions comprising polypeptides are described in US Patents No.'s 5,789,543 and 6,207,718. The preferred form depends on the intended mode of administration and therapeutic application.

A pharmaceutical carrier can be any compatible, non-toxic substance suitable to deliver a polypeptide, an antibody or a gene therapy vector to the patient. Sterile water, alcohol, fats, waxes, and inert solids may be used as the carrier. Pharmaceutically acceptable adjuvants, buffering agents, dispersing agents, and the like, may also be incorporated into the pharmaceutical compositions.

The concentration of a polypeptide or antibody of the invention in the pharmaceutical composition can vary widely, i.e., from less than about 0.1% by weight, usually being at least about 1% by weight to as much as 20% by weight or more. For oral administration, the active ingredient can be administered in solid dosage forms, such as capsules, tablets, and powders, or in liquid dosage forms, such as elixirs, syrups, and suspensions. Active component(s) can be encapsulated in gelatin capsules together with inactive ingredients and powdered carriers, such as glucose, lactose, sucrose, mannitol, starch, cellulose or cellulose derivatives, magnesium stearate, stearic acid, sodium saccharin, talcum, magnesium carbonate and the like. Examples of additional inactive ingredients that may be added to provide desirable colour, taste, stability, buffering capacity, dispersion or other known desirable features are red iron oxide, silica gel, sodium lauryl sulfate, titanium dioxide, edible white ink and the like. Similar diluents can be used to make compressed tablets. Both tablets and capsules can be manufactured as sustained release products to provide for continuous release of medication over a period of hours. Compressed tablets can be sugar coated or film coated to mask any unpleasant taste and protect the tablet from the atmosphere, or enteric-coated for selective disintegration in the gastrointestinal tract. Liquid dosage forms for oral administration can contain colouring and flavouring to increase patient acceptance.

A polypeptide, antibody or nucleic acid construct or gene therapy vector is preferably administered parentally. The polypeptide, antibody or nucleic acid construct or vector for preparations for parental administration must be sterile. Sterilisation is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophilisation and reconstitution. The parental route for administration of the polypeptide, antibody or nucleic acid construct or vector is in accord with known methods, e.g. injection or infusion by intravenous, intraperitoneal, intramuscular, intraarterial, intralesional, intracranial, intrathecal, transdermal, nasal, buccal, rectal, or vaginal routes. The polypeptide, antibody or nucleic acid construct or vector may be administered continuously by infusion or by bolus injection. A typical composition for intravenous infusion could be made up to contain 10 to 50 ml of sterile 0.9% NaCl or 5% glucose optionally supplemented with a 20% albumin solution and 1 to 50 μg of the polypeptide, antibody or nucleic acid construct or vector. A typical pharmaceutical composition for intramuscular injection may be made up to contain, for example, 1 - 10 ml of sterile buffered water and 1 to 100 μg of the polypeptide, antibody or dominant negatif or nucleic acid construct or vector of the invention. Methods for preparing parenterally administrable compositions are well known in the art and described in more detail in various sources, including, for example, Remington's Pharmaceutical Science (15th ed., Mack Publishing, Easton, PA, 1980) (incorporated by reference in its entirety for all purposes). For therapeutic applications, a pharmaceutical composition is administered to a patient suffering from a neurotraumatic injury or a neurodegenerative disease in an amount sufficient to reduce the severity of symptoms and/or prevent or arrest further development of symptoms. An amount adequate to accomplish this is defined as a "therapeutically-" or "prophylactically-effective dose". Such effective dosages will depend on the severity of the condition and on the general state of the patient's health. In general, a therapeutically- or prophylactically-effective dose preferably is a dose, which is sufficient to reverse the symptoms, i.e. to restore function of the sensory and/or motory neurons to an acceptable level, preferably (close) to the average levels found in normal unaffected healthy individuals.

In the present methods, a polypeptide or antibody or nucleic acid construct or vector is usually administered at a dosage of about 1 μg/kg patient body weight or more per week to a patient. Often dosages are greater than 10 μg/kg per week. Dosage regimes can range from 10 μg/kg per week to at least 1 mg/kg per week. Typically dosage regimes are 10 μg/kg per week, 20 μg/kg per week, 30 μg/kg per week, 40 μg/kg week, 60 μg/kg week, 80 μg/kg per week and 120 μg/kg per week. In preferred regimes 10 μg/kg, 20 μg/kg or 40 μg/kg is administered once, twice or three times weekly. Treatment is preferably administered by parenteral route.

Microarrays

Another aspect of the invention relates to microarrays (or other high throughput screening devices) comprising a nucleic acid, polypeptide or antibody as defined above. A microarray is a solid support or carrier containing one or more immobilised nucleic acid or polypeptide fragments for analysing nucleic acid or amino acid sequences or mixtures thereof (see e.g. WO 97/27317, WO 97/22720, WO 97/43450, EP 0 799 897, EP 0 785 280, WO 97/31256, WO 97/27317, WO 98/08083 and Zhu and Snyder, 2001, Curr. Opin. Chem. Biol. 5: 40-45). Microarrays comprising the nucleic acids may be applied e.g. in methods for analysing genotypes or expression patterns as indicated above. Microarrays comprising polypeptides may be used for detection of suitable candidates of substrates, ligands or other molecules interacting with the polypeptides. Microarrays comprising antibodies may be used for in methods for analysing expression patterns of the polypeptides as indicated above.

General

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb "to consist" may be replaced by "to consist essentially of meaning that a nucleic acid or a polypeptide or an antibody or a nucleic acid construct or a vector or a composition as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety. The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Example 1

To provide more insight into the molecular mechanisms underlying the regeneration- promoting properties of OEG, we performed two large scale gene expression studies on OEG in the olfactory nerve layer and on OEG in culture. In the present study, a group of 60 target genes derived from these two studies was selected and the role of a number of these target genes was examined in stimulating neurite outgrowth using siRNA- mediated knockdown of their expression. In addition, a set of target genes was examined for their putative role in the differential interaction behavior of OEG and Schwann cells (SCs) with meningeal cells (MCs). We show effects of 8 genes (including NCAM) in the outgrowth assay and of 2 genes in the cluster assay. Seven of these genes are potential novel genes involved in the neurite outgrowth stimulating properties of OEG and in the different interaction effects of OEG and SCs with MCs. Elucidating the molecular mechanisms underlying the neuroregeneration-promoting properties of OEG can eventually form the basis for studies on novel therapeutic targets in spinal cord injury.

RESULTS

Selection of target genes

The microarray experiments on OEG in the lesioned olfactory system (approach 1) and on cultured OEG (approach 2) yielded two sets of differentially expressed genes. In approach 1, differential gene expression was defined as a ² log ratio greater than 0.5 and a p- value smaller than 0.001. This resulted in 819 genes differentially expressed at at least one time point after the lesion. The changes in expression of 60 of these 819 genes were confirmed by qPCR. In approach 2, differential gene expression was defined as a ² log ratio greater than 1.5 and a p-value smaller than 0.001. Here, 350 genes were differentially expressed between cOEG and cSCs and 659 genes were differentially expressed between cOEG and nOEG. The microarray data were validated by qPCR on a subset of 37 differentially expressed genes (Franssen et al. 2007).

Target genes were selected based on a number of selection criteria as outlined in Material and Methods (FIG 1). In approach 1, 84 target genes were selected from the 819 genes. These genes were regulated at 3 to 10 days after the lesion. During this time period most axons of the newly formed olfactory neurons have reached the ONL and are growing through the ONL towards the glomeruli in the olfactory bulb. Furthermore, these genes, based on their function documented in the literature, could potentially play a role in 'the stimulation of neurite outgrowth'. The list of 84 genes consisted mainly of genes associated with (neurite) outgrowth, cell adhesion or extracellular matrix.

In the cOEG-cSC comparison of approach 2, 153 genes were potentially involved in 'the stimulation of neurite outgrowth' or 'the interaction behavior with MCs' based on their gene ontology annotation (Table 1). In the cOEG-nOEG comparison, 218 genes were selected. Subsequent selection for 'correlated expression changes' resulted in 74 genes that had a similar 'direction of expression change' in the cOEG-cSC comparison and 54 genes in the cOEG-nOEG comparison. From the group of genes that did not pass the criterium of 'correlated expression changes', 15 genes were selected in the cOEG-cSC comparison that were, based on literature, anticipated to play a role in 'the stimulation of neurite outgrowth' or 'the interaction behavior with MCs'. In the cOEG-nOEG comparison, 9 genes were added based on a literature research. This eventually resulted in a list of 99 target genes from approach 2. Combining the gene lists from the two approaches revealed 9 overlapping genes. These genes were mainly genes upregulated in the ONL after injury and higher expressed in cOEG than in nOEG. Removal of these duplicates resulted in a total list of 176 target genes. From this list, a first set of 60 genes was tested in the outgrowth and cluster assays (Table 2). From the list of 60 genes, 52 genes were analyzed in the outgrowth assay and 25 genes in the cluster assays. From these genes, 17 genes were tested in both assays.

siRNA-mediated knockdown in cOEG and cSCs

In order to investigate the role of the target genes in 'the stimulation of neurite outgrowth' and in 'the interaction behavior with MCs', we silenced gene expression of each individual gene in cOEG and cSCs by using siRNAs. Each gene was targeted by a pool of 4 different siRNA duplexes. To validate the siRNA-mediated knockdown system, transfection and knockdown efficiency was tested in cOEG using the fluorescent control siRNA siGlo Lamin A/C. At two days after transfection, 75% of the OEG was transfected (FIG 2A). The knockdown efficiency of lamin A/C was 83% after 2 days and after 7 days there was still a reduction of 66% (FIG 2B). Knockdown efficiency was further determined by transfecting cSCs with siRNAs for P75 and GAP- 43. Both genes were highly expressed in cSCs on the microarray. After three days, mRNA levels were reduced with respectively 89% and 91% (FIG 2C). Also at the protein level, a clear reduction of expression could be observed after staining cSCs for P75 and GAP-43 (FIG 2D).

Standardization of bioassays

To standardize the outgrowth assay and the cluster assay in miniaturized format and to validate the siRNA-mediated knockdown system in the bioassays, 4 different control outgrowth and cluster assays were set up. The 4 different control conditions included siGlo, siControl, mock and untreated. In the outgrowth assay, total neurite length of DRG neurons plated on a monolayer of OEG gradually increased in time in all conditions (FIG 3A). An ANOVA indicated no significant differences of control (p=0.851) or control x time (p=0.973). In the OEG-cluster assays, OEG intermingled with MCs and no cell clusters were formed in time as described in Chapter 4 (FIG 3B). Total cluster area did not change over time in all conditions and no significant differences were found of control (p=0.556) or control x time (p=0.986). In the SC- cluster assays, SCs aggregated and formed cell clusters as described before (Chapter 4) (FIG 3C). Although the total cluster area increased in time in all 4 conditions, an ANOVA showed significant differences of between controls (p=0.001). Post-hoc analysis revealed that transfecting cSCs with the siCtrl resulted in a significant lower total cluster area than the mock (p=0.015) and the untreated (p=0.001). This unexpected effect of the siCtrl might be caused by an off -target effect (Jackson et al. 2003; Scacheri et al. 2004). We therefore decided to discard the siCtrl. The siGlo was used as control in the actual validation experiments.

Identification of genes expressed by OEG that are involved in stimulating neurite outgrowth

A set of 52 genes was tested in the outgrowth assay. These genes included 36 genes upregulated in the ONL after injury and 16 genes upregulated in OEG following culturing (Table 2).

All 52 genes were individually knocked down in a monolayer of OEG and their effect on neurite outgrowth of DRG-neurons was analyzed by measuring neurite length.

Testing all genes once resulted in 11 genes that showed a significant reduction of the total neurite length following knockdown (listed in FIG 4). The effect of these genes were studied in at least 3 independent follow-up experiments. We defined 'hits' as target genes that had a significant effect in at least 2 of 3 independent experiments. The effects of coagulation factor II (thrombin) receptor (F2r), n-myc downstream regulated gene 4 (Ndrg4) and neuronal pentraxin 1 (Nptxl) were only observed in the first screen and could not be reproduced (see graphs in FIG 4). The effect of SlOO calcium binding protein A9 (S100A9) was shown in 2 of 3 experiments. Leprecan 1 was the only gene tested 4 times and showed an effect in 3 of 4 experiments. The remaining 6 genes, neural cell adhesion molecule 1 (NCAM), mesothelin, serine protease inhibitor clade I member 1 (Serpinll), neuropilin 1 (NP-I), scavenger receptor class B member 2 (Scarb 2 or CD36-like2) and BM385941 (transcribed locus, previously annotated as endophilin) showed a significant reduction of total neurite length in 3 independent experiments (FIG 4). Knockdown of mesothelin resulted in considerable cell death of OEG. The reduction in total neurite length was therefore almost certainly caused by a disruption of the monolayer of OEG. NCAM is a common cell adhesion molecule that is widely expressed in the nervous system (reviewed by (Bonfanti 2006). The polysialylated form of NCAM (PSA-NCAM) is known to be expressed by OEG and primary olfactory axons in the olfactory system. Moreover, PSA-NCAM is required for olfactory axon outgrowth, extension and pathfinding (Aoki et al. 1999; Miragall and Dermietzel 1992; Miragall et al. 1988). Therefore, we do not consider NCAM as a novel hit, since the contribution of NCAM to neurite outgrowth stimulation by OEG has already been shown. Instead, the identification of NCAM as target gene from the microarray experiments and the subsequent effects in the outgrowth assay following knockdown, validate our methodological approach to identify novel genes expressed by OEG and involved in the stimulation of neurite outgrowth. In summary, from the 52 genes tested we identified 7 hits in the outgrowth assay, including S100A9, leprecan, mesothelin, Serpinll, NP-I, Scarb 2 (i.e. CD36-like 2) and BM385941. These genes are potentially involved in the neurite outgrowth promoting properties of OEG.

Identification of genes involved in the distinct interaction behavior of cOEG and cSCs with MCs

A set of 25 genes was tested in the cluster assays. These genes were all differentially expressed between cOEG and cSCs. From the group of 25 genes, 4 genes were higher expressed in cSCs and 21 genes were higher expressed in cOEG (Table 2). The genes higher expressed in cSCs were knocked down in cSCs and their contribution to cluster formation in cocultures of SCs and MCs was investigated by measuring total cluster area. Vice versa, genes higher expressed in cOEG were knocked down in cOEG and their contribution to the intermingling behavior of OEG in coculture with MCs was examined. From the 4 genes knocked down in cSCs, the low affinity nerve growth factor receptor p75 (p75) and growth associated protein 43 (GAP-43) resulted in a statistically significant decrease in the total cluster area. The effect of p75 was observed in 2 of 3 experiments and the effect of GAP-43 in all 3 independent experiments (FIG 5A, B).

From the 21 genes tested in OEG, knockdown of receptor activity- modifying protein 3 (RAMP3), apolipoprotein D (ApoD), connective tissue growth factor (CTGF), junctional adhesion molecule 1 (JAM-I) and calponin (CNN) resulted in a significant increase in the total cluster area in the first experiment. These results could however not be repeated for ApoD, CTGF, JAM-I and CNN. RAMP3 was tested in 5 independent experiments, which resulted in variable effects. In 2 experiments, knockdown of RAMP3 in OEG resulted in a statistical significant increase of total cluster area, whereas in 1 experiment RAMP3 knockdown had an opposite effect. In 2 experiments, no effects were observed following RAMP3 knockdown. Thus, knockdown of none of the 21 genes resulted in a consistent increase of cluster formation in OEG-MC cocultures.

In summary, we identified 2 hits from the 25 genes tested in the cluster assays: the formation of SC clusters in SC-MC cluster assays was consistently reduced following knockdown of p75 and GAP-43 in SCs.

Confirmation of knockdown effects by testing individual siRNAs

The rationale behind using pools of 4 siRNAs is that the concentrations of each individual siRNA can be lowered. Consequently, a potential off -target effect of one the siRNAs will be less effective. The on-target effect will not be decreased since all 4 individual siRNAs target the same gene. Since the 4 single duplexes are distinct sequences, it is very unlikely that 2 siRNAs will cause a similar off -target effect (Echeverri et al. 2006). The chance of identifying off- target-mediated phenotypes will therefore be reduced by siRNA pooling. However, off -targeting can not be eliminated. In order to exclude the possibility that the observed effects in the outgrowth assay were still caused by off-target effects, we studied the effects of the 4 siRNAs from the pools individually. Knockdown results of the pools are confirmed when the effects can be reproduced by at least 2 of the 4 individual siRNAs (Chan et al. 2007; Echeverri et al. 2006).

In preliminary experiments, individual siRNAs including the pools were tested in the outgrowth assay as described above, except that the cultures were only analyzed at one time point, that is 8 hours. So far, we have confirmed the effects in the outgrowth assay of serpinll, leprecan and mesothelin. The results of the pools could be reproduced with at least 2 individual siRNAs in at least 2 of 3 independent experiments. The effects were not statistically significant since we have only analyzed one time point. However, the individual siRNAs of serpinll, leprecan and mesothelin resulted in a ca. 20% reduced total neurite length, which was comparable with the results obtained with the pools. As shown with the pool, at least 2 of the mesothelin individual siRNAs caused significant cell death of OEG thus confirming the on-target effects of mesothelin. The effects of S100A9, NP-I, Scarb 2 (i.e. CD36-like 2) and BM385941 are not confirmed as yet by the individual siRNAs.

DISCUSSION We have investigated the gene expression profile of OEG in the lesioned primary olfactory system and of OEG and SCs in culture to identify novel genes contributing to the neuroregeneration-promoting properties of OEG. Bioassays were developed to functionally validate a selected group of target genes potentially involved in the neurite outgrowth promoting properties of OEG and in the different interaction behavior of cOEG and cSCs with MCs. We have identified 7 genes potentially involved in neurite outgrowth stimulation and 2 genes contributing to MC-induced SC clustering.

Genes potentially involved in OEG-supported neurite outgrowth

Knockdown of Scarb 2, leprecan, NP-I, Serpinll, S100A9, mesothelin and BM385941 in OEG resulted in a reduced neurite length of DRG neurons plated on the OEG. In addition, the effects of serpinll, leprecan and mesothelin were confirmed by testing the individual siRNAs. We are currently investigating the specificity of the effects of Scarb 2, NP-I, S100A9 and BM385941. In addition to testing the individual siRNAs, we will also determine the actual mRNA and/or protein knockdown levels of all 4 individual siRNAs. Eventually, we will be able to clearly discern on-target and off-target effects. The effects and potential function of each hit will be discussed below.

Scarb 2 is a transmembrane glycoprotein, expressed on monocytes, platelets, adipocytes, cardiomyocytes, endothelial cells and epithelial cells (Greenwalt et al. 1992). Scarb 2 is a multiligand receptor implicated in diverse biological processes, such as binding and transport of fatty acids and lipids, clearance of apoptotic cells, collagen adhesion and inhibition of angiogenesis (Febbraio et al. 2001; Husemann et al. 2002). Although Scarb 2 expression has never been demonstrated in the nervous system, one of the best known ligands of Scarb 2 is the extracellular glycoprotein thrombospondin- 1 (Asch et al. 1987; Li et al. 1993). Thrombospondin-1 has important roles in the vascular system as well as in the nervous system. In the vascular system, thrombospondin-1 acts as a potent inhibitor of angiogenesis, which is mediated by Scarb 2 (Dawson et al. 1997; Good et al. 1990). In the nervous system, thrombospondin-1 is widely expressed during development (Adams and Tucker 2000). In vitro, neurite outgrowth of various types of neurons, such as retinal neurons, superior cervical ganglion cells, hippocampal neurons, cerebral cortical cells and dorsal root ganglion neurons is promoted by thrombospondin-1 (Neugebauer et al. 1991; Osterhout et al. 1992). Moreover, after peripheral nerve injury, SCs distal to the regenerating axons increased thrombospondin-1 expression (Hoffman and O'Shea 1999). With respect to the neurite-outgrowth promoting properties of thrombospondin-1, no role for the trombospondin-1 receptor Scarb 2 was reported so far. In in vitro experiments, neuron attachment to thrombospondin-1 was found to be heparin- sensitive and neurite outgrowth was mediated by integrins (Neugebauer et al. 1991). In our gene expression studies on the ONL, thrombospondin-1 and its receptor Scarb 2 were both upregulated during olfactory regeneration. Although we have not tested thrombospondin in the outgrowth assays, this may implicate that thrombospondin is involved in the neurite outgrowth stimulating effects of OEG. The upregulation of both Scarb 2 and thrombospondin and the observed effects of Scarb 2 pools in the outgrowth assays strongly implicate a role for Scarb 2 and/or thrombospondin-1 in the neurite outgrowth promoting properties of OEG.

Leprecan was identified as target gene from approach 2. It was higher expressed in cOEG compared to cSCs as well to nOEG. Leprecan (leucine proline-enriched proteoglycan) is a recently identified basement membrane- associated chondroitin sulphate proteoglycan (Wassenhove-McCarthy and McCarthy 1999). It was proposed to function as a matricelrular protein playing a role in basement membrane formation (Lauer et al. 2007). The carboxyl-terminus of leprecan has prolyl 3-hydroxylase activity, which is important in collagen biosynthesis, folding and assembly (Vranka et al. 2004). Leprecan may therefore play an important role in basement membrane- associated collagen assembly. In addition, leprecan also contains the endoplasmic reticulum retrieval signal (KDEL), which could indicate that it is involved in functions of the endoplasmic reticulum and thus the secretory pathway of cells (Wassenhove- McCarthy and McCarthy 1999). Basement membranes separate cells from the underlying connective tissue (LeBleu et al. 2007). In the primary olfactory pathway, the outer surface of the channels of interconnecting OEG is enclosed by a basement membrane, which is surrounded by fibroblasts embedded in collagen fibrils (Field et al. 2003; Li et al. 2005a; Li et al. 2005b). OEG express the two major components of the basement membrane, collagen type IV and laminin, which contribute to the formation of an axon growth-promoting substrate (Doucette 1996; Kafitz and Greer 1997). Leprecan might act as an additional important component of the basement membrane of OEG, which might be involved in the assembly of an extracellular matrix beneficial for axon growth. NP- 1 is a transmembrane glycoprotein, best known as the receptor for vascular endothelial growth factor and for two members of the class 3 semaphorin family, semaphorin 3 A (Sema3A) and 3B. In the nervous system, NP-I is expressed by neurons and blood vessels. The protein is present at low levels in neuronal cell bodies, but is mainly localized on neurites and growth cones where it plays an important role in axonal guidance (Fujisawa et al. 1997; Takagi et al. 1995). Binding of the chemorepulsive protein Sema3A to a complex of NP-I and its coreceptor plexin 1 results in growth cone collapse (Kolodkin et al. 1997). In the olfactory system, NP-I expression contributes to the formation of the olfactory spatial map during development (Taniguchi et al. 2003). The presence of NP-I on a subset of primary olfactory axons excludes them from the ventral parts of the olfactory bulb where Sema3A is expressed (Crandall et al. 2000; Schwarting et al. 2000). Furthermore, expression of Sema3A by meningeal cells at the caudal surface of the cribriform plate may guide the growth of olfactory axons through the gaps of the cribriform plate towards the olfactory bulb (Pasterkamp et al. 1998). Sema3A is also expressed by second-order neurons in the glomeruli, which may function as growth cessation signal for NP-I positive axons (Giger et al. 1998; Pasterkamp et al. 1998). The expression of NP-I in olfactory axons and its well known function in axonal guidance might indicate that the identification of NP-I as target gene in our gene expression study is caused by olfactory axons that are present in the ONL rather than the OEG. However, NP-I expression in the ONL is upregulated following injury and remains upregulated during the regeneration process, which would not coincide with the degeneration of axons. The expression of NP-I by OEG may therefore suggest another function in olfactory regeneration. NP-I was originally identified as a cell adhesion molecule, which mediated adhesion by heterotypic interactions (Fujisawa et al. 1997; Takagi et al. 1995). As a cell adhesion molecule, NP-I is important in axonal fasciculation (Fujisawa et al. 1997; Kitsukawa et al. 1995). Possibly, NP-I not only mediates axon-axon adhesion, but also axon-glia adhesion or even glia-glia adhesion. NP-I might therefore be involved in the attachment of neurites to the OEG or it could contribute to the formation of a glial substrate beneficial to axonal outgrowth by promoting mutual adhesion of OEG.

The family of serine protease inhibitors (serpins) are proteins involved in many biological processes such as blood coagulation, fibrinolysis, inflammation, angiogenesis and tissue remodeling (Medcalf 2005; van Gent et al. 2003). Serpinll is a glycoprotein that is known as neuroserpin. Neuroserpin is secreted from the growth cones of axons in the peripheral as well as in the central nervous system (Miranda and Lomas 2006; Stoeckli et al. 1991) where it inhibits the serine protease tissue plasminogen activator (tPA) (Hastings et al. 1997; Krueger et al. 1997; Osterwalder et al. 1998). tPA is widely expressed in neurons and glia and is implicated in remodeling processes of the synaptic extracellular matrix (Samson and Medcalf 2006). The co- expression of tPA and neuroserpin in many brain regions suggested that neuroserpin, as a regulator of tPA activity, plays a role in synaptogenesis (Miranda and Lomas 2006). Besides synaptogenesis, neuroserpin was also implicated in the regulation of neurite outgrowth (Hill et al. 2002; Parmar et al. 2002). Overexpression of neuroserpin in a pituitary cell line resulted in extension of neurite-like processes (Hill et al. 2002). However, neuroserpin inhibited growth factor-induced neurite outgrowth of PC12 cells. In PC12 cells, reduction of neuroserpin expression resulted in increased neurite extension (Parmar et al. 2002). These contrasting results may implicate different mechanisms underlying neuroserpin-mediated neurite outgrowth in both cell types. One proposed mechanism entailed the regulation of local extracellular matrix degradation by inhibiting tPA (Parmar et al. 2002). Neuroserpin expression has not been demonstrated in glia yet. The continuous upregulation in the ONL from day 1 till day 15 following injury suggests however that neuroserpin is expressed by OEG. With respect to its function in neurite-extension and its role in extracellular remodeling, neuroserpin might play a role in OEG-supported neurite outgrowth.

S100A9, mesothelin and BM385941, all identified in approach 1, can not directly be associated with a potential function in the stimulation of neurite outgrowth. SlOO proteins have been implicated in diverse intracellular and extracellular activities, including calcium homeostasis, regulation of protein phosphorylation and enzyme activity, functions in cytoskeleton dynamics and inflammation (Donato 2003). One of the members of the SlOO protein family, SlOOB, is mainly expressed by glia and has been shown to promote neurite outgrowth (Van Eldik et al. 1991). S100A9 is expressed by granulocytes and monocytes and is involved in chronic inflammation. Although inflammation and clearance of debris are important processes during regeneration and are probably also essential for proper regrowth of axons, it can not explain the effects in in vitro assays. S100A9 was also implicated in various other processes. SlOO regulates cytoskeletal changes (Clark et al. 1990; Foell et al. 2007) and it was reported to stimulate neutrophil adhesion to a fibronectin matrix (Anceriz et al. 2007; Newton and Hogg 1998). In addition, S100A9 stimulated fibroblast proliferation (Shibata et al. 2005). A protein with such diverse functions might be a novel target to play a role in the neurite-outgrowth promoting properties of OEG, possibly by modulating adhesion or proliferation. Mesothelin is a cell surface glycoprotein, present in mesothelial cells and highly expressed in several cancer types, such as pancreatic cancers, ovarian cancers and mesotheliomas (Chang and Pastan 1996). Mesothelin may play a role in cell adhesion and was implicated as therapeutic target molecule to control the spread of tumors (Chang and Pastan 1996; Gubbels et al. 2006; Hassan and Ho 2008). Mesothelin expression has not been demonstrated in the nervous system. In the outgrowth assays, knockdown of mesothelin expression caused substantial cell death of OEG. Testing the individual siRNAs revealed that this cell death was not caused by non-specific off- target effects, since 2 individual siRNAs caused cell death as well. Therefore, the observed effects may suggest an essential role for mesothelin in OEG as a cell adhesion molecule potentially involved in the formation of the growth-supporting monolayer.

BM385941 is a 'transcribed locus'. BM385941 was previously annotated as endophilin and based on that former annotation identified as target gene. Although in the individual siRNA experiments, the effects of the BM385941 pool could not be repeated, 3 of the 4 individual siRNAs did show an effect. Determining knockdown levels will therefore be important to confirm the results. Thus, based on its effects in the outgrowth assay, BM385941 may be a novel molecule involved in the stimulation of neurite outgrowth by OEG.

Identification of genes potentially involved in the different interaction behavior of OEG and SCs with MCs

We identified p75 and GAP-43 to be involved in MC-induced SC cluster formation. The growth-associated protein GAP-43 is a membrane-bound phosphoprotein, implicated in neuronal development, plasticity and neurite outgrowth (reviewed by (Benowitz and Routtenberg 1997). In the growth cone, GAP-43 is involved in the transduction of extracellular signals and regulation of cytoskeletal proteins by interacting with F-actin. GAP-43 is also expressed by glia, including astrocytes, oligodendrocytes and non-myelin forming SCs (Curtis et al. 1992; da Cunha and Vitkovic 1990). Terminal SCs at the motor end plate show increased levels of GAP-43 expression following denervation, which is accompanied by the formation of long processes in SCs (Woolf et al. 1992). In addition, overexpression of GAP-43 in non-neuronal cell lines resulted in the formation of filopodia (Zuber et al. 1989). This indicates that the observed effects of GAP-43 knockdown in SC cluster formation can presumably be associated to the role of GAP-43 in regulating cytoskeletal rearrangement required for cellular migration or aggregation. GAP-43 might therefore be an important component of the intracellular molecular pathway underlying SC clustering. P75 is a member of the tumor necrosis factor receptor superfamily and is expressed by both neurons and glia. The function of this receptor is complex. P75 can both function autonomously and as a co-receptor and is involved in many different signaling pathways (Gentry et al. 2004; Roux and Barker 2002). By binding neurotrophins, p75 is involved in the stimulation of neurite outgrowth, but also in the induction of apoptosis or cell survival. On the other hand, P75 interacts with the Nogo-66 receptor and is involved in the signal transduction of myelin-associated growth inhibitory factors (Wang et al. 2002).

P75 is a well-known marker for both OEG and SCs. Although p75 was expressed by both cell types in our experiments, the expression level in cOEG was only 13% of the expression level in cSCs, which indicates that p75 is differentially regulated between both cell types. Following peripheral nerve injury as well as olfactory nerve injury, p75 expression is increased in SCs and OEG (Gong et al. 1994; Johnson et al. 1988; Turner and Perez-Polo 1993). In OEG, p75 expression is implicated in the neurite-outgrowth promoting properties of the cell (Kumar et al. 2005; Ramon-Cueto et al. 1993). In SCs, the expression of p75 was suggested to be involved in the binding of neurotrophins in order to guide axons along the SCs (Johnson et al. 1988; Zhou and Li 2007). P75 is also important in the myelination of axons (Zhang et al. 2000). Interestingly, in p75 knockout mice, considerably less SCs are present along growing axons during development, which suggested a function of p75 in SC migration. SC migration was also significantly reduced in dorsal root ganglia from p75 knockout mice in vitro (Bentley and Lee 2000). In addition, p75 can change the organization of actin filaments and is implicated in filopodia formation of neuronal growth cones (Gallo and Letourneau 2004). The role of p75 in SC migration and cytoskeletal regulation could explain the effects of p75 knockdown on SC clustering in our cluster assays. In conclusion, p75 may be involved in cluster formation of SCs by controlling cytoskeletal dynamics.

In OEG cluster assays, knockdown of none of the tested genes resulted in the formation of OEG clusters. There are two possible explanations for these unsuccessful results. First, the tested genes may not be involved in the intermingling behavior of

OEG with MCs. We have tested 25 genes so far and perhaps by continuing with the validation of other genes, we will eventually reveal genes involved in the ability of

OEG to mix with MCs. Second, the failure of detecting effects may be related to the complex molecular mechanism underlying cluster formation. Our OEG cluster assays were based on the hypothesis that one or more genes, higher expressed in cOEG than cSCs, function as key genes in the molecular pathway(s) underlying the ability of OEG to intermingle with MCs. Silencing one of these key genes will then disturb this pathway and subsequently results in a change of the interaction properties of OEG with MCs, presumably detectable as cell aggregation. However, a disruption of the intermingling capacity possibly results in minor phenotypic effects on mutual adherence or cellular morphology rather than cell clustering. To induce cell clustering, activation of multiple genes will probably be required. It will therefore be less feasible to induce clustering by the knockdown of a single gene than to disrupt clustering, such as in the SC-cluster assays. An additional complicating factor with respect to the cluster assays is the duration of the assays. During the time period of 5 days, compensatory mechanisms that prevent clustering could be activated.

EXPERIMENTAL PROCEDURES

Cell cultures

For each culture, 4 inbred adult female Fischer F344 rats (Harlan, The Netherlands) were deeply anesthetized with CO ₂ and decapitated. Cultures of OEG, SCs and MCs were prepared from the same rats as follows.

Olfactory ensheathing glia. OEG were obtained from the olfactory nerve and glomerular layers (ONGL) of the olfactory bulb. Meninges were carefully removed from the olfactory bulb and used for the MC cultures. ONGLs were isolated and incubated in Ca ⁺ - and Mg ⁺ - free Hanks' buffered salt solution (HBSS; Invitrogen) containing 0.1% trypsin (Invitrogen) for 10 min at 37 ⁰ C. Trypsinisation was stopped by adding Dulbecco's modified Eagle's/Ham's F12 medium (DMEM/F12, Invitrogen), supplemented with 10% fetal calf serum (FCS; Invitrogen)) and 1% penicillin/streptomycin (PS; Invitrogen) (DF-IOS). The tissue was washed in DF-IOS and triturated in 4 ml DF-IOS until a homogeneous cell suspension was obtained. Cells were plated in DF-IOS in four poly-L-lysine (PLL)-coated 25 cm ² flasks. After 1 week, p75 positive OEG were purified from the cultures by immunopanning, as described previously (Ramon-Cueto et al. 1998). Briefly, 100 mm Petri dishes were incubated with 1:1000 anti-mouse IgG, Fc-specific (Jackson) at 4 ⁰ C overnight. After several washes with phosphate-buffered saline (PBS), dishes were incubated at 4 ⁰ C overnight with p75 monoclonal antibody (gift of Dr. P Wood) diluted 1:2.5 in PBS (pH 7.3). Dishes were washed and incubated with 0.5% bovine serum albumin (BSA; Roche) in PBS for 1 hour at room temperature and washed again. Cells were seeded onto three antibody-coated dishes and left for 5 min at 37 ⁰ C. Unbound cells were removed by washing three times with DMEM/F12. Bound cells were scraped off from the dishes and seeded onto two other antibody-coated dishes. Incubation on antibody-coated dishes was repeated to diminish the number of contaminating cells. Purified cultures were plated on two PLL-coated 25 cm flasks. After two days, medium was changed in DF-IOS containing 2 μM forskolin (Sigma- Aldrich) and 20 μg/ml pituitary extract (PEX; Sigma-Aldrich).

Schwann cells. SCs were obtained from sciatic nerves as described before (Morrissey et al. 1991). In short, epineurial sheaths were removed from the nerves. Nerves were cut into small explants and placed into 35 mm dishes containing 750 μl DMEM (Invitrogen), supplemented with 10% FCS and 1% PS (D-IOS). Once a week, explants were transferred to new dishes to remove migratory fibroblasts. After approximately 5 weeks, explants were incubated in D-10S containing 1,25 U/ml dispase (Roche) and 0,05% collagenase (Invitrogen) overnight at 37 ⁰ C. Explants were dissociated and SCs were seeded onto PLL-coated 35 mm dishes in D-10S containing 2 μM forskolin and 20 μg/ml PEX.

Meningeal cells. MCs were obtained from the meninges covering the olfactory bulbs. As described above the meninges were carefully removed from the olfactory bulbs and were incubated in HBSS, containing 0.125% trypsin, 0.5 mM EDTA and 0.25% collagenase for 45 min at 37 ⁰ C in 5% CO ₂ . Trypsinisation was stopped by adding D-10S. Tissue was triturated until a homogeneous cell suspension was obtained. MCs were seeded onto a PLL-coated 6 cm dish.

Dorsal root ganglion neurons. Dorsal root ganglia (DRG) were dissected from E15 Wistar rat embryos. All internal organs were removed from the embryos and the vertebral column was cut ventrally to expose the spinal cord. The spinal cord including all DRGs was carefully raised and removed from the embryo. DRGs were detached from the spinal cord, stripped from nerve roots and incubated in 500 μl HBSS, containing 0.125% trypsin for 30 min at 37 ⁰ C. Trypsinisation was stopped by adding an equal volume of DF-10S. Cells were triturated and washed with DF-10S.

Approach 1: Gene expression analysis of the olfactory nerve layer after injury

Gene expression changes in the ONL after lesioning the olfactory epithelium was analyzed using microarrays. In short, adult female Fischer F344 rats (Harlan, The Netherlands) were subjected to an intranasal infusion of 50 μl 0.7% Triton X-100 solution in phosphate buffer (pH 7.4). Animals were sacrificed at 1, 3, 6, 10, 15, 20, 30 and 60 days after the lesion. Non-lesioned animals were included as control (=day 0). Olfactory bulbs were isolated and cut into 400 μm thick slices, from which the ONL was manually dissected. RNA was isolated from the ONLs with the Rneasy Mini kit (Qiagen) according to the manufacturer's protocol. RNA from 5 animals per time point was pooled, amplified and labeled with Cy3-CTP and Cy5-CTP using the Agilent Low RNA Input Fluorescent Linear Amplification kit (5184-3523) according to the manufacturer's guidelines. Hybridization was performed on Agilent Rat 60-mer Oligo Microarrays (G4130A, Agilent Technologies), according to the scheme in Figure 1 of Chapter 2. Microarrays were scanned with an Agilent microarray scanner and Feature Extraction software was used to extract the intensity data.

Approach 2: Gene expression analysis of cultured OEG

Microarray analysis of cultured OEG was performed as described previously (Franssen et al. 2007). Briefly, total RNA was isolated from cOEG, cSCs and nOEG using the RNeasy Mini kit (Qiagen) according to the manufacturer's protocol. cOEG were harvested at 3.5 weeks in culture and cSCs at 2 weeks after dissociation of explants. ONLs were manually dissected from 400 μm thick sagittal sections of the olfactory bulbs from adult Fischer rats. Each RNA sample was obtained from one culture derived from 4 rats or from a pool of ONLs dissected from 4 rats. Cy3 and Cy5 dye-labeling was performed using the Agilent Low RNA Input Fluorescent Linear Amplification kit (5184-3523) according to the manufacturer's instructions. Labeled RNA was hybridized on arrays (G4130A, Agilent Technologies) consistent with the manufacturer's guidelines and according to the scheme in Fig. 2 of Chapter 3. Hybridization and scanning of arrays was performed according to the protocols provided by Agilent.

Data analysis and selection of target genes

Data analysis was performed in R (http : //www .r-proj ect.org), using the packages marray and limma. Internal normalization of the arrays was based on Loess and global normalization was based on the median absolute deviation. Normalised data were modeled in limma according to the hybridisation schemes. In approach 1, differential gene expression was calculated at each time point relative to day 0 (non-lesioned control). In approach 2, differential gene expression between cOEG and cSCs and between cOEG and nOEG was calculated. Genes with a p-value smaller than 0.001 were considered significant. In order to further refine the list of target genes for functional validation, the original lists of differentially expressed genes were subjected to a number of additional selection criteria (Fig. 1).

In approach 1, the first selection criterium was based on fold change. Only genes upregulated after injury with a ² log ratio of at least 0.5 were included. Second, only genes upregulated at 3 to 10 days after the lesion were selected, since this is the time period in which new olfactory axons reach the ONL and have commenced their journey through the ONL to the glomeruli in the OB. A third selection was based on the putative function of the genes. An extensive literature search was done with PubMed to select genes that could be expected to be involved in 'the stimulation of neurite outgrowth' based on their proposed function. These included genes directly associated with neurite growth but also genes involved in for example cellular adhesion or extracellular matrix formation. The selected genes were tested in the outgrowth assay.

In approach 2, the first selection criterium was also based on fold change. Only genes with a ² log ratio of at least 1.5 were included. Second, the web-based tool eGOn (http://www.genetools.microarray.ntnu.no/common/intiO.php) (Beisvag et al. 2006) was used to select genes with a gene ontology annotation as listed in Table 1. We predicted that, based on this criterium, we would select for genes that may be involved in 'the stimulation of neurite outgrowth' and in 'the interaction behavior with MCs'. The third selection criterium was based on 'correlated expression changes'. This means that both comparisons were linked and genes higher expressed in cOEG in both comparisons as well as genes lower expressed in cOEG in both comparisons were selected. These genes are uniquely enriched or depleted in activated OEG and are not for instance up- or downregulated because of common cell activation-related processes that are triggered when cells are cultured. The fourth criterium was based on a 'literature search', which was applied to the group of genes that did not pass the third criterium. Genes that were, based on literature, potentially associated with neurite outgrowth or cellular interaction were added to the list of target genes. Genes were selected for knockdown experiments, which means that for the cOEG-nOEG comparison, only genes higher expressed in cOEG than nOEG were selected. These genes were tested in the outgrowth assays. Genes differentially expressed between cOEG and cSCs were tested in the interaction assays.

siRNA transfection OEG or SCs were plated in PLL-coated 96-wells plates at a density of 8500 cells/well. The next day, cells were transfected with siGENOME SMART pools (Dharmacon), consisting of 4 siRNA duplexes per gene to a final concentration of 100 nM. Transfection was performed according to the manufacturer's protocol, using DharmaFECT 3. In short, transfection mix was made by mixing siRNA and DharmaFECT 3, both diluted in serum- free medium. After incubation for 20 min at room temperature, pre-warmed (37 ⁰ C) medium containing 0.5% FCS was added. Culture medium was removed from the cells and replaced by transfection mix to a final volume of 50 μl per well. After 4 hours, transfection mix was removed and replaced by culture medium. In a next series of experiments, the individual siRNAs from the SMART pools were tested at a concentration of 100 nM each. These experiments were performed to confirm the previous statistically significant effects as observed with the pools. An effect of each individual siRNA was determined as a reduction in total neurite length in more than half of the experiments compared to siGlo.

Determination of transfection and knock-down efficiency with quantitative PCR The fluorescent control siGLO Lamin A/C siRNA (Dharmacon) was used to determine transfection efficiency and knock-down efficiency. OEG were plated on PLL-coated coverslips at a density of 5.0 x 10 ⁴ cells/well and in PLL-coated 6-wells plates at a density of 2.5 x 10 ⁵ cells/well. OEG were transfected the next day with siGLO Lamin A/C siRNA at a final concentration of 100 nM. Untreated cells were used as control. To investigate the transfection efficiency, cells cultured on coverslips were fixed at 2 days after infection with 4% paraformaldehyde (PFA) for 20 min. Cell nuclei were stained with Hoechst 33258 (Biorad) and mounted in mowiol. Transfection efficiency was determined by counting the number of cells positive for the fluorescent marker siGlo as percentage of all cells. To determine the knock-down efficiency, RNA was isolated from the OEG in the 6-wells plates at 2 and 7 days after transfection using the RNeasy Mini kit (Qiagen). To further determine the knockdown efficiency, SCs were plated in 6-wells plates and on coverslips and were transfected with SMART pool siRNA for GAP-43 and for p75 at a final concentration of 100 nM. After 3 days, cells cultured on coverslips were fixed and RNA was isolated from cells cultured in 6-wells plates similar as described above. cDNA synthesis was performed with 1 μg total RNA using Superscript II and oligo-dT primers. Quantitative PCR was performed on the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) using SYBR Green PCR reagent kit (Applied Biosystems). Reaction conditions were 2 min at 5O ⁰ C, 10 min at 95 ⁰ C followed by 40 cycles of 15 sec at 95 ⁰ C and 1 min at 60°C. Data were normalized against GAPDH, H3 and H2afy. Primer sequences used were (forward and reverse respectively): LaminA/C AGTTTGAACCTACCTTTCCCCC and AATCCCACTTAATACTGCCCTCC; GAP- 43 CCCGAGGCTGACCAAGAAC and GATCTGAGAAAGGGC-AGGAGAGA; P75 CCACAATCCAACACTATACTACATTACACA and GACTCCCAGCAGGATCTAGTCTC A; GAPDH TGCCAAGTATGATGACATCAAGAAG and AGCCC AGGATGC-CCTTTAGT; H3 CA GACCTGCGCTTCCAGAGT and GCC A ACC AG AT AGGCCTC ACT; H2afy TGATTAACAC AGAGCAGTGGAGAGA and TAATAGTAAAAAGAACGCCACTGGG.

Bioassays

For the outgrowth assays, OEG were plated in PLL-coated 96-wells plates and transfected with siRNA targeting the individual target genes as described above. At three days after transfection, dissociated DRG-neurons were plated on the monolayer of OEG at a density of 6000 cells/well in DF-10S containing forskolin and PEX. Cultures were fixed with 4% PFA for 20 min at 2, 4, 6 and 8 hours after plating. Neurite lengths were measured on a KineticScan HCS Reader (Cellomics).

For the cluster assays, OEG or SCs were plated in 96-wells plates and transfected with siRNA as described above. At two days after transfection, MCs were added to the cultures at a density of 8500 cells/ well in D-10S, containing forskolin and PEX. Cultures were fixed with 4% PFA for 20 min at 1, 2 and 5 days after plating.

Cluster areas were measured on a KineticScan HCS Reader.

Outgrowth and cluster assays were standardized for the siRNA transfections using the following 4 controls; the fluorescent transfection indicator siGlo (Dharmacon), the siControl non-targeting pool (SiCtrl; Dharmacon), the DharmaFECT- only or mock and the untreated. Results are the means ± SEM of three independent experiments. Statistical analysis was conducted using a two-way analysis of variance (ANOVA) to test for effects of type of control (control) and the interaction of control and time (control x time). Differences were considered statistically significant if p<0.05.

Immunocytochemistry

Fixed cultures were washed in PBS and blocked for 30 min in PBS containing 0.1% Triton X-IOO and 2% FCS (PBS-TS). Cultures were incubated with primary antibody in PBS-TS for 2 hours at room temperature. Outgrowth assays were incubated with monoclonal anti-neuronal class III beta-tubulin (TUJl) (1:500; Covance) and cluster assays with rabbit anti-S100 (1:600; Dako). To determine knockdown, SCs were incubated with rabbit anti-GAP-43 (#9527) (1:500; gift from P.N.E. De Graan, Utrecht University, Utrecht, The Netherlands) and undiluted monoclonal anti-p75. Cultures were then washed with PBS, followed by incubation with a Cy3- (1:400; Jackson ImmunoResearch) or Alexa 568- (1:400; Molecular Probes) conjugated secondary antibody in PBS-TS for 2 hours at room temperature. Images were captured with a fluorescence microscope using similar exposure times.

Medium-throughput screening

In an automated fashion, outgrowth and cluster assays were imaged on a Cellomics KineticScan HCS Reader, using immunofluorescence as described above. For the outgrowth assays, a maximum of 40 fields per well was imaged (10x magnification), containing 500 neurons per well in total. Using the Neuronal Profiling Bioapplication (Cellomics), neurites were traced and neurite length per individual neuron was determined. For the cluster assays, the entire well was imaged (5x magnification), comprising 9 fields per well. Using the Morphology Bioapplication (Cellomics), cell clusters were outlined and the area of each cluster determined. The bioassays included 5 wells per condition (n=5). Total neurite length per condition was calculated by first averaging the total neurite length/neuron in each well. Total neurite length per condition was the average of five wells. Total cluster area per condition was calculated by first adding up all measured cluster areas per well. Total cluster area per condition was the average of five wells. Results are expressed as means ± SEM. Results were analyzed for statistically significant differences via a two-way analysis of variance (ANOVA) to test for effects of gene and interaction of gene and time (gene x time). ANOVA was followed by a Bonferroni post-hoc test to find significance between the different groups. Per experiment, differences were considered statistically significant if p<0.05. A gene was considered to have an effect in 'the stimulation of neurite outgrowth' or in 'the interaction behavior with MCs' when the results of at least 2 of 3 independent experiments were statistically significant.

Example 2

Material and Methods

Overexpression OEG or skin fibroblasts were plated in PLL-coated 96-wells plates at a density of 8000 cells/ well in culture medium (for OEG: DF-IOS containing 2 μM forskolin (Sigma- Aldrich) and 20 μg/ml pituitary extract (PEX; Sigma-Aldrich), for fibroblasts: D-IOS). After 24hr medium was replaced with the culture medium and a lentivirus at a concentration of 800000 infectious particles/well. After 18hr, the culture medium was replaced. Uninfected cells served as a control condition. After this procedure for OEG the experiment was exactly conducted as described in the outgrowth bio-assay after the transfection. After this procedure for fibroblasts the experiment was exactly conducted as described in the outgrowth bio-assay after transfection except that the neurons were allowed to grow for 24 hours.

Lentiviral design

Lentivirus was designed by combining a lentiviral vector previously described in Hendriks et al., 2004, containing an IRES-GFP (IRES: Internal Ribosome Entry Site, GFP: Green fluorescent protein) with the Gateway Cloning Gateway® Vector Conversion System (prod#l 1828-029), Invitrogen. The overexpression was controled by a hCMV (human cytomegalovirus) promoter (Hendriks et al., 2004).

Results/Discussion Figure 6 shows a significant average increase of 19% in total neurite length per neuron when DRG are cultured on a monolayer of OEG that overexpress Scavenger receptor class B, member 2 for 8hr. And Figure 7 an 70% increase when these neurons were grown on a monolayer of fibroblasts. These results are very promising considering the following 4 observations:

1. An 8hr time period is a short time for neurons to grow neurites.

2. Unlike a scar in the central nervous system, unmodified OEG are already considered a permissive substrate.

3. Since the DRG neurons used consist of a heterogenous population of neurons, the observed effects may be diluted down by neurons that don't respond to the overexpression, and

4. The result is also visible in neurons grown on fibroblast, a cell type that is normally an inhibitory substrate to neurite outgrowth. Taken together, the observed increase in outgrowth when primary neurons are cultured on primary OEG or fibroblasts suggests that a similar overexpression of Scavenger receptor class B, member 2 in an in vivo paradigm can assist regeneration processes.

References

Adams JC, Tucker RP. 2000. The thrombospondin type 1 repeat (TSR) superfamily: diverse proteins with related roles in neuronal development. Dev Dyn

218(2):280-299. Anceriz N, Vandal K, Tessier PA. 2007. S100A9 mediates neutrophil adhesion to fibronectin through activation of beta2 integrins. Biochem Biophys Res

Commun 354(l):84-89. Aoki K, Nakahara Y, Yamada S, Eto K. 1999. Role of polysialic acid on outgrowth of rat olfactory receptor neurons. Mech Dev 85(1-2): 103-110. Asch AS, Barnwell J, Silverstein RL, Nachman RL. 1987. Isolation of the thrombospondin membrane receptor. J Clin Invest 79(4):1054-1061. Au E, Richter MW, Vincent AJ, Tetzlaff W, Aebersold R, Sage EH, Roskams AJ.

2007. SPARC from olfactory ensheathing cells stimulates Schwann cells to promote neurite outgrowth and enhances spinal cord repair. J Neurosci 27(27):7208-7221.

Barber PC, Lindsay RM. 1982. Schwann cells of the olfactory nerves contain glial fibrillary acidic protein and resemble astrocytes. Neuroscience 7(12):3077-

3090.

Baron- Van Evercooren A, Gansmuller A, Duhamel E, Pascal F, Gumpel M. 1992. Repair of a myelin lesion by Schwann cells transplanted in the adult mouse spinal cord. J Neuroimmunol 40(2-3) :235-242. Beisvag V, Junge FK, Bergum H, Jolsum L, Lydersen S, Gunther CC, Ramampiaro H,

Langaas M, Sandvik AK, Laegreid A. 2006. GeneTools— application for functional annotation and statistical hypothesis testing. BMC Bioinformatics 7:470.

Benowitz LI, Routtenberg A. 1997. GAP-43: an intrinsic determinant of neuronal development and plasticity. Trends Neurosci 20(2):84-91. Bentley CA, Lee KF. 2000. p75 is important for axon growth and Schwann cell migration during development. J Neurosci 20(20):7706-7715. Bonfanti L. 2006. PSA-NCAM in mammalian structural plasticity and neurogenesis.

Prog Neurobiol 80(3): 129-164. Boruch AV, Conners JJ, Pipitone M, Deadwyler G, Storer PD, Devries GH, Jones KJ.

2001. Neurotrophic and migratory properties of an olfactory ensheathing cell line. Glia 33(3):225-229.

Carlstedt T. 1997. Nerve fibre regeneration across the peripheral -central transitional zone. J Anat 190 ( Pt l):51-56.

Chan EY, Kir S, Tooze SA. 2007. siRNA screening of the kinome identifies ULKl as a multidomain modulator of autophagy. J Biol Chem 282(35) :25464-25474. Chang K, Pastan I. 1996. Molecular cloning of mesothelin, a differentiation antigen present on mesothelium, mesotheliomas, and ovarian cancers. Proc Natl Acad Sci U S A 93(l):136-140.

Chung RS, Woodhouse A, Fung S, Dickson TC, West AK, Vickers JC, Chuah MI.

2004. Olfactory ensheathing cells promote neurite sprouting of injured axons in vitro by direct cellular contact and secretion of soluble factors. Cell MoI Life

Sci 61(10):1238-1245. Clark BR, Kelly SE, Fleming S. 1990. Calgranulin expression and association with the keratinocyte cytoskeleton. J Pathol 160(l):25-30. Crandall JE, Dibble C, Butler D, Pays L, Ahmad N, Kostek C, Puschel AW,

Schwarting GA. 2000. Patterning of olfactory sensory connections is mediated by extracellular matrix proteins in the nerve layer of the olfactory bulb. J Neurobiol 45(4): 195-206.

Curtis R, Stewart HJ, Hall SM, Wilkin GP, Mirsky R, Jessen KR. 1992. GAP-43 is expressed by nonmyelin-forming Schwann cells of the peripheral nervous system. J Cell Biol 116(6): 1455-1464. da Cunha A, Vitkovic L. 1990. Regulation of immunoreactive GAP-43 expression in rat cortical macroglia is cell type specific. J Cell Biol 11 l(l):209-215.

Dawson DW, Pearce SF, Zhong R, Silverstein RL, Frazier WA, Bouck NP. 1997.

SCARB2 mediates the In vitro inhibitory effects of thrombospondin-1 on endothelial cells. J Cell Biol 138(3):707-717.

Donato R. 2003. Intracellular and extracellular roles of SlOO proteins. Microsc Res Tech 60(6):540-551.

Doucette JR, Kiernan JA, Flumerfelt BA. 1983. The re-innervation of olfactory glomeruli following transection of primary olfactory axons in the central or peripheral nervous system. J Anat 137 (Pt 1): 1-19. Doucette R. 1990. Glial influences on axonal growth in the primary olfactory system.

Glia 3(6):433-449. Doucette R. 1996. Immunohistochemical localization of laminin, fibronectin and collagen type IV in the nerve fiber layer of the olfactory bulb. Int J Dev Neurosci 14(7-8):945-959.

Echeverri CJ, Beachy PA, Baum B, Boutros M, Buchholz F, Chanda SK, Downward J,

Ellenberg J, Fraser AG, Hacohen N, Hahn WC, Jackson AL, Kiger A, Linsley

PS, Lum L, Ma Y, Mathey-Prevot B, Root DE, Sabatini DM, Taipale J,

Perrimon N, Bernards R. 2006. Minimizing the risk of reporting false positives in large-scale RNAi screens. Nat Methods 3(10):777-779.

Fairless R, Frame MC, Barnett SC. 2005. N-cadherin differentially determines

Schwann cell and olfactory ensheathing cell adhesion and migration responses upon contact with astrocytes. MoI Cell Neurosci 28(2):253-263.

Farbman AL 1990. Olfactory neurogenesis: genetic or environmental controls? Trends Neurosci 13(9):362-365.

Febbraio M, Hajjar DP, Silverstein RL. 2001. SCARB2: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J

Clin Invest 108(6):785-791.

Felts PA, Smith KJ. 1992. Conduction properties of central nerve fibers remyelinated by Schwann cells. Brain Res 574(1-2): 178-192.

Field P, Li Y, Raisman G. 2003. Ensheathment of the olfactory nerves in the adult rat. J

Neurocytol 32(3):317-324. Foell D, Wittkowski H, Vogl T, Roth J. 2007. SlOO proteins expressed in phagocytes: a novel group of damage-associated molecular pattern molecules. J Leukoc Biol 81(l):28-37.

Franssen EH, de Bree FM, Verhaagen J. 2007. Olfactory ensheathing glia: their contribution to primary olfactory nervous system regeneration and their regenerative potential following transplantation into the injured spinal cord.

Brain Res Rev 56(l):236-258. Fujisawa H, Kitsukawa T, Kawakami A, Takagi S, Shimizu M, Hirata T. 1997. Roles of a neuronal cell-surface molecule, neuropilin, in nerve fiber fasciculation and guidance. Cell Tissue Res 290(2):465-470. Gallo G, Letourneau PC. 2004. Regulation of growth cone actin filaments by guidance cues. J Neurobiol 58(l):92-102. Garcia-Alias G, Lopez-Vales R, Fores J, Navarro X, Verdu E. 2004. Acute transplantation of olfactory ensheathing cells or Schwann cells promotes recovery after spinal cord injury in the rat. J Neurosci Res 75(5):632-641.

Gentry JJ, Barker PA, Carter BD. 2004. The p75 neurotrophin receptor: multiple interactors and numerous functions. Prog Brain Res 146:25-39. Giger RJ, Pasterkamp RJ, Heijnen S, Holtmaat AJ, Verhaagen J. 1998. Anatomical distribution of the chemorepellent semaphorin III/collapsin-1 in the adult rat and human brain: predominant expression in structures of the olfactory - hippocampal pathway and the motor system. J Neurosci Res 52(l):27-42. Golding J, Shewan D, Cohen J. 1997. Maturation of the mammalian dorsal root entry zone— from entry to no entry. Trends Neurosci 20(7):303-308.

Gong Q, Bailey MS, Pixley SK, Ennis M, Liu W, Shipley MT. 1994. Localization and regulation of low affinity nerve growth factor receptor expression in the rat olfactory system during development and regeneration. J Comp Neurol

344(3):336-348. Good DJ, Polverini PJ, Rastinejad F, Le Beau MM, Lemons RS, Frazier WA, Bouck

NP. 1990. A tumor suppressor-dependent inhibitor of angiogenesis is immunologically and functionally indistinguishable from a fragment of thrombospondin. Proc Natl Acad Sci U S A 87(17):6624-6628. Graziadei PP, Graziadei GA. 1979. Neurogenesis and neuron regeneration in the olfactory system of mammals. I. Morphological aspects of differentiation and structural organization of the olfactory sensory neurons. J Neurocytol 8(1): 1-18. Graziadei PP, Levine RR, Graziadei GA. 1978. Regeneration of olfactory axons and synapse formation in the forebrain after bulbectomy in neonatal mice. Proc Natl

Acad Sci U S A 75(10):5230-5234. Greenwalt DE, Lipsky RH, Ockenhouse CF, Ikeda H, Tandon NN, Jamieson GA. 1992.

Membrane glycoprotein SCARB2: a review of its roles in adherence, signal transduction, and transfusion medicine. Blood 80(5): 1105-1115.

Grimpe B, Pressman Y, Lupa MD, Horn KP, Bunge MB, Silver J. 2005. The role of proteoglycans in Schwann cell/astrocyte interactions and in regeneration failure at PNS/CNS interfaces. MoI Cell Neurosci 28(1): 18-29. Gubbels JA, Belisle J, Onda M, Rancourt C, Migneault M, Ho M, Bera TK, Connor J,

Sathyanarayana BK, Lee B, Pastan I, Patankar MS. 2006. Mesothelin-MUC16 binding is a high affinity, N-glycan dependent interaction that facilitates peritoneal metastasis of ovarian tumors. MoI Cancer 5(l):50. Harding J, Graziadei PP, Monti Graziadei GA, Margolis FL. 1977. Denervation in the primary olfactory pathway of mice. IV. Biochemical and morphological evidence for neuronal replacement following nerve section. Brain Res

132(l):l l-28.

Hassan R, Ho M. 2008. Mesothelin targeted cancer immunotherapy. Eur J Cancer 44(l):46-53.

Hastings GA, Coleman TA, Haudenschild CC, Stefansson S, Smith EP, Barthlow R,

Cherry S, Sandkvist M, Lawrence DA. 1997. Neuroserpin, a brain-associated inhibitor of tissue plasminogen activator is localized primarily in neurons.

Implications for the regulation of motor learning and neuronal survival. J Biol Chem 272(52):33062-33067.

Hendriks WT, Ruitenberg MJ, Blits B, Boer GJ, Verhaagen J. 2004. Viral vector- mediated gene transfer of neurotrophins to promote regeneration of the injured spinal cord. Prog Brain Res. 146: 451-476.

Hill RM, Coates LC, Parmar PK, Mezey E, Pearson JF, Birch NP. 2002. Expression and functional characterization of the serine protease inhibitor neuroserpin in endocrine cells. Ann N Y Acad Sci 971:406-415. Hoffman JR, O'Shea KS. 1999. Thrombospondin expression in nerve regeneration I.

Comparison of sciatic nerve crush, transection, and long-term denervation.

Brain Res Bull 48(4):413-420. Husemann J, Loike JD, Anankov R, Febbraio M, Silverstein SC. 2002. Scavenger receptors in neurobiology and neuropathology: their role on microglia and other cells of the nervous system. Glia 40(2): 195-205. Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G,

Linsley PS. 2003. Expression profiling reveals off- target gene regulation by RNAi. Nat Biotechnol 21(6):635-637.

Johnson EM, Jr., Taniuchi M, DiStefano PS. 1988. Expression and possible function of nerve growth factor receptors on Schwann cells. Trends Neurosci 11(7):299-

304. Kafitz KW, Greer CA. 1997. Role of laminin in axonal extension from olfactory receptor cells. J Neurobiol 32(3):298-310. Kafitz KW, Greer CA. 1999. Olfactory ensheathing cells promote neurite extension from embryonic olfactory receptor cells in vitro. Glia 25(2):99-l 10. Kitsukawa T, Shimono A, Kawakami A, Kondoh H, Fujisawa H. 1995. Overexpression of a membrane protein, neuropilin, in chimeric mice causes anomalies in the cardiovascular system, nervous system and limbs. Development 121(12):4309-

4318.

Kolodkin AL, Levengood DV, Rowe EG, Tai YT, Giger RJ, Ginty DD. 1997. Neuropilin is a semaphorin III receptor. Cell 90(4):753-762.

Kromer LF, Cornbrooks CJ. 1985. Transplants of Schwann cell cultures promote axonal regeneration in the adult mammalian brain. Proc Natl Acad Sci U S A

82(18):6330-6334.

Krueger SR, Ghisu GP, Cinelli P, Gschwend TP, Osterwalder T, Wolfer DP, Sonderegger P. 1997. Expression of neuroserpin, an inhibitor of tissue plasminogen activator, in the developing and adult nervous system of the mouse. J Neurosci 17(23):8984-8996. Kumar R, Hayat S, Felts P, Bunting S, Wigley C. 2005. Functional differences and interactions between phenotypic subpopulations of olfactory ensheathing cells in promoting CNS axonal regeneration. Glia 50(1): 12-20.

Lakatos A, Barnett SC, Franklin RJ. 2003. Olfactory ensheathing cells induce less host astrocyte response and chondroitin sulphate proteoglycan expression than

Schwann cells following transplantation into adult CNS white matter. Exp

Neurol 184(l):237-246. Lakatos A, Franklin RJ, Barnett SC. 2000. Olfactory ensheathing cells and Schwann cells differ in their in vitro interactions with astrocytes. Glia 32(3):214-225. Lauer M, Scruggs B, Chen S, Wassenhove-McCarthy D, McCarthy KJ. 2007. Leprecan distribution in the developing and adult kidney. Kidney Int 72(1):82-91. Leaver SG, Harvey AR, Plant GW. 2006. Adult olfactory ensheathing glia promote the long-distance growth of adult retinal ganglion cell neurites in vitro. Glia

53(5):467-476. LeBleu VS, Macdonald B, Kalluri R. 2007. Structure and function of basement membranes. Exp Biol Med (Maywood) 232(9): 1121- 1129. Li WX, Howard RJ, Leung LL. 1993. Identification of SVTCG in thrombospondin as the conformation-dependent, high affinity binding site for its receptor,

SCARB2. J Biol Chem 268(22):16179-16184.

Li Y, Field PM, Raisman G. 1997. Repair of adult rat corticospinal tract by transplants of olfactory ensheathing cells. Science 277(5334):2000-2002.

Li Y, Field PM, Raisman G. 2005a. Olfactory ensheathing cells and olfactory nerve fibroblasts maintain continuous open channels for regrowth of olfactory nerve fibres. Glia 52(3):245-251.

Li Y, Li D, Raisman G. 2005b. Interaction of olfactory ensheathing cells with astrocytes may be the key to repair of tract injuries in the spinal cord: The

'pathway hypothesis'. J Neurocytol 34(3-5):343-351. Li Y, Raisman G. 1994. Schwann cells induce sprouting in motor and sensory axons in the adult rat spinal cord. J Neurosci 14(7):4050-4063.

Lipson AC, Widenfalk J, Lindqvist E, Ebendal T, Olson L. 2003. Neurotrophic properties of olfactory ensheathing glia. Exp Neurol 180(2):167-171.

Medcalf RL. 2005. Meet the serpins. Febs J 272(19):4841. Miragall F, Dermietzel R. 1992. Immunocytochemical localization of cell adhesion molecules in the developing and mature olfactory system. Microsc Res Tech

23(2):157-172. Miragall F, Kadmon G, Husmann M, Schachner M. 1988. Expression of cell adhesion molecules in the olfactory system of the adult mouse: presence of the embryonic form of N-CAM. Dev Biol 129(2):516-531. Miranda E, Lomas DA. 2006. Neuroserpin: a serpin to think about. Cell MoI Life Sci

63(6):709-722. Morrissey TK, Kleitman N, Bunge RP. 1991. Isolation and functional characterization of Schwann cells derived from adult peripheral nerve. J Neurosci 11(8):2433-

2442. Neugebauer KM, Emmett CJ, Venstrom KA, Reichardt LF. 1991. Vitronectin and thrombospondin promote retinal neurite outgrowth: developmental regulation and role of integrins. Neuron 6(3):345-358.

Newton RA, Hogg N. 1998. The human SlOO protein MRP-14 is a novel activator of the beta 2 integrin Mac-1 on neutrophils. J Immunol 160(3): 1427-1435. Osterhout DJ, Frazier WA, Higgins D. 1992. Thrombospondin promotes process outgrowth in neurons from the peripheral and central nervous systems. Dev Biol

150(2):256-265.

Osterwalder T, Cinelli P, Baici A, Pennella A, Krueger SR, Schrimpf SP, Meins M, Sonderegger P. 1998. The axonally secreted serine proteinase inhibitor, neuroserpin, inhibits plasminogen activators and plasmin but not thrombin. J

Biol Chem 273(4):2312-2321. Paino CL, Fernandez- Valle C, Bates ML, Bunge MB. 1994. Regrowth of axons in lesioned adult rat spinal cord: promotion by implants of cultured Schwann cells. J Neurocytol 23(7):433-452.

Parmar PK, Coates LC, Pearson JF, Hill RM, Birch NP. 2002. Neuroserpin regulates neurite outgrowth in nerve growth factor- treated PC 12 cells. J Neurochem

82(6):1406-1415.

Pasterkamp RJ, De Winter F, Holtmaat AJ, Verhaagen J. 1998. Evidence for a role of the chemorepellent semaphorin III and its receptor neuropilin-1 in the regeneration of primary olfactory axons. J Neurosci 18(23):9962-9976. Pastrana E, Moreno-Flores MT, Gurzov EN, Avila J, Wandosell F, Diaz-Nido J. 2006.

Genes associated with adult axon regeneration promoted by olfactory ensheathing cells: a new role for matrix metalloproteinase 2. J Neurosci 26(20):5347-5359.

Plant GW, Christensen CL, Oudega M, Bunge MB. 2003. Delayed transplantation of olfactory ensheathing glia promotes sparing/regeneration of supraspinal axons in the contused adult rat spinal cord. J Neurotrauma 20(1): 1-16.

Ramer LM, Au E, Richter MW, Liu J, Tetzlaff W, Roskams AJ. 2004. Peripheral olfactory ensheathing cells reduce scar and cavity formation and promote regeneration after spinal cord injury. J Comp Neurol 473(1): 1-15. Ramon-Cueto A, Cordero MI, Santos-Benito FF, Avila J. 2000. Functional recovery of paraplegic rats and motor axon regeneration in their spinal cords by olfactory ensheathing glia. Neuron 25(2):425-435. Ramon-Cueto A, Perez J, Nieto-Sampedro M. 1993. In vitro enfolding of olfactory neurites by p75 NGF receptor positive ensheathing cells from adult rat olfactory bulb. Eur J Neurosci 5(9):1172-1180. Ramon-Cueto A, Plant GW, Avila J, Bunge MB. 1998. Long-distance axonal regeneration in the transected adult rat spinal cord is promoted by olfactory ensheathing glia transplants. J Neurosci 18(10):3803-3815.

Roux PP, Barker PA. 2002. Neurotrophin signaling through the p75 neurotrophin receptor. Prog Neurobiol 67(3):203-233.

Ruitenberg MJ, Levison DB, Lee SV, Verhaagen J, Harvey AR, Plant GW. 2005. NT-3 expression from engineered olfactory ensheathing glia promotes spinal sparing and regeneration. Brain 128(Pt 4):839-853.

Samson AL, Medcalf RL. 2006. Tissue-type plasminogen activator: a multifaceted modulator of neurotransmission and synaptic plasticity. Neuron 50(5):673-678.

Santos-Silva A, Fairless R, Frame MC, Montague P, Smith GM, Toft A, Riddell JS, Barnett SC. 2007. FGF/heparin differentially regulates Schwann cell and olfactory ensheathing cell interactions with astrocytes: a role in astrocytosis. J Neurosci 27(27):7154-7167. Sasaki M, Black JA, Lankford KL, Tokuno HA, Waxman SG, Kocsis JD. 2006. Molecular reconstruction of nodes of Ranvier after remyelination by transplanted olfactory ensheathing cells in the demyelinated spinal cord. J Neurosci 26(6): 1803- 1812.

Sawicki J. A., et al, (1998), Exp. Cell Res., 244: 367-369. Scacheri PC, Rozenblatt-Rosen O, Caplen NJ, Wolfsberg TG, Umayam L, Lee JC, Hughes CM, Shanmugam KS, Bhattacharjee A, Meyerson M, Collins FS. 2004. Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proc Natl Acad Sci U S A 101(7):1892-1897. Schwarting GA, Kostek C, Ahmad N, Dibble C, Pays L, Puschel AW. 2000. Semaphorin 3A is required for guidance of olfactory axons in mice. J Neurosci 20(20):7691-7697. Shibata F, Ito A, Ohkuma Y, Mitsui K. 2005. Mitogenic activity of S100A9 (MRP- 14).

Biol Pharm Bull 28(12):2312-2314. Smith PM, Lakatos A, Barnett SC, Jeffery ND, Franklin RJ. 2002. Cryopreserved cells isolated from the adult canine olfactory bulb are capable of extensive remyelination following transplantation into the adult rat CNS. Exp Neurol 176(2):402-406. Sonigra RJ, Brighton PC, Jacoby J, Hall S, Wigley CB. 1999. Adult rat olfactory nerve ensheathing cells are effective promoters of adult central nervous system neurite outgrowth in coculture. Glia 25(3):256-269.

Stoeckli ET, Kuhn TB, Due CO, Ruegg MA, Sonderegger P. 1991. The axonally secreted protein axonin-1 is a potent substratum for neurite growth. J Cell Biol

112(3):449-455. Takagi S, Kasuya Y, Shimizu M, Matsuura T, Tsuboi M, Kawakami A, Fujisawa H.

1995. Expression of a cell adhesion molecule, neuropilin, in the developing chick nervous system. Dev Biol 170(l):207-222. Takami T, Oudega M, Bates ML, Wood PM, Kleitman N, Bunge MB. 2002. Schwann cell but not olfactory ensheathing glia transplants improve hindlimb locomotor performance in the moderately contused adult rat thoracic spinal cord. J

Neurosci 22(15):6670-6681.

Taniguchi M, Nagao H, Takahashi YK, Yamaguchi M, Mitsui S, Yagi T, Mori K, Shimizu T. 2003. Distorted odor maps in the olfactory bulb of semaphorin 3A- deficient mice. J Neurosci 23(4): 1390-1397. Turner CP, Perez-Polo JR. 1993. Expression of p75NGFR in the olfactory system following peripheral deafferentation. Neuroreport 4(8): 1023-1026. Van Den Pol AN, Santarelli JG. 2003. Olfactory ensheathing cells: Time lapse imaging of cellular interactions, axonal support, rapid morphologic shifts, and mitosis. J

Comp Neurol 458(2): 175-194. Van Eldik LJ, Christie-Pope B, Bolin LM, Shooter EM, Whetsell WO, Jr. 1991.

Neurotrophic activity of S-100 beta in cultures of dorsal root ganglia from embryonic chick and fetal rat. Brain Res 542(2):280-285. van Gent D, Sharp P, Morgan K, Kalsheker N. 2003. Serpins: structure, function and molecular evolution. Int J Biochem Cell Biol 35(11):1536-1547. Vranka JA, Sakai LY, Bachinger HP. 2004. Prolyl 3-hydroxylase 1, enzyme characterization and identification of a novel family of enzymes. J Biol Chem

279(22):23615-23621. Wang KC, Kim JA, Sivasankaran R, Segal R, He Z. 2002. P75 interacts with the Nogo receptor as a co-receptor for Nogo, MAG and OMgp. Nature 420(6911):74-78. Wassenhove-McCarthy DJ, McCarthy KJ. 1999. Molecular characterization of a novel basement membrane- associated proteoglycan, leprecan. J Biol Chem

274(35):25004-25017.

Wewetzer K, Grothe C, Claus P. 2001. In vitro expression and regulation of ciliary neurotrophic factor and its alpha receptor subunit in neonatal rat olfactory ensheathing cells. Neurosci Lett 306(3): 165- 168. Wilby MJ, Muir EM, Fok-Seang J, Gour BJ, Blaschuk OW, Fawcett JW. 1999. N-

Cadherin inhibits Schwann cell migration on astrocytes. MoI Cell Neurosci

14(l):66-84. Woodhall E, West AK, Chuah MI. 2001. Cultured olfactory ensheathing cells express nerve growth factor, brain-derived neurotrophic factor, glia cell line-derived neurotrophic factor and their receptors. Brain Res MoI Brain Res 88(l-2):203-

213.

Woolf CJ, Reynolds ML, Chong MS, Emson P, Irwin N, Benowitz LI. 1992. Denervation of the motor endplate results in the rapid expression by terminal

Schwann cells of the growth-associated protein GAP-43. J Neurosci

12(10):3999-4010. Zhang JY, Luo XG, Xian CJ, Liu ZH, Zhou XF. 2000. Endogenous BDNF is required for myelination and regeneration of injured sciatic nerve in rodents. Eur J Neurosci 12(12):4171-4180.

Zhou XF, Li HY. 2007. Roles of glial p75NTR in axonal regeneration. J Neurosci Res

85(8):1601-1605.

Zuber MX, Goodman DW, Karns LR, Fishman MC. 1989. The neuronal growth- associated protein GAP-43 induces filopodia in non-neuronal cells. Science 244(4909): 1193- 1195. Table 1. Gene Ontology classes including their children that were used for selection of candidate genes

Gene Ontology classes

Biological process

GO:0009653 anatomical structure morphogenesis

GO:0007155 cell adhesion

GO:0007154 cell communication

GO:0016049 cell growth

GO:0006928 cell motility

GO: 0016043 cellular component organization and biogenesis

GO:0040007 growth

GO:0040011 locomotion

GO:0050896 response to stimulus

GO:0009888 tissue development

Cellular component

GO:0009986 cell surface

GO:0031012 extracellular matrix

GO:0005576 extracellular region

GO:0016020 membrane

Table 2. List of 60 target genes tested in the outgrowth and cluster assays

Accession# Gene name approach bioassay

AA819288 Retinoic acid receptor responder (tazarotene outgrowth induced) 1

AI012463 GLI pathogenesis-related 1 (glioma) 1 outgrowth

AI412212 Vasoactive intestinal polypeptide 1 outgrowth

AW534613 Wiskott-Aldrich syndrome homolog (human) 1 outgrowth

(predicted)

AW915488 Tyro protein tyrosine kinase binding protein 1 outgrowth BF407571 Neurturin 1 outgrowth BF419904 Growth arrest and DNA-damage-inducible 45 1 outgrowth gamma BF420705 Transforming growth factor, beta 2 2: OnO outgrowth

2: OS (cOEG) cluster

BM385941 Transcribed locus 1 outgrowth

BM387134 Tenascin C 1 outgrowth

BQ205363 Fibroblast growth factor receptor-like 1 2: OnO outgrowth

2: OS (cOEG) cluster

NM_012551 Early growth response 1 1 outgrowth

NM_012588 Insulin-like growth factor binding protein 3 2: OnO outgrowth

2: OS (cOEG) cluster

NM_012608 Membrane metallo endopeptidase 2: OnO outgrowth

2: OS (cOEG) cluster

NM_012610 Nerve growth factor receptor (TNFR superfamily, 2: OnO outgrowth member 16) 2: OS (cSCs) cluster

NM_012731 Neurotrophic tyrosine kinase, receptor, type 2 1 outgrowth

NM_012756 Insulin-like growth factor 2 receptor 2: OS (cOEG) outgrowth

NM_012777 Apolipoprotein D 2: OS (cOEG) cluster

NM_012823 Annexin A3 1 outgrowth

NM_012829 Cholecystokinin 1 outgrowth

NM_012950 Coagulation factor II (thrombin) receptor 2: OnO outgrowth

2: OS (cOEG) cluster

NM_012967 Intercellular adhesion molecule 1 1 outgrowth NM_013046 Thyrotropin releasing hormone 1 outgrowth NM_013122 Insulin-like growth factor binding protein 2 1 outgrowth NM_017037 Peripheral myelin protein 22 2: OnO outgrowth

2: OS (cOEG) cluster

NM_017139 Proenkephalin 1 2: OnO outgrowth

2: OS (cOEG) cluster

NM_017166 Stathmin 1 1 outgrowth

NM_017195 Growth associated protein 43 2: OS (cSCs) cluster

NM_017318 Protein tyrosine kinase 2 beta 1 outgrowth

NM_017336 Protein tyrosine phosphatase, receptor type, O 1 outgrowth

NM_017353 Solute carrier family 7 (cationic amino acid 2: OnO outgrowth transporter, y+ system), member 5 2: OS (cOEG) cluster

NM_019144 Acid phosphatase 5, tartrate resistant 1 outgrowth

NM_019237 Procollagen C-endopeptidase enhancer protein 2: OnO outgrowth

2: OS (cOEG) cluster

NM_019249 Protein tyrosine phosphatase, receptor type, F 2: OS (cSCs) cluster

NM_019370 Ectonucleotide pyrophosphatase/phosphodiesterase 3 2: OnO outgrowth

2: OS (cOEG) cluster

NM_020100 Receptor (calcitonin) activity modifying protein 3 2: OnO outgrowth

2: OS (cOEG) cluster

NM_021989 Tissue inhibitor of metalloproteinase 2 1 outgrowth

2: OS (cOEG) cluster

NM_022266 Connective tissue growth factor 2: OnO outgrowth

2: OS (cOEG) cluster

NM_022695 Neurotensin receptor 2 1 outgrowth

NM_030852 Melanoma inhibitory activity 1 2: OS (cOEG) cluster

NM_030857 Yamaguchi sarcoma viral (v-yes-1) oncogene 1 outgrowth homolog

NM_030997 VGF nerve growth factor inducible 1 outgrowth

NM_031070 Nel-like 2 homolog (chicken) 2: OS (cOEG) cluster

NM_031521 Neural cell adhesion molecule 1 1 outgrowth

NM_031658 Mesothelin 1 outgrowth

NM_031747 Calponin 1 2: OnO outgrowth

2: OS (cOEG) cluster

NM_031832 Lectin, galactOSe binding, soluble 3 1 outgrowth

NM_031967 N-myc downstream regulated gene 4 1 outgrowth

2: OS (cSCs) cluster

NM_053430 Flap structure-specific endonuclease 1 1 outgrowth NM_053587 SlOO calcium binding protein A9 (calgranulin B) 1 outgrowth NM_053667 Leprecan 1 2: OnO outgrowth

2: OS (cOEG) cluster

NM_053779 Serine (or cysteine) peptidase inhibitor, clade I, 1 outgrowth member 1

NM_053796 FI l receptor 2: OS (cOEG) cluster

NM_053908 Protein tyrosine phosphatase, non-receptor type 6 1 outgrowth

NM_054001 Scavenger receptor class B, member 2 1 outgrowth

NM_080698 Fibromodulin 2: OS (cOEG) cluster

NM_130413 Src family associated phosphoprotein 2 1 outgrowth

NM_138848 Podocalyxin-like 2: OS (cOEG) cluster

NM_145098 Neuropilin 1 1 outgrowth

NM_153735 Neuronal pentraxin 1 1 outgrowth

Table 3. List of 7 genes potentially involved in neurite outgrowth stimulation and 2 genes contributing to MC -induced SC clustering