POWDERY MILDEW RESISTANCE PROVIDING GENES IN CUCUMIS SATIVUS Description

The present invention relates to powdery mildew resistance providing genes of Cucumis sativus, wherein said resistance is provided by impairment of the present genes either at the expression or protein level. Further, the present invention relates to plants comprising the present resistance conferring genes and seeds, embryos or other propagation material thereof.

Powdery mildew (PM) is one of the main fungal diseases known in plants belonging to the Cucumis family such as Cucumis sativus (cucumber) , both in the field and greenhouse .

Powdery mildew diseases are generally caused by many different species of fungi of the order Erysiphales . The disease is characterized by distinctive symptoms such as white powder-like spots on the leaves and stems. Generally, the lower leaves are the most affected, but the mildew can appear on any part of the plant that is exposed above ground. As the disease progresses, the spots get larger and thicker as massive numbers of spores form, and the mildew spreads up and down the length of the plant such on the stem and even the fruits.

Severely affected leaves can become dry and brittle, or can wither and die. Because of the infection, the fruits can be smaller in size, fewer in number, less able to be successfully stored, sun scalded, incompletely ripe, and having a poor flavor. It may also predispose plants to be more vulnerable to other pathogens. Eventually, the plant can die. Powdery mildew can, amongst others, be caused by the fungus Sphaerotheca fuliginea (recently renamed:

Podosphaera xanthii also designated as Oidium erysiphoides) and/or Erysiphe cichoracearum DC (recently renamed:

Golovinomyces cichoracearum also designated as Oidium chrysanthemi) .

Considering the economic importance of Cucumis plant species, such as cucumber, there is a continued need in the art to provide powdery mildew resistance providing genes.

In view of the above need in the art, it is an object of the present invention, amongst other objects, to meet this need.

According to the present invention, this object, amongst other objects, is met by an powdery mildew

resistance conferring gene as defined in the appended claim 1.

Specifically, this object of the present invention, amongst other objects, is met by a powdery mildew resistance conferring gene, wherein the amino acid sequence encoded by said resistance conferring gene is selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20 and SEQ ID No. 22, and amino acid sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity such as more than 96%, 97%, 98%, 99%; and wherein said resistance conferring gene is impaired.

The object of the present invention, amongst other objects, is additionally met by a powdery mildew resistance conferring gene, wherein the cDNA sequence transcribed from said resistance conferring gene is selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, and SEQ ID No. 21, and cDNA sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity such as more than 96%, 97%, 98%, 99%; and wherein said resistance conferring gene is impaired.

Impaired resistance conferring gene according to the present invention is meant to indicate a gene providing a reduced, or even absent, susceptibility to powdery mildew caused by fungi indicated by powder-like spots on the leaves and stems , such as fungi belonging to the order Erysiphales such as Sphaerotheca fuliginea (recently renamed:

Podosphaera xanthii also designated as Oidium erysiphoides) and/or Erysiphe cichoracearum DC.

Impaired resistance conferring gene according to the present invention are mutated genes. The mutation of the present genes can through different mechanisms results in impairment. For example, mutations in protein encoding DNA sequences may lead to mutated, truncated or non-functional proteins. Mutations in non-coding DNA sequences may cause alterantive splicing, translation or protein trafficing. Alternatively, a mutation resulting in an altered

transcriptional activity of a gene, which determines the amount of mRNA available for translation to protein, may results in low levels, or absence, of proteins.

Additionally, the impairment of gene function may be caused after translation, i.e. at protein level.

Impairment according to the present invention is also indicated by observing a powdery mildew resitance in a Cucumis sativus plant comprising a gene which as mutated at the protein level as compared to the SEQ ID Nos. provided herein or no expression of the SEQ ID Nos. provided herein is observed.

Impaired is also indicated herein as a non ^¬ functional gene or protein. Although the function of the present genes is not yet identified, a non-functional gene or protein can be readily determined by establishing powdery mildew resitance (non-functional) or powdery mildew

susceptibility (functional) in a plant. A powdery mildew resitance (non-functional) paint is indicated by comprising a gene which as mutated at the protein level as compared to the SEQ ID Nos. provided herein or no expression of the SEQ ID Nos. provided herein is observed.

Functional and non-functional genes or proteins can also be determined using complementation experiments. For example, transforming a resisitant powdery mildew

Cucumis sativus plant with any of the present genes or proteins will result in a powdery mildew susceptible Cucumis sativus plant when the gene or protein is functional while the Cucumis sativus plant will remain resistant when the gene or protein is non-functional.

According to the present invention, the present powdery mildew resistance conferring genes provide powdery mildew resistance when the present genes are impaired.

Impaired according to the present invention can be indicated by the absence, or decrease of a functional, or non-muted, protein identified herein as SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20 or SEQ ID No. 22. In the art, many mechanisms are known resulting in the impairment of a gene either at the transcription, translation or protein level.

For example, impairment at the transcription level can be the result of one or more mutations in transcription regulation sequences, such as promoters, enhancers, and initiation, termination or intron splicing sequences. These sequences are generally located 5' of, 3' of, or within the coding sequence represented by SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, or SEQ ID No. 21. Impairment can also be provided by a

deletion, rearrangement or insertion in the present genes.

Impairment at the translation level can be

provided by a premature stop-codons or other RNA -> protein controlling mechanisms (such as splicing) or

posttranslational modifications influencing, for example, protein folding or cellular trafficking.

Impairment at the protein level can be provided by truncated, misfolded or disturbed protein-protein

interactions .

Independent of the underlying mechanism, impairment according to the present invention is indicated by an decrease or absence a functional protein according to SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20 or SEQ ID No. 22.

According to a preferred embodiment, impairment according to the present invention is provided by one or more mutations in the present genes resulting in the absence of a protein expression product. As indicated, these

mutations can cause a defective expression at the

transcription or translation level.

According to another preferred embodiment, impairment according to the present invention is caused by one or more mutations in the present genes resulting in a non-functional protein expression product. A non-functional protein expression product can, for example, be caused by premature stop-codons, incorrect translation or post- translational processing or by insertions, deletions or amino acid changes .

Using molecular biology methods, impairment of the present genes can also be accomplished by gene silencing, for example using siRNA or knocking out of the present genes . Methods based on EMS or other mutagenic chemical compounds capable of randomly change nucleic acids into other nucleotides are also contemplated within the context of the present invention. Detection of such mutations typically involves high sensitivity melting curve analyses or nucleotide sequencing-based TILLING procedures.

The present invention relates to nucleotide and amino acid sequences with more than 70%, preferably more than 80%, more preferably more than 90% and most preferably more than 95% sequence identity either at the nucleotide level or the amino acid level.

Sequence identity as used herein is defined as the number of identical consequtive aligned nucleotides, or amino acids, over the full length of the present sequences divided by the number of nucleotides, or amino acids, of the full length of the present sequences and multiplied by 100%.

For example, a sequence with 80% identity to SEQ ID No. 1 comprises over the total length of 1782 nucleotides of SEQ ID No. 15 1426 identical aligned consequtive

nucleotides, i.e., 1426/1782 * 100% = 80%.

According to the invention, the present genes are derived from Cucumis sativus .

According to another aspect, the present invention relates to Cucumis sativus plants comprising in their genome the present impaired powdery mildew resistance conferring genes, i.e., plants not expressing a functional protein selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No.

20 and SEQ ID No. 22, and amino acid sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity.

In general, and preferably, the present plants will be homozygous for the present impaired genes, i.e., comprising two impaired powdery mildew resistance conferring genes, wherein the cDNA sequence transcribed from said resistance conferring gene is selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, and SEQ ID No. 21, and cDNA sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity.

Considering the benefits of the present plants, i.e., providing powdery mildew resistance in cucumber plants, the invention also relates to seeds, plant parts or propagation material capable of providing the present powdery mildew resistant cucumber plants which seeds, plant parts or propagation material comprise one or more of the present powdery mildew resistance conferring genes, i.e., impaired powdery mildew resistance conferring genes, wherein the cDNA sequence transcribed from said resistance

conferring gene is selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, and SEQ ID No. 21, and cDNA sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity. According to yet another aspect, the present invention relates to isolated nucleotide sequences selected from the group consisting of SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 11, SEQ ID No. 13, SEQ ID No. 15, SEQ ID No. 17, SEQ ID No. 19, and SEQ ID No. 21, and nucleotide sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity .

According to still another aspect, the present invention relates to isolated amino acid sequences selected from the group consisting of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18, SEQ ID No. 20 and SEQ ID No. 22, and amino acid sequences with more than 70% identity, preferably more than 80% identity, more preferably more than 90% identity, and most preferably more than 95% identity .

The present invention also relates to the use of one or more of the present powdery mildew resistance

conferring genes, one or more of the present isolated nucleotide sequences, or one or more of the present isolated amino acid sequences for providing a powdery mildew

resistant cucumber plants (Cucumis sativus) . As indicated, the present use is based on impairment, either at the expression or protein level, of the genes described herein and can be readily determined by the presently provided cDNA and amino acid sequences optionally in combination with determination of the presence or absence of powdery mildew resistance and/or in combination with complementation assays .

The present invention will be further described in the examples below of preferred embodiments of the present the example, reference is made to figures

Figure 1: shows Relative expression levels of CsKIP2 in a selection of cucumber germplasm. Average values of expression per group either in absence (-) or presence (+) of a transposon are added including standard deviation error bars. Bar colors indicate the reference gene used to make the calculations.

Figure 2: shows DNA fragments of CsKIP2 amplified with

primers ID3 and ID4 and visualized by gel electrophoresis (2% agarose, lOv/cm, 40 minutes)

Figure 3: shows cDNA sequence alignment of lines with absence

(top strand) and presence (bottom strand) of a transposon-like elemenent in CsKIP2 genomic DNA. Here, a 72 bp deletion is visible in cDNA derived from lines with the transposon-like element

present. Primer binding positions are shown in bold italic characters

Figure 4: shows an amino acid alignment of CsKIP9 alleles of powdery mildew susceptible and powdery mildew resistant CsKIP9 alleles.

Examples

Example 1 : Cucumber germplasm screen for contribution of

CsKIP2 expression levels and allelic variants resistance/susceptibility

Introduction

Impairment of functioning of genes can be caused by different mechanisms. Mutations in protein encoding DNA sequences may be causal for loss-of-function alleles or genes with a change in characteristics. Alternatively, altered transcriptional activity of a gene, which determines the amount of mRNA available for translation to protein, may results in low levels of available proteins. Additionally, the impairment of gene function may be caused after

translation, i.e. at protein level.

The present examples shows that a mutation

(deletion) m the coding sequence of CsKIP2 provides powde mildew resitance.

Material and Methods

A total of twelve Cucumber germplasm lines varying in powdery mildew resistance levels were selected for analysis. Seeds were germinated under standard greenhouse conditions. Hypocotyls were infected with a local powdery mildew isolate 7 days past sowing followed by infection of the first true leaf 14 days past sowing. Evaluation of reaction phenotypes was performed 28 days past sowing (21 and 14 days post infection for hypocotyls) and phenotypes are scored on a scale of 1-9, where 1 is fully susceptible and 9 is fully resistant. Material of infected plants was collected for subsequent RNA isolation according to standard procedures (Machery-Nagel RNA Plant) . RNA isolation was followed by cDNA synthesis using a standard Oligo-dT primer combined with a reverse transcriptase (Finnzymes) with 1 μg total RNA input .

Expression levels of CsKIP2 were determined with CsKIP2 specific PCR primer pair (table 1, ID1 ID2)

amplifying a DNA fragment from exon 5 to exon 7 with a size specific to cDNA, highly different of the product size derived from genomic DNA. In addition, control fragments functioning as internal reference were amplified from three different housekeeping genes i.e. Elongation Factor 1-alpha (EF-1, A. thaliana ortholog At lg07920.1 ) , Protein

Phosphatase 2a sununit a2 (PDF2, A. thaliana ortholog

At3g25800.1) and Helicase domaing containing protein 1

(HEL1, A. thaliana ortholog At lg58050.1 ) .

For specific real time detection of dsDNA during PCR amplification, LCGreen (Idaho Technologies) was added to the PCR reaction mixture at 0.5 x concentration.

Calculations were made using the Ct method.

For the detection of allelic variants with CsKIP2, a specific region was targeted in the cDNA. This region is suspected to house a transposon-like element (exon 11 transposon) . Primers (table 1, ID3 ID4) ) designed to

specifically amplify exon 9 (partial), 10 and 11 (partial) of CsKIP2 were used for the detection of this fragment.

Table 1: CsKIP2 specific PCR primers

ID1 : 5' CGACACTTGAGCTTCTGGAG 3'

ID2 : 5 ' GCAAGATGTGCAACAATGAATC 3 '

ID3 : 5' CCCGCAATGTGGCTATTTGCTGT 3'

ID4 : 5' CCCGAGGCTGAACGACCGGA 3' Results

A selection of 12 germplasm lines from the powdery mildew disease test was made for subsequent expression studies and detection of allelic variation of CsKIP2.

Presence or absence of a transposon-like element suspected to be the causative factor of powdery mildew resistance in genomic DNA was done before starting expression studies in order to investigate its effect on expression.

Expression of CsKIP2 in leaf material derived from the selected plants was determined based on the control genes. The results show no general effect of expression based on the obtained data. On average, expression levels observed are similar (Figure 1)

After determination of expression levels, the allelic variation in the transposon-like element was investigated. The fragment amplified with primers ID3 and ID4 produced a variable fragment of size 199 bp or 127 bp (Figure 2) . The smaller fragment was found strictly in resistant plants and correlates to presence of the

transposon in genomic DNA.

The sequence of the fragments was found to be highly similar except for a 72 bp deletion in exon 11, centered around the original position of the transposon in genomic DNA (Figure 3) .

Conclusions

Expression analysis of CsKIP2 in leaf material from infected cucumber plants was carried out in order to assess the involvement of gene expression in resistance. On average, expression levels were similar in resistant and susceptible plants.

The presence of a transposon-like element found in exon 11 of the CsKIP2 gene in genomic DNA was also found not to be correlated to expression levels of CsKIP2.

The presence of the transposon-like element in genomic DNA was found to be related to resistance of plants to powdery mildew. The resistant plants with the transposon- like element in the genomic DNA showed a deletion of 72 bp in exon 11 in the cDNA, compared to susceptible plants.

Apparently, the mechanism responsible for the correct splicing of RNA (i.e. separating exons from

introns), splices the transposon-like element from the RNA, along with a part (i.e. 72 bp) of the coding sequence. After translation of mRNA to protein, the 72 bp deletion mRNA results in a protein with a 24 amino acid residue deletion. The 24 amino acid residue deletion protein product (i.e. CsKIP2 from resistant plants) is believed to have lost its function as host-factor.

Example 2: Cucumber germplasm screen for contribution of

CsKIP9 allelic variants to

resistance/susceptibility

The cDNA sequence of CsKIP9 of 5 cucumber plants was determined. Table 2 below summarizes the plant tested and their powdery mildew resitance. Table 2: Cucumber plants used for cDNA sequencing of CsKIP9

The amino acid sequences encoded by the cDNAs were aligned as shown in Figure 4. An amino acid sunstitution of asparagine (N) by aspartic acid (D) (LEEN to LEED) at position 284 of CsKIP9 (SEQ ID No. 2) was found to correlate with the powdery mildew resitance observed. Example 3: Powdery mildew resistant cucumber plant with non-function CsKIP9.

The cDNA sequence CsKIP9 of a powdery mildew resistant cucumber plant was determined and an amino acid substation in exon 3 was defined. Specifically, the coding sequence of the first amino acids of exon 3 (positions 61 to 63 of SEQ ID No. 2) of functional CsKIP9 are Glutamic acid (E) - Leucine (L) - Methionine (M) [ELM] . However, in the powdery mildew resistant cucumber plant identified, this sequence was mutated to Alanine (A) - Threonine (T) -

Isoleucine (I) [ATI] indicating that this substitution in CsKIP9 correlates with the powdery mildew resistance

observed . The powdery mildew resitance providing genes identified herein are summarized in table 3 below. The cDNA and amino acid sequences provided are the powdery mildew resistant genes in their functional form, i.e. providing powdery mildew resistance when impaired at the protein level, such as by mutation, or impaired at the expression level.

Table 3: cDNA and amino acid sequences of the present gen gene identity Plant Sequence SEQ ID No.

type

CsKIP9 Cucumis sativus cDNA 1

Aa 2

CsKIP2 Cucumis sativus cDNA 3

aa 4

CsKIPl Cucumis sativus cDNA 5

aa 6

CsKIP3 Cucumis sativus cDNA 7

aa 8

CsKIP4 Cucumis sativus cDNA 9

aa 10

CsKIP5 Cucumis sativus cDNA 11

aa 12

CsKIP6 Cucumis sativus cDNA 13

aa 14

CsKIP7 Cucumis sativus cDNA 15

aa 16

CsKIP8 Cucumis sativus cDNA 17

aa 18

CsKIPl 0 Cucumis sativus cDNA 19

aa 20

CsKIPl 1 Cucumis sativus cDNA 21

aa 22

SEQUENCE LISTING

<110> Enza Zaden Beheer B.V.

DIERGAARDE, Paul Johan

VAN ENCKEVORT, Leonora Johanna Gertruda

POSTHUMA, Karin Ingeborg

PRINS, Marinus Willem

Keygene N.V.

<120> POWDERY MILDEW RESISTANCE PROVIDING GENES IN CUCUMIS SATIVUS <130> 4/2MF77/31P

<160> 26

<170> BiSSAP 1.0

<210> 1

<211> 1782

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1782

<223> /mol_type="DNA"

/note="cDNA CsKIP9"

/organism="Cucumis sativus"

<400> 1

atggccggag gtggcgccgg aaggtccttg gaagagacgc cgacatgggc cgtcgccgcc 60 gtgtgctttg ttttggttct gatttctatt atcatcgaac acattctcca tctcatcgga 120 aagtggctaa agaagaaaca caaacgagct ctctacgaag ctctggagaa gattaaatca 180 gaactgatgc tgttgggatt catatcgctg ctgctgacgg tgggacaaag cctaatcaca 240 aatgtttgta taccacctga cgtggcagcc acgtggcatc catgtagtcc tcaaagagaa 300 gaagaattaa ctaaagaagc tgacctcgtc gattccgacc aaaatcgtcg aaaacttctc 360 gccctctccc atcacgtcaa cgccaccttc cgccgttccc tcgccgctgc cggtggtacc 420 gacaaatgtg ctgccaaggg taaagttcca tttgtatcgg aagggggtat tcatcagcta 480 catatattca tcttcgtact ggcagttttc catgttttgt attgtgtttt aactttagct 540 ttgggcaatg ccaagatgag aagttggaag tcatgggaaa aagagacaag aactgtggag 600 tatcaattct cacacgatcc ggaacggttt cgatttgcaa gagacacgtc atttgggaga 660 agacacttaa gcttttggac aaaatcccct ttcctcatat ggattgtttg tttcttcaga 720 caattcgtta ggtcggttcc aaaggttgat tacttgacct taagacatgg tttcgtcatg 780 gcacatctgg caccgcacag cgatcagaaa tttgactttc aaaaatacat aaaacgatct 840 cttgaagaaa atttcaaggt ggtggtcagt atcagccctc cgatatggtt ctttgctgtc 900 ctcttcctac ttttcaacac ccacgggtgg agggcttatc tatggctacc ctttgttccg 960 ttaattatag tgttattggt ggggacaaag ttgcaagtga taataacgaa aatggcgctg 1020 aggatacaag aaagaggaga agtggtgaaa ggagtgccgg tggtagagcc aggggatgac 1080 cttttttggt tcaatcgccc tcgtcttatt ctttacctta tcaattttgt cctcttccag 1140 aatgcctttc agcttgcctt ttttgcttgg acttggaaag aatttgggat gaaatcttgt 1200 ttccatgagc acacagagga tttggtcatc agaataacaa tgggggttct cgttcaaatc 1260 ctttgcagtt atgtcacact gccactttac gctctagtca cacagatggg ttcgacgatg 1320 aagcccacga ttttcaacga aagagtagcg acggcgttga gaaactggca ccacactgct 1380 cgtaaacaca taaaacaaaa tcgtggctca atgacgccga tgtcgagccg ccctgcaacc 1440 ccctcccacc acttgtcacc cgtccacctc cttcgccact atcgaagcga attagatagc 1500 gttcatacgt ctcctagaag atccaatttc gacaccgatc agtgggaccc tgattcccct 1560 tccccttccc cttcccacca ctttcaccgc cgtccccatc ccggcgacgg ctccatttcc 1620 aaccatcacc gtgatgtgga ggccggggat cttgatgtcg atgttgaatc gcctcaaccc 1680 gaccgaacga cccagtcaat aaacccaaca aatattgagc accatgaaat tgacgtgggg 1740 tctaacgaat tctcattcga tagaagagtt gatagagtat aa 1782

<210> 2

<211> 593

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..593

<223> /mol_type="protein"

/note="protein CSKIP9"

/organism="Cucumis sativus"

<400> 2

Met Ala Gly Gly Gly Ala Gly Arg Ser Leu Glu Glu Thr Pro Thr Trp

1 5 10 15

Ala Val Ala Ala Val Cys Phe Val Leu Val Leu He Ser He He He

20 25 30

Glu His He Leu His Leu He Gly Lys Trp Leu Lys Lys Lys His Lys

35 40 45

Arg Ala Leu Tyr Glu Ala Leu Glu Lys He Lys Ser Glu Leu Met Leu

50 55 60

Leu Gly Phe He Ser Leu Leu Leu Thr Val Gly Gin Ser Leu He Thr

65 70 75 80

Asn Val Cys He Pro Pro Asp Val Ala Ala Thr Trp His Pro Cys Ser

85 90 95

Pro Gin Arg Glu Glu Glu Leu Thr Lys Glu Ala Asp Leu Val Asp Ser

100 105 110

Asp Gin Asn Arg Arg Lys Leu Leu Ala Leu Ser His His Val Asn Ala

115 120 125 Thr Phe Arg Arg Ser Leu Ala Ala Ala Gly Gly Thr Asp Lys Cys Ala

130 135 140

Ala Lys Gly Lys Val Pro Phe Val Ser Glu Gly Gly lie His Gin Leu 145 150 155 160 His lie Phe lie Phe Val Leu Ala Val Phe His Val Leu Tyr Cys Val

165 170 175 Leu Thr Leu Ala Leu Gly Asn Ala Lys Met Arg Ser Trp Lys Ser Trp

180 185 190

Glu Lys Glu Thr Arg Thr Val Glu Tyr Gin Phe Ser His Asp Pro Glu

195 200 205

Arg Phe Arg Phe Ala Arg Asp Thr Ser Phe Gly Arg Arg His Leu Ser

210 215 220

Phe Trp Thr Lys Ser Pro Phe Leu lie Trp lie Val Cys Phe Phe Arg 225 230 235 240 Gin Phe Val Arg Ser Val Pro Lys Val Asp Tyr Leu Thr Leu Arg His

245 250 255 Gly Phe Val Met Ala His Leu Ala Pro His Ser Asp Gin Lys Phe Asp

260 265 270

Phe Gin Lys Tyr lie Lys Arg Ser Leu Glu Glu Asn Phe Lys Val Val

275 280 285

Val Ser lie Ser Pro Pro lie Trp Phe Phe Ala Val Leu Phe Leu Leu

290 295 300

Phe Asn Thr His Gly Trp Arg Ala Tyr Leu Trp Leu Pro Phe Val Pro 305 310 315 320 Leu lie lie Val Leu Leu Val Gly Thr Lys Leu Gin Val He He Thr

325 330 335 Lys Met Ala Leu Arg lie Gin Glu Arg Gly Glu Val Val Lys Gly Val

340 345 350

Pro Val Val Glu Pro Gly Asp Asp Leu Phe Trp Phe Asn Arg Pro Arg

355 360 365

Leu lie Leu Tyr Leu lie Asn Phe Val Leu Phe Gin Asn Ala Phe Gin

370 375 380

Leu Ala Phe Phe Ala Trp Thr Trp Lys Glu Phe Gly Met Lys Ser Cys 385 390 395 400 Phe His Glu His Thr Glu Asp Leu Val lie Arg lie Thr Met Gly Val

405 410 415 Leu Val Gin lie Leu Cys Ser Tyr Val Thr Leu Pro Leu Tyr Ala Leu

420 425 430

Val Thr Gin Met Gly Ser Thr Met Lys Pro Thr lie Phe Asn Glu Arg

435 440 445

Val Ala Thr Ala Leu Arg Asn Trp His His Thr Ala Arg Lys His He

450 455 460

Lys Gin Asn Arg Gly Ser Met Thr Pro Met Ser Ser Arg Pro Ala Thr 465 470 475 480 Pro Ser His His Leu Ser Pro Val His Leu Leu Arg His Tyr Arg Ser

485 490 495 Glu Leu Asp Ser Val His Thr Ser Pro Arg Arg Ser Asn Phe Asp Thr

500 505 510

Asp Gin Trp Asp Pro Asp Ser Pro Ser Pro Ser Pro Ser His His Phe

515 520 525

His Arg Arg Pro His Pro Gly Asp Gly Ser lie Ser Asn His His Arg

530 535 540

Asp Val Glu Ala Gly Asp Leu Asp Val Asp Val Glu Ser Pro Gin Pro 545 550 555 560 Asp Arg Thr Thr Gin Ser lie Asn Pro Thr Asn lie Glu His His Glu

565 570 575 lie Asp Val Gly Ser Asn Glu Phe Ser Phe Asp Arg Arg Val Asp Arg

580 585 590

Val <210> 3

<211> 1725

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1725

<223> /mol_type="DNA"

/note="cDNA CsKIP2"

/organism="Cucumis sativus"

<400> 3

atggctgaat gtggaacaga gcagcgtact ttggaagata cctcaacttg ggctgttgcg 60 gttgtttgtt ttttcttggt tgttatttca atcttcattg aacatgtcat tcacctcact 120 ggaaagtggc tggagaaaag gcacaagcca gctcttgttg aagctctaga aaaggttaaa 180 gcagagctta tgctattggg attcatatcc ctacttctaa cgataggcca agatgctgtc 240 actcaaattt gtgtttcgaa agagcttgca gcaacttggc ttccctgtgc agcaagagct 300 aaaacaggag taaaagttgc gaagaacagt cgtcttagac ttcttgaatt tttagatcct 360 gactatggtt cgaggcgtat tttagcctcg aaaggagatg atgcatgcgc taagaggggc 420 caactcgctt tcgtgtcggc atatggaatc catcagctcc atattttcat cttcgtattg 480 gctgtcttcc atgtcctgta ctgcatcata actttggctt ttggcagaac aaagatgagc 540 aaatggaagg cctgggagga tgaaaccaag acaattgaat accagtacta taatgatcca 600 gcaagattta gatttgctag agatactacg tttggacgcc gacacttgag cttctggagt 660 cgtacaccaa tttccctctg gattgtttgt ttcttcagac agttctttgg atcagttacc 720 aaggttgatt acatgacact gagacatgga ttcattgttg cacatcttgc acccggaagt 780 gaagtaaaat ttgatttcca caaatacatt agcagatctc tggaagacga ctttaaagtt 840 gttgtgggga ttagtcccgc aatgtggcta tttgctgttc tcttcatcct aaccaataca 900 aatgggtggt attcatatct atggctgcct ttcatctcct taattataat tctattggtg 960 ggaacaaagc tccatgttat tataactcat atgggattga caattcaaga aaggggtcat 1020 gttgtgaagg gtgttcccgt cgttcagcct cgggatgacc tgttttggtt tggacgtcca 1080 caacttattc tcttcctgat ccactttgtt ctctttatga atgcatttca gcttgccttc 1140 tttgcttgga ccacatatgc atttaagtgg atgggttgtt tccatcagcg agttgaagat 1200 attgtcatca gactctcaat gggggttatc atacaagttc tctgcagtta tgtcacactc 1260 ccactctatg ctttggttac tcagatgggc tctaacatga gaccaaccat tttcaacgac 1320 cgagtggcga cggcattgaa gaactggcac cactcagcca agaagaacat gaagcagcac 1380 cgcaacccag acagtacctc accattctca agcaggccag ctactccaac tcacggcatg 1440 tctcctattc accttctgca caaacatcag catggcagca catctcccag gctatccgat 1500 gccgaacccg atcgttggga agagttgcct ccttcttcac accatagtag agccccccat 1560 catgataatc atcaagatca acaagaacaa tctgagacaa taattagaga acaggagatg 1620 acagttcaag gaccaagttc aagtgaaacc ggttccataa cacgtcctgc tcgccctcat 1680 caggaaatca ctaggactcc atcagacttc tcatttgcca aatga 1725

<210> 4

<211> 574

<212 > PRT

<213> Cucumi s s ativus

<220>

<221> SOURCE

<222 > 1 . . 574

<223> /mol type= "protein "

/note= "protein Cs KI P2 "

/ organi sm= " Cucumi s s ativus "

<400> 4

Met Ala Glu Cys Gly Thr Glu Gin Arg Thr Leu Glu Asp Thr Ser Thr

1 5 10 15

Trp Ala Val Ala Val Val Cys Phe Phe Leu Val Val He Ser He Phe

20 25 30

He Glu Hi s Val He Hi s Leu Thr Gly Lys Trp Leu Glu Lys Arg Hi s

35 40 45

Lys Pro Ala Leu Val Glu Ala Leu Glu Lys Val Lys Ala Glu Leu Met

50 55 60

Leu Leu Gly Phe He Ser Leu Leu Leu Thr He Gly Gin Asp Ala Val

65 70 75 80

Thr Gin He Cys Val Ser Lys Glu Leu Ala Ala Thr Trp Leu Pro Cys

85 90 95

Ala Ala Arg Ala Lys Thr Gly Val Lys Val Ala Lys Asn Ser Arg Leu

100 105 110

Arg Leu Leu Glu Phe Leu Asp Pro Asp Tyr Gly Ser Arg Arg He Leu

115 120 125

Ala Ser Lys Gly Asp Asp Ala Cys Ala Lys Arg Gly Gin Leu Ala Phe

130 135 140

Val Ser Ala Tyr Gly He Hi s Gin Leu Hi s He Phe He Phe Val Leu

145 150 155 160

Ala Val Phe Hi s Val Leu Tyr Cys He He Thr Leu Ala Phe Gly Arg

165 170 175

Thr Lys Met Ser Lys Trp Lys Ala Trp Glu Asp Glu Thr Lys Thr He

180 185 190

Glu Tyr Gin Tyr Tyr Asn Asp Pro Ala Arg Phe Arg Phe Ala Arg Asp

195 200 205

Thr Thr Phe Gly Arg Arg Hi s Leu Ser Phe Trp Ser Arg Thr Pro He

210 215 220

Ser Leu Trp He Val Cys Phe Phe Arg Gin Phe Phe Gly Ser Val Thr

225 230 235 240

Lys Val Asp Tyr Met Thr Leu Arg Hi s Gly Phe He Val Ala Hi s Leu

245 250 255

Ala Pro Gly Ser Glu Val Lys Phe Asp Phe Hi s Lys Tyr He Ser Arg

260 265 270 Ser Leu Glu Asp Asp Phe Lys Val Val Val Gly He Ser Pro Ala Met

275 280 285

Trp Leu Phe Ala Val Leu Phe He Leu Thr Asn Thr Asn Gly Trp Tyr

290 295 300

Ser Tyr Leu Trp Leu Pro Phe He Ser Leu He He He Leu Leu Val

305 310 315 320

Gly Thr Lys Leu His Val He He Thr His Met Gly Leu Thr He Gin

325 330 335

Glu Arg Gly His Val Val Lys Gly Val Pro Val Val Gin Pro Arg Asp

340 345 350

Asp Leu Phe Trp Phe Gly Arg Pro Gin Leu He Leu Phe Leu He His

355 360 365

Phe Val Leu Phe Met Asn Ala Phe Gin Leu Ala Phe Phe Ala Trp Thr

370 375 380

Thr Tyr Ala Phe Lys Trp Met Gly Cys Phe His Gin Arg Val Glu Asp

385 390 395 400

He Val He Arg Leu Ser Met Gly Val He He Gin Val Leu Cys Ser

405 410 415

Tyr Val Thr Leu Pro Leu Tyr Ala Leu Val Thr Gin Met Gly Ser Asn

420 425 430

Met Arg Pro Thr He Phe Asn Asp Arg Val Ala Thr Ala Leu Lys Asn

435 440 445

Trp His His Ser Ala Lys Lys Asn Met Lys Gin His Arg Asn Pro Asp

450 455 460

Ser Thr Ser Pro Phe Ser Ser Arg Pro Ala Thr Pro Thr His Gly Met

465 470 475 480

Ser Pro He His Leu Leu His Lys His Gin His Gly Ser Thr Ser Pro

485 490 495

Arg Leu Ser Asp Ala Glu Pro Asp Arg Trp Glu Glu Leu Pro Pro Ser

500 505 510

Ser His His Ser Arg Ala Pro His His Asp Asn His Gin Asp Gin Gin

515 520 525

Glu Gin Ser Glu Thr He He Arg Glu Gin Glu Met Thr Val Gin Gly

530 535 540

Pro Ser Ser Ser Glu Thr Gly Ser He Thr Arg Pro Ala Arg Pro His

545 550 555 560

Gin Glu He Thr Arg Thr Pro Ser Asp Phe Ser Phe Ala Lys

565 570

<210> 5

<211> 1749

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1749

<223> /mol_type="DNA"

/note="cDNA CsKIPl"

/organism="Cucumis sativus"

<400> 5

atggcggggg cagccggtgg caagtcgctg gagcaaacac cgacatgggc cgttgccgtt gtttgctttg ttttgctcgt catctctatt ttcatcgaat atagtctcca tcttatcgga cattggctaa agaagagaca caaacgggcg ttgtttgaag cattagagaa gatcaaatca gagcttatgt tattggggtt tatatcattg ctactaacgg tggggcaagg accaataacg 240 gagatatgta ttccacaaca tgtagctgca acgtggcatc catgtacaaa ggaaagagaa 300 gatgagatga acaaagaggt ggagaaatct gtggaacatt tgggtcttga tcgccggaga 360 ctccttcatc tcctcggaaa tggtgaaagt ttccggcgga gtttggccgc tgcgggagga 420 gaggataaat gtgccgccaa gggtaaagct tcctttattt cagcagatgg aattcatcaa 480 cttcatatct tcatttttgt gttggcagtt tttcatgttt tgtattgtgt tctaacttat 540 gcgttggcta gagctaagat gaggagttgg aaaacatggg aaaaagagac caaaactgct 600 gaataccaat tctcacatga tccagagagg tttaggtttg caagagacac ctcatttggg 660 agaagacatt tgagcttttg gaccaaaaat cctgccttga tgtggatcgt tcgtttcttc 720 agacaatttg taagatctgt tccaaaagtt gattacttga cattaagaca tgggtttata 780 atggcacatt tagcacctca aagtcttaca caatttgatt ttcaaaaata cattaataga 840 tcccttgaag aagacttcaa agttgttgtg ggaatcagcc cgccaatttg gttctttgct 900 gttctatctc tcctctcaaa cactcacggt tggagggcgt atctatggct gccattcatc 960 ccactaatca ttttgctgtt gattggaaca aaattgcaag tgatcataac gaaaatggca 1020 ctaagaatac aagaaagagg tgaagtagtg aagggcgtgc cggtggtgga gcctggcggt 1080 gacctctttt ggtttaatcg gcctcgcctt attctttatc tcatcaactt tgttctcttt 1140 caaaatgcct tccaagttgc cttctttgct tggacttggt atgagtttgg gttgaattct 1200 tgcttccatg agcatataga agatgtggtg atcagaattt ctatgggggt gcttgtacaa 1260 atcctttgca gttatgttac tcttcctctt tatgcactag tcactcagat gggttcaaca 1320 atgaagccaa ctatattcaa tgagagagtg gcagaggccc ttcgcaattg gtaccactcg 1380 gctcgaaagc acatcaaaca caaccgcggt tcggtcactc caatgtcgag ccgacccgcc 1440 accccgactc acagcatgtc gcctgtccac cttctccgac actacaagag tgaagtcgat 1500 agcttccaca cctcaccgag aaggtcaccg ttcgacaccg atcgttggga caacgattcg 1560 ccctctccat ctcgccatgt tgatggttcg tcttcgtcac aaccccacgt tgagatggga 1620 ggttatgaaa aagatcccgt tgaatcaagt tcgtctcgag ttgatccggt tcaaccatct 1680 cgaaaccgca atcaacatga gattcatatt ggaggcccca aagacttttc atttgataga 1740 gttgaatga 1749

<210> 6

<211> 582

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE <222> 1..582

<223> /mol type="protein"

/note="protein CsKIPl"

/organism="Cucumis sativus"

<400> 6

Met Ala Gly Ala Ala Gly Gly Lys Ser Leu Glu Gin Thr Pro Thr Trp 1 5 10 15

Ala Val Ala Val Val Cys Phe Val Leu Leu Val lie Ser lie Phe lie

20 25 30

Glu Tyr Ser Leu His Leu lie Gly His Trp Leu Lys Lys Arg His Lys

35 40 45

Arg Ala Leu Phe Glu Ala Leu Glu Lys lie Lys Ser Glu Leu Met Leu 50 55 60

Leu Gly Phe lie Ser Leu Leu Leu Thr Val Gly Gin Gly Pro lie Thr 65 70 75 80

Glu lie Cys lie Pro Gin His Val Ala Ala Thr Trp His Pro Cys Thr

85 90 95

Lys Glu Arg Glu Asp Glu Met Asn Lys Glu Val Glu Lys Ser Val Glu

100 105 110

His Leu Gly Leu Asp Arg Arg Arg Leu Leu His Leu Leu Gly Asn Gly

115 120 125

Glu Ser Phe Arg Arg Ser Leu Ala Ala Ala Gly Gly Glu Asp Lys Cys 130 135 140

Ala Ala Lys Gly Lys Ala Ser Phe lie Ser Ala Asp Gly lie His Gin 145 150 155 160

Leu His lie Phe lie Phe Val Leu Ala Val Phe His Val Leu Tyr Cys

165 170 175

Val Leu Thr Tyr Ala Leu Ala Arg Ala Lys Met Arg Ser Trp Lys Thr

180 185 190

Trp Glu Lys Glu Thr Lys Thr Ala Glu Tyr Gin Phe Ser His Asp Pro

195 200 205

Glu Arg Phe Arg Phe Ala Arg Asp Thr Ser Phe Gly Arg Arg His Leu 210 215 220

Ser Phe Trp Thr Lys Asn Pro Ala Leu Met Trp lie Val Arg Phe Phe 225 230 235 240

Arg Gin Phe Val Arg Ser Val Pro Lys Val Asp Tyr Leu Thr Leu Arg

245 250 255

His Gly Phe lie Met Ala His Leu Ala Pro Gin Ser Leu Thr Gin Phe

260 265 270

Asp Phe Gin Lys Tyr lie Asn Arg Ser Leu Glu Glu Asp Phe Lys Val

275 280 285

Val Val Gly lie Ser Pro Pro lie Trp Phe Phe Ala Val Leu Ser Leu 290 295 300

Leu Ser Asn Thr His Gly Trp Arg Ala Tyr Leu Trp Leu Pro Phe lie 305 310 315 320

Pro Leu lie lie Leu Leu Leu lie Gly Thr Lys Leu Gin Val lie lie

325 330 335

Thr Lys Met Ala Leu Arg lie Gin Glu Arg Gly Glu Val Val Lys Gly

340 345 350

Val Pro Val Val Glu Pro Gly Gly Asp Leu Phe Trp Phe Asn Arg Pro

355 360 365

Arg Leu lie Leu Tyr Leu lie Asn Phe Val Leu Phe Gin Asn Ala Phe 370 375 380

Gin Val Ala Phe Phe Ala Trp Thr Trp Tyr Glu Phe Gly Leu Asn Ser 385 390 395 400

Cys Phe His Glu His lie Glu Asp Val Val lie Arg lie Ser Met Gly

405 410 415

Val Leu Val Gin lie Leu Cys Ser Tyr Val Thr Leu Pro Leu Tyr Ala

420 425 430 Leu Val Thr Gin Met Gly Ser Thr Met Lys Pro Thr lie Phe Asn Glu

435 440 445

Arg Val Ala Glu Ala Leu Arg Asn Trp Tyr His Ser Ala Arg Lys His

450 455 460

lie Lys His Asn Arg Gly Ser Val Thr Pro Met Ser Ser Arg Pro Ala

465 470 475 480

Thr Pro Thr His Ser Met Ser Pro Val His Leu Leu Arg His Tyr Lys

485 490 495

Ser Glu Val Asp Ser Phe His Thr Ser Pro Arg Arg Ser Pro Phe Asp

500 505 510

Thr Asp Arg Trp Asp Asn Asp Ser Pro Ser Pro Ser Arg His Val Asp

515 520 525

Gly Ser Ser Ser Ser Gin Pro His Val Glu Met Gly Gly Tyr Glu Lys

530 535 540

Asp Pro Val Glu Ser Ser Ser Ser Arg Val Asp Pro Val Gin Pro Ser

545 550 555 560

Arg Asn Arg Asn Gin His Glu lie His lie Gly Gly Pro Lys Asp Phe

565 570 575

Ser Phe Asp Arg Val Glu

580

<210> 7

<211> 1551

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1551

<223> /mol_type="DNA"

/note="cDNA CsKIP3"

/organism="Cucumis sativus"

<400> 7

atgggtggcg gaggtgaagg aacgacgctg gaattcactc cgacgtgggt tgtagccgcc 60 gtatgtactg tcatcgttgc catttctctc gccttagagc gccttcttca ctttctcggc 120 agatacctca aaagcaagaa tcaaaagccg ctcaatgaag ctcttcagaa agttaaagaa 180 gaattgatgc ttttggggtt catttcactt ctgctcactg tatttcaagg caccatctct 240 aaattgtgtg ttcctgagag tttgactgaa catttacttc cgtgtgatct gaaggataaa 300 ccgaaagctg aacatggttc gccctctggt gaatctggtt cgtcaacgac gaagcatttt 360 caaacgttat ttgtttcgag tatttctggt acggccaggc ggcttctttc tgagggatct 420 gcttcacaag ctggttactg tgccaaaaag aataaggtgc cattgctatc tcttgaagca 480 ttgcatcatc tacatatttt tatcttcatc ctagctatcg tccacgtgac attttgcgtt 540 ctcactgtag tttttggagg attgaagatt cgccagcgga agcattggga ggattctatt 600 gcaaaagaga attatgatac tgaacaagtt ctaaaaccaa aggtcactca tgtccatcaa 660 catgttttta tcaaagacca ctttttgggc tttggtaaag attcagctct tcttggttgg 720 ttgcattcat ttctcaagca attttatgct tctgtaacaa aatcagatta tgcaacgtta 780 cgacttggtt tcattacgac gcactgcagg ggaaatccaa agtttaattt tcacaagtac 840 atgatacgtg cccttgaaga tgacttcaag catgttgttg gtatcagttg gtatctttgg 900 atattcgtgg ttgtcttctt gttccttaat gtcagtggtt ggcatacata tttctggata 960 gcattcattc ctttcgttct tctgcttgct gtgggaacga agctggaaca tgtgataacc 1020 cagctggctc atgaggttgc agagaagcac atagcaatcg aaggtgatct agtagtccaa 1080 ccgtctgatg atcacttttg gttccaacgt ccccgtattg ttctcttctt gatccacttt 1140 atacttttcc aaaacgcttt tgagattgga tttttcttct ggatatgggt tcaatatgga 1200 tttgactcgt gcatcatggg acaagtccgc tatatcattc caaggctcat cattggggtg 1260 tttgttcagg ttctttgcag ttacagcacc cttctgctct gcgccattgt cactcagatg 1320 ggaagttctt tcaagaaagc aatctttgat gaacatgtac aagtagggct agttggctgg 1380 gctcagaagg tgaagaaaag aaagggactt agagcagctg ctgatggctc cagtcaagga 1440 gtcaaggaag gtggttcaac tgtggggatt cagttgggaa atgttatgcg caaggcttct 1500 gcacctcaag aaattaagcc tgatgactcc aaatcaaatg atattcctta g 1551

<210> 8

<211> 516

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..516

<223> /mol type="protein"

/note="protein CsKIP3"

/organism="Cucumis sativus"

<400> 8

Met Gly Gly Gly Gly Glu Gly Thr Thr Leu Glu Phe Thr Pro Thr Trp

1 5 10 15

Val Val Ala Ala Val Cys Thr Val lie Val Ala lie Ser Leu Ala Leu

20 25 30

Glu Arg Leu Leu His Phe Leu Gly Arg Tyr Leu Lys Ser Lys Asn Gin

35 40 45

Lys Pro Leu Asn Glu Ala Leu Gin Lys Val Lys Glu Glu Leu Met Leu

50 55 60

Leu Gly Phe lie Ser Leu Leu Leu Thr Val Phe Gin Gly Thr lie Ser

65 70 75 80

Lys Leu Cys Val Pro Glu Ser Leu Thr Glu His Leu Leu Pro Cys Asp

85 90 95

Leu Lys Asp Lys Pro Lys Ala Glu His Gly Ser Pro Ser Gly Glu Ser

100 105 110

Gly Ser Ser Thr Thr Lys His Phe Gin Thr Leu Phe Val Ser Ser lie

115 120 125

Ser Gly Thr Ala Arg Arg Leu Leu Ser Glu Gly Ser Ala Ser Gin Ala

130 135 140

Gly Tyr Cys Ala Lys Lys Asn Lys Val Pro Leu Leu Ser Leu Glu Ala

145 150 155 160 Leu His His Leu His He Phe He Phe He Leu Ala He Val His Val

165 170 175 Thr Phe Cys Val Leu Thr Val Val Phe Gly Gly Leu Lys He Arg Gin

180 185 190

Arg Lys His Trp Glu Asp Ser He Ala Lys Glu Asn Tyr Asp Thr Glu

195 200 205

Gin Val Leu Lys Pro Lys Val Thr His Val His Gin His Val Phe He

210 215 220

Lys Asp His Phe Leu Gly Phe Gly Lys Asp Ser Ala Leu Leu Gly Trp 225 230 235 240

Leu His Ser Phe Leu Lys Gin Phe Tyr Ala Ser Val Thr Lys Ser Asp

245 250 255 Tyr Ala Thr Leu Arg Leu Gly Phe He Thr Thr His Cys Arg Gly Asn

260 265 270

Pro Lys Phe Asn Phe His Lys Tyr Met He Arg Ala Leu Glu Asp Asp

275 280 285

Phe Lys His Val Val Gly He Ser Trp Tyr Leu Trp He Phe Val Val

290 295 300

Val Phe Leu Phe Leu Asn Val Ser Gly Trp His Thr Tyr Phe Trp He 305 310 315 320

Ala Phe He Pro Phe Val Leu Leu Leu Ala Val Gly Thr Lys Leu Glu

325 330 335 His Val He Thr Gin Leu Ala His Glu Val Ala Glu Lys His He Ala

340 345 350

He Glu Gly Asp Leu Val Val Gin Pro Ser Asp Asp His Phe Trp Phe

355 360 365

Gin Arg Pro Arg He Val Leu Phe Leu He His Phe He Leu Phe Gin

370 375 380

Asn Ala Phe Glu He Gly Phe Phe Phe Trp He Trp Val Gin Tyr Gly 385 390 395 400

Phe Asp Ser Cys He Met Gly Gin Val Arg Tyr He He Pro Arg Leu

405 410 415 He He Gly Val Phe Val Gin Val Leu Cys Ser Tyr Ser Thr Leu Leu

420 425 430

Leu Cys Ala He Val Thr Gin Met Gly Ser Ser Phe Lys Lys Ala He

435 440 445

Phe Asp Glu His Val Gin Val Gly Leu Val Gly Trp Ala Gin Lys Val

450 455 460

Lys Lys Arg Lys Gly Leu Arg Ala Ala Ala Asp Gly Ser Ser Gin Gly 465 470 475 480

Val Lys Glu Gly Gly Ser Thr Val Gly He Gin Leu Gly Asn Val Met

485 490 495 Arg Lys Ala Ser Ala Pro Gin Glu He Lys Pro Asp Asp Ser Lys Ser

500 505 510

Asn Asp He Pro

515

<210> 9

<211> 1641

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1641

<223> /mol_type="DNA"

/note="cDNA CsKIP4"

/organism="Cucumis sativus

<400> 9 atgttgctgg ttgtttatta tttgtgcttg agcttgttgt gggggaaatc gtggggggct 60 ccggccagcg atggcaccac gagggagctc gatcagactc cgacatgggc tgttgctggt 120 gtttgtgcta ttattatcct tatttctatc gccttggaga aactccttca taaagctgga 180 acgtggctca cggaaaagca caagagagct ctctttgaag ctctggagaa agttaaagct 240 gagctgatga ttctgggttt catttcactg ctcctcacct ttggacagaa ctacatcatt 300 aaaatatgca ttcccacaaa ggttgcaaat actatgttgc catgtgctgc caaagaggac 360 aaattggaga agggagatga aggcgaacat catcgacgac ttctaatgta tgaacggagg 420 ttcctggctg ctgctggtgg cgctgttagt tgcaaagaag gtcatgtgcc gcttatatct 480 atctcgggat tgcatcagtt gcacttgttt atcttcttct tagccgtatt tcatgtggta 540 tatagtgcca tcacaatgat gcttgggagg ctaaagattc gaggttggaa ggcatgggag 600 gaggagacct caactcacaa ttatgagttc tcaaatgata atgcacgatt caggcttact 660 cacgaaacat catttgtgaa agcccacacg agtttttgga caaaacttcc cgtcttcttt 720 tatattggat gcttcttccg acaatttttc aagtccgttg gtcaccttgc tccgggaagt 780 aaatttgact ttcaaaaata tatcaaaagg tctctagaag atgacttcaa aataattgtg 840 ggagttagtc ccgtgctttg gacatcgttt gtggtcttct tgctcataaa tgtttacgga 900 tggcaagcat tgttttggtc atccttagtt cctgtgatca taatcctagc tgttggaacc 960 aagcttcaag gagttatgac aaagatggct ctcgaaatta cagaaagaca tgctgttgtc 1020 caaggaattc ctctcgttca ggcatcagat aaatattttt ggtttggcaa gcctcagctg 1080 gttctttacc tcatccactt cgctttattt tcgaatgcat tccaaataac atacttcttc 1140 tggatttggt attcctttgg gttaaaatcc tgcttccata ctgatttcaa gctcgcaatc 1200 attaaagttg gtctcggggt tggcgttctc tgtctctgca gttatataac tcttccactc 1260 tatgctcttg tcactcagat gggtacgcgt atgaagaagt caatctttga tgaacaaaca 1320 tcgaaggctc ttaagaagtg gcacatggct gttaagaagc gacatgggaa gtccccaact 1380 cgaaaactag ggagtccaag ttcatcacca attcatccat catcaggata cgcattgcat 1440 cgtttcaaga ccacaggtca ctcgaacaga tcatccatgt atgatgagaa tgacgcatca 1500 gattatgaag tcgacactcc aaattttaca gttagaatag accatggtga tgaacatcaa 1560 gctgaaataa ttgaacccca gcatacagaa aaaaggaatg aagacgattt ctcttttgtc 1620 aaacctggac carsgaaatg a 1641

<210> 10

<211> 546

<212> PRT <213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..546

<223> /mol type="protein"

/note="proetin CsKIP4"

/organism="Cucumis sativus"

<400> 10

Met Leu Leu Val Val Tyr Tyr Leu Cys Leu Ser Leu Leu Trp Gly Lys 1 5 10 15

Ser Trp Gly Ala Pro Ala Ser Asp Gly Thr Thr Arg Glu Leu Asp Gin

20 25 30

Thr Pro Thr Trp Ala Val Ala Gly Val Cys Ala lie lie lie Leu lie

35 40 45

Ser lie Ala Leu Glu Lys Leu Leu His Lys Ala Gly Thr Trp Leu Thr

50 55 60

Glu Lys His Lys Arg Ala Leu Phe Glu Ala Leu Glu Lys Val Lys Ala 65 70 75 80

Glu Leu Met lie Leu Gly Phe lie Ser Leu Leu Leu Thr Phe Gly Gin

85 90 95

Asn Tyr lie lie Lys lie Cys lie Pro Thr Lys Val Ala Asn Thr Met

100 105 110

Leu Pro Cys Ala Ala Lys Glu Asp Lys Leu Glu Lys Gly Asp Glu Gly

115 120 125

Glu His His Arg Arg Leu Leu Met Tyr Glu Arg Arg Phe Leu Ala Ala

130 135 140

Ala Gly Gly Ala Val Ser Cys Lys Glu Gly His Val Pro Leu lie Ser 145 150 155 160 lie Ser Gly Leu His Gin Leu His Leu Phe lie Phe Phe Leu Ala Val

165 170 175

Phe His Val Val Tyr Ser Ala lie Thr Met Met Leu Gly Arg Leu Lys

180 185 190 lie Arg Gly Trp Lys Ala Trp Glu Glu Glu Thr Ser Thr His Asn Tyr

195 200 205

Glu Phe Ser Asn Asp Asn Ala Arg Phe Arg Leu Thr His Glu Thr Ser

210 215 220

Phe Val Lys Ala His Thr Ser Phe Trp Thr Lys Leu Pro Val Phe Phe 225 230 235 240

Tyr lie Gly Cys Phe Phe Arg Gin Phe Phe Lys Ser Val Gly His Leu

245 250 255

Ala Pro Gly Ser Lys Phe Asp Phe Gin Lys Tyr lie Lys Arg Ser Leu

260 265 270

Glu Asp Asp Phe Lys lie lie Val Gly Val Ser Pro Val Leu Trp Thr

275 280 285

Ser Phe Val Val Phe Leu Leu lie Asn Val Tyr Gly Trp Gin Ala Leu

290 295 300

Phe Trp Ser Ser Leu Val Pro Val lie lie lie Leu Ala Val Gly Thr 305 310 315 320

Lys Leu Gin Gly Val Met Thr Lys Met Ala Leu Glu lie Thr Glu Arg

325 330 335

His Ala Val Val Gin Gly lie Pro Leu Val Gin Ala Ser Asp Lys Tyr

340 345 350

Phe Trp Phe Gly Lys Pro Gin Leu Val Leu Tyr Leu lie His Phe Ala

355 360 365

Leu Phe Ser Asn Ala Phe Gin lie Thr Tyr Phe Phe Trp lie Trp Tyr

370 375 380

Ser Phe Gly Leu Lys Ser Cys Phe His Thr Asp Phe Lys Leu Ala lie 385 390 395 400 He Lys Val Gly Leu Gly Val Gly Val Leu Cys Leu Cys Ser Tyr He

405 410 415

Thr Leu Pro Leu Tyr Ala Leu Val Thr Gin Met Gly Thr Arg Met Lys

420 425 430

Lys Ser He Phe Asp Glu Gin Thr Ser Lys Ala Leu Lys Lys Trp His

435 440 445

Met Ala Val Lys Lys Arg His Gly Lys Ser Pro Thr Arg Lys Leu Gly

450 455 460

Ser Pro Ser Ser Ser Pro He His Pro Ser Ser Gly Tyr Ala Leu His

465 470 475 48

Arg Phe Lys Thr Thr Gly His Ser Asn Arg Ser Ser Met Tyr Asp Glu

485 490 495

Asn Asp Ala Ser Asp Tyr Glu Val Asp Thr Pro Asn Phe Thr Val Arg

500 505 510

He Asp His Gly Asp Glu His Gin Ala Glu He He Glu Pro Gin His

515 520 525

Thr Glu Lys Arg Asn Glu Asp Asp Phe Ser Phe Val Lys Pro Gly Pro

530 535 540

Thr Lys

545

<210> 11

<211> 1638

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1638

<223> /mol_type="DNA"

/note="cDNA CsKIP5"

/organism="Cucumis sativus"

<400> 11

atgggtggcg gtgccggtgc cggtggtccg agtagggagt tagatcaaac tccgacatgg 60 gccgttgccg ctgtttgtgc agtcatcatt cttatttcca tcatattgga aaaggttctt 120 cacatggttg gagagatatt tcaaaaaagg aaaaagaaag ccttgtatga agcgctcgag 180 aaagttaaag gaggggagct tatggtttta ggattcattt ctttgctctt aacatttggg 240 caaaattata ttgctaaagt ttgtataccc tcaaagtatg aaaatactat gttgccttgc 300 ccttttagag ggagtagtac tactttacct aaaagctccc atcacgccga gcctgatgat 360 gatgaagaga cttccgatca ccatcgtagg cttctttggt acgagcatcg acgtctaggt 420 ggtggtggtt ctgtagaagg ttgcaaacca gggtatacac aacttatatc tctaaatggt 480 ttgcatcaaa tacatatctt catcttcttt ctagccgttc tccatgttgt atttagtgcc 540 ataacgatga ctctcggaag attgaaaatt cgtgcgtgga aggtatggga aagacagacc 600 gaacaagaac atgatgccat gaacgatcct acaaggttta gacttactca cgagacatcc 660 tttgtgagag atcacagcag tttttggacc aaaacccccc tctcctttta ctttgtatgc 720 ttctggaggc aattctttag gtccgttagt aggccagatt acttgtccct tagacatggt 780 tttgtcactg tccatttagc ccctgggagt aaatttgact ttcagaagta cattaaaagg 840 tcattagaag atgactttaa ggtggtcgtg ggaatcagtc ctctgctatg ggcatcaatg 900 gtgctttttc tgcttctcaa tgttaatggg tggcaagtta tgttttgggt gtctatattt 960 cctctagtgg tgatcttagc tgttggaaca aagttgcaag gaattataac acaaatggct 1020 cttgaaatca aagaaagaca tgcagtggtt caagggattc cccttgttca agtctctgat 1080 agacattttt ggtttagttg gcccattttg gttctttatc tcatccatta tgtccttttc 1140 cagaatgcat ttgagattac atatttcttt tggatatggt atgaatttgg gttgagatca 1200 tgctttcatg acaactttga tcttattatc gcgagagttg gtctaggggt tggagtccag 1260 attttgtgca gttacattac actcccatta tatgctcttg taactcagat gggatcaaca 1320 atgaagaaat ccatatttga tgaacaaact tcgaaagcat tgaagcaatg gcatagaagt 1380 gctttgaaga aaaagaacga aggaggaaag cctgaaccaa cgccgatgcg aactttaggc 1440 ggtgccgttg ttgttggagg aagccctccc gagtcaccga tacaacaacc tttgcatgat 1500 caattccaac atcaaacaat gactcaatca tcaccaaccg acgtcgaagc ctccgccgtt 1560 ccttcagtca acataatgac taccgttgat ctccaccaac aacagcaaaa ctattccaat 1620 cgtgacttgt tgagatga 1638

<210> 12

<211> 545

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..545

<223> /mol type="protein"

/note ="protein i sKIP5"

/organism="Cucumis sativus

<400> 12

Met Gly Gly Gly Ala Gly Ala Gly Gly Pro Ser Arg Glu Leu Asp Gin

1 5 10 15

Thr Pro Thr Trp Ala Val Ala Ala ^' Val Cys Ala Val lie lie Leu lie

20 25 30

Ser lie lie Leu Glu Lys Val Leu His Met Val Gly Glu lie Phe Gin

35 40 45

Lys Arg Lys Lys Lys Ala Leu Tyr Glu Ala Leu Glu Lys Val Lys Gly

50 55 60

Gly Glu Leu Met Val Leu Gly Phe lie Ser Leu Leu Leu Thr Phe Gly

65 70 75 80

Gin Asn Tyr lie Ala Lys Val Cys lie Pro Ser Lys Tyr Glu Asn Thr

85 90 95

Met Leu Pro Cys Pro Phe Arg Gly Ser Ser Thr Thr Leu Pro Lys Ser

100 105 110

Ser His His Ala Glu Pro Asp Asp . Asp Glu Glu Thr Ser Asp His His

115 120 125 Arg Arg Leu Leu Trp Tyr Glu His Arg Arg Leu Gly Gly Gly Gly Ser 130 135 140

Val Glu Gly Cys Lys Pro Gly Tyr Thr Gin Leu He Ser Leu Asn Gly 145 150 155 160 Leu His Gin He His He Phe He Phe Phe Leu Ala Val Leu His Val

165 170 175

Val Phe Ser Ala He Thr Met Thr Leu Gly Arg Leu Lys He Arg Ala

180 185 190

Trp Lys Val Trp Glu Arg Gin Thr Glu Gin Glu His Asp Ala Met Asn

195 200 205

Asp Pro Thr Arg Phe Arg Leu Thr His Glu Thr Ser Phe Val Arg Asp 210 215 220

His Ser Ser Phe Trp Thr Lys Thr Pro Leu Ser Phe Tyr Phe Val Cys 225 230 235 240 Phe Trp Arg Gin Phe Phe Arg Ser Val Ser Arg Pro Asp Tyr Leu Ser

245 250 255

Leu Arg His Gly Phe Val Thr Val His Leu Ala Pro Gly Ser Lys Phe

260 265 270

Asp Phe Gin Lys Tyr He Lys Arg Ser Leu Glu Asp Asp Phe Lys Val

275 280 285

Val Val Gly He Ser Pro Leu Leu Trp Ala Ser Met Val Leu Phe Leu 290 295 300

Leu Leu Asn Val Asn Gly Trp Gin Val Met Phe Trp Val Ser He Phe 305 310 315 320 Pro Leu Val Val He Leu Ala Val Gly Thr Lys Leu Gin Gly He He

325 330 335

Thr Gin Met Ala Leu Glu He Lys Glu Arg His Ala Val Val Gin Gly

340 345 350

He Pro Leu Val Gin Val Ser Asp Arg His Phe Trp Phe Ser Trp Pro

355 360 365

He Leu Val Leu Tyr Leu He His Tyr Val Leu Phe Gin Asn Ala Phe 370 375 380

Glu He Thr Tyr Phe Phe Trp He Trp Tyr Glu Phe Gly Leu Arg Ser 385 390 395 400 Cys Phe His Asp Asn Phe Asp Leu He He Ala Arg Val Gly Leu Gly

405 410 415

Val Gly Val Gin He Leu Cys Ser Tyr He Thr Leu Pro Leu Tyr Ala

420 425 430

Leu Val Thr Gin Met Gly Ser Thr Met Lys Lys Ser He Phe Asp Glu

435 440 445

Gin Thr Ser Lys Ala Leu Lys Gin Trp His Arg Ser Ala Leu Lys Lys 450 455 460

Lys Asn Glu Gly Gly Lys Pro Glu Pro Thr Pro Met Arg Thr Leu Gly 465 470 475 480 Gly Ala Val Val Val Gly Gly Ser Pro Pro Glu Ser Pro He Gin Gin

485 490 495

Pro Leu His Asp Gin Phe Gin His Gin Thr Met Thr Gin Ser Ser Pro

500 505 510

Thr Asp Val Glu Ala Ser Ala Val Pro Ser Val Asn He Met Thr Thr

515 520 525

Val Asp Leu His Gin Gin Gin Gin Asn Tyr Ser Asn Arg Asp Leu Leu 530 535 540

Arg

545

<210> 13

<211> 1872

<212> DNA

<213> Cucumis sativus <220>

<221> source

<222> 1..1872

<223> /mol_type="DNA"

/note="cDNA CsKIP6"

/organism="Cucumis sativus"

<400> 13

atggatggtg ggatccatcg tcccacccat tgggtcatcc aattcaataa tgttgaactt 60 catccctcat tttacacacc tttgattact acttcacttt actttttcca aaatttattc 120 cttttcttct tcttcttctt cttcttcttc ttcttctttc ttatgtctgt tttttgtctt 180 tgcttctgcc ttttattgac tggcgccgcc gcgtccggtg gagacggcgg ttcccactcc 240 agggatctcg ataacacacc cacctgggct gttgctgctg tttgcttctt tttcgttctt 300 atttccattg tcttggaaaa tgttattcac aaacttggaa cgtggttgac aaaaaagcac 360 aagagttctc tgtatgaagc tctggagaag gttaaggctg agttgatgat tttgggtttc 420 atctccctgc ttctgacttt tgctcaagca tatattgtcc aaatttgtat tcctccggcc 480 attgcaaact ccatgttgcc ccgtcgccgt gaagagaaaa atgcctcaac cgatgaagac 540 gaacatcacc ggagactaca atggctaatt cgaagatcat tggctggagg tcacaatgtt 600 gtctcgtgtg aggatggtaa ggtgtctctt atatccattg atggattgca tcagttgcat 660 attctcattt tcttcttagc tgtgtttcat gtgctcttta gtgttatcac aatgacactt 720 ggaaggataa agattcgagg ctggaaggag tgggagcagg aaacttcaac gcataactat 780 gagtttttca acgatcctgc aagatttagg cttactcacg agacatcttt tgtgaaagca 840 cacaccagct tttggacacg tcttcctttc ttcttctata ttagttgctt cttcaggcaa 900 ttttatgggt ctgttagtaa ggctgattac ttgacgctac gcaatggatt cataacagtt 960 catttagcac ctggaagtaa atttaacttc cagagatata tcaaaaggtc attagaagat 1020 gacttcaagg tagtcgtcgg tgtgagtcct tttctatggt cgtcatttgt gatcttcctg 1080 ctccttaatt tatctggatg gcatacattg ttctgggcat catttatccc tctgcttata 1140 atcttagccg ttggatcaaa acttcaagcc attttgacta gaatggctct tgaaatctct 1200 gagaaacatg cagtggtcca gggaattcca ctcgtgcaag gatccgacaa gtatttctgg 1260 ttcggccgcc ctcaactgat tcttcatctc atgcattttt ctttatttca gaatgcattc 1320 cagaccacct atattttgtc tacactgtat tcttttggcc tgaattcttg cttctttgat 1380 ggtcacatcc ttacaattat aaaagttggt ttaggggtag tagcattatt tctatgcagc 1440 tatgttacgc ttccaatata cgcccttgta aatcagatgg gttcaggtat gaagaggtcc 1500 atctttgatg aacagacatc aaaggcactc atgaaatggc aggaaacggc caagaagaag 1560 cgggctaaac gagcctcagc aactaaaacc ctcggaggta gttcaaatgc ttcacctcta 1620 cactcattgc gacggtttaa aactacagga cactccatac gtgtgcctac gtatgaggac 1680 cttgagtcat ctgattacga gggggatcca ttagcaacac ctacacaagc gtcaacaagt 1740 gaatcgatta atgttgatgt aaaagatgga gatgaaatac aacaaatcgc tgaaacagag 1800 caaccccaca gtacaattca aactaaagaa ggagatgagt tctcatttat aaagcctgca 1860 acactaggat aa 1872

<210> 14

<211> 623

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..623

<223> /mol type="protein"

/note="protein CsKIP6"

/organism="Cucumis sativus"

<400> 14

Met Asp Gly Gly lie His Arg Pro Thr His Trp Val lie Gin Phe Asn

1 5 10 15

Asn Val Glu Leu His Pro Ser Phe Tyr Thr Pro Leu lie Thr Thr Ser

20 25 30

Leu Tyr Phe Phe Gin Asn Leu Phe Leu Phe Phe Phe Phe Phe Phe Phe

35 40 45

Phe Phe Phe Phe Phe Leu Met Ser Val Phe Cys Leu Cys Phe Cys Leu

50 55 60

Leu Leu Thr Gly Ala Ala Ala Ser Gly Gly Asp Gly Gly Ser His Ser

65 70 75 80

Arg Asp Leu Asp Asn Thr Pro Thr Trp Ala Val Ala Ala Val Cys Phe

85 90 95

Phe Phe Val Leu lie Ser lie Val Leu Glu Asn Val lie His Lys Leu

100 105 110

Gly Thr Trp Leu Thr Lys Lys His Lys Ser Ser Leu Tyr Glu Ala Leu

115 120 125

Glu Lys Val Lys Ala Glu Leu Met lie Leu Gly Phe lie Ser Leu Leu

130 135 140

Leu Thr Phe Ala Gin Ala Tyr lie Val Gin lie Cys lie Pro Pro Ala

145 150 155 160 lie Ala Asn Ser Met Leu Pro Arg Arg Arg Glu Glu Lys Asn Ala Ser

165 170 175

Thr Asp Glu Asp Glu His His Arg Arg Leu Gin Trp Leu lie Arg Arg

180 185 190

Ser Leu Ala Gly Gly His Asn Val Val Ser Cys Glu Asp Gly Lys Val

195 200 205

Ser Leu lie Ser lie Asp Gly Leu His Gin Leu His lie Leu lie Phe

210 215 220

Phe Leu Ala Val Phe His Val Leu Phe Ser Val lie Thr Met Thr Leu

225 230 235 240

Gly Arg lie Lys lie Arg Gly Trp Lys Glu Trp Glu Gin Glu Thr Ser

245 250 255

Thr His Asn Tyr Glu Phe Phe Asn Asp Pro Ala Arg Phe Arg Leu Thr

260 265 270 His Glu Thr Ser Phe Val Lys Ala His Thr Ser Phe Trp Thr Arg Leu

275 280 285

Pro Phe Phe Phe Tyr He Ser Cys Phe Phe Arg Gin Phe Tyr Gly Ser

290 295 300

Val Ser Lys Ala Asp Tyr Leu Thr Leu Arg Asn Gly Phe He Thr Val

305 310 315 320

His Leu Ala Pro Gly Ser Lys Phe Asn Phe Gin Arg Tyr He Lys Arg

325 330 335

Ser Leu Glu Asp Asp Phe Lys Val Val Val Gly Val Ser Pro Phe Leu

340 345 350

Trp Ser Ser Phe Val He Phe Leu Leu Leu Asn Leu Ser Gly Trp His

355 360 365

Thr Leu Phe Trp Ala Ser Phe He Pro Leu Leu He He Leu Ala Val

370 375 380

Gly Ser Lys Leu Gin Ala He Leu Thr Arg Met Ala Leu Glu He Ser

385 390 395 400

Glu Lys His Ala Val Val Gin Gly He Pro Leu Val Gin Gly Ser Asp

405 410 415

Lys Tyr Phe Trp Phe Gly Arg Pro Gin Leu He Leu His Leu Met His

420 425 430

Phe Ser Leu Phe Gin Asn Ala Phe Gin Thr Thr Tyr He Leu Ser Thr

435 440 445

Leu Tyr Ser Phe Gly Leu Asn Ser Cys Phe Phe Asp Gly His He Leu

450 455 460

Thr He He Lys Val Gly Leu Gly Val Val Ala Leu Phe Leu Cys Ser

465 470 475 480

Tyr Val Thr Leu Pro He Tyr Ala Leu Val Asn Gin Met Gly Ser Gly

485 490 495

Met Lys Arg Ser He Phe Asp Glu Gin Thr Ser Lys Ala Leu Met Lys

500 505 510

Trp Gin Glu Thr Ala Lys Lys Lys Arg Ala Lys Arg Ala Ser Ala Thr

515 520 525

Lys Thr Leu Gly Gly Ser Ser Asn Ala Ser Pro Leu His Ser Leu Arg

530 535 540

Arg Phe Lys Thr Thr Gly His Ser He Arg Val Pro Thr Tyr Glu Asp

545 550 555 560

Leu Glu Ser Ser Asp Tyr Glu Gly Asp Pro Leu Ala Thr Pro Thr Gin

565 570 575

Ala Ser Thr Ser Glu Ser He Asn Val Asp Val Lys Asp Gly Asp Glu

580 585 590

He Gin Gin He Ala Glu Thr Glu Gin Pro His Ser Thr He Gin Thr

595 600 605

Lys Glu Gly Asp Glu Phe Ser Phe He Lys Pro Ala Thr Leu Gly

610 615 620

<210> 15

<211> 1662

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1662

<223> /mol_type="DNA"

/note="cDNA CsKIP15"

/organism="Cucumis sativus"

<400> 15

atggctgaaa atgaacagga gactcgatct ttggctttga ctcccacttg gtctgttgct 60 tctgtgctga ctattttcgt tgcagtctct ttgcttgtgg agcggtccat tcaccggtta 120 agcacttggt tggggaaacc taatcgaaag ccactgtttg aggcagtgga gaaaatgaaa 180 gaagagttga tgctgcttgg atttatttct ctccttttaa cagctacttc aagctcaata 240 tcaaatatct gcgttccatc aaagttctac aatacccctt ttactccatg caccagagct 300 gaggctgacg aacatgaaga tgacaattca tccgaggaac ggaaactata tacagcttct 360 gtattacccc atttgtttag gcggatgctt aatgtgaata agaaaacctg caaagagggt 420 tatgagccgt ttgtttcata tgagggtctt gagcaattgc atcgctttat ctttataatg 480 gcagtaactc atatatctta tagctgctta acaatgttac tcgcaattgt gaagattcac 540 agatggaggg tttgggagaa tgaagcccat atggacagac atgattcact aaatgatatc 600 acaagagaaa tgacgttgcg gaggcaatca acctttgttc gatatcacac ttcaaatcct 660 atgacaagga acagttttct aatctgggtg acatgttttt tccggcaatt tgggaattct 720 gtagttcgtg ctgactacct cacacttcgc aagggcttca tcatgaatca tcatctcccc 780 ttgacttatg atttccacag ttacatgatt cgctccatgg aagaagaatt ccaaaggata 840 gttggcgtga gtggtccgtt gtggggattt gtcgttgctt tcatgctgtt taatgtaaaa 900 ggctctaatc tgtatttctg gatagcaagc gttcctattg ctcttgttct tttagtgggc 960 acgaagctgc aacatgtaat tgcaacattg gcattggaaa gtgctggtat aactggttca 1020 ttttcgggtt caaagctaaa gccaagagat gatcttttct ggtttaagaa gcctgaactc 1080 cttttgtcct taatccactt tatccttttc cagaatgcat ttgagttggc atcattcttc 1140 tggttctggt ggcaattcgg atataattct tgctttatca ggaatcatat gcttgtctat 1200 gcaagacttg ttttgggatt cgctgggcag ttcctttgca gctacagcac cttgcccttg 1260 tatgctttgg ttactcagat gggaacaaac tataaagctg cattaattcc acaaagaata 1320 agggaaacaa tccatggatg ggggaaggca gctagaagga aaagaaggct ccgcatgttt 1380 gcagatgaca ccacgattca cactgaaaca agcacggtga tgtcacttga ggatgatgac 1440 cgtaggctta ttgatgatat ttctgaaact actgccgact acacgtcaat cgaactacag 1500 ccgacttctg tacacgatga acctgactct gttcctaatg aacgaccaag cagagctaga 1560 acgcctcttc tacaaccctc cacatctctt tctgcatcag ttgatcataa gtttgaggta 1620 gaaaacttta tgaggagctt ttctatgcca gtaaaaagat ag 1662

<210> 16

<211> 553

<212> PRT

<213> Cucumis sativus <220>

<221> SOURCE

<222> 1..553

<223> /mol type="protein"

/note="proetin CsKIP7"

/organism="Cucumis sativus"

<400> 16

Met Ala Glu Asn Glu Gin Glu Thr Arg Ser Leu Ala Leu Thr Pro Thr 1 5 10 15

Trp Ser Val Ala Ser Val Leu Thr lie Phe Val Ala Val Ser Leu Leu

20 25 30

Val Glu Arg Ser lie His Arg Leu Ser Thr Trp Leu Gly Lys Pro Asn

35 40 45

Arg Lys Pro Leu Phe Glu Ala Val Glu Lys Met Lys Glu Glu Leu Met 50 55 60

Leu Leu Gly Phe lie Ser Leu Leu Leu Thr Ala Thr Ser Ser Ser lie 65 70 75 80

Ser Asn lie Cys Val Pro Ser Lys Phe Tyr Asn Thr Pro Phe Thr Pro

85 90 95

Cys Thr Arg Ala Glu Ala Asp Glu His Glu Asp Asp Asn Ser Ser Glu

100 105 110

Glu Arg Lys Leu Tyr Thr Ala Ser Val Leu Pro His Leu Phe Arg Arg

115 120 125

Met Leu Asn Val Asn Lys Lys Thr Cys Lys Glu Gly Tyr Glu Pro Phe 130 135 140

Val Ser Tyr Glu Gly Leu Glu Gin Leu His Arg Phe lie Phe lie Met 145 150 155 160

Ala Val Thr His lie Ser Tyr Ser Cys Leu Thr Met Leu Leu Ala lie

165 170 175

Val Lys lie His Arg Trp Arg Val Trp Glu Asn Glu Ala His Met Asp

180 185 190

Arg His Asp Ser Leu Asn Asp lie Thr Arg Glu Met Thr Leu Arg Arg

195 200 205

Gin Ser Thr Phe Val Arg Tyr His Thr Ser Asn Pro Met Thr Arg Asn 210 215 220

Ser Phe Leu lie Trp Val Thr Cys Phe Phe Arg Gin Phe Gly Asn Ser 225 230 235 240

Val Val Arg Ala Asp Tyr Leu Thr Leu Arg Lys Gly Phe lie Met Asn

245 250 255

His His Leu Pro Leu Thr Tyr Asp Phe His Ser Tyr Met lie Arg Ser

260 265 270

Met Glu Glu Glu Phe Gin Arg lie Val Gly Val Ser Gly Pro Leu Trp

275 280 285

Gly Phe Val Val Ala Phe Met Leu Phe Asn Val Lys Gly Ser Asn Leu 290 295 300

Tyr Phe Trp lie Ala Ser Val Pro lie Ala Leu Val Leu Leu Val Gly 305 310 315 320

Thr Lys Leu Gin His Val lie Ala Thr Leu Ala Leu Glu Ser Ala Gly

325 330 335 lie Thr Gly Ser Phe Ser Gly Ser Lys Leu Lys Pro Arg Asp Asp Leu

340 345 350

Phe Trp Phe Lys Lys Pro Glu Leu Leu Leu Ser Leu lie His Phe lie

355 360 365

Leu Phe Gin Asn Ala Phe Glu Leu Ala Ser Phe Phe Trp Phe Trp Trp 370 375 380

Gin Phe Gly Tyr Asn Ser Cys Phe lie Arg Asn His Met Leu Val Tyr 385 390 395 400

Ala Arg Leu Val Leu Gly Phe Ala Gly Gin Phe Leu Cys Ser Tyr Ser

405 410 415 Thr Leu Pro Leu Tyr Ala Leu Val Thr Gin Met Gly Thr Asn Tyr Lys

420 425 430

Ala Ala Leu lie Pro Gin Arg lie Arg Glu Thr lie His Gly Trp Gly

435 440 445

Lys Ala Ala Arg Arg Lys Arg Arg Leu Arg Met Phe Ala Asp Asp Thr

450 455 460

Thr lie His Thr Glu Thr Ser Thr Val Met Ser Leu Glu Asp Asp Asp

465 470 475 480

Arg Arg Leu lie Asp Asp lie Ser Glu Thr Thr Ala Asp Tyr Thr Ser

485 490 495

lie Glu Leu Gin Pro Thr Ser Val His Asp Glu Pro Asp Ser Val Pro

500 505 510

Asn Glu Arg Pro Ser Arg Ala Arg Thr Pro Leu Leu Gin Pro Ser Thr

515 520 525

Ser Leu Ser Ala Ser Val Asp His Lys Phe Glu Val Glu Asn Phe Met

530 535 540

Arg Ser Phe Ser Met Pro Val Lys Arg

545 550

<210> 17

<211> 1587

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1587

<223> /mol_type="DNA"

/note="cDNA CsKIP8"

/organism="Cucumis sativus"

<400> 17

atggaagaag aaggacgatc cttggccgtt acccccactt gggcttttgc cacagtggtc 60 actctcatgg tttctcttgg attcttcttc caaggcacgt tgaaacggac caaaaagtgg 120 ttgaatagga cgaaragaaa atcgttactt gctgcgttgg agaagattaa agaagagctg 180 atgctctttg gacttctttc gttgttgatg ggtcactgga ttgtttttgt tgcaagaatt 240 tgtgtcaagt catctgtctt gagcagccgt ttctatcctt gtgcgttgga gactgatctg 300 aaacgagtta gacatatttt cattgcaact caaagcttga acagttctgt tccaagggag 360 cacaataacg atgggatacg agagtattgt cctgagggtc gtgaatcgtt tgcttcatat 420 gaaagtttag agcagcttca tcgactaata ttcgttctcg gtgtcaccca tgtttcatat 480 agcttcattg ccattgccct ggctatgatt aagatatatg gctggaggac gtgggaaaat 540 gaggctaagg ctttggccat tcgaaacgcc gaagaagaat ctgcacaagc accatcaact 600 ggaccaaaca taaggcgact atcaactttt atctttcacc atacttctca tccatggagt 660 cagcatagag tccttgtttg gctgctctgt ttcagccgcc agttttggag ttctattaat 720 cgagctgatt acatggcttt gcggttggga tttatcagta ctcatgaact tcctatatcg 780 tatgacttcc acaattatat gcttcgaagc atggatgatg aatttcgtga tatggttggt 840 ataagtgtac cactctggat atatgccatt gcttgcatct tcctcaactt ccatggaagc 900 aacatttaca tttggctttc ctttgtccct gcaattgtgg taaagctagc tgtagaagtt 960 gtggattcat ccccaagggg atattattgt tttaacttga gagatgagct gttttggttt 1020 gggaagccta agcttctttt atggttgata caatttatat ccttccagaa tgcttttgag 1080 atggctacat tcatttggtc cctgtttcag tgggaaatta aggagccttc ttgtttcatg 1140 gataacgaaa cctatgttgg tatccgcttg gcgtttgggg ttatcactca attttggtgt 1200 agcttcatca cattcccact ctatgttata gtaactcaga tggggtcaaa agtcaagaaa 1260 tcacttgtgt cggagaatgt tcgaaactca cttcatcaat ggaaaagaag agtgaaggca 1320 aggccaggtg cttcttcaac ggttacactt gcgggtgcaa catcactttc atcctctgtt 1380 tttacaatgg atgatgaggg tgaagtgacc gacgacttta ccacgaactg ctcggaagga 1440 agcacatcaa atgctgctca atgcacacat ttcccccagt taattcagcc agttttgtca 1500 gatgacacgg aagtagaaat atctgttagt tctaattctc cacacattag ttccaacgac 1560 agaagtgaag gcaatgggga tggttga 1587

<210> 18

<211> 528

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..528

<223> /mol type="protein"

/note="CsKIP8"

/organism="Cucumis sativus"

<400> 18

Met Glu Glu Glu Gly Arg Ser Leu Ala Val Thr Pro Thr Trp Ala Phe

1 5 10 15

Ala Thr Val Val Thr Leu Met Val Ser Leu Gly Phe Phe Phe Gin Gly

20 25 30

Thr Leu Lys Arg Thr Lys Lys Trp Leu Asn Arg Thr Lys Arg Lys Ser

35 40 45

Leu Leu Ala Ala Leu Glu Lys lie Lys Glu Glu Leu Met Leu Phe Gly

50 55 60

Leu Leu Ser Leu Leu Met Gly His Trp lie Val Phe Val Ala Arg lie

65 70 75 80

Cys Val Lys Ser Ser Val Leu Ser Ser Arg Phe Tyr Pro Cys Ala Leu

85 90 95

Glu Thr Asp Leu Lys Arg Val Arg His lie Phe lie Ala Thr Gin Ser

100 105 110

Leu Asn Ser Ser Val Pro Arg Glu His Asn Asn Asp Gly lie Arg Glu

115 120 125

Tyr Cys Pro Glu Gly Arg Glu Ser Phe Ala Ser Tyr Glu Ser Leu Glu

130 135 140

Gin Leu His Arg Leu lie Phe Val Leu Gly Val Thr His Val Ser Tyr

145 150 155 160 Ser Phe lie Ala lie Ala Leu Ala Met lie Lys lie Tyr Gly Trp Arg

165 170 175

Thr Trp Glu Asn Glu Ala Lys Ala Leu Ala lie Arg Asn Ala Glu Glu

180 185 190

Glu Ser Ala Gin Ala Pro Ser Thr Gly Pro Asn lie Arg Arg Leu Ser

195 200 205

Thr Phe lie Phe His His Thr Ser His Pro Trp Ser Gin His Arg Val

210 215 220

Leu Val Trp Leu Leu Cys Phe Ser Arg Gin Phe Trp Ser Ser lie Asn 225 230 235 240

Arg Ala Asp Tyr Met Ala Leu Arg Leu Gly Phe lie Ser Thr His Glu

245 250 255

Leu Pro lie Ser Tyr Asp Phe His Asn Tyr Met Leu Arg Ser Met Asp

260 265 270

Asp Glu Phe Arg Asp Met Val Gly lie Ser Val Pro Leu Trp lie Tyr

275 280 285

Ala lie Ala Cys lie Phe Leu Asn Phe His Gly Ser Asn lie Tyr lie

290 295 300

Trp Leu Ser Phe Val Pro Ala lie Val Val Lys Leu Ala Val Glu Val 305 310 315 320

Val Asp Ser Ser Pro Arg Gly Tyr Tyr Cys Phe Asn Leu Arg Asp Glu

325 330 335

Leu Phe Trp Phe Gly Lys Pro Lys Leu Leu Leu Trp Leu lie Gin Phe

340 345 350 lie Ser Phe Gin Asn Ala Phe Glu Met Ala Thr Phe lie Trp Ser Leu

355 360 365

Phe Gin Trp Glu lie Lys Glu Pro Ser Cys Phe Met Asp Asn Glu Thr

370 375 380

Tyr Val Gly lie Arg Leu Ala Phe Gly Val lie Thr Gin Phe Trp Cys 385 390 395 400

Ser Phe lie Thr Phe Pro Leu Tyr Val lie Val Thr Gin Met Gly Ser

405 410 415

Lys Val Lys Lys Ser Leu Val Ser Glu Asn Val Arg Asn Ser Leu His

420 425 430

Gin Trp Lys Arg Arg Val Lys Ala Arg Pro Gly Ala Ser Ser Thr Val

435 440 445

Thr Leu Ala Gly Ala Thr Ser Leu Ser Ser Ser Val Phe Thr Met Asp

450 455 460

Asp Glu Gly Glu Val Thr Asp Asp Phe Thr Thr Asn Cys Ser Glu Gly 465 470 475 480

Ser Thr Ser Asn Ala Ala Gin Cys Thr His Phe Pro Gin Leu lie Gin

485 490 495

Pro Val Leu Ser Asp Asp Thr Glu Val Glu lie Ser Val Ser Ser Asn

500 505 510

Ser Pro His lie Ser Ser Asn Asp Arg Ser Glu Gly Asn Gly Asp Gly

515 520 525

<210> 19

<211> 1707

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1707

<223> /mol_type="DNA"

/note="cDNA CsKIPIO"

/organism="Cucumis sativus

<400> 19 atggctgaaa atgcctccca ggagggaaga tctctggctc tgacgcctac ttggtctgtt 60 gcttccgtgt tgaccattct cgtcgcagtt tcattgcttg tagaacgctc cattcatagg 120 ctaagctctt ggctgggaaa aactcataga aaacccttat ttgaggcagt ggagaaaatg 180 aaagaagagt taatgctgct tggttttatt tctttgcttc tgacggcaac atcaagtcta 240 atatcaaata tctgcattcc atccaagttt tatgatacat cttttattcc gtgctctcag 300 tcggagattg atgaacaaaa tgcggataat tcttcatctg agaagcgaaa gctatttatg 360 gtttctgttt tcccacattt gaataggagg atgctaactg tgaacaaaaa tacatgcaaa 420 gagggtcatg agccctttgt ttcctatgag ggacttgagc aattgcatcg ctttatcttt 480 gtgatggcag ttactcatat ttcttatagt tgcttaacca tgttgttggc aattgtgaag 540 atccacagtt ggagagaatg ggaaaatgaa gctcacatgg accaccatga tttattcaac 600 gatacaacga aaaaaaagat aatgcagaga caatctacct ttgtacaata tcacgcctcc 660 aatcctttaa ccaggaatag ctttcttatc tggatgacct gtttcttcag gcaatttggg 720 cgttctgttg ttcgttctga ctaccttaca cttcgcaaag gcttcatcac gaatcacaac 780 ctctcatcaa aatatgattt ccatagctac atggttcgtt ctatggaaga agaattccag 840 agaatagttg gtgtgagtgg tccgttatgr ggatttgtcg tagctttttt gctatttaat 900 gtgaaaggct ccaaccttta cttttggata gcaactattc ctgttactct tgttctttta 960 gtgggcacaa agttacagca tgttattgca actttgacgt tggagaatgc tggtataacc 1020 ggattctttt ctggagcaaa gctgaggccc cgtgatgatc ttttctggtt taagaagcct 1080 gaacttctgt tgtccttgat ccattttgtt cttttccaga atgctttcga attggcttcg 1140 ttcttctggt tctggtggca atctggatgt agttcttgct tcattagcaa tcatctgctt 1200 gtctatgtaa gactaatctt gggttttgct ggacaatttc tttgcagcta tagcacctwr 1260 cccytatacg cactggttac tcagatggga acaaactaca aggctgcctt aattcctcaa 1320 agaataaggg aaacaatcca tgggtggggt aagtcagcta gaaggaagag aaggctccgg 1380 atatttactg atgatgccac aatccacacg gaaacaagca ccgtgatgtc actkgaggac 1440 gatgacaacc aacatgtwga tacacctaaa gctgcaactg gctatgccat aattgagatg 1500 cagccaccta ctgcagcaaa tgtgtccgcc tctgtttcta atgatgcatc acgtgcggtt 1560 agaactcccc ttcttcagcc ctctctgtct ctttcattgc cwgtggctca aaacttcaat 1620 gacggagccc ctttaagaag ctcatcaatg ccggctcaaa ayttcgatgc cgaaaactct 1680 ttaagaagct catctatgcc gagataa 1707

<210> 20 <211> 568

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..568

<223> /mol type="protein"

/note="protein CsKIPIO"

/organism="Cucumis sativus"

<400> 20

Met Ala Glu Asn Ala Ser Gin Glu Gly Arg Ser Leu Ala Leu Thr Pro 1 5 10 15 Thr Trp Ser Val Ala Ser Val Leu Thr He Leu Val Ala Val Ser Leu

20 25 30

Leu Val Glu Arg Ser He His Arg Leu Ser Ser Trp Leu Gly Lys Thr

35 40 45

His Arg Lys Pro Leu Phe Glu Ala Val Glu Lys Met Lys Glu Glu Leu 50 55 60

Met Leu Leu Gly Phe He Ser Leu Leu Leu Thr Ala Thr Ser Ser Leu 65 70 75 80

He Ser Asn He Cys He Pro Ser Lys Phe Tyr Asp Thr Ser Phe He

85 90 95 Pro Cys Ser Gin Ser Glu He Asp Glu Gin Asn Ala Asp Asn Ser Ser

100 105 110

Ser Glu Lys Arg Lys Leu Phe Met Val Ser Val Phe Pro His Leu Asn

115 120 125

Arg Arg Met Leu Thr Val Asn Lys Asn Thr Cys Lys Glu Gly His Glu 130 135 140

Pro Phe Val Ser Tyr Glu Gly Leu Glu Gin Leu His Arg Phe He Phe 145 150 155 160

Val Met Ala Val Thr His He Ser Tyr Ser Cys Leu Thr Met Leu Leu

165 170 175 Ala He Val Lys He His Ser Trp Arg Glu Trp Glu Asn Glu Ala His

180 185 190

Met Asp His His Asp Leu Phe Asn Asp Thr Thr Lys Lys Lys He Met

195 200 205

Gin Arg Gin Ser Thr Phe Val Gin Tyr His Ala Ser Asn Pro Leu Thr 210 215 220

Arg Asn Ser Phe Leu He Trp Met Thr Cys Phe Phe Arg Gin Phe Gly 225 230 235 240

Arg Ser Val Val Arg Ser Asp Tyr Leu Thr Leu Arg Lys Gly Phe He

245 250 255 Thr Asn His Asn Leu Ser Ser Lys Tyr Asp Phe His Ser Tyr Met Val

260 265 270

Arg Ser Met Glu Glu Glu Phe Gin Arg He Val Gly Val Ser Gly Pro

275 280 285

Leu Trp Gly Phe Val Val Ala Phe Leu Leu Phe Asn Val Lys Gly Ser 290 295 300

Asn Leu Tyr Phe Trp He Ala Thr He Pro Val Thr Leu Val Leu Leu 305 310 315 320

Val Gly Thr Lys Leu Gin His Val He Ala Thr Leu Thr Leu Glu Asn

325 330 335 Ala Gly He Thr Gly Phe Phe Ser Gly Ala Lys Leu Arg Pro Arg Asp

340 345 350

Asp Leu Phe Trp Phe Lys Lys Pro Glu Leu Leu Leu Ser Leu He His

355 360 365

Phe Val Leu Phe Gin Asn Ala Phe Glu Leu Ala Ser Phe Phe Trp Phe 370 375 380 Trp Trp Gin Ser Gly Cys Ser Ser Cys Phe lie Ser Asn His Leu Leu

385 390 395 400

Val Tyr Val Arg Leu lie Leu Gly Phe Ala Gly Gin Phe Leu Cys Ser

405 410 415

Tyr Ser Thr Leu Pro Leu Tyr Ala Leu Val Thr Gin Met Gly Thr Asn

420 425 430

Tyr Lys Ala Ala Leu lie Pro Gin Arg lie Arg Glu Thr lie His Gly

435 440 445

Trp Gly Lys Ser Ala Arg Arg Lys Arg Arg Leu Arg lie Phe Thr Asp

450 455 460

Asp Ala Thr lie His Thr Glu Thr Ser Thr Val Met Ser Leu Glu Asp

465 470 475 480

Asp Asp Asn Gin His Val Asp Thr Pro Lys Ala Ala Thr Gly Tyr Ala

485 490 495

lie lie Glu Met Gin Pro Pro Thr Ala Ala Asn Val Ser Ala Ser Val

500 505 510

Ser Asn Asp Ala Ser Arg Ala Val Arg Thr Pro Leu Leu Gin Pro Ser

515 520 525

Leu Ser Leu Ser Leu Pro Val Ala Gin Asn Phe Asn Asp Gly Ala Pro

530 535 540

Leu Arg Ser Ser Ser Met Pro Ala Gin Asn Phe Asp Ala Glu Asn Ser

545 550 555 560

Leu Arg Ser Ser Ser Met Pro Arg

565

<210> 21

<211> 1671

<212> DNA

<213> Cucumis sativus

<220>

<221> source

<222> 1..1671

<223> /mol_type="DNA"

/note="cDNA CsKIPll"

/organism="Cucumis sativus"

<400> 21

atggaacttc aaggaggaag gtcactggct gaaacgccta cctactcggt tgcttctgtg 60 gttactgtca tggtctttgt cagcttggtg gtggagcggg caatctatag gtttggaaag 120 tggttgaaga araccaagag aaaggctctg tttgcttctt tggagaarat taaggaagag 180 ctgatgctgc ttggactgat atctttgatg ctggcacaat gtgcaaggtg gatatctgaa 240 atttgtgtga actcgtccct tttcaccagt agattctaca tttgttcaga agaagattat 300 gccaccaatg aacatattct gcttgaaagt tctctattgt ctcataatga aattgtcatt 360 cctcaaagag aattaagtgc tcttccgcat caatgtggtg agggtcgtga gccttttgtt 420 tcatatgagg gacttgaaca acttcaccgg ttcttgttcg ttcttgggat cactcatgtt 480 ctttatagct gtctagctgt tggtctggca atgagtaaga tatacagttg gaggaaatgg 540 gaaagtcaag ttaaattagc tgctgaagat aatttaccag ctaaaagaaa taaggtcatg 600 aggcggcaaa cgacgtttgt tttccatcac acatctcatc catggagcag gagtcgtatt 660 ctcatatgga tgctttgttt cctacgtcag ttcaagagtt cgataaagaa atcagactat 720 ttggccctcc gtttgggttt cattacaaag cacaaattac cgatctctta tgatttccac 780 aagtacatgg ttcggagcat ggaagacgag ttccatggaa tccttggaat tagctggccg 840 ctatggggct acgccattct ktgcatcttt gtcaacattc acggtttaaa tatctacttt 900 tggctatctt tcataccggc tgctctwgtt atgctcgttg ggacaaaact tcaacaygtw 960 gtatcctctt tggctcttga agtwttggaa cagagaggtg ggattcaaat aaaaccaaga 1020 gacgatctgt tttggtttgg aaagcctgtg attttactmc ggttaataca gctcatcata 1080 tttcagaatg catttgagat ggcgacattt atmtggtcct tgtggggatt taaggaaaga 1140 tcttgcttcg tgaagaacga ctttatgata atcacgaggt tgacttcagg tgttcttgta 1200 cagttttggt gcagctatag cattgtgcca cttaatataa ttgttacaca gatgggatcc 1260 aagtgtaaga aagcattggt ggctgagagc gtgagagagt cattgcatag ttggtgcaag 1320 agagtaaagg agaggtccaa acgwgactct gcacattcca tcactacaag atcagtatgt 1380 tcacttgaat caatggttga tgaacgagat gaaataacca ttgcttccgg tacgttgtca 1440 cggagctcat cttttgagac ctcaaatcag gtgaccgtac aatctactgc ccaactagag 1500 gctattattg agtcttcaag cttaaggagg catgaagaac ttccccccac catggcggat 1560 tttctatcac aatctgcaag agtttctcat gctaatggcc tagaaaataa tgcagagagt 1620 ggcgaagata gcaaggtcga gtcacttttc gacttgttca aaaggacatg a 1671

<210> 22

<211> 556

<212> PRT

<213> Cucumis sativus

<220>

<221> SOURCE

<222> 1..556

<223> /mol type="protein"

/note="protein CsKIPll"

/organism="Cucumis sativus"

<400> 22

Met Glu Leu Gin Gly Gly Arg Ser Leu Ala Glu Thr Pro Thr Tyr Ser

1 5 10 15

Val Ala Ser Val Val Thr Val Met Val Phe Val Ser Leu Val Val Glu

20 25 30

Arg Ala lie Tyr Arg Phe Gly Lys Trp Leu Lys Lys Thr Lys Arg Lys

35 40 45

Ala Leu Phe Ala Ser Leu Glu Lys lie Lys Glu Glu Leu Met Leu Leu

50 55 60

Gly Leu lie Ser Leu Met Leu Ala Gin Cys Ala Arg Trp lie Ser Glu

65 70 75 80

lie Cys Val Asn Ser Ser Leu Phe Thr Ser Arg Phe Tyr lie Cys Ser

85 90 95 Glu Glu Asp Tyr Ala Thr Asn Glu His lie Leu Leu Glu Ser Ser Leu

100 105 110

Leu Ser His Asn Glu lie Val lie Pro Gin Arg Glu Leu Ser Ala Leu

115 120 125

Pro His Gin Cys Gly Glu Gly Arg Glu Pro Phe Val Ser Tyr Glu Gly 130 135 140

Leu Glu Gin Leu His Arg Phe Leu Phe Val Leu Gly lie Thr His Val 145 150 155 160

Leu Tyr Ser Cys Leu Ala Val Gly Leu Ala Met Ser Lys lie Tyr Ser

165 170 175

Trp Arg Lys Trp Glu Ser Gin Val Lys Leu Ala Ala Glu Asp Asn Leu

180 185 190

Pro Ala Lys Arg Asn Lys Val Met Arg Arg Gin Thr Thr Phe Val Phe

195 200 205

His His Thr Ser His Pro Trp Ser Arg Ser Arg lie Leu lie Trp Met 210 215 220

Leu Cys Phe Leu Arg Gin Phe Lys Ser Ser lie Lys Lys Ser Asp Tyr 225 230 235 240

Leu Ala Leu Arg Leu Gly Phe lie Thr Lys His Lys Leu Pro lie Ser

245 250 255

Tyr Asp Phe His Lys Tyr Met Val Arg Ser Met Glu Asp Glu Phe His

260 265 270

Gly lie Leu Gly lie Ser Trp Pro Leu Trp Gly Tyr Ala lie Leu Cys

275 280 285

lie Phe Val Asn lie His Gly Leu Asn lie Tyr Phe Trp Leu Ser Phe 290 295 300

lie Pro Ala Ala Leu Val Met Leu Val Gly Thr Lys Leu Gin His Val 305 310 315 320

Val Ser Ser Leu Ala Leu Glu Val Leu Glu Gin Arg Gly Gly lie Gin

325 330 335 lie Lys Pro Arg Asp Asp Leu Phe Trp Phe Gly Lys Pro Val lie Leu

340 345 350

Leu Arg Leu lie Gin Leu lie lie Phe Gin Asn Ala Phe Glu Met Ala

355 360 365

Thr Phe lie Trp Ser Leu Trp Gly Phe Lys Glu Arg Ser Cys Phe Val 370 375 380

Lys Asn Asp Phe Met lie lie Thr Arg Leu Thr Ser Gly Val Leu Val 385 390 395 400

Gin Phe Trp Cys Ser Tyr Ser lie Val Pro Leu Asn lie lie Val Thr

405 410 415

Gin Met Gly Ser Lys Cys Lys Lys Ala Leu Val Ala Glu Ser Val Arg

420 425 430

Glu Ser Leu His Ser Trp Cys Lys Arg Val Lys Glu Arg Ser Lys Arg

435 440 445

Asp Ser Ala His Ser lie Thr Thr Arg Ser Val Cys Ser Leu Glu Ser 450 455 460

Met Val Asp Glu Arg Asp Glu lie Thr lie Ala Ser Gly Thr Leu Ser 465 470 475 480

Arg Ser Ser Ser Phe Glu Thr Ser Asn Gin Val Thr Val Gin Ser Thr

485 490 495

Ala Gin Leu Glu Ala lie lie Glu Ser Ser Ser Leu Arg Arg His Glu

500 505 510

Glu Leu Pro Pro Thr Met Ala Asp Phe Leu Ser Gin Ser Ala Arg Val

515 520 525

Ser His Ala Asn Gly Leu Glu Asn Asn Ala Glu Ser Gly Glu Asp Ser 530 535 540

Lys Val Glu Ser Leu Phe Asp Leu Phe Lys Arg Thr

545 550 555

<210> 23 <211> 20

<212> DNA

<213> artificial sequences

<220>

<221> source

<222> 1..20

<223> /mol_type="DNA"

/note="primer ID1"

/organism="artificial sequences "