TECHNICAL FIELD This invention pertains to the prevention and treatment of viral infections by making cells, plants, and animals non-permissive for viral infections.

BACKGROUND ART Current strategies for prevention and treatment of viral infections : Vaccines Vaccines can stimulate both cellular and humoral immune responses to viruses. The type of immunity predominating in a particular situation depends on the antigen used in a vaccine, any adjuvants administered with the antigen, and the route by which the vaccine is administered. Different vaccines elicit humoral (antibody) protection, cell-mediated immunity, or sometimes both. Antibodies are generally more effective against viral surface antigens.

Cell-mediated immunity can be effective against both surface viral antigens and core viral antigens. Core antigens tend to be more highly conserved, so immune system recognition of core antigens tends to provide greater cross-protection against related viruses. Among the more promising new technologies are the use of DNA vaccines to generate both humoral and cellular immunity, and the use of cytokines to direct and amplify the desired type of immune response. See Boland, Bill et al. (ed.),"DNA Vaccines : A New Era in Vaccinology,"Ann.

N. Y. Acad. Sci., vol. 772 (1995) (entire volume) ; Chattergoon, Michael et al.,"Genetic Immunization : a new era in vaccines and immune therapeutics,"FASEB, vol. 11, pp. 753-763 (1997) ; Dertzbaugh, Mark,"Genetically Engineered Vaccines : An Overview,"Plasmid, vol. 39, pp. 100-113 (1998). Despite the best efforts of vaccine developers, many viruses continue to elude immune system-based mechanisms by"hiding,"or by changing the character

of their antigens. For many important viruses, effective vaccines do not currently exist. New approaches to protection against viral infections are needed.

Current strategies for prevention and treatment of viral infections : Drug treatments The use of drugs to treat viral infections has been limited because viruses are so closely associated with the biochemistry of host cells. Few biochemical opportunities for treatment exist, in comparison to treating bacterial and parasitic infections. It is a major challenge to develop drugs with enough specificity to inhibit viruses without compromising the host. The few partial success stories in the modern history of anti-viral drugs have resulted from aggressive and expensive research programs. Although these efforts should continue and even expand, the fruits of such heroic labors in chemistry have been disappointing. Even when promising drugs have appeared, a genetic shift in viral populations tends to decrease the long term effectiveness of the drug. See Pillay, D.,"Emergence and control of resistance to antiviral drugs in resistance in herpes viruses, hepatitis B virus, and HIV,"Commun. Dis.

Public Health, vol. 1, pp. 5-13 (March 1998) ; Wade, R. C.,"'Flu'and structure-based drug design,"Structure, vol. 5, pp. 1139-1145 (1997) ; Shigeta, S.,"Approaches to antiviral chemotherapy for acute respiratory infections,"Antivir. Chem. Chemother, vol. 9, pp. 93-107 (March 1998) ; Athmanathan, S. et al.,"Ophthalmic antiviral chemotherapy : an overview," Indian J. Opthalmol., vol. 45, pp. 203-210 (1997) ; Colacino, J. et al.,"The identification and development of antiviral agents for the treatment of chronic hepatitis B virus infection," Progress in Drug Design, vol. 50, pp. 260-322 (1998).

Current strategies for prevention and treatment of viral infections : Antisense genetics Antisense technology uses gene sequences complementary to the message transcribed from the targeted gene to inhibit the translation of that message, thereby inhibiting the expression of the targeted gene. This relatively new technology is currently being investigated to block replication of cancerous cells, to inhibit the functioning of virus-specific genes, and to study normal gene function. Some practical applications of antisense nucleic acid sequences to inhibit the expression of essential genes of viruses to prevent and treat virus infections appear promising. See Wagner, R. W. et al.,"Antisense technology and prospects for therapy of viral infections and cancer,"Mol. Med. Today, vol. 1, pp. 31-38 (1997) ; Kilkuskie, R. E. et al., "Antisense inhibition of virus infections,"Adv. Pharmacol, vol. 40, pp. 437-483 (1997) ; G.

Sczakiel,"The design of antisense RNA,"Antisense & Nucleic Acid Drug Development, vol. 7, pp. 439-444 (1997).

Genetic modification of animal and plant hosts Genetic modification of bacterial and eukaryotic cells is well known in the art.

Methods to transform cells include inhalation or injection of free DNA, shooting DNA-coated particles into cells by gene-gun technology, introduction of DNA as complexes with carrier polymers, electroporation, incorporation of nucleic acids in liposomes, utilization of receptor- mediated endocytosis, or by using one of the many different types of viral vectors. See Nakanishi, M.,"Gene introduction into animal tissues,"Crit. Rev. Ther. Drug Carrier Syst., vol. 12, pp. 263-310 (1995) ; Robbins, P. D. et al.,"Viral vectors for gene therapy," Pharmacol. Ther., vol. 80, pp. 35-47 (October 1998) ; Rolland, A. P.,"From genes to gene medicines : recent advances in nonviral gene delivery,"Crit. Rev. Ther. Drug. Carrier Syst., vol. 15, pp. 143-198 (1998) ; Tarahovsky, Y. S.,"Liposomes in gene therapy. Structural polymorphism of lipids and effectiveness of gene delivery,"Biochemistry (Mosc), vol. 63, pp.

607-618 (June 1998) ; Guy, J. et al.,"Delivery of DNA into mammalian cells by receptor- mediated endocytosis and gene therapy,"Mol. Biotechnol., vol. 3, pp. 237-248 (1995) ; Miyoshi, H. et al.,"Transduction of Human CD34+ cells that mediate long-term engraftment of NOD/SCID mice by HIV vectors,"Science, vol. 283, pp. 682-686 (1999) ; Mushegian, A. R. et al.,"Genetic elements of plant viruses as tools for genetic engineering,"Microbiol.

Rev., vol. 59, pp. 548-578 (1995). See generally F. M. Ausubel et al. (Eds), Current Protocols in Molecular Biology, vols. 1-3, John Wiley and Sons (Wiley Interscience) (1999) ; and T. Maniatis et al. (Eds.), Molecular Cloning : A Laboratory Manual, vols. 1-3, Cold Spring Harbor Laboratory Press (2nd ed. 1989). A preferred vector for transforming a cell's genome is the transposon-based vector disclosed in Cooper, United States patent no.

5, 719, 055. The vector may be introduced, e. g., via electroporation or lipofection, using protocols known in the art. When a multicellular plant or animal is genetically modified, the modification may occur in the germ line, in somatic cells only, or in both somatic cells and germ cells. Only transformations of germ cells will be inherited by subsequent generations. In humans, genetic modification of the germ line is generally considered off-limits today due to ethical concerns. However, various experimental treatments have been tested involving modification of somatic cells in humans (such as hematopoietic stem cells) to correct genetic defects. There have been few successful attempts to genetically modify either somatic cells or germ cells to enhance resistance to viruses by any mechanism other than by stimulation of the conventional immune system or introduction of antisense viral genes."Nucleic acid vaccines" have been introduced into cells to produce antigens to stimulate a specific immune response against target viruses. A great deal more could be accomplished if additional genetic-based

techniques were available to provide protection against viral infection without compromising other functions of uninfected cells and uninfected organisms.

Studies using viral promoters to drive gene expression Methods of using viral promoters to drive the expression of foreign genes are known in the art. Glorioso et al., 1995 reviewed the use of the herpesvirus-specific immediate early (IE) promoter and other promoters to drive the expression of foreign genes. See also M. Martin et al.,"Identification of a transactivating function mapping to the putative immediate-early locus of human herpesvirus 6,"J. Virology, vol. 65, pp. 5381-5390 (1991). One example given in the Glorioso et al. review is the use of the IE promoter to drive the expression of the lacZ gene to yield p-galactosidase, which is readily detected in live cells by its ability to convert exogenously-supplied IPTG to a dark blue reaction product. This use of the IE promoter to drive production of p-galactosidase is a common research tool ; such a construct has been cloned into cultured cells for use as an early signal of infection by herpesviruses. When cloned into cells, the marker is activated following infection with a herpesvirus, because the herpesvirus cannot replicate without activating this promoter. In this manner, infected cells can readily be identified by counting the colored cells. See Sandri-Goldin, R. M. et al., "Expression of herpes simplex virus beta and gamma genes integrated in mammalian cells and their induction by an alpha gene product,"Mol. Cell Biol., vol. 11, pp. 2028-2044 (1983) ; Dicker, I. B. et al.,"Herpes simplex type 1 : lacZ recombinant viruses. I. Characterization and application to defining the mechanisms of action of known antiherpes agents,"Antiviral Res., vol. 3, pp. 191-212 (1995) ; Dicker, I. B. et al.,"Herpes simplex type 1 : lacZ recombinant viruses. II. Microtiter plate-based colorimetric assays for the discovery of new antiherpes agents and the points at which such agents disrupt the viral replication cycle,"Antiviral Res., vol. 3, pp. 213-224 (1995) ; E. Stabell et al.,"Evaluation of a genetically engineered cell line and a histochemical beta-galactosidase assay to detect simplex virus in clinical specimens,"J.

Clin. Microbiol., vol. 31, pp. 2796-2798 (1993).

Studies in a transgenic mouse model have used herpesvirus-specific inducers and promoters to study gene function and development. See Gardner, D. P. et al.,"Spatial and temporal regulation of a lacZ reporter transgene in a binary transgenic mouse system," Transgenic Res., vol. 5, pp. 37-48 (1996) ; Byrne, G. W. et al.,"Multiplex gene regulation : a two-tiered approach to transgene regulation in transgenic mice,"Proc. Natl. Acad. Sci. USA, vol. 86, pp. 5473-5477 (1989) ; and U. S. Patent 5, 221, 778. This research demonstrates that herpesvirus-specific inducers can drive expression of nonviral genes linked to herpesvirus- specific promoters in mice. Information on other virus-driven gene expression systems are

known for both animals and plants. Mori, M. et al.,"mRNA amplification system by viral replicase in transgenic plants,"FEBS Lett., vol. 336, pp. 171-174 (1993) ; Mushegian, A. R. et al.,"Genetic elements of plant viruses as tools for genetic engineering,"Microbiol. Rev., vol.

59, pp. 548-578 (1995).

M. Caruso et al.,"Expression of a Tat-inducible herpes simplex virus thymidine-kinase gene protects acyclovir-treated CD4 cells from HIV-1 spread by conditional suicide and inhibition of reverse transcription,"Virology, vol. 206, pp. 495-503 (1995) reported that lymphoid CD4+ cells harboring a herpes simplex virus type 1 thymidine kinase gene, under the transcriptional control of the HIV-1 long terminal repeat, were protected from HIV-1 spread in the presence of 10 uM acyclovir. See also M. Caruso et al.,"Expression of a tat-inducible herpes simplex virus-thymidine kinase gene protects acyclovir-treated CD4 cells from HIV-1 spread by conditional suicide and inhibition of reverse transcription,"Virology, vol. 206, pp.

495-503 (1995) ; T. Curiel et al.,"Long-term inhibition of clinical and laboratory human immunodeficiency virus strains in human T-cell lines containing an HIV-regulated diphtheria toxin A chain gene,"Hum. Gene Ther., vol. 4, pp. 741-747 (1993) ; M. Dinges et al.,"HIV- regulated diphtheria toxin A chain gene confers long-term protection against HIV type 1 infection in the human promonocytic cell line U937,"Hum. Gene Ther., vol. 6, pp. 1437-1445 (1995) ; T. Goto et al.,"Highly efficient electro-gene therapy of solid tumor by using an expression plasmid for the herpes simplex virus thymidine kinase gene,"Proc. Natl., Acad.

Sci. (USA), vol. 97, pp. 354-359 (2000) ; B. Howard et al.,"Ablation of tumor cells in vivo by direct injection of HSV-thymidine kinase retroviral vector and ganciclovir therapy,"Ann.

N. Y. Acad. Sci., vol. 880, pp. 352-365 (1999) ; D. Klatzmann et al.,"A phase 1/11 dose- escalation study of herpes simplex virus type 1 thymidine kinase"suicide"gene therapy for metastatic melanoma. Study group on gene therapy of metastatic melanoma,"Hum. Gene.

Ther., vol. 9, pp. 2585-2594 (1998) Transcription of the toxin in the HIV retroviral systems has been reported to be "leaky,"i. e., toxin can be expressed at low levels in the absence of the inducer. See, e. g., J.

Ragheb et al.,"Inhibition of human immunodeficiency virus type 1 by Tat/Rev-regulated expression of cytosine deaminase, interferon alpha2, or diphtheria toxin compared with inhibition by transdominant Rev,"Rev. Hum. Gene. Ther., vol. 10, pp. 103-112 (1999). This "leaky"expression may be typical of retroviral systems.

E. Shillitoe et al.,"Papillomaviruses as targets for cancer gene therapy,"Cancer Gene Ther., vol. 1, pp. 193-204 (1994) discusses the possible use of papillomavirus-specific promoters linked to toxin genes to be selectively expressed in tumor cells where the virus genes are active.

S. Pleschka et al.,"A plasmid-based reverse genetics system for influenza A virus,"J.

Virol., vol. 70, pp. 4188-4192. (1996) disclose that an exogenous reporter gene, such as chloramphenicol acetyltransferase (CAT), encoded so that its mRNA was in a negative-sense orientation, was successfully expressed as a gene product in the presence of influenza RNA- dependent RNA polymerase. See also 1. Mena et al.,"Rescue of a synthetic chloramphenicol acetyltransferase RNA into influenza virus-like particles obtained from recombinant plasmids," J. Virol., vol. 70, pp. 5016-5024 (1996) ; G. Newmann et al.,"Plasmid-driven formation of influenza virus-like particles,"J. Virol., vol. 74, pp. 547-551 (2000) ; and G. Newmann et al.,"RNA polymerase 1-mediated expression of influenza viral RNA molecules,"Virology, vol. 202, pp. 477-479 (1994).

There remains an unfilled need for new methods to treat and prevent viral infections.

DISCLOSURE OF INVENTION This invention presents a completely new approach to preventing, treating, and curing viral infections. This approach is based upon designing genetic codes for toxins so that the toxins can only be expressed in cells that are infected by a virus. These"genetic drugs"can be introduced into cells in a variety of ways, either to prevent or to cure viral infections by killing virus-infected cells. This method can be used to kill cells infected by many different kinds of viruses. These novel techniques may be used both to prevent the establishment of viral infections and to treat existing viral infections. The method can also be used to kill cancer cells that express viruses, whether or not the viruses actually cause the cancer.

The common theme of the three different methods of implementing the invention is to encrypt the genetic code for a toxin in such a way that an effective amount of the toxin is expressed within, and only within, virus-infected cells, leading to the death of only the infected cells and thereby terminating the infection. Methods to express toxins only within virus- infected cells include : (I) the control of toxin expression using virus-specific gene regulatory mechanisms ; (II) the control of toxin expression using antisense codes for toxins that can be translated only within virus-infected cells ; or (III) the use of negative DNA codes for toxins that can only be translated in virus-infected cells. Infection by many viruses of prokaryotes and eukaryotes may be treated or prevented by one or more of these three methods.

If the encrypted code for a toxin is present prior to infection, the host cell will be killed prior to the formation of mature or infectious virions, thereby terminating the infectious cycle of the virus. If the encrypted code for toxin production is introduced to a cell that is already

producing viruses, then the infected cell will be killed, thereby terminating the production of viruses.

The technical tools needed to practice this invention have been available for a decade or longer. The continuing, long-felt need for effective methods of controlling viral infection requires no citation. The notion that the health of an organism can be improved by introducing an exogenous toxin gene into cells of the organism flies in the face of conventional thinking-- especially where the toxin gene is used to prevent future infections by a virus not currently afflicting the organism.

Techniques to sequence, synthesize, clone, and deliver the relatively short segments of oligonucleotides needed to practice this invention are relatively simple to implement using protocols that are well known in the art.

The sequences encoding the toxins will be in different coding forms depending on the type of virus. For DNA viruses, the toxin is coded in the conventional manner, with the expression of the toxin dependent upon the virus-specific regulation of gene expression. For non-retro RNA viruses, the toxins are encoded either in the form of an antisense message, or in a form that will be transcribed as an antisense message within the infected cell, and converted to positive messenger RNA only in the presence of an infecting RNA virus. For single- stranded DNA viruses, negative DNA of the toxin construct may be converted into positive DNA using a virus-specific 3'-OH terminal sequence as a primer for DNA polymerase.

Method 1 Summary Method I is designed to impart transgenic cells, tissues, or organisms with the ability to prevent infection by DNA viruses. Most DNA viruses rely upon virus-specific gene regulatory mechanisms that use promoters and inducers to regulate viral gene expression. In Method I, virus-specific regulatory information that is identical to or functionally homologous with at least one viral nucleic acid regulatory region is used in a mechanism to kill cells promptly following infection by a virus. A gene encoding a toxin is placed under the control of a virus- specific regulatory sequence. In the absence of viral infection, these virus-specific regulatory sequences are not activated, and the toxin gene is not expressed. When viral infection occurs, the presence of a virus-specific inducer leads to expression of the toxin gene. The expressed toxin kills the infected cell, thereby terminating the infectious cycle of the virus.

Method 77 Summary Method II is designed for RNA viruses other than retroviruses. Method II may be used to treat infections by RNA viruses in transgenic or non-transgenic organisms. Method II may

also be used to impart transgenic cells, tissues or organisms with the ability to prevent infection by RNA viruses. Method II may be used against any virus whose replication is based on RNA, i. e., any virus wherein an RNA template is used to replicate RNA, including negative-stranded RNA viruses, positive-stranded RNA viruses, and double-stranded RNA viruses (such as reoviruses). In this method, an otherwise non-functional antisense code or negative message for a toxin is transcribed by a virus-specific enzyme, RNA-dependent RNA polymerase, resulting in a functional, positive message that can be translated to a toxin by the cell's ribosomes. All RNA viruses (other than retroviruses) rely upon RNA-dependent RNA polymerase to convert negative or antisense RNA into positive or messenger RNA, the form that can be translated into peptides or proteins. Those RNA viruses with an antisense RNA genome also carry this enzyme within the virion. With RNA viruses that use either double- stranded RNA or single-stranded (i. e., messenger) RNA as their genomes, the RNA-dependent RNA polymerase is encoded in the viral genome. The RNA-dependent RNA polymerase either must be expressed by the host cell, or it must have been previously packaged in the virion, in order for the viral genome to replicate. In the absence of viral infection, RNA-dependent RNA polymerase is not present in a cell, so the antisense code for the toxin is not translated.

However, during infection by a non-retro RNA virus, the antisense toxin message is converted into positive sense RNA, or messenger RNA, by the RNA-dependent RNA polymerase. The positive or messenger RNA is then translated to yield the toxin, thus killing the infected cell prior to formation of viral progeny, and thereby terminating the infectious cycle.

Method 111 Summary Method III targets primarily viruses such as retroviruses and parvoviruses that use a virus-specific nucleic acid sequence as a primer to initiate the copying of a single-strand viral genome. Method III is used to treat existing viral infections. The primer is needed because DNA-dependent DNA polymerase requires a primer with an available 3'-OH to function, as does the retroviral polymerase (reverse transcriptase). In this Method, toxins are encoded in negative single-stranded DNA flanked in the 3'direction by one or more regions complementary to the 3'end of the nucleic acid of the targeted viruses. A virus-specific primer (e. g., the 3'terminal end of the viral nucleic acid) anneals to such a region, initiating copying of the negative DNA, thus producing a strand of positive DNA encoding the toxin.

The positive strand is then transcribed to form the functional RNA message of the toxin, which is in turn translated into toxin, which kills only the infected cells.

Method III is intended for the treatment of virus-infected cells, rather than for the creation of transgenic resistant cells or organisms. The negative strand toxin coding sequence,

with a site to hybridize with the 3'-OH region of the virus nucleic acid and other complementary sequences necessary for transcription and translation, can be produced in large amounts for therapeutic purposes through means known in the art, for example by using single- stranded PCR. See, e. g., F. M. Ausubel et al. (Eds), Current Protocols in Molecular Biology, vol. 2, Chapter 15 ("The Polymerase Chain Reaction") John Wiley and Sons (Wiley Interscience) (1999).

MODES FOR CARRYING OUT THE INVENTION Method I Method I is designed to impart transgenic cells, tissues, or organisms with the ability to prevent infection by DNA viruses. Method I uses a gene that encodes a toxin, and that is placed under the regulatory control of a virus-specific promoter. Activation of the virus- specific promoter depends upon the presence of a virus-specific inducer. Productive DNA virus infections of host cells typically require the activation of at least one virus-specific promoter by a virus-specific inducer. If another copy of the same promoter (or a closely homologous promoter) is present in the cell's genome and is linked to a sequence encoding a toxin, then when the virus-specific inducer is produced--as it must be to attempt a productive cycle of virus replication--that inducer will also activate production of the toxin. In the absence of the virus-specific inducer, the gene encoding the toxin remains silent, and the toxin is not produced. It will be readily appreciated by those of skill in the art that this method is broadly applicable to prevent infection by any DNA virus that uses a virus-specific mechanism of gene expression. In sharp contrast to"DNA vaccines"or"RNA vaccines,"which use virus- specific sequences of nucleic acids to modulate conventional immune mechanisms, this invention uses virus-specific sequences to directly activate or allow the expression of a toxin to kill a virus-infected cell.

By way of example for Method I, a virus-specific promoter is linked to a sequence encoding a toxin as a mechanism to kill virus-infected cells. This genetic construct is introduced into host cell genomes (or otherwise stably maintained in the cell, e. g., as an episome), where it remains inactive unless viral infection occurs. Following viral infection, the virus-specific promoter is activated by the virus-specific inducer, the toxin is produced, and the infected cell is killed before the virus can replicate. Viral infection may be halted long before the conventional immune system even becomes"aware"of the presence of an infection, and before any symptoms of disease are exhibited. Method I can be particularly useful for preventing infections by viruses that are responsible for persistent or chronic infection. This toxin construct can be introduced into the germ lines of plants and non-human animals to

become a permanent part of the genome, or into progenitor cells of tissues (e. g., hematopoietic stem cells) in humans to provide longer lasting protection.

By way of further example for Method I, a DNA viral promoter is linked to a sequence encoding a toxin as follows. Either an immediate-early promoter or an early promoter from Herpes Simplex I (HSV-I) is used as the regulatory sequence. For example, a functional subunit of the promoter for viral protein ICP4 (an immediate early promoter, also called IE175) from GenBank accession number X06461, bases 843-1202 (D. McGeoch et al. (1986) ; G.

Byrne et al. (1989) ; U. S. Patent 5, 221, 778) is linked to DNA encoding a toxic peptide, e. g. hecate, or phor21 (a highly lytic, designed peptide), followed by appropriate stop codon and polyadenylation signals downstream. The complete DNA sequence of this prototype example targeted against herpesviruses is listed below as SEQ. ID NO. 2. Incorporated into a plasmid delivery vector, this construct is delivered to a cell or to an animal genome, where it would be idle in the absence of viral infection. Upon infection of a cell containing this construct by HSV-1 (or other herpes virus), the ICP4 promoter is induced to begin expressing the toxic peptide at the same time the infecting virus attempts to initiate the expression of wild-type ICP4 protein. Expression of the toxin causes cell death very early in the virus replication cycle, preventing the formation of mature virions. The infection ends almost as soon as it begins.

This construct should, at a minimum, be effective against the following herpes viruses : herpes simplex I, herpes simplex II, varicella zoster virus, pseudorabies, bovine herpes virus, equine herpes virus, and Marek's disease.

Virus-Specific Regulatory Sequences for use in Method I.

In Method I, the promoters used are not normally present in the host, but instead are promoters specific to viruses. These virus-specific promoters are activated only in response to infection of a cell by a virus using the same inducer/promoter mechanism of gene regulation, or a mechanism with sufficient homology to cross-react (a fairly common circumstance among viral regulatory sequences, as discussed further below). A gene product of the virus is required to induce or activate the promoter to allow transcription of the code.

Virus-specific promoters often have very strong activity. In native viruses they function to induce the production of large amounts of gene product as part of the replication cycle of the virus. The efficiency of many virus-specific promoters has made such promoters common choices in cloning/expression technologies where large amounts of expressed product are desired. One commonly used virus promoter is the very late bacculovirus promoter, which is responsible for the production of the inclusion bodies or polyhedra that accumulate in the form of a protein crystal surrounding the newly produced mature bacculovirus. See V.

Lucklow,"Bacculovirus systems for the expression of human gene products,"Curr. Opin.

Biotech., vol. 4, pp. 564-572 (1993) ; L. Miller,"Bacculoviruses : high level expression in insect cells,"Curr. Opin. Genet. Dev., vol. 3, pp. 97-101 (1993). Two proteins, plO and polyhedrin, both under the control of the very late bacculovirus promoter, are required to form the polyhedra. The very late bacculovirus promoter is commonly used to express the products of foreign genes cloned in insect cells such as Spodopterafrugiperda (Sf9). See, e. g., Choi, 1996. Genes encoding both natural and designed lytic peptides have been cloned into the bacculovirus genome under the control of the late bacculovirus promoter, and have been expressed to produce lytic peptides (Hellers et al., 1991 ; Choi, 1996). The bacculovirus system is an excellent example of the use of virus-specific regulation to drive the expression of genes, including those encoding toxins such as lytic peptides. The very late regulatory function used in this expression system is activated after many infectious virions have been formed, providing additional modified viruses to continue the process. Early expression of toxic compounds would terminate the infectious cycle and limit the yield of the desired expressed products. These bacculovirus results demonstrate that genes encoding toxins, including both naturally occurring lytic peptides and designed lytic peptides, can be effectively expressed using a virus-specific promoter. A significant difference between this prior work and the present invention is that the goal of the present invention is to kill the infected cell prior to the formation of mature virions rather than to produce large quantities of the peptide. If the goal is preventing the establishment of infection, then an earlier virus-specific promoter should be used instead of the very late promoter disclosed by Hellers et al. (1991) and Choi (1996). For applications aimed at terminating persistent infection by non-lytic viruses (Ahmed, R. et al.

1996), either an early or a late virus-specific promoter should have similar effectiveness to end the persistent state. Although bacculoviruses are best known as insect viruses and as laboratory tools, they are also major pathogens of cultured shrimp (Loh, P. C. et al. 1997).

Literature searches were conducted to identify virus-specific promoter sequences from representatives from different virus families. The results are included in Table II (below), which also includes RNA replication promoters useful in Method II. The promoter sequences reported in Table II should suffice to cover many viruses of medical, veterinary, and agricultural significance due to sequence homology, as discussed below. The different viruses may be classified into"treatment groups"accordingly.

For many viruses, complete genetic sequences are publicly reported (e. g., GenBank, the genetic sequence database operated by the National Institutes of Health). Cloning techniques are now routinely used for both DNA and RNA viruses. Many cloning vectors, including

signals essential for gene expression such as ribosomal binding sites, and encoded instructions for polyadenylation of messages are commercially available. In addition, methods for producing transgenic cells, animals, and plants are now common in the art. The invention may be carried out with laboratory techniques commonly used in the art today (albeit the techniques have previously been used for other purposes).

Because much fundamental research on the molecular biology of viruses has been published, and because many viral genes of interest are already cloned into bacteria and cells, in many cases the time-consuming procedures that would otherwise be required to generate constructs of interest may be reduced significantly. For example, a good source of cloned viral genes is the American Type Culture Collection (ATCC, Manassas, Virginia). Useful vectors and cloning vehicles are available either by purchase from any of a number of biotechnology reagent companies, or by donation from university or government research laboratories.

Although it is preferred to practice Method I with more-or-less precisely defined virus- specific promoters such as those described in Table II, there are alternative approaches that permit the practice of the invention where the precise portion of a viral nucleic acid sequence constituting such a promoter has not been identified, or even where no sequence data at all currently exist.

Alternative 1 Where sequence data for a virus exists, but where that portion of the sequence constituting the promoter for a particular early gene has not been precisely identified, the promoter will be included if a sufficiently large number of bases upstream of the transcription initiation site are ligated to a sequence encoding the toxin. The fact that"extra"bases may also be included in addition to the promoter is acceptable, even if those"extra"bases might have the effect of down-regulating the promoter under certain circumstances. Even where such down-regulation may exist, the toxin gene will still be expressed when the corresponding early native viral gene is expressed, as both will be under the control of the same regulatory elements. The number of upstream bases needed to encompass a particular promoter may readily be determined in a particular case, and for the reasons just given, the precise number of bases is not crucial. In general, sequences of 500, 1000, or 1500 bases upstream from the transcription initiation site should suffice in most cases.

Alternatives 24 Even where no information is previously available concerning the nucleotide sequence of a particular virus or its promoters, it is still possible to isolate and clone DNA segments containing suitable early promoters from the virus, and to link them to sequences encoding toxins in accordance with the present invention. If desired, it is always possible to sequence such regulatory elements after they have been isolated and cloned as described below.

Existing published information on virus-specific promoters is of three types. (1) For some commonly-studied viruses many of the promoter sequences have been reported, and may be used directly in the practice of the present invention. (2) For some viruses, available data indicate that expression of viral proteins is regulated by virus-specific promoters, but the sequences are currently unknown. (3) For many viruses, available data are too limited to provide much of a guide, except by analogy and inference based on related viruses whose promoter functions are known. For the second and third categories, techniques such as the following illustrative alternatives may be used to isolate and clone appropriate regulatory regions and link them to toxin genes : Alternative 2. Viral DNA is randomly digested with a restriction enzyme recognizing 4 bp sites. The digest is timed to yield nucleotide fragments in the 1000 bp range. The digested viral genome can be size-fractionated on a sucrose gradient ; then 0. 5 mL fractions are harvested and analyzed by agarose gel electrophoresis. The fractions yielding the majority of products in the 1000 bp range are purified by dialysis to remove the sucrose, and the DNA is then concentrated by standard procedures known in the art. For example, the restriction enzyme used is Sau3A I (a 4-bp cutter). The fragments are cloned into a plasmid vector containing a sequence coding the desired toxin. The fragments are cloned upstream of the toxin sequence into a BamH I site ; BamH I has a 6 bp recognition sequence, but the 4 bp overhanging sequence generated is the same as that of Sau3A I, allowing sticky-end ligation to occur. The new plasmid construct is then transformed into E. coli for propagation ; the DNA is harvested and used to transform appropriate cells in 96-well plates. Each well may be challenged with the virus and screened for cell lysis or death. Non-transformed cells infected with the same virus are used as controls. Cells expressing the toxin upon viral infection should lyse (or die) more quickly than cells that lyse due to the normal viral infection cycle. By correlating wells exhibiting rapid lysis to the E. coli colony from which the DNA came, the plasmid containing the viral promoter may be identified. By careful timing and observation, this system allows the determination of viral promoters used early and late in the viral cycle.

Confirmation can be obtained, for example, by assay with antibodies against the toxin to

confirm expression of the toxin and to determine the timing of that expression. This approach may be used generally to clone any promoter from any virus. For details of the protocols used, see F. M. Ausubel et al. (Eds), Current Protocols in Molecular Biology, vols. 1-3, John Wiley and Sons (Wiley Interscience) (1999) ; and T. Maniatis et al. (Eds.), Molecular Cloning : A Laboratory Manual, vols. 1-3, Cold Spring Harbor Laboratory Press (2nd ed. 1989).

Alternative 3. This alternative is similar to Alternative 2 above, except that a reporter gene is initially used in lieu of the toxin gene. The reporter gene could, for example, be the lacZ gene or another gene encoding p-galactosidase, which causes the development of a blue color in the presence of IPTG. Clones expressing the reporter gene only in the presence of viral infection are presumptively under the control of promoters responsive to a virus-specific inducer. The use of a reporter molecule can make initial screening easier. The clones identified as having a virus-specific promoter can then be used in practicing the invention. The reporter gene in the plasmid is replaced by a toxin gene (for example, the reporter gene is removed from the vector with an appropriate restriction enzyme, and a sequence encoding the toxin is ligated into the same location). The resulting construct may then be used in the present invention.

Alternative 4. This alternative is similar to Alternative 3 above, except that the reporter gene is directly and randomly inserted into the viral genome rather than into random fragments of that genome. Infected cells expressing the reporter gene are then candidates for appropriate virus-specific promoters. A second round of screening (as described for Alternative 2) is used to distinguish virus-specific from host-specific promoters.

Additional Examples for Method I The DNA virus to be used in the initial proof-of-concept experiments is the herpesvirus, both because of the importance of the herpesvirus family in causing diverse diseases in humans and animals, including cancers, and because a great deal is known about herpesvirus-specific regulatory mechanisms (Roizman, B., 1996 ; Roizman, B., and Sears, A. S., 1996).

A preferred vector for transforming a cell's genome is the transposon-based vector disclosed in Cooper, United States patent no. 5, 719, 055.

The herpesvirus-specific immediate early (IE) promoter and promoters may be used to drive the expression of foreign genes. Glorioso et al. (1995) reported using the herpesvirus IE promoter to drive expression of the lacZ gene to yield p-galactosidase, which is readily

detected in live cells by its ability to convert exogenously-supplied IPTG to a dark blue reaction product. When this construct is cloned into cells, the P-galactosidase marker gene is expressed only following infection with a herpesvirus, when viral replication will activate the IE promoter. In this manner infected cells can readily be identified by counting the colored cells. The prior efforts of Glorioso et al. were all devoted to keeping cells alive, either to study a herpesvirus function or to express a cloned product. By contrast, in accordance with the present invention one would substitute the lacZ reporter under regulation by the IE promoter with a gene encoding a toxin under regulation by the same IE promoter. Then a herpesvirus infection of any cell containing this construct in its genome (or otherwise stably maintaining the construct in the cell, e. g., as an episome) would result in the death of the cell prior to producing infectious viral progeny, promptly terminating the viral infection.

Between the insertion sequences of the transformation vector of Cooper, United States patent no. 5, 719, 055 will be inserted the 360 bp fragment of the HSV1 ICP-4 promoter previously described, ligated to a sequence coding the lytic peptide Phor21--i. e., the 21-mer (KFAKFAK) 3 (SEQ. ID NO. 1)--followed by an appropriate stop codon and polyadenylation signal sequence on the 3'-end. This promoter is an immediate early promoter that is among the first promoters activated in a cell infected by HSV1. This promoter will drive expression of the lytic peptide to cause cell death. The complete DNA sequence of this prototype example targeted against herpesviruses is listed below as SEQ. ID NO. 2.

If appropriate, these initial experiments can be repeated with other viruses and with other cell types, including for example plant, insect, arachnid, fish, crustacean, and human cells.

As another example, two of the first proteins translated from the parvovirus genome are NS 1 and NS2, which are downstream of a promoter (TATA box) at location mp4.

Evidence suggests that NS1, a large, nonstructural protein, trans-activates both regulatory and structural gene expression in different parvoviruses of various host species. For example, NS1 from the human parvovirus B19 has been reported to activate the p6 promoter, which in turn controls the transcription of all other B19 genes. Mice minute virus (MMV) NS1 trans- activates the p4 and p6 promoters. H1 NS1 trans-activates the p38 promoter. The MMV p38 promoter can be regulated in trans by either or both of the NS proteins. The NS2 nonstructural protein appears to regulate gene expression in a manner that depends on the cell type. See X. Li et al.,"The parvovirus H1 NS2 protein affects viral gene expression through sequences in the 3'untranslated region,"Virology, vol. 194, pp. 10 ff (1993). In an embodiment of the present invention, a sequence coding a toxin, e. g. phor21, is placed downstream of a promoter responsive to NS1, e. g., promoter p38 or p6, along with

appropriate stop codon and polyadenylation signals. The promoter/toxin construct is cloned into a delivery plasmid and used to transfect cells of an animal. Following infection of a transformed cell by a parvovirus, the protein NS1 is expressed early in the replication cycle.

NS1, in turn, activates the promoter controlling expression of the toxin. The toxin is expressed, and the infected cell is destroyed.

Method 77 By way of example for Method II, a strand of negative, or antisense, RNA complementary to a sequence encoding a toxin, complete with signals for virus RNA polymerase recognition and ribosome binding, is introduced into a cell, where it remains untranslated. In normal cells, a strand of negative, or antisense, RNA cannot be translated, so production of the toxin does not occur. Following infection with an RNA virus, the virus provides the RNA-dependent RNA polymerase necessary to convert the complementary toxin message to the translatable positive RNA, as the RNA polymerase performs its normal function of converting viral negative RNA into positive RNA. Translation of the message for the toxin results in death of the cell prior to formation of infectious progeny. Antisense messages can either be introduced into cells in the RNA form (in which case it would be preferred to cap the ends of the RNA to inhibit digestion by exonucleases), or they can be transcribed as antisense RNA intracellularly from complementary DNA sequences that are introduced into the cells or that are incorporated into the genome. Genetic information encoding the negative RNA message can be part of the genome under regulatory control such as low level constitutive production, or it can be transcribed in response to specific inducers such as stress inducers or interferons. Alternatively, that information could be encoded in a plasmid, or it could be introduced directly as linear or circular DNA or RNA.

In sharp contrast to established applications of antisense technology in which the antisense construct shuts down gene function, this use of an antisense message facilitates the production of a gene product, but only when a cell has been infected by an RNA virus.

As one example of the application of Method II, the 3'-terminal end of a rotavirus, such as porcine rotavirus strain OSU, comprising at least the terminal 26 nucleotides beginning with CC-3', is used as the promoter for RNA replication. M. Wentz et al.,"Identification of the minimal replicase and the minimal promoter of (-) strand synthesis, functional in rotavirus RNA replication in vitro,"Arch. Virol., vol. 12, pp. 59-67 (1996). The promoter is linked, i. e. ligated, to a (-) strand sequence encoding a toxin, including appropriate stop codon and polyadenylation sequences. This promoter/toxin construct sits dormant in the cell until

infection by a rotavirus (or related virus) occurs. Viral proteins encoding the RNA replicase recognize the promoter and begin transcribing the sequence to the (+) strand mRNA as a consequence of the viral replication process. The (+) strand mRNA is then translated into an active toxin peptide, e. g., hecate or phor21 (a highly lytic, designed peptide), resulting in cell death before mature infections virions are formed. The complete RNA sequence of this prototype example targeted against OSU rotavirus is listed below as SEQ. ID NO. 3.

Many families of important pathogenic viruses, including the influenza viruses of the family Orthomyxoviridae, use negative RNA as the genomic code (Murphy, 1996). When an RNA virus enters a susceptible host cell, the RNA-dependent RNA polymerase packaged with the virus, or encoded in the genome of the virus, converts negative RNA to positive RNA, an essential step to allow translation of the viral genes. If a negative RNA code for a toxin is also present, the same enzyme will convert the toxin code of negative RNA into positive or messenger RNA, which can then be translated to produce toxin, resulting in death of only the infected cell.

Table I lists some of the more important viruses from the class of single-stranded negative-sense RNA viruses. Table I was compiled from Murphy, F. A., 1996 and from "Classification and Nomenclature of Viruses,"Francki, Knudson, and Brown (Eds.) 1991.

Each of these viruses, like all non-retro RNA viruses, requires RNA-dependent RNA polymerase in order to replicate. Table I demonstrates the broad potential of Method II to kill cells infected by diverse single-stranded negative-sense viruses. (Note :"single-stranded" means that the nucleic acid polymers carried in the virion are not, in general, base-paired to complementary nucleic acid polymers. Some viruses have fragmented genomes, multiple nucleic acid polymers. Such fragmented genomes are considered"single-stranded"if they are not, in general, base-paired to complementary nucleic acid polymers.) Table I Examples of Single-Stranded Negative-Sense RNA Viruses

VIRUS FAMILY EXAMPLES IMPORTANT HOSTS Pararnyxoviridae Measles virus Humans Mumps virus Humans Parainfluenza virus Human & Non-human Animals Respiratory syncytial virus Humans Canine distemper virus Non-human Animals Newcastle disease virus Non-human Animals (fowl) Rinderpest virus Non-human Animals Rhabdoviridae Rabies virus Human & Non-human Animals Vesicular stomatitis virus Human & Non-human Animals Duvenhage virus Humans Infectious hematopoietic necrosis Non-human Animals (fish) virus Lettuce necrotic yellow virus Plants Potato yellow dwarf virus Plants Filoviridae Ebola virus Human & Non-human Animals Marburg virus Human & Non-human Animals Orthomyxoviridae Influenza viruses A, B, and others Human & Non-human Animals Bunyaviridae Bunyamwera virus Humans California encephalitis virus Humans Rift Valley fever virus Human & Non-human Animals Nairobi sheep disease virus Non-human Animals Hantaan virus Human & Non-human Animals Tomato spotted wilt virus Plants Sandfly fever virus Humans Arenaviridae Junin virus (Argentine hemorrhagic Humans fever virus) Lassa fever virus Humans

In other families of non-retro RNA viruses, the infecting genome is either in the form of positive-sense single-stranded RNA or double-stranded RNA. In order to replicate the viral RNA, copies of positive RNA must be generated from negative RNA templates using virus- specific RNA-dependent RNA polymerase, prior to packaging the genome as part of the maturation process. Examples of other single-stranded and double-stranded RNA viruses using this enzyme are given in Francki, Knudson, and Brown (Eds.) 1991 ; Murphy, F. A., 1996 ; and Fields, Virology, 1996. Due to this virus-specific requirement to convert negative RNA to positive RNA, a negative toxin message present in the same cell will also be converted to positive RNA, which will then be translated to yield the cell-killing toxin. This chain of events will occur only in a virus-infected cell. Therefore, a cell infected by any non-retro RNA virus is killed by the construct of Method II. The negative toxin message is otherwise benign.

The use of an RNA promoter (or RNA-dependent RNA polymerase recognition site) is important to Method II. Fortunately, these RNA promoter or recognition sequences tend to be highly conserved within genera and families of viruses, allowing broad protection with just a few different RNA promoters. In alternative embodiments to impart resistance to multiple viral families, different virus-specific promoters may be linked to toxin genes ; the promoters could be linked in tandem to drive the expression of a single sequence encoding a toxin ; or various promoter and toxin coding sequences could be linked in alternate fashion along the same nucleic acid polymer or on different nucleic acid polymers. Examples of specific RNA promoters are listed below in Table II, the references cited in Table II, and in the following references : Adkins, S. et al.,"Subgenomic RNA promoters dictate the mode of recognition by bromoviral RNA-dependent RNA polymerases,"Virology, vol. 252, pp. 1-8 (Dec. 1998) ; Brown, D. et al.,"Template recognition by an RNA-dependent RNA polymerase : identification and characterization of two RNA binding sites on Q beta replicase,"Biochemistry, vol. 34, pp.

14765-14774 (1995) ; Chapman, M. R. et al.,"Sequences 5'of the conserved tRNA-like promoter modulate the initiation of minus-strand synthesis by the brome mosaic virus RNA- dependent RNA polymerase,"Virology, vol. 252, pp. 458-467 (Dec. 1998) ; Deiman, B. A. et al.,"Minimal template requirements for initiation of minus-strand synthesis in vitro by the RNA-dependent RNA polymerase of turnip yellow mosaic virus,"J. Virol., vol. 72, pp. 3965- 3972 (May 1998) ; Fodor, E. et al.,"Photochemical cross-linking of influenza A polymerase to its virion RNA promoter defines a polymerase binding site at residues 9 to 12 of the promoter,"J. Gen. Virol., vol. 74, pp. 1327-1333 (1993) ; Frolov, I. et al.,"Alphavirus-based expression vectors : strategies and applications,"Proc. Natl. Acad. Sci. USA, vol. 93, pp.

11371-11377 (1996) ; Galarza, J. M. et al.,"Influenza A virus RNA-dependent RNA polymerase : analysis of RNA synthesis in vitro,"J. Virol., vol. 70, pp. 2360-2368 (1996) ;

Gardner, D. P. et al.,"Spatial and temporal regulation of a lacZ reporter transgene in a binary transgenic mouse system,"Transgenic Res., vol. 5, pp. 37-48 (1996) ; Guan, H. et al.,"RNA promoters located on (-)-strands of a subviral RNA associated with turnip crinkle virus,"RNA, vol. 3, pp. 1401-1412 (1997) ; Hill, K. R. et al.,"RNA-RNA recombination in Sindbis virus : roles of the 3'conserved motif, poly (A) tail, and nonviral sequences of template RNAs in polymerase recognition and template switching,"J. Virol., vol. 71, pp. 2693-2704 (1997) ; Jaspars, E. M.,"A core promoter hairpin is essential for subgenomic RNA synthesis in alfalfa mosaic alfamovirus and is conserved in other Bromoviridae,"Virus Genes, vol. 17, pp. 233- 242 (1998) ; Kao, C. C. et al.,"De novo initiation of RNA synthesis by a recombinant flaviridae RNA-dependent RNA polymerase,"Virology, vol. 253, pp. 1-7 (Jan. 1999) ; Levis, R. et al.,"Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription,"J.

Virol., vol. 64, pp. 1726-1733 (1990) ; Li, X. et al.,"Mutational analysis of the promoter required for influenza virus virion RNA synthesis,"J. Virol., vol. 66, pp. 4331-4338 (1992) ; Miller, W. A. et al.,"Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on (-)-sense genomic RNA,"Nature, vol. 313, pp. 68-70 (1985) ; Mori, M. et al., "mRNA amplification system by viral replicase in transgenic plants,"FEBS Lett., vol. 336, pp.

171-174 (1993) ; Mushegian, A. R. et al.,"Genetic elements of plant viruses as tools for genetic engineering,"Microbiol. Rev., vol. 59, pp. 548-578 (1995) ; O'Reilly, E. K. et al.,"Analysis of RNA-dependent RNA polymerase structure and function as guided by known polymerase structures and computer predictions of secondary structure,"Virology, vol. 252, pp. 287-303 (Dec. 1998) ; Parvin, J. D. et al.,"Promoter analysis of influenza virus RNA polymerase,"J.

Virol., vol. 63, pp. 5142-5152 (1989) ; Rabinowitz, J. E. et al.,"Adeno-associated virus expression systems for gene transfer,"Curr. Opin. Biotechnol., vol. 9, pp. 470-475 (Oct.

1998) ; Roberts, A. et al.,"Recovery of Negative-Strand RNA Viruses from Plasmid DNAs : A Positive Approach Revitalizes a Negative Field,"Virology, vol. 247, pp. 1-6 (1998) ; Seong, B. L. et al.,"Nucleotides 9 to 11 of the influenza A virion RNA promoter are crucial for activity in vitro,"J. Gen. Virol., vol. 73, pp. 3115-3124 (1992) ; Siegel, R. W. et al., "Sequence-specific recognition of a subgenomic RNA promoter by a viral RNA polymerase," Proc. Natl. Acad. Sci. USA, vol. 94, pp. 11238-11243 (1997) ; Siegel, R. W. et al.,"Moieties in an RNA promoter specifically recognized by a viral RNA-dependent RNA polymerase," Proc. Natl. Acad. Sci. USA, vol. 95, pp. 11613-11618 (Sept. 1998) ; Singh, R. N. et al., "Turnip yellow mosaic virus RNA-dependent RNA polymerase : initiation of minus strand synthesis in vitro,"Virology, vol. 233, pp. 430-439 (1997) ; Smallwood, S. et al.,"Promoter analysis of the vesicular stomatitis virus RNA polymerase,"Virology, vol. 192, pp. 254-263 (1993) ; Song, C.,"Requirement of a 3'-terminal stem-loop in in vitro transcription by an

RNA-dependent RNA polymerase,"J. Mol. Biol., vol. 254, pp. 6-14 (1995) ; Stawicki, S. S. et al.,"Spatial perturbations within an RNA promoter specifically recognized by a viral RNA- dependent RNA polymerase (RdRp) reveal that RdRp can adjust its promoter binding sites,"J.

Virol., vol. 73, pp. 198-204 (Jan. 1999) ; Tapparel, C. et al., The activity of Sendai virus genomic and antigenomic promoters requires a second element past the leader template regions : a motif (GNNNNN) 3 is essential for replication,"J. Virol., vol. 72, pp. 3117-3128 (Apr.

1998) ; van Rossum, C. M. et al.,"Functional equivalence of common and unique sequences in the 3'untranslated regions of alfalfa mosaic virus RNAs 1, 2, and 3,"J. Virol., vol. 71, pp.

3811-3816 (1997) ; van Rossum, C. M. et al.,"The 3'untranslated region of alfalfa mosaic virus RNA3 contains a core promoter for minus-strand RNA synthesis and an enhancer element,"J. Gen. Virol., vol. 78, pp. 3045-3049 (1997) ; Wang, J. et al.,"Minimal sequence and structural requirements of a subgenomic RNA promoter for turnip crinkle virus,"Virology, vol. 253, pp. 327-336 (Jan. 1999) ; Wang, J. et al.,"Analysis of the two subgenomic RNA promoters for turnip crinkle virus in vivo and in vitro,"Virology, vol. 232, pp. 174-186 (1997) ; Welsh, S. et al., Reporter gene expression for monitoring gene transfer,"Curr. Opin.

Biotechnol., vol. 8, pp. 617-622 (1997) ; Wentz, M. J. et al.,"Identification of the minimal replicase and the minimal promoter of (-)-strand synthesis, functional in rotavirus RNA replication in vitro,"Arch. Virol. Suppl., vol. 12, pp. 59-67 (1996) ; and Whelan, S. P. J. et al., "Regulation of RNA synthesis by the genomic termini of vesicular stomatitis virus : identification of distinct sequences essential for transcription but not replication,"J. Virol., vol. 73, pp. 297-306 (Jan. 1999).

Because negative or antisense genetic constructs are known to be useful to interrupt gene function in a variety of applications, including inhibition of viruses or cancers, and to determine the function of genes and gene products, they have been widely studied, and much is known about their manufacture and delivery. The same general techniques may be used to manufacture and introduce negative RNA toxin constructs into cells in accordance with the present invention. See, e. g., Guo and Kemphues, 1995 ; Montgomery and Fire, 1998 ; Tabara et al., 1998 ; US Pat. No. 5831069 ; US Pat. No. 5759829 ; US Pat. No. 5811537 ; US Pat. No.

5691317 ; US Pat. No. 5734039 ; US Pat. No. 5242906 ; US Pat. No. 5316930 ; Wagner, R. W. et al.,"Antisense technology and prospects for therapy of viral infections and cancer,"Mol.

Med. Today, vol. 1, pp. 31-38 (1997) ; Kilkuskie, R. E. et al.,"Antisense inhibition of virus infections,"Adv. Pharmacol, vol. 40, pp. 437-483 (1997) ; Caselmann, W. H. et al.,"Synthetic antisense oligodeoxynucleotides as potential drugs against hepatitis C,"Intervirology, vol. 40, pp. 394-399 (1997) ; Colacino, J. M. et al.,"The identification and development of antiviral agents for the treatment of chronic hepatitis B virus infection,"Prog. Drug Res., vol. 50, pp.

259-322 (1998) ; Gadani, F. et al.,"Genetic engineering of plants for virus resistance,"Arch.

Virol., vol. 115, pp. 1-21 (1990) ; Gibson, I.,"Antisense DNA and RNA strategies : new approaches to therapy,"J. R. Coll. Physicians Lond., vol. 28, pp. 507-511 (1994) ; Whitton, J. L.,"Antisense treatment of viral infection,"Adv. Virus Res., vol. 44, pp. 267-303 (1994) ; U. S. Patent 5, 616, 466 ; U. S. Patent 5, 866, 780 ; U. S. Patent 5, 811, 537 ; U. S. Patent 5, 849, 900 ; U. S. Patent 5, 834, 265 ; U. S. Patent 5, 798, 265 ; U. S. Patent 5, 610, 050 ; U. S. Patent 5, 821, 052 ; U. S. Patent 5, 712, 384 ; U. S. Patent 5, 665, 580 ; U. S. Patent 5, 849, 564 ; U. S. Patent 5, 580, 767 ; U. S. Patent 5, 316, 930 ; 5, 248, 670.

Although the use of negative genetic constructs for"antisense"applications is well documented, the exact mechanisms of"classical"antisense inhibition of gene function are not settled (Tabara et al., 1998). Using negative messages to encode toxins in RNA virus-infected cells in accordance with the present invention is quite distinct from the numerous documented applications of antisense constructs to inhibit gene function. In this embodiment of the present invention, antisense oligonucleotides are not used to inhibit gene function, but are instead used to encrypt the genetic codes of toxins in such a way that the toxins are expressed only in cells infected by non-retro RNA viruses. I. e., the negative message functions to produce a gene product, while the conventional use of antisense technology has been to inhibit production of a gene product.

The complementary sequence of the toxin message in Method II could, as one example, be contained as a complementary code within an otherwise functional (+) RNA strand coding another polypeptide ; which could be converted to a functional message for the toxin when the virus-specific RNA-dependent RNA polymerase synthesizes the complementary polymer. This variation could be useful if the efficiency of the RNA-dependent RNA polymerase is much greater for the composite (+) RNA than for the toxin-encoding (-) RNA alone.

Although Method II has been described with reference to RNA viruses, it will also work with DNA viruses that encode an RNA-dependent RNA polymerase, for example, the Hepatitis C virus, a hepadnavirus.

For treating virus infections in humans by Method II (as well as in Method III), it may sometimes be desirable to use an"indirect"or"conditional"toxin. An indirect or conditional toxin is a compound whose toxic effect depends on the presence of a second factor, typically an externally-administered pharmaceutical. For example, herpes virus thymidine kinase is itself non-toxic, but it generates a lethal toxin in the presence of a compound such as ganciclovir or acyclovir. The use of a conditional toxin such as thymidine kinase in Method II or Method III

could allow the fine-tuning of the treatment protocol. Ganciclovir and acyclovir are already approved for other uses in humans, and are considered to be safe.

Additional Examples--Method 11 Negative strand RNA viruses depend on RNA-dependent RNA polymerase (Rd-Rp) to replicate the viral genome to a (+) RNA strand before translation to yield viral proteins can occur. Many Rd-Rp recognition sites/promoters are on the 3'-end of the genome, with a critical base or multiple base sequence at that end of the genome, such as CC-3'in rotaviruses, that serves as an essential signal for replication of the viral genome. See Wentz, M. J. et al., "Identification of the minimal replicase and the minimal promoter of (-)-strand synthesis, functional in rotavirus RNA replication in vitro,"Arch. Virol. Suppl., vol. 12, pp. 59-67 (1996). Similar replication mechanisms are found in other RNA viruses such as the Flaviviridae (which includes viruses of humans and other animals). The Rd-Rp recognizes short templates on the 3'-end to initiate positive strand RNA synthesis. In the case of the pestivirus (flavivirus) bovine diarrhea virus (BVDV), the 21 nucleotides on the 3'-end contain the sequence that is recognized to initiate RNA synthesis. Although the precise mechanisms of the nucleotide sequence/RNA polymerase interaction are not yet known, it is known that the recognition sequences needed for polymerase activity are contained in this 21 nucleotide sequence. See Kao, C. C. et al.,"De novo initiation of RNA synthesis by a recombinant flaviridae RNA-dependent RNA polymerase,"Virology, vol. 253, pp. 1-7 (Jan. 1999). Other examples of 3'replication sequences are those of the vesicular stomatitis virus, the turnip crinkle virus, the influenza virus, and the alfalfa mosaic virus. See Whelan, S. P. J. et al., "Regulation of RNA synthesis by the genomic termini of vesicular stomatitis virus : identification of distinct sequences essential for transcription but not replication,"J. Virol., vol. 73, pp. 297-306 (Jan. 1999) ; Wang, J. et al.,"Minimal sequence and structural requirements of a subgenomic RNA promoter for turnip crinkle virus,"Virology, vol. 253, pp.

327-336 (Jan. 1999) ; Parvin, J. D. et al.,"Promoter analysis of influenza virus RNA polymerase,"J. Virol., vol. 63, pp. 5142-5152 (1989) ; Li, X. et al.,"Mutational analysis of the promoter required for influenza virus virion RNA synthesis,"J. Virol., vol. 66, pp. 4331- 4338 (1992) ; and van Rossum, C. M. et al.,"The 3'untranslated region of alfalfa mosaic virus RNA3 contains a core promoter for minus-strand RNA synthesis and an enhancer element,"J.

Gen. Virol., vol. 78, pp. 3045-3049 (1997).

A DNA plasmid vector will be constructed with a constitutive promoter controlling the transcription of a sequence that, when transcribed as mRNA, will have the first 30 bp from the 3'-end of the influenza virus genome linked to (-) strand mRNA for toxin. In the absence of

Rd-Rp, the (-) mRNA will persist in the cytoplasm for only a short time before being degraded.

Upon infection of the cell by an influenza virus (or other virus recognizing the same 30 bp 3' sequence), the Rd-Rp from the virus binds to the 30 bp site, the (+) strand mRNA is synthesized, and the cell's normal ribosomal machinery translates the encoded toxic peptide, killing the cell prior to the formation of mature virions.

Method III One embodiment of Method III includes a negative DNA sequence that is complementary to a sequence encoding a toxin, where the sequence also contains, in the 3' direction from the negative DNA toxin code, one or more sequences complementary to the 3'- terminal portion of a single-stranded DNA virus or of a retrovirus that uses single-stranded DNA as part of its infectious cycle. The negative-sense DNA may be delivered to cells via means known in the art, for example, via liposomes or via a modified negative-DNA virus delivery vector. This embodiment mimics the replication of negative-sense DNA viral genomes, in which a 3'-OH is provided by hybridization, to allow replication of the negative viral genome to form positive DNA. If a toxin is encoded in (-) DNA, a functional message cannot be produced unless the (-) DNA is first converted into (+) DNA. A primer with a free 3'-OH must hybridize to the (-) DNA toxin code before DNA polymerase will begin producing the corresponding (+) DNA. This primer can be provided by the 3'-terminal portion of the virus genetic code itself, with a complementary sequence in the (-) DNA located in the 3'- direction from the toxin code. Such terminal portions could include, for example, the RU region of the retrovirus genome (Coffin. J. M., 1996), or the terminal portion of a parvovirus genome (Berns, K. I., 1996). Only in a cell infected by a target virus will the essential primer be present (the 3'-terminal portion of the viral genetic code itself). Hybridization with the 3'- portion of the virus DNA allows complementary synthesis of the (-) DNA code to form the (+) DNA toxin code. Once the (+) DNA is synthesized to form a double helix with the complementary (-) DNA, the (+) mRNA for the toxin is transcribed and translated into toxin, thus terminating infection by killing the host cell. Method III may be used against ss (-) DNA viruses, ss (+) DNA viruses, and retroviruses. The complete (-) DNA sequence of a prototype example targeted against canine parvovirus is listed below as SEQ. ID NO. 4.

Further Example for Method III To demonstrate the effectiveness of method III, the SEQ. ID No. 5 (for Method I) construct will be modified by replacing the herpesvirus promoter with the commercially available cytomegalovirus (CMV) promoter, using standard techniques such as those found in

references such as Ausubel et al. (1999). The CMV promoter is a universal promoter for mammalian cells, resulting in high levels of constitutive transcription. Towards the 3'end of the CMV promoter, a sequence homologous to the 3'end of the single-stranded DNA canine parvovirus will be ligated to facilitate annealing with the native virus DNA. The 3'-OH end of the virus will anneal in position to initiate replication from the negative strand that encodes the toxin construct, to yield positive DNA. The host cell DNA-dependent DNA polymerase will then initiate the steps leading to transcription and translation of the active toxin. The negative DNA will be produced by single strand PCR using the positive strand of the construct as the template, according to the techniques described in Ausubel et al. (1999).

Animal Models Once the proof of concept has been demonstrated in vitro for the three basic Methods, the next experimental step will be in vivo testing, creating transgenic plants and animals that are non-permissive for specific viral infections. For example, mouse models for various human and animal diseases will be tested by introducing a herpesvirus-protective construct into the germ lines of mice.

As a model specific for agricultural applications, herpesvirus resistance will be introduced into chickens, which are susceptible to Marek's disease, caused by a type of herpesvirus. Furthermore, because Marek's disease results in tumors, the utility of this invention in preventing virus-associated cancers will also be demonstrated.

Additional tests will be conducted in bacteria and yeasts of economic significance ; and in plants and animals of agricultural significance or of significance as companion animals, including major crops such as wheat, rice, corn, barley, potatoes, soya, sweet potatoes, yams, and casava ; mammals such as cows, pigs, horses, sheep, goats, dogs, and cats ; insects such as bees ; and other animals such as fish (e. g., catfish, tilapia, salmon), insects (e. g., honeybees, silkworms), crustaceans (e. g., shrimp, crabs, lobsters, crawfish, prawns), and birds (e. g., chickens, turkeys, ostriches, and parrots).

Eventually, in compliance with applicable laws and regulations, the Methods will also be tested in humans.

Expected Barriers to Acquired Viral Resistance to the Novel Form of Immunity This invention is based on regulatory features and enzyme functions of viruses that are less likely to"drift"or to mutate in response to selective pressure than are those features of viruses that have been targeted by previous drug treatments or by vaccinations. The regulatory sequences of viruses tend to be highly conserved, as are the RNA polymerase function and the

polymerase recognition sequence. Sub-optimal levels of treatment are not likely to create selective pressures favoring treatment-resistant mutations, as has often occurred with other drugs such as chemical inhibitors, antibodies, or antibiotics. Also, because two separate factors are involved in Method I, the inducer and the promoter, both would have to develop compensatory mutations simultaneously in order to retain function and to evade the effect of the novel constructs. Simultaneous compensatory mutations in each of two factors are far less likely to occur than either would be alone. Furthermore, even if such a mutational event did occur, it would be relatively easy to identify the alteration, for example by sequencing the mutated promoter, and then to synthesize a new construct based on the mutated promoter, in accordance with the present invention. By contrast, it is extremely difficult, time-consuming, and expensive to identify the reason why a conventional drug has become ineffective and to redesign the drug accordingly.

Similarly, in Method II if the recognition sequence used by the RNA-dependent RNA polymerase mutated, the enzyme would also have to mutate simultaneously in order to recognize the new sequence.

The most variable characteristics of viruses are surface proteins that can be recognized by humoral and cellular immune mechanisms of the host. These regions can differ widely between genetically related viruses, and can even be diverse within populations of viruses originally derived from the same clone. The extensive diversity of surface proteins presents substantial obstacles to the successful development of vaccines, and also limits the ability of drugs to inhibit the functions of these ever-changing targets. By contrast to surface proteins, viral core proteins tend to be more stable genetically, and are conserved between related viruses to a much greater extent. Core proteins show some promise for vaccine development, because cellular processing can present core antigens on cell surfaces where they may be recognized by cell-mediated immune mechanisms. A substantial drawback to this approach is that mature, cell-free viruses cannot be inactivated by immune mechanisms directed against core antigens ; and mature viruses are often released prior to the destruction of the infected cell by immune mechanisms.

Virus-specific regulatory sequences that are never expressed as proteins are essential to the cycle of replication for many viruses. Because the regulatory sequences are not expressed, they are not attacked by the immune system or other defense mechanisms of host cells. Thus there has been no selective pressure for viruses to develop diversity in these sequences. Viral regulatory sequences tend to be highly conserved, both in sequence and function. See M.

Martin et al.,"Identification of a transactivating function mapping to the putative immediate- early locus of human herpesvirus 6,"J. Virology, vol. 65, pp. 5381-5390 (1991).

Regulatory regions are fairly resistant to mutation. In RNA viruses the RNA- dependent RNA polymerase, used in Method II of the present invention, could not readily mutate to lose its function without ending the ability of the virus to replicate. Although viruses do mutate in response to selective pressure from traditional antisense inhibition (Bull, J. J. et al.

1998), the virus could not readily eliminate the RNA-dependent RNA polymerase function without losing its ability to reproduce. Viral mutations are less likely to interfere with this new strategy of encrypting the genetic codes of toxins than for other methods of viral inhibition, including vaccinations, drug treatments, and conventional antisense inhibition of viral genes.

Protection Against Multiple Viruses with a Single Construct A single construct will often provide protection against different species of viruses, because regulatory functions are typically conserved within groups of viruses. The conservation of viral-specific functions, including gene regulation and RNA-dependent RNA polymerase functions, ensures that many constructs designed in accordance with the present invention will be effective against many different species of viruses.

This conservation of virus-specific sequences and functions enhances the utility of the prevention and treatment strategies of this invention, as viral infections can be prevented or treated even where the identity of a particular virus is unknown. For example, this invention can be used to prevent or treat infections caused by so-called"emerging"viruses, viruses that might be used as biological weapons, and"hidden"viruses contained in congeneric transplant tissues and organs, or in xenotransplants, even though the exact species of the virus may not be known.

It is feasible to have a single construct that would protect against several or many different classes of viruses, using several virus-specific mechanisms from diverse viruses, each controlling the production of a toxin, and each functioning independently of the others.

Some Applications of the Invention This invention may be applied to prokaryotic or eukaryotic cells, including germ cells and somatic cells of plants and animals. Applications include introduction of a construct in accordance with the present invention into the germ lines of agriculturally significant plants and animals or companion animals to produce virus-resistant breeds ; or introduction into somatic cells of humans, other animals, or plants to prevent or treat viral infection. For example, hematopoietic stem cells of a patient could be transformed with a construct in accordance with the present invention and then transfused back into the patient. The patient will then have a "reservoir"of non-permissive cells. Alternatively, the construct could be introduced in vivo or

ex vivo into a patient's cells, for example via liposomes or other carriers containing transformation vectors known in the art, for example the high-efficiency transformation vector of Cooper, United States patent no. 5, 719, 055, to introduce the construct into both infected and uninfected cells of the patients. Active replication of a virus (whether in a previously infected or a previously uninfected cell) would trigger the toxin and result in the death of the cell prior to release of mature virions, preventing (or at least reducing) further spread of the virus.

Alternatively, in some instances it may be desirable to introduce a construct in accordance with the present invention only temporarily, and not have the construct incorporated into the genome. For example, in a method for in vivo treatment of humans, this approach may be desirable to ensure that the construct is not incorporated into the germ line. In such a case, the DNA construct without any of the flanking sequences necessary to promote incorporation into a chromosome may be introduced into cells by a high efficiency vector such as a liposome.

Other applications in somatic cells will include the introduction of constructs in accordance with the present invention into subdermal or mucosal tissue to generate virus- resistant skin cells or mucosal cells. Transient transfection, e. g., with plasmids that do not integrate into the genome, may be used to cure viral infections, or progenitor cells may be permanently transformed.

In addition to protecting plants and animals from viral infections, there can be instances where it is desirable to protect yeasts or even prokaryotes from viruses. For example, there are many industrial uses of bacteria (transgenic or non-transgenic) to produce useful products.

There is a need to protect such cultures from bacteriophage that can reduce yields by killing or otherwise interfering with the efficiency of the culture. Phage sometimes cause the production of compounds that are toxic for humans. Limiting the transmissibility of bacteriophage within certain populations of bacteria can be desirable. See, e. g., Kim, S. G. et al.,"Bacteriophage resistance in Lactococcus lactis ssp. lactis using antisense ribonucleic acid,"J. Dairy Sci., vol.

75, pp. 1761-1767 (1992).

Toxins Suitable for Use in the Present Invention Any of a number of toxins may be used in the present invention. Preferably, a toxin should have the following characteristics : (1) As appropriate, depending on which Method is used, the toxin should be capable of being readily produced either under the regulatory control mechanisms of a virus- specific promoter ; or from messenger RNA after conversion from antisense RNA ; or from negative single-stranded DNA after conversion to positive DNA using viral

nucleic acid as a primer, for example under the control of a constitutive promoter in the last case. For example, a suitable toxin may be one of the many toxic peptides known in the art.

(2) The toxin should be capable of killing an infected cell prior to release of mature virions or capable of killing persistently infected cells.

(3) The toxin should not kill uninfected cells, whether or not they contain the construct, and whether or not an uninfected cell is near an infected cell that is killed by expression of the construct.

There are numerous toxins from plants, animals, and bacteria satisfying these criteria.

For example, there are many bacterial toxins that use an A/B subunit motif, in which the A subunit is toxic once it enters a cell but has no ability to cross cell membranes unassisted, and in which the B subunit (or multi-subunit complex) binds to cells but has no toxicity on its own.

The A subunit, even when injected systemically, is non-toxic. See, e. g., Balfanz et al., 1996 ; Middlebrook and Dorland, 1984. Nucleic acids coding for the A or active subunit could be used in this invention because the A subunit will already be inside the cell when it is produced, so it will not be necessary to include sequences coding for the B or cell-binding component.

The A subunit will kill the cell in which it is expressed, but will not damage other cells when released by cell lysis because the A subunit could not gain access to the interior of other cells.

Examples include the A subunit of cholera toxin, which destroys ion balance, and the A subunit of diphtheria toxin, which terminates protein synthesis. Other toxins comprise a single peptide chain having separate domains, where one domain functions to enable entry into the cell and a second domain is toxic. Such a multidomain peptide toxin could be truncated, using genetic engineering to produce a construct that only codes for the toxin domain. Use of a truncated toxin that is only expressed within infected target cells, and that cannot enter other cells, avoids the problem of general toxicity with respect to nontarget cells. One example of a truncated toxin that has been used in other systems to kill artificially targeted cells is the truncated form of exotoxin A from Pseudomonas aeruginosa (Brinkman et al., 1993, Pastan and FitzGerald, 1991, and Wels et al., 1995) The commonly used ricin toxin from plants also uses this same type of A/B subunit motif. Lee, H. P. et al.,"Immunotoxin Therapy for Cancer,"JAMA, vol. 269, pp. 78-81 (1993).

With such"catalytic"toxins, very few toxin molecules--even as few as a single molecule--would need to be expressed to kill an infected cell. A potential problem with such

a potent"catalytic"toxin is that the system would not tolerate any"leakiness"of transcription, so the use of such highly potent toxins may be limited to expression systems where leakiness in regulation does not occur at all, to the application of antisense nucleotide sequences encoding toxins, or to particular circumstances such as the treatment of existing potentially terminal conditions. Despite these potential concerns, it is worth noting that catalytic toxins such as diphtheria toxin A polypeptide have been successfully used (in another context) to selectively kill cell lineages in transgenic mice without evidence of non-specific"leakiness."See R.

Palmiter et al.,"Cell lineage ablation in transgenic mice by cell-specific expression of a toxin gene,"Cell, vol. 50, pp. 435-443 (1987).

Leakiness of transcription is not expected to be a major problem using viral promoters other than those from retroviruses. However, other classes of"non-catalytic"peptide toxins may be more appropriate for general use, because a small degree of"leakiness"in transcription would not be lethal. But when expressed in large numbers following virus-specific induction, the toxin molecules would kill the virus-infected cell. The class of peptides called"lytic peptides,"or"antimicrobial amphipathic peptides,"is preferred. These peptides are relatively small, generally containing 20 to 50 amino acids (or even fewer), and are capable of forming an amphipathic alpha helix in a hydrophobic environment, wherein at least part of one face is predominantly hydrophobic and at least part of the other face is predominately hydrophilic and is positively charged at physiological pH. Such structures can be predicted by applying the amino acid sequence to the Edmundson helical wheel (Schiffer and Edmundson, 1967). In addition to their small size, such peptides are widely distributed in nature and vary significantly in toxicity. They can also be designed to possess different levels of lytic activity. Many of these toxins are inactivated by serum factors, and cause systemic tissue damage only when present in high concentrations. Typically, when applied to cells in culture, a few micrograms per mL are required to kill the cultured cells. The level of toxicity of lytic peptides is determined by the amino acid composition and sequence. Different peptides can have widely differing levels of toxicity. In addition, relatively few molecules should be needed to kill a cell if the cell produces the molecules internally. A further discussion of lytic peptides suitable for use in this invention appears below.

Cloning of lytic peptide genes.

Due to the role played by lytic peptides in nature, especially to protect against bacterial infections, the production of lytic peptides by various cloning technologies has been widely investigated and published. A consistent finding of workers who have attempted to express lytic peptides by cloning is that the lytic peptides kill the cells expressing the cloned lytic

peptide gene, thereby seriously reducing product yields. In nature most lytic peptides are produced with signal sequences directing the product to be stored in membrane-bound vesicles, to be secreted on mucosal surfaces. Investigators have overcome this"killing problem"either by using mechanized peptide synthesizers, or by generating fusion proteins that are non-lytic until the lytic domain has been cleaved from the carrier domain. See, e. g., Piers, K. L., Brown, M. H., and R. E. W. Hancock, 1993.

In this context, the killing of the cell producing the cloned lytic peptide has been viewed as an unwanted consequence, resulting in failure of the experiment. By contrast, in the present invention the killing of cells that produce the cloned lytic peptide does not represent a failed experiment, but rather is the desired response to viral infection.

Successful cloning and expression of various lytic peptides in cultured cells, in plants, and in animals is well documented See, e. g., Gudmundsson et. al. 1991 ; Cooper and Enright, United States patent application serial number 08/491, 609, filed June 7, 1995 and affidavits submitted therein ; and United States patent no. 5, 556, 782. Recently, genes encoding lytic peptides, under the control of promoters inducible in response to bacterial endotoxins, have been successfully cloned into catfish and shown to be functional to produce the lytic peptide in response to endotoxin. Cooper and Enright, United States patent 5, 998, 698, and affidavits submitted therein. Genes encoding lytic peptides have also been successfully genetically engineered into plants. See Hightower et. al., 1994 ; Allefs et. al., 1995 ; Florack et. al., 1995 ; Jaynes et. al. 1993 ; and United States patent nos. 5, 597, 946 and 5, 597, 945.

Implementing the Invention without Introducing Genetic Codes for Exogenous Peptides into an Organism In some circumstances it may be desirable to avoid introducing genes encoding foreign peptides or proteins into an organism, and yet achieve the important advantages of this invention in protection against or treatment of viral infection. This goal may be accomplished by using indigenous genes of the host. For example, many gene products of a cell would be toxic to the cell, except that they are contained within cytoplasmic compartments such as granules or lysosomes, or are secreted from the cell. These toxic products are normally directed to the appropriate destination by signal sequences. By deleting the signal sequence for packaging or export,"indigenous"genes may be converted into genes encoding toxins that may be used in the present invention. To illustrate, all animals apparently produce various kinds of lytic peptides. Such indigenous peptides may be used in the treatment of viral infections in accordance with the present invention. For example, to use such an indigenous peptide in the treatment of Method I, a virus-specific promoter would be linked to a sequence encoding such

an indigenous lytic peptide, but devoid of the signal sequence normally used with the peptide.

Thus the only new genetic element introduced into the cell is a promoter of a target virus.

Promoters are neither transcribed nor translated, so no foreign peptide or protein is ever expressed in the course of protecting the cell from viral infection.

Application to Virus-Associated Cancers and to Treatment of Persistent Viral Infections.

The role of viruses in cancers has received much attention over the years. For reviews see"The Molecular Biology of the Gene"Watson et al., 1987 ; see also Nevins and Vogt, 1996. In animals, many different viruses are known to transmit cancers ; these same viruses are also sometimes secreted from the cancers they induce. In humans, several viruses are known to be associated with cancers, or to cause cancers. See Watson et al., 1987 ; Nevins and Vogt, 1996 ; Villa, 1997 ; Boshoff and Weiss, 1997 ; Palefsky et al., 1997 ; Porter and Kumar, 1998 ; Kuwano et al., 1997. A difficulty in proving causality in humans is that the viruses often associated with and expressed from tumors can also be found in non-cancerous cell types, as well as in individuals without symptoms of cancer. In using the present invention to treat virus-associated cancers, it does not matter whether the virus actually induced the cancer or is just growing there : if the virus uses virus-specific mechanisms to induce virus-specific genes, then the virus-infected cells of the cancer can be destroyed by the present invention.

Furthermore, because many types of cancers are preceded by persistent viral infections (Ahmed et al., 1996 ; Villa, 1996), as is often the case for liver cancers or cervical cancers, this novel method of killing infected cells has the potential to end the persistent state of viral infection prior to formation of cancers. Thus the risk of developing the cancer is reduced, in addition to the direct health benefits of terminating the persistent infection. Persistent viral infections generally, both from DNA and RNA viruses, are extremely difficult to prevent or treat with current vaccines or drugs, and remain essentially incurable to date, resulting in a heavy disease load and causing considerable suffering within the human population (Ahmed et al., 1996).

The novel methods of the present invention have the potential to alleviate many of the problems of curing persistent viral infections.

Most of the RNA cancer-causing or cancer-associated viruses appear to be closely related to one another genetically. Therefore it is likely that a single construct or a small number of different constructs will suffice to treat a wide variety of RNA virus-based cancers.

Unlike current drug-or radiation-based cancer treatments, which are also toxic to non- cancer cells, the use of the present invention is non-toxic to any cell that does not contain the

virus-specific regulatory sequences or enzymes exploited by the present invention.

Additionally, it is not necessary--although it is certainly possible--to selectively target the toxin to the cancer cells ; either way, the toxin would be expressed only in infected cells containing the virus-specific inducers.

Public Health Applications.

The modification of non-human germ lines to prevent viral infections has potentially broad (though sometimes indirect) implications for public health. See Gubler, 1998. The invention will, for example, be applied to modifying insect or arachnid vectors of viral diseases. The state of the art in manipulating insect genomes is quite advanced. Previous attempts to modify mosquitoes to be non-permissive for human pathogenic viruses have successfully reduced virus loads in the vector (Powers, 1996) ; and in a few cases have eliminated the ability of the vector to transmit the virus, albeit through the use of complex methods of double infections that are not likely to be applicable in the field.

The genetic additions introduced by the present invention are relatively small, and are not even expressed unless a mosquito (for example) is infected by the target virus. Because such viruses have a negative effect upon their vectors, including this construct in the vector's genome should actually give the genetically modified vectors a slight selective advantage in competition with their unmodified counterparts. Replacing virally permissive vectors with resistant vectors could have an important impact on human health, both in developed nations and in developing nations. Mosquitoes could be made non-permissive for viruses that require a virus-specific regulatory sequence for replication. Examples of mosquito-borne viruses that may be controlled through the present invention include the viruses responsible for yellow fever and dengue fever. See, e. g., K. Olson et al,"Genetically engineered resistance to Dengue-2 virus transmission of mosquitoes,"Science, vol. 272, pp. 884-886 (1996).

Alternatively, if imparting virus resistance gave a transformed mosquito species too great a selective advantage over other mosquito species in an area, it might instead be advantageous to impart that resistance not to a mosquito species that acts as a vector of human disease, but to a mosquito species that is not a vector of human disease, thereby allowing the latter to out- compete the former.

As another example of a public health application, the influenza virus is known to infect domesticated animals, particularly pigs, ducks, and chickens ; and to recombine or mutate in those animals to make new strains that are infectious in humans. The development and spread of new influenza viruses could be reduced by making pigs, ducks, and chickens non- permissive to the influenza virus in accordance with Method II.

It is possible that the present invention could reduce the application of insecticides on crops. In some cases, the damage to crops following predation by insects is largely due not to the direct effect of feeding by the insects, but to the effects of viral pathogens carried by the insects. If a crop plant were made non-permissive to viral infection in accordance with the present invention, then the need to control at least some insect pests would be reduced, thereby reducing the use of pesticides on the crop.

Prior Successes Demonstrating the Likelihood of Success of the Present Invention Prior work from the laboratories of my colleagues allows the prediction of a high likelihood of success for in vivo and in vitro trials to be conducted in the future. In particular, my colleagues have achieved prior successes using lytic peptides for other purposes, and have also achieved a high success rate for gene delivery for other purposes.

Prior Work using Lytic Peptides for Other Purposes.

Several of my colleagues are actively working on various aspects of lytic peptide design and function for various therapeutic uses in human and veterinary medicine. The majority of this work has been conducted using synthesized peptides tested on cells in vitro or in vivo by intravenous, intramuscular, or intraperitoneal injection. After an appropriate peptide has been identified (such as Phor21), a gene coding for that peptide has been synthesized and cloned downstream of an appropriate promoter and upstream from an appropriate polyA termination sequence. (Where needed for a particular application, prepro-sequences have also been incorporated for cell export of the mature peptide.) This approach has allowed the development of plasmids containing lytic peptides proven to work in a cell or an animal system.

Prior Work on Gene Delivery for Other Purposes One of my colleagues has also had considerable success with gene delivery. To increase the efficiency of stable gene delivery into a recipient chromosome, a plasmid vector was designed to force incorporation of the desired transgene into a recipient chromosome. Prior to this work, the stable incorporation of a transgene relied on homologous recombination of a transgene into the recipient chromosome, which occurs at a very low frequency in most systems. Building on experience with transposon-based systems for bacteria, a plasmid was constructed to contain a mini-transposon. A"mini-transposon"is one in which the transposon's insertion sequences have been shortened to prevent unwanted homologous recombination, and in which the transposase has been removed from between the transposon

insertion sequences to an upstream position under control of an inducible promoter. The result is two-fold : 1) expression of the transposase can be controlled, and 2) once the transposon carrying the desired gene has been delivered to a recipient chromosome, the remainder of the plasmid is destroyed, which prevents future transposition events from occurring, since the transposase is lost with the rest of the plasmid. The first gene transformed using this transposon system was that encoding the lytic peptide cecropin B under control of an acute phase promoter, both originating from the giant silk moth Hyalophora cecropia. The plasmid carrying the transposon system was named pCep90 (carrying the native cecropin B gene plus 2 kilobases of moth DNA flanking the gene on either side, for a total of 5. 9 kbp of insert between the insertion sequences). A streamlined version of pCep90 was also prepared, named pPC6, modified to include only 1. 8 kbp of the cecropin B gene between the insertion sequences. (The 2 kbp flanking each side of the cecropin B gene were removed).

Many successful genetic transformation events having a high transformation efficiency in several different species (including catfish, koi, mice, oysters, and a variety of cells in vitro) have been demonstrated with this transposon-based system. See generally U. S. Patents 5, 719, 055 and 5, 998, 698.

An Additional Example for Method I--Prevention of Herpes Infections The ICP4 (or Vmw 175) gene is an immediate-early gene isolated from Herpes Simplex I (HSV 1), as sequenced and described by M. Murchie et al.,"DNA sequence analysis of an immediate-early gene region of the herpes simplex virus type 1 genome (map coordinates 0. 950 to 0. 978)," J. Gen. Virol., vol. 62 (Pt 1), pp. 1-15 (1982) Byrne et al. (1989) linked the ICP4 promoter to a gene encoding chloramphenicol acetyltransferase (CAT) and a simian virus polyadenylation signal to create transgenic mice capable of expressing the CAT protein in the presence of herpes viral proteins responsible for turning on immediate early proteins in an HSV I infection. The vector containing this ICP4/CAT/PolyA was designated pIE. The pIE plasmid contained 360 bp of the ICP4 promoter.

Using the 360 bp fragment of the ICP 4 promoter from pIE, we have constructed plasmids pICP/Phor2lneo and pICP/Phor2llac. The base plasmid for both was pPC6 (described above), modified as follows : 1) To make the intermediate plasmid pBTnNeo, the cecropin B promoter and gene were removed from between the insertion sequences of pPC6 and replaced with a gene encoding neomycin/kanamycin resistance and a multiple cloning site.

The neomycin gene allowed selection for eukaryotic cells containing the transposon in the presence of the antibiotic neomycin or its analog, G418, as well as selection for cells containing the transposon in prokaryotic cells using the antibiotic kanamycin. The multiple

cloning site allowed easy cloning of a desired gene (in this case, ICP4/Phor21) between the insertion sequences. The result was a transposon carrying a selectable marker and the gene encoding antiviral activity. 2) The intermediate plasmid pBTnLac carried the same transposon as described above, but the cecropin B gene and promoter were replaced with a gene encoding the a fragment of the P-galactosidase gene, commonly referred to as lacZ. The lacZ gene carries a multiple cloning site to allow easy insertion of a desired gene of interest (in this case, ICP4/Phor21) and easy selection of plasmids containing the desired gene using blue/white color screening. By inserting a gene into the lacZ multiple cloning site, P-galactosidase activity was disrupted, i. e., lactose cannot be used as a carbon source when such a plasmid is transformed into an Escherichia coli strain containing only the (3-fragment of the P-galactosidase gene.

To construct plCP/Phor2lneo and pICP/Phor21/ac, we used PCR primers to amplify the ICP4 promoter from pIE. These primers had restriction sites added to the ends--Spel on the 5'end of the promoter and Hind III on the 3'end. A sequence encoding Phor21 was synthesized and then amplified with PCR primers containing restriction sites-Hind III on the 5'end and Kpn I on the 3'end. Likewise, the polyA termination sequence was amplified from cecropin B with PCR primers containing Kpn I on the 5'end and Spe I on the 3'end.

Digestion with the appropriate restriction enzymes and subsequent ligation using T4 DNA ligase (New England Biolabs, Beverly, MA) insured correct 5'-3'orientation of the ICP4 promoter to Phor21 and correct 5'-3'orientation of Phor21 to the polyA. Restriction digestion of the Spe I sites from the ligated product allowed sticky end ligation into the Spe I site in either pBTnNeo or pBTnlac. Once the ICP/Phor21 gene was cloned into the desired vector, it was sequenced to verify that all the components were present in the proper orientation. The sequence for the completed construct is SEQ. ID NO. 5. (All procedures described in the preparation of the plasmids, e. g., restriction digests, ligation etc., were conducted using either the standard protocols found in F. M. Ausubel et al. (Eds) (1999), or following the manufacturer's suggested protocols.) Testing anti-herpes activity in vitro.

Experiments to demonstrate anti-herpes activity in vitro are underway. Three cell types susceptible to the herpes virus have been chosen for the initial in vitro testing : Cos7, Vero, and channel catfish ovary cells. The experiments are described in Tables III-V ; the vector used in these experiments is pICP/Phor2lneo, containing SEQ. ID NO. 5. Preliminary results from these experiments are reported below.

Table III. Cell Transfection Protocol-Cos-7 Cells

Cell DNA Superfect Ratio % transfection number Flask-25 cm2 x 2 105 25 200 I 1 : 8 24 Row 1 104 0 0 No DNA, No well Control Superfect no virus plate Row 2 104 2 121/weM 1 : 6 1 well will receive 4 wells 8 Ag 4 x 12 = 48 no virus as a control 1 Row 3 104 2 µg 16 µl/well 1 : 8 1 well will receive 4 wells 8 Ag 4 x 16 = 64 no virus as a control Al Row 4 104 2 µg 20 µl/well 1 : 10 8 Ag 4 x 20 = 80 1 well will receive Al no virus as a control Row 5 104 0 8 µl/well 1 : 8 Superfect only + Superfect 4 x 8 = 32 ul virus only Row 6 104 0 0 0 Will receive virus, No DNA, No Superfect Total 74 yg 592 µl Table IV. Cell Transfection Protocol-Vero Cells Cell DNA Superfect Ratio Notes number Flask-25 cm2 x 2 105 6 g 36 1 1 : 6 24 Row 1 104 0 0 No DNA, no well Control Superfect, no plate virus. Row 2 104 0. 5 yg 2 yI/well 1 : 4 1 well will receive 4 wells 2 mg 4 x 2 = 8 µl no virus as a control. Row 3 104 0. 5 µg 3 µl/well 1 : 6 1 well will receive 4 wells 2 mg 4 x 3 = 12 µl no virus as a control. Row 4 104 0. 5 µg 4 µl/well 1 : 8 2 µg 4 x 4 = 16 µl 1 well will receive no virus as a control. Row 5 104 0 3 µl/well 1 : 6 Superfect 4 x 3 = 12 µl Superfect only + control virus Row 6 104 0 0 0 Will receive virus. Total 18 µg 120 µl

Table V. Cell Transfection Protocol-Channel Catfish Ovary Cells Cell DNA Superfect Ratio Notes number Flask-25 cm2 x 2 1 6 36 1 1 : 6 24 Row 1 104 0 0 No DNA, no well Control Superfect, no plate virus. Row 2 104 0.5 µg 2 µl/well 1 : 4 1 well will receive 4 wells 2 Ag 4 x 2 = 8 g1 no virus as a control. Row 3 104 5/ig 3 I/well 1 : 6 1 well will receive 4 wells 2 mg 4 x 3 = 12, ul no virus as a control. Row 4 104 0. 5 yg 4 yl/well 1 : 8 2 µg 4 x 4 = 16 µl 1 well will receive no virus as a control. Row 5 104 0 3/41/well 1 : 6 Superfect 4 x 3 = 12 y1 Superfect only + control virus Row 6 104 0 0 0 Will receive virus. Total 18 µg 120 µl Expected in vitro results.

Each cell type described in Tables III-V will be challenged with HSV 1 and observed for increased cytopathic effect. It is expected that cells expressing Phor 21 under control of the viral promoter will lyse more quickly than will control cells when a high virus titer is used, i. e., a titer sufficiently high to infect essentially all cells in the culture. When a low virus titer is used (e. g., 1 viral particle per 10 cells), cells containing ICP/Phor21 that become infected with virus will die and will be replaced by dividing uninfected cells, while all control cells will be killed by the spread of infectious HSV 1 particles. The low virus titer condition approximates the results expected in vivo.

Preliminary in vitro results for the anti-herpes construct.

As of the international filing date of this application, preliminary results for the anti- herpes construct (SEQ. ID NO. 5) showed that the construct worked as predicted. These preliminary results are reported below.

Generating Transgenic Vero Cells.

Forty eight hours after transfecting Vero cells according to the protocols of Table IV, 400 yg/mL neomycin (GeneticaT""G418) was added to the 60% confluent monolayers to generate selective pressure. After eight days, cells were transferred from the wells to 25 cm2 Falcon flasks. After five days and two additional passages, the selective pressure was reduced to 200 yg/mL. By this time, the control, non-transfected cells had died from the neomycin selective pressure. In all transfected wells, under each of the conditions of transfection of Table IV, many cells had survived, indicating successful generation of transgenic cells.

Preparation of Test Cultures.

In one 24-well CostarTM plate, well diameter 16 mm, 1 x 105 transfected Vero cells were placed in each well, and all wells of a second plate received the same quantity of untransfected Vero cells. Within 24 hours lightly confluent monolayers of cells were established in each of the wells.

Preparation of Herpes Virus Inoculum.

The Herpes virus inoculum was obtained by infecting a 162 cm2 Falcon flask of confluent normal Vero cells with a 1 : 40 dilution of Herpes Simplex Virus 1 infected tissue culture fluid, obtained from the American Type Culture Collection, accession number VR-733.

After the infected cultured cells had rounded and detached from the flask, the tissue culture fluid was harvested, the cells were removed by centrifugation, and the infected supernatant was frozen in 1 mL aliquots.

Infection of Transgenic and Non-Transgenic Vero Cells.

Four wells on each plate were infected separately with 0. 25 mL of either undiluted stock virus inoculum, or 1 : 10, 1 : 100, 1 : 1000 or 1 : 10, 000 dilution in media. After a 1 hour incubation at 37°C, the inoculum was replaced by 1 mL of media.

Results.

Five hours after infection one well from each plate at the 1 : 10 dilution of virus stock was stained for cell viability using a 0. 4% trypan blue solution. In the infected culture of normal Vero cells very few cells, about 1%, were stained, while in the infected culture of transgenic Vero cells, many of the cells, about 30 to 40%, stained dark blue, indicating cell death.

This experiment has been repeated, diluting the concentration of virus stock by 1 : 5 and 1 : 50 as compared to the original experiment described above. Cell viability was determined after six hours ; early cell death was about ten-fold higher in the cell cultures given the higher virus stock.

PCR Detection of the Herpes Virus Construct in the Transgenic Vero Cells.

PCR analysis of the Vero cells confirmed that the construct was present in the putatively transgenic Vero cells, but not in the control (untransformed) Vero cells. Using a Qiagen Blood and Cell Culture DNA Mini Kit according to the manufacturer's recommended protocols, DNA was extracted from : (a) Vero cells that had been transfected with Superfect and plCP4/Phor2lneo, and (b) control Vero cells receiving no treatment. Approximately 3. 4 jig of DNA was obtained from each group of cells, of which'0. 07 yg was used for PCR reactions with primers specific to the 5'end of ICP4 and the 3'polyA end of the ICP4/Phor21 gene. The following reactions were set up : (1) PCR on a negative control containing all components of the reaction except the extracted DNA ; (2) PCR on DNA from Vero cells that had not received ICP4/Phor21 ; and (3) PCR on DNA from Vero cells that had received the ICP4/Phor21 gene. Standard PCR conditions were used : Taq polymerase (Gibco Life Technologies Inc), lOx buffer, MgSO4, dNTP's, sdH2O, primers, and an enhancer buffer supplied with the polymerase. The reactions were denatured for 5 min at 96°C, and then subjected to 35 cycles as follows : 98°C for 45 sec, 55° for 45 sec, and 72° for 1 min. A 72°C 5 min final extension was used before holding at 4°C.

Ten jul from each PCR reaction mixture was mixed with 3 yl of tracking dye and loaded onto a 1 % agarose gel. A 1 kb ladder was used as a reference marker to estimate the size of any bands present. The DNA was electrophoresed in the gel for 90 min at 70 V, stained with 0. 5 mg/mL ethidium bromide, and visualized on a U. V. light source. The primers used were designed to amplify'800 bp of the ICP4/Phor21 gene. In both the negative control

sample and the sample from control Vero cells, no bands were observed. In the samples from the transfected Vero cells, the expected 800 bp band was observed. These data strongly support the conclusion that the experimental Vero cells were transgenic, and that they contained the ICP4/Phor21 transgene.

Testing anti-herpes activity in vivo.

Mice : Twenty mice total will be used in the initial experiment : 10 males and 10 females. Five males and five females will be used in the control group, and five each in the treatment group. The pICP/Phor211ac vector (SEQ. ID NO. 5) will be complexed to SuperFect reagent (Qiagen, Inc.) in a 1 : 3 weight : volume ratio (DNA to Superfect) in 0. 85 % physiological saline. The DNA/Superfect complex will be incubated at room temperature for 15 min before being injected into the tail veins of five males and five females at a rate of 1 ttg DNA/gram body weight of mouse, e. g., a 20 gram mouse will receive 20, ug of DNA ; the total volume of DNA/Superfect will be no more than 100 iLl. (Based on prior work in transforming mice with the same type of transposon-based vector, with an unrelated transgene, the expected rate of transgenic parents following lipofection is between about 20% and about 60% ; and the expected rate of transgenic F,'s is about 60%.) Control mice will receive Superfect only. The mice will be held for ten days to allow any unincorporated vector to be cleared from the bloodstream. On day 10, a 50-100 ttl blood sample will be drawn from each mouse, and DNA from the blood will be extracted using a Qiagen Blood Kit for DNA extraction. Each mouse's fur will be numbered with a black marker, so that each DNA sample may be associated with a specific mouse. PCR will be conducted on each sample using primers specific to ICP4 on the 5'end and polyA on the3'end. PCR protocols will be as described in Ausubel et al. (1999). Each PCR sample will be electrophoresed on a 1 % agarose gel with a 1 kilobase ladder as a reference marker, stained with 0. 5 mg/mL ethidium bromide, and visualized on a U. V. light source. Male and female mice positive for ICP4/phor21 will be paired for mating. DNA from blood samples from all F, mice resulting from these crosses will be extracted, and PCR conducted as described above. The F, mice positive for ICP4/Phor21 by PCR will be challenged with the same virulent isolate of herpes used in the in vitro experiments, at a viral load sufficient to cause disease in normal mice ; an equal number of controls will be treated in the same manner.

Expected in vivo results.

Mice containing the ICP4/Phor21 construct will rid themselves of the virulent herpes virus without becoming viremic, while the control mice will die from the challenge.

Chickens. In vivo transformation and challenge of chickens will be generally similar to that described above for mice. Sexually immature chickens will be lipofected using the same SEQ. ID NO. 5 DNA/Superfect ratios and the same amount of DNA per gram body weight.

Different injection procedures will be used : 10 birds will receive an intravenous injection through a wing vein, 10 birds will be injected in the intraperitoneal cavity, 10 birds will be injected directly in the gonads, and 10 will receive Superfect only, administered by intravenous injection. The birds will be held for 10 days to allow unincorporated DNA to clear, and PCR will be conducted to identify birds carrying the transgene. The birds positive for the transgene will be allowed to breed, and all Fl's will be screened as in the mouse experiment. The Fl's positive for the transgene by PCR will be challenged with Marek's disease herpesvirus, as will an equal number of controls. Birds containing the anti-herpes construct will be protected from the disease while the control birds will become viremic and die.

The Marek's disease challenge will not only provide an in vivo demonstration of the efficacy of Method I in preventing viral infection generally, it will also demonstrate specifically its efficacy in preventing what has previously been a major disease problem in the poultry industry.

An Additional Example for Method 11--Prevention of Influenza Infections The protocols used to construct the anti-influenza vector (SEQ. ID NO. 6) are similar to those described above for the anti-herpes vector, except for differences that are otherwise mentioned or that will be apparent in context to a person of ordinary skill in the art who is given the present disclosure in its entirety.

Using a reverse genetics system for negative strand RNA viruses, we are cloning a sequence encoding the lytic peptide Phor21 in the minus sense between the truncated human polymerase I (HpolI) promoter and a ribozyme binding sequence that generates the desired 3' end by autocatalytic cleavage.

The sequence from which the HpolI promoter and ribozyme were taken was kindly provided by Dr. Adolfo Garcia-Sastre. See S. Pleschka et al. (1996), which reported the use of this system to demonstrate CAT synthesis in studying the replication of influenza viruses.

Using PCR, each segment was amplified with primers containing restriction enzyme sites on the ends to allow ligation to Phor21 in the proper orientation. The resulting sequence of rybozyme : Phor21 : hpolI is being ligated into pBTnNeo and pBTnLac as otherwise described above. An otherwise identical plasmid is also being constructed with Phor21 in the positive sense as a negative control.

As in the herpes example, the plasmid bearing the neomycin gene will be used for cell culture experiments, e. g., human 293 cells (ATCC), and the plasmid bearing the lac gene will be used for animal experiments, e. g., mice and chickens. The same experimental design as described above will be used for each cell type and each animal, with similar results expected following challenge. The initial in vitro challenge of Vero cells will be conducted with influenza A virus (H1N1), ATCC accession number VR-825. Later in vitro and in vivo challenges will be conducted using strains of influenza virus that are virulent in the particular species.

An Additional Example for Method II--Plant Resistance to Tobacco Mosaic Virus Tobacco plants (Nicotiana benthamiana) will be made non-permissive for tobacco mosaic virus (TMV), a positive strand RNA virus. The construct will use the messenger strand sequence for the viral RNA-dependent RNA polymerase recognition sequence, located at the 3'portion of the viral genome, linked to a negative sense coding sequence for a toxin.

(Because replication of the RNA viral genome requires conversion of positive viral RNA to negative viral RNA and vice versa, the same RNA-dependent RNA polymerase must recognize both the negative strand and the positive strand of the viral RNA. Thus a polymerase recognition sequence from either the positive strand or the negative strand of RNA could be used.) The DNA constructs used for cloning into plant cells will have constitutive promoters to continuously yield the desired forms of the transcribed RNA message in the plant cells. The message will comprise a virus polymerase recognition sequence and the negative sense sequence coding the toxin. When the negative toxin message is converted to a positive message encoding the toxin by the virus RNA-dependent RNA polymerase, the positive mRNA form of the toxin code is translated to yield the toxin gene product, resulting in death of the infected cell prior to formation of mature virions.

The starting material for obtaining the viral RNA-dependent RNA polymerase (RDRP) recognition region of the TMV genome will be cDNA of the TMV genome, cloned into the pBR322 plasmid vector, and grown in E. coli. This clone is available from the American Type Culture Collection (ATCC accession no. 45138). See W. Dawson et al, 1986,"cDNA cloning of the complete genome of tobacco mosaic virus and production of infectious transcripts,"Proc. Natl. Acad. Sci. USA. vol. 83, pp. 1832-1836 (1986).

The pBR322 vector containing the TMV genome is grown in E. coli and purified using the Maxiprep kit from Qiagen (Chatsworth, CA), using the manufacturer's recommended protocols.

The RNA polymerase recognition sequence of the TMV genome is then amplified by PCR.

The RNA polymerase recognition sequence is then ligated to a toxin construct linked to a promoter, a ribosome binding sequence, and a polyadenylation sequence, according to the methods of F. M. Ausubel et al. (Eds) (1999). The toxin construct encodes the Phor21 peptide previously described.

To obtain RDRP recognition sequences in a chosen polarity, PCR primers are used with different restriction endonuclease sites on each end, so that just the selected strand will be amplified, again using the methods of F. M. Ausubel et al. (Eds) (1999).

Several techniques are known in the art for incorporating an exogenous gene into a plant. One such technique is that using a modified Ti plasmid from Agrobacterium as a vector.

The constructs are ligated into a small binary vector for propagation in E. coli, and are then are transferred by conjugation or electroporation into modified Agrobacterium tumefaciens containing Ti plasmids with the tumor-inducing portion deleted, e. g., LBA4404 or pGV3850.

See C. Wallis et al.,"Preparation of coat protein-containing binary vectors for use in Agrobacterium-mediated transformation,"pp. 341-352 in G. Foster et al. (Eds.), Plant Virology Protocols from Virus Isolation to Transgenic Resistance, Humana Press (Methods in Molecular Biology, vol. 81) (1998). This modified A. tumefaciens is an efficient vector to generate transgenic plants in a wide variety of species. Typically, after being cloned into A. tumefaciens, the desired genes are introduced into plants by plant cell culture, callus culture, leaf explants, or meristem cultures.

The prepared constructs are introduced into leaf explants of tobacco plants using the modified Ti plasmid as described by J. Topping,"Tobacco Transformation,"pp. 365-372 in G.

Foster et al. (Eds.), Plant Virology Protocols (1998). Transformed plants are selected by antibiotic resistance, grown, and tested by PCR for the presence of the construct. See D.

Worrall,"PCR analysis of transgenic tobacco plants,"pp. 417-424 in G. Foster et al. (Eds.), Plant Virology Protocols (1998).

The transgenic tobacco plants and non-transgenic controls will be experimentally infected with TMV. Evaluation of resistance will be determined both visually, and by methods described in"PART V. Evaluation of Resistance,"pp. 455-509 in G. Foster et al. (Eds.), Plant Virology Protocols (1998). The transgenic plants will be resistant to infection, while the control plants will become diseased following infection.

Lytic Peptides Useful in the Present Invention.

Many lytic peptides are known in the art and include, for example, those mentioned in the references cited in the following discussion.

Lytic peptides are small, basic peptides. Native lytic peptides appear to be major components of the antimicrobial defense systems of a number of animal species, including those of insects, amphibians, and mammals. They typically comprise 23-39 amino acids, although they can be smaller. For example, the protegrins from porcine leukocytes have 16-18 amino acids, and fragments down to 12 amino acids show activity against bacteria. See X-D Qu et al.,"Protegrin Structure and Activity against Neisseria gonorrhoea,"Infection and Immunity, vol. 65, pp. 636-639 (1997). Some designed peptides show activity at even shorter lengths. See McLaughlin et al., cited below.

Lytic peptides have the potential for forming amphipathic alpha-helices. See Boman et al.,"Humoral immunity in Cecropia pupae,"Curr. Top. Microbiol. Immunol. vol. 94/95, pp.

75-91 (1981) ; Boman et al.,"Cell-free immunity in insects,"Annu. Rev. Microbiol., vol. 41, pp. 103-126 (1987) ; Zasloff,"Magainins, a class of antimicrobial peptides from Xenopus skin : isolation, characterization of two active forms, and partial DNA sequence of a precursor," Proc. Natl. Acad. Sci. USA, vol. 84, pp. 3628-3632 (1987) ; Ganz et al.,"Defensins natural peptide antibiotics of human neutrophils,"J. Clin. Invest., vol. 76, pp. 1427-1435 (1985) ; and Lee et al.,"Antibacterial peptides from pig intestine : isolation of a mammalian cecropin," Proc. Natl. Acad. Sci. USA, vol. 86, pp. 9159-9162 (1989).

Known amino acid sequences for lytic peptides may be modified to create new peptides that would also be expected to have lytic activity by substitutions of amino acid residues that preserve the amphipathic nature of the peptides (e. g., replacing a polar residue with another polar residue, or a non-polar residue with another non-polar residue, etc.) ; by substitutions that preserve the charge distribution (e. g., replacing an acidic residue with another acidic residue, or a basic residue with another basic residue, etc.) ; or by lengthening or shortening the amino acid sequence while preserving its amphipathic character or its charge distribution. Lytic peptides and their sequences are disclosed in Yamada et al.,"Production of recombinant sarcotoxin IA in Bombyx mori cells,"Biochem. J., vol. 272, pp. 633-666 (1990) ; Taniai et al., "Isolation and nucleotide sequence of cecropin B cDNA clones from the silkworm, Bombyx mori,"Biochimica Et Biophysica Acta, vol. 1132, pp. 203-206 (1992) ; Boman et al., "Antibacterial and antimalarial properties of peptides that are cecropin-melittin hybrids,"Febs Letters, vol. 259, pp. 103-106 (1989) ; Tessier et al.,"Enhanced secretion from insect cells of a foreign protein fused to the honeybee melittin signal peptide,"Gene, vol. 98, pp. 177-183

(1991) ; Bondelle et al.,"Hemolytic and antimicrobial activities of the twenty-four individual omission analogs of melittin,"Biochemistry, vol. 30, pp. 4671-4678 (1991) ; Andreu et al., "Shortened cecropin A-melittin hybrids. Significant size reduction retains potent antibiotic activity,"Febs Letters, vol. 296, pp. 190-194 (1992) ; Macias et al.,"Bactericidal activity of magainin 2 : use of lipopolysaccharide mutants,"Can. J. Microbiol., vol. 36, pp. 582-584 (1990) ; Rana et al.,"Interactions between magainin-2 and Salmonella typhimurium outer membranes : effect of Lipopolysaccharide structure,"Biochemistry, vol. 30, pp. 5858-5866 (1991) ; Diamond et al.,"Airway epithelial cells are the site of expression of a mammalian antimicrobial peptide gene,"Proc. Natl. Acad. Sci. USA, vol. 90, pp. 4596 ff (1993) ; Selsted et al.,"Purification, primary structures and antibacterial activities of P-defensins, a new family of antimicrobial peptides from bovine neutrophils,"J. Biol. Chem., vol. 268, pp. 6641 ff (1993) ; Tang et al.,"Characterization of the disulfide motif in BNBD-12, an antimicrobial P- defensin peptide from bovine neutrophils,"J. Biol. Chem., vol. 268, pp. 6649 ff (1993) ; Lehrer et al., Blood, vol. 76, pp. 2169-2181 (1990) ; Ganz et al., Sem. Resp. Infect. 1., pp.

107-117 (1986) ; Kagan et al., Proc. Natl. Acad. Sci. USA, vol. 87, pp. 210-214 (1990) ; Wade et al., Proc. Natl. Acad. Sci. USA, vol. 87, pp. 4761-4765 (1990) ; Romeo et al., J. Biol.

Chem., vol. 263, pp. 9573-9575 (1988) ; Jaynes et al.,"Therapeutic Antimicrobial Polypeptides, Their Use and Methods for Preparation,"WO 89/00199 (1989) ; Jaynes,"Lytic Peptides, Use for Growth, Infection and Cancer,"WO 90/12866 (1990) ; Berkowitz, "Prophylaxis and Treatment of Adverse Oral Conditions with Biologically Active Peptides," WO 93/01723 (1993).

Families of naturally-occurring lytic peptides include the cecropins, the defensins, the sarcotoxins, the melittins, and the magainins. Boman and coworkers in Sweden performed the original work on the humoral defense system of Hyalophora cecropia, the giant silk moth, to protect itself from bacterial infection. See Hultmark et al.,"Insect immunity. Purification of three inducible bactericidal proteins from hemolymph of immunized pupae of Hyalophora cecropia,"Eur. J. Biochem., vol. 106, pp. 7-16 (1980) ; and Hultmark et al.,"Insect immunity. Isolation and structure of cecropin D. and four minor antibacterial components from cecropia pupae,"Eur. J. Biochem., vol. 127, pp. 207-217 (1982).

Infection in H. cecropia induces the synthesis of specialized proteins capable of disrupting bacterial cell membranes, resulting in lysis and cell death. Among these specialized proteins are those known collectively as cecropins. The principal cecropins--cecropin A, cecropin B, and cecropin D--are small, highly homologous, basic peptides. In collaboration with Merrifield, Boman's group showed that the amino-terminal half of the various cecropins contains a sequence that will form an amphipathic alpha-helix. Andrequ et al.,"N-terminal

analogues of cecropin A : synthesis, antibacterial activity, and conformational properties," Biochem., vol. 24, pp. 1683-1688 (1985). The carboxy-terminal half of the peptide comprises a hydrophobic tail. See also Boman et al.,"Cell-free immunity in Cecropia,"Eur. J.

Biochem., vol. 201, pp. 23-31 (1991).

A cecropin-like peptide has been isolated from porcine intestine. Lee et al., "Antibacterial peptides from pig intestine : isolation of a mammalian cecropin,"Proc. Natl.

Acad. Sci. USA, vol. 86, pp. 9159-9162 (1989).

Cecropin peptides have been observed to kill a number of animal pathogens other than bacteria. See Jaynes et al.,"In Vitro Cytocidal Effect of Novel Lytic Peptides on Plasmodium falciparum and Trypanosoma cruzi,"FASEB, 2878-2883 (1988) ; Arrowood et al.,"Hemolytic properties of lytic peptides active against the sporozoites of Cryptosporidium parvum,"J.

Protozool., vol. 38, No. 6, pp. 161S-163S (1991) ; and Arrowood et al.,"In vitro activities of lytic peptides against the sporozoites of Cryptosporidium parvum,"Antimicrob. Agents Chemother., vol. 35, pp. 224-227 (1991). Although many lytic peptides are selectively effective against bacteria at lower concentrations than the concentrations needed to lyse mammalian cells, they will also lyse mammalian cells at higher concentrations. See Jaynes et al.,"In vitro effect of lytic peptides on normal and transformed mammalian cell lines,"Peptide Research, vol. 2, No. 2, pp. 1-5 (1989) ; and Reed et al.,"Enhanced in vitro growth of murine fibroblast cells and preimplantation embryos cultured in medium supplemented with an amphipathic peptide,"Mol. Reprod. Devel., vol. 31, No. 2, pp. 106-113 (1992). In the present invention, the fact that the lytic peptide is secreted within the virus-infected cell itself insures that a concentration lethal to the cell may readily be produced.

Defensins, originally found in mammals, are small peptides containing six to eight cysteine residues. Ganz et al.,"Defensins natural peptide antibiotics of human neutrophils,"J.

Clin. Invest., vol. 76, pp. 1427-1435 (1985). Extracts from normal human neutrophils contain three defensin peptides : human neutrophil peptides HNP-1, HNP-2, and HNP-3. Defensin peptides have also been described in insects and higher plants. Dimarcq et al.,"Insect immunity : expression of the two major inducible antibacterial peptides, defensin and diptericin, in Phormia terranvae,"EMBO J., vol. 9, pp. 2507-2515 (1990) ; Fisher et al., Proc. Natl.

Acad. Sci. USA, vol. 84, pp. 3628-3632 (1987).

Slightly larger peptides called sarcotoxins have been purified from the fleshfly Sarcophaga peregrina. Okada et al.,"Primary structure of sarcotoxin I, an antibacterial protein induced in the hemolymph of Sarcophaga peregrina (flesh fly) larvae,"J. Biol. Chem., vol. 260, pp. 7174-7177 (1985). Although highly divergent from the cecropins and defensins, the sarcotoxins presumably have a similar antibiotic function.

Other lytic peptides have been found in amphibians. Gibson and collaborators isolated two peptides from the African clawed frog, Xenopus laevis, peptides which they named PGS and Gly'0Lys22PGS. Gibson et al.,"Novel peptide fragments originating from PGLa and the caervlein and xenopsin precursors from Xenopus laevis,"J. Biol. Chem., vol. 261, pp. 5341- 5349 (1986) ; and Givannini et al.,"Biosynthesis and degradation of peptides derived from Xenopus laevis prohormones,"Biochem. J., vol. 243, pp. 113-120 (1987). Zasloff showed that the Xenopus-derived peptides have antimicrobial activity, and renamed them magainins.

Zasloff,"Magainins, a class of antimicrobial peptides from Xenopus skin : isolation, characterization of two active forms, and partial DNA sequence of a precursor,"Proc. Natl.

Acad. Sci. USA, vol. 84, pp. 3628-3632 (1987).

Synthesis of nonhomologous analogs of different classes of lytic peptides has been reported to reveal that a positively charged, amphipathic sequence containing at least 20 amino acids appeared to be a requirement for lytic activity in some classes of peptides. Shiba et al., "Structure-activity relationship of Lepidopteran, a self-defense peptide of Bombyx more," Tetrahedron, vol. 44, No. 3, pp. 787-803 (1988). Other work has shown that smaller peptides can also be lytic. See McLaughlin et al., cited below.

The synthetic lytic peptide known as S-1 (or Shiva 1) has been shown to destroy intracellular Brucella aborts-, Trypanosoma cruzi-, Cryptosporidium parvum-, and infectious bovine herpesvirus I (IBR)-infected host cells. See Jaynes et al.,"In vitro effect of lytic peptides on normal and transformed mammalian cell lines,"Peptide Research, vol. 2, No. 2, pp. 1-5 (1989) ; Wood et al.,"Toxicity of a Novel Antimicrobial Agent to Cattle and Hamster cells In vitro,"Proc. Ann. Amer. Soc. Anim. Sci., Utah State University, Logan, UT. J.

Anim. Sci. (Suppl. 1), vol. 65, p. 380 (1987) ; Arrowood et al.,"Hemolytic properties of lytic peptides active against the sporozoites of Cryptosporidium parvum,"J. Protozool., vol. 38, No. 6, pp. 161S-163S (1991) ; Arrowood et al.,"In vitro activities of lytic peptides against the sporozoites of Cryptosporidium parvum,"Antimicrob. Agents Chemother., vol. 35, pp. 224- 227 (1991) ; and Reed et al.,"Enhanced in vitro growth of murine fibroblast cells and preimplantation embryos cultured in medium supplemented with an amphipathic peptide,"Mol.

Reprod. Devel., vol. 31, No. 2, pp. 106-113 (1992).

Morvan et al.,"In vitro activity of the antimicrobial peptide magainin 1 against Bonamia ostreae, the intrahemocytic parasite of the flat oyster Ostrea edulis,"Mol. Mar. Biol., vol. 3, pp. 327-333 (1994) reports the in vitro use of a magainin to selectively reduce the viability of the parasite Bonamia ostreae at doses that did not affect cells of the flat oyster Ostrea edulis.

Also of interest are the designed peptides disclosed in McLaughlin et al.,"Amphipathic Peptides,"United States patent no. 5, 789, 542, issued August 4, 1998 ; and Mark L.

McLaughlin et al.,"Short Amphipathic Peptides with Activity against Bacteria and Intracellular Pathogens,"United States patent application serial number 08/796, 123, filed February 6, 1997.

Lytic peptides such as are known generally in the art may be used in practicing the present inventions.

Miscellaneous.

In addition to the specific mechanisms discussed above, other virus-specific mechanisms may also be used to activate a toxin or toxic mechanism. The toxic mechanism triggered, while preferably a peptide or protein toxin as described above, could also comprise the activation of a host-cell toxin or toxic mechanism, e. g., apoptosis or necrosis.

It may be desirable in some applications to use multiple copies of the toxin gene to increase the level of expression.

In Method I, it may also be desirable to place a"stop"or"termination"codon upstream of the virus-specific promoter to prevent"read through"and unintended expression of the toxin in the absence of a virus-specific inducer.

Certain aspects of implementing the invention would be readily apparent or routine for a worker of skill in the art who has been given the disclosure of the present specification, and will therefore not be discussed at length here. For example, a message could include, in addition to a sequence encoding the toxin, appropriate start and termination signals, spacers, and perhaps caps, polyadenylated tails, and other sequences and modifications known to promote efficient gene expression and nucleic acid stability within the cell.

It should be noted that many"virus-specific"mechanisms work only in association with certain normal cellular regulatory factors. Some of the cell specificity of viruses is based upon which cell types have these regulatory factors present in their cytoplasm, as they are absolutely essential for some viruses. However, even if a virus factor requires one or more normal cellular factors to function, the mechanism is still considered"virus-specific"within the scope of the present specification and the claims, because the contribution of the virus is essential,

and the host cell factors alone are not capable of inducing toxin expression through a construct of the present invention.

Comprehensive sources disclosing techniques that are useful in carrying out the molecular manipulations used in this invention are F. M. Ausubel et al. (Eds), Current Protocols in Molecular Biology, vols. 1-3, John Wiley and Sons (Wiley Interscience) (1999) ; and J. Sambrook et al. (Eds.), Molecular Cloning : a Laboratory Manual, Cold Spring Harbor Laboratory Press (2d ed. 1989). Additional techniques for plant viruses can be found in G.

Foster et al., Plant Virology Protocols, From Virus Isolation to Transgenic Resistance, vol. 81 in M. Walker (ed.), Methods in Molecular Biology, Humana Press (1998).

The complete disclosures of all references cited in this specification are hereby incorporated by reference, as is the complete disclosure of the priority application, United States provisional patent application serial number 60/123, 653, filed 10 March 1999. In the event of an otherwise irreconcilable conflict, however, the present specification shall control.

Definitions.

As used in the specification and the Claims, unless context clearly indicates otherwise, the following terms have the meanings indicated. The definitions of some terms may differ slightly from definitions that have sometimes been given to the same terms in different contexts. For example, in other contexts the term"transformed cell"is sometimes taken to imply that exogenous DNA has been integrated into the cell's genome (or is otherwise stably maintained in the cell, e. g., as in an episome), whereas in the present specification and claims the term"transformed cell,"standing alone, carries no implication either way as to whether exogenous DNA or RNA is stably maintained in the cell ; the exogenous nucleic acid in a "transformed"cell may be present only transiently. In other contexts, the term"transformed cell"has sometimes been used to refer to cancers or immortal cell lines, while the term as used here carries no such implication either way.

A"transformed cell"is a prokaryotic or eukaryotic cell into which an exogenous genetic construct in accordance with the present invention has been introduced. The term "transformed cell"is also intended to include progeny and descendants of such cells that retain one or more copies of the introduced genetic construct. Unless context clearly indicates otherwise, a"transformed cell"may be in vivo, ex vivo, or in vitro. The introduced genetic construct may or may not be integrated into the genome of the cell ; it could, for example, either be present in a plasmid or incorporated into a chromosome. The introduced construct

may comprise linear or circular DNA or RNA, with or without the ability to replicate. Unless context clearly indicates otherwise, a"transformed cell"may be a somatic cell or a germ cell.

A"transgenic"cell or organism is one in which exogenous DNA has been integrated into the genome of the cell or organism, or is otherwise maintained in the cell more than transiently. For example, an episome or cDNA might be used to introduce a construct into skin cells to prevent episodes of herpes eruption, without actually being integrated into a chromosome. If the episome is maintained more than transiently, then the cell would be considered to be"transgenic"within the scope of this definition.

Note that under the preceding definitions a"transgenic"cell is also considered to be "transformed,"but that not all"transformed"cells need be"transgenic." A"virus permissive"cell or a cell that is"permissive"to a virus refers to a cell that can support infection by and replication of a particular virus. A"non-permissive"cell refers to a cell that cannot support propagation of that virus.

A"virus-specific element"is a virus-encoded gene product or nucleic acid sequence that does not naturally occur in the host cell in the absence of viral infection. Thus the "specificity"of a"virus-specific element"refers to specificity as compared to products naturally occurring in the uninfected host cell, and does not imply specificity as compared to other viruses. To the contrary, one of the strengths of the present invention is that many viral elements tend to be conserved, so that a single construct in accordance with the present invention will protect against multiple viruses."Virus-specific elements"include for example, but are not limited to, virus-specific inducers, RNA-dependent RNA polymerases, and virus- specific nucleic acid sequences that can act as primers for a DNA polymerase.

A"virus-specific promoter"is a promoter that requires a virus-specific inducer, or a complex between a virus-specific inducer and host cellular factors, to allow production of a gene product.

A"virus-specific inducer"is a virus-encoded gene product that can induce or activate a promoter, and that does not naturally occur in the host cell in the absence of viral infection.

Thus the"specificity"of a"virus-specific inducer"refers to specificity as compared to products naturally occurring in the uninfected host cell, and does not imply specificity as compared to

other viruses. To the contrary, one of the strengths of the present invention is that viral inducers tend to be conserved, so that a single construct in accordance with the present invention will protect against multiple viruses.

The term"virus-specific inducer"should also be construed to include virus-specific regulatory elements other than conventional inducers, other regulatory elements that can effectively be made to function as inducers. Although such adaptations of other regulatory elements to act as inducers are not, in general, preferred, they should be recognized as equivalent to the use of more conventional"inducers"for purposes of the present invention.

Furthermore, there could be specific circumstances in which it is more effective or convenient to use such a specific alternative regulatory element. As an illustrative example, a virus- specific repressor ("Repressor 1") can be made to function as an inducer of expression of a toxin via the following construct : The construct contains two genes, Gene 1 and Gene 2. Both Genes 1 and 2 are repressible. The expression of Gene 1 is repressed in the presence of virus- specific Repressor 1 ; but in the absence of Repressor 1, Gene 1 constitutively expresses Repressor 2. Repressor 2 is preferably a virus-derived repressor, or is otherwise a repressor that interferes with no normal cellular functions. (Note that Repressor 2 must be different from Repressor 1 ; and that in general, Repressor 2 should be derived from a virus other than that encoding Repressor 1.) Repressor 2 acts to repress the expression of Gene 2. In the absence of Repressor 2, Gene 2 causes the expression of a toxin that kills the cell. Thus in the absence of virus-specific Repressor 1, Gene 1 causes the constitutive expression of Repressor 2.

Repressor 2 in turn represses Gene 2, so no toxin is expressed. However, in the presence of virus-specific Repressor 1, Gene 1 is repressed, no Repressor 2 is expressed, so Gene 2 now constitutively expresses the toxin, thereby killing the cell. Thus a virus-specific regulatory element (Repressor 1) that does not normally function as an inducer can be made to act, in effect, as an inducer for a gene that expresses a toxin. In this example, note that Gene 1 and Gene 2 should preferably be on a single construct, to minimize the possibility that Gene 2 might be found in a cell in the absence of Gene 1, with resulting undesirable lethal effects.

An"RNA-dependent RNA polymerase"is an enzyme or enzyme complex that can function to make a complementary copy of an RNA sequence from an RNA template. Please refer to the definition of RNA replicases, transcriptases, and polymerases in"Classification and Nomenclature of Viruses,"Francki et al. Eds., 1991, page 55, each of which is considered to be an"RNA-dependent RNA polymerase"as that term is used in the specification and Claims.

A"toxin"is a gene product (s) that causes or leads to the destruction or incapacitation of a cell. This definition is intended to include the induction of indigenous events leading to cell death, such as apoptosis or necrosis.

A"toxin"may, for example, be a compound that induces conditional lethality, i. e., cell death requires both expression of a conditional toxin gene (for example, thymidine- kinase) and the exogenous administration of a compound (for example, ganciclovir or acyclovir) that together produce a lethal effect. Another example is the combination of the gene encoding cytosine deaminase and the prodrug 5-fluorocytosine. It has been suggested that a cell expressing cytosine deaminase will convert 5-fluorocytosine to the cytotoxic compound 5-fluorouracil, for use in killing tumor cells. See, e. g., J. Harris et al.,"Gene therapy for cancer using tumour-specific prodrug activation,"Gene Ther., vol. 1, pp. 170-175 (1994).

"Negative single-stranded DNA" (unless context clearly indicates otherwise) is a single strand of DNA that cannot be directly transcribed to form messenger RNA capable of translation by ribosomes to synthesize a toxin, but that is complementary to a positive DNA strand that can be transcribed to form messenger RNA, that can in turn be translated by ribosomes to synthesize a toxin.

A"virus" (unless context clearly indicates otherwise) may be a double-stranded DNA virus, a single-stranded (+) or (-) DNA virus, a double-stranded RNA virus, a single-stranded (+) or (-) RNA virus, a retrovirus, a virus containing both RNA and DNA, or a viroid.

An"exogenous"nucleic acid sequence is a DNA or RNA sequence that is artificially introduced into a cell or organism, and that does not naturally occur in wild type cells or organisms of the same species. The term"exogenous"is also intended to include copies of such a sequence in the progeny of a cell or the progeny of an organism that is originally transformed with such a sequence.

A"vector"is a vehicle that can deliver exogenous nucleic acid to a cell. A"vector" may or may not be capable of replication. A"vector"may include, for example, the free nucleic acid itself.

An"organism"is a prokaryotic or eukaryotic organism, single-celled or multi-celled, including humans.

Express Mail No. EE108936767<BR> Table II<BR> Examples of viral promoters useful for regulating the expression of toxins and anti-sense nucleic acid sequences<BR> in accordance with the present invention. Virus type Virus name Promoter Promoter location GenBank Reference Accession Number Single Strand RNA, Picorniviridae Capsid 1-649 AF065158 43-53, 56-61, 175, Positive Sense non- Polymerase upstream of + 1 S64847 181-184, 168, 213-214 Segmented, non-enveloped P1-A 1-747 D00625 Polyprotein 1-73 D00149 polyprotein 1-1068 M205562 polyprotein 1-650 X00429 polyprotein 1-734 M14707 Caqliciviridae TV24 polymerase N. A. U02030 Astrovisidae Replicase 1-150 L13745 3C protease 1-85 L23513 Single Strand RNA, Togaviridae Structural protein 1-39 M15240, 70-83, 185-186, 190- Positive Sense non- M18901, M32735 198, 215-216 segmented, enveloped Nonstructural 1-59, 7599-76455 J02363-J02367, protein V0073 Flavisiridae Nucleocapsid 1-48 X71611 UTR 129-316 AB019181 polyprotein 1-340 S62220 Single Strand RNA, Coronaviridae RNA polymerase 1-243 X51939 84-90, 217-221 Negative Sense, non- Rd-Rp 1-292 X69721 segmented, non-enveloped Arterivirus Replicase 1-224 Y07862 RNA polymare 1-169 U87392, U00153 RNA polymare 1-207 X53459 BRSV polymerase 1-45, 8349-8406 AF029242

Texpress Maill No. EE108936767 Virus type Virus name Promoter Promoter tocation GenBank Accession Number Single Strang RNA, Mononegavirales N protein 1-58, 1464-1468, X03673 Negative Sense, non- RNA polymerase 4824-5329 AF006497 segmented, enveloped Raramyoxoviridae RNA polymerase 1-142 X03614 Rhabdoviridae RNA polymerase 1-46, 4952-5015 L40883 N protein 1-203 AB011257 RNA polymerase 1-58, 5360-5413 M31046 Filoviridae RNA rEgul. Seq. 1-53 L11365 VP24 polymerase 11400-1150 polymerase 11000-11281 Z12132, S55429 Single Strand RNA, Orthomyxoviriae PB2 protein 1-27 X99036 Negative Sense, RNA Polymerase 1-27 X15283, M27684 segmented, enveloped translation prom. 1-164 M25075 Translation prom. 1-146 M25076 Bunyaviridae 33.6 kDa protein 1-100 S58512 L protein 1-50 X14383 Non-struct. prot 1-100 AB010996 Arenaviriae Polymerase 1-33 J04331 Double Strand RNA, Revoiridae Rolymerase 1-20 D49693 Positive Sense, Birnaviridae RNA Polymerase 1-111 U30819

Express Mail No. EE108936767 Virus type Virus name Promoter Promoter location GenBank Reference Accession Number Single Strand DNA, non- Circoviridae replicase 1-50 AF117753 12-24, 149-150, 152 enveloped replicase 1-50 AF109397 155-158, 230-232 replicase 1-129 U97525 replication prot. 80-130, 675-754 AF080560 Parvoviridae protein VP2 2800-3285 M14363 Protein VP3 3200-3696 B19 1-351 M24682 B19-Au 1-435 M13178 Orf 2 2150-2443 ORf 4 4381-4682 NS1 1-113 J02275 Express Mail No. EE108936767 Virus type Virus name Promoter Promoter location GenBank Reference Accession Number Double Strand DNA, non- Herpesviridae Trans. Activator 4413-4461 M86664 127-142, 26-30, 174, enveloped DNA polymerase 51507-51521 163-166, 39-40, 179- ICP-4 I.E. 664-1476 X06461 180, 210-212, 233-235, F alpha 1-332 J02211 154, 159, 160-162 Poxiviriade Vaccinia 1-300 J02422, M10658 promoter Iridoviridae RNA Polymerase 1-252 M13209, M14122 protease/ 1-49; 3200-3311 AF006065 polymerase African swine DNA polymerase 500-1017 AB007366 fever IE methyltransf. 1-97, 572-1020 U15575 Early 31K 1-516 X52986 DNA polymerase 1-204 U27575 adenoviridae DNA polymerase 3000-3428 AF74946 RNA Pol. III 1-416 U10684 RNA Pol. III 1-401 U10683 DNA Polymerase 1-432 AF061654

References cited in Table II 1. Salvato, M. S., and E. M. Shimomaye. 1989. The completed sequence of lymphocytic choriomeningitis virus reveals a unique RNA structure and a gene for a zinc finger protein.

Virology 173 : 1-10.

2. Salvato, M. S., E. M. Shimomaye, and M. B. A. Oldstone. 1989. The primary structure of the lymphocytic choriomeningitis virus L gene encodes a putative RNA polymerase. Virology 169 : 377-384.

3. Antonucci, T. and W. Rutter. 1989. Hepatitis B virus promoters are regulated by the HBV enhancer in a tissue specific manner. Journal of Virology 63 : 579-585.

4. Honigwachs, J., O. Faktor, R. Dikstein, Y. Shaul, and O. Laub. 1989. Liver specific expression of hepatitis B virus is determined by the combined action of the core gene promoter and the enhancer. Journal of Virology 63 : 919-927.

5. Karpen, S., R. Banerjee, A. Zelent, P. Price, and G. Acs. 1988. Identification of protein- binding sites in the hepatitis B virus enhancer and core promoter domains. Molecular and Cellular Biology 8 : 5159-5165.

6. Roossinck, M. J., S. Jameel, S. H. Loukin, and A. Siddiqui. 1986. Expression of hepatitis B viral core region in mammalian cells. Molecular and Cellular Biology 6 : 1393-1400.

7. Schaller, H., M. Fischer. 1991. Transcriptional control of hepadnavirus gene expression.

Current topics in Microbiology and Immunology 168 : 21-39.

8 Seeger, C., B. Baldwin and B. C. Tennant. 1989. Expression of infectious woodchuck hepatitis virus in murine and avian fibroblast. Journal of Virology 63 : 4665-4669.

9. Shaul, Y. 1991. Regulation of hepadnavirus transcription. In : McLachlan, A. ed. Molecular biology of hepatitis B viruses. Boca Raton, FL. CRC Press pp 193-211.

10. Yaginuma, K. and K. Koike. 1989. Identification of a promoter region for 3. 6 kb mRNA of hepatitis B virus and specific cellular binding protein. Journal of Virology 63 : 2914-2920.

11. Yen, TSB. 1993. Regulation of hepatitis B virus gene expression. Seminars in Virology 4 : 33-42.

12. Carlson, J. O., M. K. Lynde-Mass, and Z. D. Shen. 1987. A nonstructural protein of feline panleukemia virus : expression in Escherichia coli and detection of multiple forms in infected cells. Journal of Virology 61 : 621.

13. Carter, B. J., B. A. Antoni, and D. F. Klessig. 1992. Adenovirus containing a deletion of the early region 2A gene allows growth of adeno-associated virus with decreased efficiency.

Virology 191 : 473.

14. Chang, L. S. and T. Shenk. 1990. The adenovirus DNA-binding protein stimulates the rate of transcription directed by adenovirus and adeno-associated virus promoters. Journal of Virology 64 : 2103.

15. Cotmore, S. F., L. J. Sturzenbecker, and P. Tattersall. 1983. The autonomous parvovirus MVM encodes two nonstructural proteins in addition to its capsid polypeptides. Virology 129 : 333.

16. Doerig, C. B. Hirt, J. P. Antonietti, and P Beard. 1990. Nonstructural protein for parvovirus B19 and minute virus of mice controls transcription. Journal of Virology 64 : 387.

17. Lederman, M., S. F. Cotmore, E. R. Stout and R. C. Bates. 1987. Detection of bovine parvovirus proteins homologous to the nonstructural NS-1 proteins of other autonomous parvoviruses. Journal of Virology 61 : 3612.

18. Liu, J. M., S. W. Green, Y. S. Hao, K. T. McDonagh, N. S. Young, and T. Shimada. 1991.

Upstream sequences within the terminal hairpin positively regulate th P6 promoter of B19 parvovirus. Virology 185 : 39.

19. Morgan, W. R. and D. C. Ward. 1986. Three splicing patterns are used to excise the small intron common to all minute virus of mice RNAs. Journal of Virology 60 : 1170.

20. Pinte, D., D. Dadachani, C. R. Astell, and D. C. Ward. 1983. The genome of minute virus, an autonomous parvovirus, encodes two overlapping transcription units. Nucleic Acids Research 11 : 1019.

21. Rhode, S. L. and P. R. Paradiso. 1983. Nucleotide sequence of H1 and mapping of its genes by hybrid arrest translations. Journal of Virology 45 : 173.

22. Richardson, W. D., B. J. Carter, and H. Westphal. 1980. Vero cells with adenovirus type 2 mRNA produce authentic viral polypeptide patterns : early mRNA promotes growth of adenovirus-associated virus. Proceedings of the National Academy of Sciences 77 : 931.

23. Samulski, R. J. and T. Shenk. 1988. Adenovirus ElB55-Mr polypeptide facilitates timely cytoplasmic accumulation of adeno-associated virus mRNA's. Journal of Virology 62 : 206.

24. Stillman, B. W., F. Tamonoi, M. B. Mathews. 1982. Purification of an adenovirus coded DNA polymerase that is required for initiation of DNA replication. Cell 31 : 613.

26. Cochran, M. A., C. Puckett, and B. Moss. 1985. In vitro mutagenesis of the promoter region for a vaccinia virus gene : evidence for tandem early and late regulatory signals. Journal of Virology 54 : 30-37.

27. Davison, A. J. and B. Moss. 1989. The structure of vaccinia virus early promoters.

Journal of Molecular Biology 210 : 749-769.

28. Ink, B. S. and D. J. Pickup. 1989. Transcription of pox virus early gene is regulated both by a short promoter element and by a transcriptional termination signal controlling transcriptional interference. Journal of Virology 63 : 4632-4644.

29. Moss, B. 1994. Vaccinia virus transcription. In : Conaway R, Conaway J, Eds.

Transcription. New York : Raven Press pp 185-206.

30. Weir, J. P. and B. Moss. 1987. Determination of the promoter region of an early vaccinia virus gene encoding thymidine kinase. Virology 158 : 206-210.

31. Bruen, J. A. 1991. Relationships among the positive strand and double-stranded RNA viruses as viewed through their RNA-dependent RNA polymerases. Nucleic Acids Research 19 : 217-226.

32. Drayna, D. and B. N. Fields. 1982. Activation and characterization of the reovirus transcriptase : genetic analysis. Journal of Virology 41 : 110-118.

33. Koonin, E. V., E. E. Gorbalenya, and K. M. Chumakov. 1989. Tentative identification of RNA-dependent RNA polymerases of ds RNA viruses and their relationship to positive strand RNA viral polymerases. FEBS Letters 252 : 42-46.

34. Morozov, S. Y. 1989. A possible relationship of reovirus putative RNA-polymerase to polymerases of positive strand RNA viruses. Nucleic Acids Research 17 : 5394-5394.

35. Starnes, M. C., and W. K. Joklik. 1993. Reovirus protein 83 is a polyt-dependent poly (G) polymerase. Virology 193 : 356-366.

36. Golemis, E. A., N. A. Speck, and N. Hopkins. 1990. Alignment of U3 region sequences of mammalian type C viruses : identification of highly conserved motifs and implication for enhancer design. Journal of Virology 64 : 534-542.

37. Graves, B. J., P. F. Johnson, S. L. McKnight. 1986. Homologous recognition of a promoter domain common to the MSV LTR and HSV tk gene. Cell 44 : 565-576.

38. Ryden, T. A. and K. Beemon. 1989. Avian retroviral long terminal repeats bind CCAAT/enhancer-binding protein. Molecular and Cellular Biology 9 : 1155-1164.

39. Dixon LK, Wilkinson PJ, Sumpton KJ, Ekue F. Diversity of the African swine fever virus genome. In : Darai G, ed. Molecular biology of iridoviruses. Boston : Kluwer Academic ; 1990 : 271-296.

40. Noteborn N, De Boer G, Van Roozelaar D, et al. Characterization of cloned chicken anemia virus DNA that contains all elements for the infectious replication cycle. J Virol 1991 ; 65 : 3131-3139.

41. Todd D, Niagro F, Ritchie B, et al. Comparison of three animal viruses with circular single-stranded DNA genomes. Arch Virol 1991 ; 117 : 129-135.

42. Vinuela E. African swine fever. Curr Top Microbiol Immunol 1985 ; 116 : 151-170.

43. Andino R, Rieckhof GE, Baltimore D. A functional ribonucleoprotein complex forms around the 5'end of poliovirus RNA. Cell 1990 ; 63 : 369-380.

44. Andrews NC, Baltimore D. Purification of a terminal uridylyltransferase that acts as host factor in the in vitro poliovirus replicase reaction. Proc Natl Acad Sci USA 1986 ; 83 : 221-225.

45. Callahan PL, Mizutani S, Colonno RJ. Molecular cloning and complete sequence determination of RNA genome of human rhinovirus type 14. Proc Natl Acad Sci USA 1985 ; 82 : 732-736.

46. Carroll AR, Rowlands DJ, Clarke BE. The complete nucleotide sequence of the RNA coding for the primary translation product of foot-and-mouth disease virus. Nucleic Acids Res 1984 ; 12 : 2461-2472.

47. Chumakov KV, Agol VI. Poly (C) sequence is located near the 5'end of the encephalomyocarditis virus RNA. Biochem Biophys Res Commun 1976 ; 71 : 551-557.

48. Cohen JI, Ticehurst JR, Purcell RH, Buckler-White A, Baroudy BM. Complete nucleotide sequence of wild-type hepatitis A virus ; comparison with different strains of hepatitis A virus and other picornaviruses. J Virol 1987 ; 61 : 50-59.

49. Harris TJR, Brown F. The location of the poly (C) tract in the RNA of foot-and-mouth disease virus. J Gen Virol 1976 ; 33 : 493-501.

50. Kitamura N, Semler B, Rothberg PG, et al. Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature 1981 ; 291 : 547-553.

50A. Palmenberg AC, Kirby EM, Janda MR, et al. The nucleotide and deduced sequences of the encephalomyocarditis viral polyprotein coding region. Nucleic Acids Res 1984 ; 12 : 2969- 2985.

51. Perez-Bercoff R, Gander M. The genomic RNA of mengovirus. I. Location of the poly (C) tract. Virology 1977 ; 80 : 426-429.

52. Pevear DC, Calenoff M, Rozhon E, Lipton HL. Analysis of the complete nucleotide sequence of the picornavirus Theiler's murine encephalomyelitis virus indicates that it is closely related to cardioviruses. J Virol 1987 ; 61 : 1507-1516.

53. Rowlands DJ, Harris TJR, Brown F. More precise location of the polycytidylic acid tract in foot and mouth disease virus RNA. J Virol 1978 ; 26 : 335-343.

54. Jiang X, Graham DY, Wang K, Estes MK. Norwalk virus genome cloning and characterization. Science 1990 ; 250 : 1580-1583.

55. Jiang X, Wang M, Wang K, Estes MK. Sequence and genomic organization of Norwalk virus. Virology 1993 ; 195 : 51-61.

56. Jiang B, Monroe SS, Koonin EV, Stine SE, Glass RI. RNA sequence of astrovirus : distinctive genomic organization and a putative retro-virus-like ribosomal frameshifting signal that directs the viral replicase synthesis. Proc Natl Acad Sci USA 1993 ; 90 : 10539-10543.

57. Koonin EV. The phylogeny of RNA-dependent RNA polymerases of positive-strand RNA viruses. J Gen Virol 1991 ; 72 : 2197-2206.

58. Lewis TL, Greenberg HB, Hermann JE, Smith LS, Matsui SM. Analysis of astrovirus serotype 1 RNA, identification of the viral RNA-dependent RNA polymerase motif, and expression of a viral structural protein. J Virol 1994 ; 68 : 77-83.

59. Willcocks MM, Carter MJ. The 3'terminal sequence of a human astrovirus. Arch Virol 1992 ; 124 : 279-289.

60. Willcocks MM, Carter MJ. Identification and sequence determination of the capsid protein gene of human astrovirus serotype 1. FEMS Microbiol Lett 1993 ; 114 : 1-8.

61. Willcocks MM, Brown TDK, Madeley CR, Carter MJ. The complete sequence of a human astrovirus. J Gen Virol 1994 ; 75 : 1785-1788.

70. Dominguez G, Wang, C-Y, Frey TK. Sequence of the genome RNA of rubella virus : evidence for genetic rearrangement during Togavirus evolution. Virology 1990 ; 177 : 225-238.

71. Frey TK. Molecular biology of rubella virus. Advances in Virus Research 1994 ; 44 : 69- 160.

72. Hardy WR, Strauss JH. Processing the nonstructural polyproteins of Sindbis virus : nonstructural proteinase is in the C-terminal half of nsP2 and functions both in cis and in trans.

J Virol 1989 ; 63 : 4653-4664.

73. Kamer G, Argos P. Primary structural comparison of RNA-dependent polymerases from plant, animal and bacterial viruses. Nucleic Acids Res 1984 ; 12 : 7269-7282.

74. Levis R, Schlesinger S, Huang HV. Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription. J Virol 1990 ; 64 : 1726-1733.

75. Marr LD, Wang C-Y, Frey TK. Expression of the rubella virus non-structural protein ORF and demonstration of proteolytic processing. Virology 1994 ; 198 : 586-592.

76. Niesters HGM, Strauss JH. Defined mutations in the 5'nontranslated sequence of Sindbis virus RNA. J Virol 1990 ; 64 : 4162-4168.

77. Niesters HGM, Strauss JH. Mutagenesis of the conserved 51-nucleotide region of Sindbis virus. J Virol 1990 ; 64-1639-1647.

78. Raju R, Huang HV. Analysis of Sindbis virus promoter recognition in vivo, using novel vectors with two subgenomic mRNA promoters. J Virol 1991 ; 65 : 2531-2510.

79. Sawicki DL, Sawicki SG. A second nonstructural protein functions in the regulation of alphavirus negative-strand RNA synthesis. J Virol 1993 ; 67 : 3605-3610.

80. Strauss EG, Strauss JH. Structure and Replication of the Alphavirus Genome. In : Schlesinger S, Schlesinger MJ, Eds. The Togaviridae and Flaviviridae. New York : Plenum Press, 1986 ; 35-82.

81. Wang Y-F, Sawicki SG, Sawicki DL. Sindbis nsPl functions in negative-strand RNA synthesis. J Virol 1991 ; 65 : 985-988.

82. Baltimore D, Huang AS, Stampfer M. Ribonucleic acid synthesis of vesicular stomatitis virus. II. An RNA polymerase in the virion. Proc Natl Acad Sci USA 1970 ; 66 : 572-576.

83. Banerjee AK, Barik S. Gene expression of vesicular stomatitis virus genome RNA.

Virology 1992 ; 188 : 417-428.

84. Bredenbeek PJ, Pachuk CJ, Noten FA, et al. The primary structure and expression of the second open reading frame of the polymerase gene of the coronavirus MHV-A59 ; a highly conserved polymerase is expressed by an efficient ribosomal frame-shifting mechanism.

Nucleic Acids Res 1990 ; 18 : 1825-1832.

85. Brierley I, Digard P, Inglis SC. Characterization of an efficient coronavirus ribosomal frameshifting signal : requirement for an RNA pseudoknot. Cell 1989 ; 57 : 537-547.

86. Brierley I, Rolley NJ, Jenner AJ, Inglis SC. Mutational analysis of the RNA Pseudoknot component of a coronavirus ribosomal frameshifting signal. J Mol Biol 1991 ; 220 : 889-902.

87. Herold J, Raabe T, Schelle-Prinz B, Siddell SG. Nucleotide sequence of the human coronavirus 229E RNA polymerase locus. Virology 1993 ; 195 : 680-691.

88. Lee HJ, Shieh CK, Gorbalenya AE, et al. The complete sequence (22 kilobases) of murine coronavirus gene 1 encoding the putative proteases and RNA polymerase. Virology 1991 ; 180 : 567-582.

89. Perlman S, Ries D, Bolger E, Chang LJ, Stoltzfus CM. MHV nucleocapsid synthesis in the presence of cycloheximide and accumulation of negative strand MHV RNA. Virus Res 1986 ; 6 : 261-272.

90. Sawicki SG, Sawicki DL. Coronavirus minus-strand RNA synthesis and effect of cycloheximide on coronavirus RNA synthesis. J Virol 1986 ; 57 : 328-334.

91. Emerson SU. Transcription of vesicular stomatitis virus. In : Wagner RR, ed. The rhabdoviruses. New York : Plenum ; 1987 : 245-269.

92. Wertz GW, Davis NL, Patton J. The role of proteins in vesicular stomatitis virus RNA replication. In : Wagner RR, ed. The rhabdoviruses. New York : Plenum ; 1987 : 271-296.

93. Burkreyev AA, Volchkov VE, Blinov VM, Netesov SV. The VP35 and VP40 proteins of filoviruses : homology between Marburg and Ebola viruses. FEBS Lett 1993 ; 322 : 41-46.

94. Burkreyev AA, Volchkov VE, Blinov VM, Netesov SV. The GP-protein of Marburg virus contains the region similar to the"immunosuppressive domain"of oncogenic retrovirus P15E proteins. FEBS Lett 1993 ; 323 : 183-187.

95. Feldmann H, Muhlberger E, Randolf A, et al. Marburg virus, a filovirus : messenger RNAs, gene order, and regulatory elements of the replication cycle. Virus Res 1992 ; 24 : 1-19.

96. Kiley MP, Regnery RL, Johnson K. M. Ebola virus : identification of virion structural proteins. J Gen Virol 1980 ; 49 : 333-341.

97. Miihlberger E, Sanchez A., Randolf A, et al. The nucleotide sequence of the L gene of Marburg virus, a filovirus : homologies with paramyxoviruses and rhabdoviruses. Virology 1992 ; 187 : 534-547.

98. Sanchez A, Kiley MP, Holloway BP, Auperin DD. Sequence analysis of the Ebola virus genome : organization, genetic elements, and comparison with the genome of Marburg virus.

Virus Res 1993 ; 29 : 215-240.

99. Sanchez A, Kiley MP, Holloway BP, McCormic JB, Auperin DD. The nucleoprotein gene of Ebola virus : cloning, sequencing, and in vitro expression. Virology 1989 ; 170 : 81-91.

100. Sanchez A, Kiley MP, Klenk H-D, Feldmann H. Sequence analysis of the Marburg virus nucleoprotein gene : comparison to Ebola virus and other non-segmented negative-strand RNA viruses. J Gen Virol 1992 ; 73 : 347-357.

101. Teepe RG, Johnson BK, Ocheng D, et al. A probable case of Ebola virus hemorrhagic fever in Kenya. East Afr Med J 1983 ; 60 : 718-722.

102. Will C, Linder D, Slenczka W, Klenk H-D, Feldmann H. Marburg virus gene four encodes for the virion membrane protein, a type I transmembrane glycoprotein. J Virol 1992 ; 67 : 1203-1210.

103. Blumberg BM, Kolakofsky D. Intracellular vesicular stomatitis virus leader RNAs are found in nucleocapsid structures. J Virol 1981 ; 40 : 568-576.

104. Blumberg BM, Leppert M, Kolakofsky D. Interaction of VSV leader RNA and nucleocapsid protein may control VSV genome replication. Cell 1981 ; 23 : 837-845.

105. Curran J, Homann H, Buchholz C, Rochat S, Neubert W, Kolakofsky D. The hypervariable C-terminal tail of the Sendai paramyxovirus nucleocapsid protein is required for template function but not for RNA encapsidation. J Virol 1993 ; 67 : 4358-4364.

106. Horikami SM, Curran J, Kolakofsky D, Moyer SA. Complexes of Sendai virus NP-P and P-L proteins are required for defective interfering particle genome replication in vitro. J Virol 1992 ; 66 : 4901-4908.

107. Robinson WS. Ribonucleic acid polymerase activity in Sendai virions and nucleocapsid. J Virol 1971 ; 8 : 81-86.

107A. Stone HO, Portner A, Kingsbury DW. Ribonucleic acid transcriptases in Sendai virions and infected cells. J Virol 1971 ; 8 : 174-180.

108. Hay, AJ, Lomniczi B, Bellamy AR, Skehel JJ. Transcription of the influenza virus genome. Virology 1977 ; 83 : 337-355.

109. Lamb RA, Choppin PW. Synthesis of influenza virus proteins in infected cells : translation of viral polypeptides, including three P polypeptides, from RNA produced by primary transcription. Virology 1976 ; 74 : 504-519.

110. Lamb RA, Choppin PW. The gene structure and replication of influenza virus. Ann Rev Biochem 1983 ; 52 : 467-506.

111. Shapiro GI, Gurney T Jr, Krug RM Influenza virus gene expression : control mechanisms at early and late times of infection and nuclear cytoplasmic transport of virus- specific RNAs. J Virol 1987 ; 61 : 764-773.

112. Skehel JJ. Early polypeptide synthesis in influenza virus-infected cells. Virology 1973 ; 56 : 394-399.

113. Smith GL, Hay AJ. Replication of the influenza virus genome. Virology 1982 ; 118 : 96- 108.

114. de Haan P, Kormelink R, de Oliveira RR, van Poelwijk F, Peters D, Golbach R.

Tomato spotted wilt virus L RNA encodes a putative RNA polymerase. J Gen Virol 1991 ; 72 : 2207-2216.

115. de Haan P, Wagemakers L, Peters D, Goldbach R. Molecular cloning and terminal sequence determination of the S and M RNAs of tomato spotted wilt virus. J Gen Virol 1989 ; 70 : 3469-3473.

116. de Haan P, Wagemakers L, Peters D, Goldbach R. The S RNA segment of tomato spotted wilt virus has an ambisense character. J Gen Virol 1990 ; 71 : 1001-1007.

117. Elliott RM. Nucleotide sequence analysis of the large (L) genomic RNA segment of Bunyamwera virus, the prototype of the family Bunyaviridae. Virology 1989 ; 173 : 426-436.

118. Elliott RM. Nucleotide sequence analysis of the small (S) RNA segment of Bunyamwera virus, the prototype of the family Bunyaviridae. J Gen Virol 1989 ; 70 : 1281-1285.

119. Kormelink R, de Haan P, Meurs C, Peters D, Goldbach R. The nucleotide sequence of the M RNA segment of tomato spotted wilt virus, a bunyavirus with two ambisense RNA segments. J Gen Virol 1992 ; 73 : 2795-2804.

120. Lees JF, Pringle CR, Elliot RM. Nucleotide sequence of the Bunyamwera virus M RNA segment : conservation of structural features in the bunyavirus glycoprotein gene product.

Virology 1986 ; 148 : 1-14.

121. Marriott AC, el Ghorr AA, Nuttall PA. Dugbe nairovirus M RNA : nucleotide sequence and coding strategy. Virology 1992 ; 190 : 606-615.

122. Schmaljohn CS. Nucleotide sequence of the L genome segment of Hantaan virus. Nucleic Acids Res 1990 ; 18 : 6728.

123. Schmaljohn CS, Hasty SE, Dalrymple JM, et al. Antigenic and genetic properties of viruses linked to hemorrhagic fever with renal syndrome. Science 1985 ; 227 : 1041-1044.

124. Schmaljohn CS, Jennings GB, Hay J, Dalrymple JM. Coding strategy of the S genome segment of Hantaan virus. Virology 1986 ; 155 : 633-643.

125. Schmaljohn CS, Schmaljohn AL, Dalrymple JM. Hantaan virus M RNA : coding strategy, nucleotide sequence, and gene order. Virology 1987 ; 157 : 31-39.

126. Ward VK, Marriott AC, el Ghorr AA, Nuttall PA. Coding strategy of the S RNA segment of Dugbe virus (Nairovirus ; Bunyaviridae). Virology 1990 ; 175 : 518-524.

127 Allen, G. P. and Coogle, L. D. (1988). Characterization of an equine herpesvirus type 1 gene encoding a glycoprotein (gpl3) with homology to herpes simplex virus glycoprotein C. J.

Virol. 62 (8), 2850-2858 128. Robertson, G. R. and Whalley, J. M. (1988). Evolution of the herpes thymidine kinase : identification and comparison of the equine herpesvirus 1 thymidine kinase gene reveals similarity to a cell-encoded thymidylate kinase. Nucleic Acids Res. 16 (23), 11303-11317 129. Whalley, J. M., Robertson, G. R., Scott, N. A., Hudson, G. C., Bell, C. W. and Woodworth, L. M. (1989). Identification and nucleotide sequence of a gene in equine herpesvirus 1 analogous to the herpes simplex virus gene encoding the major envelope glycoprotein gB. J. Gen. Virol. 70 (Pt 2), 383-394

130. Mann, R. P., Yalamanchili, V. R. and O'Callaghan, D. J. (1989). Functional mapping and DNA sequence of an equine herpesvirus 1 origin of replication. J. Virol. 63 (3), 1275-1283 131. Guo, P. X., Geobel, S., Davis, S., Perkus, M. E., Languet, B., Desmettre, P., Allen, G. and Paoletti, E. (1989). Expression in recombinant vaccinia virus of the equine herpesvirus 1 gene encoding glycoprotein gpl3 and protection of immunized animals. J. Virol. 63 (10), 4189-4198 132. Grundy, F. J., Baumann, R. P. and O'Callaghan, D. J. (1989). DNA sequence and comparative analyses of the equine herpesvirus type 1 immediate early gene. Virology 172 (1), 223-236 133. Guo, P. X., Goebel, S., Perkus, M. E., Taylor, J., Norton, E., Allen, G., Languet, B., Desmettre, P. and Paoletti, E. (1990). Coexpression by vaccinia virus recombinants of equine herpesvirus 1 glycoproteins gpl3 and gpl4 results in potentiated immunity. J. Virol. 64 (5), 2399-2406 134. Audonnet, J. C., Winslow, J., Allen, G. and Paoletti, E. (1990). Equine herpesvirus type 1 unique short fragment encodes glycoproteins with homology to herpes simplex virus type 1 gD, gI and gE. J. Gen. Virol. 71 (Pt 12), 2969-2978 135. Yalamanchili, R. R. and O'Callaghan, D. J. (1990). Sequence and organization of the genomic termini of equine herpesvirus type 1. Virus Res. 15 (2), 149-161 136. Yalamanchili, R. R., Raengsakulrach, B. and O'Callaghan, D. J. (1991). Equine herpesvirus 1 sequence near the left terminus codes for two open reading frames. Virus Res.

18 (2-3), 109-116 137. Robertson, G. R., Scott, N. A., Miller, J. M., Sabine, M., Zheng, M., Bell, C. W. and Whalley, J. M. (1991). Sequence characteristics of a gene in equine herpesvirus 1 homologous to glycoprotein H of herpes simplex virus. DNA Seq. 1 (4), 241-249 138. Elton, D. M., Halliburton, I. W., Killington, R. A., Meredith, D. M. and Bonass, W. A.

(1991). Sequence analysis of the 4. 7-kb BamHI-EcoRI fragment of the equine herpesvirus type-1 short unique region. Gene 101 (2), 203-208

139. Flowers, C. C., Eastman, E. M. and O'Callaghan, D. J. (1991). Sequence analysis of a glycoprotein D gene homolog within the unique short segment of the EHV-1 genome.

Virology 180 (1), 175-184 140. Whalley, M., Robertson, G., Bell, C., Love, D., Elphinstone, M., Wiley, L. and Craven, D. (1991). Identification and comparative sequence analysis of a gene in glycoprotein D gene. Virus Genes 5 (4), 313-325 141. Holden, V. R., Yalamanchili, R. R., Harty, R. N. and O'Callaghan, D. J. (1992). ICP22 homolog of equine herpesvirus 1 : expression from early and late promoters. J. Virol. 66 (2), 664-673 142. Telford, E. A., Watson, M. S., McBride, K. and Davison, A. J. (1992). The DNA sequence of equine herpesvirus-1. Virology 189 (1), 304-316 143. Khudyakov, Y. E., Fields, H. A., Favorov, M. O., Khudyakova, N. S., Bonafonte, M. T. and Holloway, B. (1993). Synthetic gene for the hepatitis C virus nucleocapsid protein.

Nucleic Acids Res. 21 (11), 2747-2754 144. Salvato, M. and Shimomaye, E. M. (1989). The completed sequence of lymphocytic choriomeningitis virus reveals a unique RNA structure and a gene for a zinc-finger protein.

Virology 173, 1-10 145. Salvato, M., Shimomaye, E. and Oldstone, M. B. (1989). The primary structure of the lymphocytic choriomeningitis virus L gene encodes a putative RNA polymerase. Virology 169 (2), 377-384 146. Valenzuela, P., Quiroga, M., Zalvidar, J., Gray, P. and Rutter, W. J. (1980). The nucleotide sequence of the hepatitis B viral genome and the identification of the major viral genes, (in) Fields, B. N., Jaenisch, R. and Fox, C. F. (Eds.) ; ANIMAL VIRUS GENETICS : 57-70 ; Academic Press, New York 147. Petzold, D. R., Tautz, B., Wolf, F. and Drescher, J. (1999). Infection chains and evolution rates of Hepatitis B Virus in nosocomially infected cardiac transplant recipients. J.

Med. Virol. In press

148. Norder, H., Courouce, A. M. and Magnius, L. O. (1994). Complete genomes, phylogenetic relatedness, and structural proteins of six strains of the hepatitis B virus, four of which represent two new genotypes. Virology 198 (2), 489-503 149. Chen, K. C., Shull, B. C., Moses, E. A., Lederman, M., Stout, E. R. and Bates, R. C.

(1986). Complete nucleotide sequence and genome organization of bovine parvovirus. J.

Virol. 60 (3), 1085-1097 150. Chen, K. C., Shull, B. C., Lederman, M., Stout, E. R. and Bates, R. C. (1988). Analysis of the termini of the DNA of bovine parvovirus : demonstration of sequence inversion at the left terminus and its implication for the replication model. J. Virol. 62 (10), 3807-3813 151. Seeger, C., Ganem, D. and Varmus, H. E. (1984). Nucleotide sequence of an infectious molecularly cloned genome of ground squirrel hepatitis virus. J. Virol. 51, 367-375 152. Blundell, M. C., Beard, C. and Astell, C. R. (1987). In vitro identification of a B19 parvovirus promoter. Virology 157, 534-538 153. Park, K. and Atchison, M. L. (1991). Isolation of a candidate repressor/activator, NF-E1 (YY-1, delta), that binds to the immunoglobulin kappa 3'enhancer and the immunoglobulin heavy-chain mu E1 site. Proc. Natl. Acad. Sci. U. S. A. 88 (21), 9804-9808 154. Shi, Y., Seto, E., Chang, L. S. and Shenk, T. (1991). Transcriptional repression by YY1, a human GLI-Kruppel-related protein, and relief of repression by adenovirus E1A protein. Cell 67 (2), 377-388 155. Shade, R. O., Blundell, M. C., Cotmore, S. F., Tattersall, P. and Astell, C. R. (1986).

Nucleotide sequence and genome organization of human parvovirus B19 isolated from the serum of a child during aplastic crisis. J. Virol. 58 (3), 921-936 156. Astelle, C. R., Thomson, M., Merchlinsky, M. and Ward, D. C. (1983). The complete DNA sequence of minute virus of mice, an autonomous parvovirus. Nucleic Acids Res. 11 (4), 999-1018

157. Astell, C. R., Gardiner, E. M. and Tattersall, P. (1986). DNA sequence of the lymphotropic variant of minute virus of mice, MVM (i), and comparison with the DNA sequence of the fibrotropic prototype strain. J. Virol. 57 (2), 656-669 158. Morgan, W. R. and Ward, D. C. (1986). Three splicing patterns are used to excise the samll intron common to all minute virus of mice RNAs. J. Virol. 60 (3), 1170-1174 159. Pitcovski, J., Mualem, M., Rei-Koren, Z., Krispel, S., Gallili, G., Michael, A. and Goldberg, D. (1998). The complete DNA sequence and genome organization of the avian adenovirus, hemorrhagic enteritis virus. Virology 249 (2), 307-315 160. Kidd, A. H., Garwicz, D. and Oberg, M. (1995). Human and simian adenoviruses : phylogenetic inferences from analysis of VA RNA genes. Virology 207 (1), 32-45 161. Kidd, A. H., Garwicz, D. and Oberg, M. (1995). Human and simian adenoviruses : phylogenetic inferences from analysis of VA RNA genes. Virology 207 (1), 32-45 162. Yagubi, A., Ojkic, D., Bautista, D. and Haj-Ahmad, Y. (1998). Sequencing analysis of the region encoding the DNA polymerase of bovine adenovirus serotypes 2 and 3.

Intervirology In press 163. Venkatesan, S., Baroudy, B. M. and Moss, B. (1981). Distinctive nucleotide sequences adjacent to multiple initiation and termination sites of an early vaccinia virus gene. Cell 25 (3), 805-813 164. Cochran, M. A., Puckett, C. and Moss, B. (1985). In vitro mutagenesis of the promoter region for a vaccinia virus gene : evidence for tandem early and late regulatory signals. J.

Virol. 54 (1), 30-37 165. Rosel, J. L., Earl, P. L., Weir, J. P. and Moss, B. (1986). Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIII H genome fragment. J. Virol. 605, 436-449 166. Broyles, S. S. and Moss, B. (1986). Homology between RNA polymerases of poxviruses, prokaryotes, and eukaryotes : nucleotide sequence and transcriptional analysis of

vaccinia virus genes encoding 147-kDa and 22-kDa subunits. Proc. Natl. Acad. Sci. U. S. A.

835, 3141-3145 167. Nakashima, N., koizumi, M., Watanabe, H. and Noda, H. (1996). Complete nucleotide sequence of the Nilaparvata lugens reovirus : a putative member of the genus Fijivirus. J. Gen.

Virol. 77 (Pt 1), 139-146 168. Lew, J. F., Petric, M., Kapikian, A. Z., Jiang, X., Estes, M. K. and Green, K. Y. (1994).

Identification of Minireovirus as a Norwalk-like virus in pediatric patients with gastroenteritis.

J. Virol. 68, 3391-3396 169. Lenz, J., Celander, D., Crowther, R. L., Patarca, R., Perkins, K. D. W. and Haselthine, W. A. (1984). Determination of the leukaemogenicity of a murine retrovirus by sequences within the long terminal repeat. Nature 308 (5958), 467-470 170. Hiromasa, M., Katsutoshi, S., Mamoru, H. 1 and Seiga, I. 12/03/1993. Production of Protein by Recombinant Animal Cell. Patent : JP 1993317077-A 1 171. Sjottem, E., Anderssen, S. and Johansen, T. (1996). The promoter activity of long terminal repeats of the HERV-H family of human retrovirus-like elements is critically dependent on Spl family proteins interacting with a GC/GT box located immediately 3'to the TATA box. J. Virol. 70 (1), 188-198 172. Anderssen, S., Sjottem, E., Svineng, G. and Johansen, T. (1997). Comparative analyses of LTRs of the ERVk-H family of primate-specific retrovirus-like elements isolated from marmoset, African green monkey, and man. Virology 234 (1), 14-30 173. Richins, R. D., Scholthof, H. B. and Shepherd, R. J. (1987). Sequence of figwort mosaic virus DNA (caulimovirus group). Nucleic Acids Res. 15 (20), 8451-8466 174. Hertig, K. C., Coupar, B. E., Gould, A. R. and Boyle, D. B. (1997). Field and vaccine strains of fowlpox virus carry integrated sequences from the avian retrovirus, reticuloendotheliosis virus. Virology 235 (2), 367-376

175. Mulders, M. N., Reimerink, J. H. J., Stenvik, M., Van der Avoort, H. G. A. M., Hovi, T. and Koopmans, M. P. G. A Sabin Vaccine-Derived Field Isolate of Poliovirus Type 1 Displaying Aberrant Phenotypic and Genotypic Features, Including a Deletion in Antigenic Site 1. Unpublished 176. Boyce-Jacino, M. T., Resnick, R. and Faras, A. J. (1989). Structural and functional characterization of the unusually short long terminal repeats and their adjacent regions of a novel endogenous avian retrovirus. Virology 173, 157-166 177. Katz, R. A., Cullen, B. R., Malavarca, R. and Skalka, A. M. (1986). Role of the avian retrovirus mRNA leader in expression : Evidence for novel translational control. Mol. Cell.

Biol. 6, 372-379 178. Patschinsky, T., Jansen, H. W., Bloecker, H., Frank, R. and Bister, K. (1986).

Structure and transforming function of transduced mutant alleles of the chicken c-myc gene. J.

Virol. 59, 341-353 179. Marques, M. I. and Costa, J. V. (1995). Functional and molecular characterization of African swine fever virus mutants resistant to phosphonoacetic acid. Virology 214 (1), 72-81 180. Martins, A., Ribeiro, G., Marques, M. I. and Costa, J. V. (1994). Genetic identification and nucleotide sequence of the DNA polymerase gene of African swine fever virus. Nucleic Acids Res. 22 92), 208-213 181. Furione, M., Guillot, S., Otelea, D., Balanant, J., Candrea, A. and Crainic, R. (1993).

Polioviruses with natural recombinant genomes isolated from vaccine-associated paralytic poliomyelitis (1993). Virology 196 (1), 199-208 182. Pevear, D. C., Oh, C. K., Cunningham, L. L., Calenoff, M. and Jubelt, B. (1990).

Localization of genomic regions specific for the attenuated, mouse-adapted poliovirus type 2 strain W-2. J. Gen. Virol. 71 (Pt 1), 43-52 183. Jenkins, O., Booth, J. D., Minor, P. D. and Almond, J. W. (1987). The complete nucleotide sequence of coxsackievirus B4 and its comparison to other members of the Picorniviridae. J. Gen. Virol. 68 (Pt 7), 1835-1848

184. Pevear, D. C., Borkowski, J. A., Calenoff, M., Oh, C. K., Ostrawski, B. and Lipton, H. L. (1988). Insights into Theiler's virus neurovirulence based on a genomic comparison of the neurovirulent GDVII and less virulent BeAn strains. Virology 165, 1-12 185. Frey, T. K., Marr, L. D., Hemphill, M. L. and Dominguez, G. (1986). Molecular cloning and sequencing of the region of the rubella virus genome coding for glycoprotein E1. Virology 154 (1), 228-232 186. Frey, T. K. and Marr, L. D. (1988). Sequence of the region coding for virion proteins C and E2 and the carboxy terminus of the nonstructural proteins of rubella virus : comparison with alphaviruses. Gene 62 (1), 85-99 187. Yamanaka, K., Ishihama, A. and Nagata, K. (1988). Translational regulation of Influenza virus mRNAs. Virus Genes 2, 19-30 188. Yamanaka, K., Ishihama, A. and Nagata, K. (1988). Translational regulation of Influenza virus mRNAs. Virus Genes 2, 19-30 189. Kormelink, R., de Haan, P., Meurs, C., Peters, D. and Goldbach, R. (1993). The nucleotide sequence of the M RNA segment of tomato spotted wilt virus, a bunyavirus with two ambisense RNA segments. J. Gen. Virol. 74 (Pt 4), 790 190. Ou, J. H., Strauss, E. G. and Strauss, J. H. (1981). Comparative studies of the 3'- terminal sequences of several alpha virus RNAs. Virology 109 (2), 281-289 191. Rice, C. M. and Strauss, J. H. (1981). Nucleotide sequence of the 26S mRNA of Sindbis virus and deduced sequence of the encoded virus structural proteins. Proc. Natl. Acad. Sci.

U. S. A. 78 (4), 2062-2066 192. Rice, C. M. and Strauss, J. H. (1981). Synthesis, cleavage and sequence analysis of DNA complementary to the 26 s messenger RNA of Sindbis virus. J. Mol. Biol. 150 (3), 315-340 193. Monroe, S. S., Ou, J. H., Rice, C. M., Schlesinger, S., Strauss, E. G. and Strauss, J. H. (1982). Sequence analysis of cDNA's derived from the RNA of Sindbis virions and of defective interfering particles. J. Virol. 41 (1), 153-162

194. Ou, J. H., Trent, D. W. and Strauss, J. H. (1982). The 3'-non-coding regions of alphavirus RNAs contain repeating sequences. J. Mol. Biol. 156 (4), 719-730 195. Ou, J. H., Rice, C. M., Dalgarno, L., Strauss, E. G. and Strauss, J. H. (1982). Sequence studies of several alphavirus genomic RNAs in the region containing the start of the subgenomic RNA. Proc. Natl. Acad. Sci. U. S. A. 79 (17), 5235-5239 196. Ou, J. H., Strauss, E. G. and Strauss, J. H. (1983). The 5'-terminal sequences of the genomic RNAs of several alphaviruses. J. Mol. Biol. 168 (1), 1-15 197. Strauss, E. G., Rice, C. M. and Strauss, J. H. (1983). Sequence coding for the alphavirus nonstructural proteins is interrupted by an opal termination codon. Proc. Natl. Acad. Sci.

U. S. A. 80 (17), 5271-5275 198. Strauss, E. G., Rice, C. M. and Strauss, J. H. (1984). Complete nucleotide sequence of the genomic RNA of Sindbis virus. Virology 133 (1), 92-110 199. Herold, J. and Siddell, S. G. (1993). An'elaborated'pseudoknot is required for high frequency frameshifting during translation of HCV 229E polymerase mRNA. Nucleic Acids Res. 21 (25), 5838-5842 200. Feldmann, H., Muhlberger, E., Randolf, A., Will, C., Kiley, M. P., Sanchez, A. and Klenk, H. D. (1992). Marburg virus, a filovirus : messenger RNAs, gene order, and regulatory elements of the replication cycle. Virus Res. 24 (1), 1-19 201. Smeenk, C. a., Wright, K. E., Burns, B. F., Thaker, A. J. and Brown, E. G. (1996).

Mutations in the hemagglutinin and matrix genes of a virulent influenza virus variant, A/FM/1/47-MA, control different stages in pathogenesis. Virus Res. 44 (2), 79-95 202. Shioda, T., Iwasaki, K. and Shibuta, H. (1986). Determination of the complete nucleotide sequence of the Sendai virus genome RNA and the predicted amino acid sequences of the F, HN and L proteins. Nucleic Acids Res. 14 (4), 1545-1563

203. Schreier, E., Petzold, D. R., Michel, S. and Dittmann, S. (1988). Evolution of influenza polymerase : nucleotide sequence of the PB2 gene of A/Chile/1/83 (H1 N1). Arch. Virol. 103 (3-4), 179-187 204. Ohnishi, J., Kirita, M., Hosokawa, D. and Tsuda, S. (1997). Sequence analysis for M RNA segment of tomato spotted wilt tospovirus isolated in Japan. Ann. Phytopathol. Soc. Jpn.

63, 277 (1997) 205. Won-Staal, F. et al. 1985. Complete nucleotide sequence of the AIDS virus, HTLV-III.

Nature 313 : 277-284.

206. Starich, B., L. Ratner, S. F. Josephs, T. Okamoto, R. C. Gallo, and F. Wong-Staal.

1985. Characterization of long terminal repeat sequences of HTLV-111. Science 227 : 538-540.

207. di Marzo, V. F., T. D. Copeland, A. L. DeVico, R. Rahman, S. Oroszlan, R. C. Gallo, and M. G. Sarngadharan. 1986. Characterization of highly immunogenic p66/p51 as the reverse transcriptase of HTLV-III/LAV. Science 231 : 1289-1291.

208. Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian. 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor, Spl. Science 232 : 755-759.

209. Lightfoote, M. M., J. E. Coligan, T. M. Folks, A. S. Fauci, M. A. Martin, and S.

Venkatesan. 1986. Structural characterization of reverse transcriptase and endonuclease polypeptides of the acquired immunodeficiency syndrome retrovirus. J. Virol 60 771-775.

210. Mackem, S. and B. Roizman. 1982. Structural features of the herpes simplex virus alpha gene 4, 0, and 27 promoter regulatory sequences which confer alpha regulation on chimeric thymidine kinase genes. J. Virol. 44 : 939-949.

211. Mackem, S. and B. Roizman. 1982. Differentiation between alpha promoter and regulator regions of herpes simplex virus 1 : the functional domains and sequence of movable alpha regulator. Proc. Natl. Acad. Sci. U. S. A. 79 : 4917-4921.

212. McGeoch, D. J., A. Dolan, S. Donald, and D. H. Brauer. 1986. Complete DNA sequence of the short repeat region in the genome of herpes simplex virus type 1. Nucleic Acids Res.

14 : 1727-1745.

213. Jiang, B., Monroe, S. S., Koonin, E. V., Stine, S. E. and Glass, R. I. (1993). RNA sequence of astrovirus : distinctive genomic organization and a putative retrovirus-like ribosomal frameshifting signal that directs the viral replicase synthesis. Proc. Natl. Acad. Sci.

U. S. A. 90 (22), 10539-10543 214. Lewis, T. L., Greenberg, H. B., Herrmann, J. E., Smith, L. S. and Matsui, S. M. (1994).

Analysis of astrovirus serotype 1 RNA, identification of the viral RNA-dependent RNA polymerase motif, and expression of a viral structural protein. J. Virol. 68 (1), 77-83 215. Harasawa, R. and Giangaspero, M. (1999). Genetic variation of the 5'and 3'- untranslated regions of classical swine fever virus genome. Unpublished 216. Hayashi, N., Higashi, H., Kaminaka, K., Sugimoto, H., Esumi, M., Komatsu, K., Hayashi, K., Sugitani, M., Suzuki, K., Tadao, O. et, al. (1993). Molecular cloning and heterogeneity of the human hepatitis C virus (HCV) genome. J. Hepatol. 17 Suppl 3, S94- S107 217. van Dinten, L. C., den Boon, J. A., Wassenaar, A. L., Spaan, W. J. and Snijder, E. J. (1997). An infectious arterivirus cDNA clone : identification of a replicase point mutation that abolishes discontinuous mRNA transcription. Proc. Natl. Acad. Sci. U. S. A. 94 (3), 991-996 218. Murtaugh, M. P., Elam, M. R. and Kakach, L. T. (1995). Comparison of the structural protein coding sequences of the VR-2332 and Lelystad virus strains of the PRRS Virus. Arch.

Virol. 140 (8), 1451-1460 219. Kapur, V., Elam, M. R., Pawlovich, T. M. and Murtaugh, M. P. (1996). Genetic variation in porcine reproductive and respiratory syndrome virus isolates in the midwestern United States. J. Gen. Virol. 77 (pt 6), 1271-1276

220. Nelsen, C. J., Murtaugh, M. P. and Faaberg, K. S. (1999). Porcine reproductive and respiratory syndrome virus comparison : divergent evolution on two continents. J. Virol. 73 (1), 270-280 221. den Boon, J. A., Snijder, E. J., Chirnside, E. D., de Vries, A. A., Horzinek, M. C. and Spaan, W. J. (1991). Equine arteritis virus is not a togavirus but belongs to the coronavirus- like superfamily. J. Virol. 65 (6), 2910-2920 222. Bucholz, U. J., Finke, A. and Conzelmann, K.-K. (1999). Generation of bovine respiratory syncytial virus (BRSV) from cDNA : BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter. J. Virol. 73, 251-259 223. Tordo, N., Poch, O., Ermine, A. and Keith, G. (1986). Primary structure of leader RNA and nucleoprotein genes of the rabies genome : segmented homology with VSV. Nucleic Acids Res. 14 (6), 2671-2683 224. Gould, A. R. Characterization of a novel lyssavirus isolated from pteropid bats in Australia. Unpublished 225. Morzunov, S. P., Winton, J. R. and Nichol, S. T. (1995). The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus. Virus Res. 38 (2-3), 175-192 226. Fang, R., Luo, Z. and Zhao, H. (1998). Novel structure of the rice yellow stunt virus genome : a plant rhabdovirus encodes seven genes. Unpublished 227. Conzelmann, K.-K. K., Cox, J. H., Schneider, L. G. and Thiel, H.-J. (1990). Molecular cloning and complete nucleotide sequence of the attenuated rabies virus SAD B19. Virology 175, 485-499 228. Dybing, J. K. Sequence analysis of infectious bursal disease virus of serotype 2 and expression of the vp5 cDNA. Thesis (1991) Pathology & Microbiology, Atlantic Veterinary College, UPEI

229. Kibeng, F. S., Nagarajan, M. M. and Qian, B. (1996). Determination of the 5'and 3' terminal noncoding sequences of the bi-segmented genome of the avibirnavirus infectious bursal disease virus. Arch. Virol. 141 (6), 1133-1141 230. Hamel, A. L. and Nayar, G. P. S. Genetic characterization of four novel type-2 Porcine circoviruses. Unpublished 231. Hamel, A. L. and Nayar, G. P. S. Nucleotide sequence of a circovirus detected in cattle with various clinical syndromes. Unpublished 232. Bassami, M. R., Berryman, D., Wilcox, G. E. and Raidal, R. S. (1998). Psittacine Beak and Feather Disease Virus nucleotide sequence analysis and its relationship to porcine circovirus, Plant Circoviruses, and Chicken Anaemia Virus. Virology 249, 453-459 233. Kurita, J., Nakajima, K., Hirono, 1. and Aoki, T. (1998). Polymerase chain reaction (PCR) amplification of DNA of red sea bream iridovirus (RSIV). Fish Pathol. 33, 17-23 234. Kaur, K., Rohozinski, J. and Goorha, R. (1995). Identification and characterization of the frog virus 3 DNA methyltransferase gene. J. Gen. Virol. 76 (Pt 8), 1937-1943 235. Schmitt, M. P., Tondre, L., Kirn, K. And Aubertin, A. M. (1990). The nucleotide sequence of a delayed early gene (31K) of frog virus 3. Nucleic Acids Res. 18 (13), 4000

General References. (Other citations are given directly in the body of the specification above, or in the list of References following Table IL) Ahmed, R., Morrison, L. A., and Knipe, D. M. 1996. Persistence of viruses. In : Fields Virology pp. 219-249.

Allefs, S., Florack, D. Hoogendoorn, C., and W. J. Stiekeme. 1995. Erwinia soft rot resistance of potato cultivars transformed with a gene construct coding for antimicrobial peptide cecropin B is not altered. Am. Potato J. 72 : 437-445.

Balfanz, L., Rautenberg, P., and U. Ullmann. 1996. Molecular mechanisms of action of bacterial exotoxins. Zbl. Bakt. 284 : 170-206.

Berns, K. I., 1996. Parvoviridae : The viruses and their replication. In Fields Virology Boshoff, C., Weiss, R. A. 1998. Kaposi's sarcoma-associated herpesvirus. pp 58-56. In Advances in Cancer Research, V 75. Eds Vande Coude, G. R., and Klein, G. Academic Press. San Diego and London.

Brinkman, U., Gallo, M., Brinkman, E., Kunwar, S., and Pastani, I. 1993. A recombinant immunotoxin that is active on prostate cancer cells and is composed of the Fv region of monoclonal antibody PR1 and a truncated form of Pseudomonas exotoxin. Proc. Natl. Acad.

Sci USA 90 : 547-551.

Bull, J. J., Jacobson, A., Badgett, M. R., and I. J. Molineux. 1998. Viral escape from antisense RNA. Mol. Microbiol. 4 : 835-846.

Choi, K. 1996. Expression of a designed cecropin analog gene using a bacculovirus vector.

Ph. D Dissertation, Louisiana State University.

Coffin, J. M. 1996. Retroviridae : The viruses and their replication. In Fields Virology.

Fields, B. N., Knipe, D. M., and Howley, P. M. (Eds). Fields Virology 3rd edition, volumes 1 and 2. 1996. Lippincott-Raven, Philadelphia, New York.

Florack, D., Allefs, S., Bollen, R., Bosch, D., Visser, B., and W. Stiekema. 1995.

Expression of giant silkmoth cecropin B encoding genes in transgenic tobacco. Transgenic Research 4 : 132-141.

Francki, R. I. B., Fauquet, C. M., Knudson, D. L., and F. Brown (Eds.). Classification and Nomenclature of Viruses. Fifth Report of the International Committee on Taxonomy of Viruses. Archives of Virology Supplement 2. Springer-Verlag, Wien, New York. 1991.

Glorioso, J. C., Bender, M. A., Goins, W. F., Fink, D. J., and N. DeLuca. 1995. HSV as a gene transfer vector for the nervous system. Molecular Biotechnology. 4 : 87-99.

Gubler, D. 1998. Resurgent Vector-Borne Diseases as a Global Health Problem. Emerging Infectious Diseases. 4 : 442-449.

Gudmundsson, G. H., Lidholm, D. A., Asling, B., Gan, R., and H. G. Boman. 1991. The cecropin locus : cloning and expression of a gene cluster encoding three antibacterial peptides in Hyalophora cecropia. J. Biol. Chem. 266 : 11510-11517.

Guo, S., and Kemphues, K. J. 1995. Par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative ser-thr kinase that is asymmetrically distributed. Cell 81 : 611-620.

Hellers, M., Gunne, H., and H. Steiner. 1991. Expression of post-translational processing of preprocecropin A using a bacculovirus vector. Eur. J. Biochem. 199 : 435-439.

Hertz, J. M., and Huang, H. V. 1992. Utilization of heterologous alphavirus junction sequence as promoters by Sindbis virus. J. Virol. 66 : 857-864.

Hightower, R., Baden, C., Penzes, E., and P. Dunsmuir. 1994. The expression of cecropin peptide in transgenic tobacco does not confer resistance to Pseudomonas syringe pv tabaci.

Plant Cell Rep. 13 : 295-299.

Jaynes, J. M., Nagpala, P., Destefano-Beltran, L., Huang, J. H., Kim, J., Denny, T., and S.

Cetiner. 1993. Expression of a cecropin B lytic peptide analog in transgenic tobacco confers

enhanced resistance to bacterial wilt caused by Pseudomonas solanacearum. Plant Sci. 89 : 43-53.

Kuwano, K., Kawasaki, M., Kunitake, R., Hagimoto, N., Monoto, Y., Matsuba, T., Nakanishi, Y., Hara, N. 1997. Detection of group C adenovirus DNA in small-cell lung cancer with the nested polymerase chain reaction. J. Cancer Res Clin Oncol 123 : 377-382.

Loh, P. C., Tapay, L. M., Lu, Y., and Nadala, Jr., E. C. B. 1997. Viral pathogens of penaeid shrimp. In : Advances in Virus Research 49 :. Eds. K. Maramorosch, F. Murphy, and A. J.

Shatkin. Academic Press. San Diego, New York.

Middlebrook, J. L. and R. B. Dorland. 1984. Bacterial toxins : cellular mechanisms of action.

Microbiological Reviews. 48 : 199-221.

Montgomery, M. K. and Fire, A. 1998. Double-stranded RNA as a mediator in sequence specific genetic silencing and co-suppression. Trends Genetics 14 : 255-258.

Murphy, F. A. 1996. Virus taxonomy, pp 15-57. In Fields Virology, 3rd Edition. Bernard Fields et al., Eds. Lippincott-Raven, Philadelphia and New York.

Nevins, J. R. and Vogt, P. K. 1996. Cell Transformation. pp 301-343. In Fields Virology.

Olson, K. E., Higgs, S., Gaines, P. J., Powers, A. M., Davis, B. S., Kamrud, K. I., Carlson, J. O., Blair, C. D., Beaty, B. J. 1996. Genetically engineered resistance to Dengue-2 virus transmission of mosquitoes. Science 272 : 884-886.

Pastan, I., and FitzGerald, D. 1991. Recombinant toxins for cancer treatment. Science 254 : 1173-1177.

Palefsky, J. M., Penaranda, M-E., Pierik, L. T., Lagenaur, L. A., MacPhail, L. A., and Greenspan, D. 1997. Epstein-Barr virus BMRF-2 and BDLF-3 expression in hairy leukoplakia. Oral Diseases 3 : 5171 : 5176.

Piers, K. L., Brown, M. H., and R. E. W. Hancock. 1993. Recombinant DNA procedures for producing small antimicrobial cationic peptides in bacteria. Gene 134 : 7-13.

Porter, S. R., Di Alberti, L., Kumar, N. 1998. Human herpes virus 8 (Karposi's sarcoma herpesvirus). Oral Oncology 34 : 5-14.

Powers, A. M., Damrud, K. I., Olson, K. E., Higgs, S., Carlson, J. O., and Beaty, B. J. 1996.

Molecular engineered resistance to California serogroup virus replication in mosquito cells and mosquitoes. Proc. Natl. Acad. Sci. USA 93 : 4187-4191.

Roizman, G., 1996. Herpesviridae. In Fields Virology pp. 2221-2230.

Roizman, B., and Sears, A. E., 1996. Herpes simplex viruses and their replication. In Fields Virology pp 2231-2296.

Schiffer, M., and A. B. Edmundson. 1967. Use of the helical wheel to represent the structures of proteins and to identify segments with helical potential. Biophys. J. 7 : 121-135.

Tabara, H., Grishok, A., and Mello, C. C., 1998. RNA in C. elegans : soaking in the genome sequence. Science 282 : 430-431.

Villa, L. L. 1997. Human papillomavirus and cervical cancer. pp 321-341. In Advances in Cancer Research V 71. Eds, Vande Coude, G. R., and Klein, G. Academic Press. San Diego, London.

Watson, J. D., Hopkins, N. H., Roberts, J. W., Steitz, J. A., and A. M. Weiner. 1987."The Molecular Biology of the Gene, 4th ed. Chapter 26, The Genetic Basis of Cancer, pp 1006- 1057 and Chapter 27, The Origins of Human Cancer, especially pp. 1086-1092.

Benjamin/Cummings Publishing Co. Inc. Menlo Park, CA.

Wels, W., Moritz,. d, Schmidt, M., Jeschke, M., Hynes, N. E., and B. Groner. 1995.

Biotechnological and gene therapeutic strategies in cancer treatment. Gene 159 : 73-80.

PATENTS US Pat. No. 5759829 June 2, 1998. Antisense regulation of gene expression in plant cells.

Shewmaker, Christine K. et al.

US Pat. No. 5811537 Sept. 22, 1998. Antisense oligonucleotides targeted against human immunodeficiency virus. Friesen, Albert D.

US Pat. No. 5831069 Nov. 3, 1998. Antisense oligonucleotides against nonstructural proteins NS1 and NS2 of respiratory syncytial virus and uses thereof. Barik, Sailen US Pat. No. 5734039 March 31, 1998. Antisense oligonucleotides targeting cooperating oncogenes. Calabretta, Bruno, and Sokorski, Tomasz.

US Pat. No. 5242906 Sept. 7, 1993. Antisense oligonucleotides against Epstein-Barr virus.

Pagano, Joseph S. et al.

US Pat. No. 5691317 Nov. 25, 1997. Antisense oligonucleotides of human regulatory subunit RI-alpha of cAMP dependent protein kinases for the treatment of cancer. Cho-Chung, Yoon S.

US Pat. No. 5316930 May 31, 1994. Virus resistant plants having antisense RNA. Loesch- Fries, L. Sue, et al.

INFORMAL SEQUENCE LISTINGS Note : All sequences are listed in the conventional 5'to 3'direction, including the sequences containing negatively-coded RNA or DNA.

SEQ. ID NO. 1 is the designed lytic peptide Phor21 : KFAKFAKKFAKFAKKFAKFAK SEQ. ID NO. 2 is a DNA sequence targeting herpes viruses. The asterisks (***) in the sequence do not denote bases, and do not denote breaks in the continuous nucleic acid sequence. Instead, the asterisks are used to label different portions of the sequence. The first "subsequence" (i. e., the portion before the first set of ***) is a functional subunit of the immediate early promoter for Herpes Simplex I protein ICP4. The second"subsequence" (i. e., the portion between the first and second set of ***) is a sequence encoding phor21 (a highly lytic, designed peptide). The third"subsequence"is the stop codon TAG, and the fourth "subsequence"is a polyadenylation signal taken from the native Hyalophora cecropia gene for cecropin B. ccgggccccgccccctgcccgttcctcgttagcatgcggaacggaagcggaaaccgccgg atcgggcggtaatgagatgccatgcgggg cggggcgcggacccacccgccctcgcgccccgcccatggcagatggcgcggatgggcggg gccgggggttcgaccaacgggccgcg <BR> gccacgggcccccggcgtgccggcgtcggggcggggtcgtgcataatggaattccgttcg gggtgggcccgccgggggggcgggggg ccggcggcctccgctgctcctccttcccgccggcccctgggactatatgagcccgaggac gccccgatcgtccacacggagcgcggctgc cgaca***atgaaatttgctaaatttgctaaaaaatttgctaaatttgctaaaaaatttg ctaaatttgctaaa***tag***gcgaagccaaagc gctaggataaaataattttaatttaaaatattatttattgataaacgtttttgttactat tatattatttaatttagataataaatttaatttataaattttcattg ttaataatttaatttgtcctttaataataggtttaataacaggacatcctttataccttg cgtgcgtttgaaaataaactttatttaatgtaagcactgaga <BR> atgctattatgaataggaggatccgaagaaatctcacggtggtagggcatttactaatga tgcccgagctgggtagctaccaccctcaagtttg aaaagctgtcgccaaataccaatacaaatacctaggcttagtgtgttaccatccgaccac acgccactacatcaggaga SEQ. ID NO. 3 is a (-) RNA sequence targeting the OSU9 rotavirus. The asterisks (***) in the sequence do not denote bases, and do not denote breaks in the continuous nucleic acid sequence. Instead, the asterisks are used to label different portions of the sequence. The first

"subsequence" (i. e., the portion before the first set of ***) is the complement of a polyadenylation signal taken from the native Hyalophora cecropia gene for cecropin B. The second"subsequence" (i. e., the portion between the first and second set of ***) is the complement of a sequence encoding phor21 (a highly lytic, designed peptide). The third "subsequence"is 26 bp of rotavirus RdRp promoter from rotavirus OSU9, namely, bp 1036- 1062.

Note : As written, SEQ. ID NO. 3 is an RNA sequence. If SEQ. ID NO. 3 were encoded in DNA for transcription as RNA, e. g., as part of a chromosome or a plasmid, the U's in the sequence would be replaced by T's, and the sequence would be flanked by an appropriate promoter (preferably a constitutive promoter) on the 5'end, and by a stop codon on the 3'end. ucuccugauguaguggcguguggucggaugguaacacacuaagccuagguauuuguauug guauuuggcgacagcuuuucaa acuugagggugguagcuacccagcucgggcuucauuaguaaaugcccuaccaccgugaga uuucuucggauccuccuauucau <BR> <BR> <BR> <BR> aauagcauucucagugcuuacauuaaauaaaguuuauuuucaaacgcacgcaagguauaa aggauguccuguuauuaaaccuau uauuaaaggacaaauuaaauuauuaacaaugaaaauuuauaaauuaaauuuauuaucuaa auuaaauaauauaauaguaacaaaa <BR> <BR> <BR> acguuuaucaauaaauaauauuuuaaauuaaaauuauuuuauccuagcgcuuuggcuucg ccua***uuuagcaaauuuagca<BR> <BR> <BR> <BR> aauuuuuuagcaaauuuagcaaauuuuuuagcaaauuuagcaaauuucau***uuaaguu agaacuguaugaugugacc SEQ. ID NO. 4 is a (-) DNA sequence targeting canine parvovirus. The asterisks (***) in the sequence do not denote bases, and do not denote breaks in the continuous nucleic acid sequence. Instead, the asterisks are used to label different portions of the sequence. The first "subsequence" (i. e., the portion before the first set of ***) is the complement of a polyadenylation signal taken from the native Hyalophora cecropia gene for cecropin B. The second"subsequence" (i. e., the portion between the first and second set of ***) is the complement of a sequence encoding phor21 (a highly lytic, designed peptide). The third "subsequence"is a subunit of the NS1 promoter from accession number M38245, bp 120-274.

The fourth"subsequence"provides the 3'-OH primer sequence, and is taken from canine parvovirus accession number D26079, bp 4925-5075. tctcctgatgtagtggcgtgtggtcggatggtaacacactaagcctaggtatttgtattg gtatttggcgacagcttttcaaacttgagggtggta <BR> <BR> <BR> gctacccagctcgggcttcattagtaaatgccctaccaccgtgagatttcttcggatcct cctattcataatagcattctcagtgcttacattaaata aagtttattttcaaacgcacgcaaggtataaaggatgtcctgttattaaacctattatta aaggacaaattaaattattaacaatgaaaatttataaatt

aaatttattatctaaattaaataatataatagtaacaaaaacgtttatcaataaataata ttttaaattaaaattattttatcctagcgctttggcttcgcct<BR> <BR> <BR> <BR> <BR> <BR> a***tttagcaaatttagcaaattttttagcaaatttagcaaattttttagcaaatttag caaatttcat***taccaatcagtttcattctctccaagtg agacagtttctgttcttcgcttacagtcattgccagataccaaacagaaaatatggaaat tggtgcgggtgttaatcgggcggtggaaaagggc <BR> <BR> <BR> <BR> gggttcaaatttgtgtgtttggcggatagtaag***caacatcagtagactgactggcct ggttggttgcgcttaatcaaccagaccgctacgc<BR> <BR> <BR> <BR> <BR> <BR> <BR> ggtctggttgattaagcagagcaaccaaccaggccagtcagtctactgatgttgtgcatc tcccacccaccccccccttaaagacagattga SEQ. ID NO. 5 is a DNA sequence targeting herpes viruses. It is identical to SEQ. ID NO. 2, except that the final ttcgaa at the end of the first"subsequence" (i. e., the portion before the first set of ***) is a HindIII site, and the initial ggtacc at the beginning of the fourth "subsequence" (i. e., the portion following the third set of ***) is a KpnI site ccgggccccgccccctgcccgttcctcgttagcatgcggaacggaagcggaaaccgccgg atcgggcggtaatgagatgccatgcgggg <BR> <BR> <BR> <BR> <BR> cggggcgcggacccacccgccctcgcgccccgcccatggcagatggcgcggatgggcggg gccgggggttcgaccaacgggccgcg<BR> <BR> <BR> <BR> <BR> <BR> <BR> gccacgggcccccggcgtgccggcgtcggggcggggtcgtgcataatggaattccgttcg gggtgggcccgccgggggggcgggggg ccggcggcctccgctgctcctccttcccgccggcccctgggactatatgagcccgaggac gccccgatcgtccacacggagcgcggctgc <BR> <BR> <BR> <BR> cgacaaagctt***atgaaatttgctaaatttgctaaaaaatttgctaaatttgctaaaa aatttgctaaatttgctaaa***tag***ggtaccgc gaagccaaagcgctaggataaaataattttaatttaaaatattatttattgataaacgtt tttgttactattatattatttaatttagataataaatttaattt ataaattttcattgttaataatttaatttgtcctttaataataggtttaataacaggaca tcctttataccttgcgtgcgtttgaaaataaactttatttaatg taagcactgagaatgctattatgaataggaggatccgaagaaatctcacggtggtagggc atttactaatgatgcccgagctgggtagctacca ccctcaagtttgaaaagctgtcgccaaataccaatacaaatacctaggcttagtgtgtta ccatccgaccacacgccactacatcaggaga SEQ. ID NO. 6 is a DNA sequence designed to be incorporated into a cell's genome, where it will cause the constitutive production of mRNA's targeting influenza viruses via Method II.

The asterisks (***) in the sequence do not denote bases, and do not denote breaks in the continuous nucleic acid sequence. Instead, the asterisks are used to label different portions of the sequence. The first"subsequence" (i. e., the portion before the first set of ***) is simply a pair of bases that allow the restriction enzyme BamHI to function more effectively. The second "subsequence"is a 6-base BamHI site. The third"subsequence"is a ribozyme binding site (recognition sequence) to which the RNA-dependent RNA polymerase will bind. (The ribozyme binding site also contains an in-frame stop codon for the DNA-dependent RNA polymerase.) The fourth"subsequence"is a 6-base EcoRI site. The fifth"subsequence"

encodes the lytic peptide Phor21. The sixth"subsequence"is a stop codon for the RNA- dependent RNA polymerase. The seventh"subsequence"is a 6-base BglII site. The eighth "subsequence"is a human polymerase I promoter, i. e., a DNA-dependent RNA polymerase.

The ninth"subsequence"is a 6-base BamHI site. The tenth"subsequence"is a pair of bases that allow the restriction enzyme BamHI to function more effectively. (As written here, the fifth"subsequence"appears to be in the positive sense, but its relation to the human polymerase I promoter ensures that it will be transcribed as negative mRNA.) cg***ggatcc***atatagttcctcctttcagcaaaaaacccctcaagacccgtttaga ggccccaaggggttatgctagttattgctcagcg gtggcagcagccaactcagcttcctttcgggctttgttagcagtcgacgtcccattcgcc attaccgaggggacggtcccctcggaatgttgcc cagccggcgccagcgaggaggctgggaccatgccggccagcaaaagcagggtgacaaaga cata***gaattc***atgaaatttgcta<BR> aatttgctaaaaaatttgctaaatttgctaaaaaatttgctaaatttgctaaa***taa* **agatct***gaaaaaacacccttgtttctactaata acccggcggcccaaaatgccgactcggagcgaaagatatacctccccggggccgggaggt cgcgtcaccgaccacgccgccggcccag gcgacgcgcgacacggacacctgtccccaaaaacgccaccatcgcagccacacacggagc gcccggggccctctggtcaacccaagga cacacgcggggacagcgccgggccggggagccctcccggccgcccgtgccacacgcaggg gccggcccgt***ggatcc***cg